Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-gag, pol, nef and modifications

Abstract

First generation adenoviral vectors and associated recombinant adenovirus-based HIV vaccines which show enhanced stability and growth properties and greater cellular-mediated immunity are described within this specification. These adenoviral vectors are utilized to generate and produce through cell culture various adenoviral-based HIV-1 vaccines which contain HIV-1 gag, HIV-1 pol and/or HIV-1 nef polynucleotide pharmaceutical products, and biologically relevant modifications thereof. These adenovirus vaccines, when directly introduced into living vertebrate tissue, preferably a mammalian host such as a human or a non-human mammal of commercial or domestic veterinary importance, express the HIV1-Gag, Pol and/or Nef protein or biologically modification thereof, inducing a cellular immune response which specifically recognizes HIV-1. The exemplified polynucleotides of the present invention are synthetic DNA molecules encoding HIV-1 Gag, encoding codon optimized HIV-1 Pol, derivatives of optimized HIV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated), HIV-1 Nef and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The adenoviral vaccines of the present invention, when administered alone or in a combined modality regime, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.

Description

STATEMENT REGARDING FEDERALLY-SPONSORED R&D

Not Applicable

REFERENCE TO MICROFICHE APPENDIX

Not Applicable

FIELD OF THE INVENTION

The present invention relates to recombinant, replication-deficient first generation adenovirus vaccines found to exhibit enhanced growth properties and greater cellular-mediated immunity as compared to other replication-deficient vectors. The invention also relates to the associated first generation adenoviral vectors described herein, which, through the incorporation of additional 5′ adenovirus sequence, enhance large scale production efficiency of the recombinant, replication-defective adenovirus described herein. Another aspect of the instant invention is the surprising discovery that the intron A portion of the human cytomegalovirus (hCMV) promoter constitutes a region of instability in adenoviral vector constructs. Removal of this region from adenoviral expression constructs results in greatly improved vector stability. Therefore, improved vectors expressing a transgene under the control of an intron A-deleted CMV promoter constitute a further aspect of this invention. These adenoviral vectors are useful for generating recombinant adenovirus vaccines against human immunodeficiency virus (HIV). In particular, the first generation adenovirus vectors disclosed herein are utilized to construct and generate adenovirus-based HIV-1 vaccines which contain HIV-1 Gag, HIV-1 Pol and/or HIV-1 Nef polynucleotide pharmaceutical products, and biologically active modifications thereof. Host administration of the recombinant, replication-deficient adenovirus vaccines described herein results in expression of HIV-1 Gag, HIV-1-Pol and/or Nef protein or immunologically relevant modifications thereof, inducing a cellular immune response which specifically recognizes HIV-1. The exemplified polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HIV-1 Gag, HIV-1 Pol, derivatives of optimized HIV-1 Pol (including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated), HIV-1 Nef, and derivatives of optimized HIV-1 Nef, including nef mutants which effect wild type characteristics of Nef, such as myristylation and down regulation of host CD4. The HIV adenovirus vaccines of the present invention, when administered alone or in a combined modality and/or prime/boost regimen, will offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.

BACKGROUND OF THE INVENTION

Human Immunodeficiency Virus-1 (HIV-1) is the etiological agent of acquired human immune deficiency syndrome (AIDS) and related disorders. HIV-1 is an RNA virus of the Retroviridae family and exhibits the 5′ LTR-gag-pol-env-LTR 3′ organization of all retroviruses. The integrated form of HIV-1, known as the provirus, is approximately 9.8 Kb in length. Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs). The HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Nef).

The gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene. The mature p55 protein products are p17 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.

The pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting. The viral encoded protease proteolytically cleaves the Pol polypeptide away from the Gag-Pol fusion and further cleaves the Pol polypeptide to the mature proteins which provide protease (Pro, P10), reverse transcriptase (RT, P50), integrase (IN, p31) and RNAse H (RNAse, p15) activities.

The nef gene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.

The env gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gp160) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gp120) and the transmembrane 41-kDa envelope glycoprotein (gp41). Gp120 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.

The tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HIV-1 replication.

The rev gene encodes the 13 kDa Rev protein, a RNA binding protein. The Rev protein binds to a region of the viral RNA termed the Rev response element (RRE). The Rev protein promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm. The Rev protein is required for HIV late gene expression and in turn, HIV replication.

Gp120 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules. X4 (macrophage tropic) virus show tropism for CD4/CXCR4 complexes while a R5 (T-cell line tropic) virus interacts with a CD4/CCR5 receptor complex. After gp120 binds to CD4, gp41 mediates the fusion event responsible for virus entry. The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase. The viral DNA, known as provirus, enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles. Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS. Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3-week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease.

Destruction of CD4 helper T lymphocytes, which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection. The loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.

Effective treatment regimens for HIV-1 infected individuals have become available recently. However, these drugs will not have a significant impact on the disease in many parts of the world and they will have a minimal impact in halting the spread of infection within the human population. As is true of many other infectious diseases, a significant epidemiologic impact on the spread of HIV-1 infection will only occur subsequent to the development and introduction of an effective vaccine. There are a number of factors that have contributed to the lack of successful vaccine development to date. As noted above, it is now apparent that in a chronically infected person there exists constant virus production in spite of the presence of anti-HIV-1 humoral and cellular immune responses and destruction of virally infected cells. As in the case of other infectious diseases, the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response. Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection. A second factor is the considerable genetic variability of the virus. Although anti-HIV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HIV-1 using traditional methods. Rather, the virus seems to define a serological “continuum” so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants. Given this latter observation, it would be useful to identify immunogens and related delivery technologies that are likely to elicit anti-HIV-1 cellular immune responses. It is known that in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins. CD8 + T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein. Activation of naive CD8 + T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins. Optimal induction of CTL responses usually requires “help” in the form of cytokines from CD4 + T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.

European Patent Applications 0 638 316 (Published Feb. 15, 1995) and 0 586 076 (Published Mar. 9, 1994), (both assigned to American Home Products Corporation) describe replicating adenovirus vectors carrying an HIV gene, including env or gag. Various treatment regimens were used with chimpanzees and dogs, some of which included booster adenovirus or protein plus alum treatments.

Replication-defective adenoviral vectors harboring deletions in the E1 region are known, and recent adenoviral vectors have incorporated the known packaging repeats into these vectors; e.g., see EP 0 707 071, disclosing, inter alia, an adenoviral vector deleted of E1 sequences from base pairs 459 to 3328; and U.S. Pat. No. 6,033,908, disclosing, inter alia, an adenoviral vector deleted of base pairs 459-3510. The packaging efficiency of adenovirus has been taught to depend on the number of incorporated individual A (packaging) repeats; see, e.g., Gräble and Hearing, 1990 J. Virol. 64(5):2047-2056; Gräble and Hearing, 1992 J. Virol. 66(2):723-731.

Larder, et al., (1987 , Nature 327: 716-717) and Larder, et al., (1989 , Proc. Natl. Acad. Sci. 86: 4803-4807) disclose site specific mutagenesis of HIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.

Davies, et al. (1991 , Science 252:, 88-95) disclose the crystal structure of the RNase H domain of HIV-1 Pol.

Schatz, et al. (1989 , FEBS Lett. 257: 311-314) disclose that mutations Glu478Gln and His539Phe in a complete HIV-1 RT/RNase H DNA fragment results in defective RNase activity without effecting RT activity.

Mizrahi, et al. (1990 , Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein.

Leavitt, et al. (1993 , J. Biol. Chem. 268: 2113-2119) disclose several mutations, including a Asp64Val mutation, which show differing effect on HIV-1 integrase (IN) activity.

Wiskerchen, et al. (1995 , J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HIV-1 IN and viral replication functions.

It would be of great import in the battle against AIDS to produce a prophylactic- and/or therapeutic-based HIV vaccine which generates a strong cellular immune response against an HIV infection. The present invention addresses and meets these needs by disclosing a class of adenovirus vaccines which, upon host administration, express codon optimized and modified versions of the HIV-1 genes, gag, pol and nef. These recombinant, replication-defective adenovirus vaccines may be administered to a host, such as a human, alone or as part of a combined modality regimen and/or prime-boost vaccination regimen with components of the present invention and/or a distinct viral HIV DNA vaccine, non-viral HIV DNA vaccine, HIV subunit vaccine, an HIV whole killed vaccine and/or a live attenuated HIV vaccine.

SUMMARY OF THE INVENTION

The present invention relates to enhanced replication-defective recombinant adenovirus vaccine vectors and associated recombinant, replication-deficient adenovirus vaccines which encode various forms of HIV-1 Gag, HIV-1 Pol, and/or HIV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HIV-1 Pol and HIV-1 Nef. The adenovirus vaccines of the present invention express HIV antigens and provide for improved cellular-mediated immune responses upon host administration. Potential vaccinees include but are not limited to primates and especially humans and non-human primates, and also include any non-human mammal of commercial or domestic veterinary importance. An effect of the improved recombinant adenovirus-based vaccines of the present invention should be a lower transmission rate to previously uninfected individuals (i.e., prophylactic applications) and/or reduction in the levels of the viral loads within an infected individual (i.e., therapeutic applications), so as to prolong the asymptomatic phase of HIV-1 infection. In particular, the present invention relates to adenoviral-based vaccines which encode various forms of codon optimized HIV-1 Gag (including but in no way limited to p55 versions of codon optimized full length (FL) Gag and tPA-Gag fusion proteins), HIV-1 Pol, HIV-1 Nef, and selected modifications of immunological relevance. The administration, intracellular delivery and expression of these adenovirus vaccines elicit a host CTL and Th response. The preferred replication-defective recombinant adenoviral vaccine vectors include but are not limited to synthetic DNA molecules which (1) encode codon optimized versions of wild type HIV-1 Gag; (2) encode codon optimized versions of HIV-1 Pol; (3) encode codon optimized versions of HIV-1 Pol fusion proteins; (4) encode codon optimized versions of modified HIV-1 Pol proteins and fusion proteins, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and IN activity within the host cell; (5) encode codon optimized versions of wild type HIV-1 Nef; (6) codon optimized versions of HIV-1 Nef fusion proteins; and/or (7) codon optimized versions of HIV-1 Nef derivatives, including but not limited to nef modifications involving introduction of an amino-terminal leader sequence, removal of an amino-terminal myristylation site and/or introduction of dileucine motif mutations. The Nef-based fusion and modified proteins, disclosed within this specification and expressed from an adenoviral-based vector vaccine this specification, may possess altered trafficking and/or host cell function while retaining the ability to be properly presented to the host MHC I complex and in turn elicit a host CTL and Th response. Examples of HIV-1 Gag, Pol and/or Nef fusion proteins include but are not limited to fusion of a leader or signal peptide at the NH 2 -teriminal portion of the viral antigen coding region. Such a leader peptide includes but is not limited to a tPA leader peptide.

The adenoviral vector utilized in construction of the HIV-1 Gag-, HIV-1 Pol- and/or HIV-1 Nef-based vaccines of the present invention may comprise any replication-defective adenoviral vector which provides for enhanced genetic stability of the recombinant adenoviral genome through large scale production and purification of the recombinant virus. In other words, an HIV-1 Gag-, Pol- or Nef-based adenovirus vaccine of the present invention is a purified recombinant, replication-defective adenovirus which is shown to be genetically stable through multiple passages in cell culture and remains so during large scale production and purification procedures. Such a recombinant adenovirus vector and harvested adenovirus vaccine lends itself to large scale dose filling and subsequent worldwide distribution procedures which will be demanded of an efficacious monovalent or multivalent HIV vaccine. The present invention meets this basic requirement with description of a replication-defective adenoviral vector and vectors derived therefrom, at least partially deleted in E1, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome. A preferred embodiment of the instant invention comprises base pairs 1-450 of a wildtype adenovirus. In other preferred embodiments, the replication-defective adenoviral vector has, in addition thereto, a region 3′ to the E1-deleted region comprising base pairs 3511-3523. Basepairs 342-450 (more particularly, 400-450) constitute an extension of the 5′ region of previously disclosed vectors carrying viral antigens, particularly HIV antigens (see, e.g., PCT International Application PCT/US00/18332, published Jan. 11, 2001 (WO 01/02067), which claims priority to U.S. Provisional Application Serial Nos. 60/142,631 and 60/148,981, filed Jul. 6, 1999 and Aug. 13, 1999, respectively; these documents herein incorporated by reference. Applicants have found that extending the 5′ region further into the E1 gene into the disclosed vaccine vectors incorporated elements found to be important in optimizing the packaging of the virus.

As compared to previous vectors not comprising basepairs from about 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 of the wildtype adenovirus genome, vectors comprising the above region exhibited enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, a more potent virus effect, allowing lower doses of virus to be used to generate equivalent immunity; and a greater cellular-mediated immune response than replication-deficient vectors not comprising this region (basepairs 1-450). Even more important, adenoviral constructs derived therefrom are very stable genetically in large-scale production, particularly those comprising an expression cassette under the control of a hCMV promoter devoid of intron A. This is because Applicants have surprisingly found that the intron A portion of the hCMV promoter constituted a region of instability when employed in adenoviral vectors. Applicants have, therefore, identified an enhanced adenoviral vector which is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.

A preferred embodiment of this invention is a replication-defective adenoviral vector in accordance with the above description wherein the gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.

In preferred embodiments, the E1 gene, other than that contained within basepairs 1-450 or, alternatively, that contained within base pairs 1-450 and 3511-3523 has been deleted from the adenoviral vector, and the gene expression cassette has replaced the deleted E1 gene. In other preferred embodiments, the replication defective adenovirus genome does not have a functional E3 gene, or the E3 gene has been deleted. Most preferably, the E3 region is present within the adenoviral genome. Further preferred embodiments are wherein the gene expression cassette is in an E1 anti-parallel (transcribed in a 3′ to 5′ direction relative to the vector backbone) orientation or, more preferably, an E1 parallel (transcribed in a 5′ to 3′ direction relative to the vector backbone) orientation.

Further embodiments relate to a shuttle plasmid vector comprising: an adenoviral portion and a plasmid portion, wherein said adenovirus portion comprises: a) a replication defective adenovirus genome, at least partially deleted in E1, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) of the wildtype adenovirus genome and, preferably, in addition thereto, basepairs 3511-3523 of a wildtype adenovirus sequence; and b) a gene expression cassette comprising: (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a);and (c) a transcription terminator and/or a polyadenylation site.

Other aspects of this invention include a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and (b) harvesting the resultant adenoviral vectors.

To this end, the present invention particularly relates to harvested recombinant, replication defective virus derived from a host cell, such as but not limited to 293 cells or PER.C6® cells, including but not limited to harvested virus related to any of the MRKAd5 vector backbones, with or without an accompanying transgene, including but not limited to the HIV-1 antigens described herein. An HIV-1 vaccine is represented by any harvested, recombinant adenovirus material which expresses any one or more of the HIV-1 antigens disclosed herein. This harvested material may then be purified, formulated and stored prior to host administration.

Another aspect of this invention is a method of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising:

a) a recombinant, replication defective adenoviral vector, at least partially deleted in E1, comprising a wildtype adenovirus cis-acting adenovirus packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about base pair 458 (preferably, 1-450) and, preferably in addition thereto, base pairs 3511-3523 of a wildtype adenovirus sequence, and,

b) a gene expression cassette comprising:(i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site.

In view of the efficacious nature of the adenoviral and/or DNA plasmid vaccines described herein, the present invention relates to all methodology regarding administration of one or more of these adenoviral and/or DNA plasmid vaccines to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIV infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences. As discussed herein, such a treatment regimen may include a monovalent or multivalent composition, various combined modality applications, and/or a prime/boost regimen to as to optimize antigen expression and a concomitant cellular-mediated and/or humoral immune response upon inoculation into a living vertebrate tissue. Therefore, the present invention provides for methods of using the adenoviral and/or DNA plasmid vaccines disclosed herein within the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces intracellular expression of the gag, pol and/or nef-based vaccines.

To this end, the present invention relates in part to methods of generating a cellular immune response in a vaccinee, preferably a human vaccinee, wherein the individual is given more than one administration of adenovirus vaccine vector, and it may be given in a regimen accompanied by the administration of a plasmid vaccine. The plasmid vaccine (also referred to herein as a “DNA plasmid vaccine” or “vaccine plasmid” comprises a nucleic acid encoding a protein or an immunologically relevant portion thereof, a heterologous promoter operably linked to the nucleic acid sequence, and a transcription terminator or a polyadenylation signal (such as bGH or SPA, respectively). There may be a predetermined minimum amount of time separating the administrations. The individual can be given a first dose of plasmid vaccine, and then a second dose of plasmid vaccine. Alternatively, the individual may be given a first dose of adenovirus vaccine, and then a second dose of adenovirus vaccine. In other embodiments, the plasmid vaccine is administered first, followed after a time by administration of the adenovirus vaccine. Conversely, the adenovirus vaccine may be administered first, followed by administration of plasmid vaccine after a time. In these embodiments, an individual may be given multiple doses of the same adenovirus serotype in either viral vector or plasmid form, or the virus may be of differing serotypes. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and Venezuelan equine encephilitis virus.

The present invention also relates to multivalent adenovirus vaccine compositions which comprise Gag, Pol and Nef components described herein; see, e.g., Example 29 and Table 25. Such compositions will provide for an enhanced cellular immune response subsequent to host administration, particularly given the genetic diversity of human MHCs and of circulating virus. Examples, but not limitations, include MRKAd5-vector based multivalent vaccine compositions which provide for a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components) composition. Such a mutlivalent vaccine may be filled for a single dose or may consist of multiple inoculations of each individually filled component; and may in addition be part of a prime/boost regimen with viral or non-viral vector vaccines as introduced in the previous paragraph. To this end, preferred compositions are MRKAd5 adenovirus used in combination with multiple, distinct HIV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

The concept of a “combined modality” as disclosed herein also covers the alternative mode of administration whereby multiple HIV-1 viral antigens may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example, a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(−) or E3(+) background, preferably a E3 deleted backbone, or possibly a “2+1” divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES). Therefore, a multivalent vaccine delivered as a single, or possibly a second harvested recombinant, replication-deficient adenovirus is contemplated as part of the present invention.

Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen. A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly if pre-existing anti-vector immune responses are present. This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine. Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adenovirus immune response.

It is an object of the present invention to provide for enhanced replication-defective recombinant adenoviral vaccine vector backbones. These recombinant adenoviral backbones may accept one or more transgenes, which may be passaged through cell culture for growth, amplification and harvest.

It is a further object to provide for enhanced replication-defective recombinant adenoviral vaccine vectors which encode various transgenes.

It is also an object of the present invention to provide for a harvested recombinant, replication-deficient adenovirus which shows enhanced growth and amplification rates while in combination with increased virus stability after continuous passage in cell culture. Such a recombinant adenovirus is particularly suited for use in gene therapy and nucleotide-based vaccine vectors which, favorably, lends itself to large scale propagation.

To this end, it is an object of the present invention to provide for (1) enhanced replication-defective recombinant adenoviral vaccine vectors as described herein which encode various forms of HIV-1 Gag, HIV-1 Pol, and/or HIV-1 Nef, including immunologically relevant modifications of HIV-1 Gag, HIV-1 Pol and HIV-1 Nef, and (2) harvested, purified recombinant replication-deficient adenovirus generated by passage of the adenoviral vectors of (1) through one or multiple passages through cell culture, including but not limited to passage through 293 cells or PER.C6® cells.

It is also an object of the present invention to provide for recombinant adenovirus harvested by one or multiple passages through cell culture. As relating to recombinant adenoviral vaccine vector, this recombinant virus is harvested and formulated for subsequent host administration.

It is also an object of the present invention to provide for replication-defective adenoviral vectors wherein at least one gene is inserted in the form of a gene expression cassette comprising (a) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (b) a heterologous promoter operatively linked to the nucleic acid of part a); and, (c) a transcription terminator.

It is also an object of the present invention to provide for a host cell comprising said adenoviral vectors and/or said shuttle plasmid vectors; vaccine compositions comprising said vectors; and methods of producing the vectors comprising (a) introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and (b) harvesting the resultant adenoviral vectors. It is a further object of the present invention to provide for methods of generating a cellular immune response against a protein in an individual comprising administering to the individual an adenovirus vaccine vector comprising a) a replication defective adenoviral vector, at least partially deleted in E1, comprising a wildtype adenovirus cis-acting packaging region from about base pair 1 to between from about base pair 342 (more preferably, 400) to about 450 (preferably, 1-450) and, preferably, 3511-3523 of a wildtype adenovirus sequence, and, b) a gene expression cassette comprising:(i) a nucleic acid encoding a protein or biologically active and/or immunologically relevant portion thereof; (ii) a heterologous promoter operatively linked to the nucleic acid of part a); and (iii) a transcription terminator and/or a polyadenylation site.

It is also an objet of the present invention to provide various alternatives for vaccine administration regimes, namely administration of one or more adenoviral and/or DNA plasmid vaccines described herein to provide effective immunoprophylaxis for uninfected individuals or a therapeutic treatment for HIV infected patients. Such processes include but are not limited to multivalent HIV-1 vaccine compositions, various combined modality regimes as well as various prime/boost alternatives. These methods of administration, relating to vaccine composition and/or scheduled administration, will increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

As used throughout the specification and claims, the following definitions and abbreviations are used:

“HAART” refers to—highly active antiretroviral therapy—.

“first generation” vectors are characterized as being replication-defective. They typically have a deleted or inactivated E1 gene region, and preferably have a deleted or inactivated E3 gene region as well.

“AEX” refers to Anion Exchange chromatography.

“QPA” refers to Quick PCR-based Potency Assay.

“bps” refers to basepairs.

“s” or “str” denotes that the transgene is in the E1 parallel or “straight” orientation.

“PBMCs” refers to peripheral blood monocyte cells.

“FL” refers to full length.

“FLgag” refers to a full-length optimized gag gene, as shown in FIG. 2 .

“Ad5-Flgag” refers to an adenovirus serotype 5 replication deficient virus which carries an expression cassette which comprises a full length optimized gag gene under the control of a CMV promoter.

“Promoter” means a recognition site on a DNA strand to which an RNA polymerase binds. The promoter forms an initiation complex with RNA polymerase to initiate and drive transcriptional activity. The complex can be modified by activating sequences such as enhancers or inhibiting sequences such as silencers.

“Leader” means a DNA sequence at the 5′ end of a structural gene which is transcribed along with the gene. This usually results a protein having an N-terminal peptide extension, often referred to as a pro-sequences.

“Intron” means a section of DNA occurring in the middle of a gene which does not code for an amino acid in the gene product. The precursor RNA of the intron is excised and is therefore not transcribed into mRNA not translated into protein.

“Immunologically relevant” or “biologically active” means (1) with regards to a viral protein, that the protein is capable, upon administration, of eliciting a measurable immune response within an individual sufficient to retard the propagation and/or spread of the virus and/or to reduce the viral load present within the individual; or (2) with regards to a nucleotide sequence, that the sequence is capable of encoding for a protein capable of the above.

“Cassette” refers to a nucleic acid sequence which is to be expressed, along with its transcription and translational control sequences. By changing the cassette, a vector can express a different sequence.

“bGHpA” refers to the bovine growth hormone transcription terminator/polyadenylation sequence.

“tPAgag” refers to a fusion between the leader sequence of the tissue plasminogen activator leader sequence and an optimized HIV gag gene, as exemplified in FIGS. 30A-B , whether in a DNA or adenovirus-based vaccine vector.

Where utilized, “IA” or “inact” refers to an inactivated version of a gene (e.g. IApol).

“MCS” is “multiple cloning site”.

In general, adenoviral constructs, gene constructs are named by reference to the genes contained therein. For example:

“Ad5 HIV-1 gag”, also referred to as the original HIV-1 gag adenoviral vector, is a vector containing a transgene cassette composed of a hCMV intron A promoter, the full length version of the human codon-optimized HIV-1 gag gene, and the bovine growth hormone polyadenylation signal. The transgene was inserted in the E1 antiparallel orientation in an E1 and E3 deleted adenovector.

“MRK Ad5 HIV-1 gag” also referred to as “MRKAd5gag” or “Ad5gag2” is an adenoviral vector taught herein which is deleted of E1, comprises basepairs 1-450 and 3511-3523, and has a human codon-optimized HIV-1 gene in an E1 parallel orientation under the control of a CMV promoter without intron A. The construct also comprises a bovine growth hormone polyadenylation signal.

“pV1JnsHIVgag”, also referred to as “HIVFLgagPR9901”, is a plasmid comprising the CMV immediate-early (IE) promoter and intron A, a full-length codon-optimized HIV gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone.

“pV1JnsCMV(no intron)-FLgag-bGHpA” is a plasmid derived from pV1JnsHIVgag which is deleted of the intron A portion of CMV and which comprises the full length HIV gag gene. This plasmid is also referred to as “pV1JnsHIVgag-bGHpA”, pV1Jns-hCMV-FL-gag-bGHpA” and “pV1JnsCMV(no intron)+FLgag+bGHpA”.

“pV1JnsCMV(no intron)-FLgag-SPA” is a plasmid of the same composition as pV1JnsCMV(no intron)-FLgag-bGHpA except that the SPA termination sequence replaces that of bGHpA. This plasmid is also referred to as “pV1Jns-HIVgag-SPA” and pV1Jns-hCMV-FLgag-SPA”.

“pdelE1sp1A” is a universal shuttle vector with no expression cassette (i.e., no promoter or polyA). The vector comprises wildtype adenovirus serotype 5 (Ad5) sequences from bp 1 to bp 341 and bp 3524 to bp 5798, and has a multiple cloning site between the Ad5 sequences ending 341 bp and beginning 3524 bp. This plasmid is also referred to as the original Ad 5 shuttle vector.

“MRKpdelE1 sp1A” or “MRKpdelE1 (Pac/pIX/pack450)” or

“MRKpdelE1(Pac/pIX/pack450)Cla1” is a universal shuttle vector with no expression cassette (i.e. no promoter or polyA) comprising wildtype adenovirus serotype 5 (Ad5) sequences from bp1 to bp450 and bp 3511 to bp 5798. The vector has a multiple cloning site between the Ad5 sequence ending 450 bp and beginning 3511 bp. This shuttle vector may be used to insert the CMV promoter and the bGHpA fragments in both the straight (“str”. or E1 parallel) orientation or in the opposite (opp. or E1 antiparallel) orientation)

“MRKpdelE1(Pac/pIX/pack450)+CMVmin+BGHpA(str.)” is still another shuttle vector which is the modified vector that contains the CMV promoter (no intronA) and the bGHpA fragments. The expression unit containing the hCMV promoter (no intron A) and the bovine growth hormone polyadenylation signal has been inserted into the shuttle vector such that insertion of the gene of choice at a unique BglII site will ensure the direction of transcription of the transgene will be Ad5 E1 parallel when inserted into the MRKpAd5(E1/E3+)Cla1 pre-plasmid. This shuttle vector, as shown in FIGS. 22 and 23 , was used to insert the respective IApol and G2A,LLAA nef genes directly into.

“MRKpdelE1-CMV(no intron)-FLgag-bGHpA” is a shuttle comprising Ad5 sequences from basepairs 1-450 and 3511-5798, with an expression cassette containing human CMV without intron A, the full-length human codon-optimized HIV gag gene and bovine growth hormone polyadenylation signal. This plasmid is also referred to as “MRKpdelE1 shuttle +hCMV-FL-gag-BGHpA”

“MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA” is an adenoviral vector comprising all Ad5 sequences except those nucleotides encompassing the E1 region (from 451-3510), a human CMV promoter without intron A, a full-length human codon-optimized HIV gag gene, and a bovine growth hormone polyadenylation signal. This vector is also referred to as “MRKpAdHVE3+hCMV-FL-gag-BGHpA”, “MRKpAd5HIV-1gag”, “MRKpAd5gag”, “pMRKAd5gag” or “pAd5gag2”.

“pV1Jns-HIV-pol inact(opt)” or “pV1Jns-HIV IA pol (opt) is the inactivated Pol gene (contained within SEQ ID NO:3) cloned into the BglII site of V1Jns (FIGS. 17 A-C). As noted herein, various derivatives of HIV-1 pol may be cloned into a plasmid expression vector such as V1Jns or V1Jns-tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.

“MRKpdel+hCMVmin+FL-pol+bGHpA(s)” is the “MRKpdelE1(Pac/pIX/pack450)+CMVmin+BGHpA(str.)” shuttle mentioned above which contains the IA pol gene is the proper orientation. This shuttle vector is used in a bacterial recombination with MRKpAd(E1−/E3+)Cla1.

“MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+”, also referred to herein as “pMRKAd5pol”, is the pre-adenovirus plasmid which comprises a CMV-pol inact(opt)-pGHpA construct. The construction of this pre-adenovirus plasmid is shown in FIG. 22 .

“pV1Jns/nef (G2A,LLAA)” or “V1Jns/opt nef (G2A,LLAA)” comprises codon optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175 (SEQ ID NO:13; which comprises an initiating methionine residue at nucleotides 12-14 and a “TAA” stop codon from nucleotides 660-662). This fragment is subcloned into the Bgl II site of V1Jns and/or V1Jns-tPA (FIGS. 16 A-B). As noted above for HIV-1 pol, HIV-1 nef constructs may be cloned into a plasmid expression vector such as V1Jns or V1Jns-tPA, thus serving directly as DNA vaccine candidates or as a source for subcloning into an appropriate adenoviral vector.

“MRKpdelE1hCMVminFL-nefBGHpA(s)”, also referred to herein as “pMRKAd5nef”, is the pre-adenovirus plasmid which comprises a CMV-nef (G2A,LLAA) codon optimized sequence. The construction of this pre-adenovirus plasmid is shown in FIG. 23 .

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the original HIV-1 gag adenovector (Ad5HIV-1gag). This vector is disclosed in PCT International Application No. PCT/US00/18332 (WO 01/02607) filed Jul. 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed Jul. 6, 1999 and U.S. application Ser. No. 60/148,981, filed Aug. 13, 1999, all three applications which are hereby incorporated by reference.

FIG. 2 shows the nucleic acid sequence (SEQ ID NO: 27) of the optimized human HIV-1 gag open reading frame.

FIG. 3 shows diagrammatically the new transgene constructs in comparison with the original gag transgene.

FIG. 4 shows the modifications made to the original adenovector backbone in the generation of the novel vectors of the instant invention.

FIG. 5 shows the virus mixing experiments that were carried out to determine the effects of the addition made to the packaging signal region (Expt. #1) and the E3 gene on viral growth (Expt. #2). The bars denote the region of modifications made to the E1 deletion.

FIGS. 6A-6B show an autoradiograph of viral DNA analysis following the viral mixing experiments described in Examples 6 and 7.

FIGS. 7A , 7 B and 7 C are as follows: FIG. 7A shows the hCMV-Flgag-bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Both E1 parallel and E1 antiparallel transgene orientation are represented. FIG. 7B shows the hCMV-Flgag-SPA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Again, both E1 parallel and E1 antiparallel transgene orientation are represented. FIG. 7C shows the mCMV-Flgag-bGHpA adenovectors constructed within the MRKpAdHVE3 and MRKpAdHVO adenovector backbones. Once again, both E1 parallel and E1 antiparallel transgene orientation are represented.

FIG. 8A shows the experiment designed to test the effect of transgene orientation.

FIG. 8B shows the experiments designed to test the effect of polyadenylation signal.

FIG. 9 shows viral DNA from the four adenoviral vectors tested (Example 12) at P5, following BstE11 digestion.

FIG. 10 shows viral DNA analysis of passages 11 and 12 of MRKpAdHVE3, MRKAd5HIV-1gag, and MRKAd5HIV-1gagE3−.

FIG. 11 shows viral DNA analysis (HindIII digestion) of passage 6 MRKpAdHVE3 and MRKAd5HIV-1gag used to initiate the viral competition study. The last two lanes are passage 11 analysis of duplicate passages of the competition study (each virus at MOI of 280 viral particles).

FIG. 12 shows viral DNA analysis by HindIII digestion on high passage numbers for MRKAd5HIV-1gag in serum-containing media with collections made at specified times. The first lane shows the 1 kb DNA size marker. The other lanes represent pre-plasmid control (digested with Pac1 and HindIII), MRKAd5HIV-1gag at P16, P19, and P21.

FIG. 13 shows serum anti-p24 levels at 3 wks post i.m. immunization of balb/c mice (n=10) with varying doses of several Adgag constructs: (A) MRK Ad5 HIV-1 gag (through passage 5); (B) MRKAd5 hCMV-FLgag-bGHpA (E3−); (C) MRKAd5 hCMV-FLgag-SPA (E3+); (D) MRKAd5 mCMV-FLgag-bGHpA (E3+); (E) research lot (293 cell-derived) of Ad5HIV-1 gag; and (F) clinical lot (Ad5gagFN0001) of Ad5HIV-1 gag. Reported are the geometric mean titers (GMT) for each cohort along with the standard error bars.

FIG. 14 shows a restriction map of the pMRKAd5HIV-1gag vector.

FIGS. 15A-1 to 15 A- 45 illustrate the nucleotide sequence of the pMRKAd5HIV-1gag vector (SEQ ID NO:25 and SEQ ID NO:26.

FIGS. 16A-B shows a schematic representation of DNA vaccine expression vectors V1Jns (A) and V1Jns-tPA (B), which are utilized for HIV-1 gag, pol and nef constructs in various DNA/viral vector combined modality regimens as disclosed herein.

FIGS. 17A-1 to 17 A- 3 show the nucleotide (SEQ ID NO:3) and amino acid sequence (SEQ ID NO:4) of IA-Pol. Underlined codons and amino acids denote mutations, as listed in Table 1.

FIG. 18 shows codon optimized nucleotide and amino acid sequences through the fusion junction of tPA-pol inact(opt) (contained within SEQ ID NOs: 7 and 8, respectively). The underlined portion represents the NH 2 -terminal region of IA-Pol.

FIGS. 19A-1 to 19 A- 2 show a nucleotide sequence comparison between wild type nef(jrfl) and codon optimized nef. The wild type nef gene from the jrfl isolate consists of 648 nucleotides capable of encoding a 216 amino acid polypeptide. WT, wild type sequence (SEQ ID NO: 19); opt, codon-optimized sequence (contained within SEQ ID NO:9). The Nef amino acid sequence is shown in one-letter code (SEQ ID NO: 10).

FIGS. 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors V1Jns/nef (FIG. 20 A), V1Jns/nef(G2A,LLAA) (FIG. 20 B), V1Jns/tpanef ( FIG. 20C ) and V1Jns/tpanef(LLAA) ( FIG. 20C , also). 5′ and 3′ flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. V1Jns/tpanef and V1Jns/tpanef(LLAA) have identical sequences at the junctions.

FIG. 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucine174 and 175 are the sites involved in myristylation and dileucine motif, respectively. For both versions of the tpanef fusion genes, the putative leader peptide cleavage sites are indicated with “*”, and a exogenous serine residue introduced during the construction of the mutants is underlined.

FIG. 22 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Pol.

FIG. 23 shows diagrammatically the construction of the pre-adenovirus plasmid construct, MRKAd5Nef.

FIG. 24 shows a comparison of clade B vs. lade C anti-gag T cell responses in lade B HIV-infected subjects.

FIG. 25 shows a comparison of clade B vs. clade C anti-nef T cell responses in clade B HIV-infected subjects.

FIGS. 26A-1 to 26 A- 46 illustrate the nucleotide sequence of the pMRKAd5HIV-1pol adenoviral vector (SEQ ID NO:28 and SEQ ID NO:29), comprising the coding region of the inactivated pol gene (SEQ ID NO:3).

FIGS. 27A-1 to 27 A- 44 illustrate the nucleotide sequence of the pMRKAd5HIV-1 nef adenoviral vector (SEQ ID NO:30 and SEQ ID NO:31), comprising the coding region of the inactivated nef gene (SEQ ID NO: 13).

FIG. 28 shows the stability of MRKAd5 vectors comprising various promoter fragments (hCMV or mCMV) and terminations signals (bGH or SPA) in E3(+) or E3(−) backbones.

FIGS. 29A and B shows the anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi time points ( FIG. 29A ) and the timcourse QPA supernatant titers ( FIG. 29B ) for MRKAd5gag, MRKAd5pol and MRKAd5nef.

FIGS. 30A-1 to 30 A- 2 show the nucleotide sequence (SEQ ID NO:32) and amino acid sequence (SEQ ID NO:33) comprising the open reading frame of a representative tPA-gag fusion for use in the DNA and/or adenoviral vaccine disclosed herein.

FIG. 31 shows the intracellular γIFN staining of PBMCs collected at week 10 (post DNA prime) and week 30 (post Ad boost). The cells were stimulated overnight in the presence or absence of the gag peptide pool. They were subsequently stained using fluorescence-tagged anti-CD3, anti-CD8, anti-CD4, and anti-γIFN monoclonal antibodies. Each plot shows all CD3+ T cells which were segregated in terms of positive staining for surface CD8 and γIFN production. The numbers in the upper right and lower right quadrants of each plot are the percentages of CD3 + cells that were CD8 + γIFN + and CD4 + γIFN + , respectively.

FIG. 32 shows a comparison of single-modality adenovirus immunization with DNA+adjuvant prime/adenovirus boost immunization.

FIGS. 33A-1 to 33 A- 2 show the nucleotide sequence (SEQ ID NO: 34) of the open reading frame for the gag-IApol fusion of Example 29.

FIGS. 34A-1 to 34 A- 2 show the protein sequence (SEQ ID NO:35) of the gag-IApol fusion frame.

DETAILED DESCRIPTION OF THE INVENTION

A novel replication-defective, or “first generation,” adenoviral vector suitable for use in gene therapy or nucleotide-based vaccine vectors is described. This vector is at least partially deleted in E1 and comprises a wildtype adenovirus cis-acting packaging region from about base pair 1 to between about base pair 342 (more preferably, 400) to about 458 (preferably, 1-450) and, preferably, 3511-3523 of a wild-type adenovirus sequence. It has been found that a vector of this description possesses enhanced growth characteristics, with approximately 5-10 fold greater amplification rates, and is more potent allowing lower doses of virus to be used to generate equivalent immunity. The vector, furthermore, generates a harvested recombinant adenovirus which shows greater cellular-mediated immune responses than replication-deficient vectors not comprising this region (basepairs 342-450). Adenoviral constructs derived from these vectors are, further, very stable genetically, particularly those comprising a transgene under the control of a hCMV promoter devoid of intron A. Viruses in accordance with this description were passaged continually and analyzed; see Example 12. Each virus analyzed maintained it correct genetic structure. Analysis was also carried out under propagation conditions similar to that performed in large scale production. Again, the vectors were found to possess enhanced genetic stability; see FIG. 12 . Following 21 passages, the viral DNA showed no evidence of rearrangement, and was highly reproducible from one production lot to the next. The outcome of all relevant tests indicate that the adenoviral vector is extremely well suited for large-scale production of recombinant, replication-deficient adenovirus, as shown herein with the data associated with FIG. 28 .

A preferred adenoviral vector in accordance with this description is a vector comprising basepairs 1-450, which is deleted in E3. This vector can accommodate up to approximately 7,500 base pairs of foreign DNA inserts (or exogenous genetic material). Another preferred vector is one retaining E3 which comprises basepairs 1-450. A preferred vector of this description is an E3+vector comprising basepairs 1-450 and 3511-3523. This vector, when deleted of the region spanning basepairs 451-3510, can accommodate up to approximately, 4,850 base pairs of foreign DNA inserts (or exogenous genetic material). The cloning capacities of the above vectors have been determined using 105% of the wildtype Ad5 sequence as the upper genome size limit.

Wildtype adenovirus serotype 5 is used as the basis for the specific basepair numbers provided throughout the specification. The wildtype adenovirus serotype 5 sequence is known and described in the art; see, Chroboczek et al., 1992 J. Virology 186:280, which is hereby incorporated by reference. Accordingly, a particular embodiment of the instant invention is a vector based on the adenovirus serotype 5 sequence. One of skill in the art can readily identify the above regions in other adenovirus serotypes (e.g., serotypes 2, 4, 6, 12, 16, 17, 24, 31, 33, and 42), regions defined by basepairs corresponding to the above basepair positions given for adenovirus serotype 5. Accordingly, the instant invention encompasses all adenoviral vectors partially deleted in E1 comprising basepairs corresponding to 1-450 (particularly, 342-450) and, preferably, 3511-3523 of a wild-type adenovirus serotype 5 (Ad5) nucleic acid sequence. Particularly preferred embodiments of the instant invention are those derived from adenoviruses like Ad5 which are classified in subgroup C (e.g., Ad2).

Vectors in accordance with the instant invention are at least partially deleted in E1. Preferably the E1 region is completely deleted or inactivated. Most preferably, the region deleted of E1 is within basepairs 451-3510. It is to be noted that the extended 5′ and 3′ regions of the disclosed vectors are believed to effectively reduce the size of the E1 deletion of previous constructs without overlapping any part of the E1A/E1B gene present in the cell line used, i.e., the PER.C6® cell line transefected with base pairs 459-3510. Overlap of adenoviral sequences is avoided because of the possibility of recombination. One of ordinary skill in the art can certainly appreciate that the instant invention can, therefore, be modified if a different cell line transfected with a different segment of adenovirus DNA is utilized. For purposes of exemplification, a 5′ region of base pairs 1 to up to 449 is more appropriate if a cell line is transfected with adenoviral sequence from base pairs 450-3510. This holds true as well in the consideration of segments 3′ to the E1 deletion.

Preferred embodiments of the instant invention possess an intact E3 region (i.e., an E3 gene capable of encoding a functional E3). Alternate embodiments have a partially deleted E3, an inactivated E3 region, or a sequence completely deleted of E3. Applicants have found, in accordance with the instant invention, that virus comprising the E3 gene were able to amplify more rapidly compared with virus not comprising an E3 gene; see FIG. 6 wherein a diagnostic CsCl band corresponding to the E3+virus tested (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3-virus. These results were obtained following a virus competition study involving mixing equal MOI ratio (1:1) of adenovectors both comprising the E3 gene and not comprising the E3 gene. This increased amplification capacity of the E3+ adenovectors was subsequently confirmed with growth studies; see Table 4A, wherein the E3+ virus exhibit amplification ratios of 470, 420 and 320 as compared with the 115 and 40-50 of the E3-constructs.

As stated above, vectors in accordance with the instant invention can accommodate up to approximately 4,850 base pairs of exogenous genetic material for an E3+ vector and approximately 7,500 base pairs for an E3-vector. Preferably, the insert brings the adenoviral vector as close as possible to a wild-type genomic size (e.g., for Ad5, 35,935 basepairs). It is well known that adenovirus amplifies best when they are close to their wild-type genomic size.

The genetic material can be inserted in an E1-parallel or an E1 anti-parallel orientation, as such is illustrated in FIGS. 7A , 7 B, 7 C and FIG. 8 A. Particularly preferred embodiments of the instant invention, have the insert in an E1-parallel orientation. Applicants have found, via competition experiments with plasmids containing transgenes in differing orientation (FIG. 8 A), that vector constructs with the foreign DNA insert in an E1-parallel orientation amplify better and actually out-compete E1-antiparallel-oriented transgenes. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the E1 parallel orientation as compared with the E1 anti-parallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the E1 parallel orientation for both transgenes tested.

Adenoviral vectors in accordance with the instant invention are particularly well suited to effectuate expression of desired proteins, one example of which is an HIV protein, particularly an HIV full length gag protein. Exogenous genetic material encoding a protein of interest can exist in the form of an expression cassette. A gene expression cassette preferably comprises (a) a nucleic acid encoding a protein of interest; (b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription terminator.

The transcriptional promoter is preferably recognized by an eukaryotic RNA polymerase. In a preferred embodiment, the promoter is a “strong” or “efficient” promoter. An example of a strong promoter is the immediate early human cytomegalovirus promoter (Chapman et al, 1991 Nucl. Acids Res 19:3979-3986, which is incorporated by reference), preferably without intronic sequences. Most preferred for use within the instant adenoviral vector is a human CMV promoter without intronic seqeunces, like intron A. Applicants have found that intron A, a portion of the human cytomegalovirus promoter (hCMV), constitutes a region of instability for adenoviral vectors. CMV without intron A has been found to effectuate (Examples 1-3) comparable expression capabilities in vitro when driving HIV gag expression and, furthermore, behaved equivalently to intron A-containing constructs in Balb/c mice in vivo with respect to their antibody and T-cell responses at both dosages of plasmid DNA tested (20 μg and 200 μg). Those skilled in the art will appreciate that any of a number of other known promoters, such as the strong immunoglobulin, or other eukaryotic gene promoters may also be used, including the EF1 alpha promoter, the murine CMV promoter, Rous sarcoma virus (RSV) promoter, SV40 early/late promoters and the beta-actin promoter.

In preferred embodiments, the promoter may also comprise a regulatable sequence such as the Tet operator sequence. This would be extremely useful, for example, in cases where the gene products are effecting a result other than that desired and repression is sought.

Preferred transcription termination sequences present within the gene expression cassette are the bovine growth hormone terminator/polyadenylation signal (bGHpA) and the short synthetic polyA signal (SPA) of 50 nucleotides in length, defined as follows: AATAAAAGATCTTTATTTTCATTAGATCTGTGTGTTGGT-TTTTTGTGTG (SEQ ID NO:26).

The combination of the CMV promoter (devoid of the intron A region) with the BGH terminator is particularly preferred although other promoter/terminator combinations in the context of FG adenovirus may also be used.

Other embodiments incorporate a leader or signal peptide into the transgene. A preferred leader is that from the tissue-specific plasminogen activator protein, tPA. Examples include but are not limited to the various tPA-gag, tPA-pol and tPA-nef adenovirus-based vaccines disclosed throughout this specification.

In view of the improved adenovirus vectors described herein, an essential portion of the present invention are adenoviral-based HIV vaccines comprising said adenovirus backbones which may be administered to a mammalian host, preferably a human host, in either a prophylactic or therapeutic setting. The HIV vaccines of the present invention, whether administered alone or in combination regimens with other viral- or non-viral-based DNA vaccines, should elicit potent and broad cellular immune responses against HIV that will either lessen the likelihood of persistent virus infection and/or lead to the establishment of a clinically significant lowered virus load subject to HIV infection or in combination with HAART therapy, mitigate the effects of previously established HIV infection (antiviral immunotherapy(ARI)). While any HIV antigen (e.g., gag, pol, nef, gp160, gp41, gp120, tat, rev, etc.) may be utilized in the herein described recombinant adenoviral vectors, preferred embodiments include the codon optimized p55 gag antigen (herein exemplified as MRKAd5gag), pol and nef. Sequences based on different Clades of HIV-1 are suitable for use in the instant invention, most preferred of which are Clade B and Clade C. Particularly preferred embodiments are those sequences (especially, codon-optimized sequences) based on concensus Clade B sequences. Preferred versions of the MRKAd5pol and MRKAd5nef series of adenoviral vaccines will encode modified versions of pol or nef, as discussed herein. Preferred embodiments of the MRKAd5HIV-1 vectors carrying HIV envelope genes and modifications thereof comprise the HIV codon-optimized env sequences of PCT International Applications PCT/US97/02294 and PCT/US97/10517, published Aug. 28, 1997 (WO 97/31115) and Dec. 24, 1997, respectively; both documents of which are hereby incorporated by reference.

A most preferred aspect of the instant invention is the disclosed use of the adenoviral vector described above to effectuate expression of HIV gag. Sequences for many genes of many HIV strains are publicly available in GENBANK and primary, field isolates of HIV are available from the National Institute of Allergy and Infectious Diseases (NIAID) which has contracted with Quality Biological (Gaithersburg, Md.) to make these strains available. Strains are also available from the World Health Organization (WHO), Geneva Switzerland. It is preferred that the gag gene be from an HIV-1 strain (CAM-1; Myers et al, eds. “Human Retroviruses and AIDS: 1995, IIA3-IIA19, which is hereby incorporated by reference). This gene closely resembles the consensus amino acid sequence for the clade B (North American/European) sequence. Therefore, it is within the purview of the skilled artisan to choose an appropriate nucleotide sequence which encodes a specific HIV gag antigen, or immunologically relevant portion thereof. As shown in Example 25, a clade B or lade C based p55 gag antigen will potentially be useful on a global scale. As noted herein, the transgene of choice for insertion in to a DNA or MRKAd-based adenoviral vector of the present invention is a codon optimized version of p55 gag. Such a MRKAd5gag adenoviral vector is documented in Example 11 and is at least referred to herein as MRKAd5HIV-1gag. Of course, additional versions are contemplated, including but not limited to modifications such as promoter (e.g., mCMV for hCMV) and/or pA-terminations signal (SPA for bGH) switching, as well as generating MRK Ad5 backbones with or without deletion of the Ad5 E3 gene.

The present invention also relates a series of MRKAd5pol-based adenoviral vaccines which are shown herein to generate cellular immune responses subsequent to administration in mice and non-human primate studies. Several of the MRKAd5pol series are exemplified herein. One such adenoviral vector is referred to as MRKAd5hCMV-inact opt pol(E3+), which comprises the MRKAd5 backbone, the hCMV promoter (no intron A), an inactivated pol transgene, and contains the Ad5 E3 gene in the adenoviral backbone. A second exemplified pre-adenovirus plasmid and concomitant virus is referred to as MRKAd5hCMV-inact opt pol(E3−), which is identical to the former adenoviral vector except that the E3 is deleted. Both constructions contain a codon optimized, inactivated version of HIV-1 Pol, wherein at least the entire coding region is disclosed herein as SEQ ID NO:3 and the expressed protein is shown as SEQ ID NO:4 (see also FIGS. 17A-C and Table 1, which show targeted deletion for inactivated pol. This and other preferred codon optimized versions of HIV Pol as disclosed herein are essentially as described in U.S. application Ser. No. 09/745,221, filed Dec. 21, 2000 and PCT International Application PCT/US00/34724, also filed Dec. 21, 2000, both documents which are hereby incorporated by reference. As disclosed in the above-mentioned documents, the open reading frame for these codon-optimized HIV-1 Pol-based DNA vaccines are represented by codon optimized DNA molecules encoding codon optimized HIV-1 Pol (e.g. SEQ ID NO:2), codon optimized HIV-1 Pol fused to an amino terminal localized leader sequence (e.g. SEQ ID NO:6), and especially preferable, and exemplified by the MRKAd5-Pol construct in e.g., Example 19, biologically inactivated pol (“inact opt Pol”; e.g., SEQ ID NO:4) which is devoid of significant PR, RT, RNase or IN activity associated with wild type Pol. In addition, a construct related to SEQ ID NO:4 is contemplated which contains a leader peptide at the amino terminal region of the IA Pol protein. A specific construct is ligated within an appropriate DNA plasmid vector containing regulatory regions operatively linked to the respective HIV-1 Pol coding region, with or without a nucleotide sequence encoding a functional leader peptide. To this end, various HIV-1 Pol constructs disclosed herein relate to open reading frames for cloning to the enhanced first generation Ad vectors of the present invention (such a series of MRKAd5pol adenoviral vaccine vectors), including but not limited to wild type Pol (comprising the DNA molecule encoding WT opt Pol, as set forth in SEQ ID NO:2), tPA-opt WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID NO:6), inact opt Pol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ ID NO:4), and tPA-inact opt Pol, (comprising the DNA molecule encoding tPA-inact opt Pol, as set forth in SEQ ID NO:8). The pol-based versions of enhanced first generation adenovirus vaccines elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans. As noted in the above, an effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection.

The present invention further relates to a series of MRKAd5nef-based adenoviral vaccines which, similar to HIV gag and pol antigens, generate cellular immune responses subsequent to administration in mice and non-human primate studies. The MRKAd5nef series are exemplified herein by utilizing the improved MRK adenoviral backbone in combination with modified versions of HIV nef. These exemplified MRKAd5nef vectors are as follows: (1) MRKAd5hCMV-nef(G2A,LLAA) (E3+), which comprises the improved MRKAd5 backbone, a human CMV promoter an intact Ad5 E3 gene and a modified nef gene: (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+), which is the same as (1) above but substituting a murine CMV promoter for a human CMV promoter; and (3) MRKAd5mCMV-tpanef(LLAA) (E3+), which is the same as (2) except that the nef transgene is tpanef(LLAA). Codon optimized versions of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. application Ser. No. 09/738,782, filed Dec. 15, 2000 and PCT International Application PCT/US00/34162, also filed Dec. 15, 2000, both documents which are hereby incorporated by reference. Particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO:10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH 2 -terminus of the HIV-1 Nef polypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:11, while the expressed open reading frame is disclosed herein as SEQ ID NO:12. Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:13, while the expressed open reading frame is disclosed herein as SEQ ID NO:14. MRKAd5nef vectors (1) MRKAd5hCMV-nef(G2A,LLAA) (E3+) and (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+) contain this transgene. An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO:15, while the expressed open reading frame is disclosed herein as SEQ ID NO:16. The MRKAd5nef vector “MRKAd5mCMV-tpanef(LLAA) (E3+)” contains this transgene.

Along with the improved MRKAd5gag adenovirus vaccine vector described herein, generation of a MRKAd5pol and MRKAd5nef adenovirus vector provide for enhanced HIV vaccine capabilities. Namely, the generation of this trio of adenoviral vaccine vectors, all shown to generate effective cellular immune responses subsequent to host administration, provide for the ability to administer these vaccine candidates not only alone, but preferably as part of a divalent (i.e., gag and nef, gag and pol, or pol and nef components) or a trivalent vaccine (i.e., gag, pol and nef components). Therefore, a preferred aspect of the present invention are vaccine formulations and associated methods of administration and concomitant generation of host cellular immune responses associated with formulating three separate series of MRKAd5-based adenoviral vector vaccines. Of course, this MRKAd5 vaccine series based on distinct HIV antigens promotes expanded opportunities for formulation of a divalent or trivalent vaccine, or possibly administration of separate formulations of one or more monovalent or divalent formulations within a reasonable window of time. It is also within the scope of the present invention to embark on combined modality regimes which include multiple but distinct components from a specific antigen. An example, but certainly not a limitation, would be separate MRKAd5pol vectors, with one vaccine vector expressing wild type Pol (SEQ ID NO:2) and another MRKAd5pol vector expressing inactivated Pol (SEQ ID NO:6). Another example might be separate MRKAd5nef vectors, with one vaccine vector expressing the tPA/LLAA version of Nef (SEQ ID NO:16) and another MRKAd5nef vector expressing the G2A,LLAA modified version of Nef (SEQ ID NO:14). Therefore, the MRKAd5 adenoviral vectors of the present invention may be used in combination with multiple, distinct HIV antigen classes. Each HIV antigen class is subject to sequence manipulation, thus providing for a multitude of potential vaccine combinations; and such combinations are within the scope of the present invention. The utilization of such combined modalities vaccine formulation and administration increase the probability of eliciting an even more potent cellular immune response when compared to inoculation with a single modality regimen.

The present invention also relates to application of a mono-, dual-, or tri-modality administration regime of the MRKAd5gag, pol and nef adenoviral vaccine series in a prime/boost vaccination schedule. This prime/boost schedule may include any reasonable combination of the MRKAd5gag, pol and nef adenoviral vaccine series disclosed herein. In addition, a prime/boost regime may also involve other viral and/or non-viral DNA vaccines. A preferable addition to an adenoviral vaccine vector regime includes but is not limited to plasmid DNA vaccines, especially DNA plasmid vaccines that contain at least one of the codon optimized gag, pol and nef constructions, as disclosed herein.

Therefore, one aspect of this invention is the administration of the adenoviral vector containing the optimized gag gene in a prime/boost regiment in conjunction with a plasmid DNA encoding gag. To distinguish this plasmid from the adenoviral-containing shuttle plasmids used in the construction of an adenovirus vector, this plasmid will be referred to as a “vaccine plasmid” or “DNA plasmid vaccine”. Preferred vaccine plasmids for use in this administration protocol are disclosed in pending U.S. patent application Ser. No. 09/017,981, filed Feb. 3, 1998 and WO98/34640, published Aug. 13, 1998, both of which are hereby incorporated by reference. Briefly, the preferred vaccine plasmid is designated V1Jns-FLgag, which expresses the same codon-optimized gag gene as the adenoviral vectors of this invention (see FIG. 2 for the nucleotide sequence of the exemplified optimized codon version of full length p55 gag). The vaccine plasmid backbone, designated V1Jns contains the CMV immediate-early (IE) promoter and intron A, a bovine growth hormone-derived polyadenylation and transcription termination sequence as the gene expression regulatory elements, and a minimal pUC backbone; see Montgomery et al., 1993 , DNA Cell Biol. 12:777-783. The pUC sequence permits high levels of plasmid production in E. coli and has a neomycin resistance gene in place of an ampicillin resistance gene to provide selected growth in the presence of kanamycin. Alternatively, a vaccine plasmid which has the CMV promoter deleted of intron A can be used. Those of skill in the art will recognize that alternative vaccine plasmid vectors may be easily substituted for these specific constructs, and this invention specifically envisions use of such alternative plasmid DNA vaccine vectors.

Another aspect of the present invention is a prime/boost regimen which includes a vaccine plasmid which encodes an HIV pol antigen, preferably a codon optimized form of pol and also preferably a vaccine plasmid which comprises a nucleotide sequence which encodes a Pol antigen selected from the group of Pol antigens as shown in SEQ ID NOs: 2, 4, 6 and 8. The variety of potential DNA plasmid vaccines which encode various biologically active forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response. The preferred synthetic DNA molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIV-1 Pol proteins. The HIV-1 pol open reading disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as delivered via a recombinant adenoviral vaccine, especially an enhanced first generation recombinant adenoviral vaccine as described herein. Several embodiments of this portion of the invention are provided in detail below, namely DNA molecules which comprise a HIV-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human. Again, these DNA sequences are positioned appropriately within a recombinant adenoviral vector, such as the exemplified recombinant adenoviral vector described herein, so as to promote expression of the respective HIV-1 Pol gene of interest, and subsequent to administration, elicit a host CTL and Th response. Again, these preferred, but in no way limiting, pol genes are as disclosed herein and essentially as described in U.S. application Ser. No. 09/745,221, filed Dec. 21, 2000 and PCT International Application PCT/US00/34724, also filed Dec. 21, 2000, both documents which are hereby incorporated by reference.

A third series of vaccine plasmids which are useful in a combined modality and/or prime/boost regimen are vaccine plasmids which encode an HIV nef antigen or biologically and/or immunologically relevant modification thereof. As noted elsewhere, preferred vaccine plasmids contain a codon optimized form of nef and also preferably comprise a nucleotide sequence which encodes a Nef antigen selected from the group of Nef antigens as shown in SEQ ID NOs: 10, 12, 14 and 16. These preferred nef coding regions are disclosed herein, as well as being described in U.S. application Ser. No. 09/738,782, filed Dec. 15, 2000 and PCT International Application PCT/US00/34162, also filed Dec. 15, 2000, both documents which are hereby incorporated by reference.

Therefore, the adenoviral vaccines and plasmid DNA vaccines of this invention may be administered alone, or may be part of a prime and boost administration regimen. A mixed modality priming and booster inoculation scheme will result in an enhanced immune response, particularly is pre-existing anti-vector immune responses are present. This one aspect of this invention is a method of priming a subject with the plasmid vaccine by administering the plasmid vaccine at least one time, allowing a predetermined length of time to pass, and then boosting by administering the adenoviral vaccine. Multiple primings typically, 1-4, are usually employed, although more may be used. The length of time between priming and boost may typically vary from about four months to a year, but other time frames may be used. In experiments with rhesus monkeys, the animals were primed four times with plasmid vaccines, then were boosted 4 months later with the adenoviral vaccine. Their cellular immune response was notably higher than that of animals which had only received adenoviral vaccine. The use of a priming regimen may be particularly preferred in situations where a person has a pre-existing anti-adenovirus immune response.

Furthermore and in the alternative, multiple HIV-1 viral antigens, such as the MRKAd5 adenoviral vaccines disclosed herein, may be ligated into a proper shuttle plasmid for generation of a pre-adenoviral plasmid comprising multiple open reading frames. For example a trivalent vector may comprise a gag-pol-nef fusion, in either a E3(−) or E3(+) background, preferably a E3 deleted backbone, or possible a “2+1” divalent vaccine, such as a gag-pol fusion (i.e., codon optimized p55 gag and inactivated optimized pol; Example 29 and Table 25) within the same MRKAd5 backbone, with each open reading frame being operatively linked to a distinct promoter and transcription termination sequence. Alternatively, the two open reading frames may be operatively linked to a single promoter, with the open reading frames operatively linked by an internal ribosome entry sequence (IRES), as disclosed in International Publication No. WO 95/24485, which is hereby incorporated by reference. FIG. 9 shows that the use of multiple promoters and termination sequences provide for similar growth properties, while FIG. 28 shows that these MRKAd5gag-based vectors are also stable at least through passage 21. In the absence of the use of IRES-based technology, it is preferred that a distinct promoter be used to support each respective open reading frame, so as to best preserve vector stability. As examples, and certainly not as limitations, potential multiple transgene vaccines may include a three transgene vector such as hCMV-gagpol-bGHpA+mCMV-nef-SPA in an E3 deleted backbone or hCMV-gagpol-bGHpA+mCMV-nef-SPA(E3+). Potential “2+1” divalent vaccines of the present invention might be a hCMV-gag-bGHpA +mCMV-nef-SPA in an E3+backbone (vector #1) in combination with hCMV-pol-bGHpA in an E3+backbone (vector #2), with all transgenes in the E1 parallel orientation. Fusion constructs other than the gag-pol fusion described above are also suitable for use in various divalent vaccine strategies and can be composed of any two HIV antigens fused to one another (e.g., nef-pol and gag-nef). These adenoviral compositions are, as above, preferably delivered along with an adenoviral composition comprising an additional HIV antigen in order to diversify the immune response generated upon administration. Therefore, a multivalent vaccine delivered in a single, or possible second, adenoviral vector is certainly contemplated as part of the present invention. Again, this mode of administration is another example of whereby an efficaceous adenovirus-based HIV-1 vaccine may be administered via a combined modality regime. It is important to note, however, that in terms of deciding on an insert for the disclosed adenoviral vectors, due consideration must be dedicated to the effective packaging limitations of the adenovirus vehicle. Adenovirus has been shown to exhibit an upper cloning capacity limit of approximately 105% of the wildtype Ad5 sequence.

Regardless of the gene chosen for expression, it is preferred that the sequence be “optimized” for expression in a human cellular environment. A “triplet” codon of four possible nucleotide bases can exist in 64 variant forms. That these forms provide the message for only 20 different amino acids (as well as transcription initiation and termination) means that some amino acids can be coded for by more than one codon. Indeed, some amino acids have as many as six “redundant”, alternative codons while some others have a single, required codon. For reasons not completely understood, alternative codons are not at all uniformly present in the endogenous DNA of differing types of cells and there appears to exist variable natural hierarchy or “preference” for certain codons in certain types of cells. As one example, the amino acid leucine is specified by any of six DNA codons including CTA, CTC, CTG, CTT, TTA, and TTG (which correspond, respectively, to the mRNA codons, CUA, CUC, CUG, CUU, UUA and UUG). Exhaustive analysis of genome codon frequencies for microorganisms has revealed endogenous DNA of E. coli most commonly contains the CTG leucine-specifying codon, while the DNA of yeasts and slime molds most commonly includes a TTA leucine-specifying codon. In view of this hierarchy, it is generally held that the likelihood of obtaining high levels of expression of a leucine-rich polypeptide by an E. coli host will depend to some extent on the frequency of codon use. For example, a gene rich in TTA codons will in all probability be poorly expressed in E. coli , whereas a CTG rich gene will probably highly express the polypeptide. Similarly, when yeast cells are the projected transformation host cells for expression of a leucine-rich polypeptide, a preferred codon for use in an inserted DNA would be TTA.

The implications of codon preference phenomena on recombinant DNA techniques are manifest, and the phenomenon may serve to explain many prior failures to achieve high expression levels of exogenous genes in successfully transformed host organisms—a less “preferred” codon may be repeatedly present in the inserted gene and the host cell machinery for expression may not operate as efficiently. This phenomenon suggests that synthetic genes which have been designed to include a projected host cell's preferred codons provide a preferred form of foreign genetic material for practice of recombinant DNA techniques. Thus, one aspect of this invention is an adenovirus vector or adenovirus vector in some combination with a vaccine plasmid where both specifically include a gene which is codon optimized for expression in a human cellular environment. As noted herein, a preferred gene for use in the instant invention is a codon-optimized HIV gene and, particularly, HIV gag, pol or nef.

Adenoviral vectors in accordance with the instant invention can be constructed using known techniques, such as those reviewed in Hitt et al, 1997“Human Adenovirus Vectors for Gene Transfer into Mammalian Cells” Advances in Pharmacology 40:137-206, which is hereby incorporated by reference.

In constructing the adenoviral vectors of this invention, it is often convenient to insert them into a plasmid or shuttle vector. These techniques are known and described in Hitt et al., supra. This invention specifically includes both the adenovirus and the adenovirus when inserted into a shuttle plasmid.

Preferred shuttle vectors contain an adenoviral portion and a plasmid portion. The adenoviral portion is essentially the same as the adenovirus vector discussed supra, containing adenoviral sequences (with non-functional or deleted E1 and E3 regions) and the gene expression cassette, flanked by convenient restriction sites. The plasmid portion of the shuttle vector often contains an antibiotic resistance marker under transcriptional control of a prokaryotic promoter so that expression of the antibiotic does not occur in eukaryotic cells. Ampicillin resistance genes, neomycin resistance genes and other pharmaceutically acceptable antibiotic resistance markers may be used. To aid in the high level production of the polynucleotide by fermentation in prokaryotic organisms, it is advantageous for the shuttle vector to contain a prokaryotic origin of replication and be of high copy number. A number of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences. It is also desirable that the vectors not be able to replicate in eukaryotic cells. This minimizes the risk of integration of polynucleotide vaccine sequences into the recipients' genome. Tissue-specific promoters or enhancers may be used whenever it is desirable to limit expression of the polynucleotide to a particular tissue type.

In one embodiment of this invention, the pre-plasmids (e.g., pMRKAd5pol, pMRKAd5nef and pMRKAd5gag were generated by homologous recombination using the MRKHVE3 (and MRKHVO for the E3-version) backbones and the appropriate shuttle vector, as shown for pMRKAd5pol in FIG. 22 and for pMRKAd5nef in FIG. 23 . The plasmid in linear form is capable of replication after entering the PER.C6® cells and virus is produced. The infected cells and media were harvested after viral replication was complete.

Viral vectors can be propagated in various E1 complementing cell lines, including the known cell lines 293 and PER.C6®. Both these cell lines express the adenoviral E1 gene product. PER.C6® is described in WO 97/00326 (published Jan. 3, 1997) and issued U.S. Pat. No. 6,033,908, both of which are hereby incorporated by reference. It is a primary human retinoblast cell line transduced with an E1 gene segment that complements the production of replication deficient (FG) adenovirus, but is designed to prevent generation of replication competent adenovirus by homologous recombination. Cells of particular interest have been stably transformed with a transgene that encodes the AD5E1A and E1B gene, like PER.C6®, from 459 bp to 3510 bp inclusive. 293 cells are described in Graham et al., 1977 J. Gen. Virol 36:59-72, which is hereby incorporated by reference. As stated above, consideration must be given to the adenoviral sequences present in the complementing cell line used. It is important that the sequences not overlap with that present in the vector if the possibility of recombination is to be minimized.

It has been found that vectors generated in accordance with the above description are more effective in inducing an immune response and, thus, constitute very promising vaccine candidates. More particularly, it has been found that first generation adenoviral vectors in accordance with the above description carrying a codon-optimized HIV gag gene, regulated with a strong heterologous promoter can be used as human anti-HIV vaccines, and are capable of inducing immune responses.

Standard techniques of molecular biology for preparing and purifying DNA constructs enable the preparation of the DNA immunogens of this invention.

A vaccine composition comprising an adenoviral vector in accordance with the instant invention may contain physiologically acceptable components, such as buffer, normal saline or phosphate buffered saline, sucrose, other salts and polysorbate. One preferred formulation has: 2.5-10 mM TRIS buffer, preferably about 5 mM TRIS buffer; 25-100 mM NaCl, preferably about 75 mM NaCl; 2.5-10% sucrose, preferably about 5% sucrose; 0.01-2 mM MgCl 2 ; and 0.001%-0.01% polysorbate 80 (plant derived). The pH should range from about 7.0-9.0, preferably about 8.0. One skilled in the art will appreciate that other conventional vaccine excipients may also be used it make the formulation. The preferred formulation contains 5 mM TRIS, 75 mM NaCl, 5% sucrose, 1 mM MgCl 2 , 0.005% polysorbate 80 at pH 8.0 This has a pH and divalent cation composition which is near the optimum for Ad5 stability and minimizes the potential for adsorption of virus to a glass surface. It does not cause tissue irritation upon intramuscular injection. It is preferably frozen until use.

The amount of adenoviral particles in the vaccine composition to be introduced into a vaccine recipient will depend on the strength of the transcriptional and translational promoters used and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of 1×10 7 to 1×10 12 particles and preferably about 1×10 10 to 1×10 11 particles is administered directly into muscle tissue. Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided. Following vaccination with HIV adenoviral vector, boosting with a subsequent HIV adenoviral vector and/or plasmid may be desirable. Parenteral administration, such as intravenous, intramuscular, subcutaneous or other means of administration of interleukin-12 protein, concurrently with or subsequent to parenteral introduction of the vaccine compositions of this invention is also advantageous.

The adenoviral vector and/or vaccine plasmids of this invention polynucleotide may be unassociated with any proteins, adjuvants or other agents which impact on the recipients' immune system. In this case, it is desirable for the vector to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline. Alternatively, the vector may be associated with an adjuvant known in the art to boost immune responses (i.e., a “biologically effective” adjuvant), such as a protein or other carrier. Vaccine plasmids of this invention may, for instance, be delivered in saline (e.g., PBS) with or without an adjuvant. Preferred adjuvants are Alum or CRL1005 Block Copolymer. Agents which assist in the cellular uptake of DNA, such as, but not limited to, calcium ions, may also be used to advantage. These agents are generally referred to herein as transfection facilitating reagents and pharmaceutically acceptable carriers. Techniques for coating microprojectiles coated with polynucleotide are known in the art and are also useful in connection with this invention.

This invention also includes a prime and boost regimen wherein a first adenoviral vector is administered, then a booster dose is given. The booster dose may be repeated at selected time intervals. Alternatively, a preferred inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype. More preferably, the inoculation scheme comprises priming with a first adenovirus serotype and then boosting with a second adenovirus serotype, wherein the first and second adenovirus serotypes are classified within separate subgroups of adenoviruses. The above prime/boost schemes are particularly preferred in those situations where a preexisting immunity is identified to the adenoviral vector of choice. In this type of scheme, the individual or population of individuals is primed with an adenovirus of a serotype other than that to which the preexisting immunity is identified. This enables the first adenovirus to effectuate sufficient expression of the transgene while evading existing immunity to the second adenovirus (the boosting adenovirus) and, further, allows for the subsequent delivery of the transgene via the boosting adenovirus to be more effective. Adenovirus serotype 5 is one example of a virus to which such a scheme might be desirable. In accordance with this invention, therefore, one might decide to prime with a non-group C adenovirus (e.g., Ad12, a group A adenovirus, Ad24, a group D adenovirus, or Ad35, a group B adenovirus) to evade anti-Ad5 immunity and then boost with Ad5, a group C adenovirus. Another preferred embodiment involves administration of a different adenovirus (including non-human adenovirus) vaccine followed by administration of the adenoviral vaccines disclosed. In the alternative, a viral antigen of interest can be first delivered via a viral vaccine other than an adenovirus-based vaccine, and then followed with the adenoviral vaccine disclosed. Alternative viral vaccines include but are not limited to pox virus and venezuelan equine encephilitis virus.

A large body of human and animal data supports the importance of cellular immune responses, especially CTL in controlling (or eliminating) HIV infection. In humans, very high levels of CTL develop following primary infection and correlate with the control of viremia. Several small groups of individuals have been described who are repeatedly exposed to HIV by remain uninfected; CTL has been noted in several of these cohorts. In the SIV model of HIV infection, CTL similarly develops following primary infection, and it has been demonstrated that addition of anti-CD8 monoclonal antibody abrogated this control of infection and leads to disease progression. This invention uses adenoviral vaccines alone or in combination with plasmid vaccines to induce CTL.

The following non-limiting Examples are presented to better illustrate the invention.

EXAMPLE 1

Removal of the Intron A Portion of the hCMV Promoter

GMP grade pVIJnsHIVgag was used as the starting material to amplify the hCMV promoter. PVIJnsHIVgag is a plasmid comprising the CMV immediate-early (IE) promoter and intron A, a full-length codon-optimized HIV gag gene, a bovine growth hormone-derived polyadenylation and transcriptional termination sequence, and a minimal pUC backbone; see Montgomery et al., supra for a description of the plasmid backbone. The amplification was performed with primers suitably positioned to flank the hCMV promoter. A 5′ primer was placed upstream of the Msc1 site of the hCMV promoter and a 3′ primer (designed to contain the BglII recognition sequence) was placed 3′ of the hCMV promoter. The resulting PCR product (using high fidelity Taq polymerase) which encompassed the entire hCMV promoter (minus intron A) was cloned into TOPO PCR blunt vector and then removed by double digestion with Msc1 and BglII. This fragment was then cloned back into the original GMP grade pV1JnsHIVgag plasmid from which the original promoter, intron A, and the gag gene were removed following Msc1 and BglII digestion. This ligation reaction resulted in the construction of a hCMV promoter (minus intron A)+bGHpA expression cassette within the original pV1JnsHIVgag vector backbone. This vector is designated pVIJnsCMV(no intron).

The FLgag gene was excised from pV1JnsHIVgag using BglII digestion and the 1,526 bp gene was gel purified and cloned into pV1JnsCMV(no intron) at the BglII site. Colonies were screened using Sma1 restriction enzymes to identify clones that carried the Flgag gene in the correct orientation. This plasmid, designated pV1JnsCMV(no intron)-FLgag-bGHpA, was fully sequenced to confirm sequence integrity.

Two additional transgenes were also constructed. The plasmid, pV1JnsCMV(no intron)-FLgag-SPA, is identical to pV1JnsCMV(no intron)-FLgag-bGHpA except that the bovine growth hormone polyadenylation signal has been replaced with a short synthetic polyA signal (SPA) of 50 nucleotides in length. The sequence of the SPA is as shown, with the essential components (poly(A) site, (GT) n , and (T) n ; respectively) underlined:

AATAAA                                                                    AGATCTTTATTTTCATTAGATCT                                                                        GTGTG TTGGTTTTTTGTGTG (SEQ ID NO:18).

The plasmid, pV1Jns-mCMV-FLgag-bGHpA, is identical to the pV1JnsCMV(no intron)-FLgag-bGHpA except that the hCMV promoter has been removed and replaced with the murine CMV (mCMV) promoter.

FIG. 3 diagrammatically shows the new transgene constructs in comparison with the original transgene.

EXAMPLE 2

Gag Expression Assay for Modified Gag Transgenes

Gag Elisa was performed on culture supernatants obtained from transient tissue culture transfection experiments in which the two new hCMV-containing plasmid constructs, pV1JnsCMV(no intron)-FLgag-bGHpA and pV1JnsCMV(no intron)-FLgag-SPA, both devoid of intron A, were compared to pV1JnsHIVgag which, as noted above possesses the intron A as part of the hCMV promoter. Table 2 below shows the in vitro gag expression data of the new gag plasmids compared with the GMP grade original plasmid. The results displayed in Table 2 show that both of the new hCMV gag plasmid constructs have expression capacities comparable to the original plasmid construct which contains the intron A portion of the hCMV promoter.

TABLE 2
In vitro DNA transfection of original and
new plasmid HIV-1 gag constructs.
Plasmid                          μg gag/10e6 COS cells/5 μg DNA/48 hr
HIVFL-gagPR9901                                                                        a 10.8
PVIJns.hCMV-FLgag-bGHpA                                                                        b 16.6
pV1Jns-hCMV-FLgag-SPA                                                                        b,c 12.0
a                                                                                GMP grade pV1Jns-hCMVintronA-FLgag-bGHpA.
b                                                                                New plasmid constructions that have the intron A portion removed from the hCMV promoter.
c                                                                                In this construct the bGH terminator has been replaced with the short synthetic polyadenylation signal (SPA)

EXAMPLE 3

Rodent (Balb/c) Study for Modified Gag Transgenes

A rodent study was performed on the two new plasmid constructs described above—pV1JnsCMV(no intron)-FLgag-bGHpA and pV1JnsCMV(no intron)-FLgag-SPA—in order to compare them with the construct described above possessing the intron A portion of the CMV promoter, pV1JnsHIVgag. Gag antibody and Elispot responses (described in PCT International Application No. PCT/US00/18332 (WO 01/02607) filed Jul. 3, 2000, claiming priority to U.S. Provisional Application Serial No. 60/142,631, filed Jul. 6, 1999 and U.S. application Ser. No. 60/148,981, filed Aug. 13, 1999, all three applications which are hereby incorporated by reference) were measured. The results displayed in Table 3 below, show that the new plasmid constructs behaved equivalently to the original construct in Balb/c mice with respect to their antibody and T-cell responses at both dosages of plasmid DNA tested, 20 μg and 200 μg.

EXAMPLE 4

TABLE 3
HIV191: Immunogenicity of V1Jns-gag under different promoter and
termination control elements.
			SFC/10{circumflex over ( )}6 Cells
DNA a		Anti-p24 Titers	(4 Wk PD1) d
Promoter/	Dose,	(3 Wk PD1) c	Me-
terminator	ug b	GMT	+SE	−SE	dia	gag197-205	p24
HIVFL-	200	12800	4652	3412	2(2)	129(19)	30(11)
gag	20	5572	1574	1227	0	56(9)	25(6)
PR9901
(GMP
grade)
pV1Jns-	200	11143	2831	2257	0	98(5)	12(6)
hCMV-	20	7352	2808	2032	0	73(9)	11(6)
FL-gag-
bGHpA
pV1Jns-	200	16890	5815	4326	1(1)	94(4)	26(7)
hCMV-	20	5971	5361	2825	0	85(17)	38(10)
FL-gag-
SPA
Naïve	0	123	50	36	0	0	0
a in PBS
b i.m. Injections into both quads, 50 μL per quad
c n = 10; GMT, geometric mean titer; SE, standard. error
d n = 5, pooled spleens; mean of triplicate wells and standard. deviation. in parentheses;

Construction of the Modified Shuttle Vector-“MRKpdelE1 Shuttle”

The modifications to the original Ad5 shuttle vector (pdelE1sp1A; a vector comprising Ad5 sequences from basepairs 1-341 and 3524-5798, with a multiple cloning region between nucleotides 341 and 3524 of Ad5, included the following three manipulations carried out in sequential cloning steps as follows:

(1) The left ITR region was extended to include the Pac1 site at the junction between the vector backbone and the adenovirus left ITR sequences. This allow for easier manipulations using the bacterial homologous recombination system.

(2) The packaging region was extended to include sequences of the wild-type (WT) adenovirus from 342 bp to 450 bp inclusive.

(3) The area downstream of pIX was extended 13 nucleotides (i.e., nucleotides 3511-3523 inclusive).

These modifications ( FIG. 4 ) effectively reduced the size of the E1 deletion without overlapping with any part of the E1A/E1B gene present in the transformed PER.C6® cell line. All manipulations were performed by modifying the Ad shuttle vector pdelE1sp1A.

Once the modifications were made to the shuttle vector, the changes were incorporated into the original Ad5 adenovector backbones (pAdHVO and pAdHVE3) by bacterial homologous recombination using E. coli BJ5183 chemically competent cells.

EXAMPLE 5

Construction of Modified Adenovector Backbones (E3+ and E3−)

The original adenovectors pAdHVO (comprising all Ad5 sequences except those nucleotides encompassing the E1 and E3 regions) and pADHVE3 (comprising all Ad5 sequences except those nucleotides encompassing the E1 region), were each reconstructed so that they contained the modifications to the E1 region. This was accomplished by digesting the newly modified shuttle vector (MRKpdelE1 shuttle) with Pac1 and BstZ1101 and isolating the 2,734 bp fragment which corresponds to the adenovirus sequence. This fragment was co-transformed with DNA from either Cla1 linearized pAdHVO (E3− adenovector) or Cla1 linearized pAdHVE3 (E3+adenovector) into E. coli BJ5183 competent cells. At least two colonies from each transformation were selected and grown in Terrific™ broth for 6-8 hours until turbidity was reached. DNA was extracted from each cell pellet and then transformed into E. coli XL1 competent cells. One colony from each transformation was selected and grown for plasmid DNA purification. The plasmid was analyzed by restriction digestions to identify correct clones. The modified adenovectors were designated MRKpAdHVO (E3− plasmid) and MRKpAdHVE3 (E3+ plasmid). Virus from these new adenovectors (MRKHVO and MRKHVE3, respectively) as well as the old version of the adenovectors were generated in the PER.C6® cell lines to accommodate the following series of viral competition experiments. In addition, the multiple cloning site of the original shuttle vector contained Cla1, BamHI, Xho I, EcoRV, HindIII, Sal I, and Bgl II sites. This MCS was replaced with a new MCS containing Not I, CIa I, EcoRV and Asc I sites. This new MCS has been transferred to the MRKpAdHVO and MRKpAdHVE3 pre-plasmids along with the modification made to the packaging region and pIX gene.

EXAMPLE 6

Analysis of the Effect of the Packaging Signal Extension

To study the effects of the modifications made to the E1 deletion region, the viruses obtained from the original backbone (pAdHVE3) and the new backbone (MRKpAdHVE3) were mixed together in equal MOI ratios (1:1 and 5:5) and passaged through several rounds; see FIG. 5 , Expt.#1. Both of the viruses in the experiment contained the E3 gene intact and did not contain a transgene. The only difference between the two viruses was within the region of the E1 deletion. Following the coinfection of the viruses at P1 (passage 1), the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the virus extracted and purified by CsCl banding. The viral DNA was extracted and digested with HindIII and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids (pAdHVE3 (“OLD E3+”); MRKpAdHVE3 (“NEW E3+”)) were also digested with HindIII (and Pac1 to remove the vector backbone) and subsequently labeled with [ 33 P]dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. FIG. 6 clearly shows that the new adenovirus which has the addition made to the packaging signal region has a growth advantage compared with the original adenovirus. In the experiments performed (at either ratio tested), only the digestion bands pertaining to the newly modified virus were present. The diagnostic band of size 3,206 (from the new virus) was clearly present. However, there was no evidence of the diagnostic band of size 2,737 bp expected from the original virus.

EXAMPLE 7

Analysis of the Effect of the E3 Gene

The second set of the virus competition study involved mixing equal MOI ratio (1:1) of the newly modified viruses, that obtained from MRKpAdHVO and MRKpAdHVE3 ( FIG. 5 , Expt. #2). In this set, both viruses had the new modifications made to the E1 deletion. The first virus (that from MRKpAdHVO) does not contain an E3 gene. The second virus (that from MKpAdHVE3) does contain the E3 gene. Neither of the viruses contain a transgene. Following co-infection of the viruses, the mixtures were propagated through an additional 4 passages at which time the cells were harvested and the total virus extracted and purified by CsCl banding. The viral DNA was extracted and digested with HindIII and the digestion products were then radioactively labeled. For the controls, the respective pre-plasmids MRKpAdHVO (“NEW E3−”); MRKpAdHVE3 (“NEW E3+”) were also digested with HindIII (and Pac1 to remove the vector backbone) and then labeled with [ 33 P]dATP. The radioactively labeled digestion products were subjected to gel electrophoresis and the gel was dried down onto Whatman paper before being exposed to autoradiographic film. FIG. 6 shows the results of the viral DNA analysis of the E3+ virus and E3− virus mixing experiment. The diagnostic band corresponding to the E3+ virus (5,665 bp) was present in greater amount compared with the diagnostic band of 3,010 bp corresponding to the E3− virus. This indicates that the virus that contains the E3 gene is able to amplify more rapidly compared with the virus that does not contain an E3 gene. This increased amplification capacity has been confirmed by growth studies; see Table 4 below.

EXAMPLE 8

Construction of the New Shuttle Vector Containing Modified Gag Transgene—“MRKpdelE1-CMV(No Intron)-FLgag-bGHpA”

The modified plasmid pV1JnsCMV(no intron)-FLgag-bGHpA was digested with Msc1 overnight and then digested with Sfi1 for 2 hours at 50° C. The DNA was then treated with Mungbean nuclease for 30 mins at 30° C. The DNA mixture was desalted using the Qiaex II kit and then Klenow treated for 30 mins at 37° C. to fully blunt the ends of the transgene fragment. The 2,559 bp transgene fragment was then gel purified. The modified shuttle vector (MRKpdelE1 shuttle) was linearized by digestion with EcoRV, treated with calf intestinal phosphatase and the resulting 6,479 bp fragment was then gel purified. The two purified fragments were then ligated together and several dozen clones were screened to check for insertion of the transgene within the shuttle vector. Diagnostic restriction digestion was performed to identify those clones carrying the transgene in the E1 parallel and E1 anti-parallel orientation. This strategy was followed to clone in the other gag transgenes in the MRKpdelE1 shuttle vector.

EXAMPLE 9

Construction of the MRK FG Adenovectors

The shuttle vector containing the HIV-1 gag transgene in the E1 parallel orientation, MRKpdelE1-CMV(no intron)-FLgag-bGHpA, was digested with Pac1. The reaction mixture was digested with BsfZ171. The 5,291 bp fragment was purified by gel extraction. The MRKpAdHVE3 plasmid was digested with Cla1 overnight at 37° C. and gel purified. About 100 ng of the 5,290 bp shuttle +transgene fragment and ˜100 ng of linearized MRKpAdHVE3 DNA were co-transformed into E. coli BJ5183 chemically competent cells. Several clones were selected and grown in 2 ml Terrific™ broth for 6-8 hours, until turbidity was reached. The total DNA from the cell pellet was purified using Qiagen alkaline lysis and phenol chloroform method. The DNA was precipitated with isopropanol and resuspended in 20 μl dH 2 O. A 2 μl aliquot of this DNA was transformed into E. coli XL-1 competent cells. A single colony from each separate transformation was selected and grown overnight in 3 ml LB+100 μg/ml ampicillin. The DNA was isolated using Qiagen columns. A positive clone was identified by digestion with the restriction enzyme BstEII which cleaves within the gag gene as well as the plasmid backbone. The pre-plasmid clone is designated MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA and is 37,498 bp in size. This strategy was followed to generate E3− and E3+ versions of each of the other gag transgene constructions in both E1 parallel and E1 anti-parallel versions. FIGS. 7A , 7 B and 7 C show the various combinations of adenovectors constructed.

EXAMPLE 10

Plasmid Competition Studies

A series of plasmid competition studies was carried out. Briefly, the screening of the various combinations of new constructs was performed by mixing equal amounts of each of two competing plasmids. In the experiment shown in FIG. 8A , plasmids containing the same transgene but in different orientations were mixed together to create a “competition” between the two plasmids. The aim was to look at the effects of transgene orientation. In the experiment shown in FIG. 8B , plasmids containing different polyadenylation signals (but in the same orientation) were mixed together in equal amounts. The aim was to assess effects of polyA signals. Following the initial transfection, the virus was passaged through ten rounds and the viral DNA analyzed by radioactive restriction analysis.

Analysis of the viral species from the plasmid mixing experiment ( FIG. 8A ) showed that adenovectors which had the transgene inserted in the E1 parallel orientation amplified better and were able to out-compete the adenovirus which had the transgene inserted in the E1 anti-parallel orientation. Viral DNA analysis of the mixtures at passage 3 and certainly at passage 6, showed a greater ratio of the virus carrying the transgene in the E1 parallel orientation compared with the E1 antiparallel version. By passage 10, the only viral species observed was the adenovector with the transgene in the E1 parallel orientation for both transgenes tested (hCMV(no intron)-FLgag-bGHpA and hCMV(no intron)-FLgag-SPA).

Analysis of the viral species from the plasmid mixing experiment #2 ( FIG. 8B ) at passages 3 and 6 showed that the polyadenylation signals tested (bGHpA and SPA) did not have an effect on the growth of the virus. Even at passage 10 the two viral species in the mixture were still present in equal amounts.

EXAMPLE 11

Virus Generation of an Enhanced Adenoviral Construct—“MRK Ad5 HIV-1gag”

The results obtained from the competition study allowed us to make the following conclusions: (1) The packaging signal extension is beneficial; (2) Presence of E3 does enhance viral growth; (3) E1 parallel orientation is recommended; and (4) PolyA signals have no effect on the growth of the adenovirus.

MRK Ad5 HIV-1 gag exhibited the most desirable results. This construct contains the hCMV(no intron)-FLgag-bGHpA transgene inserted into the new E3+ adenovector backbone, MRKpAdHVE3, in the E1 parallel orientation. We have designated this adenovector MRK Ad5 HIV-1 gag. This construct was prepared as outlined below:

The pre-plasmid MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA was digested was Pac1 to release the vector backbone and 3.3 μg was transfected by calcium phosphate method (Amersham Pharmacia Biotech.) in a 6 cm dish containing PER.C6® cells at ˜60% confluence. Once CPE was reached (7-10 days), the culture was freeze/thawed three times and the cell debris pelleted. 1 ml of this cell lysate was used to infect into a 6 cm dish containing PER.C6® cells at 80-90% confluence. Once CPE was reached, the culture was freeze/thawed three times and the cell debris pelleted. The cell lysate was then used to infect a 15 cm dish containing PER.C6® cells at 80-90% confluence. This infection procedure was continued and expanded at passage 6. The virus was then extracted from the cell pellet by CsCl method. Two bandings were performed (3-gradient CsCl followed by a continuous CsCl gradient). Following the second banding, the virus was dialyzed in A105 buffer. Viral DNA was extracted using pronase treatment followed by phenol chloroform. The viral DNA was then digested with HindIII and radioactively labeled with [ 33 P]dATP. Following gel electrophoresis to separate the digestion products the gel was dried down on Whatman paper and then subjected to autoradiography. The digestion products were compared with the digestion products from the pre-plasmid (that had been digested with Pac1/HindIII prior to labeling). The expected sizes were observed, indicating that the virus had been successfully rescued. This strategy was used to rescue virus from each of the various adenovector plasmid constructs prepared.

EXAMPLE 12

Stability Analyses

To determine whether the various adenovector constructs (e.g., MRK Ad5 HIV-1 gag) show genetic stability, the viruses were each passaged continually. The viral DNA was analyzed at passages 3, 6 and 10. Each virus maintained its correct genetic structure. In addition, the stability of the MRK Ad5 HIV-1 gag was analyzed under propagation conditions similar to that performed in large scale production. For this analysis, the transfections of MRK Ad5 HIV-1 gag as well as three other adenoviral vectors were repeated and the virus was purified at P3. The three other adenovectors were as follows: (1) that comprising hCMV(no intron)-Flgag with a bGHpA terminator in an E3− adenovector backbone; (2) that comprising hCMV(no intron)-Flgag with a SPA termination signal in an E3+ adenovector backbone, and that comprising a mCMV-Flgag with a bGHpA terminator in an E3+ adenovector backbone. All of the vectors have the transgene inserted in the E1 parallel orientation. Viral DNA was analyzed by radioactive restriction analysis to confirm that it was correct before being delivered to fermentation cell culture for continued passaging in serum-free media. At P5 each of the four viruses were purified and the viral DNA extracted for analysis by the restriction digestion and radiolabeling procedure. This virus has subsequently been used in a series of studies (in vitro gag expression in COS cells, rodent study and rhesus monkey study) as will be described below. The viruses from P5 are shown in FIG. 9 .

The passaging under serum-free conditions was continued for the MRKHVE3 (transgene-less, obtained from MRKpAdHVE3 pre-plasmid) and the MRKAd5HIV-1gag (obtained from MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA pre-plasmid) viruses. FIG. 10 shows viral DNA analysis by radioactive restriction digestion at passage 11 for MRKHVE3, MRKAd5HIV-1gagE3−, and passage 11 and 12 for MRKAd5HIV-1gag. Aside from the first lane which is the DNA marker lane, the next three lanes are virus from the pre-plasmid controls (controls based on the original virus)-MRKpAdHVE3 (also referred to as “pMRKHVE3” ), MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA, and pMRKAd5gag(E3−), respectively. As seen in FIG. 10 , each of the viral DNA samples show the expected bands with no extraneous bands showing. This signifies that there are no major variant adenovirus species present that can be detected by autoradiography.

FIG. 11 shows the results of viral competition study between MRKHVE3 and MRKAd5HIV-1gag. These viruses were mixed together at equal MOI (140 viral particles each; 280 vp total) at passage 6 and continued to be passaged until P11. Aside from the first lane which is the DNA marker lane, the next two lanes are the pre-plasmid controls obtained from MRKpAdHVE3 and MRKpAdHVE3+CMV(no intron)-FLgag-bGHpA. The next two lanes are the viral DNA from the starting viral material at passage six. The last two lanes are the competition studies performed in duplicate. The data in FIG. 11 shows the effect the gag transgene in culture. Growth of a MRKAd5gag virus was compared with growth of a “transgene-less” MRKHVE3. These two viruses were infected at the same MOI (i.e. 140 vp each) at passage 6 and then passaged through to passage 11 and the viral pool was analyzed by radioactive restriction analysis. The data shows that one virus did not out compete the other. Therefore, the gag transgene did not show obvious signs of toxicity to the adenovirus.

Analysis by HindIII digestion shows that each virus specie is present in approximately equal amounts. As above, there does not appear to be signs of any extraneous bands. FIG. 12 shows higher passage numbers for MRKAd5HIV-1gag grown under serum-containing conditions. The genome integrity again has been maintained and there is no evidence of rearrangements, even at the highest passage level (P21).

Each of the four vectors shown in FIG. 9 were analyzed for amplification capacity. Table 4 below shows the QPA analysis used in the estimation of viral amplification ratios at P4. The determination of the amplification ratio for the original HIV-1 gag construct is based on the clinical lot at P12. It has been shown that amplification rates increases with higher passage number for the original virus. The reason for this observation is due to the emergence of variants which exhibit increased growth rates compared to the intact adenovector. With continued passaging of the original Ad gag vector, the level of variants increases and hence amplification rates increase also.

The MRK Ad5 HIV-1 gag virus has also been continually passaged under process conditions (i.e., serum-free media). Viral DNA extracted from passages 11 and 12 show no evidence of rearrangement.

TABLE 4
Amplification Ratios Based on AEX and QPA Analysis of
Virus Amplification from Passage 3 to Passage 4.
Ad gag construct       Amplification Ratio
MRKAd5gag              470
HCMV-Flgag-bGHpA [E3−] 115
HCMV-Flgag-SPA [E3+]   320
mCMV-FLgag-bGHpA [E3+] 420
Original construct*    40-50
*This estimation is based on the clinical lot growth characteristics at Passage 12.

EXAMPLE 13

Analytical Evaluation of the Enhanced Ad5 Constructs

To study the effects of the transgene and the E3 gene on virus amplification, the enhanced adenoviral vector, MRK Ad5 HIV-1 gag, along with its transgene-less version (MRKpAdHVE3) and its E3− version (MRK Ad5 HIV-1 gag E3−), was studied for several passages under serum-free conditions. Table 5A shows the amplification ratios determined for passages P3 to P8 for MRK Ad5 HIV-1 gag. Within a certain MOI range, it has been determined that the virus output is directly proportional to the virus input. Therefore, the greater the number of virus particles per cell at infection, the greater the virus amount produced. Viral amplification ratios, on the other hand, are inversely proportional to the virus input. The lower the virus input, the greater the amplification ratio.

Table 5B shows the amplification rates of the new E3+ vector backbone MRKpAdHVE3. It has a significantly lower rate of amplification compared with the gag transgene containing version. This may be contributed to the larger size MRK Ad5 HIV-1 gag since it contains the transgene. This inclusion of the transgene brings the size of the adenovirus closer to the size of a wild type Ad5 virus. It is well known that adenoviruses amplify best when they are at close to their wild type genomic size. Wild type Ad5 is 35,935 bp. The MRKpAdHVE3 is 32, 905 bp in length. The enhanced adenovector MRK Ad5 HIV-1 gag is 35,453bp (See FIG. 14 for vector map; see also FIGS. 15A-X show the complete pre-adenoviral vector sequence, which includes an additional 2,021 bp of the vector backbone).

Table 5C shows the amplification rates of the new E3− gag containing virus MRK Ad5 HIV-1 gag E3−. Once again, this virus shows lower growth rate than the enhanced adenoviral vector. This may be attributed to the decreased sized of this virus (due to the E3 gene deletion) compared with wild type Ad5. The MRK Ad5 HIV-1 gag E3− virus is 32,810 bp in length. This can be compared with the wild type Ad5 which is 35,935 bp and MRK Ad5 HIV-1 gag which is 35,453 bp in length.

TABLE 5A
Amplification ratios determined by AEX and QPA for MRKAd5gag over several
continuous passaging in serum free media. Following P5, two replicate samples were taken
(rep-1 and rep-2) and analyzed.
MRKAd5gag rep1
	Titer		AEX
	Xv (10 6 cells/ml), Viability (%)	Harvest Time	Cell Passage	10 10 vp/	Titer 10 4	QPA	Ratio	Amplification	Internal
	Infection	Harvest	h.p.l.	Number	ml culture	vp/cell	10 9 TCID 50 /ml	AEX:QPA	Ratio	Control
P4	1.49, 81%	0.58, 50%	44	46	8.7	5.9	1.72	50	470
									(MOI = 125)
P5	1.38, 93%	0.66, 47%	48	49	6.7	4.9	1.38	49	170
P6	1.04, 94%	0.68, 77%	47	48	5.8	5.6	1.42	41	200
P7	1.50, 84%	0.96, 61%	49.5	50	3.9	1.4	0.97	40	50
P7	1.09, 97%	0.76, 59%	50	52	5.2	4.7	1.70	31	170
P8	1.03, 94%	0.86, 64%	47.5	54	9.0	8.7	1.10	82	310
P9	0.89, 95%	0.99, 73%	47.5	56	4.4	4.9	1.03	43	175	3.12
										2.84
P10	1.09, 91%	1.06, 66%	47.5	58	3.0	2.8	1.16	26	100	2.70
										2.60
P11	1.19, 88%	0.98, 65%	47	60	3.6	3.0	1.15	31	110	2.70
										2.70
P12	0.98, 91%	0.85, 63%	47.5	47	5.4	5.5	1.20	45	200	2.86
										2.60
P13	1.00, 88%	0.70, 67%	49	49	5.8	5.8	1.11	52	210	3.18
										3.18
P14	1.94, 92%	0.88, 67%	46	53	8.6	4.4			160	3.28
										3.27
P15	0.97, 96%	0.64, 66%	47	47	6.9	7.1			250	3.12
										2.91

TABLE 5B
Amplification ratios determined by AEX and QPA for MRKHVE3 over several
continuous passaging in serum free media. MRKHVE3 is the new vector backbone which does
NOT carry a transgene.
MRKHVE3
	Titer		AEX
	Xv (10 6 cells/ml), Viability (%)	Harvest Time	Cell Passage	10 10 vp/	Titer	QPA	Ratio	Amplification	Internal
	Infection	Harvest	h.p.l.	Number	ml culture	10 4 vp/cell	10 9 TCID 50 /ml	AEX:QPA	Ratio	Control
P4	1.10, 97%	1.28, 79%	49	54	4.1	3.8	1.70	25	300
									(MOI = 125)
P5	0.92, 89%	1.18, 77%	47	48	4.3	4.7	1.24	35	170
P6	1.55, 86%	1.26, 76%	49.5	50	1.2	0.8	0.56	21	30
P6	1.09, 97%	1.11, 81%	49	52	4.0	3.6	1.16	34	130
P7	1.17, 91%	1.22, 91%	47.5	54	3.7	3.2	0.50	74	110
P8	0.98, 88%	1.41, 83%	48	56	2.1	2.1	0.47	45	75	3.12
										2.84
P9	1.20, 89%	1.26, 81%	47.5	58	0.8	0.7	0.29	28	25	2.70
										2.60
P10	0.99, 82%	1.55, 86%	47	60	2.3	2.3	0.43	53	80	2.70
										2.70
P11	1.07, 96%	1.25, 83%	48	47	2.7	2.5	0.41	66	90	2.86
										2.60
P12	0.80, 91%	1.14, 80%	49.5	49	5.9	7.4	0.48	123	260	3.18
										3.18
P13	1.96, 95%	1.14, 85%	45.5	53	5.8	3.0			110	3.28
										3.27
P14	0.97, 96%	1.03, 98%	48.5	47	9.4	9.7			350	3.12
										2.91
P15	0.87, 99%	0.97, 59%	49.5	49	5.3	6.1			218	2.78
										2.52

TABLE 5C
Amplification ratios determined by AEX and QPA for MRKAd5gag(E3−) over several
continuous passaging in serum free media. This construct is identical to the MRKAd5gag construct
except that this version is DELETED of the E3 gene.
MRKAd5gag(E3−)
	Titer		AEX
	Xv (10 6 cells/ml), Viability (%)	Harvest Time	Cell Passage	10 10 vp/	Titer	QPA	Ratio	Amplification	Internal
	Infection	Harvest	h.p.l.	Number	ml culture	10 4 vp/cell	10 9 TCID 50 /ml	AEX:QPA	Ratio	Control
P4	1.62, 77%	1.12, 62%	47.5	46	2.0	1.2	0.92	20	100
									(MOI = 125)
P5	1.16, 92%	0.62, 43%	49	49	3.3	2.9	0.99	34	100
P6	1.71, 86%	0.20, 10%	49	50	4.7	2.7	1.70	28	100
P6	1.09, 97%	0.63, 54%	49.5	52	5.4	5.0	1.76	31	180
P7	1.17, 91%	0.98, 72%	47.50	54	7.1	6.1	0.67	106	220
P8	0.98, 88%	0.77, 48%	48	56	3.1	3.2	0.66	47	115	3.12
										2.84
P9	1.20, 89%	1.03, 72%	48	58	1.8	1.5	0.57	32	55	2.70
										2.60
P10	0.99, 82%	0.80, 62%	46.5	60	3.2	3.2	0.68	47	115	2.70
										2.70
P11	1.07, 96%	0.98, 70%	48.5	47	5.9	5.5	0.68	87	200	2.86
										2.60
P12	0.80, 91%	0.67, 59%	50	49	5.1	6.4	0.72	71	230	3.18
										3.18
P13	1.96, 95%	0.91, 59%	45.5	53	7.4	3.8			135	3.28
										3.27
P14	0.97, 96%	0.81, 74%	48	47	6.8	7.0			250	3.12
										2.91
P15	0.87, 99%	0.84, 56%	49	49	4.8	5.5			196	2.78
										2.52

EXAMPLE 14

Gag Expression Analysis of the Novel Constructs

In vitro gag analysis of the MRK Ad5 HIV-1 gag and the original HIV-gag vectors (research and clinical lot) show comparable gag expression. The clinical lot shows only a slightly reduced gag expression level. The most noticeable difference is with the mCMV vector. This vector shows roughly 3 fold lower expression levels compared with the other vectors tested (which all contain hCMV promoters). The mCMV-FLgag with bGHpA assay was performed three times using different propagation and purification lots and it consistently exhibited weaker gag expression.

EXAMPLE 15

Evaluation of MRK Ad5 HIV-1 gag and Other gag-Containing Adenovectors in Balb/c Mice

Cohorts of 10 balb/c mice were vaccinated intramuscularly with escalating doses of MRK Ad5 HIV-1 gag, and the research and clinical lots of original Ad5HIV-1gag. Serum samples were collected 3 weeks post dose 1 and analyzed by anti-p24 sandwich ELISA.

Anti-p24 titers in mice that received MRK Ad5 HIV-1 gag (107 and 109 vp(viral particle) doses) were comparable ( FIG. 13 ) to those of the research lot of Ad5HIV-1 gag, for which much of the early rhesus data were generated on. These titers were also comparable when E3 is deleted (MRKAd5hCMVgagbGHpA(E3−)) or SPA is substituted for bGHpA terminator (MRKAd5 hCMV-gag-SPA (E3+)) or murine CMV promoter is used in place of hCMV (MRKAd5 mCMV-gag-bGHpA (E3+)) in the MRKAd5 backbone.

The results shown in Table 7 indicate that the three other vectors (in addition to the preferred vector, MRK Ad5 HIV-1 gag, are also capable of inducing strong anti-gag antibody responses in mice. Interestingly enough, while the mCMV-FLgag construct containing bGHpA and E3+ in an E1 parallel orientation showed lowest gag expression in the COS cell in vitro infection (Table 6) in comparison with the other vectors tested, it generated the greatest anti-gag antibody response this in vivo Balb/c study. Table 7 also shows a dose response in anti-gag antibody production in both the research and the clinical lot. As expected, the clinical lot shows reduced anti-gag antibody induction at each dosage level compared to the same dosage used for the research lot.

TABLE 6
In vitro analysis for gag expression in COS cells by Elisa assay.
Viral Vectors                                                                        a μg gag/4.8 × 10e5 COS/10e8 parts/48 hr
MRKAd5gag                                                                        b 1.40
Clinical lot Ad5gag                                                                        c 1.28
Research lot Ad5gag                                                                        d 1.32
MCMVFL-gagbGHpA                                                                        e 0.42
a                                                                                A                                                                                    260nm                                                                                 absorbance readings taken for viral particle determinations.
b                                                                                MRKAd5gag was produced in serum free conditions and purified at P5.
c                                                                                Clinical lot# Ad5gagFN0001
d                                                                                Research Ad5FLgag lot# 6399
e                                                                                mCMVFL-gagbGHpA was produced in serum free conditions and purified at P5.

TABLE 7
mHIV020 Anti-p24 Ab Titers in Balb/c mice (n = 10) vaccinated with various Adgag
constructs and lots (3 week post dose1).
Group		Dose
ID	Vaccine	(vp)	GMT	SE upper	SE lower
1	a MRKAd5gag	10{circumflex over ( )}7	25600	5877	4780
2	″	10{circumflex over ( )}9	409600	94028	76473
3	hCMV FL-gag bGHpA [E3−] →	10{circumflex over ( )}7	7352	2077	1620
4	″	10{circumflex over ( )}9	235253	59767	47659
5	hCMV FL-gag SPA [E3+] →	10{circumflex over ( )}7	12800	9905	236
6	″	10{circumflex over ( )}9	310419	99181	75165
7	b mCMV FL-gag bGHpA [E3+] →	10{circumflex over ( )}7	44572	23504	15389
8	″	10{circumflex over ( )}9	941014	239068	190636
9	c hCMV FL-gag bGHpA [E3−] ←	10{circumflex over ( )}7	3676	934	745
10	″	10{circumflex over ( )}9	117627	17491	15227
11	research lot hCMV intronA FL-gag bGHpA [E3−] <−	10{circumflex over ( )}6	528	262	175
12	″	10{circumflex over ( )}7	14703	5274	3882
13	″	10{circumflex over ( )}8	58813	14942	11915
14	″	10{circumflex over ( )}9	204800	53232	42250
15	clinical lot hCMVintronA FL-gag bGHpA [E3−] <−	10{circumflex over ( )}6	230	82	61
16	″	10{circumflex over ( )}7	4222	3405	1138
17	″	10{circumflex over ( )}8	19401	3939	3274
18	″	10{circumflex over ( )}9	89144	25187	19639
19	Naïve	none	93	7	6
*2 × 50 μL i.m. (quad) injections/animal
P.l.s: Youil, Chen, Casimiro
Vaccination: T. Toner, Q. Su
Assay: M. Chen
a The structure of MRKAd5gag is: hCMVFL-gagbGHpA [E3+] → The same lot of MRKAd5gag used in this rodent study was used in the Rhesus monkey study (Tables 7 and 8).
b The same lot of mCMVFL-gagbGHpA[E3+] used in the in vitro study (Table 6) ws used here.
c This construct was designed by Volker Sandig. It contains a shorter version of the hCMV promoter than that used in the MRK constructs. The adenovector backbone is identical to the original backbone used in the original Adgag vector. Expression at 10e7 dose from this vector is 7 fold lower then the same dose of the MRKAd5gag and 4 fold lower than the research lot.

EXAMPLE 16

Comparison of Humoral and Cellular Responses Towards the Original Ad-gag Construct with the New MRK Ad5 HIV-1 gag in Rhesus Monkeys

Cohorts of 3 rhesus monkeys were vaccinated intramuscularly with MRK Ad5 HIV-1 gag or the clinical Ad5gag bulk at two doses, 10 11 vp and 10 9 vp. Immunizations were conducted at week 0, 4, and 25. Serum and PBMC samples were collected at selected time points. The serum sample were assayed for anti-p24 Ab titers (using competitive based assay) and the PBMCs for antigen-specific IFN-gamma secretion following overnight stimulation with gag 20-mer peptide pool (via ELISpot assay).

The results shown in Table 8 indicate comparable responses with respect to the generation of anti-gag antibodies. The frequencies of gag-specific T cells in peripheral blood assummarized in Table 9 demonstrate a strong cellular immune response generated after a single dose with the new construct MRK Ad5 HIV-1 gag. The responses are also boostable with second dose of the same vector. The vector is also able to induce CD8+ T cell responses (as evident by remaining spot counts after CD4+ depletion of PBMCs) which are responsible for cytotoxic activity.

TABLE 8
Anti-p24 antibody titers (in mMU/mL) in rhesus macaques immunized with
gag-expressing adenovectors (Protocol HIV203).
Vaccine	Pre	Wk 4	Wk 8	Wk 12	Wk 16	Wk 20	Wk 25	Wk 28
MRKA
d5gag a ,
10{circumflex over ( )}11
vp
97N010	<10	118	5528	11523	7062	21997	ND	51593
97N116	<10	62	772	1447	1562	2174	ND	20029
98X007	<10	66	3353	6156	6845	3719	ND	24031
MRKA
d5gag,
10{circumflex over ( )}9
vp
97N120	<10	51	204	318	366	482	ND	6550
97N144	<10	18	118	274	706	888	ND	7136
98X008	<10	15	444	386	996	1072	ND	12851
Ad5
gag b ,
Clinical
Lot,
10{circumflex over ( )}11
vp
97X001	<10	87	2579	4718	7174	7250	ND	69226
97N146	<10	72	3604	7380	7526	18906	ND	60283
98X009	<10	78	4183	3946	3124	6956	ND	26226
Ad5
gag,
Clinical
Lot,
10{circumflex over ( )}9 vp
97N020	<10	<10	143	371	390	1821	ND	17177
97X003	<10	<10	39	93	156	596	ND	2053
98X012	<10	81	342	717	956	1558	ND	11861
a MRKAd5gag (hCMV, bGHpA, E3+)
b original Ad5gag vector (hCMV/Intron A, bGHpA, E3−), lot#F N0001
ND, not determined

TABLE 9
Number of gag-specific T cells per million peripheral blood mononuclear
cells (PBMCs) in rhesus monkeys immunized with gag-expressing adenovectors.
Also included are those frequencies in PBMCs depleted of CD4 + T cells.
	Vaccination	Monkey	T = 4 Wk		T = 6 Wk		T = 11 Wk		T = 16 Wk		T = 25 Wk		T = 28 Wk
Grp#	T = 0, 4, 25 wks	ID	Media a	Gag H b	Media	Gag H	Media	Gag H	Media	Gag H	Media	Gag H	Media	Gag H
1	MRKAd5gag	97N010	6	89	0	395	0	1058	0	1174	3	775	4	1074
	10{circumflex over ( )}11 vp	97N010	4	38			3	993			0	76	0	594
		(CD4−)
		97N116	1	396	1	609	0	534	4	395	1	261	0	408
		97N116	11	676			0	593			0	184	0	666
		(CD4−)
		98X007	10	579	0	1304	3	2193	1	2118	3	1588	0	2113
		98X007	20	965			0	2675			0	1656	0	1278
		(CD4−)
2	MRKAd5gag	97N120	5	275	1	249	4	141	4	119	9	206	4	219
	10{circumflex over ( )}9 vp	97N120	11	170			0	85			0	75	1	219
		(CD4−)
		97N144	3	236	6	438	1	318	3	256	1	98	5	373
		97N144	6	148			0	285			ND	ND	0	625
		(CD4−)
		98X008	4	368	1	1090	3	891	4	673	3	473	5	735
		98X008	14	696			0	1175			0	391	4	848
		(CD4−)
3	Ad5gag clinical	97X001	0	261	1	485	0	817	0	1220b	1	894	0	1858
	lot 10{circumflex over ( )}11 vp	97X001	10	283			3	996			0	1010	0	1123
		(CD4−)
		97N146	3	150	1	465	0	339	1	1272	3	1238	3	1785
		97N146	6	133			0	370			0	654	0	971
		(CD4−)
		98X009	0	93	3	339	3	559	0	896	1	384	0	1748
		98X009	0	73			0	333			0	225	0	644
		(CD4−)
4	Ad5gag clinical	97N020	3	30	1	101	0	66	0	36	0	26	0	41
	lot 10{circumflex over ( )}9 vp	97N020	10	29			0	15			0	1	0	16
		(CD4−)
		97X003	4	68	5	134	0	18	1	38	4	38	6	81
		97X003	9	40			0	6			0	4	0	19
		(CD4−)
		98X012	5	95	3	54	1	34	0	18	0	20	1	121
		98X012	11	70			0	11			0	8	0	41
		(CD4−)
5	Naïve	96R041	6	8	1	1	0	0	0	0	0	0	1	0
		053F	14	18	5	16	20	14	19	15	10	15	24	9
Based on either 4 × 10{circumflex over ( )}5 or 2 × 10{circumflex over ( )}5 cells per well (depending on spot density)
ND, not determined
a mock or no peptide control
b Pool of 20-aa peptides overlapping by 10 aa and encompassing the gag sequence

The adenovectors described herein and, particularly, MRK Ad5 HIV-1 gag, represent very promising HIV-gag adenovectors with respect to their enhanced growth characteristics in both serum and, more importantly, in serum-free media conditions. In comparison with the current HIV-1 gag adenovector construct, MRK Ad5 HIV-1 gag shows a 5-10 fold increased amplification rate. We have shown that it is genetically stable at passage 21. This construct is able to generate significant cellular immune responses in vivo even at a relatively low dose of 10{circumflex over ( )}9 vp. The potency of the MRKAd5gag construct is comparable to, if not better than the original HIV-1gag vector as shown in this rhesus monkey study.

EXAMPLE 17

Codon Optimized HIV-1 pol and Codon Optimzed HIV-1 pol Modifications

The open reading frames for the various synthetic pol genes disclosed herein comprise coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase (IN). The protein sequence is based on that of Hxb2r, a clonal isolate of IIIB; this sequence has been shown to be closest to the consensus clade B sequence with only 16 nonidentical residues out of 848 (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, New Mexico). The skilled artisan will understand after review of this specification that any available HIV-1 or HIV-2 strain provides a potential template for the generation of HIV pol DNA vaccine constructs disclosed herein. It is further noted that the protease gene is excluded from the DNA vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation. The design of the gene sequences for both wild-type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred (“humanized”) codons for each amino acid residue in the sequence in order to maximize in vivo mammalian expression (Lathe, 1985 , J. Mol. Biol. 183:1-12). As can be discerned by inspecting the codon usage in SEQ ID NOs: 1, 3, 5 and 7, the following codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gln (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which, as noted elsewhere in this specification, is hereby incorporated by reference. It is intended that the skilled artisan may use alternative versions of codon optimization or may omit this step when generating HIV pol vaccine constructs within the scope of the present invention. Therefore, the present invention also relates to non-codon optimized versions of DNA molecules and associated recombinant adenoviral HIV vaccines which encode the various wild type and modified forms of the HIV Pol protein disclosed herein. However, codon optimization of these constructs is a preferred embodiment of this invention.

A particular embodiment of this portion of the invention comprisies codon optimized nucleotide sequences which encode wt-pol DNA constructs (herein, “wt-pol” or “wt-pol (codon optimized))” wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized “wild type” sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:1, the open reading frame being contained from an initiating Met residue at nucleotides 10-12 to a termination codon from nucleotides 2560-2562. SEQ ID NO:1 is as follows:

AGATCTACCA TGGCCCCCAT CTCCCCCATT GAGACTGTGC CTGTGAAGCT GAAGCCTGGC (SEQ ID NO:1)
ATGGATGGCC CCAAGGTGAA GCAGTGGCCC CTGACTGAGG AGAAGATCAA GGCCCTGGTG
GAAATCTGCA CTGAGATGGA GAAGGAGGGC AAAATCTCCA AGATTGGCCC CGAGAACCCC
TACAACACCC CTGTGTTTGC CATCAAGAAG AAGGACTCCA CCAAGTGGAG GAAGCTGGTG
GACTTCAGGG AGCTGAACAA GAGGACCCAG GACTTCTGGG AGGTGCAGCT GGGCATCCCC
CACCCCGCTG GCCTGAAGAA GAAGAAGTCT GTGACTGTGC TGGATGTGGG GGATGCCTAC
TTCTCTGTGC CCCTGGATGA GGACTTCAGG AAGTACACTG CCTTCACCAT CCCCTCCATC
AACAATGAGA CCCCTGGCAT CAGGTACCAG TACAATGTGC TGCCCCAGGG CTGGAAGGGC
TCCCCTGCCA TCTTCCAGTC CTCCATGACC AAGATCCTGG AGCCCTTCAG GAAGCAGAAC
CCTGACATTG TGATCTACCA GTACATGGAT GACCTGTATG TGGGCTCTGA CCTGGAGATT
GGGCAGCACA GGACCAAGAT TGAGGAGCTG AGGCAGCACC TGCTGAGGTG GGGCCTGACC
ACCCCTGACA AGAAGCACCA GAAGGAGCCC CCCTTCCTGT GGATGGGCTA TGAGCTGCAC
CCCGACAAGT GGACTGTGCA GCCCATTGTG CTGCCTGAGA AGGACTCCTG GACTGTGAAT
GACATCCAGA AGCTGGTGGG CAAGCTGAAC TGGGCCTCCC AAATCTACCC TGGCATCAAG
GTGAGGCAGC TGTGCAAGCT GCTGAGGGGC ACCAAGGCCC TGACTGAGGT GATCCCCCTG
ACTGAGGAGG CTGAGCTGGA GCTGGCTGAG AACAGGGAGA TCCTGAAGGA GCCTGTGCAT
GGGGTGTACT ATGACCCCTC CAAGGACCTG ATTGCTGAGA TCCAGAAGCA GGGCCAGGGC
CAGTGGACCT ACCAAATCTA CCAGGAGCCC TTCAAGAACC TGAAGACTGG CAAGTATGCC
AGGATGAGGG GGGCCCACAC CAATGATGTG AAGCAGCTGA CTGAGGCTGT GCAGAAGATC
ACCACTGAGT CCATTGTGAT CTGGGGCAAG ACCCCCAAGT TCAAGCTGCC CATCCAGAAG
GAGACCTGGG AGACCTGGTG GACTGAGTAC TGGCAGGCCA CCTGGATCCC TGAGTGGGAG
TTTGTGAACA CCCCCCCCCT GGTGAAGCTG TGGTACCAGC TGGAGAAGGA GCCCATTGTG
GGGGCTGAGA CCTTCTATGT GGATGGGGCT GCCAACAGGG AGACCAAGCT GGGCAAGGCT
GGCTATGTGA CCAACAGGGG CAGGCAGAAG GTGGTGACCC TGACTGACAC CACCAACCAG
AAGACTGAGC TCCAGGCCAT CTACCTGGCC CTCCAGGACT CTGGCCTGGA GGTGAACATT
GTGACTGACT CCCAGTATGC CCTGGGCATC ATCCAGGCCC AGCCTGATCA GTCTGAGTCT
GAGCTGGTGA ACCAGATCAT TGAGCAGCTG ATCAAGAAGG AGAAGGTGTA CCTGGCCTGG
GTGCCTGCCC ACAAGGGCAT TGGGGGCAAT GAGCAGGTGG ACAAGCTGGT GTCTGCTGGC
ATCAGGAAGG TGCTGTTCCT GGATGGCATT GACAAGGCCC AGGATGAGCA TGAGAAGTAC
CACTCCAACT GGAGGGCTAT GGCCTCTGAC TTCAACCTGC CCCCTGTGGT GGCTAAGGAG
ATTGTGGCCT CCTGTGACAA GTGCCAGCTG AAGGGGGAGG CCATGCATGG GCAGGTGGAC
TGCTCCCCTG GCATCTGGCA GCTGGACTGC ACCCACCTGG AGGGCAAGGT GATCCTGGTG
GCTGTGCATG TGGCCTCCGG CTACATTGAG GCTGAGGTGA TCCCTGCTGA GACAGGCCAG
GAGACTGCCT ACTTCCTGCT GAAGCTGGCT GGCAGGTGGC CTGTGAAGAC CATCCACACT
GACAATGGCT CCAACTTCAC TGGGGCCACA GTGAGGGCTG CCTGCTGGTG GGCTGGCATC
AAGCAGGAGT TTGGCATCCC CTACAACCCC CAGTCCCAGG GGGTGGTGGA GTCCATGAAC
AAGGAGCTGA AGAAGATCAT TGGGCAGGTG AGGGACCAGG CTGAGCACCT GAAGACAGCT
GTGCAGATGG CTGTGTTCAT CCACAACTTC AAGAGGAAGG GGGGCATCGG GGGCTACTCC
GCTGGGGAGA GGATTGTGGA CATCATTGCC ACAGACATCC AGACCAAGGA GCTCCAGAAG
CAGATCACCA AGATCCAGAA CTTCAGGGTG TACTACAGGG ACTCCAGGAA CCCCCTGTGG
AAGGGCCCTG CCAAGCTGCT GTGGAAGGGG GAGGGGGCTG TGGTGATCCA GGACAACTCT
GACATCAAGG TGGTGCCCAG GAGGAAGGCC AAGATCATCA GGGACTATGG CAAGCAGATG
GCTGGGGATG ACTGTGTGGC CTCCAGGCAG GATGAGGACT AAAGCCCGGG CAGATCT.

The open reading frame of the wild type pol construct disclosed as SEQ ID NO:1 contains 850 amino acids, disclosed herein as SEQ ID NO:2, as follows:

Met Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro (SEQ ID NO:2)
Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys
Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Glu Gly Lys
Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala
Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg
Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile
Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Asp
Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys
Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile
Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys Gly Ser Pro Ala
Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln
Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Asp Asp Leu Tyr Val Gly
Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg
Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln
Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys
Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val
Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile
Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr
Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu
Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr
Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln Lys Gln Gly Gln
Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys
Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys
Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile
Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp
Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp
Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu
Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala
Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly
Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr Glu
Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn
Ile Val Thr Asp Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro
Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile
Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile
Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys
Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys
Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro
Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys
Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln
Leu Asp Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His
Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly
Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val
Lys Thr Ile His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val
Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro
Tyr Asn Pro Gln Ser Gln Gly Val Val Glu Ser Met Asn Lys Glu Leu
Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr
Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly
Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr
Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn
Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro
Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn
Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp
Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp
Glu Asp.

The present invention especially relates to an adenoviral vector vaccine which comprises a codon optimized HIV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HIV-1 pol (RT-RH-IN) activity of the expressed protein. Therefore, the present invention preferably relates to an adenoviral HIV-1 DNA pol-based vaccine wherein the construct is devoid of DNA sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, RNase and/or IN activity. One type of HIV-1 pol mutant which is part and parcel of an adenoviral vector vaccine may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct in a DNA molecule which contains at least one point mutation which alters the active site of the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. To this end, an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4, FIGS. 17A-C ) which has no PR, RT, RNase or IN activity, wherein three such point mutations reside within each of the RT, RNase and IN catalytic domains. Therefore, an especially preferred exemplification is an adenoviral vaccine which comprises, in an appropriate fashion, a DNA molecule which encodes IA-pol, which contains all nine mutations as shown below in Table 1. An additional preferred amino acid residue for substitution is Asp551, localized within the RNase domain of Pol. Any combination of the mutations disclosed herein may suitable and therefore may be utilized as an IA-Pol-based vaccine of the present invention. While addition and deletion mutations are contemplated and within the scope of the invention, the preferred mutation is a point mutation resulting in a substitution of the wild type amino acid with an alternative amino acid residue.

TABLE 1
wt aa	aa residue	mutant aa	enzyme function
Asp	112	Ala	RT
Asp	187	Ala	RT
Asp	188	Ala	RT
Asp	445	Ala	RNase H
Glu	480	Ala	RNase H
Asp	500	Ala	RNase H
Asp	626	Ala	IN
Asp	678	Ala	IN
Glu	714	Ala	IN

It is preferred that point mutations be incorporated into the IApol mutant adenoviral vaccines of the present invention so as to lessen the possibility of altering epitopes in and around the active site(s) of HIV-1 Pol.

To this end, SEQ ID NO:3 discloses the nucleotide sequence which codes for a codon optimized pol in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as “IApol”:

AGATCTACCA TGGCCCCCAT CTCCCCCATT GAGACTGTGC CTGTGAAGCT GAAGCCTGGC (SEQ ID NO:3)
ATGGATGGCC CCAAGGTGAA GCAGTGGCCC CTGACTGAGG AGAAGATCAA GGCCCTGGTG
GAAATCTGCA CTGAGATGGA GAAGGAGGGC AAAATCTCCA AGATTGGCCC CGAGAACCCC
TACAACACCC CTGTGTTTGC CATCAAGAAG AAGGACTCCA CCAAGTGGAG GAAGCTGGTG
GACTTCAGGG AGCTGAACAA GAGGACCCAG GACTTCTGGG AGGTGCAGCT GGGCATCCCC
CACCCCGCTG GCCTGAAGAA GAAGAAGTCT GTGACTGTGC TGGCTGTGGG GGATGCCTAC
TTCTCTGTGC CCCTGGATGA GGACTTCAGG AAGTACACTG CCTTCACCAT CCCCTCCATC
AACAATGAGA CCCCTGGCAT CAGGTACCAG TACAATGTGC TGCCCCAGGG CTGGAAGGGC
TCCCCTGCCA TCTTCCAGTC CTCCATGACC AAGATCCTGG AGCCCTTCAG GAAGCAGAAC
CCTGACATTG TGATCTACCA GTACATGGCT GCCCTGTATG TGGGCTCTGA CCTGGAGATT
GGGCAGCACA GGACCAAGAT TGAGGAGCTG AGGCAGCACC TGCTGAGGTG GGGCCTGACC
ACCCCTGACA AGAAGCACCA GAAGGAGCCC CCCTTCCTGT GGATGGGCTA TGAGCTGCAC
CCCGACAAGT GGACTGTGCA GCCCATTGTG CTGCCTGAGA AGGACTCCTG GACTGTGAAT
GACATCCAGA AGCTGGTGGG CAAGCTGAAC TGGGCCTCCC AAATCTACCC TGGCATCAAG
GTGAGGCAGC TGTGCAAGCT GCTGAGGGGC ACCAAGGCCC TGACTGAGGT GATCCCCCTG
ACTGAGGAGG CTGAGCTGGA GCTGGCTGAG AACAGGGAGA TCCTGAAGGA GCCTGTGCAT
GGGGTGTACT ATGACCCCTC CAAGGACCTG ATTGCTGAGA TCCAGAAGCA GGGCCAGGGC
CAGTGGACCT ACCAAATCTA CCAGGAGCCC TTCAAGAACC TGAAGACTGG CAAGTATGCC
AGGATGAGGG GGGCCCACAC CAATGATGTG AAGCAGCTGA CTGAGGCTGT GCAGAAGATC
ACCACTGAGT CCATTGTGAT CTGGGGCAAG ACCCCCAAGT TCAAGCTGCC CATCCAGAAG
GAGACCTGGG AGACCTGGTG GACTGAGTAC TGGCAGGCCA CCTGGATCCC TGAGTGGGAG
TTTGTGAACA CCCCCCCCCT GGTGAAGCTG TGGTACCAGC TGGAGAAGGA GCCCATTGTG
GGGGCTGAGA CCTTCTATGT GGCTGGGGCT GCCAACAGGG AGACCAAGCT GGGCAAGGCT
GGCTATGTGA CCAACAGGGG CAGGCAGAAG GTGGTGACCC TGACTGACAC CACCAACCAG
AAGACTGCCC TCCAGGCCAT CTACCTGGCC CTCCAGGACT CTGGCCTGGA GGTGAACATT
GTGACTGCCT CCCAGTATGC CCTGGGCATC ATCCAGGCCC AGCCTGATCA GTCTGAGTCT
GAGCTGGTGA ACCAGATCAT TGAGCAGCTG ATCAAGAAGG AGAAGGTGTA CCTGGCCTGG
GTGCCTGCCC ACAAGGGCAT TGGGGGCAAT GAGCAGGTGG ACAAGCTGGT GTCTGCTGGC
ATCAGGAAGG TGCTGTTCCT GGATGGCATT GACAAGGCCC AGGATGAGCA TGAGAAGTAC
CACTCCAACT GGAGGGCTAT GGCCTCTGAC TTCAACCTGC CCCCTGTGGT GGCTAAGGAG
ATTGTGGCCT CCTGTGACAA GTGCCAGCTG AAGGGGGAGG CCATGCATGG GCAGGTGGAC
TGCTCCCCTG GCATCTGGCA GCTGGCCTGC ACCCACCTGG AGGGCAAGGT GATCCTGGTG
GCTGTGCATG TGGCCTCCGG CTACATTGAG GCTGAGGTGA TCCCTGCTGA GACAGGCCAG
GAGACTGCCT ACTTCCTGCT GAAGCTGGCT GGCAGGTGGC CTGTGAAGAC CATCCACACT
GCCAATGGCT CCAACTTCAC TGGGGCCACA GTGAGGGCTG CCTGCTGGTG GGCTGGCATC
AAGCAGGAGT TTGGCATCCC CTACAACCCC CAGTCCCAGG GGGTGGTGGC CTCCATGAAC
AAGGAGCTGA AGAAGATCAT TGGGCAGGTG AGGGACCAGG CTGAGCACCT GAAGACAGCT
GTGCAGATGG CTGTGTTCAT CCACAACTTC AAGAGGAAGG GGGGCATCGG GGGCTACTCC
GCTGGGGAGA GGATTGTGGA CATCATTGCC ACAGACATCC AGACCAAGGA GCTCCAGAAG
CAGATCACCA AGATCCAGAA CTTCAGGGTG TACTACAGGG ACTCCAGGAA CCCCCTGTGG
AAGGGCCCTG CCAAGCTGCT GTGGAAGGGG GAGGGGGCTG TGGTGATCCA GGACAACTCT
GACATCAAGG TGGTGCCCAG GAGGAAGGCC AAGATCATCA GGGACTATGG CAAGCAGATG
GCTGGGGATG ACTGTGTGGC CTCCAGGCAG GATGAGGACT AAAGCCCGGG CAGATCT.

In order to produce the IA-pol-based adenoviral vaccines of the present invention, inactivation of the enzymatic functions was achieved by replacing a total of nine active site residues from the enzyme subunits with alanine side-chains. As shown in Table 1, all residues that comprise the catalytic triad of the polymerase, namely Asp112, Asp187, and Asp188, were substituted with alanine (Ala) residues (Larder, et al., Nature 1987, 327: 716-717; Larder, et al., 1989 , Proc. Natl. Acad. Sci. 1989, 86: 4803-4807). Three additional mutations were introduced at Asp445, Glu480 and Asp500 to abolish RNase H activity (Asp551 was left unchanged in this IA Pol construct), with each residue being substituted for an Ala residue, respectively (Davies, et al., 1991, Science 252:, 88-95; Schatz, et al., 1989 , FEBS Lett. 257: 311-314; Mizrahi, et al., 1990, Nucl. Acids. Res. 18: pp. 5359-5353). HIV pol integrase function was abolished through three mutations at Asp626, Asp678 and Glu714. Again, each of these residues has been substituted with an Ala residue (Wiskerchen, et al., 1995, J. Virol. 69: 376-386; Leavitt, et al., 1993, J. Biol. Chem. 268: 2113-2119). Amino acid residue Pro3 of SEQ ID NO:4 marks the start of the RT gene. The complete amino acid sequence of IA-Pol is disclosed herein as SEQ ID NO:4 and FIGS. 17A-C , as follows:

Met Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro (SEQ ID NO:4)
Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys
Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Gly Gly Lys
Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala
Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg
Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile
Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Ala
Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys
Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile
Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys Gly Ser Pro Ala
Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln
Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Ala Ala Leu Tyr Val Gly
Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg
Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln
Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys
Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val
Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile
Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr
Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu
Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr
Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln Lys Gln Gly Gln
Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys
Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys
Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile
Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp
Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp
Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu
Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala
Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly
Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr Ala
Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn
Ile Val Thr Ala Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro
Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile
Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile
Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys
Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys
Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro
Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys
Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln
Leu Ala Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His
Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly
Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val
Lys Thr Ile His Thr Ala Asn Gly Ser Asn Phe Thr Gly Ala Thr Val
Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro
Tyr Asn Pro Gln Ser Gln Gly Val Val Ala Ser Met Asn Lys Glu Leu
Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr
Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly
Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr
Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn
Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro
Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn
Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp
Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp
Glu Asp.

As noted above, it will be understood that any combination of the mutations disclosed above may be suitable and therefore be utilized as an IA-pol-based adenoviral HIV vaccine of the present invention, either when administered alone or in a combined modality regime and/or a prime-boost regimen. For example, it may be possible to mutate only 2 of the 3 residues within the respective reverse transcriptase, RNase H, and integrase coding regions while still abolishing these enzymatic activities. However, the IA-pol construct described above and disclosed as SEQ ID NO:3, as well as the expressed protein (SEQ ID NO:4;) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.

Another aspect of this portion of the invention are codon optimized HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides. Any functional leader peptide may be tested for efficacy. However, a preferred embodiment of the present invention, as with HIV-1 Nef constructs shown herein, is to provide for a HIV-1 Pol mutant adenoviral vaccine construction wherein the pol coding region or a portion thereof is operatively linked to a leader peptide, preferably a leader peptide from human tPA. In other words, a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. As noted in FIGS. 16A-B , a DNA vector which may be utilized to practice the present invention may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Pol protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Pol protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Pol protein of interest, including but not limited to a HIV-1 Pol protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO:17). Therefore, another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA. To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5′ end of the coding region. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame disclosed herein as SEQ ID NO:6.

To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5′ end of the coding region (herein, “tPA-wt-pol”). A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635. SEQ ID NO:5 is as follows:

GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT (SEQ ID NO:5)
CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA
GCTGAAGCCT GGCATGGATC GCCCCAAGGT GAAGCAGTGG CCCCTGACTG AGGAGAAGAT
CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG
CCCCGAGAAC CCCTACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG
GAGGAAGCTG GTGGACTTCA GGGAGCTGAA CAAGAGGACC CAGGACTTCT GGGAGGTGCA
GCTGGGCATC CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGTGACTG TGCTGGATGT
GGGGGATGCC TACTTCTCTG TGCCCCTGGA TGAGGACTTC AGGAAGTACA CTGCCTTCAC
CATCCCCTCC ATCAACAATG AGACCCCTGG CATCAGGTAC CAGTACAATG TGCTGCCCCA
GGGCTGGAAG GGCTCCCCTG CCATCTTCCA GTCCTCCATG ACCAAGATCC TGGAGCCCTT
CAGGAAGCAG AACCCTGACA TTGTGATCTA CCAGTACATG GATGACCTGT ATGTGGGCTC
TGACCTGGAG ATTGGGCAGC ACAGGACCAA GATTGAGGAG CTGAGGCAGC ACCTGCTGAG
GTGGGGCCTG ACCACCCCTG ACAAGAAGCA CCAGAAGGAG CCCCCCTTCC TGTGGATGGG
CTATGAGCTG CACCCCGACA AGTGGACTGT GCAGCCCATT GTGCTGCCTG AGAAGGACTC
CTGGACTGTG AATGACATCC AGAAGCTGGT GGGCAAGCTG AACTGGGCCT CCCAAATCTA
CCCTGGCATC AAGGTGAGGC AGCTGTGCAA GCTGCTGAGG GGCACCAAGG CCCTGACTGA
GGTGATCCCC CTGACTGAGG AGGCTGAGCT GGAGCTGGCT GAGAACAGGG AGATCCTGAA
GGAGCCTGTG CATGGGGTGT ACTATGACCC CTCCAAGGAC CTGATTGCTG AGATCCAGAA
GCAGGGCCAG GGCCAGTGGA CCTACCAAAT CTACCAGGAG CCCTTCAAGA ACCTGAAGAC
TGGCAAGTAT GCCAGGATGA GGGGGGCCCA CACCAATGAT GTGAAGCAGC TGACTGAGGC
TGTGCAGAAG ATCACCACTG AGTCCATTGT GATCTGGGGC AAGACCCCCA AGTTCAAGCT
GCCCATCCAG AAGGAGACCT GGGAGACCTG GTGGACTGAG TACTGGCAGG CCACCTGGAT
CCCTGAGTGG GAGTTTGTGA ACACCCCCCC CCTGGTGAAG CTGTGGTACC AGCTGGAGAA
GGAGCCCATT GTGGGGGCTG AGACCTTCTA TGTGGATGGG GCTGCCAACA GGGAGACCAA
GCTGGGCAAG GCTGGCTATG TGACCAACAG GGGCAGGCAG AAGGTGGTGA CCCTGACTGA
CACCACCAAC CAGAAGACTG AGCTCCAGGC CATCTACCTG GCCCTCCAGG ACTCTGGCCT
GGAGGTGAAC ATTGTGACTG ACTCCCAGTA TGCCCTGGGC ATCATCCAGG CCCAGCCTGA
TCAGTCTGAG TCTGAGCTGG TGAACCAGAT CATTGAGCAG CTGATCAAGA AGGAGAAGGT
GTACCTGGCC TGGGTGCCTG CCCACAAGGG CATTGGGGGC AATGAGCAGG TGGACAAGCT
GGTGTCTGCT GGCATCAGGA AGGTGCTGTT CCTGGATGGC ATTGACAAGG CCCAGGATGA
GCATGAGAAG TACCACTCCA ACTGGAGGGC TATGGCCTCT GACTTCAACC TGCCCCCTGT
GGTGGCTAAG GAGATTGTGG CCTCCTGTGA CAAGTGCCAG CTGAAGGGGG AGGCCATGCA
TGGGCAGGTG GACTGCTCCC CTGGCATCTG GCAGCTGGAC TGCACCCACC TGGAGGGCAA
GGTGATCCTG GTGGCTGTGC ATGTGGCCTC CGGCTACATT GAGGCTGAGG TGATCCCTGC
TGAGACAGGC CAGGAGACTG CCTACTTCCT GCTGAAGCTG GCTGGCAGGT GGCCTGTGAA
GACCATCCAC ACTGACAATG GCTCCAACTT CACTGGGGCC ACAGTGAGGG CTGCCTGCTG
GTGGGCTGGC ATCAAGCAGG AGTTTGGCAT CCCCTACAAC CCCCAGTCCC AGGGGGTGGT
GGAGTCCATG AACAAGGAGC TGAAGAAGAT CATTGGGCAG GTGAGGGACC AGGCTGAGCA
CCTGAAGACA GCTGTGCAGA TGGCTGTGTT CATCCACAAC TTCAAGAGGA AGGGGGGCAT
CGGGGGCTAC TCCGCTGGGG AGAGGATTGT GGACATCATT GCCACAGACA TCCAGACCAA
GGAGCTCCAG AAGCAGATCA CCAAGATCCA GAACTTCAGG GTGTACTACA GGGACTCCAG
GAACCCCCTG TGGAAGGGCC CTGCCAAGCT GCTGTGGAAG GGGGAGGGGG CTGTGGTGAT
CCAGGACAAC TCTGACATCA AGGTGGTGCC CAGGAGGAAG GCCAAGATCA TCAGGGACTA
TGGCAAGCAG ATGGCTGGGG ATGACTGTGT GGCCTCCAGG CAGGATGAGG ACTAAAGCCC
GGGCAGATCT.

The open reading frame of the wild type tPA-pol construct disclosed as SEQ ID NO:5 contains 875 amino acids, disclosed herein as SEQ ID NO:6, as follows:

Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly (SEQ ID NO:6)
Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ala Pro Ile Ser Pro Ile
Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val
Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile
Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu
Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr
Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln
Asp Phe Trp Glu Val Gln Leu Gly Ile Pro His Pro Ala Gly Leu Lys
Lys Lys Lys Ser Val Thr Val Leu Asp Val Gly Asp Ala Tyr Phe Ser
Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro
Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu
Pro Gln Gly Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr
Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr
Gln Tyr Met Asp Asp Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln
His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly
Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp
Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val
Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val
Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg
Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile
Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala 0Th Asn Arg Glu Ile
Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu
Ile Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile
Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met
Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln
Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe
Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr
Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro
Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala
Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly
Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu
Thr Asp Thr Thr Asn Gln Lys Thr Glu Leu Gln Ala Ile Tyr Leu Ala
Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Asp Ser Gln Tyr
Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu
Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu
Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp
Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile
Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala
Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val
Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln
Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Asp Cys Thr His Leu Glu
Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu
Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu
Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Asp Asn
Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala
Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly
Val Val Glu Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val
Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe
Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly
Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu
Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp
Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly
Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro
Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly
Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp.

The present invention also relates to a codon optimized HIV-1 Pol mutant contained within a recombinant adenoviral vector such as IA-Pol (SEQ ID NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. Any such adenoviral-based HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide including but not limited to the human tPA leader sequence. Therefore, any such leader peptide-based HIV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a leader peptide/HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ ID NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in FIG. 18 . The complete amino acid sequence of the expressed protein is set forth in SEQ ID NO:8. To this end, SEQ ID NO:7 discloses the nucleotide sequence which codes for a human tPA leader fused to the IA Pol protein comprising the nine mutations shown in Table 1 (herein, “tPA-opt-IApol”). The open reading frame begins with the initiating Met (nucleotides 8-10) and terminates with a “TAA” codon at nucleotides 2633-2635. The nucleotide sequence encoding tPA-IAPol is also disclosed as follows:

GATCACCATG GATGCAATGA AGAGAGGGCT CTGCTGTGTG CTGCTGCTGT GTGGAGCAGT (SEQ ID NO:7)
CTTCGTTTCG CCCAGCGAGA TCTCCGCCCC CATCTCCCCC ATTGAGACTG TGCCTGTGAA
GCTGAAGCCT GGCATGGATG GCCCCAAGGT GAAGCAGTGG CCCCTGACTG AGGAGAAGAT
CAAGGCCCTG GTGGAAATCT GCACTGAGAT GGAGAAGGAG GGCAAAATCT CCAAGATTGG
CCCCGAGAAC CCCTACAACA CCCCTGTGTT TGCCATCAAG AAGAAGGACT CCACCAAGTG
GAGGAAGCTG GTGGACTTCA GGGAGCTGAA CAAGAGGACC CAGGACTTCT GGGAGGTGCA
GCTGGGCATC CCCCACCCCG CTGGCCTGAA GAAGAAGAAG TCTGTGACTG TGCTGGCTGT
GGGGGATGCC TACTTCTCTG TGCCCCTGGA TGAGGACTTC AGGAAGTACA CTGCCTTCAC
CATCCCCTCC ATCAACAATG AGACCCCTGG CATCAGGTAC CAGTACAATG TGCTGCCCCA
GGGCTGGAAG GGCTCCCCTG CCATCTTCCA GTCCTCCATG ACCAAGATCC TGGAGCCCTT
CAGGAAGCAG AACCCTGACA TTGTGATCTA CCAGTACATG GCTGCCCTGT ATGTGGGCTC
TGACCTGGAG ATTGGGCAGC ACAGGACCAA GATTGAGGAG CTGAGGCAGC ACCTGCTGAG
GTGGGGCCTG ACCACCCCTG ACAAGAAGCA CCAGAAGGAG CCCCCCTTCC TGTGGATGGG
CTATGAGCTG CACCCCGACA AGTGGACTGT GCAGCCCATT GTGCTGCCTG AGAAGGACTC
CTGGACTGTG AATGACATCC AGAAGCTGGT GGGCAAGCTG AACTGGGCCT CCCAAATCTA
CCCTGGCATC AAGGTGAGGC AGCTGTGCAA GCTGCTGAGG GGCACCAAGG CCCTGACTGA
GGTGATCCCC CTGACTGAGG AGGCTGAGCT GGAGCTGGCT GAGAACAGGG AGATCCTGAA
GGAGCCTGTG CATGGGGTGT ACTATGACCC CTCCAAGGAC CTGATTGCTG AGATCCAGAA
GCAGGGCCAG GGCCAGTGGA CCTACCAAAT CTACCAGGAG CCCTTCAAGA ACCTGAAGAC
TGGCAAGTAT GCCAGGATGA GGGGGGCCCA CACCAATGAT GTGAAGCAGC TGACTGAGGC
TGTGCAGAAG ATCACCACTG AGTCCATTGT GATCTGGGGC AAGACCCCCA AGTTCAAGCT
GCCCATCCAG AAGGAGACCT GGGAGACCTG GTGGACTGAG TACTGGCAGG CCACCTGGAT
CCCTGAGTGG GAGTTTGTGA ACACCCCCCC CCTGGTGAAG CTGTGGTACC AGCTGGAGAA
GGAGCCCATT GTGGGGGCTG AGACCTTCTA TGTGGCTGGG GCTGCCAACA GGGAGACCAA
GCTGGGCAAG GCTGGCTATG TGACCAACAG GGGCAGGCAG AAGGTGGTGA CCCTGACTGA
CACCACCAAC CAGAAGACTG CCCTCCAGGC CATCTACCTG GCCCTCCAGG ACTCTGGCCT
GGAGGTGAAC ATTGTGACTG CCTCCCAGTA TGCCCTGGGC ATCATCCAGG CCCAGCCTGA
TCAGTCTGAG TCTGAGCTGG TGAACCAGAT CATTGAGCAG CTGATCAAGA AGGAGAAGGT
GTACCTGGCC TGGGTGCCTG CCCACAAGGG CATTGGGGGC AATGAGCAGG TGGACAAGCT
GGTGTCTGCT GGCATCAGGA AGGTGCTGTT CCTGGATGGC ATTGACAAGG CCCAGGATGA
GCATGAGAAG TACCACTCCA ACTGGAGGGC TATGGCCTCT GACTTCAACC TGCCCCCTGT
GGTGGCTAAG GAGATTGTGG CCTCCTGTGA CAAGTGCCAG CTGAAGGGGG AGGCCATGCA
TGGGCAGGTG GACTGCTCCC CTGGCATCTG GCAGCTGGCC TGCACCCACC TGGAGGGCAA
GGTGATCCTG GTGGCTGTGC ATGTGGCCTC CGGCTACATT GAGGCTGAGG TGATCCCTGC
TGAGACAGGC CAGGAGACTG CCTACTTCCT GCTGAAGCTG GCTGGCAGGT GGCCTGTGAA
GACCATCCAC ACTGCCAATG GCTCCAACTT CACTGGGGCC ACAGTGAGGG CTGCCTGCTG
GTGGGCTGGC ATCAAGCAGG AGTTTGGCAT CCCCTACAAC CCCCAGTCCC AGGGGGTGGT
GGCCTCCATG AACAAGGAGC TGAAGAAGAT CATTGGGCAG GTGAGGGACC AGGCTGAGCA
CCTGAAGACA GCTGTGCAGA TGGCTGTGTT CATCCACAAC TTCAAGAGGA AGGGGGGCAT
CGGGGGCTAC TCCGCTGGGG AGAGGATTGT GGACATCATT GCCACAGACA TCCAGACCAA
GGAGCTCCAG AAGCAGATCA CCAAGATCCA GAACTTCAGG GTGTACTACA GGGACTCCAG
GAACCCCCTG TGGAAGGGCC CTGCCAAGCT GCTGTGGAAG GGGGAGGGGG CTGTGGTGAT
CCAGGACAAC TCTGACATCA AGGTGGTGCC CAGGAGGAAG GCCAAGATCA TCAGGGACTA
TGGCAAGCAG ATGGCTGGGG ATGACTGTGT GGCCTCCAGG CAGGATGAGG ACTAAAGCCC
GGGCAGATCT.

The open reading frame of the tPA-IA-pol construct disclosed as SEQ ID NO:7 contains 875 amino acids, disclosed herein as tPA-IA-Pol and SEQ ID NO:8, as follows:

Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly (SEQ ID NO:8)
Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ala Pro Ile Ser Pro Ile
Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val
Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile
Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu
Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr
Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln
Asp Phe Trp Glu Val Gln Leu Gly Ile Pro His Pro Ala Gly Leu Lys
Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser
Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro
Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu
Pro Gln Gly Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr
Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr
Gln Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu GTh Ile Gly Gln
His Arg Thr Lys Ile Ghl Glu Leu Arg Gln His Leu Leu Arg Trp Gly
Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp
Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val
Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val
Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg
Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile
Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile
Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu
Ile Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile
Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met
Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln
Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe
Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr
Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro
Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala
Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly
Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu
Thr Asp Thr Thr Asn Gln Lys Thr Ala Leu Gln Ala Ile Tyr Leu Ala
Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Ala Ser Gln Tyr
Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu
Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu
Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp
Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile
Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala
Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val
Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln
Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Ala Cys Thr His Leu Glu
Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu
Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu
Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Ala Asn
Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala
Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly
Val Val Ala Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val
Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe
Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly
Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu
Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp
Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly
Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro
Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly
Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp.

EXAMPLE 18

Codon Optimized HIV-1 Nef and Codon Optimzed HIV-1 Nef Modifications

Codon optimized version of HIV-1 Nef and HIV-1 Nef modifications are essentially as described in U.S. application Ser. No. 09/738,782, filed Dec. 15, 2000 and PCT International Application PCT/US00/34162, also filed Dec. 15, 2000, both documents which are hereby incorporated by reference. As disclosed within the above-mentioned documents, particular embodiments of codon optimized Nef and Nef modifications relate to a DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:9, while the expressed open reading frame is disclosed herein as SEQ ID NO:10. Another embodiment of Nef-based coding regions for use in the adenoviral vectors of the present invention comprise a codon optimized DNA molecule encoding a protein containing the human plasminogen activator (tpa) leader peptide fused with the NH 2 -terminus of the HIV-1 Nef polypeptide. The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:11, while the expressed open reading frame is disclosed herein as SEQ ID NO:12. Another modified Nef optimized coding region relates to a DNA molecule encoding optimized HIV-1 Nef wherein the open reading frame codes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175, herein described as opt nef (G2A, LLAA). The DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:13, while the expressed open reading frame is disclosed herein as SEQ ID NO:14. An additional embodiment relates to a DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA), comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175, herein referred to as opt tpanef (LLAA) is disclosed herein as SEQ ID NO:15, while the expressed open reading frame is disclosed herein as SEQ ID NO:16.

As disclosed in the above-identified documents (U.S. application Ser. No. 09/738,782 and PCT International Application PCT/US00/34162) and reiterated herein, the following nef-based nucleotide and amino acid sequences which comprise the respective open reading frame are as follows:

1. The nucleotide sequence of the codon optimized version of HIV-1 jrfl nef gene is disclosed herein as SEQ ID NO:9, as shown herein:

GATCTGCCAC CATGGGCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA (SEQ ID NO:9)
GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG
CCGTGGGCGT GGGCGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA
ACACCGCCGC CACCAACGCC GACTGCGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG
GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC
TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC
AGGACATCCT GGACCTGTGG GTGTACCACA CCCAGGGCTA CTTCCCCGAC TGGCAGAACT
ACACCCCCGG CCCCGGCATC AGGTTCCCCC TGACCTTCGG CTGGTGCTTC AAGCTGGTGC
CCGTGGAGCC CGAGAAGGTG GAGGAGGCCA ACGAGGGCGA GAACAACTGC CTGCTGCACC
CCATGTCCCA GCACGGCATC GAGGACCCCG AGAAGGAGGT GCTGGAGTGG AGGTTCGACT
CCAAGCTGGC CTTCCACCAC GTGGCCAGGG AGCTGCACCC CGAGTACTAC AAGGACTGCT
AAAGCCCGGG C.

Preferred codon usage is as follows: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gln (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which is hereby incorporated by reference. See also FIGS. 19A-B for a comparion of wild type vs. codon optimized nucleotides comprising the open reading frame of HIV-Nef.

The open reading frame for SEQ ID NO:9 above comprises an initiating methionine residue at nucleotides 12-14 and a “TAA” stop codon from nucleotides 660-662. The open reading frame of SEQ ID NO:9 provides for a 216 amino acid HIV-1 Nef protein expressed through utilization of a codon optimized DNA vaccine vector. The 216 amino acid HIV-1 Nef (jfrl) protein is disclosed herein as SEQ ID NO:10, and as follows:

Met Gly Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val (SEQ ID NO:10)
Arg Clu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg
Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu
Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp
Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val
Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp
Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His
Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln
Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg
Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro
Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His
Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu
Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu
His Pro Glu Tyr Tyr Lys Asp Cys.

HIV-1 Nef is a 216 amino acid cytosolic protein which associates with the inner surface of the host cell plasma membrane through myristylation of Gly-2 (Franchini et al., 1986 , Virology 155: 593-599). While not all possible Nef functions have been elucidated, it has become clear that correct trafficking of Nef to the inner plasma membrane promotes viral replication by altering the host intracellular environment to facilitate the early phase of the HIV-1 life cycle and by increasing the infectivity of progeny viral particles. In one aspect of the invention regarding codon-optimized, protein-modified polypeptides, the nef-encoding region of the adenovirus vector of the present invention is modified to contain a nucleotide sequence which encodes a heterologous leader peptide such that the amino terminal region of the expressed protein will contain the leader peptide. The diversity of function that typifies eukaryotic cells depends upon the structural differentiation of their membrane boundaries. To generate and maintain these structures, proteins must be transported from their site of synthesis in the endoplasmic reticulum to predetermined destinations throughout the cell. This requires that the trafficking proteins display sorting signals that are recognized by the molecular machinery responsible for route selection located at the access points to the main trafficking pathways. Sorting decisions for most proteins need to be made only once as they traverse their biosynthetic pathways since their final destination, the cellular location at which they perform their function, becomes their permanent residence. Maintenance of intracellular integrity depends in part on the selective sorting and accurate transport of proteins to their correct destinations. Defined sequence motifs exist in proteins which can act as ‘address labels’. A number of sorting signals have been found associated with the cytoplasmic domains of membrane proteins. An effective induction of CTL responses often required sustained, high level endogenous expression of an antigen. As membrane-association via myristylation is an essential requirement for most of Nef's function, mutants lacking myristylation, by glycine-to-alanine change, change of the dileucine motif and/or by substitution with a tpa leader sequence as described herein, will be functionally defective, and therefore will have improved safety profile compared to wild-type Nef for use as an HIV-1 vaccine component.

In another embodiment of this portion of the invention, either the DNA vector or the HIV-1 nef nucleotide sequence is modified to include the human tissue-specific plasminogen activator (tPA) leader. As shown in FIGS. 16A-B , a DNA vector may be modified by known recombinant DNA methodology to contain a leader signal peptide of interest, such that downstream cloning of the modified HIV-1 protein of interest results in a nucleotide sequence which encodes a modified HIV-1 tPA/Nef protein. In the alternative, as noted above, insertion of a nucleotide sequence which encodes a leader peptide may be inserted into a DNA vector housing the open reading frame for the Nef protein of interest. Regardless of the cloning strategy, the end result is a polynucleotide vaccine which comprises vector components for effective gene expression in conjunction with nucleotide sequences which encode a modified HIV-1 Nef protein of interest, including but not limited to a HIV-1 Nef protein which contains a leader peptide. The amino acid sequence of the human tPA leader utilized herein is as follows: MDAMKRGLCCVLLLCGAVFVSPSEISS (SEQ ID NO:17).

It has been shown that myristylation of Gly-2 in conjunction with a dileucine motif in the carboxy region of the protein is essential for Nef-induced down regulation of CD4 (Aiken et al., 1994 , Cell 76: 853-864) via endocytosis. It has also been shown that Nef expression promotes down regulation of MHCI (Schwartz et al., 1996 , Nature Medicine 2(3): 338-342) via endocytosis. The present invention relates in part to DNA vaccines which encode modified Nef proteins altered in trafficking and/or functional properties. The modifications introduced into the adenoviral vector HIV vaccines of the present invention include but are not limited to additions, deletions or substitutions to the nef open reading frame which results in the expression of a modified Nef protein which includes an amino terminal leader peptide, modification or deletion of the amino terminal myristylation site, and modification or deletion of the dileucine motif within the Nef protein and which alter function within the infected host cell. Therefore, a central theme of the DNA molecules and recombinant adenoviral HIV vaccines of the present invention is (1) host administration and intracellular delivery of a codon optimized nef-based adenoviral HIV vaccine; (2) expression of a modified Nef protein which is immunogenic in terms of eliciting both CTL and Th responses; and, (3) inhibiting or at least altering known early viral functions of Nef which have been shown to promote HIV-1 replication and load within an infected host. Therefore, the nef coding region may be altered, resulting in a DNA vaccine which expresses a modified Nef protein wherein the amino terminal Gly-2 myristylation residue is either deleted or modified to express alternate amino acid residues. Also, the nef coding region may be altered so as to result in a DNA vaccine which expresses a modified Nef protein wherein the dileucine motif is either deleted or modified to express alternate amino acid residues. In addition, the adenoviral vector HIV vaccines of the present invention also relate to an isolated DNA molecule, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion or substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence.

Therefore, specific Nef-based constructs further include the following, as exemplification's and not limitations. For example, the present invention relates to an adenoviral vector vaccine which encodes modified forms of HIV-1, an open reading frame which encodes a Nef protein which comprises a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl) is referred to herein as opt tpanef. The nucleotide sequence comprising the open reading frame of opt tpanef is disclosed herein as SEQ ID NO:11, as shown below:

CATGGATGCA ATGAAGAGAG GGCTCTGCTG TGTGCTGCTG CTGTCTGGAG CAGTCTTCGT (SEQ ID NO:11)
TTCGCCCAGC GAGATCTCCT CCAAGAGGTC CGTGCCCGGC TGGTCCACCG TGAGGGAGAG
GATGAGGAGG GCCGAGCCCG CCGCCGACAG GGTGAGGAGG ACCGAGCCCG CCGCCGTGGG
CGTGGGCGCC GTGTCCAGGG ACCTGGAGAA GCACGGCGCC ATCACCTCCT CCAACACCGC
CGCCACCAAC GCCGACTGCG CCTGGCTGGA GGCCCAGGAG GACGAGGAGG TGGGCTTCCC
CGTGAGGCCC CAGGTGCCCC TGAGGCCCAT GACCTACAAG GGCGCCGTGG ACCTGTCCCA
CTTCCTGAAG GAGAAGGGCG GCCTGGAGGG CCTGATCCAC TCCCAGAAGA GGCAGGACAT
CCTGGACCTG TGGGTGTACC ACACCCAGGG CTACTTCCCC GACTGGCAGA ACTACACCCC
CGGCCCCGGC ATCAGGTTCC CCCTGACCTT CGGCTGGTGC TTCAAGCTGG TGCCCGTGGA
GCCCGAGAAG GTGGAGGAGG CCAACGAGGG CGAGAACAAC TGCCTGCTGC ACCCCATGTC
CCAGCACGGC ATCGAGGACC CCGAGAAGGA GGTGCTGGAG TGGAGGTTCG ACTCCAAGCT
GGCCTTCCAC CACGTGGCCA GGGAGCTGCA CCCCGAGTAC TACAAGGACT GCTAAAGCC

The open reading frame of SEQ ID NO:11 provides for a 237 amino acid HIV-1 Nef protein which comprises a tPA leader sequence fused to amino acids 6-216 of HIV-1 Nef, including the dileucine motif at amino acid residues 174 and 175. This 237 amino acid tPA/Nef (jfrl) fusion protein is disclosed herein as SEQ ID NO:12, and is shown as follows:

Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly (SEQ ID NO:12)
Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ser Lys Arg Ser Val Pro
Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala
Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val
Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala
Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu
Val Gly Phe Pro Val Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr
Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu
Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp
Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro
Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu
Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn
Asn Cys Leu Leu His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu
Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His
Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys.

Therefore, this exemplified Nef protein, Opt tPA-Nef, contains both a tPA leader sequence as well as deleting the myristylation site of Gly-2A DNA molecule encoding HIV-1 Nef from the HIV-1 jfrl isolate wherein the codons are optimized for expression in a mammalian system such as a human.

In another specific embodiment of the present invention, a DNA molecule is disclosed which encodes optimized HIV-1 Nef wherein the open reading frame of a recombinant adenoviral HIV vaccine encodes for modifications at the amino terminal myristylation site (Gly-2 to Ala-2) and substitution of the Leu-174-Leu-175 dileucine motif to Ala-174-Ala-175. This open reading frame is herein described as opt nef (G2A,LLAA) and is disclosed as SEQ ID NO:13, which comprises an initiating methionine residue at nucleotides 12-14 and a “TAA” stop codon from nucleotides 660-662. The nucleotide sequence of this codon optimized version of HIV-1 jrfl nef gene with the above mentioned modifications is disclosed herein as SEQ ID NO:13, as follows:

GATCTGCCAC CATGGCCGGC AAGTGGTCCA AGAGGTCCGT GCCCGGCTGG TCCACCGTGA (SEQ ID NO:13)
GGGAGAGGAT GAGGAGGGCC GAGCCCGCCG CCGACAGGGT GAGGAGGACC GAGCCCGCCG
CCGTGGGCGT GGGCGCCGTG TCCAGGGACC TGGAGAAGCA CGGCGCCATC ACCTCCTCCA
ACACCGCCGC CACCAACGCC GACTGCGCCT GGCTGGAGGC CCAGGAGGAC GAGGAGGTGG
GCTTCCCCGT GAGGCCCCAG GTGCCCCTGA GGCCCATGAC CTACAAGGGC GCCGTGGACC
TGTCCCACTT CCTGAAGGAG AAGGGCGGCC TGGAGGGCCT GATCCACTCC CAGAAGAGGC
AGGACATCCT GGACCTGTGG GTGTACCACA CCCAGGGCTA CTTCCCCGAC TGGCAGAACT
ACACCCCCGG CCCCGGCATC AGGTTCCCCC TGACCTTCGG CTGGTGCTTC AAGCTGGTGC
CCGTGGAGCC CGAGAAGGTG GAGGAGGCCA ACGAGGGCGA GAACAACTGC GCCGCCCACC
CCATGTCCCA GCACGGCATC GAGGACCCCG AGAAGGAGGT GCTGGAGTGG AGGTTCGACT
CCAAGCTGGC CTTCCACCAC GTGGCCAGGG AGCTGCACCC CGAGTACTAC AAGGACTGCT
AAAGCCCGGG C.

The open reading frame of SEQ ID NO:13 encodes Nef (G2A,LLAA), disclosed herein as SEQ ID NO:14, as follows:

Met Ala Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val (SEQ ID NO:14).
Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg
Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu
Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp
Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val
Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp
Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His
Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln
Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg
Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro
Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Ala Ala His
Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu
Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu
His Pro Glu Tyr Tyr Lys Asp Cys Ser

An additional embodiment of the present invention relates to another DNA molecule encoding optimized HIV-1 Nef wherein the amino terminal myristylation site and dileucine motif have been deleted, as well as comprising a tPA leader peptide. This DNA molecule, opt tpanef (LLAA) comprises an open reading frame which encodes a Nef protein containing a tPA leader sequence fused to amino acid residue 6-216 of HIV-1 Nef (jfrl), wherein Leu-174 and Leu-175 are substituted with Ala-174 and Ala-175 (Ala-195 and Ala-196 in this tPA-based fusion protein). The nucleotide sequence comprising the open reading frame of opt tpanef (LLAA) is disclosed herein as SEQ ID NO:15, as shown below:

CATGGATGCA ATGAAGAGAG GGCTCTGCTG TGTGCTGCTG CTGTGTGGAG CAGTCTTCGT (SEQ ID NO:15)
TTCGCCCAGC GAGATCTCCT CCAAGAGGTC CGTGCCCGGC TGGTCCACCG TGAGGGAGAG
GATGAGGAGG GCCGAGCCCG CCGCCGACAG GGTGAGGAGG ACCGAGCCCG CCGCCGTGGG
CGTGGGCGCC GTGTCCAGGG ACCTGGAGAA GCACGGCGCC ATCACCTCCT CCAACACCGC
CGCCACCAAC GCCGACTGCG CCTGGCTGGA GGCCCAGGAG GACGAGGAGG TGGGCTTCCC
CGTGAGGCCC CAGGTGCCCC TGAGGCCCAT GACCTACAAG GGCGCCGTGG ACCTGTCCCA
CTTCCTGAAG GAGAAGGGCG GCCTGGAGGG CCTGATCCAC TCCCAGAAGA GGCAGGACAT
CCTGGACCTG TGGGTGTACC ACACCCAGGG CTACTTCCCC GACTGGCAGA ACTACACCCC
CGGCCCCGGC ATCAGGTTCC CCCTGACCTT CGGCTGGTGC TTCAAGCTGG TGCCCGTGGA
GCCCGAGAAG GTGGAGGAGG CCAACGAGGG CGAGAACAAC TGCGCCGCCC ACCCCATGTC
CCAGCACGGC ATCGAGGACC CCGAGAAGGA GGTGCTGGAG TGGAGGTTCG ACTCCAAGCT
GGCCTTCCAC CACGTGGCCA GGGAGCTGCA CCCCGAGTAC TACAAGGACT GCTAAAGCCC

The open reading frame of SEQ ID NO:15 encoding tPA-Nef (LLAA), disclosed herein as SEQ ID NO:16, is as follows:

Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly (SEQ ID NO:16)
Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ser Lys Arg Ser Val Pro
Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala
Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val
Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala
Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu
Val Gly Phe Pro Val Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr
Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu
Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp
Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro
Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu
Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn
Asn Cys Ala Ala His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu
Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His
Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys.

An adenoviral vector of the present invention may comprise a DNA sequence, regardless of codon usage, which expresses a wild type or modified Nef protein as described herein, including but not limited to modified Nef proteins which comprise a deletion or substitution of Gly 2, a deletion of substitution of Leu 174 and Leu 175 and/or inclusion of a leader sequence. Therefore, partial or fully codon optimized DNA vaccine expression vector constructs are preferred since such constructs should result in increased host expression. However, it is within the scope of the present invention to utilize “non-codon optimized” versions of the constructs disclosed herein, especially modified versions of HIV Nef which are shown to promote a substantial cellular immune response subsequent to host administration.

FIGS. 20A-C show nucleotide sequences at junctions between nef coding sequence and plasmid backbone of nef expression vectors V1Jns/nef (FIG. 20 A), V1Jns/nef(G2A,LLAA) (FIG. 20 B), V1Jns/tpanef ( FIG. 20C ) and V1Jns/tpanef(LLAA) ( FIG. 20C , also). 5′ and 3′ flanking sequences of codon optimized nef or codon optimized nef mutant genes are indicated by bold/italic letters; nef and nef mutant coding sequences are indicated by plain letters. Also indicated (as underlined) are the restriction endonuclease sites involved in construction of respective nef expression vectors. V1Jns/tpanef and V1Jns/tpanef(LLAA) have identical sequences at the junctions.

FIG. 21 shows a schematic presentation of nef and nef derivatives. Amino acid residues involved in Nef derivatives are presented. Glycine 2 and Leucine174 and 175 are the sites involved in myristylation and dileucine motif, respectively.

EXAMPLE 19

MRKAd5Pol Construction and Virus Rescue

Construction of Vector: Shuttle Plasmid and Pre-Adenovirus Plasmid—Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5pol, is depicted in FIG. 22 . Briefly, the adenoviral shuttle vector for the full-length inactivated HIV-1 pol gene is as follows. The vector MRKpdelE1(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is a derivative of the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. The vector contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique BglII site will ensure the direction of transcription of the transgene will be Ad5 E1 parallel when inserted into the MRKpAd5(E1−/E3+)Cla1 (or MRKpAdHVE3) pre-plasmid. The vector, similar to the original shuttle vector contains the Pac1 site, extension to the packaging signal region, and extension to the pIX gene. The synthetic full-length codon-optimized HIV-1 pol gene was isolated directly from the plasmid pV1Jns-HIV-pol-inact(opt). Digestion of this plasmid with Bgl II releases the pol gene intact (comprising a codon optimized IA pol sequence as disclosed in SEQ ID NO:3). The pol fragment was gel purified and ligated into the MRKpdelE1(Pac/pIX/pack450)+CMVmin+BGHpA(str.) shuttle vector at the BglII site. The clones were checked for the correct orientation of the gene by using restriction enzymes DraIII/Not1. A positive clone was isolated and named MRKpdel+hCMVmin+FL-pol+bGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdel+hCMVmin+FL-pol+bGHpA(S) was digested with restriction enzymes Pac1 and Bst1107 I (or its isoschizomer, BstZ107 I) and then co-transformed into E. coli strain BJ5183 with linearized (Cla1 digested) adenoviral backbone plasmid, MRKpAd(E1−/E3+)Cla1. The resulting pre-plasmid originally named MRKpAd+hCMVmin+FL-pol+bGHpA(S)E3+ is now referred to as “pMRKAd5pol”. The genetic structure of the resulting pMRKAd5pol was verified by PCR, restriction enzyme and DNA sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the pol transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAd5HIV-1pol adenoviral vector is shown in FIGS. 26 A-AO.

Generation of Research-Grade Recombinant Adenovirus—The pre-adenovirus plasmid, pMRKAd5pol, was rescued as infectious virions in PER.C6® adherent monolayer cell culture. To rescue infectious virus, 12 μg of pMRKAd5pol was digested with restriction enzyme PacI (New England Biolabs) and 3.3 μg was transfected per 6 cm dish of PER.C6® cells using the calcium phosphate co-precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). PacI digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6®cells. Infected cells and media were harvested 6-10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at ≦−60° C. This pol containing recombinant adenovirus is referred to herein as “MRKAd5pol”. This recombinant adenovirus expresses an inactivated HIV-1 Pol protein as shown in SEQ ID NO:6.

EXAMPLE 20

MRKAd5Nef Construction and Virus Rescue

Construction of Vector: Shuttle Plasmid and Pre-Adenovirus Plasmid—Key steps performed in the construction of the vectors, including the pre-adenovirus plasmid denoted MRKAd5nef, is depicted in FIG. 23 . Briefly, as shown in Example 19 above, the vector MRKpdelE1(Pac/pIX/pack450)+CMVmin+BGHpA(str.) is the shuttle vector used in the construction of the MRKAd5gag adenoviral pre-plasmid. It has been modified to contain the Pac1 site, extension to the packaging signal region, and extension to the pIX gene. It contains an expression cassette with the hCMV promoter (no intronA) and the bovine growth hormone polyadenylation signal. The expression unit has been inserted into the shuttle vector such that insertion of the gene of choice at a unique Bgl11 site will ensure the direction of transcription of the transgene will be Ad5 E1 parallel when inserted into the MRKpAd5(E1−/E3+)Cla1 pre-plasmid. The synthetic full-length codon-optimized HIV-1 nef gene was isolated directly from the plasmid pV1Jns/nef (G2A,LLAA). Digestion of this plasmid with Bgl11 releases the nef gene intact, which comprises the nucleotide sequence as disclosed in SEQ ID NO:13. The nef fragment was gel purified and ligated into the MRKpdelE1+CMVmin+BGHpA(str.) shuttle vector at the Bgl11 site. The clones were checked for correction orientation of the gene by using restriction enzyme Sca1. A positive clone was isolated and named MRKpdelE1hCMVminFL-nefBGHpA(s). The genetic structure of this plasmid was verified by PCR, restriction enzyme and DNA sequencing. The pre-adenovirus plasmid was constructed as follows. Shuttle plasmid MRKpdelE1hCMVminFL-nefBGHpA(s) was digested with restriction enzymes Pac1 and Bst1107 I (or its isoschizomer, BstZ107 I) and then co-transformed into E. coli strain BJ5183 with linearized (Cla1 digested) adenoviral backbone plasmid, MRKpAd(E1/E3+)Cla1. The resulting pre-plasmid originally named MRKpdelE1hCMVminFL-nefBGHpA(s) is now referred to as “pMRKAd5nef”. The genetic structure of the resulting pMRKAd5nef was verified by PCR, restriction enzyme and DNA sequence analysis. The vectors were transformed into competent E. coli XL-1 Blue for preparative production. The recovered plasmid was verified by restriction enzyme digestion and DNA sequence analysis, and by expression of the nef transgene in transient transfection cell culture. The complete nucleotide sequence of this pMRKAd5HIV-1nef adenoviral vector is shown in FIGS. 27 A-AM.

Generation of Research-Grade Recombinant Adenovirus—The pre-adenovirus plasmid, pMRKAd5nef, was rescued as infectious virions in PER.C6® adherent monolayer cell culture. To rescue infectious virus, 12 μg of pMRKAdnef was digested with restriction enzyme Pac1 (New England Biolabs) and 3.3 μg was transfected per 6 cm dish of PER.C6® cells using the calcium phosphate co-precipitation technique (Cell Phect Transfection Kit, Amersham Pharmacia Biotech Inc.). Pac1 digestion releases the viral genome from plasmid sequences allowing viral replication to occur after entry into PER.C6® cells. Infected cells and media were harvested 6-10 days post-transfection, after complete viral cytopathic effect (CPE) was observed. Infected cells and media were stored at ≦−60° C. This nef containing recombinant adenovirus is now referred to as “MRKAd5nef”.

EXAMPLE 21

Construction of Murine CMV Promoter Containing Shuttle Vectors for Inactivated Pol and Nef/G2A,LLAA

The murine CMV (mCMV) was amplified from the plasmid pMH4 (supplied by Frank Graham, McMaster University) using the primer set: mCMV (Not I) Forward: 5′-ATA AGA AT G CGG CCG C CA TAT ACT GAG TCA TTA GG-3′ (SEQ ID NO:20); mCMV (Bgl II)Reverse: 5′-AAG GA A GAT CT A CCG ACG CTG GTC GCG CCT C-3′ (SEQ ID NO:21). The underlined nucleotides represent the Not I and the Bgl II sites respectively for each primer. This PCR amplicon was used for the construction of the mCMV shuttle vector containing the transgene in the E1 parallel orientation. The hCMV promoter was removed from the original shuttle vector (containing the hCMV-gag-bGHpA transgene in the E1 parallel orientation) by digestion with Not I and Bgl II. The mCMV promoter (Not I/Bgl II digested PCR product) was inserted into the shuttle vector in a directional manner. The shuttle vector was then digested with Bgl II and the gag reporter gene (Bgl II fragment) was re-inserted back into the shuttle vector. Several clones were screened for correct orientation of the reporter gene. For the construction of the mCMV-gag in the E1 antiparallel orientation, the mCMV promoter was amplified from the plasmid pMH4 using the following primer set: mCMV (Asc I) Forward: 5′-ATA AGA AT G GCG CGC C AT ATA CTG AGT CAT TAG G (SEQ ID NO:22); mCMV (Bgl II) Reverse: 5′ AAG GA A GAT CT A CCG ACG CTG GTC GCG CCT C (SEQ ID NO:21). The underlined nucleotides represent the Asc I and Bgl II sites, respectively for each primer. The shuttle vector containing the hCMV-gag transgene in the E1 antiparallel orientation was digested with Asc1 and Bgl11 to remove the hCMV-gag portion of the transgene. The mCMV promoter (Asc1/Bgl11 digested PCR product) was inserted into the shuttle vector in a directional manner. The vector was then digested with Bgl11 and the gag reporter gene (Bgl11 fragment) was re-inserted. Several clones were screened for correct orientation of the reporter gene. For each of the full length IA pol and full length nef/G2A,LLAA genes, cloning was performed using the unique Bgl II site within the mCMV-bGHpA shuttle vector. The pol and nef genes were excised from their respective pV1Jns plasmids by Bgl II digestion.

EXAMPLE 22

Construction of mCMV Full Length Inactivated Pol and Full Length nef/G2A.LLAA Adenovectors

Each of these transgenes of Example 21 were inserted into the modified shuttle vector in both the E1 parallel and E1 anti-parallel orientations. Pac1 and BstZ110I digestion of each shuttle vector was performed and each specific transgene fragment containing the flanking Ad5 sequences was isolated and co-transformed with Cla I digested MRKpAd5(E3+) or MRKpAd5(E3−) adenovector plasmids via bacterial homologous recombination in BJ5183 E. coli cells. Recombinant pre-plasmid adenovectors containing the various transgenes in both the E3− and E3+ versions (and in the E1 parallel and E1 antiparallel orientations) were subsequently prepared in large scale following transformation into XL-1 Blue E. coli cells and analyzed by restriction analysis and sequencing.

EXAMPLE 23

Construction of hCMV-tpa-nef (LLAA) Adenovector

The tpa-nef gene was amplified out from GMP grade pV1Jns-tpanef (LLAA) vector using the primer sets: Tpanef (BamHI) F 5′-ATT GGA TCC ATG GAT GCA ATG AAG AGA GGG (SEQ ID 23); Tpanef (BamHI) R 5′-ATA GGA TCC TTA GCA GTC CTT GTA GTA CTC G (SEQ ID NO:24). The resulting PCR product was digested with BamHI, gel purified and cloned into the Bgl II site of MRKAd5CMV-bGHpA shuttle vector (Bgl II digested and calf intestinal phosphatase treated). Clones containing the tpanef (LLAA) gene (see SEQ ID NO:15 for complet coding region) in the correct orientation with respect to the hCMV promoter were selected following Sca I digestion. The resulting MRKAd5tpanef shuttle vector was digested with Pac I and Bst Z1101 and cloned into the E3+ MRKAd5 adenovector via bacterial homologous recombination techniques.

EXAMPLE 24

Immunogenicity of MRKAd5pol and MRKAd5nef Vaccine

Materials and Methods—Rodent Immunization—Groups of N=10 BALB/c mice were immunized i.m. with the following vectors: (1) MRKAd5hCMV-IApol (E3+) at either 10{circumflex over ( )}7 vp and 10{circumflex over ( )}9 vp; and (2) MRKAd5hCMV-IApol (E3−) at either 10{circumflex over ( )}7 vp and 10{circumflex over ( )}9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and IFNg ELIspot analyses, respectively. For all rodent immunizations, the Ad5 vectors were diluted in 5 mM Tris, 5% sucrose, 75 mM NaCl, 1 mM MgCl2, 0.005% polysorbate 80, pH 8.0. The total dose was injected to both quadricep muscles in 50 μL aliquots using a 0.3-mL insulin syringe with 28½ G needles (Becton-Dickinson, Franklin Lakes, N.J.).

Groups of N=10 C57/BL6 mice were immunized i.m. with the following vectors: (1) MRKAd5hCMV-nef(G2A,LLAA) (E3+) at either 10{circumflex over ( )}7 vp and 10{circumflex over ( )}9 vp; (2) MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10{circumflex over ( )}7 vp and 10{circumflex over ( )}9 vp; and (3) MRKAd5mCMV-tpanef(LLAA) (E3+) at either 10{circumflex over ( )}7 vp and 10{circumflex over ( )}9 vp. At 7 weeks post dose, 5 of the 10 mice per cohort were boosted with the same vector and dose they initially received. At 3 weeks post the second does, sera and spleens were collected from all the animals for RT ELISA and IFNg ELIspot analyses, respectively.

Non-Human Primate Immunization—Cohorts of 3 rhesus macaques (2-3 kg) were vaccinated with the following Ad vectors: (1) MRKAd5hCMV-IApol (E3+) at either 10{circumflex over ( )}9 vp and 10{circumflex over ( )}11 vp dose; and (2) MRKAd5hCMV-IApol (E3−) at either 10{circumflex over ( )}9 vp and 10{circumflex over ( )}11 vp; (3) MRKAd5hCMV-nef(G2A,LLAA) (E3+) at either 10{circumflex over ( )}9 vp and 10{circumflex over ( )}11 vp; and (4) MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10{circumflex over ( )}9 vp and 10{circumflex over ( )}11 vp. The vaccine was administered to chemically restrained monkeys (10 mg/kg ketamine) by needle injection of two 0.5 mL aliquots of the Ad vectors (in 5 mM Tris, 5% sucrose, 75 mM NaCl, 1 mM MgCl 2 , 0.005% polysorbate 80, pH 8.0) into both deltoid muscles. The animals were immunized twice at a 4 week interval (T=0, 4 weeks).

Murine Anti-RT and Anti-Nef ELISA—Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester, N.Y.) were coated by overnight incubation with 100 μL of 1 μg/mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, Md.) in PBS. For anti-nef ELISA, 100 uL of 1 ug/mL HIV-1 nef (Advanced Biotechnologies, Columbia, Md.) was used to coat the plates. The plates were washed with PBS/0.05% Tween 20 using Titertek MAP instrument (Hunstville, Ala.) and incubated for 2 h with 200 μL/well of blocking solution (PBS/0.05% tween/1% BSA). An initial serum dilution of 100-fold was performed followed by 4-fold serial dilution. 100-μL aliquots of serially diluted samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 μL of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, Calif.) were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 μL 1,2-phenylenediamine dihydrochloride/hydrogen peroxide (DAKO, Norway) solution for 15 min. The reaction was quenched by adding 100 μL of 0.5M H 2 SO4 per well. OD 492 readings were recorded using Titertek Multiskan MCC/340 with S20 stacker. Endpoint titers were defined as the highest serum dilution that resulted in an absorbance value of greater than or equal to 0.1 OD 492 (2.5 times the background value).

Non-Human Primate and Murine ELIspot Assays—The enzyme-linked immuno-spot (ELISpot) assay was utilized to enumerate antigen-specific INFγ-secreting cells from mouse spleens (Miyahira, et al.1995 , J. Immunol. Methods 181:45-54) or macaque PBMCs. Mouse spleens were pooled from 5 mice/cohort and single cell suspensions were prepared at 5×10 6 /mL in complete RPMI media (RPMI1640, 10% FBS, 2 mM L-glutamine, 100 U/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM β-ME). Rhesus PBMCs were prepared from 8-15 mL of heparinized blood following standard Ficoll gradient separation (Coligan, et al, 1998 , Current Protocols in Immunology. John Wiley & Sons, Inc.). Multiscreen opaque plates (Millipore, France) were coated with 100 μl/well of either 5 μg/mL purified rat anti-mouse IFN-γ IgG1, clone R4-6A2 (Pharmingen, San Diego, Calif.), or 15 ug/mL mouse anti-human IFN-γ IgG 2a (Cat. No. 1598-00, R&D Systems, Minneapolis, Minn.) in PBS at 4° C. overnight for murine or monkey assays, respectively. The plates were washed with PBS/penicillin/streptomycin and blocked with 200 μL/well of complete RPMI media for 37° C. for at least 2 h.

To each well, 50 μL of cell samples (4-5×10 5 cells per well) and 50 μL of the antigen solution were added. To the control well, 50 μL of the media containing DMSO were added; for specific responses, either selected peptides or peptide pools (4 ug/mL per peptide final concentration) were added. For BALB/c mice immunized with the pol constructs, stimulation was conducted using a pool of CD4 + -epitope containing 20-mer peptides (aa21-40, aa411-430, aa641-660, aa731-750, aa771-790 or a pool of CD8 + -epitope containing peptides (aa201-220, aa311-330, aa781-800). For C57/BL6 mice immunized with the nef construct, either aa51-70 (CD8 + T cell epitope) or aa81-100 (CD4 + ) peptide derived from the nef sequence was added for specific stimulation. In monkeys, the responses against pol were evaluated using two pools (L and R) of 20-aa peptides that encompass the entire pol sequence and overlap by 10 amino acids. In monkeys vaccinated with the nef constructs, a single pool containing 20-mer peptides covering the entire HIV-1 nef sequence and overlapping by 10 aa was used. Each sample/antigen mixture was performed in triplicate wells for murine samples or in duplicate wells for rhesus PBMCs. Plates were incubated at 37° C., 5% CO 2 , 90% humidity for 20-24 h. The plates were washed with PBS/0.05% Tween 20 and incubated with 100 μL/well of either 1.25 μg/mL biotin-conjugated rat anti-mouse IFN-γ mAb, clone XMG1.2 (Pharmingen) or of 0.1 ug/mL biotinylated anti-human IFN-gamma goat polyclonal antibody (R&D Systems) at 4° C. overnight. The plates were washed and incubated with 100 μL/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5% FBS for 30 min at 37° C. Spots were developed by incubating with 100 μL/well 1-step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 10 6 cell input.

Non-Human Primate Anti-RT ELISA—The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well. Briefly, Maxisorp plates were coated with saturating amounts of pol positive human serum (#97111234). 250 uL of each sample is incubated with 15 uL of 266 ng/mL RT recombinant protein (in RCM 563, 1% BSA, 0.1% tween, 0.1% NaN 3 ) and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature. Similar mixtures are prepared using serially diluted samples of a standard and a negative control which defines maximum RT binding. 200 uL/well of each sample and standard were added to the washed plate and the plate incubated 16-24 h at room temperature. Bound RT is quantified following the procedures described in Coulter p24 assay kit and reported in milliMerck units per mL arbitrarily defined by the chosen standard.

Results—Rodent Studies—BALB/c mice (n=5 mice/cohort) were immunized once or twice with varying doses of MRKAd5hCMV-IApol(E3+) and MRKAd5hCMV-IApol(E3−). At 3 weeks after the second dose, Anti-pol IgG levels were determined by an ELISA assay using RT as a surrogate antigen. Cellular response were quantified via IFNγ ELISpot assay against pools of pol-epitope containing peptides. The results of these assays are summarized in Table 10. The results indicate that the mouse vaccinees exhibited detectable anti-RT IgGs with an adenovector dose as low as 10{circumflex over ( )}7 vp. The humoral responses are highly dose-dependent and are boostable with a second immunization. One or two doses of either pol vectors elicit high frequencies of antigen-specific CD4 + and CD8 + T cells; the responses are weakly dose-dependent but are boostable with a second immunization.

TABLE 10
Immunogenicity of MRKAd5pol Vectors in BALB/c mice.
	SFC/10{circumflex over ( )}6 cells c
	CD4+	CD8+
	No. of	Anti-RT IgG Titers a		peptide	peptide
Group	Vaccine	Dose	Doses	GMT	+SE	−SE	Medium	pool	pool
1	MRKAd5hCMVFLpol (E3+)	10{circumflex over ( )}7 vp	2	310419	301785	153020	1(1)	75(4)	2313(67)
			1	919	372	265	1(1)	72(9)	533(41)
2	MRKAd5hCMVFLpol (E3+)	10{circumflex over ( )}9 vp	2	1638400 b	0	0	2(2)	114(9)	2063(182)
			1	713155	528520	303555	1(1)	48(7)	733(89)
3	MRKAd5hCMVFLpol (E3−)	10{circumflex over ( )}7 vp	2	310419	386218	172097	0(0)	223(7)	2607(27)
			1	6400	14013	4393	10(8)	141(21)	409(28)
4	MRKAd5hCMVFLpol (E3−)	10{circumflex over ( )}9 vp	2	1638400 b	0	0	1(1)	160(13)	2385(11)
			1	1241675 b	396725	300661	0(0)	39(13)	833(83)
5	Naïve	none	none	57	9	7	9(2)	11(4)	10(1)
a GMT, geometric mean titer of the cohort of 5 mice; SE, standard error of the gemetric mean
b Near or at the upper limit of the serial dilution; hence, could be greater than this value
c No. of Spot-forming Cells per million splecnoytes; mean values of triplicates are reported along with standard errors in parenthesis.

C57/BL6 mice were immunized once or twice with varying doses of MRKAd5hCMV-nef(G2A,LLAA) (E3+), MRKAd5mCMV-nef(G2A,LLAA) (E3+) at either 10{circumflex over ( )}7 vp and(3) MRKAd5mCMV-tpanef(LLAA) (E3+) at either 10{circumflex over ( )}7 vp and 10{circumflex over ( )}9 vp. The immune response were analyzed using similar protocols and the results are listed in Table 11. While anti-nef IgG responses could not be detected in this model system with any of the constructs, there are strong indications of a cellular immunity generated against nef using the ELIspot assay.

TABLE 11
Immunogenicity of MRKAd5nef Vectors in C57/BL6 mice.
	Anti-nef IgG	SFC/10{circumflex over ( )}6 cells b
	No. of	Titers a		aa51-70	aa81-100
Group	Vaccine	Dose	Doses	GMT	+SE	−SE	Medium	CD8+	CD4+
1	MRKAd5hCMVFLnef (E3+)	10{circumflex over ( )}7 vp	2	174	70	50	1(1)	23(1)	1(1)
			1	132	42	32	0(0)	0(0)	0(0)
2	MRKAd5hCMVFLnef (E3+)	10{circumflex over ( )}9 vp	2	174	70	50	0(0)	61(7)	4(2)
			1	132	42	32	1(1)	62(7)	3(1)
3	MRKAd5mCMVFLnef (E3+)	10{circumflex over ( )}7 vp	2	132	42	32	3(1)	15(5)	5(2)
			1	115	46	33	3(2)	3(2)	4(2)
4	MRKAd5mCMVFLnef (E3+)	10{circumflex over ( )}9 vp	2	132	42	32	4(2)	83(13)	5(1)
			1	132	42	32	2(1)	29(2)	4(0)
5	MRKAd5mCMVtpanef (E3+)	10{circumflex over ( )}7 vp	2	132	42	32	3(2)	14(2)	5(1)
			1	100	0	0	3(1)	13(4)	10(3)
6	MRKAd5mCMVtpanef (E3+)	10{circumflex over ( )}9 vp	2	230	170	98	3(2)	145(29)	4(0)
			1	115	46	33	7(1)	151(14)	10(0)
7	Naïve	none	none	152	78	52	21(2)	18(6)	26(3)
a GMT, geometric mean titer of the cohort of 5 mice; SE, standard error of the gemetric mean
b No. of spot-forming cells per million splecnoytes; mean values of triplicates are reported along with standard errors in parenthesis

Monkey Studies—Cohorts of 3 rhesus macaques were immunized with 2 doses of MRKAd5hCMV-IApol(E3+) and MRKAd5hCMV-IApol(E3−). The number of antigen-specific T cells (per million PBMCs) were enumerated using one of two peptide pools (L and R) that cover the entire pol sequence; the results are listed in Table 12. Moderate-to-strong T cell responses were detected in the vaccinees using either constructs even at a low dose of 10{circumflex over ( )}9 vp. Longitudinal analyses of the anti-RT antibody titers in the animals suggest that the pol transgene product is expressed efficiently to elicit a humoral response (Table 13). It would appear that generally higher immune responses were observed in animals that received the E3− construct compared to the E3+ virus.

TABLE 12
Pol-specific T Cell Responses in MRKAd5pol Immunized Rhesus
Macaques.
	Prebleed		T = 4		T = 7		T = 16
Vaccine (T = 0, 4 wks)	Monk #	Mock	Pol L	Pol R	Mock	Pol L	Pol R	Mock	Pol L	Pol R	Mock	Pol L	Pol R
MRKAd5hCMV-I Apol(E3+)	99C100	1	0	0	1	38	31	0	52	146	0	49	715
10{circumflex over ( )}11 vp	99C215	1	2	2	10	98	249	1	109	305	22	88	250
	99D201	5	5	4	6	149	95	0	40	35	0	35	18
MRKAd5hCMV-I Apol(E3+)	99D212	0	2	0	4	331	114	0	58	14	0	6	6
10{circumflex over ( )}9 vp	99D180	0	4	2	0	19	192	4	36	156	5	38	106
	99C201	8	5	21	6	62	62	0	18	32	1	14	65
MRKAd5hCMV-I Apol(E3−)	99D239	5	2	2	20	82	172	1	66	114	9	21	40
10{circumflex over ( )}11 vp	99C186	4	12	6	5	120	421	2	271	489	16	875	530
	99C084	1	8	9	8	84	464	0	14	236	1	24	264
MRKAd5hCMV-I Apol(E3−)	CC7C	10	10	8	12	724	745	4	322	376	4	188	176
10{circumflex over ( )}9 vp	CD1G	2	0	1	5	474	468	0	232	212	0	101	121
	CD11	6	6	12	10	98	110	5	60	80	8	25	34
Naïve	083Q	nd	nd	nd	nd	nd	nd	4	2	2	2	1	2
nd, not determined
Reported are SFC per million PBMCs; mean of duplicate wells

TABLE 13
Anti-RT Ig Levels in MRKAd5pol Immunized macaques.
RT ANTIBODY ASSAY TITERS IN mMU/mL
Vaccine/Monkey Tag	T = 4	T = 7	T = 12	T = 16
MRKAd5hCMV-IApol(E3+), 10{circumflex over ( )}11 vp
99C100	61	1999	5928	4768
99C215	81	1541	2356	2767
99D201	53	336	539	387
MRKAd5hCMV-IApol(E3+), 10{circumflex over ( )}9 vp
99D212	10	40	49	68
99D180	<10	36	79	93
99C201	<10	37	71	76
MRKAd5hCMV-IApol(E3−), 10{circumflex over ( )}11 vp
99D239	44	460	1234	1015
99C186	21	233	480	345
99C084	235	2637	2858	1626
MRKAd5hCMV-IApol(E3−), 10{circumflex over ( )}9 vp
CC7C	32	175	306	235
CD1G	20	140	273	419
CD11	15	112	149	237

When rhesus macaques were immunized i.m. with two doses of MRKAd5nef constructs, vigorous T cell responses ranging from 100 to as high as 1100 per million were observed in 8 of 12 vaccinees (Table 14). The efficacies of the mCMV- and hCMV-driven nef constructs are comparable on the basis of the data generated thus far.

TABLE 14
Nef-specific T cell Responses in MRKAd5nef Immunized Rhesus
Macaques.
	Pre	T = 4	T = 7	T = 16
Vaccine (T = 0,4 wks)	Monk #	Mock	Nef	Mock	Nef	Mock	Nef	Mock	Nef
MRKAd5hCMV-nef(G2A,LLAA) (E3+)	CD2D	0	4	31	440	4	368	1	251
10{circumflex over ( )}11 vp	CC7B	0	0	2	521	0	178	1	1522
	CC61	2	9	31	112	0	108	11	100
MRKAd5hCMV-nef(G2A,LLAA) (E3+)	CC2K	9	9	6	52	0	35	0	15
10{circumflex over ( )} 9 vp	CD15	5	4	30	998	2	586	0	434
	CD16	6	1	6	1146	0	369	1	212
MRKAd5mCMV-nef(G2A,LLAA) (E3+)	99D191	1	5	4	614	0	298	2	419
10{circumflex over ( )} 11 vp	99D144	4	6	5	434	0	1100	2	932
	99C193	1	2	1	58	1	22	0	64
MRKAd5mCMV-nef(G2A,LLAA) (E3+)	99D224	1	11	14	231	1	125	0	70
10{circumflex over ( )} 9 vp	99D250	8	9	4	108	0	54	0	5
	99C120	1	6	20	299	0	92	0	79
Naive	083Q	nd	nd	18	22	4	5	2	1

EXAMPLE 25

Comparison of Clade B vs. Clade C T Cell Responses in HIV-Infected Subjects

PBMC samples collected from two dozens of patients infected with HIV-1 in US were tested in ELISPOT assays with peptide pools of 20-mer peptides overlapping by 10 amino acids. Four different peptide pools were tested for cross-clade recognition, and they were either derived from a lade B-based isolate (gag H-b; nef-b) or a clade C-based isolate (gag H-c, nef-c). Data in Table 15 shows that T cells from these patients presumably infected with lade B HIV-1 could recognize clade C gag and nef antigens in ELISPOT assay. Correlation analysis further demonstrated that these T cell responses against lade C gag peptide pool were about 60% of the clade B counterpart (FIG. 24 ), while the T cell responses against lade C nef were about 85% of the clade B counterpart (FIG. 25 ). These results suggest that cellular immune responses generated in patients infected with lade B HIV-1 can recognize gag and nef antigens derived from clade C HIV-1. These data show that a HIV vaccine, such as a DNA or MRKAd5-based adenoviral vaccine expressing a clade B gag and/or nef antigen will potentially have the ability to provide a prophylactic and/or therapetic advantage on a global scale.

TABLE 15
Responses Shown as the Number of gIFN-Secreting T Cells per Million
PBMCs
		gag epitope #
subject	bleed date	(from mapping)	mock	gag H-b	gagH-c	nef-b	nef-c
#100	19-Jul-99	12	10	3950	1385	1295	1300
#101	25-Jul-99	3	15	3885	1280	na	1020
#102	25-Jul-99	4	15	1740	850	1255	1785
#104	7-Jun-99	2	5	1355	1185	na	1060
#107	11-Oct-99	2	25	3305	2795	670	870
#405	11-Jul-99	2	15	4575	3180	1700	1500
#501	19-Jul-99	2	15	1100	570	3365	3460
#505	18-Jul-99	5	10	2145	1725	1235	na
#506	28-Feb-99	2	25	150	45	400	610
#701	28-Mar-99	5	30	7620	4775	3320	2780
#709	17-May-99	3	15	2785	1945	1090	1630
#710	24-May-99	4	5	1055	1080	2210	2140

EXAMPLE 26

Characterization and Production of MRKAd5pol and MRKAd5nef Vectors in Roller Bottles

Expansion of Nef and Pol Adenovectors—Nef and pol CsCl purified MRKAd5 seeds were used to infect roller bottles to produce P4 virus to be used as a seed for further experiments. P4 MRKAd5 pol and nef vectors were used to infect roller bottles at an MOI 280 vp/cell, except for hCMV-tpa-nef [E3+] which was infected at an MOI of 125 due to low titers of seed obtained at P4.

TABLE 16
Viral particle concentrations for P5 nef and pol adenovectors
	AEX Titer
	(10 10 vp/ml	AEX Titer	Amplification
Adenovector	culture)	(10 4 vp/cell)	Ratio
hCMV-FL-nef [E3+]	1.1	0.9	30
mCMV-FL-nef [E3+]	2.2	2.1	75
hCMV-tpa-nef [E3+]	0.07	0.1	5
mCMV-tpa-nef [E3+]	1.3	0.9	35
hCMV-FL-pol [E3+]	2.7	2.1	75
hCMV-FL-pol [E3−]	1.9	1.3	45

Roller Bottle Passaging—Passaging of the pol and nef constructs continued through passage seven. Cell-associated (freeze/thaw lysis) and whole broth (triton-lysis) titers obtained in all passages were very consistent. In general, MRKAd5pol is ca. 70% as productive as MRKAd5gag while MRKAd5nef is ca. 25% as productive as MRKAd5gag. Samples of P7 virus for both constructs were analyzed by V&CB by restriction digest analysis and did not show any rearrangements.

TABLE 17
Passage Six Viral Productivity for MRKAd5pol and MRKAd5nef
	Xviable (10 6 cells/ml),		AEX Titer
	Viability (%)	Cell Passage	(Cell Associated)	Titer	Amplification	Triton Lysis Titer
	Infection	Harvest	Number	10 10 vp/ml culture	10 4 vp/cell	Ratio	10 10 vp/ml culture
hCMV-FL-nef [E3+]	pool	1.22, 85%		62	0.8	0.7	25	1.6
	1		0.99, 62%
	2		1.10, 72%
hCMV-FL-pol [E3+]	pool	1.42, 89%		62	4.5	3.2	115	7.0
	1		1.22, 70%
	2		1.42, 74%

TABLE 18
Passage Seven Viral Productivity for MRKAd5pol and MRKAd5nef
	Xviable (10 6 cells/ml),		AEX Titer
	Viability (%)	Cell Passage	(Cell Associated)	Titer	Amplification	Triton Lysis Titer
	Infection	Harvest	Number	10 10 vp/ml culture	10 4 vp/cell	Ratio	10 10 vp/ml culture
hCMV-FL-nef [E3+]	Pool	1.33, 90%		66	1.0	0.8	29	2.1
	1		0.96, 70%
	2		1.18, 73%
hCMV-FL-pol [E3+]	Pool	0.90*, 90%		56	4.2	4.7	168	6.5
	1		1.18, 88%
	2		1.04, 80%

MRKAd5nef and MRKAd5pol Viral Production Kinetics—A timecourse experiment was carried out in roller bottles to determine if the viral production kinetics of the MRKAd5pol and MRKAd5nef vectors were similar to those of MRKAd5gag. PER.C6® cells in roller bottle cultures were infected at an MOI of 280 vp/cells with P5 MRKAd5pol, PS MRKAd5nef and P7 MRKAd5gag; for each adenovector, two infected bottles were sampled at 24, 36, 48, and 60 hours post infection. In addition, two bottles were left unsampled until 48 hpi when they were harvested under the Phase I process conditions. The anion-exchange HPLC viral particle concentrations of the freeze-thaw recovered cell associated virus at the 24, 36, 48, and 60 hpi timepoints are shown in FIGS. 29A-B . The QPA titers show a similar trend (data not shown).

Comparison of hCMV- and mCMV-FL-nef—As the titers obtained with the MRKAd5nef construct (hCMV-FL-nef) were lower than those obtained with MRKAd5gag or MRKAd5pol, a viral productivity comparison experiment was performed with mCMV-FL-nef. For each of the two adenovectors (hCMV- and mCMV-FL-nef), two roller bottles were infected at an MOI of 280 vp/cell with passage five clarified lysate. The macroscopic and microscopic observations of the four roller bottles were identical at the time of harvest. Analysis of the clarified lysate produced indicated a higher viral particle concentration in the bottles infected with mCMV-FL-nef, as shown in Table 19. It is stipulated that the higher productivity with mCMV promoter driven nef vector is due to lower nef expression levels in PER.C6® cells-experiments are underway at V&CB to measure nef expression levels.

TABLE 19
Passage Six Viral Productivity Comparison of hCMV- and mCMV-FL-nef
	Xv (10 6 cells/ml), Viability (%)	Cell Passage	AEX Titer	Titer	Amplification	Triton Lysis Titer
	Infection	Harvest	Number	10 10 vp/ml culture	10 4 vp/cell	Ratio	10 10 vp/ml culture
hCMV-FL-nef	Pool	1.11, 91%		60	1.5	1.4	50	2.8
(MRKAd5nef)	1		1.23, 75%
	2		1.34, 74%
mCMV-FL-nef	Pool	1.11, 91%		60	2.3	2.1	75	4.6
	1		1.49, 84%
	2		1.18, 77%

EXAMPLE 27

Characterization and Large Scale Production of MRKAd5nef Virus in Bioreactors

Materials and Methods—The experiment of the present example was run twice under the following conditions: 36.5° C., DO 30%, pH 7.30, 150rpm agitation rate, no sparging, Life Technologies (Gibco, Invitrogen) 293 SFM II (with 6 mM L-glutamine), 0.5M NaOH as base for pH control. During the first run (B20010115), two 10L stirred vessel bioreactors were inoculated with PER.C6® cells at a concentration of 0.2×10 6 cells/ml. Cells were grown until they reached a cell concentration of approximately 1×10 6 cells/ml. The cells were infected with uncloned MRKAd5nef (G2A,LLAA) at a MOI of 280 virus particles (vp)/cell. For the second batch (B20010202), the same procedure as the first run was used, except the cells were infected with cloned MRAd5nef. During both runs, the bioreactors were harvested 48 hours post-infection. Samples were taken and virus concentrations were determined from whole broth (with triton lysis), supernatant, and cell pellets (3× freeze/thaw) with the AEX and QPA assays. Metabolites were measured with BioProfile 250 throughout the process.

TABLE 20
Experimental Conditions
Temperature 36.5° C.
DO          30%
PH          7.30
Agitation   150 rpm
Sparging    None

TABLE 21
Virus source used for experiments.
			Cloned/Uncloned	MOI
	Run	Batch ID	MRKAd5nef	(vp/cells)
	#1	B20010115-1	Uncloned	280
		B20010115-2	Uncloned	280
	#2	B20010202-1	Cloned	280
		B20010202-2	Cloned	280

Results—Table 22 and 23 show an the ability to scale up production of MRKAd5nef by growth in a bioreactor.

TABLE 22
Virus Concentration as measured by the AEX assay
	Cloned/Uncloned	Virus Concentration @ 48 hpi (1 × 10 13 vp/L)
Run	Batch ID	MRKAd5nef	Supernatant	Clarified Lysate	Total	Triton Lysate
#1	B20010115-1	Uncloned	0.72	3.26	3.98	5.76
	B20010115-2	Uncloned	0.38	1.67	2.05	2.46
#2	B20010202-1	Cloned	0.80	6.00	6.80	8.88
	B20010202-2	Cloned	0.50	6.00	6.50	8.47

TABLE 23
Virus Titers as measured by the QPA assay
	Virus Concentration @ 48 hpi (1 × 10 11 IU/L)
		Cloned/Uncloned	Whole		Clarified		Triton
Run	Batch ID	MRKAd5nef	Broth	Supernatant	Lysate	Total	Lysate
#1	B20010115-1	Uncloned	0.13	1.12	1.76	2.88	11.28
	B20010115-2	Uncloned	0.14	0.73	1.54	2.27	5.86
#2	B20010202-1	Cloned	0.14	0.97	1.62	2.69	11.89
	B20010202-2	Cloned	0.14	1.17	1.70	2.97	12.47

The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.

EXAMPLE 28

MRKAd5HIV-1gag Boosting of DNA-Primed Animals

Groups of 3-5 rhesus macaques were immunized with (a) 5 mgs of V1Jns-Flgag (pV1JnsCMV(no intron)-FL-gag-bGHpA), (b) 5 mgs of V1Jns-Flgag formulated with 45 mgs of a non-ionic block copolymer CRL1005, or (c) 5 mgs of V1Jns-Flgag formulated with 7.5 mgs of CRL1005 and 0.6 mM benzalkonium chloride at weeks 0, 4, and 8. All animals received a single dose of 10e7 viral particles (vp) of the MRKAd5HIV-1gag at week 26. Note: 10e7 is too low to prime or boost effectively when used as a single modality (dose is selected to mimic preexposure to adenovirus); see FIG. 32 .

Blood samples were collected from all animals at several time points and peripheral blood mononuclear cells (PBMCs) were prepared using standard Ficoll method. The PBMCs were counted and analyzed for gamma-interferon secretion using the ELISpot assay (Table 24). For each monkey, the PBMCs were incubated overnight either in the absence (medium) or presence of a pool (called “gag H”) of 50 20-aa long peptides that encompass the entire HIV-1 gag sequence.

The results indicate that MRKAd5HIV-1gag was very effective in boosting the T cell immune responses in these monkeys. At week 28 or 2 weeks after the viral boost, the number of gag-specific T cells per million PBMCs increased 2-48 fold compared to the levels observed at week 24 or 2 weeks prior to the boost.

The PBMCs were also analyzed by intracellular gamma-interferon staining prior to (at week 10) and after the MRKAd5gag boost (at week 30). The results for select animals are shown on FIG. 31 . The results indicate that (a) immunization with DNA/adjuvant formulation elicited T cell responses which can either be balanced, CD4 + -biased or CD8 + -biased, and (b) boosting with the MRKAd5gag construct produced in all cases a strongly CD8 + -biased response. These results suggest that boosting with MRKAd5HIV-1gag construct is able to improve the levels of antigen-specific CD8 + T cells.

TABLE 24
Boosting of DNA/Adjuvant-Primed Rhesus Monkeys with MRKAd5gag
Number of SFC/million PBMCs
	Priming	Boost		T = 0	T = 4	T = 6	T = 10
Grp #	T = 0, 4, 8 wks	T = 26 wks	Monk #	Medium	gag H	Medium	gag H	Medium	gag H	Medium	gag H
1	DNA/5 mgs	MRKAd5gag(E3+)	CB5H	NA	NA	3	35	15	71	4	224
	PBS	10{circumflex over ( )} 7 vp	CC6X	0	0	0	15	0	46	0	58
	(D101)		AW3G	5	11	0	36	3	51	3	46
2	DNA/5 mgs +	MRKAd5gag(E3+)	CC1C	0	4	1	60	0	111	5	270
	CRL1005/45 mgs	10{circumflex over ( )} 7 vp	CC1K	4	0	1	101	0	254	0	791
			AW3P	9	8	1	10	4	71	4	154
			CB5F	NA	NA	0	31	0	288	0	530
			AK8B	9	12	4	36	1	119	0	439
3	DNA/5 mgs+	MRKAd5gag(E3+)	AW20	10	4	1	59	5	264	19	425
	CRL1005/7.5 mgs + 0.6 mM BAK	10{circumflex over ( )} 7 vp	CA4R	1	0	3	121	1	135	1	270
			CB58	8	6	0	6	3	119	0	274
			CB5W	4	3	0	26	1	91	0	139
			CB7D	1	0	0	136	0	316	1	609
4	none	None	98D201	3	0	0	0	1	0	0	0
	Priming	Boost		T = 17	T = 24	T = 28	T = 30
Grp #	T = 0, 4, 8 wks	T = 26 wks	Monk #	Medium	gag H	Medium	gag H	Medium	gag H	Medium	gag H
1	DNA/5 mgs	MRKAd5gag(E3+)	CB5H	8	115	6	85	19	956	0	316
	PBS	10{circumflex over ( )} 7 vp	CC6X	0	75	0	35	3	1705	1	755
	(D101)		AW3G	2	89	8	65	10	989	0	395
2	DNA/5 mgs +	MRKAd5gag(E3+)	CC1C	4	280	8	232	3	959	19	1345
	CRL1005/45 mgs	10{circumflex over ( )} 7 vp	CC1K	5	452	0	321	0	1915	1	1099
			AW3P	8	104	5	85	11	836	6	241
			CB5F	19	374	9	251	8	1549	20	1734
			AK8B	0	425	0	316	4	1229	5	1354
3	DNA/5 mgs+	MRKAd5gag(E3+)	AW20	6	105	9	205	18	565	8	404
	CRL1005/7.5 mgs + 0.6 mM BAK	10{circumflex over ( )} 7 vp	CA4R	5	130	1	105	14	1384	10	978
			CB58	6	282	1	208	0	636	1	828
			CB5W	0	164	1	62	5	543	1	349
			CB7D	5	626	1	759	0	2278	4	1831
4	none	None	98D201	0	1	1	2	3	0	0	0
NA, not available

EXAMPLE 29

Construction of Gagpol Fusion for MRKAd5Gagpol Fusion Constructs

The open reading frames for the codon-optimized HIV-1 gag gene was fused directly to the open reading frame of the IA pol gene (consisting of RT, RNAseH and integrase domains) by stepwise PCR. Because the gene (SEQ ID NO:34) does not include the protease gene and the frameshift sequence, it encodes a single polypeptide of the combined size of p55, RT, RNAse H and integrase (1350 amino acids; SEQ ID NO:35).

The fragment that extends from the BstEII site within the gag gene to the last non-stop codon was ligated via PCR to a fragment that extends from the start codon of the IApol to a unique BamHI site. This fragment was digested with BstEII and BamHI. Construction of gag-IApol fusion was achieved via three-fragment ligation involving the PstI-BstEII gag digestion fragment, the BstEII/BamHI digested PCR product and long PstI/BamHI V1R-FLpol backbone fragment.

The MRKAd5-gagpol adenovirus vector was constructed using the BglII fragment of the V1R-gagpol containing the entire ORF of gag-IApol fusion gene.

EXAMPLE 30

Immunogenicity Studies in Non-Human Primates

Cohorts of three (3) macaques were immunized with 10e8 or 10e10 viral particles (vp) of one of the following MRKAd5 HIV-1 vaccines: (1) MRKAd5gag; (2) MRKAd5pol; (3) MRKAd5nef; (4) a mixture containing equal amounts of MRKAd5gag, MRKAd5pol, and MRKAd5nef, or (5) a mixture of equal amounts of MRKAd5gagpol and MRKAd5nef. The vaccines were administered at weeks 0 and 4.

The T cell responses against each of the HIV-1 antigens were assayed by IFN-gamma ELISpot assay using pools of 20-aa peptides that encompass the entire protein sequence of each antigen. The results (Table 25) are expressed as the number of spot-forming cells (sfc) per million peripheral blood mononuclear cells (PBMC) that respond to each of the peptide pools.

Results indicate the following observations: (1) each of the single gene constructs (MRKAd5gag, MRKAd5pol, or MRKAd5nef) is able to elicit high levels of antigen-specific T cells in monkeys; (2) the single-gene MRKAd5 constructs can be mixed as a multi-cocktail formulation capable of eliciting very broad T cell responses against gag, pol, and nef; (3) the MRKAd5 vector expressing the fusion protein of gag plus IA pol is capable of inducing strong T cell responses to both gag and pol.

TABLE 25
Evaluation of Mixtures of MRKAd5 vectors expressing humanized
HIV-1 gag, pol, gagpol, nef in rhesus macaques
	Vaccine		T = 6 wks
Grp #	T = 0, 4 wks	Monk #	Mock	Gag H	Pol-1	Pol-2	Nef
1	MRKAd5 gag	CB9V	0	15	—	—	—
	10{circumflex over ( )} 10 vp	CD19	0	374	—	—	—
		109H	1	843	—	—	—
2	MRKAd5 gag	99D130	1	948	—	—	—
	10{circumflex over ( )} 8 vp	W277	16	324	—	—	—
		143H	4	595	—	—	—
3	MRKAd5 pol	CC1X	4	—	46	256	—
	10{circumflex over ( )} 10 vp	AW3W	3	—	463	550	—
		AV43	6	—	95	1333	—
4	MRKAd5 pol	AW38	1	—	19	30	—
	10{circumflex over ( )} 8 vp	CC8K	0	—	50	995	—
		CC21	1	—	33	436	—
5	MRKAd5 nef	076Q	9	—	—	—	1204
	10{circumflex over ( )} 10 vp	091Q	4	—	—	—	85
		083Q	0	—	—	—	176
6	MRKAd5 nef	00C029	1	—	—	—	114
	10{circumflex over ( )} 8 vp	98D022	6	—	—	—	170
		98D160	3	—	—	—	198
7	MRKAd5gag + MRKAd5pol + MRKAd5nef	99D251	3	206	15	193	120
	10{circumflex over ( )} 10 vp each	05H	3	135	21	9	638
		00C016	3	26	4	51	23
8	MRKAd5gag + MRKAd5pol + MRKAd5nef	99D215	1	171	18	193	240
	10{circumflex over ( )} 8 vp each	81H	5	73	6	14	243
		12H	8	1140	115	811	719
9	MRKAd5gagpol + MRKAd5 nef	99D211	0	83	56	838	725
	10{circumflex over ( )} 10 vp each	22H	4	385	119	1194	1915
		61H	4	343	11	765	853
10	MRKAd5gagpol + MRKAd5 nef	34H	3	78	19	5	75
	10{circumflex over ( )} 8 vp each	48H	1	65	105	46	43
		70H	5	158	15	220	191
Indicated are numbers of spot-forming cells per million PBMCS against the peptide pools. Mock, no peptides; gag H, fifty 20-aa peptides encompassing p55 sequence; pol-1, 20-aa peptides representing N-terminal half of IA pol; pol-2, 20-aa peptides representing the carboxy-terminal half of IA pol; nef, 20-aa peptides encompassing the entire
# wild-type nef sequence. Responses to the antigens prior to the first immunization did not exceed 40 sfc/10{circumflex over ( )} 6 PBMC.

38 1 2577 DNA Artificial Sequence Codon optimized DNA encoding modified wt pol 1agatctacca tggcccccat ctcccccatt gagactgtgc ctgtgaagct gaagcctggc 60atggatggcc ccaaggtgaa gcagtggccc ctgactgagg agaagatcaa ggccctggtg 120gaaatctgca ctgagatgga gaaggagggc aaaatctcca agattggccc cgagaacccc 180tacaacaccc ctgtgtttgc catcaagaag aaggactcca ccaagtggag gaagctggtg 240gacttcaggg agctgaacaa gaggacccag gacttctggg aggtgcagct gggcatcccc 300caccccgctg gcctgaagaa gaagaagtct gtgactgtgc tggatgtggg ggatgcctac 360ttctctgtgc ccctggatga ggacttcagg aagtacactg ccttcaccat cccctccatc 420aacaatgaga cccctggcat caggtaccag tacaatgtgc tgccccaggg ctggaagggc 480tcccctgcca tcttccagtc ctccatgacc aagatcctgg agcccttcag gaagcagaac 540cctgacattg tgatctacca gtacatggat gacctgtatg tgggctctga cctggagatt 600gggcagcaca ggaccaagat tgaggagctg aggcagcacc tgctgaggtg gggcctgacc 660acccctgaca agaagcacca gaaggagccc cccttcctgt ggatgggcta tgagctgcac 720cccgacaagt ggactgtgca gcccattgtg ctgcctgaga aggactcctg gactgtgaat 780gacatccaga agctggtggg caagctgaac tgggcctccc aaatctaccc tggcatcaag 840gtgaggcagc tgtgcaagct gctgaggggc accaaggccc tgactgaggt gatccccctg 900actgaggagg ctgagctgga gctggctgag aacagggaga tcctgaagga gcctgtgcat 960ggggtgtact atgacccctc caaggacctg attgctgaga tccagaagca gggccagggc 1020cagtggacct accaaatcta ccaggagccc ttcaagaacc tgaagactgg caagtatgcc 1080aggatgaggg gggcccacac caatgatgtg aagcagctga ctgaggctgt gcagaagatc 1140accactgagt ccattgtgat ctggggcaag acccccaagt tcaagctgcc catccagaag 1200gagacctggg agacctggtg gactgagtac tggcaggcca cctggatccc tgagtgggag 1260tttgtgaaca ccccccccct ggtgaagctg tggtaccagc tggagaagga gcccattgtg 1320ggggctgaga ccttctatgt ggatggggct gccaacaggg agaccaagct gggcaaggct 1380ggctatgtga ccaacagggg caggcagaag gtggtgaccc tgactgacac caccaaccag 1440aagactgagc tccaggccat ctacctggcc ctccaggact ctggcctgga ggtgaacatt 1500gtgactgact cccagtatgc cctgggcatc atccaggccc agcctgatca gtctgagtct 1560gagctggtga accagatcat tgagcagctg atcaagaagg agaaggtgta cctggcctgg 1620gtgcctgccc acaagggcat tgggggcaat gagcaggtgg acaagctggt gtctgctggc 1680atcaggaagg tgctgttcct ggatggcatt gacaaggccc aggatgagca tgagaagtac 1740cactccaact ggagggctat ggcctctgac ttcaacctgc cccctgtggt ggctaaggag 1800attgtggcct cctgtgacaa gtgccagctg aagggggagg ccatgcatgg gcaggtggac 1860tgctcccctg gcatctggca gctggactgc acccacctgg agggcaaggt gatcctggtg 1920gctgtgcatg tggcctccgg ctacattgag gctgaggtga tccctgctga gacaggccag 1980gagactgcct acttcctgct gaagctggct ggcaggtggc ctgtgaagac catccacact 2040gacaatggct ccaacttcac tggggccaca gtgagggctg cctgctggtg ggctggcatc 2100aagcaggagt ttggcatccc ctacaacccc cagtcccagg gggtggtgga gtccatgaac 2160aaggagctga agaagatcat tgggcaggtg agggaccagg ctgagcacct gaagacagct 2220gtgcagatgg ctgtgttcat ccacaacttc aagaggaagg ggggcatcgg gggctactcc 2280gctggggaga ggattgtgga catcattgcc acagacatcc agaccaagga gctccagaag 2340cagatcacca agatccagaa cttcagggtg tactacaggg actccaggaa ccccctgtgg 2400aagggccctg ccaagctgct gtggaagggg gagggggctg tggtgatcca ggacaactct 2460gacatcaagg tggtgcccag gaggaaggcc aagatcatca gggactatgg caagcagatg 2520gctggggatg actgtgtggc ctccaggcag gatgaggact aaagcccggg cagatct 2577 2 850 PRT Artificial Sequence Codon optimized HIV-1 pol 2Met Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro 1 5 10 15Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys 20 25 30Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Glu Gly Lys 35 40 45Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala 50 55 60Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg65 70 75 80Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile 85 90 95Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Asp 100 105 110Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys 115 120 125Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile 130 135 140Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys Gly Ser Pro Ala145 150 155 160Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln 165 170 175Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Asp Asp Leu Tyr Val Gly 180 185 190Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg 195 200 205Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln 210 215 220Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys225 230 235 240Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val 245 250 255Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile 260 265 270Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr 275 280 285Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu 290 295 300Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr305 310 315 320Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln Lys Gln Gly Gln 325 330 335Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys 340 345 350Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys 355 360 365Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile 370 375 380Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp385 390 395 400Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp 405 410 415Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu 420 425 430Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Asp Gly Ala Ala 435 440 445Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly 450 455 460Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr Glu465 470 475 480Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn 485 490 495Ile Val Thr Asp Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro 500 505 510Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile 515 520 525Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile 530 535 540Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys545 550 555 560Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys 565 570 575Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro 580 585 590Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys 595 600 605Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln 610 615 620Leu Asp Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His625 630 635 640Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly 645 650 655Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val 660 665 670Lys Thr Ile His Thr Asp Asn Gly Ser Asn Phe Thr Gly Ala Thr Val 675 680 685Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro 690 695 700Tyr Asn Pro Gln Ser Gln Gly Val Val Glu Ser Met Asn Lys Glu Leu705 710 715 720Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr 725 730 735Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly 740 745 750Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr 755 760 765Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn 770 775 780Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro785 790 795 800Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn 805 810 815Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp 820 825 830Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp 835 840 845Glu Asp 850 3 2577 DNA Artificial Sequence Codon optimized DNA encoding inactivated Pol (IA-Pol) 3agatctacca tggcccccat ctcccccatt gagactgtgc ctgtgaagct gaagcctggc 60atggatggcc ccaaggtgaa gcagtggccc ctgactgagg agaagatcaa ggccctggtg 120gaaatctgca ctgagatgga gaaggagggc aaaatctcca agattggccc cgagaacccc 180tacaacaccc ctgtgtttgc catcaagaag aaggactcca ccaagtggag gaagctggtg 240gacttcaggg agctgaacaa gaggacccag gacttctggg aggtgcagct gggcatcccc 300caccccgctg gcctgaagaa gaagaagtct gtgactgtgc tggctgtggg ggatgcctac 360ttctctgtgc ccctggatga ggacttcagg aagtacactg ccttcaccat cccctccatc 420aacaatgaga cccctggcat caggtaccag tacaatgtgc tgccccaggg ctggaagggc 480tcccctgcca tcttccagtc ctccatgacc aagatcctgg agcccttcag gaagcagaac 540cctgacattg tgatctacca gtacatggct gccctgtatg tgggctctga cctggagatt 600gggcagcaca ggaccaagat tgaggagctg aggcagcacc tgctgaggtg gggcctgacc 660acccctgaca agaagcacca gaaggagccc cccttcctgt ggatgggcta tgagctgcac 720cccgacaagt ggactgtgca gcccattgtg ctgcctgaga aggactcctg gactgtgaat 780gacatccaga agctggtggg caagctgaac tgggcctccc aaatctaccc tggcatcaag 840gtgaggcagc tgtgcaagct gctgaggggc accaaggccc tgactgaggt gatccccctg 900actgaggagg ctgagctgga gctggctgag aacagggaga tcctgaagga gcctgtgcat 960ggggtgtact atgacccctc caaggacctg attgctgaga tccagaagca gggccagggc 1020cagtggacct accaaatcta ccaggagccc ttcaagaacc tgaagactgg caagtatgcc 1080aggatgaggg gggcccacac caatgatgtg aagcagctga ctgaggctgt gcagaagatc 1140accactgagt ccattgtgat ctggggcaag acccccaagt tcaagctgcc catccagaag 1200gagacctggg agacctggtg gactgagtac tggcaggcca cctggatccc tgagtgggag 1260tttgtgaaca ccccccccct ggtgaagctg tggtaccagc tggagaagga gcccattgtg 1320ggggctgaga ccttctatgt ggctggggct gccaacaggg agaccaagct gggcaaggct 1380ggctatgtga ccaacagggg caggcagaag gtggtgaccc tgactgacac caccaaccag 1440aagactgccc tccaggccat ctacctggcc ctccaggact ctggcctgga ggtgaacatt 1500gtgactgcct cccagtatgc cctgggcatc atccaggccc agcctgatca gtctgagtct 1560gagctggtga accagatcat tgagcagctg atcaagaagg agaaggtgta cctggcctgg 1620gtgcctgccc acaagggcat tgggggcaat gagcaggtgg acaagctggt gtctgctggc 1680atcaggaagg tgctgttcct ggatggcatt gacaaggccc aggatgagca tgagaagtac 1740cactccaact ggagggctat ggcctctgac ttcaacctgc cccctgtggt ggctaaggag 1800attgtggcct cctgtgacaa gtgccagctg aagggggagg ccatgcatgg gcaggtggac 1860tgctcccctg gcatctggca gctggcctgc acccacctgg agggcaaggt gatcctggtg 1920gctgtgcatg tggcctccgg ctacattgag gctgaggtga tccctgctga gacaggccag 1980gagactgcct acttcctgct gaagctggct ggcaggtggc ctgtgaagac catccacact 2040gccaatggct ccaacttcac tggggccaca gtgagggctg cctgctggtg ggctggcatc 2100aagcaggagt ttggcatccc ctacaacccc cagtcccagg gggtggtggc ctccatgaac 2160aaggagctga agaagatcat tgggcaggtg agggaccagg ctgagcacct gaagacagct 2220gtgcagatgg ctgtgttcat ccacaacttc aagaggaagg ggggcatcgg gggctactcc 2280gctggggaga ggattgtgga catcattgcc acagacatcc agaccaagga gctccagaag 2340cagatcacca agatccagaa cttcagggtg tactacaggg actccaggaa ccccctgtgg 2400aagggccctg ccaagctgct gtggaagggg gagggggctg tggtgatcca ggacaactct 2460gacatcaagg tggtgcccag gaggaaggcc aagatcatca gggactatgg caagcagatg 2520gctggggatg actgtgtggc ctccaggcag gatgaggact aaagcccggg cagatct 2577 4 850 PRT Artificial Sequence Codon optimized DNA inactivated Pol (IA-Pol) 4Met Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val Lys Leu Lys Pro 1 5 10 15Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu Thr Glu Glu Lys 20 25 30Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu Lys Glu Gly Lys 35 40 45Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr Pro Val Phe Ala 50 55 60Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu Val Asp Phe Arg65 70 75 80Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val Gln Leu Gly Ile 85 90 95Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val Thr Val Leu Ala 100 105 110Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu Asp Phe Arg Lys 115 120 125Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu Thr Pro Gly Ile 130 135 140Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys Gly Ser Pro Ala145 150 155 160Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro Phe Arg Lys Gln 165 170 175Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Ala Ala Leu Tyr Val Gly 180 185 190Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile Glu Glu Leu Arg 195 200 205Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp Lys Lys His Gln 210 215 220Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu His Pro Asp Lys225 230 235 240Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp Ser Trp Thr Val 245 250 255Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp Ala Ser Gln Ile 260 265 270Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu Leu Arg Gly Thr 275 280 285Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu Ala Glu Leu Glu 290 295 300Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val His Gly Val Tyr305 310 315 320Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln Lys Gln Gly Gln 325 330 335Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe Lys Asn Leu Lys 340 345 350Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr Asn Asp Val Lys 355 360 365Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu Ser Ile Val Ile 370 375 380Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln Lys Glu Thr Trp385 390 395 400Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp Ile Pro Glu Trp 405 410 415Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp Tyr Gln Leu Glu 420 425 430Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val Ala Gly Ala Ala 435 440 445Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val Thr Asn Arg Gly 450 455 460Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn Gln Lys Thr Ala465 470 475 480Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly Leu Glu Val Asn 485 490 495Ile Val Thr Ala Ser Gln Tyr Ala Leu Gly Ile Ile Gln Ala Gln Pro 500 505 510Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile Glu Gln Leu Ile 515 520 525Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala His Lys Gly Ile 530 535 540Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala Gly Ile Arg Lys545 550 555 560Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp Glu His Glu Lys 565 570 575Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe Asn Leu Pro Pro 580 585 590Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys Cys Gln Leu Lys 595 600 605Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro Gly Ile Trp Gln 610 615 620Leu Ala Cys Thr His Leu Glu Gly Lys Val Ile Leu Val Ala Val His625 630 635 640Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro Ala Glu Thr Gly 645 650 655Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly Arg Trp Pro Val 660 665 670Lys Thr Ile His Thr Ala Asn Gly Ser Asn Phe Thr Gly Ala Thr Val 675 680 685Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu Phe Gly Ile Pro 690 695 700Tyr Asn Pro Gln Ser Gln Gly Val Val Ala Ser Met Asn Lys Glu Leu705 710 715 720Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu His Leu Lys Thr 725 730 735Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys Arg Lys Gly Gly 740 745 750Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp Ile Ile Ala Thr 755 760 765Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr Lys Ile Gln Asn 770 775 780Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu Trp Lys Gly Pro785 790 795 800Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val Ile Gln Asp Asn 805 810 815Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys Ile Ile Arg Asp 820 825 830Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala Ser Arg Gln Asp 835 840 845Glu Asp 850 5 2650 DNA Artificial Sequence Codon optimized DNA encoding modified HIV-1 pol fused to an amino terminal localized leader sequence 5gatcaccatg gatgcaatga agagagggct ctgctgtgtg ctgctgctgt gtggagcagt 60cttcgtttcg cccagcgaga tctccgcccc catctccccc attgagactg tgcctgtgaa 120gctgaagcct ggcatggatg gccccaaggt gaagcagtgg cccctgactg aggagaagat 180caaggccctg gtggaaatct gcactgagat ggagaaggag ggcaaaatct ccaagattgg 240ccccgagaac ccctacaaca cccctgtgtt tgccatcaag aagaaggact ccaccaagtg 300gaggaagctg gtggacttca gggagctgaa caagaggacc caggacttct gggaggtgca 360gctgggcatc ccccaccccg ctggcctgaa gaagaagaag tctgtgactg tgctggatgt 420gggggatgcc tacttctctg tgcccctgga tgaggacttc aggaagtaca ctgccttcac 480catcccctcc atcaacaatg agacccctgg catcaggtac cagtacaatg tgctgcccca 540gggctggaag ggctcccctg ccatcttcca gtcctccatg accaagatcc tggagccctt 600caggaagcag aaccctgaca ttgtgatcta ccagtacatg gatgacctgt atgtgggctc 660tgacctggag attgggcagc acaggaccaa gattgaggag ctgaggcagc acctgctgag 720gtggggcctg accacccctg acaagaagca ccagaaggag ccccccttcc tgtggatggg 780ctatgagctg caccccgaca agtggactgt gcagcccatt gtgctgcctg agaaggactc 840ctggactgtg aatgacatcc agaagctggt gggcaagctg aactgggcct cccaaatcta 900ccctggcatc aaggtgaggc agctgtgcaa gctgctgagg ggcaccaagg ccctgactga 960ggtgatcccc ctgactgagg aggctgagct ggagctggct gagaacaggg agatcctgaa 1020ggagcctgtg catggggtgt actatgaccc ctccaaggac ctgattgctg agatccagaa 1080gcagggccag ggccagtgga cctaccaaat ctaccaggag cccttcaaga acctgaagac 1140tggcaagtat gccaggatga ggggggccca caccaatgat gtgaagcagc tgactgaggc 1200tgtgcagaag atcaccactg agtccattgt gatctggggc aagaccccca agttcaagct 1260gcccatccag aaggagacct gggagacctg gtggactgag tactggcagg ccacctggat 1320ccctgagtgg gagtttgtga acaccccccc cctggtgaag ctgtggtacc agctggagaa 1380ggagcccatt gtgggggctg agaccttcta tgtggatggg gctgccaaca gggagaccaa 1440gctgggcaag gctggctatg tgaccaacag gggcaggcag aaggtggtga ccctgactga 1500caccaccaac cagaagactg agctccaggc catctacctg gccctccagg actctggcct 1560ggaggtgaac attgtgactg actcccagta tgccctgggc atcatccagg cccagcctga 1620tcagtctgag tctgagctgg tgaaccagat cattgagcag ctgatcaaga aggagaaggt 1680gtacctggcc tgggtgcctg cccacaaggg cattgggggc aatgagcagg tggacaagct 1740ggtgtctgct ggcatcagga aggtgctgtt cctggatggc attgacaagg cccaggatga 1800gcatgagaag taccactcca actggagggc tatggcctct gacttcaacc tgccccctgt 1860ggtggctaag gagattgtgg cctcctgtga caagtgccag ctgaaggggg aggccatgca 1920tgggcaggtg gactgctccc ctggcatctg gcagctggac tgcacccacc tggagggcaa 1980ggtgatcctg gtggctgtgc atgtggcctc cggctacatt gaggctgagg tgatccctgc 2040tgagacaggc caggagactg cctacttcct gctgaagctg gctggcaggt ggcctgtgaa 2100gaccatccac actgacaatg gctccaactt cactggggcc acagtgaggg ctgcctgctg 2160gtgggctggc atcaagcagg agtttggcat cccctacaac ccccagtccc agggggtggt 2220ggagtccatg aacaaggagc tgaagaagat cattgggcag gtgagggacc aggctgagca 2280cctgaagaca gctgtgcaga tggctgtgtt catccacaac ttcaagagga aggggggcat 2340cgggggctac tccgctgggg agaggattgt ggacatcatt gccacagaca tccagaccaa 2400ggagctccag aagcagatca ccaagatcca gaacttcagg gtgtactaca gggactccag 2460gaaccccctg tggaagggcc ctgccaagct gctgtggaag ggggaggggg ctgtggtgat 2520ccaggacaac tctgacatca aggtggtgcc caggaggaag gccaagatca tcagggacta 2580tggcaagcag atggctgggg atgactgtgt ggcctccagg caggatgagg actaaagccc 2640gggcagatct 2650 6 875 PRT Artificial Sequence Codon optimized HIV-1 pol fused to an amino terminal localized leader sequence 6Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ala Pro Ile Ser Pro Ile 20 25 30Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val 35 40 45Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile 50 55 60Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu65 70 75 80Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr 85 90 95Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln 100 105 110Asp Phe Trp Glu Val Gln Leu Gly Ile Pro His Pro Ala Gly Leu Lys 115 120 125Lys Lys Lys Ser Val Thr Val Leu Asp Val Gly Asp Ala Tyr Phe Ser 130 135 140Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro145 150 155 160Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu 165 170 175Pro Gln Gly Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr 180 185 190Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr 195 200 205Gln Tyr Met Asp Asp Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln 210 215 220His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly225 230 235 240Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp 245 250 255Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val 260 265 270Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val 275 280 285Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg 290 295 300Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile305 310 315 320Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile 325 330 335Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu 340 345 350Ile Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile 355 360 365Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met 370 375 380Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln385 390 395 400Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe 405 410 415Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr 420 425 430Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro 435 440 445Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala 450 455 460Glu Thr Phe Tyr Val Asp Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly465 470 475 480Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu 485 490 495Thr Asp Thr Thr Asn Gln Lys Thr Glu Leu Gln Ala Ile Tyr Leu Ala 500 505 510Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Asp Ser Gln Tyr 515 520 525Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu 530 535 540Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu545 550 555 560Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp 565 570 575Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile 580 585 590Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala 595 600 605Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val 610 615 620Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln625 630 635 640Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Asp Cys Thr His Leu Glu 645 650 655Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu 660 665 670Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu 675 680 685Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Asp Asn 690 695 700Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala705 710 715 720Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly 725 730 735Val Val Glu Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val 740 745 750Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe 755 760 765Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly 770 775 780Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu785 790 795 800Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp 805 810 815Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly 820 825 830Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro 835 840 845Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly 850 855 860Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp865 870 875 7 2650 DNA Artificial Sequence Codon optimized DNA encoding human tPA leader fused to the IA-Pol protein 7gatcaccatg gatgcaatga agagagggct ctgctgtgtg ctgctgctgt gtggagcagt 60cttcgtttcg cccagcgaga tctccgcccc catctccccc attgagactg tgcctgtgaa 120gctgaagcct ggcatggatg gccccaaggt gaagcagtgg cccctgactg aggagaagat 180caaggccctg gtggaaatct gcactgagat ggagaaggag ggcaaaatct ccaagattgg 240ccccgagaac ccctacaaca cccctgtgtt tgccatcaag aagaaggact ccaccaagtg 300gaggaagctg gtggacttca gggagctgaa caagaggacc caggacttct gggaggtgca 360gctgggcatc ccccaccccg ctggcctgaa gaagaagaag tctgtgactg tgctggctgt 420gggggatgcc tacttctctg tgcccctgga tgaggacttc aggaagtaca ctgccttcac 480catcccctcc atcaacaatg agacccctgg catcaggtac cagtacaatg tgctgcccca 540gggctggaag ggctcccctg ccatcttcca gtcctccatg accaagatcc tggagccctt 600caggaagcag aaccctgaca ttgtgatcta ccagtacatg gctgccctgt atgtgggctc 660tgacctggag attgggcagc acaggaccaa gattgaggag ctgaggcagc acctgctgag 720gtggggcctg accacccctg acaagaagca ccagaaggag ccccccttcc tgtggatggg 780ctatgagctg caccccgaca agtggactgt gcagcccatt gtgctgcctg agaaggactc 840ctggactgtg aatgacatcc agaagctggt gggcaagctg aactgggcct cccaaatcta 900ccctggcatc aaggtgaggc agctgtgcaa gctgctgagg ggcaccaagg ccctgactga 960ggtgatcccc ctgactgagg aggctgagct ggagctggct gagaacaggg agatcctgaa 1020ggagcctgtg catggggtgt actatgaccc ctccaaggac ctgattgctg agatccagaa 1080gcagggccag ggccagtgga cctaccaaat ctaccaggag cccttcaaga acctgaagac 1140tggcaagtat gccaggatga ggggggccca caccaatgat gtgaagcagc tgactgaggc 1200tgtgcagaag atcaccactg agtccattgt gatctggggc aagaccccca agttcaagct 1260gcccatccag aaggagacct gggagacctg gtggactgag tactggcagg ccacctggat 1320ccctgagtgg gagtttgtga acaccccccc cctggtgaag ctgtggtacc agctggagaa 1380ggagcccatt gtgggggctg agaccttcta tgtggctggg gctgccaaca gggagaccaa 1440gctgggcaag gctggctatg tgaccaacag gggcaggcag aaggtggtga ccctgactga 1500caccaccaac cagaagactg ccctccaggc catctacctg gccctccagg actctggcct 1560ggaggtgaac attgtgactg cctcccagta tgccctgggc atcatccagg cccagcctga 1620tcagtctgag tctgagctgg tgaaccagat cattgagcag ctgatcaaga aggagaaggt 1680gtacctggcc tgggtgcctg cccacaaggg cattgggggc aatgagcagg tggacaagct 1740ggtgtctgct ggcatcagga aggtgctgtt cctggatggc attgacaagg cccaggatga 1800gcatgagaag taccactcca actggagggc tatggcctct gacttcaacc tgccccctgt 1860ggtggctaag gagattgtgg cctcctgtga caagtgccag ctgaaggggg aggccatgca 1920tgggcaggtg gactgctccc ctggcatctg gcagctggcc tgcacccacc tggagggcaa 1980ggtgatcctg gtggctgtgc atgtggcctc cggctacatt gaggctgagg tgatccctgc 2040tgagacaggc caggagactg cctacttcct gctgaagctg gctggcaggt ggcctgtgaa 2100gaccatccac actgccaatg gctccaactt cactggggcc acagtgaggg ctgcctgctg 2160gtgggctggc atcaagcagg agtttggcat cccctacaac ccccagtccc agggggtggt 2220ggcctccatg aacaaggagc tgaagaagat cattgggcag gtgagggacc aggctgagca 2280cctgaagaca gctgtgcaga tggctgtgtt catccacaac ttcaagagga aggggggcat 2340cgggggctac tccgctgggg agaggattgt ggacatcatt gccacagaca tccagaccaa 2400ggagctccag aagcagatca ccaagatcca gaacttcagg gtgtactaca gggactccag 2460gaaccccctg tggaagggcc ctgccaagct gctgtggaag ggggaggggg ctgtggtgat 2520ccaggacaac tctgacatca aggtggtgcc caggaggaag gccaagatca tcagggacta 2580tggcaagcag atggctgggg atgactgtgt ggcctccagg caggatgagg actaaagccc 2640gggcagatct 2650 8 875 PRT Artificial Sequence Codon optimized human tPA leader fused to the IA-Pol protein 8Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ala Pro Ile Ser Pro Ile 20 25 30Glu Thr Val Pro Val Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val 35 40 45Lys Gln Trp Pro Leu Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile 50 55 60Cys Thr Glu Met Glu Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu65 70 75 80Asn Pro Tyr Asn Thr Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr 85 90 95Lys Trp Arg Lys Leu Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln 100 105 110Asp Phe Trp Glu Val Gln Leu Gly Ile Pro His Pro Ala Gly Leu Lys 115 120 125Lys Lys Lys Ser Val Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser 130 135 140Val Pro Leu Asp Glu Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro145 150 155 160Ser Ile Asn Asn Glu Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu 165 170 175Pro Gln Gly Trp Lys Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr 180 185 190Lys Ile Leu Glu Pro Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr 195 200 205Gln Tyr Met Ala Ala Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln 210 215 220His Arg Thr Lys Ile Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly225 230 235 240Leu Thr Thr Pro Asp Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp 245 250 255Met Gly Tyr Glu Leu His Pro Asp Lys Trp Thr Val Gln Pro Ile Val 260 265 270Leu Pro Glu Lys Asp Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val 275 280 285Gly Lys Leu Asn Trp Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg 290 295 300Gln Leu Cys Lys Leu Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile305 310 315 320Pro Leu Thr Glu Glu Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile 325 330 335Leu Lys Glu Pro Val His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu 340 345 350Ile Ala Glu Ile Gln Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile 355 360 365Tyr Gln Glu Pro Phe Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met 370 375 380Arg Gly Ala His Thr Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln385 390 395 400Lys Ile Thr Thr Glu Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe 405 410 415Lys Leu Pro Ile Gln Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr 420 425 430Trp Gln Ala Thr Trp Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro 435 440 445Leu Val Lys Leu Trp Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala 450 455 460Glu Thr Phe Tyr Val Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly465 470 475 480Lys Ala Gly Tyr Val Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu 485 490 495Thr Asp Thr Thr Asn Gln Lys Thr Ala Leu Gln Ala Ile Tyr Leu Ala 500 505 510Leu Gln Asp Ser Gly Leu Glu Val Asn Ile Val Thr Ala Ser Gln Tyr 515 520 525Ala Leu Gly Ile Ile Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu 530 535 540Val Asn Gln Ile Ile Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu545 550 555 560Ala Trp Val Pro Ala His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp 565 570 575Lys Leu Val Ser Ala Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile 580 585 590Asp Lys Ala Gln Asp Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala 595 600 605Met Ala Ser Asp Phe Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val 610 615 620Ala Ser Cys Asp Lys Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln625 630 635 640Val Asp Cys Ser Pro Gly Ile Trp Gln Leu Ala Cys Thr His Leu Glu 645 650 655Gly Lys Val Ile Leu Val Ala Val His Val Ala Ser Gly Tyr Ile Glu 660 665 670Ala Glu Val Ile Pro Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu 675 680 685Leu Lys Leu Ala Gly Arg Trp Pro Val Lys Thr Ile His Thr Ala Asn 690 695 700Gly Ser Asn Phe Thr Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala705 710 715 720Gly Ile Lys Gln Glu Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly 725 730 735Val Val Ala Ser Met Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val 740 745 750Arg Asp Gln Ala Glu His Leu Lys Thr Ala Val Gln Met Ala Val Phe 755 760 765Ile His Asn Phe Lys Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly 770 775 780Glu Arg Ile Val Asp Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu785 790 795 800Gln Lys Gln Ile Thr Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp 805 810 815Ser Arg Asn Pro Leu Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly 820 825 830Glu Gly Ala Val Val Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro 835 840 845Arg Arg Lys Ala Lys Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly 850 855 860Asp Asp Cys Val Ala Ser Arg Gln Asp Glu Asp865 870 875 9 671 DNA Artificial Sequence Codon optimized DNA encoding HIV-1 nef from the HIV-1 jfrl isolate 9gatctgccac catgggcggc aagtggtcca agaggtccgt gcccggctgg tccaccgtga 60gggagaggat gaggagggcc gagcccgccg ccgacagggt gaggaggacc gagcccgccg 120ccgtgggcgt gggcgccgtg tccagggacc tggagaagca cggcgccatc acctcctcca 180acaccgccgc caccaacgcc gactgcgcct ggctggaggc ccaggaggac gaggaggtgg 240gcttccccgt gaggccccag gtgcccctga ggcccatgac ctacaagggc gccgtggacc 300tgtcccactt cctgaaggag aagggcggcc tggagggcct gatccactcc cagaagaggc 360aggacatcct ggacctgtgg gtgtaccaca cccagggcta cttccccgac tggcagaact 420acacccccgg ccccggcatc aggttccccc tgaccttcgg ctggtgcttc aagctggtgc 480ccgtggagcc cgagaaggtg gaggaggcca acgagggcga gaacaactgc ctgctgcacc 540ccatgtccca gcacggcatc gaggaccccg agaaggaggt gctggagtgg aggttcgact 600ccaagctggc cttccaccac gtggccaggg agctgcaccc cgagtactac aaggactgct 660aaagcccggg c 671 10 216 PRT Artificial Sequence Codon optimized HIV-1 nef from the HIV-1 jfrl isolate 10Met Gly Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val 1 5 10 15Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg 20 25 30Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu 35 40 45Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp 50 55 60Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val65 70 75 80Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp 85 90 95Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His 100 105 110Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln 115 120 125Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg 130 135 140Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro145 150 155 160Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Leu Leu His 165 170 175Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu 180 185 190Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu 195 200 205His Pro Glu Tyr Tyr Lys Asp Cys 210 215 11 719 DNA Artificial Sequence Codon optimized DNA encoding human plasminogen activator (tPA) leader fused with the NH2-terminus of HIV-1 nef 11catggatgca atgaagagag ggctctgctg tgtgctgctg ctgtgtggag cagtcttcgt 60ttcgcccagc gagatctcct ccaagaggtc cgtgcccggc tggtccaccg tgagggagag 120gatgaggagg gccgagcccg ccgccgacag ggtgaggagg accgagcccg ccgccgtggg 180cgtgggcgcc gtgtccaggg acctggagaa gcacggcgcc atcacctcct ccaacaccgc 240cgccaccaac gccgactgcg cctggctgga ggcccaggag gacgaggagg tgggcttccc 300cgtgaggccc caggtgcccc tgaggcccat gacctacaag ggcgccgtgg acctgtccca 360cttcctgaag gagaagggcg gcctggaggg cctgatccac tcccagaaga ggcaggacat 420cctggacctg tgggtgtacc acacccaggg ctacttcccc gactggcaga actacacccc 480cggccccggc atcaggttcc ccctgacctt cggctggtgc ttcaagctgg tgcccgtgga 540gcccgagaag gtggaggagg ccaacgaggg cgagaacaac tgcctgctgc accccatgtc 600ccagcacggc atcgaggacc ccgagaagga ggtgctggag tggaggttcg actccaagct 660ggccttccac cacgtggcca gggagctgca ccccgagtac tacaaggact gctaaagcc 719 12 237 PRT Artificial Sequence Codon optimized DNA for human plasminogen activator (tPA) leader fused with the NH2-terminus of HIV-1 nef 12Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ser Lys Arg Ser Val Pro 20 25 30Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala 35 40 45Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val 50 55 60Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala65 70 75 80Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu 85 90 95Val Gly Phe Pro Val Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr 100 105 110Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu 115 120 125Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp 130 135 140Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro145 150 155 160Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu 165 170 175Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn 180 185 190Asn Cys Leu Leu His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu 195 200 205Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His 210 215 220Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys225 230 235 13 671 DNA Artificial Sequence DNA encoding optimized modified HIV-1 nef 13gatctgccac catggccggc aagtggtcca agaggtccgt gcccggctgg tccaccgtga 60gggagaggat gaggagggcc gagcccgccg ccgacagggt gaggaggacc gagcccgccg 120ccgtgggcgt gggcgccgtg tccagggacc tggagaagca cggcgccatc acctcctcca 180acaccgccgc caccaacgcc gactgcgcct ggctggaggc ccaggaggac gaggaggtgg 240gcttccccgt gaggccccag gtgcccctga ggcccatgac ctacaagggc gccgtggacc 300tgtcccactt cctgaaggag aagggcggcc tggagggcct gatccactcc cagaagaggc 360aggacatcct ggacctgtgg gtgtaccaca cccagggcta cttccccgac tggcagaact 420acacccccgg ccccggcatc aggttccccc tgaccttcgg ctggtgcttc aagctggtgc 480ccgtggagcc cgagaaggtg gaggaggcca acgagggcga gaacaactgc gccgcccacc 540ccatgtccca gcacggcatc gaggaccccg agaaggaggt gctggagtgg aggttcgact 600ccaagctggc cttccaccac gtggccaggg agctgcaccc cgagtactac aaggactgct 660aaagcccggg c 671 14 217 PRT Artificial Sequence Codon optimized modified HIV-1 nef 14Met Ala Gly Lys Trp Ser Lys Arg Ser Val Pro Gly Trp Ser Thr Val 1 5 10 15Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala Asp Arg Val Arg Arg 20 25 30Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val Ser Arg Asp Leu Glu 35 40 45Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala Ala Thr Asn Ala Asp 50 55 60Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu Val Gly Phe Pro Val65 70 75 80Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr Lys Gly Ala Val Asp 85 90 95Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu Glu Gly Leu Ile His 100 105 110Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp Val Tyr His Thr Gln 115 120 125Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro Gly Pro Gly Ile Arg 130 135 140Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu Val Pro Val Glu Pro145 150 155 160Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn Asn Cys Ala Ala His 165 170 175Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu Lys Glu Val Leu Glu 180 185 190Trp Arg Phe Asp Ser Lys Leu Ala Phe His His Val Ala Arg Glu Leu 195 200 205His Pro Glu Tyr Tyr Lys Asp Cys Ser 210 215 15 720 DNA Artificial Sequence Codon optimized DNA encoding modified HIV-1nef fused to a leader sequence 15catggatgca atgaagagag ggctctgctg tgtgctgctg ctgtgtggag cagtcttcgt 60ttcgcccagc gagatctcct ccaagaggtc cgtgcccggc tggtccaccg tgagggagag 120gatgaggagg gccgagcccg ccgccgacag ggtgaggagg accgagcccg ccgccgtggg 180cgtgggcgcc gtgtccaggg acctggagaa gcacggcgcc atcacctcct ccaacaccgc 240cgccaccaac gccgactgcg cctggctgga ggcccaggag gacgaggagg tgggcttccc 300cgtgaggccc caggtgcccc tgaggcccat gacctacaag ggcgccgtgg acctgtccca 360cttcctgaag gagaagggcg gcctggaggg cctgatccac tcccagaaga ggcaggacat 420cctggacctg tgggtgtacc acacccaggg ctacttcccc gactggcaga actacacccc 480cggccccggc atcaggttcc ccctgacctt cggctggtgc ttcaagctgg tgcccgtgga 540gcccgagaag gtggaggagg ccaacgaggg cgagaacaac tgcgccgccc accccatgtc 600ccagcacggc atcgaggacc ccgagaagga ggtgctggag tggaggttcg actccaagct 660ggccttccac cacgtggcca gggagctgca ccccgagtac tacaaggact gctaaagccc 720 16 237 PRT Artificial Sequence Codon optimized modified HIV-1 nef fused to a leader sequence 16Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ser Lys Arg Ser Val Pro 20 25 30Gly Trp Ser Thr Val Arg Glu Arg Met Arg Arg Ala Glu Pro Ala Ala 35 40 45Asp Arg Val Arg Arg Thr Glu Pro Ala Ala Val Gly Val Gly Ala Val 50 55 60Ser Arg Asp Leu Glu Lys His Gly Ala Ile Thr Ser Ser Asn Thr Ala65 70 75 80Ala Thr Asn Ala Asp Cys Ala Trp Leu Glu Ala Gln Glu Asp Glu Glu 85 90 95Val Gly Phe Pro Val Arg Pro Gln Val Pro Leu Arg Pro Met Thr Tyr 100 105 110Lys Gly Ala Val Asp Leu Ser His Phe Leu Lys Glu Lys Gly Gly Leu 115 120 125Glu Gly Leu Ile His Ser Gln Lys Arg Gln Asp Ile Leu Asp Leu Trp 130 135 140Val Tyr His Thr Gln Gly Tyr Phe Pro Asp Trp Gln Asn Tyr Thr Pro145 150 155 160Gly Pro Gly Ile Arg Phe Pro Leu Thr Phe Gly Trp Cys Phe Lys Leu 165 170 175Val Pro Val Glu Pro Glu Lys Val Glu Glu Ala Asn Glu Gly Glu Asn 180 185 190Asn Cys Ala Ala His Pro Met Ser Gln His Gly Ile Glu Asp Pro Glu 195 200 205Lys Glu Val Leu Glu Trp Arg Phe Asp Ser Lys Leu Ala Phe His His 210 215 220Val Ala Arg Glu Leu His Pro Glu Tyr Tyr Lys Asp Cys225 230 235 17 27 PRT Artificial Sequence Amino acid sequence of human tPA leader 17Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ser 20 25 18 49 DNA Artificial Sequence Short synthetic polyA signal (SPA) 18aataaaagat ctttattttc attagatctg tgtgttggtt ttttgtgtg 49 19 651 DNA Human Immunodeficiency Virus 19atgggtggca agtggtcaaa acgtagtgtg cctggatggt ctactgtaag ggaaagaatg 60agacgagctg agccagcagc agatagggtg agacgaactg agccagcagc agtaggggtg 120ggagcagtat ctcgagacct ggaaaaacat ggagcaatca caagtagcaa tacagcagct 180accaatgctg attgtgcctg gctagaagca caagaggatg aggaagtggg ttttccagtc 240agacctcagg tacctttaag accaatgact tacaagggag ctgtagatct tagccacttt 300ttaaaagaaa aggggggact ggaagggcta attcactcac agaaaagaca agatatcctt 360gatctgtggg tctaccacac acaaggctac ttccctgatt ggcagaacta cacaccaggg 420ccaggaatca gatttccatt gacctttgga tggtgcttca agctagtacc agttgagcca 480gaaaaggtag aagaggccaa tgaaggagag aacaactgct tgttacaccc tatgagccag 540catgggatag aggacccgga gaaggaagtg ttagagtgga ggtttgacag caagctagca 600tttcatcacg tggcccgaga gctgcatccg gagtactaca aggactgctg a 651 20 35 DNA Artificial Sequence PCR primer 20ataagaatgc ggccgccata tactgagtca ttagg 35 21 31 DNA Artificial Sequence PCR primer 21aaggaagatc taccgacgct ggtcgcgcct c 31 22 34 DNA Artificial Sequence PCR primer 22ataagaatgg cgcgccatat actgagtcat tagg 34 23 31 DNA Artificial Sequence PCR primer 23aaggaagatc taccgacgct ggtcgcgcct c 31 24 30 DNA Artificial Sequence PCR primer 24attggatcca tggatgcaat gaagagaggg 30 25 37474 DNA Artificial Sequence DNA encoding pMRKAd5 HIV-1 gag, coding 25ttcttaatta acatcatcaa taatatacct tattttggat tgaagccaat atgataatga 60gggggtggag tttgtgacgt ggcgcggggc gtgggaacgg ggcgggtgac gtagtagtgt 120ggcggaagtg tgatgttgca agtgtggcgg aacacatgta agcgacggat gtggcaaaag 180tgacgttttt ggtgtgcgcc ggtgtacaca ggaagtgaca attttcgcgc ggttttaggc 240ggatgttgta gtaaatttgg gcgtaaccga gtaagatttg gccattttcg cgggaaaact 300gaataagagg aagtgaaatc tgaataattt tgtgttactc atagcgcgta atatttgtct 360agggccgcgg ggactttgac cgtttacgtg gagactcgcc caggtgtttt tctcaggtgt 420tttccgcgtt ccgggtcaaa gttggcgttt tattattata ggcggccgcg atccattgca 480tacgttgtat ccatatcata atatgtacat ttatattggc tcatgtccaa cattaccgcc 540atgttgacat tgattattga ctagttatta atagtaatca attacggggt cattagttca 600tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc 660gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat 720agggactttc cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt 780acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc 840cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta 900cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg 960atagcggttt gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt 1020gttttggcac caaaatcaac gggactttcc aaaatgtcgt aacaactccg ccccattgac 1080gcaaatgggc ggtaggcgtg tacggtggga ggtctatata agcagagctc gtttagtgaa 1140ccgtcagatc gcctggagac gccatccacg ctgttttgac ctccatagaa gacaccggga 1200ccgatccagc ctccgcggcc gggaacggtg cattggaacg cggattcccc gtgccaagag 1260tgagatctac catgggtgct agggcttctg tgctgtctgg tggtgagctg gacaagtggg 1320agaagatcag gctgaggcct ggtggcaaga agaagtacaa gctaaagcac attgtgtggg 1380cctccaggga gctggagagg tttgctgtga accctggcct gctggagacc tctgaggggt 1440gcaggcagat cctgggccag ctccagccct ccctgcaaac aggctctgag gagctgaggt 1500ccctgtacaa cacagtggct accctgtact gtgtgcacca gaagattgat gtgaaggaca 1560ccaaggaggc cctggagaag attgaggagg agcagaacaa gtccaagaag aaggcccagc 1620aggctgctgc tggcacaggc aactccagcc aggtgtccca gaactacccc attgtgcaga 1680acctccaggg ccagatggtg caccaggcca tctccccccg gaccctgaat gcctgggtga 1740aggtggtgga ggagaaggcc ttctcccctg aggtgatccc catgttctct gccctgtctg 1800agggtgccac cccccaggac ctgaacacca tgctgaacac agtggggggc catcaggctg 1860ccatgcagat gctgaaggag accatcaatg aggaggctgc tgagtgggac aggctgcatc 1920ctgtgcacgc tggccccatt gcccccggcc agatgaggga gcccaggggc tctgacattg 1980ctggcaccac ctccaccctc caggagcaga ttggctggat gaccaacaac ccccccatcc 2040ctgtggggga aatctacaag aggtggatca tcctgggcct gaacaagatt gtgaggatgt 2100actcccccac ctccatcctg gacatcaggc agggccccaa ggagcccttc agggactatg 2160tggacaggtt ctacaagacc ctgagggctg agcaggcctc ccaggaggtg aagaactgga 2220tgacagagac cctgctggtg cagaatgcca accctgactg caagaccatc ctgaaggccc 2280tgggccctgc tgccaccctg gaggagatga tgacagcctg ccagggggtg gggggccctg 2340gtcacaaggc cagggtgctg gctgaggcca tgtcccaggt gaccaactcc gccaccatca 2400tgatgcagag gggcaacttc aggaaccaga ggaagacagt gaagtgcttc aactgtggca 2460aggtgggcca cattgccaag aactgtaggg cccccaggaa gaagggctgc tggaagtgtg 2520gcaaggaggg ccaccagatg aaggactgca atgagaggca ggccaacttc ctgggcaaaa 2580tctggccctc ccacaagggc aggcctggca acttcctcca gtccaggcct gagcccacag 2640cccctcccga ggagtccttc aggtttgggg aggagaagac cacccccagc cagaagcagg 2700agcccattga caaggagctg taccccctgg cctccctgag gtccctgttt ggcaacgacc 2760cctcctccca gtaaaataaa gcccgggcag atctgctgtg ccttctagtt gccagccatc 2820tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct 2880ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg 2940gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg 3000ggatgcggtg ggctctatgg ccgatcggcg cgccgtactg aaatgtgtgg gcgtggctta 3060agggtgggaa agaatatata aggtgggggt cttatgtagt tttgtatctg ttttgcagca 3120gccgccgccg ccatgagcac caactcgttt gatggaagca ttgtgagctc atatttgaca 3180acgcgcatgc ccccatgggc cggggtgcgt cagaatgtga tgggctccag cattgatggt 3240cgccccgtcc tgcccgcaaa ctctactacc ttgacctacg agaccgtgtc tggaacgccg 3300ttggagactg cagcctccgc cgccgcttca gccgctgcag ccaccgcccg cgggattgtg 3360actgactttg ctttcctgag cccgcttgca aacagtgcag cttcccgttc atccgcccgc 3420gatgacaagt tgacggctct tttggcacaa ttggattctt tgacccggga acttaatgtc 3480gtttctcagc agctgttgga tctgcgccag caggtttctg ccctgaaggc ttcctcccct 3540cccaatgcgg tttaaaacat aaataaaaaa ccagactctg tttggatttg gatcaagcaa 3600gtgtcttgct gtctttattt aggggttttg cgcgcgcggt aggcccggga ccagcggtct 3660cggtcgttga gggtcctgtg tattttttcc aggacgtggt aaaggtgact ctggatgttc 3720agatacatgg gcataagccc gtctctgggg tggaggtagc accactgcag agcttcatgc 3780tgcggggtgg tgttgtagat gatccagtcg tagcaggagc gctgggcgtg gtgcctaaaa 3840atgtctttca gtagcaagct gattgccagg ggcaggccct tggtgtaagt gtttacaaag 3900cggttaagct gggatgggtg catacgtggg gatatgagat gcatcttgga ctgtattttt 3960aggttggcta tgttcccagc catatccctc cggggattca tgttgtgcag aaccaccagc 4020acagtgtatc cggtgcactt gggaaatttg tcatgtagct tagaaggaaa tgcgtggaag 4080aacttggaga cgcccttgtg acctccaaga ttttccatgc attcgtccat aatgatggca 4140atgggcccac gggcggcggc ctgggcgaag atatttctgg gatcactaac gtcatagttg 4200tgttccagga tgagatcgtc ataggccatt tttacaaagc gcgggcggag ggtgccagac 4260tgcggtataa tggttccatc cggcccaggg gcgtagttac cctcacagat ttgcatttcc 4320cacgctttga gttcagatgg ggggatcatg tctacctgcg gggcgatgaa gaaaacggtt 4380tccggggtag gggagatcag ctgggaagaa agcaggttcc tgagcagctg cgacttaccg 4440cagccggtgg gcccgtaaat cacacctatt accggctgca actggtagtt aagagagctg 4500cagctgccgt catccctgag caggggggcc acttcgttaa gcatgtccct gactcgcatg 4560ttttccctga ccaaatccgc cagaaggcgc tcgccgccca gcgatagcag ttcttgcaag 4620gaagcaaagt ttttcaacgg tttgagaccg tccgccgtag gcatgctttt gagcgtttga 4680ccaagcagtt ccaggcggtc ccacagctcg gtcacctgct ctacggcatc tcgatccagc 4740atatctcctc gtttcgcggg ttggggcggc tttcgctgta cggcagtagt cggtgctcgt 4800ccagacgggc cagggtcatg tctttccacg ggcgcagggt cctcgtcagc gtagtctggg 4860tcacggtgaa ggggtgcgct ccgggctgcg cgctggccag ggtgcgcttg aggctggtcc 4920tgctggtgct gaagcgctgc cggtcttcgc cctgcgcgtc ggccaggtag catttgacca 4980tggtgtcata gtccagcccc tccgcggcgt ggcccttggc gcgcagcttg cccttggagg 5040aggcgccgca cgaggggcag tgcagacttt tgagggcgta gagcttgggc gcgagaaata 5100ccgattccgg ggagtaggca tccgcgccgc aggccccgca gacggtctcg cattccacga 5160gccaggtgag ctctggccgt tcggggtcaa aaaccaggtt tcccccatgc tttttgatgc 5220gtttcttacc tctggtttcc atgagccggt gtccacgctc ggtgacgaaa aggctgtccg 5280tgtccccgta tacagacttg agaggcctgt cctcgagcgg tgttccgcgg tcctcctcgt 5340atagaaactc ggaccactct gagacaaagg ctcgcgtcca ggccagcacg aaggaggcta 5400agtgggaggg gtagcggtcg ttgtccacta gggggtccac tcgctccagg gtgtgaagac 5460acatgtcgcc ctcttcggca tcaaggaagg tgattggttt gtaggtgtag gccacgtgac 5520cgggtgttcc tgaagggggg ctataaaagg gggtgggggc gcgttcgtcc tcactctctt 5580ccgcatcgct gtctgcgagg gccagctgtt ggggtgagta ctccctctga aaagcgggca 5640tgacttctgc gctaagattg tcagtttcca aaaacgagga ggatttgata ttcacctggc 5700ccgcggtgat gcctttgagg gtggccgcat ccatctggtc agaaaagaca atctttttgt 5760tgtcaagctt ggtggcaaac gacccgtaga gggcgttgga cagcaacttg gcgatggagc 5820gcagggtttg gtttttgtcg cgatcggcgc gctccttggc cgcgatgttt agctgcacgt 5880attcgcgcgc aacgcaccgc cattcgggaa agacggtggt gcgctcgtcg ggcaccaggt 5940gcacgcgcca accgcggttg tgcagggtga caaggtcaac gctggtggct acctctccgc 6000gtaggcgctc gttggtccag cagaggcggc cgcccttgcg cgagcagaat ggcggtaggg 6060ggtctagctg cgtctcgtcc ggggggtctg cgtccacggt aaagaccccg ggcagcaggc 6120gcgcgtcgaa gtagtctatc ttgcatcctt gcaagtctag cgcctgctgc catgcgcggg 6180cggcaagcgc gcgctcgtat gggttgagtg ggggacccca tggcatgggg tgggtgagcg 6240cggaggcgta catgccgcaa atgtcgtaaa cgtagagggg ctctctgagt attccaagat 6300atgtagggta gcatcttcca ccgcggatgc tggcgcgcac gtaatcgtat agttcgtgcg 6360agggagcgag gaggtcggga ccgaggttgc tacgggcggg ctgctctgct cggaagacta 6420tctgcctgaa gatggcatgt gagttggatg atatggttgg acgctggaag acgttgaagc 6480tggcgtctgt gagacctacc gcgtcacgca cgaaggaggc gtaggagtcg cgcagcttgt 6540tgaccagctc ggcggtgacc tgcacgtcta gggcgcagta gtccagggtt tccttgatga 6600tgtcatactt atcctgtccc ttttttttcc acagctcgcg gttgaggaca aactcttcgc 6660ggtctttcca gtactcttgg atcggaaacc cgtcggcctc cgaacggtaa gagcctagca 6720tgtagaactg gttgacggcc tggtaggcgc agcatccctt ttctacgggt agcgcgtatg 6780cctgcgcggc cttccggagc gaggtgtggg tgagcgcaaa ggtgtccctg accatgactt 6840tgaggtactg gtatttgaag tcagtgtcgt cgcatccgcc ctgctcccag agcaaaaagt 6900ccgtgcgctt tttggaacgc ggatttggca gggcgaaggt gacatcgttg aagagtatct 6960ttcccgcgcg aggcataaag ttgcgtgtga tgcggaaggg tcccggcacc tcggaacggt 7020tgttaattac ctgggcggcg agcacgatct cgtcaaagcc gttgatgttg tggcccacaa 7080tgtaaagttc caagaagcgc gggatgccct tgatggaagg caatttttta agttcctcgt 7140aggtgagctc ttcaggggag ctgagcccgt gctctgaaag ggcccagtct gcaagatgag 7200ggttggaagc gacgaatgag ctccacaggt cacgggccat tagcatttgc aggtggtcgc 7260gaaaggtcct aaactggcga cctatggcca ttttttctgg ggtgatgcag tagaaggtaa 7320gcgggtcttg ttcccagcgg tcccatccaa ggttcgcggc taggtctcgc gcggcagtca 7380ctagaggctc atctccgccg aacttcatga ccagcatgaa gggcacgagc tgcttcccaa 7440aggcccccat ccaagtatag gtctctacat cgtaggtgac aaagagacgc tcggtgcgag 7500gatgcgagcc gatcgggaag aactggatct cccgccacca attggaggag tggctattga 7560tgtggtgaaa gtagaagtcc ctgcgacggg ccgaacactc gtgctggctt ttgtaaaaac 7620gtgcgcagta ctggcagcgg tgcacgggct gtacatcctg cacgaggttg acctgacgac 7680cgcgcacaag gaagcagagt gggaatttga gcccctcgcc tggcgggttt ggctggtggt 7740cttctacttc ggctgcttgt ccttgaccgt ctggctgctc gaggggagtt acggtggatc 7800ggaccaccac gccgcgcgag cccaaagtcc agatgtccgc gcgcggcggt cggagcttga 7860tgacaacatc gcgcagatgg gagctgtcca tggtctggag ctcccgcggc gtcaggtcag 7920gcgggagctc ctgcaggttt acctcgcata gacgggtcag ggcgcgggct agatccaggt 7980gatacctaat ttccaggggc tggttggtgg cggcgtcgat ggcttgcaag aggccgcatc 8040cccgcggcgc gactacggta ccgcgcggcg ggcggtgggc cgcgggggtg tccttggatg 8100atgcatctaa aagcggtgac gcgggcgagc ccccggaggt agggggggct ccggacccgc 8160cgggagaggg ggcaggggca cgtcggcgcc gcgcgcgggc aggagctggt gctgcgcgcg 8220taggttgctg gcgaacgcga cgacgcggcg gttgatctcc tgaatctggc gcctctgcgt 8280gaagacgacg ggcccggtga gcttgaacct gaaagagagt tcgacagaat caatttcggt 8340gtcgttgacg gcggcctggc gcaaaatctc ctgcacgtct cctgagttgt cttgataggc 8400gatctcggcc atgaactgct cgatctcttc ctcctggaga tctccgcgtc cggctcgctc 8460cacggtggcg gcgaggtcgt tggaaatgcg ggccatgagc tgcgagaagg cgttgaggcc 8520tccctcgttc cagacgcggc tgtagaccac gcccccttcg gcatcgcggg cgcgcatgac 8580cacctgcgcg agattgagct ccacgtgccg ggcgaagacg gcgtagtttc gcaggcgctg 8640aaagaggtag ttgagggtgg tggcggtgtg ttctgccacg aagaagtaca taacccagcg 8700tcgcaacgtg gattcgttga tatcccccaa ggcctcaagg cgctccatgg cctcgtagaa 8760gtccacggcg aagttgaaaa actgggagtt gcgcgccgac acggttaact cctcctccag 8820aagacggatg agctcggcga cagtgtcgcg cacctcgcgc tcaaaggcta caggggcctc 8880ttcttcttct tcaatctcct cttccataag ggcctcccct tcttcttctt ctggcggcgg 8940tgggggaggg gggacacggc ggcgacgacg gcgcaccggg aggcggtcga caaagcgctc 9000gatcatctcc ccgcggcgac ggcgcatggt ctcggtgacg gcgcggccgt tctcgcgggg 9060gcgcagttgg aagacgccgc ccgtcatgtc ccggttatgg gttggcgggg ggctgccatg 9120cggcagggat acggcgctaa cgatgcatct caacaattgt tgtgtaggta ctccgccgcc 9180gagggacctg agcgagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 9240ccagtcacag tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggc ggcggtcggg 9300gttgtttctg gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagacggcg 9360gatggtcgac agaagcacca tgtccttggg tccggcctgc tgaatgcgca ggcggtcggc 9420catgccccag gcttcgtttt gacatcggcg caggtctttg tagtagtctt gcatgagcct 9480ttctaccggc acttcttctt ctccttcctc ttgtcctgca tctcttgcat ctatcgctgc 9540ggcggcggcg gagtttggcc gtaggtggcg ccctcttcct cccatgcgtg tgaccccgaa 9600gcccctcatc ggctgaagca gggctaggtc ggcgacaacg cgctcggcta atatggcctg 9660ctgcacctgc gtgagggtag actggaagtc atccatgtcc acaaagcggt ggtatgcgcc 9720cgtgttgatg gtgtaagtgc agttggccat aacggaccag ttaacggtct ggtgacccgg 9780ctgcgagagc tcggtgtacc tgagacgcga gtaagccctc gagtcaaata cgtagtcgtt 9840gcaagtccgc accaggtact ggtatcccac caaaaagtgc ggcggcggct ggcggtagag 9900gggccagcgt agggtggccg gggctccggg ggcgagatct tccaacataa ggcgatgata 9960tccgtagatg tacctggaca tccaggtgat gccggcggcg gtggtggagg cgcgcggaaa 10020gtcgcggacg cggttccaga tgttgcgcag cggcaaaaag tgctccatgg tcgggacgct 10080ctggccggtc aggcgcgcgc aatcgttgac gctctagacc gtgcaaaagg agagcctgta 10140agcgggcact cttccgtggt ctggtggata aattcgcaag ggtatcatgg cggacgaccg 10200gggttcgagc cccgtatccg gccgtccgcc gtgatccatg cggttaccgc ccgcgtgtcg 10260aacccaggtg tgcgacgtca gacaacgggg gagtgctcct tttggcttcc ttccaggcgc 10320ggcggctgct gcgctagctt ttttggccac tggccgcgcg cagcgtaagc ggttaggctg 10380gaaagcgaaa gcattaagtg gctcgctccc tgtagccgga gggttatttt ccaagggttg 10440agtcgcggga cccccggttc gagtctcgga ccggccggac tgcggcgaac gggggtttgc 10500ctccccgtca tgcaagaccc cgcttgcaaa ttcctccgga aacagggacg agcccctttt 10560ttgcttttcc cagatgcatc cggtgctgcg gcagatgcgc ccccctcctc agcagcggca 10620agagcaagag cagcggcaga catgcagggc accctcccct cctcctaccg cgtcaggagg 10680ggcgacatcc gcggttgacg cggcagcaga tggtgattac gaacccccgc ggcgccgggc 10740ccggcactac ctggacttgg aggagggcga gggcctggcg cggctaggag cgccctctcc 10800tgagcggcac ccaagggtgc agctgaagcg tgatacgcgt gaggcgtacg tgccgcggca 10860gaacctgttt cgcgaccgcg agggagagga gcccgaggag atgcgggatc gaaagttcca 10920cgcagggcgc gagctgcggc atggcctgaa tcgcgagcgg ttgctgcgcg aggaggactt 10980tgagcccgac gcgcgaaccg ggattagtcc cgcgcgcgca cacgtggcgg ccgccgacct 11040ggtaaccgca tacgagcaga cggtgaacca ggagattaac tttcaaaaaa gctttaacaa 11100ccacgtgcgt acgcttgtgg cgcgcgagga ggtggctata ggactgatgc atctgtggga 11160ctttgtaagc gcgctggagc aaaacccaaa tagcaagccg ctcatggcgc agctgttcct 11220tatagtgcag cacagcaggg acaacgaggc attcagggat gcgctgctaa acatagtaga 11280gcccgagggc cgctggctgc tcgatttgat aaacatcctg cagagcatag tggtgcagga 11340gcgcagcttg agcctggctg acaaggtggc cgccatcaac tattccatgc ttagcctggg 11400caagttttac gcccgcaaga tataccatac cccttacgtt cccatagaca aggaggtaaa 11460gatcgagggg ttctacatgc gcatggcgct gaaggtgctt accttgagcg acgacctggg 11520cgtttatcgc aacgagcgca tccacaaggc cgtgagcgtg agccggcggc gcgagctcag 11580cgaccgcgag ctgatgcaca gcctgcaaag ggccctggct ggcacgggca gcggcgatag 11640agaggccgag tcctactttg acgcgggcgc tgacctgcgc tgggccccaa gccgacgcgc 11700cctggaggca gctggggccg gacctgggct ggcggtggca cccgcgcgcg ctggcaacgt 11760cggcggcgtg gaggaatatg acgaggacga tgagtacgag ccagaggacg gcgagtacta 11820agcggtgatg tttctgatca gatgatgcaa gacgcaacgg acccggcggt gcgggcggcg 11880ctgcagagcc agccgtccgg ccttaactcc acggacgact ggcgccaggt catggaccgc 11940atcatgtcgc tgactgcgcg caatcctgac gcgttccggc agcagccgca ggccaaccgg 12000ctctccgcaa ttctggaagc ggtggtcccg gcgcgcgcaa accccacgca cgagaaggtg 12060ctggcgatcg taaacgcgct ggccgaaaac agggccatcc ggcccgacga ggccggcctg 12120gtctacgacg cgctgcttca gcgcgtggct cgttacaaca gcggcaacgt gcagaccaac 12180ctggaccggc tggtggggga tgtgcgcgag gccgtggcgc agcgtgagcg cgcgcagcag 12240cagggcaacc tgggctccat ggttgcacta aacgccttcc tgagtacaca gcccgccaac 12300gtgccgcggg gacaggagga ctacaccaac tttgtgagcg cactgcggct aatggtgact 12360gagacaccgc aaagtgaggt gtaccagtct gggccagact attttttcca gaccagtaga 12420caaggcctgc agaccgtaaa cctgagccag gctttcaaaa acttgcaggg gctgtggggg 12480gtgcgggctc ccacaggcga ccgcgcgacc gtgtctagct tgctgacgcc caactcgcgc 12540ctgttgctgc tgctaatagc gcccttcacg gacagtggca gcgtgtcccg ggacacatac 12600ctaggtcact tgctgacact gtaccgcgag gccataggtc aggcgcatgt ggacgagcat 12660actttccagg agattacaag tgtcagccgc gcgctggggc aggaggacac gggcagcctg 12720gaggcaaccc taaactacct gctgaccaac cggcggcaga agatcccctc gttgcacagt 12780ttaaacagcg aggaggagcg cattttgcgc tacgtgcagc agagcgtgag ccttaacctg 12840atgcgcgacg gggtaacgcc cagcgtggcg ctggacatga ccgcgcgcaa catggaaccg 12900ggcatgtatg cctcaaaccg gccgtttatc aaccgcctaa tggactactt gcatcgcgcg 12960gccgccgtga accccgagta tttcaccaat gccatcttga acccgcactg gctaccgccc 13020cctggtttct acaccggggg attcgaggtg cccgagggta acgatggatt cctctgggac 13080gacatagacg acagcgtgtt ttccccgcaa ccgcagaccc tgctagagtt gcaacagcgc 13140gagcaggcag aggcggcgct gcgaaaggaa agcttccgca ggccaagcag cttgtccgat 13200ctaggcgctg cggccccgcg gtcagatgct agtagcccat ttccaagctt gatagggtct 13260cttaccagca ctcgcaccac ccgcccgcgc ctgctgggcg aggaggagta cctaaacaac 13320tcgctgctgc agccgcagcg cgaaaaaaac ctgcctccgg catttcccaa caacgggata 13380gagagcctag tggacaagat gagtagatgg aagacgtacg cgcaggagca cagggacgtg 13440ccaggcccgc gcccgcccac ccgtcgtcaa aggcacgacc gtcagcgggg tctggtgtgg 13500gaggacgatg actcggcaga cgacagcagc gtcctggatt tgggagggag tggcaacccg 13560tttgcgcacc ttcgccccag gctggggaga atgttttaaa aaaaaaaaaa gcatgatgca 13620aaataaaaaa ctcaccaagg ccatggcacc gagcgttggt tttcttgtat tccccttagt 13680atgcggcgcg cggcgatgta tgaggaaggt cctcctccct cctacgagag tgtggtgagc 13740gcggcgccag tggcggcggc gctgggttct cccttcgatg ctcccctgga cccgccgttt 13800gtgcctccgc ggtacctgcg gcctaccggg gggagaaaca gcatccgtta ctctgagttg 13860gcacccctat tcgacaccac ccgtgtgtac ctggtggaca acaagtcaac ggatgtggca 13920tccctgaact accagaacga ccacagcaac tttctgacca cggtcattca aaacaatgac 13980tacagcccgg gggaggcaag cacacagacc atcaatcttg acgaccggtc gcactggggc 14040ggcgacctga aaaccatcct gcataccaac atgccaaatg tgaacgagtt catgtttacc 14100aataagttta aggcgcgggt gatggtgtcg cgcttgccta ctaaggacaa tcaggtggag 14160ctgaaatacg agtgggtgga gttcacgctg cccgagggca actactccga gaccatgacc 14220atagacctta tgaacaacgc gatcgtggag cactacttga aagtgggcag acagaacggg 14280gttctggaaa gcgacatcgg ggtaaagttt gacacccgca acttcagact ggggtttgac 14340cccgtcactg gtcttgtcat gcctggggta tatacaaacg aagccttcca tccagacatc 14400attttgctgc caggatgcgg ggtggacttc acccacagcc gcctgagcaa cttgttgggc 14460atccgcaagc ggcaaccctt ccaggagggc tttaggatca cctacgatga tctggagggt 14520ggtaacattc ccgcactgtt ggatgtggac gcctaccagg cgagcttgaa agatgacacc 14580gaacagggcg ggggtggcgc aggcggcagc aacagcagtg gcagcggcgc ggaagagaac 14640tccaacgcgg cagccgcggc aatgcagccg gtggaggaca tgaacgatca tgccattcgc 14700ggcgacacct ttgccacacg ggctgaggag aagcgcgctg aggccgaagc agcggccgaa 14760gctgccgccc ccgctgcgca acccgaggtc gagaagcctc agaagaaacc ggtgatcaaa 14820cccctgacag aggacagcaa gaaacgcagt tacaacctaa taagcaatga cagcaccttc 14880acccagtacc gcagctggta ccttgcatac aactacggcg accctcagac cggaatccgc 14940tcatggaccc tgctttgcac tcctgacgta acctgcggct cggagcaggt ctactggtcg 15000ttgccagaca tgatgcaaga ccccgtgacc ttccgctcca cgcgccagat cagcaacttt 15060ccggtggtgg gcgccgagct gttgcccgtg cactccaaga gcttctacaa cgaccaggcc 15120gtctactccc aactcatccg ccagtttacc tctctgaccc acgtgttcaa tcgctttccc 15180gagaaccaga ttttggcgcg cccgccagcc cccaccatca ccaccgtcag tgaaaacgtt 15240cctgctctca cagatcacgg gacgctaccg ctgcgcaaca gcatcggagg agtccagcga 15300gtgaccatta ctgacgccag acgccgcacc tgcccctacg tttacaaggc cctgggcata 15360gtctcgccgc gcgtcctatc gagccgcact ttttgagcaa gcatgtccat ccttatatcg 15420cccagcaata acacaggctg gggcctgcgc ttcccaagca agatgtttgg cggggccaag 15480aagcgctccg accaacaccc agtgcgcgtg cgcgggcact accgcgcgcc ctggggcgcg 15540cacaaacgcg gccgcactgg gcgcaccacc gtcgatgacg ccatcgacgc ggtggtggag 15600gaggcgcgca actacacgcc cacgccgcca ccagtgtcca cagtggacgc ggccattcag 15660accgtggtgc gcggagcccg gcgctatgct aaaatgaaga gacggcggag gcgcgtagca 15720cgtcgccacc gccgccgacc cggcactgcc gcccaacgcg cggcggcggc cctgcttaac 15780cgcgcacgtc gcaccggccg acgggcggcc atgcgggccg ctcgaaggct ggccgcgggt 15840attgtcactg tgccccccag gtccaggcga cgagcggccg ccgcagcagc cgcggccatt 15900agtgctatga ctcagggtcg caggggcaac gtgtattggg tgcgcgactc ggttagcggc 15960ctgcgcgtgc ccgtgcgcac ccgccccccg cgcaactaga ttgcaagaaa aaactactta 16020gactcgtact gttgtatgta tccagcggcg gcggcgcgca acgaagctat gtccaagcgc 16080aaaatcaaag aagagatgct ccaggtcatc gcgccggaga tctatggccc cccgaagaag 16140gaagagcagg attacaagcc ccgaaagcta aagcgggtca aaaagaaaaa gaaagatgat 16200gatgatgaac ttgacgacga ggtggaactg ctgcacgcta ccgcgcccag gcgacgggta 16260cagtggaaag gtcgacgcgt aaaacgtgtt ttgcgacccg gcaccaccgt agtctttacg 16320cccggtgagc gctccacccg cacctacaag cgcgtgtatg atgaggtgta cggcgacgag 16380gacctgcttg agcaggccaa cgagcgcctc ggggagtttg cctacggaaa gcggcataag 16440gacatgctgg cgttgccgct ggacgagggc aacccaacac ctagcctaaa gcccgtaaca 16500ctgcagcagg tgctgcccgc gcttgcaccg tccgaagaaa agcgcggcct aaagcgcgag 16560tctggtgact tggcacccac cgtgcagctg atggtaccca agcgccagcg actggaagat 16620gtcttggaaa aaatgaccgt ggaacctggg ctggagcccg aggtccgcgt gcggccaatc 16680aagcaggtgg cgccgggact gggcgtgcag accgtggacg ttcagatacc cactaccagt 16740agcaccagta ttgccaccgc cacagagggc atggagacac aaacgtcccc ggttgcctca 16800gcggtggcgg atgccgcggt gcaggcggtc gctgcggccg cgtccaagac ctctacggag 16860gtgcaaacgg acccgtggat gtttcgcgtt tcagcccccc ggcgcccgcg ccgttcgagg 16920aagtacggcg ccgccagcgc gctactgccc gaatatgccc tacatccttc cattgcgcct 16980acccccggct atcgtggcta cacctaccgc cccagaagac gagcaactac ccgacgccga 17040accaccactg gaacccgccg ccgccgtcgc cgtcgccagc ccgtgctggc cccgatttcc 17100gtgcgcaggg tggctcgcga aggaggcagg accctggtgc tgccaacagc gcgctaccac 17160cccagcatcg tttaaaagcc ggtctttgtg gttcttgcag atatggccct cacctgccgc 17220ctccgtttcc cggtgccggg attccgagga agaatgcacc gtaggagggg catggccggc 17280cacggcctga cgggcggcat gcgtcgtgcg caccaccggc ggcggcgcgc gtcgcaccgt 17340cgcatgcgcg gcggtatcct gcccctcctt attccactga tcgccgcggc gattggcgcc 17400gtgcccggaa ttgcatccgt ggccttgcag gcgcagagac actgattaaa aacaagttgc 17460atgtggaaaa atcaaaataa aaagtctgga ctctcacgct cgcttggtcc tgtaactatt 17520ttgtagaatg gaagacatca actttgcgtc tctggccccg cgacacggct cgcgcccgtt 17580catgggaaac tggcaagata tcggcaccag caatatgagc ggtggcgcct tcagctgggg 17640ctcgctgtgg agcggcatta aaaatttcgg ttccaccgtt aagaactatg gcagcaaggc 17700ctggaacagc agcacaggcc agatgctgag ggataagttg aaagagcaaa atttccaaca 17760aaaggtggta gatggcctgg cctctggcat tagcggggtg gtggacctgg ccaaccaggc 17820agtgcaaaat aagattaaca gtaagcttga tccccgccct cccgtagagg agcctccacc 17880ggccgtggag acagtgtctc cagaggggcg tggcgaaaag cgtccgcgcc ccgacaggga 17940agaaactctg gtgacgcaaa tagacgagcc tccctcgtac gaggaggcac taaagcaagg 18000cctgcccacc acccgtccca tcgcgcccat ggctaccgga gtgctgggcc agcacacacc 18060cgtaacgctg gacctgcctc cccccgccga cacccagcag aaacctgtgc tgccaggccc 18120gaccgccgtt gttgtaaccc gtcctagccg cgcgtccctg cgccgcgccg ccagcggtcc 18180gcgatcgttg cggcccgtag ccagtggcaa ctggcaaagc acactgaaca gcatcgtggg 18240tctgggggtg caatccctga agcgccgacg atgcttctga tagctaacgt gtcgtatgtg 18300tgtcatgtat gcgtccatgt cgccgccaga ggagctgctg agccgccgcg cgcccgcttt 18360ccaagatggc taccccttcg atgatgccgc agtggtctta catgcacatc tcgggccagg 18420acgcctcgga gtacctgagc cccgggctgg tgcagtttgc ccgcgccacc gagacgtact 18480tcagcctgaa taacaagttt agaaacccca cggtggcgcc tacgcacgac gtgaccacag 18540accggtccca gcgtttgacg ctgcggttca tccctgtgga ccgtgaggat actgcgtact 18600cgtacaaggc gcggttcacc ctagctgtgg gtgataaccg tgtgctggac atggcttcca 18660cgtactttga catccgcggc gtgctggaca ggggccctac ttttaagccc tactctggca 18720ctgcctacaa cgccctggct cccaagggtg ccccaaatcc ttgcgaatgg gatgaagctg 18780ctactgctct tgaaataaac ctagaagaag aggacgatga caacgaagac gaagtagacg 18840agcaagctga gcagcaaaaa actcacgtat ttgggcaggc gccttattct ggtataaata 18900ttacaaagga gggtattcaa ataggtgtcg aaggtcaaac acctaaatat gccgataaaa 18960catttcaacc tgaacctcaa ataggagaat ctcagtggta cgaaacagaa attaatcatg 19020cagctgggag agtcctaaaa aagactaccc caatgaaacc atgttacggt tcatatgcaa 19080aacccacaaa tgaaaatgga gggcaaggca ttcttgtaaa gcaacaaaat ggaaagctag 19140aaagtcaagt ggaaatgcaa tttttctcaa ctactgaggc agccgcaggc aatggtgata 19200acttgactcc taaagtggta ttgtacagtg aagatgtaga tatagaaacc ccagacactc 19260atatttctta catgcccact attaaggaag gtaactcacg agaactaatg ggccaacaat 19320ctatgcccaa caggcctaat tacattgctt ttagggacaa ttttattggt ctaatgtatt 19380acaacagcac gggtaatatg ggtgttctgg cgggccaagc atcgcagttg aatgctgttg 19440tagatttgca agacagaaac acagagcttt cataccagct tttgcttgat tccattggtg 19500atagaaccag gtacttttct atgtggaatc aggctgttga cagctatgat ccagatgtta 19560gaattattga aaatcatgga actgaagatg aacttccaaa ttactgcttt ccactgggag 19620gtgtgattaa tacagagact cttaccaagg taaaacctaa aacaggtcag gaaaatggat 19680gggaaaaaga tgctacagaa ttttcagata aaaatgaaat aagagttgga aataattttg 19740ccatggaaat caatctaaat gccaacctgt ggagaaattt cctgtactcc aacatagcgc 19800tgtatttgcc cgacaagcta aagtacagtc cttccaacgt aaaaatttct gataacccaa 19860acacctacga ctacatgaac aagcgagtgg tggctcccgg gctagtggac tgctacatta 19920accttggagc acgctggtcc cttgactata tggacaacgt caacccattt aaccaccacc 19980gcaatgctgg cctgcgctac cgctcaatgt tgctgggcaa tggtcgctat gtgcccttcc 20040acatccaggt gcctcagaag ttctttgcca ttaaaaacct ccttctcctg ccgggctcat 20100acacctacga gtggaacttc aggaaggatg ttaacatggt tctgcagagc tccctaggaa 20160atgacctaag ggttgacgga gccagcatta agtttgatag catttgcctt tacgccacct 20220tcttccccat ggcccacaac accgcctcca cgcttgaggc catgcttaga aacgacacca 20280acgaccagtc ctttaacgac tatctctccg ccgccaacat gctctaccct atacccgcca 20340acgctaccaa cgtgcccata tccatcccct cccgcaactg ggcggctttc cgcggctggg 20400ccttcacgcg ccttaagact aaggaaaccc catcactggg ctcgggctac gacccttatt 20460acacctactc tggctctata ccctacctag atggaacctt ttacctcaac cacaccttta 20520agaaggtggc cattaccttt gactcttctg tcagctggcc tggcaatgac cgcctgctta 20580cccccaacga gtttgaaatt aagcgctcag ttgacgggga gggttacaac gttgcccagt 20640gtaacatgac caaagactgg ttcctggtac aaatgctagc taactataac attggctacc 20700agggcttcta tatcccagag agctacaagg accgcatgta ctccttcttt agaaacttcc 20760agcccatgag ccgtcaggtg gtggatgata ctaaatacaa ggactaccaa caggtgggca 20820tcctacacca acacaacaac tctggatttg ttggctacct tgcccccacc atgcgcgaag 20880gacaggccta ccctgctaac ttcccctatc cgcttatagg caagaccgca gttgacagca 20940ttacccagaa aaagtttctt tgcgatcgca ccctttggcg catcccattc tccagtaact 21000ttatgtccat gggcgcactc acagacctgg gccaaaacct tctctacgcc aactccgccc 21060acgcgctaga catgactttt gaggtggatc ccatggacga gcccaccctt ctttatgttt 21120tgtttgaagt ctttgacgtg gtccgtgtgc accagccgca ccgcggcgtc atcgaaaccg 21180tgtacctgcg cacgcccttc tcggccggca acgccacaac ataaagaagc aagcaacatc 21240aacaacagct gccgccatgg gctccagtga gcaggaactg aaagccattg tcaaagatct 21300tggttgtggg ccatattttt tgggcaccta tgacaagcgc tttccaggct ttgtttctcc 21360acacaagctc gcctgcgcca tagtcaatac ggccggtcgc gagactgggg gcgtacactg 21420gatggccttt gcctggaacc cgcactcaaa aacatgctac ctctttgagc cctttggctt 21480ttctgaccag cgactcaagc aggtttacca gtttgagtac gagtcactcc tgcgccgtag 21540cgccattgct tcttcccccg accgctgtat aacgctggaa aagtccaccc aaagcgtaca 21600ggggcccaac tcggccgcct gtggactatt ctgctgcatg tttctccacg cctttgccaa 21660ctggccccaa actcccatgg atcacaaccc caccatgaac cttattaccg gggtacccaa 21720ctccatgctc aacagtcccc aggtacagcc caccctgcgt cgcaaccagg aacagctcta 21780cagcttcctg gagcgccact cgccctactt ccgcagccac agtgcgcaga ttaggagcgc 21840cacttctttt tgtcacttga aaaacatgta aaaataatgt actagagaca ctttcaataa 21900aggcaaatgc ttttatttgt acactctcgg gtgattattt acccccaccc ttgccgtctg 21960cgccgtttaa aaatcaaagg ggttctgccg cgcatcgcta tgcgccactg gcagggacac 22020gttgcgatac tggtgtttag tgctccactt aaactcaggc acaaccatcc gcggcagctc 22080ggtgaagttt tcactccaca ggctgcgcac catcaccaac gcgtttagca ggtcgggcgc 22140cgatatcttg aagtcgcagt tggggcctcc gccctgcgcg cgcgagttgc gatacacagg 22200gttgcagcac tggaacacta tcagcgccgg gtggtgcacg ctggccagca cgctcttgtc 22260ggagatcaga tccgcgtcca ggtcctccgc gttgctcagg gcgaacggag tcaactttgg 22320tagctgcctt cccaaaaagg gcgcgtgccc aggctttgag ttgcactcgc accgtagtgg 22380catcaaaagg tgaccgtgcc cggtctgggc gttaggatac agcgcctgca taaaagcctt 22440gatctgctta aaagccacct gagcctttgc gccttcagag aagaacatgc cgcaagactt 22500gccggaaaac tgattggccg gacaggccgc gtcgtgcacg cagcaccttg cgtcggtgtt 22560ggagatctgc accacatttc ggccccaccg gttcttcacg atcttggcct tgctagactg 22620ctccttcagc gcgcgctgcc cgttttcgct cgtcacatcc atttcaatca cgtgctcctt 22680atttatcata atgcttccgt gtagacactt aagctcgcct tcgatctcag cgcagcggtg 22740cagccacaac gcgcagcccg tgggctcgtg atgcttgtag gtcacctctg caaacgactg 22800caggtacgcc tgcaggaatc gccccatcat cgtcacaaag gtcttgttgc tggtgaaggt 22860cagctgcaac ccgcggtgct cctcgttcag ccaggtcttg catacggccg ccagagcttc 22920cacttggtca ggcagtagtt tgaagttcgc ctttagatcg ttatccacgt ggtacttgtc 22980catcagcgcg cgcgcagcct ccatgccctt ctcccacgca gacacgatcg gcacactcag 23040cgggttcatc accgtaattt cactttccgc ttcgctgggc tcttcctctt cctcttgcgt 23100ccgcatacca cgcgccactg ggtcgtcttc attcagccgc cgcactgtgc gcttacctcc 23160tttgccatgc ttgattagca ccggtgggtt gctgaaaccc accatttgta gcgccacatc 23220ttctctttct tcctcgctgt ccacgattac ctctggtgat ggcgggcgct cgggcttggg 23280agaagggcgc ttctttttct tcttgggcgc aatggccaaa tccgccgccg aggtcgatgg 23340ccgcgggctg ggtgtgcgcg gcaccagcgc gtcttgtgat gagtcttcct cgtcctcgga 23400ctcgatacgc cgcctcatcc gcttttttgg gggcgcccgg ggaggcggcg gcgacgggga 23460cggggacgac acgtcctcca tggttggggg acgtcgcgcc gcaccgcgtc cgcgctcggg 23520ggtggtttcg cgctgctcct cttcccgact ggccatttcc ttctcctata ggcagaaaaa 23580gatcatggag tcagtcgaga agaaggacag cctaaccgcc ccctctgagt tcgccaccac 23640cgcctccacc gatgccgcca acgcgcctac caccttcccc gtcgaggcac ccccgcttga 23700ggaggaggaa gtgattatcg agcaggaccc aggttttgta agcgaagacg acgaggaccg 23760ctcagtacca acagaggata aaaagcaaga ccaggacaac gcagaggcaa acgaggaaca 23820agtcgggcgg ggggacgaaa ggcatggcga ctacctagat gtgggagacg acgtgctgtt 23880gaagcatctg cagcgccagt gcgccattat ctgcgacgcg ttgcaagagc gcagcgatgt 23940gcccctcgcc atagcggatg tcagccttgc ctacgaacgc cacctattct caccgcgcgt 24000accccccaaa cgccaagaaa acggcacatg cgagcccaac ccgcgcctca acttctaccc 24060cgtatttgcc gtgccagagg tgcttgccac ctatcacatc tttttccaaa actgcaagat 24120acccctatcc tgccgtgcca accgcagccg agcggacaag cagctggcct tgcggcaggg 24180cgctgtcata cctgatatcg cctcgctcaa cgaagtgcca aaaatctttg agggtcttgg 24240acgcgacgag aagcgcgcgg caaacgctct gcaacaggaa aacagcgaaa atgaaagtca 24300ctctggagtg ttggtggaac tcgagggtga caacgcgcgc ctagccgtac taaaacgcag 24360catcgaggtc acccactttg cctacccggc acttaaccta ccccccaagg tcatgagcac 24420agtcatgagt gagctgatcg tgcgccgtgc gcagcccctg gagagggatg caaatttgca 24480agaacaaaca gaggagggcc tacccgcagt tggcgacgag cagctagcgc gctggcttca 24540aacgcgcgag cctgccgact tggaggagcg acgcaaacta atgatggccg cagtgctcgt 24600taccgtggag cttgagtgca tgcagcggtt ctttgctgac ccggagatgc agcgcaagct 24660agaggaaaca ttgcactaca cctttcgaca gggctacgta cgccaggcct gcaagatctc 24720caacgtggag ctctgcaacc tggtctccta ccttggaatt ttgcacgaaa accgccttgg 24780gcaaaacgtg cttcattcca cgctcaaggg cgaggcgcgc cgcgactacg tccgcgactg 24840cgtttactta tttctatgct acacctggca gacggccatg ggcgtttggc agcagtgctt 24900ggaggagtgc aacctcaagg agctgcagaa actgctaaag caaaacttga aggacctatg 24960gacggccttc aacgagcgct ccgtggccgc gcacctggcg gacatcattt tccccgaacg 25020cctgcttaaa accctgcaac agggtctgcc agacttcacc agtcaaagca tgttgcagaa 25080ctttaggaac tttatcctag agcgctcagg aatcttgccc gccacctgct gtgcacttcc 25140tagcgacttt gtgcccatta agtaccgcga atgccctccg ccgctttggg gccactgcta 25200ccttctgcag ctagccaact accttgccta ccactctgac ataatggaag acgtgagcgg 25260tgacggtcta ctggagtgtc actgtcgctg caacctatgc accccgcacc gctccctggt 25320ttgcaattcg cagctgctta acgaaagtca aattatcggt acctttgagc tgcagggtcc 25380ctcgcctgac gaaaagtccg cggctccggg gttgaaactc actccggggc tgtggacgtc 25440ggcttacctt cgcaaatttg tacctgagga ctaccacgcc cacgagatta ggttctacga 25500agaccaatcc cgcccgccta atgcggagct taccgcctgc gtcattaccc agggccacat 25560tcttggccaa ttgcaagcca tcaacaaagc ccgccaagag tttctgctac gaaagggacg 25620gggggtttac ttggaccccc agtccggcga ggagctcaac ccaatccccc cgccgccgca 25680gccctatcag cagcagccgc gggcccttgc ttcccaggat ggcacccaaa aagaagctgc 25740agctgccgcc gccacccacg gacgaggagg aatactggga cagtcaggca gaggaggttt 25800tggacgagga ggaggaggac atgatggaag actgggagag cctagacgag gaagcttccg 25860aggtcgaaga ggtgtcagac gaaacaccgt caccctcggt cgcattcccc tcgccggcgc 25920cccagaaatc ggcaaccggt tccagcatgg ctacaacctc cgctcctcag gcgccgccgg 25980cactgcccgt tcgccgaccc aaccgtagat gggacaccac tggaaccagg gccggtaagt 26040ccaagcagcc gccgccgtta gcccaagagc aacaacagcg ccaaggctac cgctcatggc 26100gcgggcacaa gaacgccata gttgcttgct tgcaagactg tgggggcaac atctccttcg 26160cccgccgctt tcttctctac catcacggcg tggccttccc ccgtaacatc ctgcattact 26220accgtcatct ctacagccca tactgcaccg gcggcagcgg cagcaacagc agcggccaca 26280cagaagcaaa ggcgaccgga tagcaagact ctgacaaagc ccaagaaatc cacagcggcg 26340gcagcagcag gaggaggagc gctgcgtctg gcgcccaacg aacccgtatc gacccgcgag 26400cttagaaaca ggatttttcc cactctgtat gctatatttc aacagagcag gggccaagaa 26460caagagctga aaataaaaaa caggtctctg cgatccctca cccgcagctg cctgtatcac 26520aaaagcgaag atcagcttcg gcgcacgctg gaagacgcgg aggctctctt cagtaaatac 26580tgcgcgctga ctcttaagga ctagtttcgc gccctttctc aaatttaagc gcgaaaacta 26640cgtcatctcc agcggccaca cccggcgcca gcacctgttg tcagcgccat tatgagcaag 26700gaaattccca cgccctacat gtggagttac cagccacaaa tgggacttgc ggctggagct 26760gcccaagact actcaacccg aataaactac atgagcgcgg gaccccacat gatatcccgg 26820gtcaacggaa tacgcgccca ccgaaaccga attctcctgg aacaggcggc tattaccacc 26880acacctcgta ataaccttaa tccccgtagt tggcccgctg ccctggtgta ccaggaaagt 26940cccgctccca ccactgtggt acttcccaga gacgcccagg ccgaagttca gatgactaac 27000tcaggggcgc agcttgcggg cggctttcgt cacagggtgc ggtcgcccgg gcagggtata 27060actcacctga caatcagagg gcgaggtatt cagctcaacg acgagtcggt gagctcctcg 27120cttggtctcc gtccggacgg gacatttcag atcggcggcg ccggccgctc ttcattcacg 27180cctcgtcagg caatcctaac tctgcagacc tcgtcctctg agccgcgctc tggaggcatt 27240ggaactctgc aatttattga ggagtttgtg ccatcggtct actttaaccc cttctcggga 27300cctcccggcc actatccgga tcaatttatt cctaactttg acgcggtaaa ggactcggcg 27360gacggctacg actgaatgtt aagtggagag gcagagcaac tgcgcctgaa acacctggtc 27420cactgtcgcc gccacaagtg ctttgcccgc gactccggtg agttttgcta ctttgaattg 27480cccgaggatc atatcgaggg cccggcgcac ggcgtccggc ttaccgccca gggagagctt 27540gcccgtagcc tgattcggga gtttacccag cgccccctgc tagttgagcg ggacagggga 27600ccctgtgttc tcactgtgat ttgcaactgt cctaaccctg gattacatca agatctttgt 27660tgccatctct gtgctgagta taataaatac agaaattaaa atatactggg gctcctatcg 27720ccatcctgta aacgccaccg tcttcacccg cccaagcaaa ccaaggcgaa ccttacctgg 27780tacttttaac atctctccct ctgtgattta caacagtttc aacccagacg gagtgagtct 27840acgagagaac ctctccgagc tcagctactc catcagaaaa aacaccaccc tccttacctg 27900ccgggaacgt acgagtgcgt caccggccgc tgcaccacac ctaccgcctg accgtaaacc 27960agactttttc cggacagacc tcaataactc tgtttaccag aacaggaggt gagcttagaa 28020aacccttagg gtattaggcc aaaggcgcag ctactgtggg gtttatgaac aattcaagca 28080actctacggg ctattctaat tcaggtttct ctagaatcgg ggttggggtt attctctgtc 28140ttgtgattct ctttattctt atactaacgc ttctctgcct aaggctcgcc gcctgctgtg 28200tgcacatttg catttattgt cagcttttta aacgctgggg tcgccaccca agatgattag 28260gtacataatc ctaggtttac tcacccttgc gtcagcccac ggtaccaccc aaaaggtgga 28320ttttaaggag ccagcctgta atgttacatt cgcagctgaa gctaatgagt gcaccactct 28380tataaaatgc accacagaac atgaaaagct gcttattcgc cacaaaaaca aaattggcaa 28440gtatgctgtt tatgctattt ggcagccagg tgacactaca gagtataatg ttacagtttt 28500ccagggtaaa agtcataaaa cttttatgta tacttttcca ttttatgaaa tgtgcgacat 28560taccatgtac atgagcaaac agtataagtt gtggccccca caaaattgtg tggaaaacac 28620tggcactttc tgctgcactg ctatgctaat tacagtgctc gctttggtct gtaccctact 28680ctatattaaa tacaaaagca gacgcagctt tattgaggaa aagaaaatgc cttaatttac 28740taagttacaa agctaatgtc accactaact gctttactcg ctgcttgcaa aacaaattca 28800aaaagttagc attataatta gaataggatt taaacccccc ggtcatttcc tgctcaatac 28860cattcccctg aacaattgac tctatgtggg atatgctcca gcgctacaac cttgaagtca 28920ggcttcctgg atgtcagcat ctgactttgg ccagcacctg tcccgcggat ttgttccagt 28980ccaactacag cgacccaccc taacagagat gaccaacaca accaacgcgg ccgccgctac 29040cggacttaca tctaccacaa atacacccca agtttctgcc tttgtcaata actgggataa 29100cttgggcatg tggtggttct ccatagcgct tatgtttgta tgccttatta ttatgtggct 29160catctgctgc ctaaagcgca aacgcgcccg accacccatc tatagtccca tcattgtgct 29220acacccaaac aatgatggaa tccatagatt ggacggactg aaacacatgt tcttttctct 29280tacagtatga ttaaatgaga catgattcct cgagttttta tattactgac ccttgttgcg 29340cttttttgtg cgtgctccac attggctgcg gtttctcaca tcgaagtaga ctgcattcca 29400gccttcacag tctatttgct ttacggattt gtcaccctca cgctcatctg cagcctcatc 29460actgtggtca tcgcctttat ccagtgcatt gactgggtct gtgtgcgctt tgcatatctc 29520agacaccatc cccagtacag ggacaggact atagctgagc ttcttagaat tctttaatta 29580tgaaatttac tgtgactttt ctgctgatta tttgcaccct atctgcgttt tgttccccga 29640cctccaagcc tcaaagacat atatcatgca gattcactcg tatatggaat attccaagtt 29700gctacaatga aaaaagcgat ctttccgaag cctggttata tgcaatcatc tctgttatgg 29760tgttctgcag taccatctta gccctagcta tatatcccta ccttgacatt ggctggaacg 29820caatagatgc catgaaccac ccaactttcc ccgcgcccgc tatgcttcca ctgcaacaag 29880ttgttgccgg cggctttgtc ccagccaatc agcctcgccc accttctccc acccccactg 29940aaatcagcta ctttaatcta acaggaggag atgactgaca ccctagatct agaaatggac 30000ggaattatta cagagcagcg cctgctagaa agacgcaggg cagcggccga gcaacagcgc 30060atgaatcaag agctccaaga catggttaac ttgcaccagt gcaaaagggg tatcttttgt 30120ctcgtaaagc aggccaaagt cacctacgac agtaatacca ccggacaccg ccttagctac 30180aagttgccaa ccaagcgtca gaaattggtg gtcatggtgg gagaaaagcc cattaccata 30240actcagcact cggtagaaac cgaaggctgc attcactcac cttgtcaagg acctgaggat 30300ctctgcaccc ttattaagac cctgtgcggt ctcaaagatc ttattccctt taactaataa 30360aaaaaaataa taaagcatca cttacttaaa atcagttagc aaatttctgt ccagtttatt 30420cagcagcacc tccttgccct cctcccagct ctggtattgc agcttcctcc tggctgcaaa 30480ctttctccac aatctaaatg gaatgtcagt ttcctcctgt tcctgtccat ccgcacccac 30540tatcttcatg ttgttgcaga tgaagcgcgc aagaccgtct gaagatacct tcaaccccgt 30600gtatccatat gacacggaaa ccggtcctcc aactgtgcct tttcttactc ctccctttgt 30660atcccccaat gggtttcaag agagtccccc tggggtactc tctttgcgcc tatccgaacc 30720tctagttacc tccaatggca tgcttgcgct caaaatgggc aacggcctct ctctggacga 30780ggccggcaac cttacctccc aaaatgtaac cactgtgagc ccacctctca aaaaaaccaa 30840gtcaaacata aacctggaaa tatctgcacc cctcacagtt acctcagaag ccctaactgt 30900ggctgccgcc gcacctctaa tggtcgcggg caacacactc accatgcaat cacaggcccc 30960gctaaccgtg cacgactcca aacttagcat tgccacccaa ggacccctca cagtgtcaga 31020aggaaagcta gccctgcaaa catcaggccc cctcaccacc accgatagca gtacccttac 31080tatcactgcc tcaccccctt taactactgc cactggtagc ttgggcattg acttgaaaga 31140gcccatttat acacaaaatg gaaaactagg actaaagtac ggggctcctt tgcatgtaac 31200agacgaccta aacactttga ccgtagcaac tggtccaggt gtgactatta ataatacttc 31260cttgcaaact aaagttactg gagccttggg ttttgattca caaggcaata tgcaacttaa 31320tgtagcagga ggactaagga ttgattctca aaacagacgc cttatacttg atgttagtta 31380tccgtttgat gctcaaaacc aactaaatct aagactagga cagggccctc tttttataaa 31440ctcagcccac aacttggata ttaactacaa caaaggcctt tacttgttta cagcttcaaa 31500caattccaaa aagcttgagg ttaacctaag cactgccaag gggttgatgt ttgacgctac 31560agccatagcc attaatgcag gagatgggct tgaatttggt tcacctaatg caccaaacac 31620aaatcccctc aaaacaaaaa ttggccatgg cctagaattt gattcaaaca aggctatggt 31680tcctaaacta ggaactggcc ttagttttga cagcacaggt gccattacag taggaaacaa 31740aaataatgat aagctaactt tgtggaccac accagctcca tctcctaact gtagactaaa 31800tgcagagaaa gatgctaaac tcactttggt cttaacaaaa tgtggcagtc aaatacttgc 31860tacagtttca gttttggctg ttaaaggcag tttggctcca atatctggaa cagttcaaag 31920tgctcatctt attataagat ttgacgaaaa tggagtgcta ctaaacaatt ccttcctgga 31980cccagaatat tggaacttta gaaatggaga tcttactgaa ggcacagcct atacaaacgc 32040tgttggattt atgcctaacc tatcagctta tccaaaatct cacggtaaaa ctgccaaaag 32100taacattgtc agtcaagttt acttaaacgg agacaaaact aaacctgtaa cactaaccat 32160tacactaaac ggtacacagg aaacaggaga cacaactcca agtgcatact ctatgtcatt 32220ttcatgggac tggtctggcc acaactacat taatgaaata tttgccacat cctcttacac 32280tttttcatac attgcccaag aataaagaat cgtttgtgtt atgtttcaac gtgtttattt 32340ttcaattgca gaaaatttca agtcattttt cattcagtag tatagcccca ccaccacata 32400gcttatacag atcaccgtac cttaatcaaa ctcacagaac cctagtattc aacctgccac 32460ctccctccca acacacagag tacacagtcc tttctccccg gctggcctta aaaagcatca 32520tatcatgggt aacagacata ttcttaggtg ttatattcca cacggtttcc tgtcgagcca 32580aacgctcatc agtgatatta ataaactccc cgggcagctc acttaagttc atgtcgctgt 32640ccagctgctg agccacaggc tgctgtccaa cttgcggttg cttaacgggc ggcgaaggag 32700aagtccacgc ctacatgggg gtagagtcat aatcgtgcat caggataggg cggtggtgct 32760gcagcagcgc gcgaataaac tgctgccgcc gccgctccgt cctgcaggaa tacaacatgg 32820cagtggtctc ctcagcgatg attcgcaccg cccgcagcat aaggcgcctt gtcctccggg 32880cacagcagcg caccctgatc tcacttaaat cagcacagta actgcagcac agcaccacaa 32940tattgttcaa aatcccacag tgcaaggcgc tgtatccaaa gctcatggcg gggaccacag 33000aacccacgtg gccatcatac cacaagcgca ggtagattaa gtggcgaccc ctcataaaca 33060cgctggacat aaacattacc tcttttggca tgttgtaatt caccacctcc cggtaccata 33120taaacctctg attaaacatg gcgccatcca ccaccatcct aaaccagctg gccaaaacct 33180gcccgccggc tatacactgc agggaaccgg gactggaaca atgacagtgg agagcccagg 33240actcgtaacc atggatcatc atgctcgtca tgatatcaat gttggcacaa cacaggcaca 33300cgtgcataca cttcctcagg attacaagct cctcccgcgt tagaaccata tcccagggaa 33360caacccattc ctgaatcagc gtaaatccca cactgcaggg aagacctcgc acgtaactca 33420cgttgtgcat tgtcaaagtg ttacattcgg gcagcagcgg atgatcctcc agtatggtag 33480cgcgggtttc tgtctcaaaa ggaggtagac gatccctact gtacggagtg cgccgagaca 33540accgagatcg tgttggtcgt agtgtcatgc caaatggaac gccggacgta gtcatatttc 33600ctgaagcaaa accaggtgcg ggcgtgacaa acagatctgc gtctccggtc tcgccgctta 33660gatcgctctg tgtagtagtt gtagtatatc cactctctca aagcatccag gcgccccctg 33720gcttcgggtt ctatgtaaac tccttcatgc gccgctgccc tgataacatc caccaccgca 33780gaataagcca cacccagcca acctacacat tcgttctgcg agtcacacac gggaggagcg 33840ggaagagctg gaagaaccat gttttttttt ttattccaaa agattatcca aaacctcaaa 33900atgaagatct attaagtgaa cgcgctcccc tccggtggcg tggtcaaact ctacagccaa 33960agaacagata atggcatttg taagatgttg cacaatggct tccaaaaggc aaacggccct 34020cacgtccaag tggacgtaaa ggctaaaccc ttcagggtga atctcctcta taaacattcc 34080agcaccttca accatgccca aataattctc atctcgccac cttctcaata tatctctaag 34140caaatcccga atattaagtc cggccattgt aaaaatctgc tccagagcgc cctccacctt 34200cagcctcaag cagcgaatca tgattgcaaa aattcaggtt cctcacagac ctgtataaga 34260ttcaaaagcg gaacattaac aaaaataccg cgatcccgta ggtcccttcg cagggccagc 34320tgaacataat cgtgcaggtc tgcacggacc agcgcggcca cttccccgcc aggaaccatg 34380acaaaagaac ccacactgat tatgacacgc atactcggag ctatgctaac cagcgtagcc 34440ccgatgtaag cttgttgcat gggcggcgat ataaaatgca aggtgctgct caaaaaatca 34500ggcaaagcct cgcgcaaaaa agaaagcaca tcgtagtcat gctcatgcag ataaaggcag 34560gtaagctccg gaaccaccac agaaaaagac accatttttc tctcaaacat gtctgcgggt 34620ttctgcataa acacaaaata aaataacaaa aaaacattta aacattagaa gcctgtctta 34680caacaggaaa aacaaccctt ataagcataa gacggactac ggccatgccg gcgtgaccgt 34740aaaaaaactg gtcaccgtga ttaaaaagca ccaccgacag ctcctcggtc atgtccggag 34800tcataatgta agactcggta aacacatcag gttgattcac atcggtcagt gctaaaaagc 34860gaccgaaata gcccggggga atacataccc gcaggcgtag agacaacatt acagccccca 34920taggaggtat aacaaaatta ataggagaga aaaacacata aacacctgaa aaaccctcct 34980gcctaggcaa aatagcaccc tcccgctcca gaacaacata cagcgcttcc acagcggcag 35040ccataacagt cagccttacc agtaaaaaag aaaacctatt aaaaaaacac cactcgacac 35100ggcaccagct caatcagtca cagtgtaaaa aagggccaag tgcagagcga gtatatatag 35160gactaaaaaa tgacgtaacg gttaaagtcc acaaaaaaca cccagaaaac cgcacgcgaa 35220cctacgccca gaaacgaaag ccaaaaaacc cacaacttcc tcaaatcgtc acttccgttt 35280tcccacgtta cgtcacttcc cattttaaga aaactacaat tcccaacaca tacaagttac 35340tccgccctaa aacctacgtc acccgccccg ttcccacgcc ccgcgccacg tcacaaactc 35400caccccctca ttatcatatt ggcttcaatc caaaataagg tatattattg atgatgttaa 35460ttaagaattc ggatctgcga cgcgaggctg gatggccttc cccattatga ttcttctcgc 35520ttccggcggc atcgggatgc ccgcgttgca ggccatgctg tccaggcagg tagatgacga 35580ccatcaggga cagcttcaag gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct 35640ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac gctcaagtca 35700gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg gaagctccct 35760cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct ttctcccttc 35820gggaagcgtg gcgctttctc atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt 35880tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct gcgccttatc 35940cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac tggcagcagc 36000cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt tcttgaagtg 36060gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc tgctgaagcc 36120agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca ccgctggtag 36180cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga 36240tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac gttaagggat 36300tttggtcatg agattatcaa aaaggatctt cacctagatc cttttaaatc aatctaaagt 36360atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca 36420gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg 36480atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca 36540ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt 36600cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt 36660agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca 36720cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca 36780tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga 36840agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact 36900gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga 36960gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caacacggga taataccgcg 37020ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc 37080tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 37140tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 37200gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 37260caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 37320atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac 37380gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc 37440tttcgtcttc aagaattgga tccgaattct taat 37474 26 37474 DNA Artificial Sequence DNA encoding pMRKAd5 HIV-1 gag, noncoding 26aagaattaat tgtagtagtt attatatgga ataaaaccta acttcggtta tactattact 60cccccacctc aaacactgca ccgcgccccg cacccttgcc ccgcccactg catcatcaca 120ccgccttcac actacaacgt tcacaccgcc ttgtgtacat tcgctgccta caccgttttc 180actgcaaaaa ccacacgcgg ccacatgtgt ccttcactgt taaaagcgcg ccaaaatccg 240cctacaacat catttaaacc cgcattggct cattctaaac cggtaaaagc gcccttttga 300cttattctcc ttcactttag acttattaaa acacaatgag tatcgcgcat tataaacaga 360tcccggcgcc cctgaaactg gcaaatgcac ctctgagcgg gtccacaaaa agagtccaca 420aaaggcgcaa ggcccagttt caaccgcaaa ataataatat ccgccggcgc taggtaacgt 480atgcaacata ggtatagtat tatacatgta aatataaccg agtacaggtt gtaatggcgg 540tacaactgta actaataact gatcaataat tatcattagt taatgcccca gtaatcaagt 600atcgggtata tacctcaagg cgcaatgtat tgaatgccat ttaccgggcg gaccgactgg 660cgggttgctg ggggcgggta actgcagtta ttactgcata caagggtatc attgcggtta 720tccctgaaag gtaactgcag ttacccacct cataaatgcc atttgacggg tgaaccgtca 780tgtagttcac atagtatacg gttcatgcgg gggataactg cagttactgc catttaccgg 840gcggaccgta atacgggtca tgtactggaa taccctgaaa ggatgaaccg tcatgtagat 900gcataatcag tagcgataat ggtaccacta cgccaaaacc gtcatgtagt tacccgcacc 960tatcgccaaa ctgagtgccc ctaaaggttc agaggtgggg taactgcagt taccctcaaa 1020caaaaccgtg gttttagttg ccctgaaagg ttttacagca ttgttgaggc ggggtaactg 1080cgtttacccg ccatccgcac atgccaccct ccagatatat tcgtctcgag caaatcactt 1140ggcagtctag cggacctctg cggtaggtgc gacaaaactg gaggtatctt ctgtggccct 1200ggctaggtcg gaggcgccgg cccttgccac gtaaccttgc gcctaagggg cacggttctc 1260actctagatg gtacccacga tcccgaagac acgacagacc accactcgac ctgttcaccc 1320tcttctagtc cgactccgga ccaccgttct tcttcatgtt cgatttcgtg taacacaccc 1380ggaggtccct cgacctctcc aaacgacact tgggaccgga cgacctctgg agactcccca 1440cgtccgtcta ggacccggtc gaggtcggga gggacgtttg tccgagactc ctcgactcca 1500gggacatgtt gtgtcaccga tgggacatga cacacgtggt cttctaacta cacttcctgt 1560ggttcctccg ggacctcttc taactcctcc tcgtcttgtt caggttcttc ttccgggtcg 1620tccgacgacg accgtgtccg ttgaggtcgg tccacagggt cttgatgggg taacacgtct 1680tggaggtccc ggtctaccac gtggtccggt agaggggggc ctgggactta cggacccact 1740tccaccacct cctcttccgg aagaggggac tccactaggg gtacaagaga cgggacagac 1800tcccacggtg gggggtcctg gacttgtggt acgacttgtg tcaccccccg gtagtccgac 1860ggtacgtcta cgacttcctc tggtagttac tcctccgacg actcaccctg tccgacgtag 1920gacacgtgcg accggggtaa cgggggccgg tctactccct cgggtccccg agactgtaac 1980gaccgtggtg gaggtgggag gtcctcgtct aaccgaccta ctggttgttg ggggggtagg 2040gacaccccct ttagatgttc tccacctagt aggacccgga cttgttctaa cactcctaca 2100tgagggggtg gaggtaggac ctgtagtccg tcccggggtt cctcgggaag tccctgatac 2160acctgtccaa gatgttctgg gactcccgac tcgtccggag ggtcctccac ttcttgacct 2220actgtctctg ggacgaccac gtcttacggt tgggactgac gttctggtag gacttccggg 2280acccgggacg acggtgggac ctcctctact actgtcggac ggtcccccac cccccgggac 2340cagtgttccg gtcccacgac cgactccggt acagggtcca ctggttgagg cggtggtagt 2400actacgtctc cccgttgaag tccttggtct ccttctgtca cttcacgaag ttgacaccgt 2460tccacccggt gtaacggttc ttgacatccc gggggtcctt cttcccgacg accttcacac 2520cgttcctccc ggtggtctac ttcctgacgt tactctccgt ccggttgaag gacccgtttt 2580agaccgggag ggtgttcccg tccggaccgt tgaaggaggt caggtccgga ctcgggtgtc 2640ggggagggct cctcaggaag tccaaacccc tcctcttctg gtgggggtcg gtcttcgtcc 2700tcgggtaact gttcctcgac atgggggacc ggagggactc cagggacaaa ccgttgctgg 2760ggaggagggt cattttattt cgggcccgtc tagacgacac ggaagatcaa cggtcggtag 2820acaacaaacg gggagggggc acggaaggaa ctgggacctt ccacggtgag ggtgacagga 2880aaggattatt ttactccttt aacgtagcgt aacagactca tccacagtaa gataagaccc 2940cccaccccac cccgtcctgt cgttccccct cctaaccctt ctgttatcgt ccgtacgacc 3000cctacgccac ccgagatacc ggctagccgc gcggcatgac tttacacacc cgcaccgaat 3060tcccaccctt tcttatatat tccaccccca gaatacatca aaacatagac aaaacgtcgt 3120cggcggcggc ggtactcgtg gttgagcaaa ctaccttcgt aacactcgag tataaactgt 3180tgcgcgtacg ggggtacccg gccccacgca gtcttacact acccgaggtc gtaactacca 3240gcggggcagg acgggcgttt gagatgatgg aactggatgc tctggcacag accttgcggc 3300aacctctgac gtcggaggcg gcggcgaagt cggcgacgtc ggtggcgggc gccctaacac 3360tgactgaaac gaaaggactc gggcgaacgt ttgtcacgtc gaagggcaag taggcgggcg 3420ctactgttca actgccgaga aaaccgtgtt aacctaagaa actgggccct tgaattacag 3480caaagagtcg tcgacaacct agacgcggtc gtccaaagac gggacttccg aaggagggga 3540gggttacgcc aaattttgta tttatttttt ggtctgagac aaacctaaac ctagttcgtt 3600cacagaacga cagaaataaa tccccaaaac gcgcgcgcca tccgggccct ggtcgccaga 3660gccagcaact cccaggacac ataaaaaagg tcctgcacca tttccactga gacctacaag 3720tctatgtacc cgtattcggg cagagacccc acctccatcg tggtgacgtc tcgaagtacg 3780acgccccacc acaacatcta ctaggtcagc atcgtcctcg cgacccgcac cacggatttt 3840tacagaaagt catcgttcga ctaacggtcc ccgtccggga accacattca caaatgtttc 3900gccaattcga ccctacccac gtatgcaccc ctatactcta cgtagaacct gacataaaaa 3960tccaaccgat acaagggtcg gtatagggag gcccctaagt acaacacgtc ttggtggtcg 4020tgtcacatag gccacgtgaa ccctttaaac agtacatcga atcttccttt acgcaccttc 4080ttgaacctct gcgggaacac tggaggttct aaaaggtacg taagcaggta ttactaccgt 4140tacccgggtg cccgccgccg gacccgcttc tataaagacc ctagtgattg cagtatcaac 4200acaaggtcct actctagcag tatccggtaa aaatgtttcg cgcccgcctc ccacggtctg 4260acgccatatt accaaggtag gccgggtccc cgcatcaatg ggagtgtcta aacgtaaagg 4320gtgcgaaact caagtctacc cccctagtac agatggacgc cccgctactt cttttgccaa 4380aggccccatc ccctctagtc gacccttctt tcgtccaagg actcgtcgac gctgaatggc 4440gtcggccacc cgggcattta gtgtggataa tggccgacgt tgaccatcaa ttctctcgac 4500gtcgacggca gtagggactc gtccccccgg tgaagcaatt cgtacaggga ctgagcgtac 4560aaaagggact ggtttaggcg gtcttccgcg agcggcgggt cgctatcgtc aagaacgttc 4620cttcgtttca aaaagttgcc aaactctggc aggcggcatc cgtacgaaaa ctcgcaaact 4680ggttcgtcaa ggtccgccag ggtgtcgagc cagtggacga gatgccgtag agctaggtcg 4740tatagaggag caaagcgccc aaccccgccg aaagcgacat gccgtcatca gccacgagca 4800ggtctgcccg gtcccagtac agaaaggtgc ccgcgtccca ggagcagtcg catcagaccc 4860agtgccactt ccccacgcga ggcccgacgc gcgaccggtc ccacgcgaac tccgaccagg 4920acgaccacga cttcgcgacg gccagaagcg ggacgcgcag ccggtccatc gtaaactggt 4980accacagtat caggtcgggg aggcgccgca ccgggaaccg cgcgtcgaac gggaacctcc 5040tccgcggcgt gctccccgtc acgtctgaaa actcccgcat ctcgaacccg cgctctttat 5100ggctaaggcc cctcatccgt aggcgcggcg tccggggcgt ctgccagagc gtaaggtgct 5160cggtccactc gagaccggca agccccagtt tttggtccaa agggggtacg aaaaactacg 5220caaagaatgg agaccaaagg tactcggcca caggtgcgag ccactgcttt tccgacaggc 5280acaggggcat atgtctgaac tctccggaca ggagctcgcc acaaggcgcc aggaggagca 5340tatctttgag cctggtgaga ctctgtttcc gagcgcaggt ccggtcgtgc ttcctccgat 5400tcaccctccc catcgccagc aacaggtgat cccccaggtg agcgaggtcc cacacttctg 5460tgtacagcgg gagaagccgt agttccttcc actaaccaaa catccacatc cggtgcactg 5520gcccacaagg acttcccccc gatattttcc cccacccccg cgcaagcagg agtgagagaa 5580ggcgtagcga cagacgctcc cggtcgacaa ccccactcat gagggagact tttcgcccgt 5640actgaagacg cgattctaac agtcaaaggt ttttgctcct cctaaactat aagtggaccg 5700ggcgccacta cggaaactcc caccggcgta ggtagaccag tcttttctgt tagaaaaaca 5760acagttcgaa ccaccgtttg ctgggcatct cccgcaacct gtcgttgaac cgctacctcg 5820cgtcccaaac caaaaacagc gctagccgcg cgaggaaccg gcgctacaaa tcgacgtgca 5880taagcgcgcg ttgcgtggcg gtaagccctt tctgccacca cgcgagcagc ccgtggtcca 5940cgtgcgcggt tggcgccaac acgtcccact gttccagttg cgaccaccga tggagaggcg 6000catccgcgag caaccaggtc gtctccgccg gcgggaacgc gctcgtctta ccgccatccc 6060ccagatcgac gcagagcagg ccccccagac gcaggtgcca tttctggggc ccgtcgtccg 6120cgcgcagctt catcagatag aacgtaggaa cgttcagatc gcggacgacg gtacgcgccc 6180gccgttcgcg cgcgagcata cccaactcac cccctggggt accgtacccc acccactcgc 6240gcctccgcat gtacggcgtt tacagcattt gcatctcccc gagagactca taaggttcta 6300tacatcccat cgtagaaggt ggcgcctacg accgcgcgtg cattagcata tcaagcacgc 6360tccctcgctc ctccagccct ggctccaacg atgcccgccc gacgagacga gccttctgat 6420agacggactt ctaccgtaca ctcaacctac tataccaacc tgcgaccttc tgcaacttcg 6480accgcagaca ctctggatgg cgcagtgcgt gcttcctccg catcctcagc gcgtcgaaca 6540actggtcgag ccgccactgg acgtgcagat cccgcgtcat caggtcccaa aggaactact 6600acagtatgaa taggacaggg aaaaaaaagg tgtcgagcgc caactcctgt ttgagaagcg 6660ccagaaaggt catgagaacc tagcctttgg gcagccggag gcttgccatt ctcggatcgt 6720acatcttgac caactgccgg accatccgcg tcgtagggaa aagatgccca tcgcgcatac 6780ggacgcgccg gaaggcctcg ctccacaccc actcgcgttt ccacagggac tggtactgaa 6840actccatgac cataaacttc agtcacagca gcgtaggcgg gacgagggtc tcgtttttca 6900ggcacgcgaa aaaccttgcg cctaaaccgt cccgcttcca ctgtagcaac ttctcataga 6960aagggcgcgc tccgtatttc aacgcacact acgccttccc agggccgtgg agccttgcca 7020acaattaatg gacccgccgc tcgtgctaga gcagtttcgg caactacaac accgggtgtt 7080acatttcaag gttcttcgcg ccctacggga actaccttcc gttaaaaaat tcaaggagca 7140tccactcgag aagtcccctc gactcgggca cgagactttc ccgggtcaga cgttctactc 7200ccaaccttcg ctgcttactc gaggtgtcca gtgcccggta atcgtaaacg tccaccagcg 7260ctttccagga tttgaccgct ggataccggt aaaaaagacc ccactacgtc atcttccatt 7320cgcccagaac aagggtcgcc agggtaggtt ccaagcgccg atccagagcg cgccgtcagt 7380gatctccgag tagaggcggc ttgaagtact ggtcgtactt cccgtgctcg acgaagggtt 7440tccgggggta ggttcatatc cagagatgta gcatccactg tttctctgcg agccacgctc 7500ctacgctcgg ctagcccttc ttgacctaga gggcggtggt taacctcctc accgataact 7560acaccacttt catcttcagg gacgctgccc ggcttgtgag cacgaccgaa aacatttttg 7620cacgcgtcat gaccgtcgcc acgtgcccga catgtaggac gtgctccaac tggactgctg 7680gcgcgtgttc cttcgtctca cccttaaact cggggagcgg accgcccaaa ccgaccacca 7740gaagatgaag ccgacgaaca ggaactggca gaccgacgag ctcccctcaa tgccacctag 7800cctggtggtg cggcgcgctc gggtttcagg tctacaggcg cgcgccgcca gcctcgaact 7860actgttgtag cgcgtctacc ctcgacaggt accagacctc gagggcgccg cagtccagtc 7920cgccctcgag gacgtccaaa tggagcgtat ctgcccagtc ccgcgcccga tctaggtcca 7980ctatggatta aaggtccccg accaaccacc gccgcagcta ccgaacgttc tccggcgtag 8040gggcgccgcg ctgatgccat ggcgcgccgc ccgccacccg gcgcccccac aggaacctac 8100tacgtagatt ttcgccactg cgcccgctcg ggggcctcca tcccccccga ggcctgggcg 8160gccctctccc ccgtccccgt gcagccgcgg cgcgcgcccg tcctcgacca cgacgcgcgc 8220atccaacgac cgcttgcgct gctgcgccgc caactagagg acttagaccg cggagacgca 8280cttctgctgc ccgggccact cgaacttgga ctttctctca agctgtctta gttaaagcca 8340cagcaactgc cgccggaccg cgttttagag gacgtgcaga ggactcaaca gaactatccg 8400ctagagccgg tacttgacga gctagagaag gaggacctct agaggcgcag gccgagcgag 8460gtgccaccgc cgctccagca acctttacgc ccggtactcg acgctcttcc gcaactccgg 8520agggagcaag gtctgcgccg acatctggtg cgggggaagc cgtagcgccc gcgcgtactg 8580gtggacgcgc tctaactcga ggtgcacggc ccgcttctgc cgcatcaaag cgtccgcgac 8640tttctccatc aactcccacc accgccacac aagacggtgc ttcttcatgt attgggtcgc 8700agcgttgcac ctaagcaact atagggggtt ccggagttcc gcgaggtacc ggagcatctt 8760caggtgccgc ttcaactttt tgaccctcaa cgcgcggctg tgccaattga ggaggaggtc 8820ttctgcctac tcgagccgct gtcacagcgc gtggagcgcg agtttccgat gtccccggag 8880aagaagaaga agttagagga gaaggtattc ccggagggga agaagaagaa gaccgccgcc 8940accccctccc ccctgtgccg ccgctgctgc cgcgtggccc tccgccagct gtttcgcgag 9000ctagtagagg ggcgccgctg ccgcgtacca gagccactgc cgcgccggca agagcgcccc 9060cgcgtcaacc ttctgcggcg ggcagtacag ggccaatacc caaccgcccc ccgacggtac 9120gccgtcccta tgccgcgatt gctacgtaga gttgttaaca acacatccat gaggcggcgg 9180ctccctggac tcgctcaggc gtagctggcc tagccttttg gagagctctt tccgcagatt 9240ggtcagtgtc agcgttccat ccgactcgtg gcaccgcccg ccgtcgcccg ccgccagccc 9300caacaaagac cgcctccacg acgactacta cattaatttc atccgccaga actctgccgc 9360ctaccagctg tcttcgtggt acaggaaccc aggccggacg acttacgcgt ccgccagccg 9420gtacggggtc cgaagcaaaa ctgtagccgc gtccagaaac atcatcagaa cgtactcgga 9480aagatggccg tgaagaagaa gaggaaggag aacaggacgt agagaacgta gatagcgacg 9540ccgccgccgc ctcaaaccgg catccaccgc gggagaagga gggtacgcac actggggctt 9600cggggagtag ccgacttcgt cccgatccag ccgctgttgc gcgagccgat tataccggac 9660gacgtggacg cactcccatc tgaccttcag taggtacagg tgtttcgcca ccatacgcgg 9720gcacaactac cacattcacg tcaaccggta ttgcctggtc aattgccaga ccactgggcc 9780gacgctctcg agccacatgg actctgcgct cattcgggag ctcagtttat gcatcagcaa 9840cgttcaggcg tggtccatga ccatagggtg gtttttcacg ccgccgccga ccgccatctc 9900cccggtcgca tcccaccggc cccgaggccc ccgctctaga aggttgtatt ccgctactat 9960aggcatctac atggacctgt aggtccacta cggccgccgc caccacctcc gcgcgccttt 10020cagcgcctgc gccaaggtct acaacgcgtc gccgtttttc acgaggtacc agccctgcga 10080gaccggccag tccgcgcgcg ttagcaactg cgagatctgg cacgttttcc tctcggacat 10140tcgcccgtga gaaggcacca gaccacctat ttaagcgttc ccatagtacc gcctgctggc 10200cccaagctcg gggcataggc cggcaggcgg cactaggtac gccaatggcg ggcgcacagc 10260ttgggtccac acgctgcagt ctgttgcccc ctcacgagga aaaccgaagg aaggtccgcg 10320ccgccgacga cgcgatcgaa aaaaccggtg accggcgcgc gtcgcattcg ccaatccgac 10380ctttcgcttt cgtaattcac cgagcgaggg acatcggcct cccaataaaa ggttcccaac 10440tcagcgccct gggggccaag ctcagagcct ggccggcctg acgccgcttg cccccaaacg 10500gaggggcagt acgttctggg gcgaacgttt aaggaggcct ttgtccctgc tcggggaaaa 10560aacgaaaagg gtctacgtag gccacgacgc cgtctacgcg gggggaggag tcgtcgccgt 10620tctcgttctc gtcgccgtct gtacgtcccg tgggagggga ggaggatggc gcagtcctcc 10680ccgctgtagg cgccaactgc gccgtcgtct accactaatg cttgggggcg ccgcggcccg 10740ggccgtgatg gacctgaacc tcctcccgct cccggaccgc gccgatcctc gcgggagagg 10800actcgccgtg ggttcccacg tcgacttcgc actatgcgca ctccgcatgc acggcgccgt 10860cttggacaaa gcgctggcgc tccctctcct cgggctcctc tacgccctag ctttcaaggt 10920gcgtcccgcg ctcgacgccg taccggactt agcgctcgcc aacgacgcgc tcctcctgaa 10980actcgggctg cgcgcttggc cctaatcagg gcgcgcgcgt gtgcaccgcc ggcggctgga 11040ccattggcgt atgctcgtct gccacttggt cctctaattg aaagtttttt cgaaattgtt 11100ggtgcacgca tgcgaacacc gcgcgctcct ccaccgatat cctgactacg tagacaccct 11160gaaacattcg cgcgacctcg ttttgggttt atcgttcggc gagtaccgcg tcgacaagga 11220atatcacgtc gtgtcgtccc tgttgctccg taagtcccta cgcgacgatt tgtatcatct 11280cgggctcccg gcgaccgacg agctaaacta tttgtaggac gtctcgtatc accacgtcct 11340cgcgtcgaac tcggaccgac tgttccaccg gcggtagttg ataaggtacg aatcggaccc 11400gttcaaaatg cgggcgttct atatggtatg gggaatgcaa gggtatctgt tcctccattt 11460ctagctcccc aagatgtacg cgtaccgcga cttccacgaa tggaactcgc tgctggaccc 11520gcaaatagcg ttgctcgcgt aggtgttccg gcactcgcac tcggccgccg cgctcgagtc 11580gctggcgctc gactacgtgt cggacgtttc ccgggaccga ccgtgcccgt cgccgctatc 11640tctccggctc aggatgaaac tgcgcccgcg actggacgcg acccggggtt cggctgcgcg 11700ggacctccgt cgaccccggc ctggacccga ccgccaccgt gggcgcgcgc gaccgttgca 11760gccgccgcac ctccttatac tgctcctgct actcatgctc ggtctcctgc cgctcatgat 11820tcgccactac aaagactagt ctactacgtt ctgcgttgcc tgggccgcca cgcccgccgc 11880gacgtctcgg tcggcaggcc ggaattgagg tgcctgctga ccgcggtcca gtacctggcg 11940tagtacagcg actgacgcgc gttaggactg cgcaaggccg tcgtcggcgt ccggttggcc 12000gagaggcgtt aagaccttcg ccaccagggc cgcgcgcgtt tggggtgcgt gctcttccac 12060gaccgctagc atttgcgcga ccggcttttg tcccggtagg ccgggctgct ccggccggac 12120cagatgctgc gcgacgaagt cgcgcaccga gcaatgttgt cgccgttgca cgtctggttg 12180gacctggccg accaccccct acacgcgctc cggcaccgcg tcgcactcgc gcgcgtcgtc 12240gtcccgttgg acccgaggta ccaacgtgat ttgcggaagg actcatgtgt cgggcggttg 12300cacggcgccc ctgtcctcct gatgtggttg aaacactcgc gtgacgccga ttaccactga 12360ctctgtggcg tttcactcca catggtcaga cccggtctga taaaaaaggt ctggtcatct 12420gttccggacg tctggcattt ggactcggtc cgaaagtttt tgaacgtccc cgacaccccc 12480cacgcccgag ggtgtccgct ggcgcgctgg cacagatcga acgactgcgg gttgagcgcg 12540gacaacgacg acgattatcg cgggaagtgc ctgtcaccgt cgcacagggc cctgtgtatg 12600gatccagtga acgactgtga catggcgctc cggtatccag tccgcgtaca cctgctcgta 12660tgaaaggtcc tctaatgttc acagtcggcg cgcgaccccg tcctcctgtg cccgtcggac 12720ctccgttggg atttgatgga cgactggttg gccgccgtct tctaggggag caacgtgtca 12780aatttgtcgc tcctcctcgc gtaaaacgcg atgcacgtcg tctcgcactc ggaattggac 12840tacgcgctgc cccattgcgg gtcgcaccgc gacctgtact ggcgcgcgtt gtaccttggc 12900ccgtacatac ggagtttggc cggcaaatag ttggcggatt acctgatgaa cgtagcgcgc 12960cggcggcact tggggctcat aaagtggtta cggtagaact tgggcgtgac cgatggcggg 13020ggaccaaaga tgtggccccc taagctccac gggctcccat tgctacctaa ggagaccctg 13080ctgtatctgc tgtcgcacaa aaggggcgtt ggcgtctggg acgatctcaa cgttgtcgcg 13140ctcgtccgtc tccgccgcga cgctttcctt tcgaaggcgt ccggttcgtc gaacaggcta 13200gatccgcgac gccggggcgc cagtctacga tcatcgggta aaggttcgaa ctatcccaga 13260gaatggtcgt gagcgtggtg ggcgggcgcg gacgacccgc tcctcctcat ggatttgttg 13320agcgacgacg tcggcgtcgc gctttttttg gacggaggcc gtaaagggtt gttgccctat 13380ctctcggatc acctgttcta ctcatctacc ttctgcatgc gcgtcctcgt gtccctgcac 13440ggtccgggcg cgggcgggtg ggcagcagtt tccgtgctgg cagtcgcccc agaccacacc 13500ctcctgctac tgagccgtct gctgtcgtcg caggacctaa accctccctc accgttgggc 13560aaacgcgtgg aagcggggtc cgacccctct tacaaaattt tttttttttt cgtactacgt 13620tttatttttt gagtggttcc ggtaccgtgg ctcgcaacca aaagaacata aggggaatca 13680tacgccgcgc gccgctacat actccttcca ggaggaggga ggatgctctc acaccactcg 13740cgccgcggtc accgccgccg cgacccaaga gggaagctac gaggggacct gggcggcaaa 13800cacggaggcg ccatggacgc cggatggccc ccctctttgt cgtaggcaat gagactcaac 13860cgtggggata agctgtggtg ggcacacatg gaccacctgt tgttcagttg cctacaccgt 13920agggacttga tggtcttgct ggtgtcgttg aaagactggt gccagtaagt tttgttactg 13980atgtcgggcc ccctccgttc gtgtgtctgg tagttagaac tgctggccag cgtgaccccg 14040ccgctggact tttggtagga cgtatggttg tacggtttac acttgctcaa gtacaaatgg 14100ttattcaaat tccgcgccca ctaccacagc gcgaacggat gattcctgtt agtccacctc 14160gactttatgc tcacccacct caagtgcgac gggctcccgt tgatgaggct ctggtactgg 14220tatctggaat acttgttgcg ctagcacctc gtgatgaact ttcacccgtc tgtcttgccc 14280caagaccttt cgctgtagcc ccatttcaaa ctgtgggcgt tgaagtctga ccccaaactg 14340gggcagtgac cagaacagta cggaccccat atatgtttgc ttcggaaggt aggtctgtag 14400taaaacgacg gtcctacgcc ccacctgaag tgggtgtcgg cggactcgtt gaacaacccg 14460taggcgttcg ccgttgggaa ggtcctcccg aaatcctagt ggatgctact agacctccca 14520ccattgtaag ggcgtgacaa cctacacctg cggatggtcc gctcgaactt tctactgtgg 14580cttgtcccgc ccccaccgcg tccgccgtcg ttgtcgtcac cgtcgccgcg ccttctcttg 14640aggttgcgcc gtcggcgccg ttacgtcggc cacctcctgt acttgctagt acggtaagcg 14700ccgctgtgga aacggtgtgc ccgactcctc ttcgcgcgac tccggcttcg tcgccggctt 14760cgacggcggg ggcgacgcgt tgggctccag ctcttcggag tcttctttgg ccactagttt 14820ggggactgtc tcctgtcgtt ctttgcgtca atgttggatt attcgttact gtcgtggaag 14880tgggtcatgg cgtcgaccat ggaacgtatg ttgatgccgc tgggagtctg gccttaggcg 14940agtacctggg acgaaacgtg aggactgcat tggacgccga gcctcgtcca gatgaccagc 15000aacggtctgt actacgttct ggggcactgg aaggcgaggt gcgcggtcta gtcgttgaaa 15060ggccaccacc cgcggctcga caacgggcac gtgaggttct cgaagatgtt gctggtccgg 15120cagatgaggg ttgagtaggc ggtcaaatgg agagactggg tgcacaagtt agcgaaaggg 15180ctcttggtct aaaaccgcgc gggcggtcgg gggtggtagt ggtggcagtc acttttgcaa 15240ggacgagagt gtctagtgcc ctgcgatggc gacgcgttgt cgtagcctcc tcaggtcgct 15300cactggtaat gactgcggtc tgcggcgtgg acggggatgc aaatgttccg ggacccgtat 15360cagagcggcg cgcaggatag ctcggcgtga aaaactcgtt cgtacaggta ggaatatagc 15420gggtcgttat tgtgtccgac cccggacgcg aagggttcgt tctacaaacc gccccggttc 15480ttcgcgaggc tggttgtggg tcacgcgcac gcgcccgtga tggcgcgcgg gaccccgcgc 15540gtgtttgcgc cggcgtgacc cgcgtggtgg cagctactgc ggtagctgcg ccaccacctc 15600ctccgcgcgt tgatgtgcgg gtgcggcggt ggtcacaggt gtcacctgcg ccggtaagtc 15660tggcaccacg cgcctcgggc cgcgatacga ttttacttct ctgccgcctc cgcgcatcgt 15720gcagcggtgg cggcggctgg gccgtgacgg cgggttgcgc gccgccgccg ggacgaattg 15780gcgcgtgcag cgtggccggc tgcccgccgg tacgcccggc gagcttccga ccggcgccca 15840taacagtgac acggggggtc caggtccgct gctcgccggc ggcgtcgtcg gcgccggtaa 15900tcacgatact gagtcccagc gtccccgttg cacataaccc acgcgctgag ccaatcgccg 15960gacgcgcacg ggcacgcgtg ggcggggggc gcgttgatct aacgttcttt tttgatgaat 16020ctgagcatga caacatacat aggtcgccgc cgccgcgcgt tgcttcgata caggttcgcg 16080ttttagtttc ttctctacga ggtccagtag cgcggcctct agataccggg gggcttcttc 16140cttctcgtcc taatgttcgg ggctttcgat ttcgcccagt ttttcttttt ctttctacta 16200ctactacttg aactgctgct ccaccttgac gacgtgcgat ggcgcgggtc cgctgcccat 16260gtcacctttc cagctgcgca ttttgcacaa aacgctgggc cgtggtggca tcagaaatgc 16320gggccactcg cgaggtgggc gtggatgttc gcgcacatac tactccacat gccgctgctc 16380ctggacgaac tcgtccggtt gctcgcggag cccctcaaac ggatgccttt cgccgtattc 16440ctgtacgacc gcaacggcga cctgctcccg ttgggttgtg gatcggattt cgggcattgt 16500gacgtcgtcc acgacgggcg cgaacgtggc aggcttcttt tcgcgccgga tttcgcgctc 16560agaccactga accgtgggtg gcacgtcgac taccatgggt tcgcggtcgc tgaccttcta 16620cagaaccttt tttactggca ccttggaccc gacctcgggc tccaggcgca cgccggttag 16680ttcgtccacc gcggccctga cccgcacgtc tggcacctgc aagtctatgg gtgatggtca 16740tcgtggtcat aacggtggcg gtgtctcccg tacctctgtg tttgcagggg ccaacggagt 16800cgccaccgcc tacggcgcca cgtccgccag cgacgccggc gcaggttctg gagatgcctc 16860cacgtttgcc tgggcaccta caaagcgcaa agtcgggggg ccgcgggcgc ggcaagctcc 16920ttcatgccgc ggcggtcgcg cgatgacggg cttatacggg atgtaggaag gtaacgcgga 16980tgggggccga tagcaccgat gtggatggcg gggtcttctg ctcgttgatg ggctgcggct 17040tggtggtgac cttgggcggc ggcggcagcg gcagcggtcg ggcacgaccg gggctaaagg 17100cacgcgtccc accgagcgct tcctccgtcc tgggaccacg acggttgtcg cgcgatggtg 17160gggtcgtagc aaattttcgg ccagaaacac caagaacgtc tataccggga gtggacggcg 17220gaggcaaagg gccacggccc taaggctcct tcttacgtgg catcctcccc gtaccggccg 17280gtgccggact gcccgccgta cgcagcacgc gtggtggccg ccgccgcgcg cagcgtggca 17340gcgtacgcgc cgccatagga cggggaggaa taaggtgact agcggcgccg ctaaccgcgg 17400cacgggcctt aacgtaggca ccggaacgtc cgcgtctctg tgactaattt ttgttcaacg 17460tacacctttt tagttttatt tttcagacct gagagtgcga gcgaaccagg acattgataa 17520aacatcttac cttctgtagt tgaaacgcag agaccggggc gctgtgccga gcgcgggcaa 17580gtaccctttg accgttctat agccgtggtc gttatactcg ccaccgcgga agtcgacccc 17640gagcgacacc tcgccgtaat ttttaaagcc aaggtggcaa ttcttgatac cgtcgttccg 17700gaccttgtcg tcgtgtccgg tctacgactc cctattcaac tttctcgttt taaaggttgt 17760tttccaccat ctaccggacc ggagaccgta atcgccccac cacctggacc ggttggtccg 17820tcacgtttta ttctaattgt cattcgaact aggggcggga gggcatctcc tcggaggtgg 17880ccggcacctc tgtcacagag gtctccccgc accgcttttc gcaggcgcgg ggctgtccct 17940tctttgagac cactgcgttt atctgctcgg agggagcatg ctcctccgtg atttcgttcc 18000ggacgggtgg tgggcagggt agcgcgggta ccgatggcct cacgacccgg tcgtgtgtgg 18060gcattgcgac ctggacggag gggggcggct gtgggtcgtc tttggacacg acggtccggg 18120ctggcggcaa caacattggg caggatcggc gcgcagggac gcggcgcggc ggtcgccagg 18180cgctagcaac gccgggcatc ggtcaccgtt gaccgtttcg tgtgacttgt cgtagcaccc 18240agacccccac gttagggact tcgcggctgc tacgaagact atcgattgca cagcatacac 18300acagtacata cgcaggtaca gcggcggtct cctcgacgac tcggcggcgc gcgggcgaaa 18360ggttctaccg atggggaagc tactacggcg tcaccagaat gtacgtgtag agcccggtcc 18420tgcggagcct catggactcg gggcccgacc acgtcaaacg ggcgcggtgg ctctgcatga 18480agtcggactt attgttcaaa tctttggggt gccaccgcgg atgcgtgctg cactggtgtc 18540tggccagggt cgcaaactgc gacgccaagt agggacacct ggcactccta tgacgcatga 18600gcatgttccg cgccaagtgg gatcgacacc cactattggc acacgacctg taccgaaggt 18660gcatgaaact gtaggcgccg cacgacctgt ccccgggatg aaaattcggg atgagaccgt 18720gacggatgtt gcgggaccga gggttcccac ggggtttagg aacgcttacc ctacttcgac 18780gatgacgaga actttatttg gatcttcttc tcctgctact gttgcttctg cttcatctgc 18840tcgttcgact cgtcgttttt tgagtgcata aacccgtccg cggaataaga ccatatttat 18900aatgtttcct cccataagtt tatccacagc ttccagtttg tggatttata cggctatttt 18960gtaaagttgg acttggagtt tatcctctta gagtcaccat gctttgtctt taattagtac 19020gtcgaccctc tcaggatttt ttctgatggg gttactttgg tacaatgcca agtatacgtt 19080ttgggtgttt acttttacct cccgttccgt aagaacattt cgttgtttta cctttcgatc 19140tttcagttca cctttacgtt aaaaagagtt gatgactccg tcggcgtccg ttaccactat 19200tgaactgagg atttcaccat aacatgtcac ttctacatct atatctttgg ggtctgtgag 19260tataaagaat gtacgggtga taattccttc cattgagtgc tcttgattac ccggttgtta 19320gatacgggtt gtccggatta atgtaacgaa aatccctgtt aaaataacca gattacataa 19380tgttgtcgtg cccattatac ccacaagacc gcccggttcg tagcgtcaac ttacgacaac 19440atctaaacgt tctgtctttg tgtctcgaaa gtatggtcga aaacgaacta aggtaaccac 19500tatcttggtc catgaaaaga tacaccttag tccgacaact gtcgatacta ggtctacaat 19560cttaataact tttagtacct tgacttctac ttgaaggttt aatgacgaaa ggtgaccctc 19620cacactaatt atgtctctga gaatggttcc attttggatt ttgtccagtc cttttaccta 19680ccctttttct acgatgtctt aaaagtctat ttttacttta ttctcaacct ttattaaaac 19740ggtaccttta gttagattta cggttggaca cctctttaaa ggacatgagg ttgtatcgcg 19800acataaacgg gctgttcgat ttcatgtcag gaaggttgca tttttaaaga ctattgggtt 19860tgtggatgct gatgtacttg ttcgctcacc accgagggcc cgatcacctg acgatgtaat 19920tggaacctcg tgcgaccagg gaactgatat acctgttgca gttgggtaaa ttggtggtgg 19980cgttacgacc ggacgcgatg gcgagttaca acgacccgtt accagcgata cacgggaagg 20040tgtaggtcca cggagtcttc aagaaacggt aatttttgga ggaagaggac ggcccgagta 20100tgtggatgct caccttgaag tccttcctac aattgtacca agacgtctcg agggatcctt 20160tactggattc ccaactgcct cggtcgtaat tcaaactatc gtaaacggaa atgcggtgga 20220agaaggggta ccgggtgttg tggcggaggt gcgaactccg gtacgaatct ttgctgtggt 20280tgctggtcag gaaattgctg atagagaggc ggcggttgta cgagatggga tatgggcggt 20340tgcgatggtt gcacgggtat aggtagggga gggcgttgac ccgccgaaag gcgccgaccc 20400ggaagtgcgc ggaattctga ttcctttggg gtagtgaccc gagcccgatg ctgggaataa 20460tgtggatgag accgagatat gggatggatc taccttggaa aatggagttg gtgtggaaat 20520tcttccaccg gtaatggaaa ctgagaagac agtcgaccgg accgttactg gcggacgaat 20580gggggttgct caaactttaa ttcgcgagtc aactgcccct cccaatgttg caacgggtca 20640cattgtactg gtttctgacc aaggaccatg tttacgatcg attgatattg taaccgatgg 20700tcccgaagat atagggtctc tcgatgttcc tggcgtacat gaggaagaaa tctttgaagg 20760tcgggtactc ggcagtccac cacctactat gatttatgtt cctgatggtt gtccacccgt 20820aggatgtggt tgtgttgttg agacctaaac aaccgatgga acgggggtgg tacgcgcttc 20880ctgtccggat gggacgattg aaggggatag gcgaatatcc gttctggcgt caactgtcgt 20940aatgggtctt tttcaaagaa acgctagcgt gggaaaccgc gtagggtaag aggtcattga 21000aatacaggta cccgcgtgag tgtctggacc cggttttgga agagatgcgg ttgaggcggg 21060tgcgcgatct gtactgaaaa ctccacctag ggtacctgct cgggtgggaa gaaatacaaa 21120acaaacttca gaaactgcac caggcacacg tggtcggcgt ggcgccgcag tagctttggc 21180acatggacgc gtgcgggaag agccggccgt tgcggtgttg tatttcttcg ttcgttgtag 21240ttgttgtcga cggcggtacc cgaggtcact cgtccttgac tttcggtaac agtttctaga 21300accaacaccc ggtataaaaa acccgtggat actgttcgcg aaaggtccga aacaaagagg 21360tgtgttcgag cggacgcggt atcagttatg ccggccagcg ctctgacccc cgcatgtgac 21420ctaccggaaa cggaccttgg gcgtgagttt ttgtacgatg gagaaactcg ggaaaccgaa 21480aagactggtc gctgagttcg tccaaatggt caaactcatg ctcagtgagg acgcggcatc 21540gcggtaacga agaagggggc tggcgacata ttgcgacctt ttcaggtggg tttcgcatgt 21600ccccgggttg agccggcgga cacctgataa gacgacgtac aaagaggtgc ggaaacggtt 21660gaccggggtt tgagggtacc tagtgttggg gtggtacttg gaataatggc cccatgggtt 21720gaggtacgag ttgtcagggg tccatgtcgg gtgggacgca gcgttggtcc ttgtcgagat 21780gtcgaaggac ctcgcggtga gcgggatgaa ggcgtcggtg tcacgcgtct aatcctcgcg 21840gtgaagaaaa acagtgaact ttttgtacat ttttattaca tgatctctgt gaaagttatt 21900tccgtttacg aaaataaaca tgtgagagcc cactaataaa tgggggtggg aacggcagac 21960gcggcaaatt tttagtttcc ccaagacggc gcgtagcgat acgcggtgac cgtccctgtg 22020caacgctatg accacaaatc acgaggtgaa tttgagtccg tgttggtagg cgccgtcgag 22080ccacttcaaa agtgaggtgt ccgacgcgtg gtagtggttg cgcaaatcgt ccagcccgcg 22140gctatagaac ttcagcgtca accccggagg cgggacgcgc gcgctcaacg ctatgtgtcc 22200caacgtcgtg accttgtgat agtcgcggcc caccacgtgc gaccggtcgt gcgagaacag 22260cctctagtct aggcgcaggt ccaggaggcg caacgagtcc cgcttgcctc agttgaaacc 22320atcgacggaa gggtttttcc cgcgcacggg tccgaaactc aacgtgagcg tggcatcacc 22380gtagttttcc actggcacgg gccagacccg caatcctatg tcgcggacgt attttcggaa 22440ctagacgaat tttcggtgga ctcggaaacg cggaagtctc ttcttgtacg gcgttctgaa 22500cggccttttg actaaccggc ctgtccggcg cagcacgtgc gtcgtggaac gcagccacaa 22560cctctagacg tggtgtaaag ccggggtggc caagaagtgc tagaaccgga acgatctgac 22620gaggaagtcg cgcgcgacgg gcaaaagcga gcagtgtagg taaagttagt gcacgaggaa 22680taaatagtat tacgaaggca catctgtgaa ttcgagcgga agctagagtc gcgtcgccac 22740gtcggtgttg cgcgtcgggc acccgagcac tacgaacatc cagtggagac gtttgctgac 22800gtccatgcgg acgtccttag cggggtagta gcagtgtttc cagaacaacg accacttcca 22860gtcgacgttg ggcgccacga ggagcaagtc ggtccagaac gtatgccggc ggtctcgaag 22920gtgaaccagt ccgtcatcaa acttcaagcg gaaatctagc aataggtgca ccatgaacag 22980gtagtcgcgc gcgcgtcgga ggtacgggaa gagggtgcgt ctgtgctagc cgtgtgagtc 23040gcccaagtag tggcattaaa gtgaaaggcg aagcgacccg agaaggagaa ggagaacgca 23100ggcgtatggt gcgcggtgac ccagcagaag taagtcggcg gcgtgacacg cgaatggagg 23160aaacggtacg aactaatcgt ggccacccaa cgactttggg tggtaaacat cgcggtgtag 23220aagagaaaga aggagcgaca ggtgctaatg gagaccacta ccgcccgcga gcccgaaccc 23280tcttcccgcg aagaaaaaga agaacccgcg ttaccggttt aggcggcggc tccagctacc 23340ggcgcccgac ccacacgcgc cgtggtcgcg cagaacacta ctcagaagga gcaggagcct 23400gagctatgcg gcggagtagg cgaaaaaacc cccgcgggcc cctccgccgc cgctgcccct 23460gcccctgctg tgcaggaggt accaaccccc tgcagcgcgg cgtggcgcag gcgcgagccc 23520ccaccaaagc gcgacgagga gaagggctga ccggtaaagg aagaggatat ccgtcttttt 23580ctagtacctc agtcagctct tcttcctgtc ggattggcgg gggagactca agcggtggtg 23640gcggaggtgg ctacggcggt tgcgcggatg gtggaagggg cagctccgtg ggggcgaact 23700cctcctcctt cactaatagc tcgtcctggg tccaaaacat tcgcttctgc tgctcctggc 23760gagtcatggt tgtctcctat ttttcgttct ggtcctgttg cgtctccgtt tgctccttgt 23820tcagcccgcc cccctgcttt ccgtaccgct gatggatcta caccctctgc tgcacgacaa 23880cttcgtagac gtcgcggtca cgcggtaata gacgctgcgc aacgttctcg cgtcgctaca 23940cggggagcgg tatcgcctac agtcggaacg gatgcttgcg gtggataaga gtggcgcgca 24000tggggggttt gcggttcttt tgccgtgtac gctcgggttg ggcgcggagt tgaagatggg 24060gcataaacgg cacggtctcc acgaacggtg gatagtgtag aaaaaggttt tgacgttcta 24120tggggatagg acggcacggt tggcgtcggc tcgcctgttc gtcgaccgga acgccgtccc 24180gcgacagtat ggactatagc ggagcgagtt gcttcacggt ttttagaaac tcccagaacc 24240tgcgctgctc ttcgcgcgcc gtttgcgaga cgttgtcctt ttgtcgcttt tactttcagt 24300gagacctcac aaccaccttg agctcccact gttgcgcgcg gatcggcatg attttgcgtc 24360gtagctccag tgggtgaaac ggatgggccg tgaattggat ggggggttcc agtactcgtg 24420tcagtactca ctcgactagc acgcggcacg cgtcggggac ctctccctac gtttaaacgt 24480tcttgtttgt ctcctcccgg atgggcgtca accgctgctc gtcgatcgcg cgaccgaagt 24540ttgcgcgctc ggacggctga acctcctcgc tgcgtttgat tactaccggc gtcacgagca 24600atggcacctc gaactcacgt acgtcgccaa gaaacgactg ggcctctacg tcgcgttcga 24660tctcctttgt aacgtgatgt ggaaagctgt cccgatgcat gcggtccgga cgttctagag 24720gttgcacctc gagacgttgg accagaggat ggaaccttaa aacgtgcttt tggcggaacc 24780cgttttgcac gaagtaaggt gcgagttccc gctccgcgcg gcgctgatgc aggcgctgac 24840gcaaatgaat aaagatacga tgtggaccgt ctgccggtac ccgcaaaccg tcgtcacgaa 24900cctcctcacg ttggagttcc tcgacgtctt tgacgatttc gttttgaact tcctggatac 24960ctgccggaag ttgctcgcga ggcaccggcg cgtggaccgc ctgtagtaaa aggggcttgc 25020ggacgaattt tgggacgttg tcccagacgg tctgaagtgg tcagtttcgt acaacgtctt 25080gaaatccttg aaataggatc tcgcgagtcc ttagaacggg cggtggacga cacgtgaagg 25140atcgctgaaa cacgggtaat tcatggcgct tacgggaggc ggcgaaaccc cggtgacgat 25200ggaagacgtc gatcggttga tggaacggat ggtgagactg tattaccttc tgcactcgcc 25260actgccagat gacctcacag tgacagcgac gttggatacg tggggcgtgg cgagggacca 25320aacgttaagc gtcgacgaat tgctttcagt ttaatagcca tggaaactcg acgtcccagg 25380gagcggactg cttttcaggc gccgaggccc caactttgag tgaggccccg acacctgcag 25440ccgaatggaa gcgtttaaac atggactcct gatggtgcgg gtgctctaat ccaagatgct 25500tctggttagg gcgggcggat tacgcctcga atggcggacg cagtaatggg tcccggtgta 25560agaaccggtt aacgttcggt agttgtttcg ggcggttctc aaagacgatg ctttccctgc 25620cccccaaatg aacctggggg tcaggccgct cctcgagttg ggttaggggg gcggcggcgt 25680cgggatagtc gtcgtcggcg cccgggaacg aagggtccta ccgtgggttt ttcttcgacg 25740tcgacggcgg cggtgggtgc ctgctcctcc ttatgaccct gtcagtccgt ctcctccaaa 25800acctgctcct cctcctcctg tactaccttc tgaccctctc ggatctgctc cttcgaaggc 25860tccagcttct ccacagtctg ctttgtggca gtgggagcca gcgtaagggg agcggccgcg 25920gggtctttag ccgttggcca aggtcgtacc gatgttggag gcgaggagtc cgcggcggcc 25980gtgacgggca agcggctggg ttggcatcta ccctgtggtg accttggtcc cggccattca 26040ggttcgtcgg cggcggcaat cgggttctcg ttgttgtcgc ggttccgatg gcgagtaccg 26100cgcccgtgtt cttgcggtat caacgaacga acgttctgac acccccgttg tagaggaagc 26160gggcggcgaa agaagagatg gtagtgccgc accggaaggg ggcattgtag gacgtaatga 26220tggcagtaga gatgtcgggt atgacgtggc cgccgtcgcc gtcgttgtcg tcgccggtgt 26280gtcttcgttt ccgctggcct atcgttctga gactgtttcg ggttctttag gtgtcgccgc 26340cgtcgtcgtc ctcctcctcg cgacgcagac cgcgggttgc ttgggcatag ctgggcgctc 26400gaatctttgt cctaaaaagg gtgagacata cgatataaag ttgtctcgtc cccggttctt 26460gttctcgact tttatttttt gtccagagac gctagggagt gggcgtcgac ggacatagtg 26520ttttcgcttc tagtcgaagc cgcgtgcgac cttctgcgcc tccgagagaa gtcatttatg 26580acgcgcgact gagaattcct gatcaaagcg cgggaaagag tttaaattcg cgcttttgat 26640gcagtagagg tcgccggtgt gggccgcggt cgtggacaac agtcgcggta atactcgttc 26700ctttaagggt gcgggatgta cacctcaatg gtcggtgttt accctgaacg ccgacctcga 26760cgggttctga tgagttgggc ttatttgatg tactcgcgcc ctggggtgta ctatagggcc 26820cagttgcctt atgcgcgggt ggctttggct taagaggacc ttgtccgccg ataatggtgg 26880tgtggagcat tattggaatt aggggcatca accgggcgac gggaccacat ggtcctttca 26940gggcgagggt ggtgacacca tgaagggtct ctgcgggtcc ggcttcaagt ctactgattg 27000agtccccgcg tcgaacgccc gccgaaagca gtgtcccacg ccagcgggcc cgtcccatat 27060tgagtggact gttagtctcc cgctccataa gtcgagttgc tgctcagcca ctcgaggagc 27120gaaccagagg caggcctgcc ctgtaaagtc tagccgccgc ggccggcgag aagtaagtgc 27180ggagcagtcc gttaggattg agacgtctgg agcaggagac tcggcgcgag acctccgtaa 27240ccttgagacg ttaaataact cctcaaacac ggtagccaga tgaaattggg gaagagccct 27300ggagggccgg tgataggcct agttaaataa ggattgaaac tgcgccattt cctgagccgc 27360ctgccgatgc tgacttacaa ttcacctctc cgtctcgttg acgcggactt tgtggaccag 27420gtgacagcgg cggtgttcac gaaacgggcg ctgaggccac tcaaaacgat gaaacttaac 27480gggctcctag tatagctccc gggccgcgtg ccgcaggccg aatggcgggt ccctctcgaa 27540cgggcatcgg actaagccct caaatgggtc gcgggggacg atcaactcgc cctgtcccct 27600gggacacaag agtgacacta aacgttgaca ggattgggac ctaatgtagt tctagaaaca 27660acggtagaga cacgactcat attatttatg tctttaattt tatatgaccc cgaggatagc 27720ggtaggacat ttgcggtggc agaagtgggc gggttcgttt ggttccgctt ggaatggacc 27780atgaaaattg tagagaggga gacactaaat gttgtcaaag ttgggtctgc ctcactcaga 27840tgctctcttg gagaggctcg agtcgatgag gtagtctttt ttgtggtggg aggaatggac 27900ggcccttgca tgctcacgca gtggccggcg acgtggtgtg gatggcggac tggcatttgg 27960tctgaaaaag gcctgtctgg agttattgag acaaatggtc ttgtcctcca ctcgaatctt 28020ttgggaatcc cataatccgg tttccgcgtc gatgacaccc caaatacttg ttaagttcgt 28080tgagatgccc gataagatta agtccaaaga gatcttagcc ccaaccccaa taagagacag 28140aacactaaga gaaataagaa tatgattgcg aagagacgga ttccgagcgg cggacgacac 28200acgtgtaaac gtaaataaca gtcgaaaaat ttgcgacccc agcggtgggt tctactaatc 28260catgtattag gatccaaatg agtgggaacg cagtcgggtg ccatggtggg ttttccacct 28320aaaattcctc ggtcggacat tacaatgtaa gcgtcgactt cgattactca cgtggtgaga 28380atattttacg tggtgtcttg tacttttcga cgaataagcg gtgtttttgt tttaaccgtt 28440catacgacaa atacgataaa ccgtcggtcc actgtgatgt ctcatattac aatgtcaaaa 28500ggtcccattt tcagtatttt gaaaatacat atgaaaaggt aaaatacttt acacgctgta 28560atggtacatg tactcgtttg tcatattcaa caccgggggt gttttaacac accttttgtg 28620accgtgaaag acgacgtgac gatacgatta atgtcacgag cgaaaccaga catgggatga 28680gatataattt atgttttcgt ctgcgtcgaa ataactcctt ttcttttacg gaattaaatg 28740attcaatgtt tcgattacag tggtgattga cgaaatgagc gacgaacgtt ttgtttaagt 28800ttttcaatcg taatattaat cttatcctaa atttgggggg ccagtaaagg acgagttatg 28860gtaaggggac ttgttaactg agatacaccc tatacgaggt cgcgatgttg gaacttcagt 28920ccgaaggacc tacagtcgta gactgaaacc ggtcgtggac agggcgccta aacaaggtca 28980ggttgatgtc gctgggtggg attgtctcta ctggttgtgt tggttgcgcc ggcggcgatg 29040gcctgaatgt agatggtgtt tatgtggggt tcaaagacgg aaacagttat tgaccctatt 29100gaacccgtac accaccaaga ggtatcgcga atacaaacat acggaataat aatacaccga 29160gtagacgacg gatttcgcgt ttgcgcgggc tggtgggtag atatcagggt agtaacacga 29220tgtgggtttg ttactacctt aggtatctaa cctgcctgac tttgtgtaca agaaaagaga 29280atgtcatact aatttactct gtactaagga gctcaaaaat ataatgactg ggaacaacgc 29340gaaaaaacac gcacgaggtg taaccgacgc caaagagtgt agcttcatct gacgtaaggt 29400cggaagtgtc agataaacga aatgcctaaa cagtgggagt gcgagtagac gtcggagtag 29460tgacaccagt agcggaaata ggtcacgtaa ctgacccaga cacacgcgaa acgtatagag 29520tctgtggtag gggtcatgtc cctgtcctga tatcgactcg aagaatctta agaaattaat 29580actttaaatg acactgaaaa gacgactaat aaacgtggga tagacgcaaa acaaggggct 29640ggaggttcgg agtttctgta tatagtacgt ctaagtgagc atatacctta taaggttcaa 29700cgatgttact tttttcgcta gaaaggcttc ggaccaatat acgttagtag agacaatacc 29760acaagacgtc atggtagaat cgggatcgat atatagggat ggaactgtaa ccgaccttgc 29820gttatctacg gtacttggtg ggttgaaagg ggcgcgggcg atacgaaggt gacgttgttc 29880aacaacggcc gccgaaacag ggtcggttag tcggagcggg tggaagaggg tgggggtgac 29940tttagtcgat gaaattagat tgtcctcctc tactgactgt gggatctaga tctttacctg 30000ccttaataat gtctcgtcgc ggacgatctt tctgcgtccc gtcgccggct cgttgtcgcg 30060tacttagttc tcgaggttct gtaccaattg aacgtggtca cgttttcccc atagaaaaca 30120gagcatttcg tccggtttca gtggatgctg tcattatggt ggcctgtggc ggaatcgatg 30180ttcaacggtt ggttcgcagt ctttaaccac cagtaccacc ctcttttcgg gtaatggtat 30240tgagtcgtga gccatctttg gcttccgacg taagtgagtg gaacagttcc tggactccta 30300gagacgtggg aataattctg ggacacgcca gagtttctag aataagggaa attgattatt 30360tttttttatt atttcgtagt gaatgaattt tagtcaatcg tttaaagaca ggtcaaataa 30420gtcgtcgtgg aggaacggga ggagggtcga gaccataacg tcgaaggagg accgacgttt 30480gaaagaggtg ttagatttac cttacagtca aaggaggaca aggacaggta ggcgtgggtg 30540atagaagtac aacaacgtct acttcgcgcg ttctggcaga cttctatgga agttggggca 30600cataggtata ctgtgccttt ggccaggagg ttgacacgga aaagaatgag gagggaaaca 30660tagggggtta cccaaagttc tctcaggggg accccatgag agaaacgcgg ataggcttgg 30720agatcaatgg aggttaccgt acgaacgcga gttttacccg ttgccggaga gagacctgct 30780ccggccgttg gaatggaggg ttttacattg gtgacactcg ggtggagagt ttttttggtt 30840cagtttgtat ttggaccttt atagacgtgg ggagtgtcaa tggagtcttc gggattgaca 30900ccgacggcgg cgtggagatt accagcgccc gttgtgtgag tggtacgtta gtgtccgggg 30960cgattggcac gtgctgaggt ttgaatcgta acggtgggtt cctggggagt gtcacagtct 31020tcctttcgat cgggacgttt gtagtccggg ggagtggtgg tggctatcgt catgggaatg 31080atagtgacgg agtgggggaa attgatgacg gtgaccatcg aacccgtaac tgaactttct 31140cgggtaaata tgtgttttac cttttgatcc tgatttcatg ccccgaggaa acgtacattg 31200tctgctggat ttgtgaaact ggcatcgttg accaggtcca cactgataat tattatgaag 31260gaacgtttga tttcaatgac ctcggaaccc aaaactaagt gttccgttat acgttgaatt 31320acatcgtcct cctgattcct aactaagagt tttgtctgcg gaatatgaac tacaatcaat 31380aggcaaacta cgagttttgg ttgatttaga ttctgatcct gtcccgggag aaaaatattt 31440gagtcgggtg ttgaacctat aattgatgtt gtttccggaa atgaacaaat gtcgaagttt 31500gttaaggttt ttcgaactcc aattggattc gtgacggttc cccaactaca aactgcgatg 31560tcggtatcgg taattacgtc ctctacccga acttaaacca agtggattac gtggtttgtg 31620tttaggggag ttttgttttt aaccggtacc ggatcttaaa ctaagtttgt tccgatacca 31680aggatttgat ccttgaccgg aatcaaaact gtcgtgtcca cggtaatgtc atcctttgtt 31740tttattacta ttcgattgaa acacctggtg tggtcgaggt agaggattga catctgattt 31800acgtctcttt ctacgatttg agtgaaacca gaattgtttt acaccgtcag tttatgaacg 31860atgtcaaagt caaaaccgac aatttccgtc aaaccgaggt tatagacctt gtcaagtttc 31920acgagtagaa taatattcta aactgctttt acctcacgat gatttgttaa ggaaggacct 31980gggtcttata accttgaaat ctttacctct agaatgactt ccgtgtcgga tatgtttgcg 32040acaacctaaa tacggattgg atagtcgaat aggttttaga gtgccatttt gacggttttc 32100attgtaacag tcagttcaaa tgaatttgcc tctgttttga tttggacatt gtgattggta 32160atgtgatttg ccatgtgtcc tttgtcctct gtgttgaggt tcacgtatga gatacagtaa 32220aagtaccctg accagaccgg tgttgatgta attactttat aaacggtgta ggagaatgtg 32280aaaaagtatg taacgggttc ttatttctta gcaaacacaa tacaaagttg cacaaataaa 32340aagttaacgt cttttaaagt tcagtaaaaa gtaagtcatc atatcggggt ggtggtgtat 32400cgaatatgtc tagtggcatg gaattagttt gagtgtcttg ggatcataag ttggacggtg 32460gagggagggt tgtgtgtctc atgtgtcagg aaagaggggc cgaccggaat ttttcgtagt 32520atagtaccca ttgtctgtat aagaatccac aatataaggt gtgccaaagg acagctcggt 32580ttgcgagtag tcactataat tatttgaggg gcccgtcgag tgaattcaag tacagcgaca 32640ggtcgacgac tcggtgtccg acgacaggtt gaacgccaac gaattgcccg ccgcttcctc 32700ttcaggtgcg gatgtacccc catctcagta ttagcacgta gtcctatccc gccaccacga 32760cgtcgtcgcg cgcttatttg acgacggcgg cggcgaggca ggacgtcctt atgttgtacc 32820gtcaccagag gagtcgctac taagcgtggc gggcgtcgta ttccgcggaa caggaggccc 32880gtgtcgtcgc gtgggactag agtgaattta gtcgtgtcat tgacgtcgtg tcgtggtgtt 32940ataacaagtt ttagggtgtc acgttccgcg acataggttt cgagtaccgc ccctggtgtc 33000ttgggtgcac cggtagtatg gtgttcgcgt ccatctaatt caccgctggg gagtatttgt 33060gcgacctgta tttgtaatgg agaaaaccgt acaacattaa gtggtggagg gccatggtat 33120atttggagac taatttgtac cgcggtaggt ggtggtagga tttggtcgac cggttttgga 33180cgggcggccg atatgtgacg tcccttggcc ctgaccttgt tactgtcacc tctcgggtcc 33240tgagcattgg tacctagtag tacgagcagt actatagtta caaccgtgtt gtgtccgtgt 33300gcacgtatgt gaaggagtcc taatgttcga ggagggcgca atcttggtat agggtccctt 33360gttgggtaag gacttagtcg catttagggt gtgacgtccc ttctggagcg tgcattgagt 33420gcaacacgta acagtttcac aatgtaagcc cgtcgtcgcc tactaggagg tcataccatc 33480gcgcccaaag acagagtttt cctccatctg ctagggatga catgcctcac gcggctctgt 33540tggctctagc acaaccagca tcacagtacg gtttaccttg cggcctgcat cagtataaag 33600gacttcgttt tggtccacgc ccgcactgtt tgtctagacg cagaggccag agcggcgaat 33660ctagcgagac acatcatcaa catcatatag gtgagagagt ttcgtaggtc cgcgggggac 33720cgaagcccaa gatacatttg aggaagtacg cggcgacggg actattgtag gtggtggcgt 33780cttattcggt gtgggtcggt tggatgtgta agcaagacgc tcagtgtgtg ccctcctcgc 33840ccttctcgac cttcttggta caaaaaaaaa aataaggttt tctaataggt tttggagttt 33900tacttctaga taattcactt gcgcgagggg aggccaccgc accagtttga gatgtcggtt 33960tcttgtctat taccgtaaac attctacaac gtgttaccga aggttttccg tttgccggga 34020gtgcaggttc acctgcattt ccgatttggg aagtcccact tagaggagat atttgtaagg 34080tcgtggaagt tggtacgggt ttattaagag tagagcggtg gaagagttat atagagattc 34140gtttagggct tataattcag gccggtaaca tttttagacg aggtctcgcg ggaggtggaa 34200gtcggagttc gtcgcttagt actaacgttt ttaagtccaa ggagtgtctg gacatattct 34260aagttttcgc cttgtaattg tttttatggc gctagggcat ccagggaagc gtcccggtcg 34320acttgtatta gcacgtccag acgtgcctgg tcgcgccggt gaaggggcgg tccttggtac 34380tgttttcttg ggtgtgacta atactgtgcg tatgagcctc gatacgattg gtcgcatcgg 34440ggctacattc gaacaacgta cccgccgcta tattttacgt tccacgacga gttttttagt 34500ccgtttcgga gcgcgttttt tctttcgtgt agcatcagta cgagtacgtc tatttccgtc 34560cattcgaggc cttggtggtg tctttttctg tggtaaaaag agagtttgta cagacgccca 34620aagacgtatt tgtgttttat tttattgttt ttttgtaaat ttgtaatctt cggacagaat 34680gttgtccttt ttgttgggaa tattcgtatt ctgcctgatg ccggtacggc cgcactggca 34740tttttttgac cagtggcact aatttttcgt ggtggctgtc gaggagccag tacaggcctc 34800agtattacat tctgagccat ttgtgtagtc caactaagtg tagccagtca cgatttttcg 34860ctggctttat cgggccccct tatgtatggg cgtccgcatc tctgttgtaa tgtcgggggt 34920atcctccata ttgttttaat tatcctctct ttttgtgtat ttgtggactt tttgggagga 34980cggatccgtt ttatcgtggg agggcgaggt cttgttgtat gtcgcgaagg tgtcgccgtc 35040ggtattgtca gtcggaatgg tcattttttc ttttggataa tttttttgtg gtgagctgtg 35100ccgtggtcga gttagtcagt gtcacatttt ttcccggttc acgtctcgct catatatatc 35160ctgatttttt actgcattgc caatttcagg tgttttttgt gggtcttttg gcgtgcgctt 35220ggatgcgggt ctttgctttc ggttttttgg gtgttgaagg agtttagcag tgaaggcaaa 35280agggtgcaat gcagtgaagg gtaaaattct tttgatgtta agggttgtgt atgttcaatg 35340aggcgggatt ttggatgcag tgggcggggc aagggtgcgg ggcgcggtgc agtgtttgag 35400gtgggggagt aatagtataa ccgaagttag gttttattcc atataataac tactacaatt 35460aattcttaag cctagacgct gcgctccgac ctaccggaag gggtaatact aagaagagcg 35520aaggccgccg tagccctacg ggcgcaacgt ccggtacgac aggtccgtcc atctactgct 35580ggtagtccct gtcgaagttc cggtcgtttt ccggtccttg gcatttttcc ggcgcaacga 35640ccgcaaaaag gtatccgagg cggggggact gctcgtagtg tttttagctg cgagttcagt 35700ctccaccgct ttgggctgtc ctgatatttc tatggtccgc aaagggggac cttcgaggga 35760gcacgcgaga ggacaaggct gggacggcga atggcctatg gacaggcgga aagagggaag 35820cccttcgcac cgcgaaagag tatcgagtgc gacatccata gagtcaagcc acatccagca 35880agcgaggttc gacccgacac acgtgcttgg ggggcaagtc gggctggcga cgcggaatag 35940gccattgata gcagaactca ggttgggcca ttctgtgctg aatagcggtg accgtcgtcg 36000gtgaccattg tcctaatcgt ctcgctccat acatccgcca cgatgtctca agaacttcac 36060caccggattg atgccgatgt gatcttcctg tcataaacca tagacgcgag acgacttcgg 36120tcaatggaag cctttttctc aaccatcgag aactaggccg tttgtttggt ggcgaccatc 36180gccaccaaaa aaacaaacgt tcgtcgtcta atgcgcgtct ttttttccta gagttcttct 36240aggaaactag aaaagatgcc ccagactgcg agtcaccttg cttttgagtg caattcccta 36300aaaccagtac tctaatagtt tttcctagaa gtggatctag gaaaatttag ttagatttca 36360tatatactca tttgaaccag actgtcaatg gttacgaatt agtcactccg tggatagagt 36420cgctagacag ataaagcaag taggtatcaa cggactgagg ggcagcacat ctattgatgc 36480tatgccctcc cgaatggtag accggggtca cgacgttact atggcgctct gggtgcgagt 36540ggccgaggtc taaatagtcg ttatttggtc ggtcggcctt cccggctcgc gtcttcacca 36600ggacgttgaa ataggcggag gtaggtcaga taattaacaa cggcccttcg atctcattca 36660tcaagcggtc aattatcaaa cgcgttgcaa caacggtaac gatgtccgta gcaccacagt 36720gcgagcagca aaccataccg aagtaagtcg aggccaaggg ttgctagttc cgctcaatgt 36780actagggggt acaacacgtt ttttcgccaa tcgaggaagc caggaggcta gcaacagtct 36840tcattcaacc ggcgtcacaa tagtgagtac caataccgtc gtgacgtatt aagagaatga 36900cagtacggta ggcattctac gaaaagacac tgaccactca tgagttggtt cagtaagact 36960cttatcacat acgccgctgg ctcaacgaga acgggccgca gttgtgccct attatggcgc 37020ggtgtatcgt cttgaaattt tcacgagtag taaccttttg caagaagccc cgcttttgag 37080agttcctaga atggcgacaa ctctaggtca agctacattg ggtgagcacg tgggttgact 37140agaagtcgta gaaaatgaaa gtggtcgcaa agacccactc gtttttgtcc ttccgtttta 37200cggcgttttt tcccttattc ccgctgtgcc tttacaactt atgagtatga gaaggaaaaa 37260gttataataa cttcgtaaat agtcccaata acagagtact cgcctatgta taaacttaca 37320taaatctttt tatttgttta tccccaaggc gcgtgtaaag gggcttttca cggtggactg 37380cagattcttt ggtaataata gtactgtaat tggatatttt tatccgcata gtgctccggg 37440aaagcagaag ttcttaacct aggcttaaga atta 37474 27 1521 DNA Artificial Sequence Codon optimized DNA encoding human HIV-1 gag 27atgggtgcta gggcttctgt gctgtctggt ggtgagctgg acaagtggga gaagatcagg 60ctgaggcctg gtggcaagaa gaagtacaag ctaaagcaca ttgtgtgggc ctccagggag 120ctggagaggt ttgctgtgaa ccctggcctg ctggagacct ctgaggggtg caggcagatc 180ctgggccagc tccagccctc cctgcaaaca ggctctgagg agctgaggtc cctgtacaac 240acagtggcta ccctgtactg tgtgcaccag aagattgatg tgaaggacac caaggaggcc 300ctggagaaga ttgaggagga gcagaacaag tccaagaaga aggcccagca ggctgctgct 360ggcacaggca actccagcca ggtgtcccag aactacccca ttgtgcagaa cctccagggc 420cagatggtgc accaggccat ctccccccgg accctgaatg cctgggtgaa ggtggtggag 480gagaaggcct tctcccctga ggtgatcccc atgttctctg ccctgtctga gggtgccacc 540ccccaggacc tgaacaccat gctgaacaca gtggggggcc atcaggctgc catgcagatg 600ctgaaggaga ccatcaatga ggaggctgct gagtgggaca ggctgcatcc tgtgcacgct 660ggccccattg cccccggcca gatgagggag cccaggggct ctgacattgc tggcaccacc 720tccaccctcc aggagcagat tggctggatg accaacaacc cccccatccc tgtgggggaa 780atctacaaga ggtggatcat cctgggcctg aacaagattg tgaggatgta ctcccccacc 840tccatcctgg acatcaggca gggccccaag gagcccttca gggactatgt ggacaggttc 900tacaagaccc tgagggctga gcaggcctcc caggaggtga agaactggat gacagagacc 960ctgctggtgc agaatgccaa ccctgactgc aagaccatcc tgaaggccct gggccctgct 1020gccaccctgg aggagatgat gacagcctgc cagggggtgg ggggccctgg tcacaaggcc 1080agggtgctgg ctgaggccat gtcccaggtg accaactccg ccaccatcat gatgcagagg 1140ggcaacttca ggaaccagag gaagacagtg aagtgcttca actgtggcaa ggtgggccac 1200attgccaaga actgtagggc ccccaggaag aagggctgct ggaagtgtgg caaggagggc 1260caccagatga aggactgcaa tgagaggcag gccaacttcc tgggcaaaat ctggccctcc 1320cacaagggca ggcctggcaa cttcctccag tccaggcctg agcccacagc ccctcccgag 1380gagtccttca ggtttgggga ggagaagacc acccccagcc agaagcagga gcccattgac 1440aaggagctgt accccctggc ctccctgagg tccctgtttg gcaacgaccc ctcctcccag 1500taaaataaag cccgggcaga t 1521 28 38519 DNA Artificial Sequence Codon optimized DNA encoding pMRKAd5HIV-1 pol, coding 28catcatcaat aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggcaaaagt gacgtttttg 180gtgtgcgccg gtgtacacag gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240taaatttggg cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300agtgaaatct gaataatttt gtgttactca tagcgcgtaa tatttgtcta gggccgcggg 360gactttgacc gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt ttccgcgttc 420cgggtcaaag ttggcgtttt attattatag gcggccgcga tccattgcat acgttgtatc 480catatcataa tatgtacatt tatattggct catgtccaac attaccgcca tgttgacatt 540gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 600tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 660cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 720attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 780atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 840atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 900tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 960actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 1020aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 1080gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac cgtcagatcg 1140cctggagacg ccatccacgc tgttttgacc tccatagaag acaccgggac cgatccagcc 1200tccgcggccg ggaacggtgc attggaacgc ggattccccg tgccaagagt gagatctacc 1260atggccccca tctcccccat tgagactgtg cctgtgaagc tgaagcctgg catggatggc 1320cccaaggtga agcagtggcc cctgactgag gagaagatca aggccctggt ggaaatctgc 1380actgagatgg agaaggaggg caaaatctcc aagattggcc ccgagaaccc ctacaacacc 1440cctgtgtttg ccatcaagaa gaaggactcc accaagtgga ggaagctggt ggacttcagg 1500gagctgaaca agaggaccca ggacttctgg gaggtgcagc tgggcatccc ccaccccgct 1560ggcctgaaga agaagaagtc tgtgactgtg ctggctgtgg gggatgccta cttctctgtg 1620cccctggatg aggacttcag gaagtacact gccttcacca tcccctccat caacaatgag 1680acccctggca tcaggtacca gtacaatgtg ctgccccagg gctggaaggg ctcccctgcc 1740atcttccagt cctccatgac caagatcctg gagcccttca ggaagcagaa ccctgacatt 1800gtgatctacc agtacatggc tgccctgtat gtgggctctg acctggagat tgggcagcac 1860aggaccaaga ttgaggagct gaggcagcac ctgctgaggt ggggcctgac cacccctgac 1920aagaagcacc agaaggagcc ccccttcctg tggatgggct atgagctgca ccccgacaag 1980tggactgtgc agcccattgt gctgcctgag aaggactcct ggactgtgaa tgacatccag 2040aagctggtgg gcaagctgaa ctgggcctcc caaatctacc ctggcatcaa ggtgaggcag 2100ctgtgcaagc tgctgagggg caccaaggcc ctgactgagg tgatccccct gactgaggag 2160gctgagctgg agctggctga gaacagggag atcctgaagg agcctgtgca tggggtgtac 2220tatgacccct ccaaggacct gattgctgag atccagaagc agggccaggg ccagtggacc 2280taccaaatct accaggagcc cttcaagaac ctgaagactg gcaagtatgc caggatgagg 2340ggggcccaca ccaatgatgt gaagcagctg actgaggctg tgcagaagat caccactgag 2400tccattgtga tctggggcaa gacccccaag ttcaagctgc ccatccagaa ggagacctgg 2460gagacctggt ggactgagta ctggcaggcc acctggatcc ctgagtggga gtttgtgaac 2520accccccccc tggtgaagct gtggtaccag ctggagaagg agcccattgt gggggctgag 2580accttctatg tggctggggc tgccaacagg gagaccaagc tgggcaaggc tggctatgtg 2640accaacaggg gcaggcagaa ggtggtgacc ctgactgaca ccaccaacca gaagactgcc 2700ctccaggcca tctacctggc cctccaggac tctggcctgg aggtgaacat tgtgactgcc 2760tcccagtatg ccctgggcat catccaggcc cagcctgatc agtctgagtc tgagctggtg 2820aaccagatca ttgagcagct gatcaagaag gagaaggtgt acctggcctg ggtgcctgcc 2880cacaagggca ttgggggcaa tgagcaggtg gacaagctgg tgtctgctgg catcaggaag 2940gtgctgttcc tggatggcat tgacaaggcc caggatgagc atgagaagta ccactccaac 3000tggagggcta tggcctctga cttcaacctg ccccctgtgg tggctaagga gattgtggcc 3060tcctgtgaca agtgccagct gaagggggag gccatgcatg ggcaggtgga ctgctcccct 3120ggcatctggc agctggcctg cacccacctg gagggcaagg tgatcctggt ggctgtgcat 3180gtggcctccg gctacattga ggctgaggtg atccctgctg agacaggcca ggagactgcc 3240tacttcctgc tgaagctggc tggcaggtgg cctgtgaaga ccatccacac tgccaatggc 3300tccaacttca ctggggccac agtgagggct gcctgctggt gggctggcat caagcaggag 3360tttggcatcc cctacaaccc ccagtcccag ggggtggtgg cctccatgaa caaggagctg 3420aagaagatca ttgggcaggt gagggaccag gctgagcacc tgaagacagc tgtgcagatg 3480gctgtgttca tccacaactt caagaggaag gggggcatcg ggggctactc cgctggggag 3540aggattgtgg acatcattgc cacagacatc cagaccaagg agctccagaa gcagatcacc 3600aagatccaga acttcagggt gtactacagg gactccagga accccctgtg gaagggccct 3660gccaagctgc tgtggaaggg ggagggggct gtggtgatcc aggacaactc tgacatcaag 3720gtggtgccca ggaggaaggc caagatcatc agggactatg gcaagcagat ggctggggat 3780gactgtgtgg cctccaggca ggatgaggac taaagcccgg gcagatctgc tgtgccttct 3840agttgccagc catctgttgt ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc 3900actcccactg tcctttccta ataaaatgag gaaattgcat cgcattgtct gagtaggtgt 3960cattctattc tggggggtgg ggtggggcag gacagcaagg gggaggattg ggaagacaat 4020agcaggcatg ctggggatgc ggtgggctct atggccgatc ggcgcgccgt actgaaatgt 4080gtgggcgtgg cttaagggtg ggaaagaata tataaggtgg gggtcttatg tagttttgta 4140tctgttttgc agcagccgcc gccgccatga gcaccaactc gtttgatgga agcattgtga 4200gctcatattt gacaacgcgc atgcccccat gggccggggt gcgtcagaat gtgatgggct 4260ccagcattga tggtcgcccc gtcctgcccg caaactctac taccttgacc tacgagaccg 4320tgtctggaac gccgttggag actgcagcct ccgccgccgc ttcagccgct gcagccaccg 4380cccgcgggat tgtgactgac tttgctttcc tgagcccgct tgcaaacagt gcagcttccc 4440gttcatccgc ccgcgatgac aagttgacgg ctcttttggc acaattggat tctttgaccc 4500gggaacttaa tgtcgtttct cagcagctgt tggatctgcg ccagcaggtt tctgccctga 4560aggcttcctc ccctcccaat gcggtttaaa acataaataa aaaaccagac tctgtttgga 4620tttggatcaa gcaagtgtct tgctgtcttt atttaggggt tttgcgcgcg cggtaggccc 4680gggaccagcg gtctcggtcg ttgagggtcc tgtgtatttt ttccaggacg tggtaaaggt 4740gactctggat gttcagatac atgggcataa gcccgtctct ggggtggagg tagcaccact 4800gcagagcttc atgctgcggg gtggtgttgt agatgatcca gtcgtagcag gagcgctggg 4860cgtggtgcct aaaaatgtct ttcagtagca agctgattgc caggggcagg cccttggtgt 4920aagtgtttac aaagcggtta agctgggatg ggtgcatacg tggggatatg agatgcatct 4980tggactgtat ttttaggttg gctatgttcc cagccatatc cctccgggga ttcatgttgt 5040gcagaaccac cagcacagtg tatccggtgc acttgggaaa tttgtcatgt agcttagaag 5100gaaatgcgtg gaagaacttg gagacgccct tgtgacctcc aagattttcc atgcattcgt 5160ccataatgat ggcaatgggc ccacgggcgg cggcctgggc gaagatattt ctgggatcac 5220taacgtcata gttgtgttcc aggatgagat cgtcataggc catttttaca aagcgcgggc 5280ggagggtgcc agactgcggt ataatggttc catccggccc aggggcgtag ttaccctcac 5340agatttgcat ttcccacgct ttgagttcag atggggggat catgtctacc tgcggggcga 5400tgaagaaaac ggtttccggg gtaggggaga tcagctggga agaaagcagg ttcctgagca 5460gctgcgactt accgcagccg gtgggcccgt aaatcacacc tattaccggc tgcaactggt 5520agttaagaga gctgcagctg ccgtcatccc tgagcagggg ggccacttcg ttaagcatgt 5580ccctgactcg catgttttcc ctgaccaaat ccgccagaag gcgctcgccg cccagcgata 5640gcagttcttg caaggaagca aagtttttca acggtttgag accgtccgcc gtaggcatgc 5700ttttgagcgt ttgaccaagc agttccaggc ggtcccacag ctcggtcacc tgctctacgg 5760catctcgatc cagcatatct cctcgtttcg cgggttgggg cggctttcgc tgtacggcag 5820tagtcggtgc tcgtccagac gggccagggt catgtctttc cacgggcgca gggtcctcgt 5880cagcgtagtc tgggtcacgg tgaaggggtg cgctccgggc tgcgcgctgg ccagggtgcg 5940cttgaggctg gtcctgctgg tgctgaagcg ctgccggtct tcgccctgcg cgtcggccag 6000gtagcatttg accatggtgt catagtccag cccctccgcg gcgtggccct tggcgcgcag 6060cttgcccttg gaggaggcgc cgcacgaggg gcagtgcaga cttttgaggg cgtagagctt 6120gggcgcgaga aataccgatt ccggggagta ggcatccgcg ccgcaggccc cgcagacggt 6180ctcgcattcc acgagccagg tgagctctgg ccgttcgggg tcaaaaacca ggtttccccc 6240atgctttttg atgcgtttct tacctctggt ttccatgagc cggtgtccac gctcggtgac 6300gaaaaggctg tccgtgtccc cgtatacaga cttgagaggc ctgtcctcga gcggtgttcc 6360gcggtcctcc tcgtatagaa actcggacca ctctgagaca aaggctcgcg tccaggccag 6420cacgaaggag gctaagtggg aggggtagcg gtcgttgtcc actagggggt ccactcgctc 6480cagggtgtga agacacatgt cgccctcttc ggcatcaagg aaggtgattg gtttgtaggt 6540gtaggccacg tgaccgggtg ttcctgaagg ggggctataa aagggggtgg gggcgcgttc 6600gtcctcactc tcttccgcat cgctgtctgc gagggccagc tgttggggtg agtactccct 6660ctgaaaagcg ggcatgactt ctgcgctaag attgtcagtt tccaaaaacg aggaggattt 6720gatattcacc tggcccgcgg tgatgccttt gagggtggcc gcatccatct ggtcagaaaa 6780gacaatcttt ttgttgtcaa gcttggtggc aaacgacccg tagagggcgt tggacagcaa 6840cttggcgatg gagcgcaggg tttggttttt gtcgcgatcg gcgcgctcct tggccgcgat 6900gtttagctgc acgtattcgc gcgcaacgca ccgccattcg ggaaagacgg tggtgcgctc 6960gtcgggcacc aggtgcacgc gccaaccgcg gttgtgcagg gtgacaaggt caacgctggt 7020ggctacctct ccgcgtaggc gctcgttggt ccagcagagg cggccgccct tgcgcgagca 7080gaatggcggt agggggtcta gctgcgtctc gtccgggggg tctgcgtcca cggtaaagac 7140cccgggcagc aggcgcgcgt cgaagtagtc tatcttgcat ccttgcaagt ctagcgcctg 7200ctgccatgcg cgggcggcaa gcgcgcgctc gtatgggttg agtgggggac cccatggcat 7260ggggtgggtg agcgcggagg cgtacatgcc gcaaatgtcg taaacgtaga ggggctctct 7320gagtattcca agatatgtag ggtagcatct tccaccgcgg atgctggcgc gcacgtaatc 7380gtatagttcg tgcgagggag cgaggaggtc gggaccgagg ttgctacggg cgggctgctc 7440tgctcggaag actatctgcc tgaagatggc atgtgagttg gatgatatgg ttggacgctg 7500gaagacgttg aagctggcgt ctgtgagacc taccgcgtca cgcacgaagg aggcgtagga 7560gtcgcgcagc ttgttgacca gctcggcggt gacctgcacg tctagggcgc agtagtccag 7620ggtttccttg atgatgtcat acttatcctg tccctttttt ttccacagct cgcggttgag 7680gacaaactct tcgcggtctt tccagtactc ttggatcgga aacccgtcgg cctccgaacg 7740gtaagagcct agcatgtaga actggttgac ggcctggtag gcgcagcatc ccttttctac 7800gggtagcgcg tatgcctgcg cggccttccg gagcgaggtg tgggtgagcg caaaggtgtc 7860cctgaccatg actttgaggt actggtattt gaagtcagtg tcgtcgcatc cgccctgctc 7920ccagagcaaa aagtccgtgc gctttttgga acgcggattt ggcagggcga aggtgacatc 7980gttgaagagt atctttcccg cgcgaggcat aaagttgcgt gtgatgcgga agggtcccgg 8040cacctcggaa cggttgttaa ttacctgggc ggcgagcacg atctcgtcaa agccgttgat 8100gttgtggccc acaatgtaaa gttccaagaa gcgcgggatg cccttgatgg aaggcaattt 8160tttaagttcc tcgtaggtga gctcttcagg ggagctgagc ccgtgctctg aaagggccca 8220gtctgcaaga tgagggttgg aagcgacgaa tgagctccac aggtcacggg ccattagcat 8280ttgcaggtgg tcgcgaaagg tcctaaactg gcgacctatg gccatttttt ctggggtgat 8340gcagtagaag gtaagcgggt cttgttccca gcggtcccat ccaaggttcg cggctaggtc 8400tcgcgcggca gtcactagag gctcatctcc gccgaacttc atgaccagca tgaagggcac 8460gagctgcttc ccaaaggccc ccatccaagt ataggtctct acatcgtagg tgacaaagag 8520acgctcggtg cgaggatgcg agccgatcgg gaagaactgg atctcccgcc accaattgga 8580ggagtggcta ttgatgtggt gaaagtagaa gtccctgcga cgggccgaac actcgtgctg 8640gcttttgtaa aaacgtgcgc agtactggca gcggtgcacg ggctgtacat cctgcacgag 8700gttgacctga cgaccgcgca caaggaagca gagtgggaat ttgagcccct cgcctggcgg 8760gtttggctgg tggtcttcta cttcggctgc ttgtccttga ccgtctggct gctcgagggg 8820agttacggtg gatcggacca ccacgccgcg cgagcccaaa gtccagatgt ccgcgcgcgg 8880cggtcggagc ttgatgacaa catcgcgcag atgggagctg tccatggtct ggagctcccg 8940cggcgtcagg tcaggcggga gctcctgcag gtttacctcg catagacggg tcagggcgcg 9000ggctagatcc aggtgatacc taatttccag gggctggttg gtggcggcgt cgatggcttg 9060caagaggccg catccccgcg gcgcgactac ggtaccgcgc ggcgggcggt gggccgcggg 9120ggtgtccttg gatgatgcat ctaaaagcgg tgacgcgggc gagcccccgg aggtaggggg 9180ggctccggac ccgccgggag agggggcagg ggcacgtcgg cgccgcgcgc gggcaggagc 9240tggtgctgcg cgcgtaggtt gctggcgaac gcgacgacgc ggcggttgat ctcctgaatc 9300tggcgcctct gcgtgaagac gacgggcccg gtgagcttga acctgaaaga gagttcgaca 9360gaatcaattt cggtgtcgtt gacggcggcc tggcgcaaaa tctcctgcac gtctcctgag 9420ttgtcttgat aggcgatctc ggccatgaac tgctcgatct cttcctcctg gagatctccg 9480cgtccggctc gctccacggt ggcggcgagg tcgttggaaa tgcgggccat gagctgcgag 9540aaggcgttga ggcctccctc gttccagacg cggctgtaga ccacgccccc ttcggcatcg 9600cgggcgcgca tgaccacctg cgcgagattg agctccacgt gccgggcgaa gacggcgtag 9660tttcgcaggc gctgaaagag gtagttgagg gtggtggcgg tgtgttctgc cacgaagaag 9720tacataaccc agcgtcgcaa cgtggattcg ttgatatccc ccaaggcctc aaggcgctcc 9780atggcctcgt agaagtccac ggcgaagttg aaaaactggg agttgcgcgc cgacacggtt 9840aactcctcct ccagaagacg gatgagctcg gcgacagtgt cgcgcacctc gcgctcaaag 9900gctacagggg cctcttcttc ttcttcaatc tcctcttcca taagggcctc cccttcttct 9960tcttctggcg gcggtggggg aggggggaca cggcggcgac gacggcgcac cgggaggcgg 10020tcgacaaagc gctcgatcat ctccccgcgg cgacggcgca tggtctcggt gacggcgcgg 10080ccgttctcgc gggggcgcag ttggaagacg ccgcccgtca tgtcccggtt atgggttggc 10140ggggggctgc catgcggcag ggatacggcg ctaacgatgc atctcaacaa ttgttgtgta 10200ggtactccgc cgccgaggga cctgagcgag tccgcatcga ccggatcgga aaacctctcg 10260agaaaggcgt ctaaccagtc acagtcgcaa ggtaggctga gcaccgtggc gggcggcagc 10320gggcggcggt cggggttgtt tctggcggag gtgctgctga tgatgtaatt aaagtaggcg 10380gtcttgagac ggcggatggt cgacagaagc accatgtcct tgggtccggc ctgctgaatg 10440cgcaggcggt cggccatgcc ccaggcttcg ttttgacatc ggcgcaggtc tttgtagtag 10500tcttgcatga gcctttctac cggcacttct tcttctcctt cctcttgtcc tgcatctctt 10560gcatctatcg ctgcggcggc ggcggagttt ggccgtaggt ggcgccctct tcctcccatg 10620cgtgtgaccc cgaagcccct catcggctga agcagggcta ggtcggcgac aacgcgctcg 10680gctaatatgg cctgctgcac ctgcgtgagg gtagactgga agtcatccat gtccacaaag 10740cggtggtatg cgcccgtgtt gatggtgtaa gtgcagttgg ccataacgga ccagttaacg 10800gtctggtgac ccggctgcga gagctcggtg tacctgagac gcgagtaagc cctcgagtca 10860aatacgtagt cgttgcaagt ccgcaccagg tactggtatc ccaccaaaaa gtgcggcggc 10920ggctggcggt agaggggcca gcgtagggtg gccggggctc cgggggcgag atcttccaac 10980ataaggcgat gatatccgta gatgtacctg gacatccagg tgatgccggc ggcggtggtg 11040gaggcgcgcg gaaagtcgcg gacgcggttc cagatgttgc gcagcggcaa aaagtgctcc 11100atggtcggga cgctctggcc ggtcaggcgc gcgcaatcgt tgacgctcta gaccgtgcaa 11160aaggagagcc tgtaagcggg cactcttccg tggtctggtg gataaattcg caagggtatc 11220atggcggacg accggggttc gagccccgta tccggccgtc cgccgtgatc catgcggtta 11280ccgcccgcgt gtcgaaccca ggtgtgcgac gtcagacaac gggggagtgc tccttttggc 11340ttccttccag gcgcggcggc tgctgcgcta gcttttttgg ccactggccg cgcgcagcgt 11400aagcggttag gctggaaagc gaaagcatta agtggctcgc tccctgtagc cggagggtta 11460ttttccaagg gttgagtcgc gggacccccg gttcgagtct cggaccggcc ggactgcggc 11520gaacgggggt ttgcctcccc gtcatgcaag accccgcttg caaattcctc cggaaacagg 11580gacgagcccc ttttttgctt ttcccagatg catccggtgc tgcggcagat gcgcccccct 11640cctcagcagc ggcaagagca agagcagcgg cagacatgca gggcaccctc ccctcctcct 11700accgcgtcag gaggggcgac atccgcggtt gacgcggcag cagatggtga ttacgaaccc 11760ccgcggcgcc gggcccggca ctacctggac ttggaggagg gcgagggcct ggcgcggcta 11820ggagcgccct ctcctgagcg gcacccaagg gtgcagctga agcgtgatac gcgtgaggcg 11880tacgtgccgc ggcagaacct gtttcgcgac cgcgagggag aggagcccga ggagatgcgg 11940gatcgaaagt tccacgcagg gcgcgagctg cggcatggcc tgaatcgcga gcggttgctg 12000cgcgaggagg actttgagcc cgacgcgcga accgggatta gtcccgcgcg cgcacacgtg 12060gcggccgccg acctggtaac cgcatacgag cagacggtga accaggagat taactttcaa 12120aaaagcttta acaaccacgt gcgtacgctt gtggcgcgcg aggaggtggc tataggactg 12180atgcatctgt gggactttgt aagcgcgctg gagcaaaacc caaatagcaa gccgctcatg 12240gcgcagctgt tccttatagt gcagcacagc agggacaacg aggcattcag ggatgcgctg 12300ctaaacatag tagagcccga gggccgctgg ctgctcgatt tgataaacat cctgcagagc 12360atagtggtgc aggagcgcag cttgagcctg gctgacaagg tggccgccat caactattcc 12420atgcttagcc tgggcaagtt ttacgcccgc aagatatacc atacccctta cgttcccata 12480gacaaggagg taaagatcga ggggttctac atgcgcatgg cgctgaaggt gcttaccttg 12540agcgacgacc tgggcgttta tcgcaacgag cgcatccaca aggccgtgag cgtgagccgg 12600cggcgcgagc tcagcgaccg cgagctgatg cacagcctgc aaagggccct ggctggcacg 12660ggcagcggcg atagagaggc cgagtcctac tttgacgcgg gcgctgacct gcgctgggcc 12720ccaagccgac gcgccctgga ggcagctggg gccggacctg ggctggcggt ggcacccgcg 12780cgcgctggca acgtcggcgg cgtggaggaa tatgacgagg acgatgagta cgagccagag 12840gacggcgagt actaagcggt gatgtttctg atcagatgat gcaagacgca acggacccgg 12900cggtgcgggc ggcgctgcag agccagccgt ccggccttaa ctccacggac gactggcgcc 12960aggtcatgga ccgcatcatg tcgctgactg cgcgcaatcc tgacgcgttc cggcagcagc 13020cgcaggccaa ccggctctcc gcaattctgg aagcggtggt cccggcgcgc gcaaacccca 13080cgcacgagaa ggtgctggcg atcgtaaacg cgctggccga aaacagggcc atccggcccg 13140acgaggccgg cctggtctac gacgcgctgc ttcagcgcgt ggctcgttac aacagcggca 13200acgtgcagac caacctggac cggctggtgg gggatgtgcg cgaggccgtg gcgcagcgtg 13260agcgcgcgca gcagcagggc aacctgggct ccatggttgc actaaacgcc ttcctgagta 13320cacagcccgc caacgtgccg cggggacagg aggactacac caactttgtg agcgcactgc 13380ggctaatggt gactgagaca ccgcaaagtg aggtgtacca gtctgggcca gactattttt 13440tccagaccag tagacaaggc ctgcagaccg taaacctgag ccaggctttc aaaaacttgc 13500aggggctgtg gggggtgcgg gctcccacag gcgaccgcgc gaccgtgtct agcttgctga 13560cgcccaactc gcgcctgttg ctgctgctaa tagcgccctt cacggacagt ggcagcgtgt 13620cccgggacac atacctaggt cacttgctga cactgtaccg cgaggccata ggtcaggcgc 13680atgtggacga gcatactttc caggagatta caagtgtcag ccgcgcgctg gggcaggagg 13740acacgggcag cctggaggca accctaaact acctgctgac caaccggcgg cagaagatcc 13800cctcgttgca cagtttaaac agcgaggagg agcgcatttt gcgctacgtg cagcagagcg 13860tgagccttaa cctgatgcgc gacggggtaa cgcccagcgt ggcgctggac atgaccgcgc 13920gcaacatgga accgggcatg tatgcctcaa accggccgtt tatcaaccgc ctaatggact 13980acttgcatcg cgcggccgcc gtgaaccccg agtatttcac caatgccatc ttgaacccgc 14040actggctacc gccccctggt ttctacaccg ggggattcga ggtgcccgag ggtaacgatg 14100gattcctctg ggacgacata gacgacagcg tgttttcccc gcaaccgcag accctgctag 14160agttgcaaca gcgcgagcag gcagaggcgg cgctgcgaaa ggaaagcttc cgcaggccaa 14220gcagcttgtc cgatctaggc gctgcggccc cgcggtcaga tgctagtagc ccatttccaa 14280gcttgatagg gtctcttacc agcactcgca ccacccgccc gcgcctgctg ggcgaggagg 14340agtacctaaa caactcgctg ctgcagccgc agcgcgaaaa aaacctgcct ccggcatttc 14400ccaacaacgg gatagagagc ctagtggaca agatgagtag atggaagacg tacgcgcagg 14460agcacaggga cgtgccaggc ccgcgcccgc ccacccgtcg tcaaaggcac gaccgtcagc 14520ggggtctggt gtgggaggac gatgactcgg cagacgacag cagcgtcctg gatttgggag 14580ggagtggcaa cccgtttgcg caccttcgcc ccaggctggg gagaatgttt taaaaaaaaa 14640aaaagcatga tgcaaaataa aaaactcacc aaggccatgg caccgagcgt tggttttctt 14700gtattcccct tagtatgcgg cgcgcggcga tgtatgagga aggtcctcct ccctcctacg 14760agagtgtggt gagcgcggcg ccagtggcgg cggcgctggg ttctcccttc gatgctcccc 14820tggacccgcc gtttgtgcct ccgcggtacc tgcggcctac cggggggaga aacagcatcc 14880gttactctga gttggcaccc ctattcgaca ccacccgtgt gtacctggtg gacaacaagt 14940caacggatgt ggcatccctg aactaccaga acgaccacag caactttctg accacggtca 15000ttcaaaacaa tgactacagc ccgggggagg caagcacaca gaccatcaat cttgacgacc 15060ggtcgcactg gggcggcgac ctgaaaacca tcctgcatac caacatgcca aatgtgaacg 15120agttcatgtt taccaataag tttaaggcgc gggtgatggt gtcgcgcttg cctactaagg 15180acaatcaggt ggagctgaaa tacgagtggg tggagttcac gctgcccgag ggcaactact 15240ccgagaccat gaccatagac cttatgaaca acgcgatcgt ggagcactac ttgaaagtgg 15300gcagacagaa cggggttctg gaaagcgaca tcggggtaaa gtttgacacc cgcaacttca 15360gactggggtt tgaccccgtc actggtcttg tcatgcctgg ggtatataca aacgaagcct 15420tccatccaga catcattttg ctgccaggat gcggggtgga cttcacccac agccgcctga 15480gcaacttgtt gggcatccgc aagcggcaac ccttccagga gggctttagg atcacctacg 15540atgatctgga gggtggtaac attcccgcac tgttggatgt ggacgcctac caggcgagct 15600tgaaagatga caccgaacag ggcgggggtg gcgcaggcgg cagcaacagc agtggcagcg 15660gcgcggaaga gaactccaac gcggcagccg cggcaatgca gccggtggag gacatgaacg 15720atcatgccat tcgcggcgac acctttgcca cacgggctga ggagaagcgc gctgaggccg 15780aagcagcggc cgaagctgcc gcccccgctg cgcaacccga ggtcgagaag cctcagaaga 15840aaccggtgat caaacccctg acagaggaca gcaagaaacg cagttacaac ctaataagca 15900atgacagcac cttcacccag taccgcagct ggtaccttgc atacaactac ggcgaccctc 15960agaccggaat ccgctcatgg accctgcttt gcactcctga cgtaacctgc ggctcggagc 16020aggtctactg gtcgttgcca gacatgatgc aagaccccgt gaccttccgc tccacgcgcc 16080agatcagcaa ctttccggtg gtgggcgccg agctgttgcc cgtgcactcc aagagcttct 16140acaacgacca ggccgtctac tcccaactca tccgccagtt tacctctctg acccacgtgt 16200tcaatcgctt tcccgagaac cagattttgg cgcgcccgcc agcccccacc atcaccaccg 16260tcagtgaaaa cgttcctgct ctcacagatc acgggacgct accgctgcgc aacagcatcg 16320gaggagtcca gcgagtgacc attactgacg ccagacgccg cacctgcccc tacgtttaca 16380aggccctggg catagtctcg ccgcgcgtcc tatcgagccg cactttttga gcaagcatgt 16440ccatccttat atcgcccagc aataacacag gctggggcct gcgcttccca agcaagatgt 16500ttggcggggc caagaagcgc tccgaccaac acccagtgcg cgtgcgcggg cactaccgcg 16560cgccctgggg cgcgcacaaa cgcggccgca ctgggcgcac caccgtcgat gacgccatcg 16620acgcggtggt ggaggaggcg cgcaactaca cgcccacgcc gccaccagtg tccacagtgg 16680acgcggccat tcagaccgtg gtgcgcggag cccggcgcta tgctaaaatg aagagacggc 16740ggaggcgcgt agcacgtcgc caccgccgcc gacccggcac tgccgcccaa cgcgcggcgg 16800cggccctgct taaccgcgca cgtcgcaccg gccgacgggc ggccatgcgg gccgctcgaa 16860ggctggccgc gggtattgtc actgtgcccc ccaggtccag gcgacgagcg gccgccgcag 16920cagccgcggc cattagtgct atgactcagg gtcgcagggg caacgtgtat tgggtgcgcg 16980actcggttag cggcctgcgc gtgcccgtgc gcacccgccc cccgcgcaac tagattgcaa 17040gaaaaaacta cttagactcg tactgttgta tgtatccagc ggcggcggcg cgcaacgaag 17100ctatgtccaa gcgcaaaatc aaagaagaga tgctccaggt catcgcgccg gagatctatg 17160gccccccgaa gaaggaagag caggattaca agccccgaaa gctaaagcgg gtcaaaaaga 17220aaaagaaaga tgatgatgat gaacttgacg acgaggtgga actgctgcac gctaccgcgc 17280ccaggcgacg ggtacagtgg aaaggtcgac gcgtaaaacg tgttttgcga cccggcacca 17340ccgtagtctt tacgcccggt gagcgctcca cccgcaccta caagcgcgtg tatgatgagg 17400tgtacggcga cgaggacctg cttgagcagg ccaacgagcg cctcggggag tttgcctacg 17460gaaagcggca taaggacatg ctggcgttgc cgctggacga gggcaaccca acacctagcc 17520taaagcccgt aacactgcag caggtgctgc ccgcgcttgc accgtccgaa gaaaagcgcg 17580gcctaaagcg cgagtctggt gacttggcac ccaccgtgca gctgatggta cccaagcgcc 17640agcgactgga agatgtcttg gaaaaaatga ccgtggaacc tgggctggag cccgaggtcc 17700gcgtgcggcc aatcaagcag gtggcgccgg gactgggcgt gcagaccgtg gacgttcaga 17760tacccactac cagtagcacc agtattgcca ccgccacaga gggcatggag acacaaacgt 17820ccccggttgc ctcagcggtg gcggatgccg cggtgcaggc ggtcgctgcg gccgcgtcca 17880agacctctac ggaggtgcaa acggacccgt ggatgtttcg cgtttcagcc ccccggcgcc 17940cgcgccgttc gaggaagtac ggcgccgcca gcgcgctact gcccgaatat gccctacatc 18000cttccattgc gcctaccccc ggctatcgtg gctacaccta ccgccccaga agacgagcaa 18060ctacccgacg ccgaaccacc actggaaccc gccgccgccg tcgccgtcgc cagcccgtgc 18120tggccccgat ttccgtgcgc agggtggctc gcgaaggagg caggaccctg gtgctgccaa 18180cagcgcgcta ccaccccagc atcgtttaaa agccggtctt tgtggttctt gcagatatgg 18240ccctcacctg ccgcctccgt ttcccggtgc cgggattccg aggaagaatg caccgtagga 18300ggggcatggc cggccacggc ctgacgggcg gcatgcgtcg tgcgcaccac cggcggcggc 18360gcgcgtcgca ccgtcgcatg cgcggcggta tcctgcccct ccttattcca ctgatcgccg 18420cggcgattgg cgccgtgccc ggaattgcat ccgtggcctt gcaggcgcag agacactgat 18480taaaaacaag ttgcatgtgg aaaaatcaaa ataaaaagtc tggactctca cgctcgcttg 18540gtcctgtaac tattttgtag aatggaagac atcaactttg cgtctctggc cccgcgacac 18600ggctcgcgcc cgttcatggg aaactggcaa gatatcggca ccagcaatat gagcggtggc 18660gccttcagct ggggctcgct gtggagcggc attaaaaatt tcggttccac cgttaagaac 18720tatggcagca aggcctggaa cagcagcaca ggccagatgc tgagggataa gttgaaagag 18780caaaatttcc aacaaaaggt ggtagatggc ctggcctctg gcattagcgg ggtggtggac 18840ctggccaacc aggcagtgca aaataagatt aacagtaagc ttgatccccg ccctcccgta 18900gaggagcctc caccggccgt ggagacagtg tctccagagg ggcgtggcga aaagcgtccg 18960cgccccgaca gggaagaaac tctggtgacg caaatagacg agcctccctc gtacgaggag 19020gcactaaagc aaggcctgcc caccacccgt cccatcgcgc ccatggctac cggagtgctg 19080ggccagcaca cacccgtaac gctggacctg cctccccccg ccgacaccca gcagaaacct 19140gtgctgccag gcccgaccgc cgttgttgta acccgtccta gccgcgcgtc cctgcgccgc 19200gccgccagcg gtccgcgatc gttgcggccc gtagccagtg gcaactggca aagcacactg 19260aacagcatcg tgggtctggg ggtgcaatcc ctgaagcgcc gacgatgctt ctgatagcta 19320acgtgtcgta tgtgtgtcat gtatgcgtcc atgtcgccgc cagaggagct gctgagccgc 19380cgcgcgcccg ctttccaaga tggctacccc ttcgatgatg ccgcagtggt cttacatgca 19440catctcgggc caggacgcct cggagtacct gagccccggg ctggtgcagt ttgcccgcgc 19500caccgagacg tacttcagcc tgaataacaa gtttagaaac cccacggtgg cgcctacgca 19560cgacgtgacc acagaccggt cccagcgttt gacgctgcgg ttcatccctg tggaccgtga 19620ggatactgcg tactcgtaca aggcgcggtt caccctagct gtgggtgata accgtgtgct 19680ggacatggct tccacgtact ttgacatccg cggcgtgctg gacaggggcc ctacttttaa 19740gccctactct ggcactgcct acaacgccct ggctcccaag ggtgccccaa atccttgcga 19800atgggatgaa gctgctactg ctcttgaaat aaacctagaa gaagaggacg atgacaacga 19860agacgaagta gacgagcaag ctgagcagca aaaaactcac gtatttgggc aggcgcctta 19920ttctggtata aatattacaa aggagggtat tcaaataggt gtcgaaggtc aaacacctaa 19980atatgccgat aaaacatttc aacctgaacc tcaaatagga gaatctcagt ggtacgaaac 20040agaaattaat catgcagctg ggagagtcct aaaaaagact accccaatga aaccatgtta 20100cggttcatat gcaaaaccca caaatgaaaa tggagggcaa ggcattcttg taaagcaaca 20160aaatggaaag ctagaaagtc aagtggaaat gcaatttttc tcaactactg aggcagccgc 20220aggcaatggt gataacttga ctcctaaagt ggtattgtac agtgaagatg tagatataga 20280aaccccagac actcatattt cttacatgcc cactattaag gaaggtaact cacgagaact 20340aatgggccaa caatctatgc ccaacaggcc taattacatt gcttttaggg acaattttat 20400tggtctaatg tattacaaca gcacgggtaa tatgggtgtt ctggcgggcc aagcatcgca 20460gttgaatgct gttgtagatt tgcaagacag aaacacagag ctttcatacc agcttttgct 20520tgattccatt ggtgatagaa ccaggtactt ttctatgtgg aatcaggctg ttgacagcta 20580tgatccagat gttagaatta ttgaaaatca tggaactgaa gatgaacttc caaattactg 20640ctttccactg ggaggtgtga ttaatacaga gactcttacc aaggtaaaac ctaaaacagg 20700tcaggaaaat ggatgggaaa aagatgctac agaattttca gataaaaatg aaataagagt 20760tggaaataat tttgccatgg aaatcaatct aaatgccaac ctgtggagaa atttcctgta 20820ctccaacata gcgctgtatt tgcccgacaa gctaaagtac agtccttcca acgtaaaaat 20880ttctgataac ccaaacacct acgactacat gaacaagcga gtggtggctc ccgggctagt 20940ggactgctac attaaccttg gagcacgctg gtcccttgac tatatggaca acgtcaaccc 21000atttaaccac caccgcaatg ctggcctgcg ctaccgctca atgttgctgg gcaatggtcg 21060ctatgtgccc ttccacatcc aggtgcctca gaagttcttt gccattaaaa acctccttct 21120cctgccgggc tcatacacct acgagtggaa cttcaggaag gatgttaaca tggttctgca 21180gagctcccta ggaaatgacc taagggttga cggagccagc attaagtttg atagcatttg 21240cctttacgcc accttcttcc ccatggccca caacaccgcc tccacgcttg aggccatgct 21300tagaaacgac accaacgacc agtcctttaa cgactatctc tccgccgcca acatgctcta 21360ccctataccc gccaacgcta ccaacgtgcc catatccatc ccctcccgca actgggcggc 21420tttccgcggc tgggccttca cgcgccttaa gactaaggaa accccatcac tgggctcggg 21480ctacgaccct tattacacct actctggctc tataccctac ctagatggaa ccttttacct 21540caaccacacc tttaagaagg tggccattac ctttgactct tctgtcagct ggcctggcaa 21600tgaccgcctg cttaccccca acgagtttga aattaagcgc tcagttgacg gggagggtta 21660caacgttgcc cagtgtaaca tgaccaaaga ctggttcctg gtacaaatgc tagctaacta 21720taacattggc taccagggct tctatatccc agagagctac aaggaccgca tgtactcctt 21780ctttagaaac ttccagccca tgagccgtca ggtggtggat gatactaaat acaaggacta 21840ccaacaggtg ggcatcctac accaacacaa caactctgga tttgttggct accttgcccc 21900caccatgcgc gaaggacagg cctaccctgc taacttcccc tatccgctta taggcaagac 21960cgcagttgac agcattaccc agaaaaagtt tctttgcgat cgcacccttt ggcgcatccc 22020attctccagt aactttatgt ccatgggcgc actcacagac ctgggccaaa accttctcta 22080cgccaactcc gcccacgcgc tagacatgac ttttgaggtg gatcccatgg acgagcccac 22140ccttctttat gttttgtttg aagtctttga cgtggtccgt gtgcaccagc cgcaccgcgg 22200cgtcatcgaa accgtgtacc tgcgcacgcc cttctcggcc ggcaacgcca caacataaag 22260aagcaagcaa catcaacaac agctgccgcc atgggctcca gtgagcagga actgaaagcc 22320attgtcaaag atcttggttg tgggccatat tttttgggca cctatgacaa gcgctttcca 22380ggctttgttt ctccacacaa gctcgcctgc gccatagtca atacggccgg tcgcgagact 22440gggggcgtac actggatggc ctttgcctgg aacccgcact caaaaacatg ctacctcttt 22500gagccctttg gcttttctga ccagcgactc aagcaggttt accagtttga gtacgagtca 22560ctcctgcgcc gtagcgccat tgcttcttcc cccgaccgct gtataacgct ggaaaagtcc 22620acccaaagcg tacaggggcc caactcggcc gcctgtggac tattctgctg catgtttctc 22680cacgcctttg ccaactggcc ccaaactccc atggatcaca accccaccat gaaccttatt 22740accggggtac ccaactccat gctcaacagt ccccaggtac agcccaccct gcgtcgcaac 22800caggaacagc tctacagctt cctggagcgc cactcgccct acttccgcag ccacagtgcg 22860cagattagga gcgccacttc tttttgtcac ttgaaaaaca tgtaaaaata atgtactaga 22920gacactttca ataaaggcaa atgcttttat ttgtacactc tcgggtgatt atttaccccc 22980acccttgccg tctgcgccgt ttaaaaatca aaggggttct gccgcgcatc gctatgcgcc 23040actggcaggg acacgttgcg atactggtgt ttagtgctcc acttaaactc aggcacaacc 23100atccgcggca gctcggtgaa gttttcactc cacaggctgc gcaccatcac caacgcgttt 23160agcaggtcgg gcgccgatat cttgaagtcg cagttggggc ctccgccctg cgcgcgcgag 23220ttgcgataca cagggttgca gcactggaac actatcagcg ccgggtggtg cacgctggcc 23280agcacgctct tgtcggagat cagatccgcg tccaggtcct ccgcgttgct cagggcgaac 23340ggagtcaact ttggtagctg ccttcccaaa aagggcgcgt gcccaggctt tgagttgcac 23400tcgcaccgta gtggcatcaa aaggtgaccg tgcccggtct gggcgttagg atacagcgcc 23460tgcataaaag ccttgatctg cttaaaagcc acctgagcct ttgcgccttc agagaagaac 23520atgccgcaag acttgccgga aaactgattg gccggacagg ccgcgtcgtg cacgcagcac 23580cttgcgtcgg tgttggagat ctgcaccaca tttcggcccc accggttctt cacgatcttg 23640gccttgctag actgctcctt cagcgcgcgc tgcccgtttt cgctcgtcac atccatttca 23700atcacgtgct ccttatttat cataatgctt ccgtgtagac acttaagctc gccttcgatc 23760tcagcgcagc ggtgcagcca caacgcgcag cccgtgggct cgtgatgctt gtaggtcacc 23820tctgcaaacg actgcaggta cgcctgcagg aatcgcccca tcatcgtcac aaaggtcttg 23880ttgctggtga aggtcagctg caacccgcgg tgctcctcgt tcagccaggt cttgcatacg 23940gccgccagag cttccacttg gtcaggcagt agtttgaagt tcgcctttag atcgttatcc 24000acgtggtact tgtccatcag cgcgcgcgca gcctccatgc ccttctccca cgcagacacg 24060atcggcacac tcagcgggtt catcaccgta atttcacttt ccgcttcgct gggctcttcc 24120tcttcctctt gcgtccgcat accacgcgcc actgggtcgt cttcattcag ccgccgcact 24180gtgcgcttac ctcctttgcc atgcttgatt agcaccggtg ggttgctgaa acccaccatt 24240tgtagcgcca catcttctct ttcttcctcg ctgtccacga ttacctctgg tgatggcggg 24300cgctcgggct tgggagaagg gcgcttcttt ttcttcttgg gcgcaatggc caaatccgcc 24360gccgaggtcg atggccgcgg gctgggtgtg cgcggcacca gcgcgtcttg tgatgagtct 24420tcctcgtcct cggactcgat acgccgcctc atccgctttt ttgggggcgc ccggggaggc 24480ggcggcgacg gggacgggga cgacacgtcc tccatggttg ggggacgtcg cgccgcaccg 24540cgtccgcgct cgggggtggt ttcgcgctgc tcctcttccc gactggccat ttccttctcc 24600tataggcaga aaaagatcat ggagtcagtc gagaagaagg acagcctaac cgccccctct 24660gagttcgcca ccaccgcctc caccgatgcc gccaacgcgc ctaccacctt ccccgtcgag 24720gcacccccgc ttgaggagga ggaagtgatt atcgagcagg acccaggttt tgtaagcgaa 24780gacgacgagg accgctcagt accaacagag gataaaaagc aagaccagga caacgcagag 24840gcaaacgagg aacaagtcgg gcggggggac gaaaggcatg gcgactacct agatgtggga 24900gacgacgtgc tgttgaagca tctgcagcgc cagtgcgcca ttatctgcga cgcgttgcaa 24960gagcgcagcg atgtgcccct cgccatagcg gatgtcagcc ttgcctacga acgccaccta 25020ttctcaccgc gcgtaccccc caaacgccaa gaaaacggca catgcgagcc caacccgcgc 25080ctcaacttct accccgtatt tgccgtgcca gaggtgcttg ccacctatca catctttttc 25140caaaactgca agatacccct atcctgccgt gccaaccgca gccgagcgga caagcagctg 25200gccttgcggc agggcgctgt catacctgat atcgcctcgc tcaacgaagt gccaaaaatc 25260tttgagggtc ttggacgcga cgagaagcgc gcggcaaacg ctctgcaaca ggaaaacagc 25320gaaaatgaaa gtcactctgg agtgttggtg gaactcgagg gtgacaacgc gcgcctagcc 25380gtactaaaac gcagcatcga ggtcacccac tttgcctacc cggcacttaa cctacccccc 25440aaggtcatga gcacagtcat gagtgagctg atcgtgcgcc gtgcgcagcc cctggagagg 25500gatgcaaatt tgcaagaaca aacagaggag ggcctacccg cagttggcga cgagcagcta 25560gcgcgctggc ttcaaacgcg cgagcctgcc gacttggagg agcgacgcaa actaatgatg 25620gccgcagtgc tcgttaccgt ggagcttgag tgcatgcagc ggttctttgc tgacccggag 25680atgcagcgca agctagagga aacattgcac tacacctttc gacagggcta cgtacgccag 25740gcctgcaaga tctccaacgt ggagctctgc aacctggtct cctaccttgg aattttgcac 25800gaaaaccgcc ttgggcaaaa cgtgcttcat tccacgctca agggcgaggc gcgccgcgac 25860tacgtccgcg actgcgttta cttatttcta tgctacacct ggcagacggc catgggcgtt 25920tggcagcagt gcttggagga gtgcaacctc aaggagctgc agaaactgct aaagcaaaac 25980ttgaaggacc tatggacggc cttcaacgag cgctccgtgg ccgcgcacct ggcggacatc 26040attttccccg aacgcctgct taaaaccctg caacagggtc tgccagactt caccagtcaa 26100agcatgttgc agaactttag gaactttatc ctagagcgct caggaatctt gcccgccacc 26160tgctgtgcac ttcctagcga ctttgtgccc attaagtacc gcgaatgccc tccgccgctt 26220tggggccact gctaccttct gcagctagcc aactaccttg cctaccactc tgacataatg 26280gaagacgtga gcggtgacgg tctactggag tgtcactgtc gctgcaacct atgcaccccg 26340caccgctccc tggtttgcaa ttcgcagctg cttaacgaaa gtcaaattat cggtaccttt 26400gagctgcagg gtccctcgcc tgacgaaaag tccgcggctc cggggttgaa actcactccg 26460gggctgtgga cgtcggctta ccttcgcaaa tttgtacctg aggactacca cgcccacgag 26520attaggttct acgaagacca atcccgcccg cctaatgcgg agcttaccgc ctgcgtcatt 26580acccagggcc acattcttgg ccaattgcaa gccatcaaca aagcccgcca agagtttctg 26640ctacgaaagg gacggggggt ttacttggac ccccagtccg gcgaggagct caacccaatc 26700cccccgccgc cgcagcccta tcagcagcag ccgcgggccc ttgcttccca ggatggcacc 26760caaaaagaag ctgcagctgc cgccgccacc cacggacgag gaggaatact gggacagtca 26820ggcagaggag gttttggacg aggaggagga ggacatgatg gaagactggg agagcctaga 26880cgaggaagct tccgaggtcg aagaggtgtc agacgaaaca ccgtcaccct cggtcgcatt 26940cccctcgccg gcgccccaga aatcggcaac cggttccagc atggctacaa cctccgctcc 27000tcaggcgccg ccggcactgc ccgttcgccg acccaaccgt agatgggaca ccactggaac 27060cagggccggt aagtccaagc agccgccgcc gttagcccaa gagcaacaac agcgccaagg 27120ctaccgctca tggcgcgggc acaagaacgc catagttgct tgcttgcaag actgtggggg 27180caacatctcc ttcgcccgcc gctttcttct ctaccatcac ggcgtggcct tcccccgtaa 27240catcctgcat tactaccgtc atctctacag cccatactgc accggcggca gcggcagcaa 27300cagcagcggc cacacagaag caaaggcgac cggatagcaa gactctgaca aagcccaaga 27360aatccacagc ggcggcagca gcaggaggag gagcgctgcg tctggcgccc aacgaacccg 27420tatcgacccg cgagcttaga aacaggattt ttcccactct gtatgctata tttcaacaga 27480gcaggggcca agaacaagag ctgaaaataa aaaacaggtc tctgcgatcc ctcacccgca 27540gctgcctgta tcacaaaagc gaagatcagc ttcggcgcac gctggaagac gcggaggctc 27600tcttcagtaa atactgcgcg ctgactctta aggactagtt tcgcgccctt tctcaaattt 27660aagcgcgaaa actacgtcat ctccagcggc cacacccggc gccagcacct gttgtcagcg 27720ccattatgag caaggaaatt cccacgccct acatgtggag ttaccagcca caaatgggac 27780ttgcggctgg agctgcccaa gactactcaa cccgaataaa ctacatgagc gcgggacccc 27840acatgatatc ccgggtcaac ggaatacgcg cccaccgaaa ccgaattctc ctggaacagg 27900cggctattac caccacacct cgtaataacc ttaatccccg tagttggccc gctgccctgg 27960tgtaccagga aagtcccgct cccaccactg tggtacttcc cagagacgcc caggccgaag 28020ttcagatgac taactcaggg gcgcagcttg cgggcggctt tcgtcacagg gtgcggtcgc 28080ccgggcaggg tataactcac ctgacaatca gagggcgagg tattcagctc aacgacgagt 28140cggtgagctc ctcgcttggt ctccgtccgg acgggacatt tcagatcggc ggcgccggcc 28200gctcttcatt cacgcctcgt caggcaatcc taactctgca gacctcgtcc tctgagccgc 28260gctctggagg cattggaact ctgcaattta ttgaggagtt tgtgccatcg gtctacttta 28320accccttctc gggacctccc ggccactatc cggatcaatt tattcctaac tttgacgcgg 28380taaaggactc ggcggacggc tacgactgaa tgttaagtgg agaggcagag caactgcgcc 28440tgaaacacct ggtccactgt cgccgccaca agtgctttgc ccgcgactcc ggtgagtttt 28500gctactttga attgcccgag gatcatatcg agggcccggc gcacggcgtc cggcttaccg 28560cccagggaga gcttgcccgt agcctgattc gggagtttac ccagcgcccc ctgctagttg 28620agcgggacag gggaccctgt gttctcactg tgatttgcaa ctgtcctaac cctggattac 28680atcaagatct ttgttgccat ctctgtgctg agtataataa atacagaaat taaaatatac 28740tggggctcct atcgccatcc tgtaaacgcc accgtcttca cccgcccaag caaaccaagg 28800cgaaccttac ctggtacttt taacatctct ccctctgtga tttacaacag tttcaaccca 28860gacggagtga gtctacgaga gaacctctcc gagctcagct actccatcag aaaaaacacc 28920accctcctta cctgccggga acgtacgagt gcgtcaccgg ccgctgcacc acacctaccg 28980cctgaccgta aaccagactt tttccggaca gacctcaata actctgttta ccagaacagg 29040aggtgagctt agaaaaccct tagggtatta ggccaaaggc gcagctactg tggggtttat 29100gaacaattca agcaactcta cgggctattc taattcaggt ttctctagaa tcggggttgg 29160ggttattctc tgtcttgtga ttctctttat tcttatacta acgcttctct gcctaaggct 29220cgccgcctgc tgtgtgcaca tttgcattta ttgtcagctt tttaaacgct ggggtcgcca 29280cccaagatga ttaggtacat aatcctaggt ttactcaccc ttgcgtcagc ccacggtacc 29340acccaaaagg tggattttaa ggagccagcc tgtaatgtta cattcgcagc tgaagctaat 29400gagtgcacca ctcttataaa atgcaccaca gaacatgaaa agctgcttat tcgccacaaa 29460aacaaaattg gcaagtatgc tgtttatgct atttggcagc caggtgacac tacagagtat 29520aatgttacag ttttccaggg taaaagtcat aaaactttta tgtatacttt tccattttat 29580gaaatgtgcg acattaccat gtacatgagc aaacagtata agttgtggcc cccacaaaat 29640tgtgtggaaa acactggcac tttctgctgc actgctatgc taattacagt gctcgctttg 29700gtctgtaccc tactctatat taaatacaaa agcagacgca gctttattga ggaaaagaaa 29760atgccttaat ttactaagtt acaaagctaa tgtcaccact aactgcttta ctcgctgctt 29820gcaaaacaaa ttcaaaaagt tagcattata attagaatag gatttaaacc ccccggtcat 29880ttcctgctca ataccattcc cctgaacaat tgactctatg tgggatatgc tccagcgcta 29940caaccttgaa gtcaggcttc ctggatgtca gcatctgact ttggccagca cctgtcccgc 30000ggatttgttc cagtccaact acagcgaccc accctaacag agatgaccaa cacaaccaac 30060gcggccgccg ctaccggact tacatctacc acaaatacac cccaagtttc tgcctttgtc 30120aataactggg ataacttggg catgtggtgg ttctccatag cgcttatgtt tgtatgcctt 30180attattatgt ggctcatctg ctgcctaaag cgcaaacgcg cccgaccacc catctatagt 30240cccatcattg tgctacaccc aaacaatgat ggaatccata gattggacgg actgaaacac 30300atgttctttt ctcttacagt atgattaaat gagacatgat tcctcgagtt tttatattac 30360tgacccttgt tgcgcttttt tgtgcgtgct ccacattggc tgcggtttct cacatcgaag 30420tagactgcat tccagccttc acagtctatt tgctttacgg atttgtcacc ctcacgctca 30480tctgcagcct catcactgtg gtcatcgcct ttatccagtg cattgactgg gtctgtgtgc 30540gctttgcata tctcagacac catccccagt acagggacag gactatagct gagcttctta 30600gaattcttta attatgaaat ttactgtgac ttttctgctg attatttgca ccctatctgc 30660gttttgttcc ccgacctcca agcctcaaag acatatatca tgcagattca ctcgtatatg 30720gaatattcca agttgctaca atgaaaaaag cgatctttcc gaagcctggt tatatgcaat 30780catctctgtt atggtgttct gcagtaccat cttagcccta gctatatatc cctaccttga 30840cattggctgg aacgcaatag atgccatgaa ccacccaact ttccccgcgc ccgctatgct 30900tccactgcaa caagttgttg ccggcggctt tgtcccagcc aatcagcctc gcccaccttc 30960tcccaccccc actgaaatca gctactttaa tctaacagga ggagatgact gacaccctag 31020atctagaaat ggacggaatt attacagagc agcgcctgct agaaagacgc agggcagcgg 31080ccgagcaaca gcgcatgaat caagagctcc aagacatggt taacttgcac cagtgcaaaa 31140ggggtatctt ttgtctcgta aagcaggcca aagtcaccta cgacagtaat accaccggac 31200accgccttag ctacaagttg ccaaccaagc gtcagaaatt ggtggtcatg gtgggagaaa 31260agcccattac cataactcag cactcggtag aaaccgaagg ctgcattcac tcaccttgtc 31320aaggacctga ggatctctgc acccttatta agaccctgtg cggtctcaaa gatcttattc 31380cctttaacta ataaaaaaaa ataataaagc atcacttact taaaatcagt tagcaaattt 31440ctgtccagtt tattcagcag cacctccttg ccctcctccc agctctggta ttgcagcttc 31500ctcctggctg caaactttct ccacaatcta aatggaatgt cagtttcctc ctgttcctgt 31560ccatccgcac ccactatctt catgttgttg cagatgaagc gcgcaagacc gtctgaagat 31620accttcaacc ccgtgtatcc atatgacacg gaaaccggtc ctccaactgt gccttttctt 31680actcctccct ttgtatcccc caatgggttt caagagagtc cccctggggt actctctttg 31740cgcctatccg aacctctagt tacctccaat ggcatgcttg cgctcaaaat gggcaacggc 31800ctctctctgg acgaggccgg caaccttacc tcccaaaatg taaccactgt gagcccacct 31860ctcaaaaaaa ccaagtcaaa cataaacctg gaaatatctg cacccctcac agttacctca 31920gaagccctaa ctgtggctgc cgccgcacct ctaatggtcg cgggcaacac actcaccatg 31980caatcacagg ccccgctaac cgtgcacgac tccaaactta gcattgccac ccaaggaccc 32040ctcacagtgt cagaaggaaa gctagccctg caaacatcag gccccctcac caccaccgat 32100agcagtaccc ttactatcac tgcctcaccc cctctaacta ctgccactgg tagcttgggc 32160attgacttga aagagcccat ttatacacaa aatggaaaac taggactaaa gtacggggct 32220cctttgcatg taacagacga cctaaacact ttgaccgtag caactggtcc aggtgtgact 32280attaataata cttccttgca aactaaagtt actggagcct tgggttttga ttcacaaggc 32340aatatgcaac ttaatgtagc aggaggacta aggattgatt ctcaaaacag acgccttata 32400cttgatgtta gttatccgtt tgatgctcaa aaccaactaa atctaagact aggacagggc 32460cctcttttta taaactcagc ccacaacttg gatattaact acaacaaagg cctttacttg 32520tttacagctt caaacaattc caaaaagctt gaggttaacc taagcactgc caaggggttg 32580atgtttgacg ctacagccat agccattaat gcaggagatg ggcttgaatt tggttcacct 32640aatgcaccaa acacaaatcc cctcaaaaca aaaattggcc atggcctaga atttgattca 32700aacaaggcta tggttcctaa actaggaact ggccttagtt ttgacagcac aggtgccatt 32760acagtaggaa acaaaaataa tgataagcta actttgtgga ccacaccagc tccatctcct 32820aactgtagac taaatgcaga gaaagatgct aaactcactt tggtcttaac aaaatgtggc 32880agtcaaatac ttgctacagt ttcagttttg gctgttaaag gcagtttggc tccaatatct 32940ggaacagttc aaagtgctca tcttattata agatttgacg aaaatggagt gctactaaac 33000aattccttcc tggacccaga atattggaac tttagaaatg gagatcttac tgaaggcaca 33060gcctatacaa acgctgttgg atttatgcct aacctatcag cttatccaaa atctcacggt 33120aaaactgcca aaagtaacat tgtcagtcaa gtttacttaa acggagacaa aactaaacct 33180gtaacactaa ccattacact aaacggtaca caggaaacag gagacacaac tccaagtgca 33240tactctatgt cattttcatg ggactggtct ggccacaact acattaatga aatatttgcc 33300acatcctctt acactttttc atacattgcc caagaataaa gaatcgtttg tgttatgttt 33360caacgtgttt atttttcaat tgcagaaaat ttcaagtcat ttttcattca gtagtatagc 33420cccaccacca catagcttat acagatcacc gtaccttaat caaactcaca gaaccctagt 33480attcaacctg ccacctccct cccaacacac agagtacaca gtcctttctc cccggctggc 33540cttaaaaagc atcatatcat gggtaacaga catattctta ggtgttatat tccacacggt 33600ttcctgtcga gccaaacgct catcagtgat attaataaac tccccgggca gctcacttaa 33660gttcatgtcg ctgtccagct gctgagccac aggctgctgt ccaacttgcg gttgcttaac 33720gggcggcgaa ggagaagtcc acgcctacat gggggtagag tcataatcgt gcatcaggat 33780agggcggtgg tgctgcagca gcgcgcgaat aaactgctgc cgccgccgct ccgtcctgca 33840ggaatacaac atggcagtgg tctcctcagc gatgattcgc accgcccgca gcataaggcg 33900ccttgtcctc cgggcacagc agcgcaccct gatctcactt aaatcagcac agtaactgca 33960gcacagcacc acaatattgt tcaaaatccc acagtgcaag gcgctgtatc caaagctcat 34020ggcggggacc acagaaccca cgtggccatc ataccacaag cgcaggtaga ttaagtggcg 34080acccctcata aacacgctgg acataaacat tacctctttt ggcatgttgt aattcaccac 34140ctcccggtac catataaacc tctgattaaa catggcgcca tccaccacca tcctaaacca 34200gctggccaaa acctgcccgc cggctataca ctgcagggaa ccgggactgg aacaatgaca 34260gtggagagcc caggactcgt aaccatggat catcatgctc gtcatgatat caatgttggc 34320acaacacagg cacacgtgca tacacttcct caggattaca agctcctccc gcgttagaac 34380catatcccag ggaacaaccc attcctgaat cagcgtaaat cccacactgc agggaagacc 34440tcgcacgtaa ctcacgttgt gcattgtcaa agtgttacat tcgggcagca gcggatgatc 34500ctccagtatg gtagcgcggg tttctgtctc aaaaggaggt agacgatccc tactgtacgg 34560agtgcgccga gacaaccgag atcgtgttgg tcgtagtgtc atgccaaatg gaacgccgga 34620cgtagtcata tttcctgaag caaaaccagg tgcgggcgtg acaaacagat ctgcgtctcc 34680ggtctcgccg cttagatcgc tctgtgtagt agttgtagta tatccactct ctcaaagcat 34740ccaggcgccc cctggcttcg ggttctatgt aaactccttc atgcgccgct gccctgataa 34800catccaccac cgcagaataa gccacaccca gccaacctac acattcgttc tgcgagtcac 34860acacgggagg agcgggaaga gctggaagaa ccatgttttt ttttttattc caaaagatta 34920tccaaaacct caaaatgaag atctattaag tgaacgcgct cccctccggt ggcgtggtca 34980aactctacag ccaaagaaca gataatggca tttgtaagat gttgcacaat ggcttccaaa 35040aggcaaacgg ccctcacgtc caagtggacg taaaggctaa acccttcagg gtgaatctcc 35100tctataaaca ttccagcacc ttcaaccatg cccaaataat tctcatctcg ccaccttctc 35160aatatatctc taagcaaatc ccgaatatta agtccggcca ttgtaaaaat ctgctccaga 35220gcgccctcca ccttcagcct caagcagcga atcatgattg caaaaattca ggttcctcac 35280agacctgtat aagattcaaa agcggaacat taacaaaaat accgcgatcc cgtaggtccc 35340ttcgcagggc cagctgaaca taatcgtgca ggtctgcacg gaccagcgcg gccacttccc 35400cgccaggaac catgacaaaa gaacccacac tgattatgac acgcatactc ggagctatgc 35460taaccagcgt agccccgatg taagcttgtt gcatgggcgg cgatataaaa tgcaaggtgc 35520tgctcaaaaa atcaggcaaa gcctcgcgca aaaaagaaag cacatcgtag tcatgctcat 35580gcagataaag gcaggtaagc tccggaacca ccacagaaaa agacaccatt tttctctcaa 35640acatgtctgc gggtttctgc ataaacacaa aataaaataa caaaaaaaca tttaaacatt 35700agaagcctgt cttacaacag gaaaaacaac ccttataagc ataagacgga ctacggccat 35760gccggcgtga ccgtaaaaaa actggtcacc gtgattaaaa agcaccaccg acagctcctc 35820ggtcatgtcc ggagtcataa tgtaagactc ggtaaacaca tcaggttgat tcacatcggt 35880cagtgctaaa aagcgaccga aatagcccgg gggaatacat acccgcaggc gtagagacaa 35940cattacagcc cccataggag gtataacaaa attaatagga gagaaaaaca cataaacacc 36000tgaaaaaccc tcctgcctag gcaaaatagc accctcccgc tccagaacaa catacagcgc 36060ttccacagcg gcagccataa cagtcagcct taccagtaaa aaagaaaacc tattaaaaaa 36120acaccactcg acacggcacc agctcaatca gtcacagtgt aaaaaagggc caagtgcaga 36180gcgagtatat ataggactaa aaaatgacgt aacggttaaa gtccacaaaa aacacccaga 36240aaaccgcacg cgaacctacg cccagaaacg aaagccaaaa aacccacaac ttcctcaaat 36300cgtcacttcc gttttcccac gttacgtcac ttcccatttt aagaaaacta caattcccaa 36360cacatacaag ttactccgcc ctaaaaccta cgtcacccgc cccgttccca cgccccgcgc 36420cacgtcacaa actccacccc ctcattatca tattggcttc aatccaaaat aaggtatatt 36480attgatgatg ttaattaaga attcggatct gcgacgcgag gctggatggc cttccccatt 36540atgattcttc tcgcttccgg cggcatcggg atgcccgcgt tgcaggccat gctgtccagg 36600caggtagatg acgaccatca gggacagctt caaggccagc aaaaggccag gaaccgtaaa 36660aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 36720cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 36780cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 36840gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 36900tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 36960cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 37020ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 37080gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc 37140gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 37200accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 37260ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 37320tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 37380aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 37440aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg 37500tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 37560gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 37620agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 37680aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 37740gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 37800caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc 37860cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 37920ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 37980ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac 38040gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 38100cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 38160gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 38220caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 38280tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 38340acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 38400aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc 38460gtatcacgag gccctttcgt cttcaagaat tggatccgaa ttcttaattt cttaattaa 38519 29 38519 DNA Artificial Sequence Codon optimized DNA encoding pMRKAd5HIV-1 pol, noncoding 29gtagtagtta ttatatggaa taaaacctaa cttcggttat actattactc ccccacctca 60aacactgcac cgcgccccgc acccttgccc cgcccactgc atcatcacac cgccttcaca 120ctacaacgtt cacaccgcct tgtgtacatt cgctgcctac accgttttca ctgcaaaaac 180cacacgcggc cacatgtgtc cttcactgtt aaaagcgcgc caaaatccgc ctacaacatc 240atttaaaccc gcattggctc attctaaacc ggtaaaagcg cccttttgac ttattctcct 300tcactttaga cttattaaaa cacaatgagt atcgcgcatt ataaacagat cccggcgccc 360ctgaaactgg caaatgcacc tctgagcggg tccacaaaaa gagtccacaa aaggcgcaag 420gcccagtttc aaccgcaaaa taataatatc cgccggcgct aggtaacgta tgcaacatag 480gtatagtatt atacatgtaa atataaccga gtacaggttg taatggcggt acaactgtaa 540ctaataactg atcaataatt atcattagtt aatgccccag taatcaagta tcgggtatat 600acctcaaggc gcaatgtatt gaatgccatt taccgggcgg accgactggc gggttgctgg 660gggcgggtaa ctgcagttat tactgcatac aagggtatca ttgcggttat ccctgaaagg 720taactgcagt tacccacctc ataaatgcca tttgacgggt gaaccgtcat gtagttcaca 780tagtatacgg ttcatgcggg ggataactgc agttactgcc atttaccggg cggaccgtaa 840tacgggtcat gtactggaat accctgaaag gatgaaccgt catgtagatg cataatcagt 900agcgataatg gtaccactac gccaaaaccg tcatgtagtt acccgcacct atcgccaaac 960tgagtgcccc taaaggttca gaggtggggt aactgcagtt accctcaaac aaaaccgtgg 1020ttttagttgc cctgaaaggt tttacagcat tgttgaggcg gggtaactgc gtttacccgc 1080catccgcaca tgccaccctc cagatatatt cgtctcgagc aaatcacttg gcagtctagc 1140ggacctctgc ggtaggtgcg acaaaactgg aggtatcttc tgtggccctg gctaggtcgg 1200aggcgccggc ccttgccacg taaccttgcg cctaaggggc acggttctca ctctagatgg 1260taccgggggt agagggggta actctgacac ggacacttcg acttcggacc gtacctaccg 1320gggttccact tcgtcaccgg ggactgactc ctcttctagt tccgggacca cctttagacg 1380tgactctacc tcttcctccc gttttagagg ttctaaccgg ggctcttggg gatgttgtgg 1440ggacacaaac ggtagttctt cttcctgagg tggttcacct ccttcgacca cctgaagtcc 1500ctcgacttgt tctcctgggt cctgaagacc ctccacgtcg acccgtaggg ggtggggcga 1560ccggacttct tcttcttcag acactgacac gaccgacacc ccctacggat gaagagacac 1620ggggacctac tcctgaagtc cttcatgtga cggaagtggt aggggaggta gttgttactc 1680tggggaccgt agtccatggt catgttacac gacggggtcc cgaccttccc gaggggacgg 1740tagaaggtca ggaggtactg gttctaggac ctcgggaagt ccttcgtctt gggactgtaa 1800cactagatgg tcatgtaccg acgggacata cacccgagac tggacctcta acccgtcgtg 1860tcctggttct aactcctcga ctccgtcgtg gacgactcca ccccggactg gtggggactg 1920ttcttcgtgg tcttcctcgg ggggaaggac acctacccga tactcgacgt ggggctgttc 1980acctgacacg tcgggtaaca cgacggactc ttcctgagga cctgacactt actgtaggtc 2040ttcgaccacc cgttcgactt gacccggagg gtttagatgg gaccgtagtt ccactccgtc 2100gacacgttcg acgactcccc gtggttccgg gactgactcc actaggggga ctgactcctc 2160cgactcgacc tcgaccgact cttgtccctc taggacttcc tcggacacgt accccacatg 2220atactgggga ggttcctgga ctaacgactc taggtcttcg tcccggtccc ggtcacctgg 2280atggtttaga tggtcctcgg gaagttcttg gacttctgac cgttcatacg gtcctactcc 2340ccccgggtgt ggttactaca cttcgtcgac tgactccgac acgtcttcta gtggtgactc 2400aggtaacact agaccccgtt ctgggggttc aagttcgacg ggtaggtctt cctctggacc 2460ctctggacca cctgactcat gaccgtccgg tggacctagg gactcaccct caaacacttg 2520tggggggggg accacttcga caccatggtc gacctcttcc tcgggtaaca cccccgactc 2580tggaagatac accgaccccg acggttgtcc ctctggttcg acccgttccg accgatacac 2640tggttgtccc cgtccgtctt ccaccactgg gactgactgt ggtggttggt cttctgacgg 2700gaggtccggt agatggaccg ggaggtcctg agaccggacc tccacttgta acactgacgg 2760agggtcatac gggacccgta gtaggtccgg gtcggactag tcagactcag actcgaccac 2820ttggtctagt aactcgtcga ctagttcttc ctcttccaca tggaccggac ccacggacgg 2880gtgttcccgt aacccccgtt actcgtccac ctgttcgacc acagacgacc gtagtccttc 2940cacgacaagg acctaccgta actgttccgg gtcctactcg tactcttcat ggtgaggttg 3000acctcccgat accggagact gaagttggac gggggacacc accgattcct ctaacaccgg 3060aggacactgt tcacggtcga cttccccctc cggtacgtac ccgtccacct gacgagggga 3120ccgtagaccg tcgaccggac gtgggtggac ctcccgttcc actaggacca ccgacacgta 3180caccggaggc cgatgtaact ccgactccac tagggacgac tctgtccggt cctctgacgg 3240atgaaggacg acttcgaccg accgtccacc ggacacttct ggtaggtgtg acggttaccg 3300aggttgaagt gaccccggtg tcactcccga cggacgacca cccgaccgta gttcgtcctc 3360aaaccgtagg ggatgttggg ggtcagggtc ccccaccacc ggaggtactt gttcctcgac 3420ttcttctagt aacccgtcca ctccctggtc cgactcgtgg acttctgtcg acacgtctac 3480cgacacaagt aggtgttgaa gttctccttc cccccgtagc ccccgatgag gcgacccctc 3540tcctaacacc tgtagtaacg gtgtctgtag gtctggttcc tcgaggtctt cgtctagtgg 3600ttctaggtct tgaagtccca catgatgtcc ctgaggtcct tgggggacac cttcccggga 3660cggttcgacg acaccttccc cctcccccga caccactagg tcctgttgag actgtagttc 3720caccacgggt cctccttccg gttctagtag tccctgatac cgttcgtcta ccgaccccta 3780ctgacacacc ggaggtccgt cctactcctg atttcgggcc cgtctagacg acacggaaga 3840tcaacggtcg gtagacaaca aacggggagg gggcacggaa ggaactggga ccttccacgg 3900tgagggtgac aggaaaggat tattttactc ctttaacgta gcgtaacaga ctcatccaca 3960gtaagataag accccccacc ccaccccgtc ctgtcgttcc ccctcctaac ccttctgtta 4020tcgtccgtac gacccctacg ccacccgaga taccggctag ccgcgcggca tgactttaca 4080cacccgcacc gaattcccac cctttcttat atattccacc cccagaatac atcaaaacat 4140agacaaaacg tcgtcggcgg cggcggtact cgtggttgag caaactacct tcgtaacact 4200cgagtataaa ctgttgcgcg tacgggggta cccggcccca cgcagtctta cactacccga 4260ggtcgtaact accagcgggg caggacgggc gtttgagatg atggaactgg atgctctggc 4320acagaccttg cggcaacctc tgacgtcgga ggcggcggcg aagtcggcga cgtcggtggc 4380gggcgcccta acactgactg aaacgaaagg actcgggcga acgtttgtca cgtcgaaggg 4440caagtaggcg ggcgctactg ttcaactgcc gagaaaaccg tgttaaccta agaaactggg 4500cccttgaatt acagcaaaga gtcgtcgaca acctagacgc ggtcgtccaa agacgggact 4560tccgaaggag gggagggtta cgccaaattt tgtatttatt ttttggtctg agacaaacct 4620aaacctagtt cgttcacaga acgacagaaa taaatcccca aaacgcgcgc gccatccggg 4680ccctggtcgc cagagccagc aactcccagg acacataaaa aaggtcctgc accatttcca 4740ctgagaccta caagtctatg tacccgtatt cgggcagaga ccccacctcc atcgtggtga 4800cgtctcgaag tacgacgccc caccacaaca tctactaggt cagcatcgtc ctcgcgaccc 4860gcaccacgga tttttacaga aagtcatcgt tcgactaacg gtccccgtcc gggaaccaca 4920ttcacaaatg tttcgccaat tcgaccctac ccacgtatgc acccctatac tctacgtaga 4980acctgacata aaaatccaac cgatacaagg gtcggtatag ggaggcccct aagtacaaca 5040cgtcttggtg gtcgtgtcac ataggccacg tgaacccttt aaacagtaca tcgaatcttc 5100ctttacgcac cttcttgaac ctctgcggga acactggagg ttctaaaagg tacgtaagca 5160ggtattacta ccgttacccg ggtgcccgcc gccggacccg cttctataaa gaccctagtg 5220attgcagtat caacacaagg tcctactcta gcagtatccg gtaaaaatgt ttcgcgcccg 5280cctcccacgg tctgacgcca tattaccaag gtaggccggg tccccgcatc aatgggagtg 5340tctaaacgta aagggtgcga aactcaagtc taccccccta gtacagatgg acgccccgct 5400acttcttttg ccaaaggccc catcccctct agtcgaccct tctttcgtcc aaggactcgt 5460cgacgctgaa tggcgtcggc cacccgggca tttagtgtgg ataatggccg acgttgacca 5520tcaattctct cgacgtcgac ggcagtaggg actcgtcccc ccggtgaagc aattcgtaca 5580gggactgagc gtacaaaagg gactggttta ggcggtcttc cgcgagcggc gggtcgctat 5640cgtcaagaac gttccttcgt ttcaaaaagt tgccaaactc tggcaggcgg catccgtacg 5700aaaactcgca aactggttcg tcaaggtccg ccagggtgtc gagccagtgg acgagatgcc 5760gtagagctag gtcgtataga ggagcaaagc gcccaacccc gccgaaagcg acatgccgtc 5820atcagccacg agcaggtctg cccggtccca gtacagaaag gtgcccgcgt cccaggagca 5880gtcgcatcag acccagtgcc acttccccac gcgaggcccg acgcgcgacc ggtcccacgc 5940gaactccgac caggacgacc acgacttcgc gacggccaga agcgggacgc gcagccggtc 6000catcgtaaac tggtaccaca gtatcaggtc ggggaggcgc cgcaccggga accgcgcgtc 6060gaacgggaac ctcctccgcg gcgtgctccc cgtcacgtct gaaaactccc gcatctcgaa 6120cccgcgctct ttatggctaa ggcccctcat ccgtaggcgc ggcgtccggg gcgtctgcca 6180gagcgtaagg tgctcggtcc actcgagacc ggcaagcccc agtttttggt ccaaaggggg 6240tacgaaaaac tacgcaaaga atggagacca aaggtactcg gccacaggtg cgagccactg 6300cttttccgac aggcacaggg gcatatgtct gaactctccg gacaggagct cgccacaagg 6360cgccaggagg agcatatctt tgagcctggt gagactctgt ttccgagcgc aggtccggtc 6420gtgcttcctc cgattcaccc tccccatcgc cagcaacagg tgatccccca ggtgagcgag 6480gtcccacact tctgtgtaca gcgggagaag ccgtagttcc ttccactaac caaacatcca 6540catccggtgc actggcccac aaggacttcc ccccgatatt ttcccccacc cccgcgcaag 6600caggagtgag agaaggcgta gcgacagacg ctcccggtcg acaaccccac tcatgaggga 6660gacttttcgc ccgtactgaa gacgcgattc taacagtcaa aggtttttgc tcctcctaaa 6720ctataagtgg accgggcgcc actacggaaa ctcccaccgg cgtaggtaga ccagtctttt 6780ctgttagaaa aacaacagtt cgaaccaccg tttgctgggc atctcccgca acctgtcgtt 6840gaaccgctac ctcgcgtccc aaaccaaaaa cagcgctagc cgcgcgagga accggcgcta 6900caaatcgacg tgcataagcg cgcgttgcgt ggcggtaagc cctttctgcc accacgcgag 6960cagcccgtgg tccacgtgcg cggttggcgc caacacgtcc cactgttcca gttgcgacca 7020ccgatggaga ggcgcatccg cgagcaacca ggtcgtctcc gccggcggga acgcgctcgt 7080cttaccgcca tcccccagat cgacgcagag caggcccccc agacgcaggt gccatttctg 7140gggcccgtcg tccgcgcgca gcttcatcag atagaacgta ggaacgttca gatcgcggac 7200gacggtacgc gcccgccgtt cgcgcgcgag catacccaac tcaccccctg gggtaccgta 7260ccccacccac tcgcgcctcc gcatgtacgg cgtttacagc atttgcatct ccccgagaga 7320ctcataaggt tctatacatc ccatcgtaga aggtggcgcc tacgaccgcg cgtgcattag 7380catatcaagc acgctccctc gctcctccag ccctggctcc aacgatgccc gcccgacgag 7440acgagccttc tgatagacgg acttctaccg tacactcaac ctactatacc aacctgcgac 7500cttctgcaac ttcgaccgca gacactctgg atggcgcagt gcgtgcttcc tccgcatcct 7560cagcgcgtcg aacaactggt cgagccgcca ctggacgtgc agatcccgcg tcatcaggtc 7620ccaaaggaac tactacagta tgaataggac agggaaaaaa aaggtgtcga gcgccaactc 7680ctgtttgaga agcgccagaa aggtcatgag aacctagcct ttgggcagcc ggaggcttgc 7740cattctcgga tcgtacatct tgaccaactg ccggaccatc cgcgtcgtag ggaaaagatg 7800cccatcgcgc atacggacgc gccggaaggc ctcgctccac acccactcgc gtttccacag 7860ggactggtac tgaaactcca tgaccataaa cttcagtcac agcagcgtag gcgggacgag 7920ggtctcgttt ttcaggcacg cgaaaaacct tgcgcctaaa ccgtcccgct tccactgtag 7980caacttctca tagaaagggc gcgctccgta tttcaacgca cactacgcct tcccagggcc 8040gtggagcctt gccaacaatt aatggacccg ccgctcgtgc tagagcagtt tcggcaacta 8100caacaccggg tgttacattt caaggttctt cgcgccctac gggaactacc ttccgttaaa 8160aaattcaagg agcatccact cgagaagtcc cctcgactcg ggcacgagac tttcccgggt 8220cagacgttct actcccaacc ttcgctgctt actcgaggtg tccagtgccc ggtaatcgta 8280aacgtccacc agcgctttcc aggatttgac cgctggatac cggtaaaaaa gaccccacta 8340cgtcatcttc cattcgccca gaacaagggt cgccagggta ggttccaagc gccgatccag 8400agcgcgccgt cagtgatctc cgagtagagg cggcttgaag tactggtcgt acttcccgtg 8460ctcgacgaag ggtttccggg ggtaggttca tatccagaga tgtagcatcc actgtttctc 8520tgcgagccac gctcctacgc tcggctagcc cttcttgacc tagagggcgg tggttaacct 8580cctcaccgat aactacacca ctttcatctt cagggacgct gcccggcttg tgagcacgac 8640cgaaaacatt tttgcacgcg tcatgaccgt cgccacgtgc ccgacatgta ggacgtgctc 8700caactggact gctggcgcgt gttccttcgt ctcaccctta aactcgggga gcggaccgcc 8760caaaccgacc accagaagat gaagccgacg aacaggaact ggcagaccga cgagctcccc 8820tcaatgccac ctagcctggt ggtgcggcgc gctcgggttt caggtctaca ggcgcgcgcc 8880gccagcctcg aactactgtt gtagcgcgtc taccctcgac aggtaccaga cctcgagggc 8940gccgcagtcc agtccgccct cgaggacgtc caaatggagc gtatctgccc agtcccgcgc 9000ccgatctagg tccactatgg attaaaggtc cccgaccaac caccgccgca gctaccgaac 9060gttctccggc gtaggggcgc cgcgctgatg ccatggcgcg ccgcccgcca cccggcgccc 9120ccacaggaac ctactacgta gattttcgcc actgcgcccg ctcgggggcc tccatccccc 9180ccgaggcctg ggcggccctc tcccccgtcc ccgtgcagcc gcggcgcgcg cccgtcctcg 9240accacgacgc gcgcatccaa cgaccgcttg cgctgctgcg ccgccaacta gaggacttag 9300accgcggaga cgcacttctg ctgcccgggc cactcgaact tggactttct ctcaagctgt 9360cttagttaaa gccacagcaa ctgccgccgg accgcgtttt agaggacgtg cagaggactc 9420aacagaacta tccgctagag ccggtacttg acgagctaga gaaggaggac ctctagaggc 9480gcaggccgag cgaggtgcca ccgccgctcc agcaaccttt acgcccggta ctcgacgctc 9540ttccgcaact ccggagggag caaggtctgc gccgacatct ggtgcggggg aagccgtagc 9600gcccgcgcgt actggtggac gcgctctaac tcgaggtgca cggcccgctt ctgccgcatc 9660aaagcgtccg cgactttctc catcaactcc caccaccgcc acacaagacg gtgcttcttc 9720atgtattggg tcgcagcgtt gcacctaagc aactataggg ggttccggag ttccgcgagg 9780taccggagca tcttcaggtg ccgcttcaac tttttgaccc tcaacgcgcg gctgtgccaa 9840ttgaggagga ggtcttctgc ctactcgagc cgctgtcaca gcgcgtggag cgcgagtttc 9900cgatgtcccc ggagaagaag aagaagttag aggagaaggt attcccggag gggaagaaga 9960agaagaccgc cgccaccccc tcccccctgt gccgccgctg ctgccgcgtg gccctccgcc 10020agctgtttcg cgagctagta gaggggcgcc gctgccgcgt accagagcca ctgccgcgcc 10080ggcaagagcg cccccgcgtc aaccttctgc ggcgggcagt acagggccaa tacccaaccg 10140ccccccgacg gtacgccgtc cctatgccgc gattgctacg tagagttgtt aacaacacat 10200ccatgaggcg gcggctccct ggactcgctc aggcgtagct ggcctagcct tttggagagc 10260tctttccgca gattggtcag tgtcagcgtt ccatccgact cgtggcaccg cccgccgtcg 10320cccgccgcca gccccaacaa agaccgcctc cacgacgact actacattaa tttcatccgc 10380cagaactctg ccgcctacca gctgtcttcg tggtacagga acccaggccg gacgacttac 10440gcgtccgcca gccggtacgg ggtccgaagc aaaactgtag ccgcgtccag aaacatcatc 10500agaacgtact cggaaagatg gccgtgaaga agaagaggaa ggagaacagg acgtagagaa 10560cgtagatagc gacgccgccg ccgcctcaaa ccggcatcca ccgcgggaga aggagggtac 10620gcacactggg gcttcgggga gtagccgact tcgtcccgat ccagccgctg ttgcgcgagc 10680cgattatacc ggacgacgtg gacgcactcc catctgacct tcagtaggta caggtgtttc 10740gccaccatac gcgggcacaa ctaccacatt cacgtcaacc ggtattgcct ggtcaattgc 10800cagaccactg ggccgacgct ctcgagccac atggactctg cgctcattcg ggagctcagt 10860ttatgcatca gcaacgttca ggcgtggtcc atgaccatag ggtggttttt cacgccgccg 10920ccgaccgcca tctccccggt cgcatcccac cggccccgag gcccccgctc tagaaggttg 10980tattccgcta ctataggcat ctacatggac ctgtaggtcc actacggccg ccgccaccac 11040ctccgcgcgc ctttcagcgc ctgcgccaag gtctacaacg cgtcgccgtt tttcacgagg 11100taccagccct gcgagaccgg ccagtccgcg cgcgttagca actgcgagat ctggcacgtt 11160ttcctctcgg acattcgccc gtgagaaggc accagaccac ctatttaagc gttcccatag 11220taccgcctgc tggccccaag ctcggggcat aggccggcag gcggcactag gtacgccaat 11280ggcgggcgca cagcttgggt ccacacgctg cagtctgttg ccccctcacg aggaaaaccg 11340aaggaaggtc cgcgccgccg acgacgcgat cgaaaaaacc ggtgaccggc gcgcgtcgca 11400ttcgccaatc cgacctttcg ctttcgtaat tcaccgagcg agggacatcg gcctcccaat 11460aaaaggttcc caactcagcg ccctgggggc caagctcaga gcctggccgg cctgacgccg 11520cttgccccca aacggagggg cagtacgttc tggggcgaac gtttaaggag gcctttgtcc 11580ctgctcgggg aaaaaacgaa aagggtctac gtaggccacg acgccgtcta cgcgggggga 11640ggagtcgtcg ccgttctcgt tctcgtcgcc gtctgtacgt cccgtgggag gggaggagga 11700tggcgcagtc ctccccgctg taggcgccaa ctgcgccgtc gtctaccact aatgcttggg 11760ggcgccgcgg cccgggccgt gatggacctg aacctcctcc cgctcccgga ccgcgccgat 11820cctcgcggga gaggactcgc cgtgggttcc cacgtcgact tcgcactatg cgcactccgc 11880atgcacggcg ccgtcttgga caaagcgctg gcgctccctc tcctcgggct cctctacgcc 11940ctagctttca aggtgcgtcc cgcgctcgac gccgtaccgg acttagcgct cgccaacgac 12000gcgctcctcc tgaaactcgg gctgcgcgct tggccctaat cagggcgcgc gcgtgtgcac 12060cgccggcggc tggaccattg gcgtatgctc gtctgccact tggtcctcta attgaaagtt 12120ttttcgaaat tgttggtgca cgcatgcgaa caccgcgcgc tcctccaccg atatcctgac 12180tacgtagaca ccctgaaaca ttcgcgcgac ctcgttttgg gtttatcgtt cggcgagtac 12240cgcgtcgaca aggaatatca cgtcgtgtcg tccctgttgc tccgtaagtc cctacgcgac 12300gatttgtatc atctcgggct cccggcgacc gacgagctaa actatttgta ggacgtctcg 12360tatcaccacg tcctcgcgtc gaactcggac cgactgttcc accggcggta gttgataagg 12420tacgaatcgg acccgttcaa aatgcgggcg ttctatatgg tatggggaat gcaagggtat 12480ctgttcctcc atttctagct ccccaagatg tacgcgtacc gcgacttcca cgaatggaac 12540tcgctgctgg acccgcaaat agcgttgctc gcgtaggtgt tccggcactc gcactcggcc 12600gccgcgctcg agtcgctggc gctcgactac gtgtcggacg tttcccggga ccgaccgtgc 12660ccgtcgccgc tatctctccg gctcaggatg aaactgcgcc cgcgactgga cgcgacccgg 12720ggttcggctg cgcgggacct ccgtcgaccc cggcctggac ccgaccgcca ccgtgggcgc 12780gcgcgaccgt tgcagccgcc gcacctcctt atactgctcc tgctactcat gctcggtctc 12840ctgccgctca tgattcgcca ctacaaagac tagtctacta cgttctgcgt tgcctgggcc 12900gccacgcccg ccgcgacgtc tcggtcggca ggccggaatt gaggtgcctg ctgaccgcgg 12960tccagtacct ggcgtagtac agcgactgac gcgcgttagg actgcgcaag gccgtcgtcg 13020gcgtccggtt ggccgagagg cgttaagacc ttcgccacca gggccgcgcg cgtttggggt 13080gcgtgctctt ccacgaccgc tagcatttgc gcgaccggct tttgtcccgg taggccgggc 13140tgctccggcc ggaccagatg ctgcgcgacg aagtcgcgca ccgagcaatg ttgtcgccgt 13200tgcacgtctg gttggacctg gccgaccacc ccctacacgc gctccggcac cgcgtcgcac 13260tcgcgcgcgt cgtcgtcccg ttggacccga ggtaccaacg tgatttgcgg aaggactcat 13320gtgtcgggcg gttgcacggc gcccctgtcc tcctgatgtg gttgaaacac tcgcgtgacg 13380ccgattacca ctgactctgt ggcgtttcac tccacatggt cagacccggt ctgataaaaa 13440aggtctggtc atctgttccg gacgtctggc atttggactc ggtccgaaag tttttgaacg 13500tccccgacac cccccacgcc cgagggtgtc cgctggcgcg ctggcacaga tcgaacgact 13560gcgggttgag cgcggacaac gacgacgatt atcgcgggaa gtgcctgtca ccgtcgcaca 13620gggccctgtg tatggatcca gtgaacgact gtgacatggc gctccggtat ccagtccgcg 13680tacacctgct cgtatgaaag gtcctctaat gttcacagtc ggcgcgcgac cccgtcctcc 13740tgtgcccgtc ggacctccgt tgggatttga tggacgactg gttggccgcc gtcttctagg 13800ggagcaacgt gtcaaatttg tcgctcctcc tcgcgtaaaa cgcgatgcac gtcgtctcgc 13860actcggaatt ggactacgcg ctgccccatt gcgggtcgca ccgcgacctg tactggcgcg 13920cgttgtacct tggcccgtac atacggagtt tggccggcaa atagttggcg gattacctga 13980tgaacgtagc gcgccggcgg cacttggggc tcataaagtg gttacggtag aacttgggcg 14040tgaccgatgg cgggggacca aagatgtggc cccctaagct ccacgggctc ccattgctac 14100ctaaggagac cctgctgtat ctgctgtcgc acaaaagggg cgttggcgtc tgggacgatc 14160tcaacgttgt cgcgctcgtc cgtctccgcc gcgacgcttt cctttcgaag gcgtccggtt 14220cgtcgaacag gctagatccg cgacgccggg gcgccagtct acgatcatcg ggtaaaggtt 14280cgaactatcc cagagaatgg tcgtgagcgt ggtgggcggg cgcggacgac ccgctcctcc 14340tcatggattt gttgagcgac gacgtcggcg tcgcgctttt tttggacgga ggccgtaaag 14400ggttgttgcc ctatctctcg gatcacctgt tctactcatc taccttctgc atgcgcgtcc 14460tcgtgtccct gcacggtccg ggcgcgggcg ggtgggcagc agtttccgtg ctggcagtcg 14520ccccagacca caccctcctg ctactgagcc gtctgctgtc gtcgcaggac ctaaaccctc 14580cctcaccgtt gggcaaacgc gtggaagcgg ggtccgaccc ctcttacaaa attttttttt 14640ttttcgtact acgttttatt ttttgagtgg ttccggtacc gtggctcgca accaaaagaa 14700cataagggga atcatacgcc gcgcgccgct acatactcct tccaggagga gggaggatgc 14760tctcacacca ctcgcgccgc ggtcaccgcc gccgcgaccc aagagggaag ctacgagggg 14820acctgggcgg caaacacgga ggcgccatgg acgccggatg gcccccctct ttgtcgtagg 14880caatgagact caaccgtggg gataagctgt ggtgggcaca catggaccac ctgttgttca 14940gttgcctaca ccgtagggac ttgatggtct tgctggtgtc gttgaaagac tggtgccagt 15000aagttttgtt actgatgtcg ggccccctcc gttcgtgtgt ctggtagtta gaactgctgg 15060ccagcgtgac cccgccgctg gacttttggt aggacgtatg gttgtacggt ttacacttgc 15120tcaagtacaa atggttattc aaattccgcg cccactacca cagcgcgaac ggatgattcc 15180tgttagtcca cctcgacttt atgctcaccc acctcaagtg cgacgggctc ccgttgatga 15240ggctctggta ctggtatctg gaatacttgt tgcgctagca cctcgtgatg aactttcacc 15300cgtctgtctt gccccaagac ctttcgctgt agccccattt caaactgtgg gcgttgaagt 15360ctgaccccaa actggggcag tgaccagaac agtacggacc ccatatatgt ttgcttcgga 15420aggtaggtct gtagtaaaac gacggtccta cgccccacct gaagtgggtg tcggcggact 15480cgttgaacaa cccgtaggcg ttcgccgttg ggaaggtcct cccgaaatcc tagtggatgc 15540tactagacct cccaccattg taagggcgtg acaacctaca cctgcggatg gtccgctcga 15600actttctact gtggcttgtc ccgcccccac cgcgtccgcc gtcgttgtcg tcaccgtcgc 15660cgcgccttct cttgaggttg cgccgtcggc gccgttacgt cggccacctc ctgtacttgc 15720tagtacggta agcgccgctg tggaaacggt gtgcccgact cctcttcgcg cgactccggc 15780ttcgtcgccg gcttcgacgg cgggggcgac gcgttgggct ccagctcttc ggagtcttct 15840ttggccacta gtttggggac tgtctcctgt cgttctttgc gtcaatgttg gattattcgt 15900tactgtcgtg gaagtgggtc atggcgtcga ccatggaacg tatgttgatg ccgctgggag 15960tctggcctta ggcgagtacc tgggacgaaa cgtgaggact gcattggacg ccgagcctcg 16020tccagatgac cagcaacggt ctgtactacg ttctggggca ctggaaggcg aggtgcgcgg 16080tctagtcgtt gaaaggccac cacccgcggc tcgacaacgg gcacgtgagg ttctcgaaga 16140tgttgctggt ccggcagatg agggttgagt aggcggtcaa atggagagac tgggtgcaca 16200agttagcgaa agggctcttg gtctaaaacc gcgcgggcgg tcgggggtgg tagtggtggc 16260agtcactttt gcaaggacga gagtgtctag tgccctgcga tggcgacgcg ttgtcgtagc 16320ctcctcaggt cgctcactgg taatgactgc ggtctgcggc gtggacgggg atgcaaatgt 16380tccgggaccc gtatcagagc ggcgcgcagg atagctcggc gtgaaaaact cgttcgtaca 16440ggtaggaata tagcgggtcg ttattgtgtc cgaccccgga cgcgaagggt tcgttctaca 16500aaccgccccg gttcttcgcg aggctggttg tgggtcacgc gcacgcgccc gtgatggcgc 16560gcgggacccc gcgcgtgttt gcgccggcgt gacccgcgtg gtggcagcta ctgcggtagc 16620tgcgccacca cctcctccgc gcgttgatgt gcgggtgcgg cggtggtcac aggtgtcacc 16680tgcgccggta agtctggcac cacgcgcctc gggccgcgat acgattttac ttctctgccg 16740cctccgcgca tcgtgcagcg gtggcggcgg ctgggccgtg acggcgggtt gcgcgccgcc 16800gccgggacga attggcgcgt gcagcgtggc cggctgcccg ccggtacgcc cggcgagctt 16860ccgaccggcg cccataacag tgacacgggg ggtccaggtc cgctgctcgc cggcggcgtc 16920gtcggcgccg gtaatcacga tactgagtcc cagcgtcccc gttgcacata acccacgcgc 16980tgagccaatc gccggacgcg cacgggcacg cgtgggcggg gggcgcgttg atctaacgtt 17040cttttttgat gaatctgagc atgacaacat acataggtcg ccgccgccgc gcgttgcttc 17100gatacaggtt cgcgttttag tttcttctct acgaggtcca gtagcgcggc ctctagatac 17160cggggggctt cttccttctc gtcctaatgt tcggggcttt cgatttcgcc cagtttttct 17220ttttctttct actactacta cttgaactgc tgctccacct tgacgacgtg cgatggcgcg 17280ggtccgctgc ccatgtcacc tttccagctg cgcattttgc acaaaacgct gggccgtggt 17340ggcatcagaa atgcgggcca ctcgcgaggt gggcgtggat gttcgcgcac atactactcc 17400acatgccgct gctcctggac gaactcgtcc ggttgctcgc ggagcccctc aaacggatgc 17460ctttcgccgt attcctgtac gaccgcaacg gcgacctgct cccgttgggt tgtggatcgg 17520atttcgggca ttgtgacgtc gtccacgacg ggcgcgaacg tggcaggctt cttttcgcgc 17580cggatttcgc gctcagacca ctgaaccgtg ggtggcacgt cgactaccat gggttcgcgg 17640tcgctgacct tctacagaac cttttttact ggcaccttgg acccgacctc gggctccagg 17700cgcacgccgg ttagttcgtc caccgcggcc ctgacccgca cgtctggcac ctgcaagtct 17760atgggtgatg gtcatcgtgg tcataacggt ggcggtgtct cccgtacctc tgtgtttgca 17820ggggccaacg gagtcgccac cgcctacggc gccacgtccg ccagcgacgc cggcgcaggt 17880tctggagatg cctccacgtt tgcctgggca cctacaaagc gcaaagtcgg ggggccgcgg 17940gcgcggcaag ctccttcatg ccgcggcggt cgcgcgatga cgggcttata cgggatgtag 18000gaaggtaacg cggatggggg ccgatagcac cgatgtggat ggcggggtct tctgctcgtt 18060gatgggctgc ggcttggtgg tgaccttggg cggcggcggc agcggcagcg gtcgggcacg 18120accggggcta aaggcacgcg tcccaccgag cgcttcctcc gtcctgggac cacgacggtt 18180gtcgcgcgat ggtggggtcg tagcaaattt tcggccagaa acaccaagaa cgtctatacc 18240gggagtggac ggcggaggca aagggccacg gccctaaggc tccttcttac gtggcatcct 18300ccccgtaccg gccggtgccg gactgcccgc cgtacgcagc acgcgtggtg gccgccgccg 18360cgcgcagcgt ggcagcgtac gcgccgccat aggacgggga ggaataaggt gactagcggc 18420gccgctaacc gcggcacggg ccttaacgta ggcaccggaa cgtccgcgtc tctgtgacta 18480atttttgttc aacgtacacc tttttagttt tatttttcag acctgagagt gcgagcgaac 18540caggacattg ataaaacatc ttaccttctg tagttgaaac gcagagaccg gggcgctgtg 18600ccgagcgcgg gcaagtaccc tttgaccgtt ctatagccgt ggtcgttata ctcgccaccg 18660cggaagtcga ccccgagcga cacctcgccg taatttttaa agccaaggtg gcaattcttg 18720ataccgtcgt tccggacctt gtcgtcgtgt ccggtctacg actccctatt caactttctc 18780gttttaaagg ttgttttcca ccatctaccg gaccggagac cgtaatcgcc ccaccacctg 18840gaccggttgg tccgtcacgt tttattctaa ttgtcattcg aactaggggc gggagggcat 18900ctcctcggag gtggccggca cctctgtcac agaggtctcc ccgcaccgct tttcgcaggc 18960gcggggctgt cccttctttg agaccactgc gtttatctgc tcggagggag catgctcctc 19020cgtgatttcg ttccggacgg gtggtgggca gggtagcgcg ggtaccgatg gcctcacgac 19080ccggtcgtgt gtgggcattg cgacctggac ggaggggggc ggctgtgggt cgtctttgga 19140cacgacggtc cgggctggcg gcaacaacat tgggcaggat cggcgcgcag ggacgcggcg 19200cggcggtcgc caggcgctag caacgccggg catcggtcac cgttgaccgt ttcgtgtgac 19260ttgtcgtagc acccagaccc ccacgttagg gacttcgcgg ctgctacgaa gactatcgat 19320tgcacagcat acacacagta catacgcagg tacagcggcg gtctcctcga cgactcggcg 19380gcgcgcgggc gaaaggttct accgatgggg aagctactac ggcgtcacca gaatgtacgt 19440gtagagcccg gtcctgcgga gcctcatgga ctcggggccc gaccacgtca aacgggcgcg 19500gtggctctgc atgaagtcgg acttattgtt caaatctttg gggtgccacc gcggatgcgt 19560gctgcactgg tgtctggcca gggtcgcaaa ctgcgacgcc aagtagggac acctggcact 19620cctatgacgc atgagcatgt tccgcgccaa gtgggatcga cacccactat tggcacacga 19680cctgtaccga aggtgcatga aactgtaggc gccgcacgac ctgtccccgg gatgaaaatt 19740cgggatgaga ccgtgacgga tgttgcggga ccgagggttc ccacggggtt taggaacgct 19800taccctactt cgacgatgac gagaacttta tttggatctt cttctcctgc tactgttgct 19860tctgcttcat ctgctcgttc gactcgtcgt tttttgagtg cataaacccg tccgcggaat 19920aagaccatat ttataatgtt tcctcccata agtttatcca cagcttccag tttgtggatt 19980tatacggcta ttttgtaaag ttggacttgg agtttatcct cttagagtca ccatgctttg 20040tctttaatta gtacgtcgac cctctcagga ttttttctga tggggttact ttggtacaat 20100gccaagtata cgttttgggt gtttactttt acctcccgtt ccgtaagaac atttcgttgt 20160tttacctttc gatctttcag ttcaccttta cgttaaaaag agttgatgac tccgtcggcg 20220tccgttacca ctattgaact gaggatttca ccataacatg tcacttctac atctatatct 20280ttggggtctg tgagtataaa gaatgtacgg gtgataattc cttccattga gtgctcttga 20340ttacccggtt gttagatacg ggttgtccgg attaatgtaa cgaaaatccc tgttaaaata 20400accagattac ataatgttgt cgtgcccatt atacccacaa gaccgcccgg ttcgtagcgt 20460caacttacga caacatctaa acgttctgtc tttgtgtctc gaaagtatgg tcgaaaacga 20520actaaggtaa ccactatctt ggtccatgaa aagatacacc ttagtccgac aactgtcgat 20580actaggtcta caatcttaat aacttttagt accttgactt ctacttgaag gtttaatgac 20640gaaaggtgac cctccacact aattatgtct ctgagaatgg ttccattttg gattttgtcc 20700agtcctttta cctacccttt ttctacgatg tcttaaaagt ctatttttac tttattctca 20760acctttatta aaacggtacc tttagttaga tttacggttg gacacctctt taaaggacat 20820gaggttgtat cgcgacataa acgggctgtt cgatttcatg tcaggaaggt tgcattttta 20880aagactattg ggtttgtgga tgctgatgta cttgttcgct caccaccgag ggcccgatca 20940cctgacgatg taattggaac ctcgtgcgac cagggaactg atatacctgt tgcagttggg 21000taaattggtg gtggcgttac gaccggacgc gatggcgagt tacaacgacc cgttaccagc 21060gatacacggg aaggtgtagg tccacggagt cttcaagaaa cggtaatttt tggaggaaga 21120ggacggcccg agtatgtgga tgctcacctt gaagtccttc ctacaattgt accaagacgt 21180ctcgagggat cctttactgg attcccaact gcctcggtcg taattcaaac tatcgtaaac 21240ggaaatgcgg tggaagaagg ggtaccgggt gttgtggcgg aggtgcgaac tccggtacga 21300atctttgctg tggttgctgg tcaggaaatt gctgatagag aggcggcggt tgtacgagat 21360gggatatggg cggttgcgat ggttgcacgg gtataggtag gggagggcgt tgacccgccg 21420aaaggcgccg acccggaagt gcgcggaatt ctgattcctt tggggtagtg acccgagccc 21480gatgctggga ataatgtgga tgagaccgag atatgggatg gatctacctt ggaaaatgga 21540gttggtgtgg aaattcttcc accggtaatg gaaactgaga agacagtcga ccggaccgtt 21600actggcggac gaatgggggt tgctcaaact ttaattcgcg agtcaactgc ccctcccaat 21660gttgcaacgg gtcacattgt actggtttct gaccaaggac catgtttacg atcgattgat 21720attgtaaccg atggtcccga agatataggg tctctcgatg ttcctggcgt acatgaggaa 21780gaaatctttg aaggtcgggt actcggcagt ccaccaccta ctatgattta tgttcctgat 21840ggttgtccac ccgtaggatg tggttgtgtt gttgagacct aaacaaccga tggaacgggg 21900gtggtacgcg cttcctgtcc ggatgggacg attgaagggg ataggcgaat atccgttctg 21960gcgtcaactg tcgtaatggg tctttttcaa agaaacgcta gcgtgggaaa ccgcgtaggg 22020taagaggtca ttgaaataca ggtacccgcg tgagtgtctg gacccggttt tggaagagat 22080gcggttgagg cgggtgcgcg atctgtactg aaaactccac ctagggtacc tgctcgggtg 22140ggaagaaata caaaacaaac ttcagaaact gcaccaggca cacgtggtcg gcgtggcgcc 22200gcagtagctt tggcacatgg acgcgtgcgg gaagagccgg ccgttgcggt gttgtatttc 22260ttcgttcgtt gtagttgttg tcgacggcgg tacccgaggt cactcgtcct tgactttcgg 22320taacagtttc tagaaccaac acccggtata aaaaacccgt ggatactgtt cgcgaaaggt 22380ccgaaacaaa gaggtgtgtt cgagcggacg cggtatcagt tatgccggcc agcgctctga 22440cccccgcatg tgacctaccg gaaacggacc ttgggcgtga gtttttgtac gatggagaaa 22500ctcgggaaac cgaaaagact ggtcgctgag ttcgtccaaa tggtcaaact catgctcagt 22560gaggacgcgg catcgcggta acgaagaagg gggctggcga catattgcga ccttttcagg 22620tgggtttcgc atgtccccgg gttgagccgg cggacacctg ataagacgac gtacaaagag 22680gtgcggaaac ggttgaccgg ggtttgaggg tacctagtgt tggggtggta cttggaataa 22740tggccccatg ggttgaggta cgagttgtca ggggtccatg tcgggtggga cgcagcgttg 22800gtccttgtcg agatgtcgaa ggacctcgcg gtgagcggga tgaaggcgtc ggtgtcacgc 22860gtctaatcct cgcggtgaag aaaaacagtg aactttttgt acatttttat tacatgatct 22920ctgtgaaagt tatttccgtt tacgaaaata aacatgtgag agcccactaa taaatggggg 22980tgggaacggc agacgcggca aatttttagt ttccccaaga cggcgcgtag cgatacgcgg 23040tgaccgtccc tgtgcaacgc tatgaccaca aatcacgagg tgaatttgag tccgtgttgg 23100taggcgccgt cgagccactt caaaagtgag gtgtccgacg cgtggtagtg gttgcgcaaa 23160tcgtccagcc cgcggctata gaacttcagc gtcaaccccg gaggcgggac gcgcgcgctc 23220aacgctatgt gtcccaacgt cgtgaccttg tgatagtcgc ggcccaccac gtgcgaccgg 23280tcgtgcgaga acagcctcta gtctaggcgc aggtccagga ggcgcaacga gtcccgcttg 23340cctcagttga aaccatcgac ggaagggttt ttcccgcgca cgggtccgaa actcaacgtg 23400agcgtggcat caccgtagtt ttccactggc acgggccaga cccgcaatcc tatgtcgcgg 23460acgtattttc ggaactagac gaattttcgg tggactcgga aacgcggaag tctcttcttg 23520tacggcgttc tgaacggcct tttgactaac cggcctgtcc ggcgcagcac gtgcgtcgtg 23580gaacgcagcc acaacctcta gacgtggtgt aaagccgggg tggccaagaa gtgctagaac 23640cggaacgatc tgacgaggaa gtcgcgcgcg acgggcaaaa gcgagcagtg taggtaaagt 23700tagtgcacga ggaataaata gtattacgaa ggcacatctg tgaattcgag cggaagctag 23760agtcgcgtcg ccacgtcggt gttgcgcgtc gggcacccga gcactacgaa catccagtgg 23820agacgtttgc tgacgtccat gcggacgtcc ttagcggggt agtagcagtg tttccagaac 23880aacgaccact tccagtcgac gttgggcgcc acgaggagca agtcggtcca gaacgtatgc 23940cggcggtctc gaaggtgaac cagtccgtca tcaaacttca agcggaaatc tagcaatagg 24000tgcaccatga acaggtagtc gcgcgcgcgt cggaggtacg ggaagagggt gcgtctgtgc 24060tagccgtgtg agtcgcccaa gtagtggcat taaagtgaaa ggcgaagcga cccgagaagg 24120agaaggagaa cgcaggcgta tggtgcgcgg tgacccagca gaagtaagtc ggcggcgtga 24180cacgcgaatg gaggaaacgg tacgaactaa tcgtggccac ccaacgactt tgggtggtaa 24240acatcgcggt gtagaagaga aagaaggagc gacaggtgct aatggagacc actaccgccc 24300gcgagcccga accctcttcc cgcgaagaaa aagaagaacc cgcgttaccg gtttaggcgg 24360cggctccagc taccggcgcc cgacccacac gcgccgtggt cgcgcagaac actactcaga 24420aggagcagga gcctgagcta tgcggcggag taggcgaaaa aacccccgcg ggcccctccg 24480ccgccgctgc ccctgcccct gctgtgcagg aggtaccaac cccctgcagc gcggcgtggc 24540gcaggcgcga gcccccacca aagcgcgacg aggagaaggg ctgaccggta aaggaagagg 24600atatccgtct ttttctagta cctcagtcag ctcttcttcc tgtcggattg gcgggggaga 24660ctcaagcggt ggtggcggag gtggctacgg cggttgcgcg gatggtggaa ggggcagctc 24720cgtgggggcg aactcctcct ccttcactaa tagctcgtcc tgggtccaaa acattcgctt 24780ctgctgctcc tggcgagtca tggttgtctc ctatttttcg ttctggtcct gttgcgtctc 24840cgtttgctcc ttgttcagcc cgcccccctg ctttccgtac cgctgatgga tctacaccct 24900ctgctgcacg acaacttcgt agacgtcgcg gtcacgcggt aatagacgct gcgcaacgtt 24960ctcgcgtcgc tacacgggga gcggtatcgc ctacagtcgg aacggatgct tgcggtggat 25020aagagtggcg cgcatggggg gtttgcggtt cttttgccgt gtacgctcgg gttgggcgcg 25080gagttgaaga tggggcataa acggcacggt ctccacgaac ggtggatagt gtagaaaaag 25140gttttgacgt tctatgggga taggacggca cggttggcgt cggctcgcct gttcgtcgac 25200cggaacgccg tcccgcgaca gtatggacta tagcggagcg agttgcttca cggtttttag 25260aaactcccag aacctgcgct gctcttcgcg cgccgtttgc gagacgttgt ccttttgtcg 25320cttttacttt cagtgagacc tcacaaccac cttgagctcc cactgttgcg cgcggatcgg 25380catgattttg cgtcgtagct ccagtgggtg aaacggatgg gccgtgaatt ggatgggggg 25440ttccagtact cgtgtcagta ctcactcgac tagcacgcgg cacgcgtcgg ggacctctcc 25500ctacgtttaa acgttcttgt ttgtctcctc ccggatgggc gtcaaccgct gctcgtcgat 25560cgcgcgaccg aagtttgcgc gctcggacgg ctgaacctcc tcgctgcgtt tgattactac 25620cggcgtcacg agcaatggca cctcgaactc acgtacgtcg ccaagaaacg actgggcctc 25680tacgtcgcgt tcgatctcct ttgtaacgtg atgtggaaag ctgtcccgat gcatgcggtc 25740cggacgttct agaggttgca cctcgagacg ttggaccaga ggatggaacc ttaaaacgtg 25800cttttggcgg aacccgtttt gcacgaagta aggtgcgagt tcccgctccg cgcggcgctg 25860atgcaggcgc tgacgcaaat gaataaagat acgatgtgga ccgtctgccg gtacccgcaa 25920accgtcgtca cgaacctcct cacgttggag ttcctcgacg tctttgacga tttcgttttg 25980aacttcctgg atacctgccg gaagttgctc gcgaggcacc ggcgcgtgga ccgcctgtag 26040taaaaggggc ttgcggacga attttgggac gttgtcccag acggtctgaa gtggtcagtt 26100tcgtacaacg tcttgaaatc cttgaaatag gatctcgcga gtccttagaa cgggcggtgg 26160acgacacgtg aaggatcgct gaaacacggg taattcatgg cgcttacggg aggcggcgaa 26220accccggtga cgatggaaga cgtcgatcgg ttgatggaac ggatggtgag actgtattac 26280cttctgcact cgccactgcc agatgacctc acagtgacag cgacgttgga tacgtggggc 26340gtggcgaggg accaaacgtt aagcgtcgac gaattgcttt cagtttaata gccatggaaa 26400ctcgacgtcc cagggagcgg actgcttttc aggcgccgag gccccaactt tgagtgaggc 26460cccgacacct gcagccgaat ggaagcgttt aaacatggac tcctgatggt gcgggtgctc 26520taatccaaga tgcttctggt tagggcgggc ggattacgcc tcgaatggcg gacgcagtaa 26580tgggtcccgg tgtaagaacc ggttaacgtt cggtagttgt ttcgggcggt tctcaaagac 26640gatgctttcc ctgcccccca aatgaacctg ggggtcaggc cgctcctcga gttgggttag 26700gggggcggcg gcgtcgggat agtcgtcgtc ggcgcccggg aacgaagggt cctaccgtgg 26760gtttttcttc gacgtcgacg gcggcggtgg gtgcctgctc ctccttatga ccctgtcagt 26820ccgtctcctc caaaacctgc tcctcctcct cctgtactac cttctgaccc tctcggatct 26880gctccttcga aggctccagc ttctccacag tctgctttgt ggcagtggga gccagcgtaa 26940ggggagcggc cgcggggtct ttagccgttg gccaaggtcg taccgatgtt ggaggcgagg 27000agtccgcggc ggccgtgacg ggcaagcggc tgggttggca tctaccctgt ggtgaccttg 27060gtcccggcca ttcaggttcg tcggcggcgg caatcgggtt ctcgttgttg tcgcggttcc 27120gatggcgagt accgcgcccg tgttcttgcg gtatcaacga acgaacgttc tgacaccccc 27180gttgtagagg aagcgggcgg cgaaagaaga gatggtagtg ccgcaccgga agggggcatt 27240gtaggacgta atgatggcag tagagatgtc gggtatgacg tggccgccgt cgccgtcgtt 27300gtcgtcgccg gtgtgtcttc gtttccgctg gcctatcgtt ctgagactgt ttcgggttct 27360ttaggtgtcg ccgccgtcgt cgtcctcctc ctcgcgacgc agaccgcggg ttgcttgggc 27420atagctgggc gctcgaatct ttgtcctaaa aagggtgaga catacgatat aaagttgtct 27480cgtccccggt tcttgttctc gacttttatt ttttgtccag agacgctagg gagtgggcgt 27540cgacggacat agtgttttcg cttctagtcg aagccgcgtg cgaccttctg cgcctccgag 27600agaagtcatt tatgacgcgc gactgagaat tcctgatcaa agcgcgggaa agagtttaaa 27660ttcgcgcttt tgatgcagta gaggtcgccg gtgtgggccg cggtcgtgga caacagtcgc 27720ggtaatactc gttcctttaa gggtgcggga tgtacacctc aatggtcggt gtttaccctg 27780aacgccgacc tcgacgggtt ctgatgagtt gggcttattt gatgtactcg cgccctgggg 27840tgtactatag ggcccagttg ccttatgcgc gggtggcttt ggcttaagag gaccttgtcc 27900gccgataatg gtggtgtgga gcattattgg aattaggggc atcaaccggg cgacgggacc 27960acatggtcct ttcagggcga gggtggtgac accatgaagg gtctctgcgg gtccggcttc 28020aagtctactg attgagtccc cgcgtcgaac gcccgccgaa agcagtgtcc cacgccagcg 28080ggcccgtccc atattgagtg gactgttagt ctcccgctcc ataagtcgag ttgctgctca 28140gccactcgag gagcgaacca gaggcaggcc tgccctgtaa agtctagccg ccgcggccgg 28200cgagaagtaa gtgcggagca gtccgttagg attgagacgt ctggagcagg agactcggcg 28260cgagacctcc gtaaccttga gacgttaaat aactcctcaa acacggtagc cagatgaaat 28320tggggaagag ccctggaggg ccggtgatag gcctagttaa ataaggattg aaactgcgcc 28380atttcctgag ccgcctgccg atgctgactt acaattcacc tctccgtctc gttgacgcgg 28440actttgtgga ccaggtgaca gcggcggtgt tcacgaaacg ggcgctgagg ccactcaaaa 28500cgatgaaact taacgggctc ctagtatagc tcccgggccg cgtgccgcag gccgaatggc 28560gggtccctct cgaacgggca tcggactaag ccctcaaatg ggtcgcgggg gacgatcaac 28620tcgccctgtc ccctgggaca caagagtgac actaaacgtt gacaggattg ggacctaatg 28680tagttctaga aacaacggta gagacacgac tcatattatt tatgtcttta attttatatg 28740accccgagga tagcggtagg acatttgcgg tggcagaagt gggcgggttc gtttggttcc 28800gcttggaatg gaccatgaaa attgtagaga gggagacact aaatgttgtc aaagttgggt 28860ctgcctcact cagatgctct cttggagagg ctcgagtcga tgaggtagtc ttttttgtgg 28920tgggaggaat ggacggccct tgcatgctca cgcagtggcc ggcgacgtgg tgtggatggc 28980ggactggcat ttggtctgaa aaaggcctgt ctggagttat tgagacaaat ggtcttgtcc 29040tccactcgaa tcttttggga atcccataat ccggtttccg cgtcgatgac accccaaata 29100cttgttaagt tcgttgagat gcccgataag attaagtcca aagagatctt agccccaacc 29160ccaataagag acagaacact aagagaaata agaatatgat tgcgaagaga cggattccga 29220gcggcggacg acacacgtgt aaacgtaaat aacagtcgaa aaatttgcga ccccagcggt 29280gggttctact aatccatgta ttaggatcca aatgagtggg aacgcagtcg ggtgccatgg 29340tgggttttcc acctaaaatt cctcggtcgg acattacaat gtaagcgtcg acttcgatta 29400ctcacgtggt gagaatattt tacgtggtgt cttgtacttt tcgacgaata agcggtgttt 29460ttgttttaac cgttcatacg acaaatacga taaaccgtcg gtccactgtg atgtctcata 29520ttacaatgtc aaaaggtccc attttcagta ttttgaaaat acatatgaaa aggtaaaata 29580ctttacacgc tgtaatggta catgtactcg tttgtcatat tcaacaccgg gggtgtttta 29640acacaccttt tgtgaccgtg aaagacgacg tgacgatacg attaatgtca cgagcgaaac 29700cagacatggg atgagatata atttatgttt tcgtctgcgt cgaaataact ccttttcttt 29760tacggaatta aatgattcaa tgtttcgatt acagtggtga ttgacgaaat gagcgacgaa 29820cgttttgttt aagtttttca atcgtaatat taatcttatc ctaaatttgg ggggccagta 29880aaggacgagt tatggtaagg ggacttgtta actgagatac accctatacg aggtcgcgat 29940gttggaactt cagtccgaag gacctacagt cgtagactga aaccggtcgt ggacagggcg 30000cctaaacaag gtcaggttga tgtcgctggg tgggattgtc tctactggtt gtgttggttg 30060cgccggcggc gatggcctga atgtagatgg tgtttatgtg gggttcaaag acggaaacag 30120ttattgaccc tattgaaccc gtacaccacc aagaggtatc gcgaatacaa acatacggaa 30180taataataca ccgagtagac gacggatttc gcgtttgcgc gggctggtgg gtagatatca 30240gggtagtaac acgatgtggg tttgttacta ccttaggtat ctaacctgcc tgactttgtg 30300tacaagaaaa gagaatgtca tactaattta ctctgtacta aggagctcaa aaatataatg 30360actgggaaca acgcgaaaaa acacgcacga ggtgtaaccg acgccaaaga gtgtagcttc 30420atctgacgta aggtcggaag tgtcagataa acgaaatgcc taaacagtgg gagtgcgagt 30480agacgtcgga gtagtgacac cagtagcgga aataggtcac gtaactgacc cagacacacg 30540cgaaacgtat agagtctgtg gtaggggtca tgtccctgtc ctgatatcga ctcgaagaat 30600cttaagaaat taatacttta aatgacactg aaaagacgac taataaacgt gggatagacg 30660caaaacaagg ggctggaggt tcggagtttc tgtatatagt acgtctaagt gagcatatac 30720cttataaggt tcaacgatgt tacttttttc gctagaaagg cttcggacca atatacgtta 30780gtagagacaa taccacaaga cgtcatggta gaatcgggat cgatatatag ggatggaact 30840gtaaccgacc ttgcgttatc tacggtactt ggtgggttga aaggggcgcg ggcgatacga 30900aggtgacgtt gttcaacaac ggccgccgaa acagggtcgg ttagtcggag cgggtggaag 30960agggtggggg tgactttagt cgatgaaatt agattgtcct cctctactga ctgtgggatc 31020tagatcttta cctgccttaa taatgtctcg tcgcggacga tctttctgcg tcccgtcgcc 31080ggctcgttgt cgcgtactta gttctcgagg ttctgtacca attgaacgtg gtcacgtttt 31140ccccatagaa aacagagcat ttcgtccggt ttcagtggat gctgtcatta tggtggcctg 31200tggcggaatc gatgttcaac ggttggttcg cagtctttaa ccaccagtac caccctcttt 31260tcgggtaatg gtattgagtc gtgagccatc tttggcttcc gacgtaagtg agtggaacag 31320ttcctggact cctagagacg tgggaataat tctgggacac gccagagttt ctagaataag 31380ggaaattgat tatttttttt tattatttcg tagtgaatga attttagtca atcgtttaaa 31440gacaggtcaa ataagtcgtc gtggaggaac gggaggaggg tcgagaccat aacgtcgaag 31500gaggaccgac gtttgaaaga ggtgttagat ttaccttaca gtcaaaggag gacaaggaca 31560ggtaggcgtg ggtgatagaa gtacaacaac gtctacttcg cgcgttctgg cagacttcta 31620tggaagttgg ggcacatagg tatactgtgc ctttggccag gaggttgaca cggaaaagaa 31680tgaggaggga aacatagggg gttacccaaa gttctctcag ggggacccca tgagagaaac 31740gcggataggc ttggagatca atggaggtta ccgtacgaac gcgagtttta cccgttgccg 31800gagagagacc tgctccggcc gttggaatgg agggttttac attggtgaca ctcgggtgga 31860gagttttttt ggttcagttt gtatttggac ctttatagac gtggggagtg tcaatggagt 31920cttcgggatt gacaccgacg gcggcgtgga gattaccagc gcccgttgtg tgagtggtac 31980gttagtgtcc ggggcgattg gcacgtgctg aggtttgaat cgtaacggtg ggttcctggg 32040gagtgtcaca gtcttccttt cgatcgggac gtttgtagtc cgggggagtg gtggtggcta 32100tcgtcatggg aatgatagtg acggagtggg ggagattgat gacggtgacc atcgaacccg 32160taactgaact ttctcgggta aatatgtgtt ttaccttttg atcctgattt catgccccga 32220ggaaacgtac attgtctgct ggatttgtga aactggcatc gttgaccagg tccacactga 32280taattattat gaaggaacgt ttgatttcaa tgacctcgga acccaaaact aagtgttccg 32340ttatacgttg aattacatcg tcctcctgat tcctaactaa gagttttgtc tgcggaatat 32400gaactacaat caataggcaa actacgagtt ttggttgatt tagattctga tcctgtcccg 32460ggagaaaaat atttgagtcg ggtgttgaac ctataattga tgttgtttcc ggaaatgaac 32520aaatgtcgaa gtttgttaag gtttttcgaa ctccaattgg attcgtgacg gttccccaac 32580tacaaactgc gatgtcggta tcggtaatta cgtcctctac ccgaacttaa accaagtgga 32640ttacgtggtt tgtgtttagg ggagttttgt ttttaaccgg taccggatct taaactaagt 32700ttgttccgat accaaggatt tgatccttga ccggaatcaa aactgtcgtg tccacggtaa 32760tgtcatcctt tgtttttatt actattcgat tgaaacacct ggtgtggtcg aggtagagga 32820ttgacatctg atttacgtct ctttctacga tttgagtgaa accagaattg ttttacaccg 32880tcagtttatg aacgatgtca aagtcaaaac cgacaatttc cgtcaaaccg aggttataga 32940ccttgtcaag tttcacgagt agaataatat tctaaactgc ttttacctca cgatgatttg 33000ttaaggaagg acctgggtct tataaccttg aaatctttac ctctagaatg acttccgtgt 33060cggatatgtt tgcgacaacc taaatacgga ttggatagtc gaataggttt tagagtgcca 33120ttttgacggt tttcattgta acagtcagtt caaatgaatt tgcctctgtt ttgatttgga 33180cattgtgatt ggtaatgtga tttgccatgt gtcctttgtc ctctgtgttg aggttcacgt 33240atgagataca gtaaaagtac cctgaccaga ccggtgttga tgtaattact ttataaacgg 33300tgtaggagaa tgtgaaaaag tatgtaacgg gttcttattt cttagcaaac acaatacaaa 33360gttgcacaaa taaaaagtta acgtctttta aagttcagta aaaagtaagt catcatatcg 33420gggtggtggt gtatcgaata tgtctagtgg catggaatta gtttgagtgt cttgggatca 33480taagttggac ggtggaggga gggttgtgtg tctcatgtgt caggaaagag gggccgaccg 33540gaatttttcg tagtatagta cccattgtct gtataagaat ccacaatata aggtgtgcca 33600aaggacagct cggtttgcga gtagtcacta taattatttg aggggcccgt cgagtgaatt 33660caagtacagc gacaggtcga cgactcggtg tccgacgaca ggttgaacgc caacgaattg 33720cccgccgctt cctcttcagg tgcggatgta cccccatctc agtattagca cgtagtccta 33780tcccgccacc acgacgtcgt cgcgcgctta tttgacgacg gcggcggcga ggcaggacgt 33840ccttatgttg taccgtcacc agaggagtcg ctactaagcg tggcgggcgt cgtattccgc 33900ggaacaggag gcccgtgtcg tcgcgtggga ctagagtgaa tttagtcgtg tcattgacgt 33960cgtgtcgtgg tgttataaca agttttaggg tgtcacgttc cgcgacatag gtttcgagta 34020ccgcccctgg tgtcttgggt gcaccggtag tatggtgttc gcgtccatct aattcaccgc 34080tggggagtat ttgtgcgacc tgtatttgta atggagaaaa ccgtacaaca ttaagtggtg 34140gagggccatg gtatatttgg agactaattt gtaccgcggt aggtggtggt aggatttggt 34200cgaccggttt tggacgggcg gccgatatgt gacgtccctt ggccctgacc ttgttactgt 34260cacctctcgg gtcctgagca ttggtaccta gtagtacgag cagtactata gttacaaccg 34320tgttgtgtcc gtgtgcacgt atgtgaagga gtcctaatgt tcgaggaggg cgcaatcttg 34380gtatagggtc ccttgttggg taaggactta gtcgcattta gggtgtgacg tcccttctgg 34440agcgtgcatt gagtgcaaca cgtaacagtt tcacaatgta agcccgtcgt cgcctactag 34500gaggtcatac catcgcgccc aaagacagag ttttcctcca tctgctaggg atgacatgcc 34560tcacgcggct ctgttggctc tagcacaacc agcatcacag tacggtttac cttgcggcct 34620gcatcagtat aaaggacttc gttttggtcc acgcccgcac tgtttgtcta gacgcagagg 34680ccagagcggc gaatctagcg agacacatca tcaacatcat ataggtgaga gagtttcgta 34740ggtccgcggg ggaccgaagc ccaagataca tttgaggaag tacgcggcga cgggactatt 34800gtaggtggtg gcgtcttatt cggtgtgggt cggttggatg tgtaagcaag acgctcagtg 34860tgtgccctcc tcgcccttct cgaccttctt ggtacaaaaa aaaaaataag gttttctaat 34920aggttttgga gttttacttc tagataattc acttgcgcga ggggaggcca ccgcaccagt 34980ttgagatgtc ggtttcttgt ctattaccgt aaacattcta caacgtgtta ccgaaggttt 35040tccgtttgcc gggagtgcag gttcacctgc atttccgatt tgggaagtcc cacttagagg 35100agatatttgt aaggtcgtgg aagttggtac gggtttatta agagtagagc ggtggaagag 35160ttatatagag attcgtttag ggcttataat tcaggccggt aacattttta gacgaggtct 35220cgcgggaggt ggaagtcgga gttcgtcgct tagtactaac gtttttaagt ccaaggagtg 35280tctggacata ttctaagttt tcgccttgta attgttttta tggcgctagg gcatccaggg 35340aagcgtcccg gtcgacttgt attagcacgt ccagacgtgc ctggtcgcgc cggtgaaggg 35400gcggtccttg gtactgtttt cttgggtgtg actaatactg tgcgtatgag cctcgatacg 35460attggtcgca tcggggctac attcgaacaa cgtacccgcc gctatatttt acgttccacg 35520acgagttttt tagtccgttt cggagcgcgt tttttctttc gtgtagcatc agtacgagta 35580cgtctatttc cgtccattcg aggccttggt ggtgtctttt tctgtggtaa aaagagagtt 35640tgtacagacg cccaaagacg tatttgtgtt ttattttatt gtttttttgt aaatttgtaa 35700tcttcggaca gaatgttgtc ctttttgttg ggaatattcg tattctgcct gatgccggta 35760cggccgcact ggcatttttt tgaccagtgg cactaatttt tcgtggtggc tgtcgaggag 35820ccagtacagg cctcagtatt acattctgag ccatttgtgt agtccaacta agtgtagcca 35880gtcacgattt ttcgctggct ttatcgggcc cccttatgta tgggcgtccg catctctgtt 35940gtaatgtcgg gggtatcctc catattgttt taattatcct ctctttttgt gtatttgtgg 36000actttttggg aggacggatc cgttttatcg tgggagggcg aggtcttgtt gtatgtcgcg 36060aaggtgtcgc cgtcggtatt gtcagtcgga atggtcattt tttcttttgg ataatttttt 36120tgtggtgagc tgtgccgtgg tcgagttagt cagtgtcaca ttttttcccg gttcacgtct 36180cgctcatata tatcctgatt ttttactgca ttgccaattt caggtgtttt ttgtgggtct 36240tttggcgtgc gcttggatgc gggtctttgc tttcggtttt ttgggtgttg aaggagttta 36300gcagtgaagg caaaagggtg caatgcagtg aagggtaaaa ttcttttgat gttaagggtt 36360gtgtatgttc aatgaggcgg gattttggat gcagtgggcg gggcaagggt gcggggcgcg 36420gtgcagtgtt tgaggtgggg gagtaatagt ataaccgaag ttaggtttta ttccatataa 36480taactactac aattaattct taagcctaga cgctgcgctc cgacctaccg gaaggggtaa 36540tactaagaag agcgaaggcc gccgtagccc tacgggcgca acgtccggta cgacaggtcc 36600gtccatctac tgctggtagt ccctgtcgaa gttccggtcg ttttccggtc cttggcattt 36660ttccggcgca acgaccgcaa aaaggtatcc gaggcggggg gactgctcgt agtgttttta 36720gctgcgagtt cagtctccac cgctttgggc tgtcctgata tttctatggt ccgcaaaggg 36780ggaccttcga gggagcacgc gagaggacaa ggctgggacg gcgaatggcc tatggacagg 36840cggaaagagg gaagcccttc gcaccgcgaa agagtatcga gtgcgacatc catagagtca 36900agccacatcc agcaagcgag gttcgacccg acacacgtgc ttggggggca agtcgggctg 36960gcgacgcgga ataggccatt gatagcagaa ctcaggttgg gccattctgt gctgaatagc 37020ggtgaccgtc gtcggtgacc attgtcctaa tcgtctcgct ccatacatcc gccacgatgt 37080ctcaagaact tcaccaccgg attgatgccg atgtgatctt cctgtcataa accatagacg 37140cgagacgact tcggtcaatg gaagcctttt tctcaaccat cgagaactag gccgtttgtt 37200tggtggcgac catcgccacc aaaaaaacaa acgttcgtcg tctaatgcgc gtcttttttt 37260cctagagttc ttctaggaaa ctagaaaaga tgccccagac tgcgagtcac cttgcttttg 37320agtgcaattc cctaaaacca gtactctaat agtttttcct agaagtggat ctaggaaaat 37380ttagttagat ttcatatata ctcatttgaa ccagactgtc aatggttacg aattagtcac 37440tccgtggata gagtcgctag acagataaag caagtaggta tcaacggact gaggggcagc 37500acatctattg atgctatgcc ctcccgaatg gtagaccggg gtcacgacgt tactatggcg 37560ctctgggtgc gagtggccga ggtctaaata gtcgttattt ggtcggtcgg ccttcccggc 37620tcgcgtcttc accaggacgt tgaaataggc ggaggtaggt cagataatta acaacggccc 37680ttcgatctca ttcatcaagc ggtcaattat caaacgcgtt gcaacaacgg taacgatgtc 37740cgtagcacca cagtgcgagc agcaaaccat accgaagtaa gtcgaggcca agggttgcta 37800gttccgctca atgtactagg gggtacaaca cgttttttcg ccaatcgagg aagccaggag 37860gctagcaaca gtcttcattc aaccggcgtc acaatagtga gtaccaatac cgtcgtgacg 37920tattaagaga atgacagtac ggtaggcatt ctacgaaaag acactgacca ctcatgagtt 37980ggttcagtaa gactcttatc acatacgccg ctggctcaac gagaacgggc cgcagttgtg 38040ccctattatg gcgcggtgta tcgtcttgaa attttcacga gtagtaacct tttgcaagaa 38100gccccgcttt tgagagttcc tagaatggcg acaactctag gtcaagctac attgggtgag 38160cacgtgggtt gactagaagt cgtagaaaat gaaagtggtc gcaaagaccc actcgttttt 38220gtccttccgt tttacggcgt tttttccctt attcccgctg tgcctttaca acttatgagt 38280atgagaagga aaaagttata ataacttcgt aaatagtccc aataacagag tactcgccta 38340tgtataaact tacataaatc tttttatttg tttatcccca aggcgcgtgt aaaggggctt 38400ttcacggtgg actgcagatt ctttggtaat aatagtactg taattggata tttttatccg 38460catagtgctc cgggaaagca gaagttctta acctaggctt aagaattaaa gaattaatt 38519 30 36620 DNA Artificial Sequence Codon optimized DNA encoding pMRKAd5HIV-1 nef, coding 30catcatcaat aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggcaaaagt gacgtttttg 180gtgtgcgccg gtgtacacag gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240taaatttggg cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300agtgaaatct gaataatttt gtgttactca tagcgcgtaa tatttgtcta gggccgcggg 360gactttgacc gtttacgtgg agactcgccc aggtgttttt ctcaggtgtt ttccgcgttc 420cgggtcaaag ttggcgtttt attattatag gcggccgcga tccattgcat acgttgtatc 480catatcataa tatgtacatt tatattggct catgtccaac attaccgcca tgttgacatt 540gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 600tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 660cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 720attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 780atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 840atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 900tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 960actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 1020aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 1080gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac cgtcagatcg 1140cctggagacg ccatccacgc tgttttgacc tccatagaag acaccgggac cgatccagcc 1200tccgcggccg ggaacggtgc attggaacgc ggattccccg tgccaagagt gagatctgcc 1260accatggccg gcaagtggtc caagaggtcc gtgcccggct ggtccaccgt gagggagagg 1320atgaggaggg ccgagcccgc cgccgacagg gtgaggagga ccgagcccgc cgcagtgggc 1380gtgggcgccg tgtccaggga cctggagaag cacggcgcca tcacctcctc caacaccgcc 1440gccaccaacg ccgactgcgc ctggctggag gcccaggagg acgaggaggt gggcttcccc 1500gtgaggcccc aggtgcccct gaggcccatg acctacaagg gcgccgtgga cctgtcccac 1560ttcctgaagg agaagggcgg cctggagggc ctgatccact cccagaagag gcaggacatc 1620ctggacctgt gggtgtacca cacccagggc tacttccccg actggcagaa ctacaccccc 1680ggccccggca tcaggttccc cctgaccttc ggctggtgct tcaagctggt gcccgtggag 1740cccgagaagg tggaggaggc caacgagggc gagaacaact gcgccgccca ccccatgtcc 1800cagcacggca tcgaggaccc cgagaaggag gtgctggagt ggaggttcga ctccaagctg 1860gccttccacc acgtggccag ggagctgcac cccgagtact acaaggactg ctaaagcccg 1920ggcagatctg ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct 1980tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca 2040tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag 2100ggggaggatt gggaagacaa tagcaggcat gctggggatg cggtgggctc tatggccgat 2160cggcgcgccg tactgaaatg tgtgggcgtg gcttaagggt gggaaagaat atataaggtg 2220ggggtcttat gtagttttgt atctgttttg cagcagccgc cgccgccatg agcaccaact 2280cgtttgatgg aagcattgtg agctcatatt tgacaacgcg catgccccca tgggccgggg 2340tgcgtcagaa tgtgatgggc tccagcattg atggtcgccc cgtcctgccc gcaaactcta 2400ctaccttgac ctacgagacc gtgtctggaa cgccgttgga gactgcagcc tccgccgccg 2460cttcagccgc tgcagccacc gcccgcggga ttgtgactga ctttgctttc ctgagcccgc 2520ttgcaaacag tgcagcttcc cgttcatccg cccgcgatga caagttgacg gctcttttgg 2580cacaattgga ttctttgacc cgggaactta atgtcgtttc tcagcagctg ttggatctgc 2640gccagcaggt ttctgccctg aaggcttcct cccctcccaa tgcggtttaa aacataaata 2700aaaaaccaga ctctgtttgg atttggatca agcaagtgtc ttgctgtctt tatttagggg 2760ttttgcgcgc gcggtaggcc cgggaccagc ggtctcggtc gttgagggtc ctgtgtattt 2820tttccaggac gtggtaaagg tgactctgga tgttcagata catgggcata agcccgtctc 2880tggggtggag gtagcaccac tgcagagctt catgctgcgg ggtggtgttg tagatgatcc 2940agtcgtagca ggagcgctgg gcgtggtgcc taaaaatgtc tttcagtagc aagctgattg 3000ccaggggcag gcccttggtg taagtgttta caaagcggtt aagctgggat gggtgcatac 3060gtggggatat gagatgcatc ttggactgta tttttaggtt ggctatgttc ccagccatat 3120ccctccgggg attcatgttg tgcagaacca ccagcacagt gtatccggtg cacttgggaa 3180atttgtcatg tagcttagaa ggaaatgcgt ggaagaactt ggagacgccc ttgtgacctc 3240caagattttc catgcattcg tccataatga tggcaatggg cccacgggcg gcggcctggg 3300cgaagatatt tctgggatca ctaacgtcat agttgtgttc caggatgaga tcgtcatagg 3360ccatttttac aaagcgcggg cggagggtgc cagactgcgg tataatggtt ccatccggcc 3420caggggcgta gttaccctca cagatttgca tttcccacgc tttgagttca gatgggggga 3480tcatgtctac ctgcggggcg atgaagaaaa cggtttccgg ggtaggggag atcagctggg 3540aagaaagcag gttcctgagc agctgcgact taccgcagcc ggtgggcccg taaatcacac 3600ctattaccgg ctgcaactgg tagttaagag agctgcagct gccgtcatcc ctgagcaggg 3660gggccacttc gttaagcatg tccctgactc gcatgttttc cctgaccaaa tccgccagaa 3720ggcgctcgcc gcccagcgat agcagttctt gcaaggaagc aaagtttttc aacggtttga 3780gaccgtccgc cgtaggcatg cttttgagcg tttgaccaag cagttccagg cggtcccaca 3840gctcggtcac ctgctctacg gcatctcgat ccagcatatc tcctcgtttc gcgggttggg 3900gcggctttcg ctgtacggca gtagtcggtg ctcgtccaga cgggccaggg tcatgtcttt 3960ccacgggcgc agggtcctcg tcagcgtagt ctgggtcacg gtgaaggggt gcgctccggg 4020ctgcgcgctg gccagggtgc gcttgaggct ggtcctgctg gtgctgaagc gctgccggtc 4080ttcgccctgc gcgtcggcca ggtagcattt gaccatggtg tcatagtcca gcccctccgc 4140ggcgtggccc ttggcgcgca gcttgccctt ggaggaggcg ccgcacgagg ggcagtgcag 4200acttttgagg gcgtagagct tgggcgcgag aaataccgat tccggggagt aggcatccgc 4260gccgcaggcc ccgcagacgg tctcgcattc cacgagccag gtgagctctg gccgttcggg 4320gtcaaaaacc aggtttcccc catgcttttt gatgcgtttc ttacctctgg tttccatgag 4380ccggtgtcca cgctcggtga cgaaaaggct gtccgtgtcc ccgtatacag acttgagagg 4440cctgtcctcg agcggtgttc cgcggtcctc ctcgtataga aactcggacc actctgagac 4500aaaggctcgc gtccaggcca gcacgaagga ggctaagtgg gaggggtagc ggtcgttgtc 4560cactaggggg tccactcgct ccagggtgtg aagacacatg tcgccctctt cggcatcaag 4620gaaggtgatt ggtttgtagg tgtaggccac gtgaccgggt gttcctgaag gggggctata 4680aaagggggtg ggggcgcgtt cgtcctcact ctcttccgca tcgctgtctg cgagggccag 4740ctgttggggt gagtactccc tctgaaaagc gggcatgact tctgcgctaa gattgtcagt 4800ttccaaaaac gaggaggatt tgatattcac ctggcccgcg gtgatgcctt tgagggtggc 4860cgcatccatc tggtcagaaa agacaatctt tttgttgtca agcttggtgg caaacgaccc 4920gtagagggcg ttggacagca acttggcgat ggagcgcagg gtttggtttt tgtcgcgatc 4980ggcgcgctcc ttggccgcga tgtttagctg cacgtattcg cgcgcaacgc accgccattc 5040gggaaagacg gtggtgcgct cgtcgggcac caggtgcacg cgccaaccgc ggttgtgcag 5100ggtgacaagg tcaacgctgg tggctacctc tccgcgtagg cgctcgttgg tccagcagag 5160gcggccgccc ttgcgcgagc agaatggcgg tagggggtct agctgcgtct cgtccggggg 5220gtctgcgtcc acggtaaaga ccccgggcag caggcgcgcg tcgaagtagt ctatcttgca 5280tccttgcaag tctagcgcct gctgccatgc gcgggcggca agcgcgcgct cgtatgggtt 5340gagtggggga ccccatggca tggggtgggt gagcgcggag gcgtacatgc cgcaaatgtc 5400gtaaacgtag aggggctctc tgagtattcc aagatatgta gggtagcatc ttccaccgcg 5460gatgctggcg cgcacgtaat cgtatagttc gtgcgaggga gcgaggaggt cgggaccgag 5520gttgctacgg gcgggctgct ctgctcggaa gactatctgc ctgaagatgg catgtgagtt 5580ggatgatatg gttggacgct ggaagacgtt gaagctggcg tctgtgagac ctaccgcgtc 5640acgcacgaag gaggcgtagg agtcgcgcag cttgttgacc agctcggcgg tgacctgcac 5700gtctagggcg cagtagtcca gggtttcctt gatgatgtca tacttatcct gtcccttttt 5760tttccacagc tcgcggttga ggacaaactc ttcgcggtct ttccagtact cttggatcgg 5820aaacccgtcg gcctccgaac ggtaagagcc tagcatgtag aactggttga cggcctggta 5880ggcgcagcat cccttttcta cgggtagcgc gtatgcctgc gcggccttcc ggagcgaggt 5940gtgggtgagc gcaaaggtgt ccctgaccat gactttgagg tactggtatt tgaagtcagt 6000gtcgtcgcat ccgccctgct cccagagcaa aaagtccgtg cgctttttgg aacgcggatt 6060tggcagggcg aaggtgacat cgttgaagag tatctttccc gcgcgaggca taaagttgcg 6120tgtgatgcgg aagggtcccg gcacctcgga acggttgtta attacctggg cggcgagcac 6180gatctcgtca aagccgttga tgttgtggcc cacaatgtaa agttccaaga agcgcgggat 6240gcccttgatg gaaggcaatt ttttaagttc ctcgtaggtg agctcttcag gggagctgag 6300cccgtgctct gaaagggccc agtctgcaag atgagggttg gaagcgacga atgagctcca 6360caggtcacgg gccattagca tttgcaggtg gtcgcgaaag gtcctaaact ggcgacctat 6420ggccattttt tctggggtga tgcagtagaa ggtaagcggg tcttgttccc agcggtccca 6480tccaaggttc gcggctaggt ctcgcgcggc agtcactaga ggctcatctc cgccgaactt 6540catgaccagc atgaagggca cgagctgctt cccaaaggcc cccatccaag tataggtctc 6600tacatcgtag gtgacaaaga gacgctcggt gcgaggatgc gagccgatcg ggaagaactg 6660gatctcccgc caccaattgg aggagtggct attgatgtgg tgaaagtaga agtccctgcg 6720acgggccgaa cactcgtgct ggcttttgta aaaacgtgcg cagtactggc agcggtgcac 6780gggctgtaca tcctgcacga ggttgacctg acgaccgcgc acaaggaagc agagtgggaa 6840tttgagcccc tcgcctggcg ggtttggctg gtggtcttct acttcggctg cttgtccttg 6900accgtctggc tgctcgaggg gagttacggt ggatcggacc accacgccgc gcgagcccaa 6960agtccagatg tccgcgcgcg gcggtcggag cttgatgaca acatcgcgca gatgggagct 7020gtccatggtc tggagctccc gcggcgtcag gtcaggcggg agctcctgca ggtttacctc 7080gcatagacgg gtcagggcgc gggctagatc caggtgatac ctaatttcca ggggctggtt 7140ggtggcggcg tcgatggctt gcaagaggcc gcatccccgc ggcgcgacta cggtaccgcg 7200cggcgggcgg tgggccgcgg gggtgtcctt ggatgatgca tctaaaagcg gtgacgcggg 7260cgagcccccg gaggtagggg gggctccgga cccgccggga gagggggcag gggcacgtcg 7320gcgccgcgcg cgggcaggag ctggtgctgc gcgcgtaggt tgctggcgaa cgcgacgacg 7380cggcggttga tctcctgaat ctggcgcctc tgcgtgaaga cgacgggccc ggtgagcttg 7440aacctgaaag agagttcgac agaatcaatt tcggtgtcgt tgacggcggc ctggcgcaaa 7500atctcctgca cgtctcctga gttgtcttga taggcgatct cggccatgaa ctgctcgatc 7560tcttcctcct ggagatctcc gcgtccggct cgctccacgg tggcggcgag gtcgttggaa 7620atgcgggcca tgagctgcga gaaggcgttg aggcctccct cgttccagac gcggctgtag 7680accacgcccc cttcggcatc gcgggcgcgc atgaccacct gcgcgagatt gagctccacg 7740tgccgggcga agacggcgta gtttcgcagg cgctgaaaga ggtagttgag ggtggtggcg 7800gtgtgttctg ccacgaagaa gtacataacc cagcgtcgca acgtggattc gttgatatcc 7860cccaaggcct caaggcgctc catggcctcg tagaagtcca cggcgaagtt gaaaaactgg 7920gagttgcgcg ccgacacggt taactcctcc tccagaagac ggatgagctc ggcgacagtg 7980tcgcgcacct cgcgctcaaa ggctacaggg gcctcttctt cttcttcaat ctcctcttcc 8040ataagggcct ccccttcttc ttcttctggc ggcggtgggg gaggggggac acggcggcga 8100cgacggcgca ccgggaggcg gtcgacaaag cgctcgatca tctccccgcg gcgacggcgc 8160atggtctcgg tgacggcgcg gccgttctcg cgggggcgca gttggaagac gccgcccgtc 8220atgtcccggt tatgggttgg cggggggctg ccatgcggca gggatacggc gctaacgatg 8280catctcaaca attgttgtgt aggtactccg ccgccgaggg acctgagcga gtccgcatcg 8340accggatcgg aaaacctctc gagaaaggcg tctaaccagt cacagtcgca aggtaggctg 8400agcaccgtgg cgggcggcag cgggcggcgg tcggggttgt ttctggcgga ggtgctgctg 8460atgatgtaat taaagtaggc ggtcttgaga cggcggatgg tcgacagaag caccatgtcc 8520ttgggtccgg cctgctgaat gcgcaggcgg tcggccatgc cccaggcttc gttttgacat 8580cggcgcaggt ctttgtagta gtcttgcatg agcctttcta ccggcacttc ttcttctcct 8640tcctcttgtc ctgcatctct tgcatctatc gctgcggcgg cggcggagtt tggccgtagg 8700tggcgccctc ttcctcccat gcgtgtgacc ccgaagcccc tcatcggctg aagcagggct 8760aggtcggcga caacgcgctc ggctaatatg gcctgctgca cctgcgtgag ggtagactgg 8820aagtcatcca tgtccacaaa gcggtggtat gcgcccgtgt tgatggtgta agtgcagttg 8880gccataacgg accagttaac ggtctggtga cccggctgcg agagctcggt gtacctgaga 8940cgcgagtaag ccctcgagtc aaatacgtag tcgttgcaag tccgcaccag gtactggtat 9000cccaccaaaa agtgcggcgg cggctggcgg tagaggggcc agcgtagggt ggccggggct 9060ccgggggcga gatcttccaa cataaggcga tgatatccgt agatgtacct ggacatccag 9120gtgatgccgg cggcggtggt ggaggcgcgc ggaaagtcgc ggacgcggtt ccagatgttg 9180cgcagcggca aaaagtgctc catggtcggg acgctctggc cggtcaggcg cgcgcaatcg 9240ttgacgctct agaccgtgca aaaggagagc ctgtaagcgg gcactcttcc gtggtctggt 9300ggataaattc gcaagggtat catggcggac gaccggggtt cgagccccgt atccggccgt 9360ccgccgtgat ccatgcggtt accgcccgcg tgtcgaaccc aggtgtgcga cgtcagacaa 9420cgggggagtg ctccttttgg cttccttcca ggcgcggcgg ctgctgcgct agcttttttg 9480gccactggcc gcgcgcagcg taagcggtta ggctggaaag cgaaagcatt aagtggctcg 9540ctccctgtag ccggagggtt attttccaag ggttgagtcg cgggaccccc ggttcgagtc 9600tcggaccggc cggactgcgg cgaacggggg tttgcctccc cgtcatgcaa gaccccgctt 9660gcaaattcct ccggaaacag ggacgagccc cttttttgct tttcccagat gcatccggtg 9720ctgcggcaga tgcgcccccc tcctcagcag cggcaagagc aagagcagcg gcagacatgc 9780agggcaccct cccctcctcc taccgcgtca ggaggggcga catccgcggt tgacgcggca 9840gcagatggtg attacgaacc cccgcggcgc cgggcccggc actacctgga cttggaggag 9900ggcgagggcc tggcgcggct aggagcgccc tctcctgagc ggcacccaag ggtgcagctg 9960aagcgtgata cgcgtgaggc gtacgtgccg cggcagaacc tgtttcgcga ccgcgaggga 10020gaggagcccg aggagatgcg ggatcgaaag ttccacgcag ggcgcgagct gcggcatggc 10080ctgaatcgcg agcggttgct gcgcgaggag gactttgagc ccgacgcgcg aaccgggatt 10140agtcccgcgc gcgcacacgt ggcggccgcc gacctggtaa ccgcatacga gcagacggtg 10200aaccaggaga ttaactttca aaaaagcttt aacaaccacg tgcgtacgct tgtggcgcgc 10260gaggaggtgg ctataggact gatgcatctg tgggactttg taagcgcgct ggagcaaaac 10320ccaaatagca agccgctcat ggcgcagctg ttccttatag tgcagcacag cagggacaac 10380gaggcattca gggatgcgct gctaaacata gtagagcccg agggccgctg gctgctcgat 10440ttgataaaca tcctgcagag catagtggtg caggagcgca gcttgagcct ggctgacaag 10500gtggccgcca tcaactattc catgcttagc ctgggcaagt tttacgcccg caagatatac 10560catacccctt acgttcccat agacaaggag gtaaagatcg aggggttcta catgcgcatg 10620gcgctgaagg tgcttacctt gagcgacgac ctgggcgttt atcgcaacga gcgcatccac 10680aaggccgtga gcgtgagccg gcggcgcgag ctcagcgacc gcgagctgat gcacagcctg 10740caaagggccc tggctggcac gggcagcggc gatagagagg ccgagtccta ctttgacgcg 10800ggcgctgacc tgcgctgggc cccaagccga cgcgccctgg aggcagctgg ggccggacct 10860gggctggcgg tggcacccgc gcgcgctggc aacgtcggcg gcgtggagga atatgacgag 10920gacgatgagt acgagccaga ggacggcgag tactaagcgg tgatgtttct gatcagatga 10980tgcaagacgc aacggacccg gcggtgcggg cggcgctgca gagccagccg tccggcctta 11040actccacgga cgactggcgc caggtcatgg accgcatcat gtcgctgact gcgcgcaatc 11100ctgacgcgtt ccggcagcag ccgcaggcca accggctctc cgcaattctg gaagcggtgg 11160tcccggcgcg cgcaaacccc acgcacgaga aggtgctggc gatcgtaaac gcgctggccg 11220aaaacagggc catccggccc gacgaggccg gcctggtcta cgacgcgctg cttcagcgcg 11280tggctcgtta caacagcggc aacgtgcaga ccaacctgga ccggctggtg ggggatgtgc 11340gcgaggccgt ggcgcagcgt gagcgcgcgc agcagcaggg caacctgggc tccatggttg 11400cactaaacgc cttcctgagt acacagcccg ccaacgtgcc gcggggacag gaggactaca 11460ccaactttgt gagcgcactg cggctaatgg tgactgagac accgcaaagt gaggtgtacc 11520agtctgggcc agactatttt ttccagacca gtagacaagg cctgcagacc gtaaacctga 11580gccaggcttt caaaaacttg caggggctgt ggggggtgcg ggctcccaca ggcgaccgcg 11640cgaccgtgtc tagcttgctg acgcccaact cgcgcctgtt gctgctgcta atagcgccct 11700tcacggacag tggcagcgtg tcccgggaca catacctagg tcacttgctg acactgtacc 11760gcgaggccat aggtcaggcg catgtggacg agcatacttt ccaggagatt acaagtgtca 11820gccgcgcgct ggggcaggag gacacgggca gcctggaggc aaccctaaac tacctgctga 11880ccaaccggcg gcagaagatc ccctcgttgc acagtttaaa cagcgaggag gagcgcattt 11940tgcgctacgt gcagcagagc gtgagcctta acctgatgcg cgacggggta acgcccagcg 12000tggcgctgga catgaccgcg cgcaacatgg aaccgggcat gtatgcctca aaccggccgt 12060ttatcaaccg cctaatggac tacttgcatc gcgcggccgc cgtgaacccc gagtatttca 12120ccaatgccat cttgaacccg cactggctac cgccccctgg tttctacacc gggggattcg 12180aggtgcccga gggtaacgat ggattcctct gggacgacat agacgacagc gtgttttccc 12240cgcaaccgca gaccctgcta gagttgcaac agcgcgagca ggcagaggcg gcgctgcgaa 12300aggaaagctt ccgcaggcca agcagcttgt ccgatctagg cgctgcggcc ccgcggtcag 12360atgctagtag cccatttcca agcttgatag ggtctcttac cagcactcgc accacccgcc 12420cgcgcctgct gggcgaggag gagtacctaa acaactcgct gctgcagccg cagcgcgaaa 12480aaaacctgcc tccggcattt cccaacaacg ggatagagag cctagtggac aagatgagta 12540gatggaagac gtacgcgcag gagcacaggg acgtgccagg cccgcgcccg cccacccgtc 12600gtcaaaggca cgaccgtcag cggggtctgg tgtgggagga cgatgactcg gcagacgaca 12660gcagcgtcct ggatttggga gggagtggca acccgtttgc gcaccttcgc cccaggctgg 12720ggagaatgtt ttaaaaaaaa aaaaagcatg atgcaaaata aaaaactcac caaggccatg 12780gcaccgagcg ttggttttct tgtattcccc ttagtatgcg gcgcgcggcg atgtatgagg 12840aaggtcctcc tccctcctac gagagtgtgg tgagcgcggc gccagtggcg gcggcgctgg 12900gttctccctt cgatgctccc ctggacccgc cgtttgtgcc tccgcggtac ctgcggccta 12960ccggggggag aaacagcatc cgttactctg agttggcacc cctattcgac accacccgtg 13020tgtacctggt ggacaacaag tcaacggatg tggcatccct gaactaccag aacgaccaca 13080gcaactttct gaccacggtc attcaaaaca atgactacag cccgggggag gcaagcacac 13140agaccatcaa tcttgacgac cggtcgcact ggggcggcga cctgaaaacc atcctgcata 13200ccaacatgcc aaatgtgaac gagttcatgt ttaccaataa gtttaaggcg cgggtgatgg 13260tgtcgcgctt gcctactaag gacaatcagg tggagctgaa atacgagtgg gtggagttca 13320cgctgcccga gggcaactac tccgagacca tgaccataga ccttatgaac aacgcgatcg 13380tggagcacta cttgaaagtg ggcagacaga acggggttct ggaaagcgac atcggggtaa 13440agtttgacac ccgcaacttc agactggggt ttgaccccgt cactggtctt gtcatgcctg 13500gggtatatac aaacgaagcc ttccatccag acatcatttt gctgccagga tgcggggtgg 13560acttcaccca cagccgcctg agcaacttgt tgggcatccg caagcggcaa cccttccagg 13620agggctttag gatcacctac gatgatctgg agggtggtaa cattcccgca ctgttggatg 13680tggacgccta ccaggcgagc ttgaaagatg acaccgaaca gggcgggggt ggcgcaggcg 13740gcagcaacag cagtggcagc ggcgcggaag agaactccaa cgcggcagcc gcggcaatgc 13800agccggtgga ggacatgaac gatcatgcca ttcgcggcga cacctttgcc acacgggctg 13860aggagaagcg cgctgaggcc gaagcagcgg ccgaagctgc cgcccccgct gcgcaacccg 13920aggtcgagaa gcctcagaag aaaccggtga tcaaacccct gacagaggac agcaagaaac 13980gcagttacaa cctaataagc aatgacagca ccttcaccca gtaccgcagc tggtaccttg 14040catacaacta cggcgaccct cagaccggaa tccgctcatg gaccctgctt tgcactcctg 14100acgtaacctg cggctcggag caggtctact ggtcgttgcc agacatgatg caagaccccg 14160tgaccttccg ctccacgcgc cagatcagca actttccggt ggtgggcgcc gagctgttgc 14220ccgtgcactc caagagcttc tacaacgacc aggccgtcta ctcccaactc atccgccagt 14280ttacctctct gacccacgtg ttcaatcgct ttcccgagaa ccagattttg gcgcgcccgc 14340cagcccccac catcaccacc gtcagtgaaa acgttcctgc tctcacagat cacgggacgc 14400taccgctgcg caacagcatc ggaggagtcc agcgagtgac cattactgac gccagacgcc 14460gcacctgccc ctacgtttac aaggccctgg gcatagtctc gccgcgcgtc ctatcgagcc 14520gcactttttg agcaagcatg tccatcctta tatcgcccag caataacaca ggctggggcc 14580tgcgcttccc aagcaagatg tttggcgggg ccaagaagcg ctccgaccaa cacccagtgc 14640gcgtgcgcgg gcactaccgc gcgccctggg gcgcgcacaa acgcggccgc actgggcgca 14700ccaccgtcga tgacgccatc gacgcggtgg tggaggaggc gcgcaactac acgcccacgc 14760cgccaccagt gtccacagtg gacgcggcca ttcagaccgt ggtgcgcgga gcccggcgct 14820atgctaaaat gaagagacgg cggaggcgcg tagcacgtcg ccaccgccgc cgacccggca 14880ctgccgccca acgcgcggcg gcggccctgc ttaaccgcgc acgtcgcacc ggccgacggg 14940cggccatgcg ggccgctcga aggctggccg cgggtattgt cactgtgccc cccaggtcca 15000ggcgacgagc ggccgccgca gcagccgcgg ccattagtgc tatgactcag ggtcgcaggg 15060gcaacgtgta ttgggtgcgc gactcggtta gcggcctgcg cgtgcccgtg cgcacccgcc 15120ccccgcgcaa ctagattgca agaaaaaact acttagactc gtactgttgt atgtatccag 15180cggcggcggc gcgcaacgaa gctatgtcca agcgcaaaat caaagaagag atgctccagg 15240tcatcgcgcc ggagatctat ggccccccga agaaggaaga gcaggattac aagccccgaa 15300agctaaagcg ggtcaaaaag aaaaagaaag atgatgatga tgaacttgac gacgaggtgg 15360aactgctgca cgctaccgcg cccaggcgac gggtacagtg gaaaggtcga cgcgtaaaac 15420gtgttttgcg acccggcacc accgtagtct ttacgcccgg tgagcgctcc acccgcacct 15480acaagcgcgt gtatgatgag gtgtacggcg acgaggacct gcttgagcag gccaacgagc 15540gcctcgggga gtttgcctac ggaaagcggc ataaggacat gctggcgttg ccgctggacg 15600agggcaaccc aacacctagc ctaaagcccg taacactgca gcaggtgctg cccgcgcttg 15660caccgtccga agaaaagcgc ggcctaaagc gcgagtctgg tgacttggca cccaccgtgc 15720agctgatggt acccaagcgc cagcgactgg aagatgtctt ggaaaaaatg accgtggaac 15780ctgggctgga gcccgaggtc cgcgtgcggc caatcaagca ggtggcgccg ggactgggcg 15840tgcagaccgt ggacgttcag atacccacta ccagtagcac cagtattgcc accgccacag 15900agggcatgga gacacaaacg tccccggttg cctcagcggt ggcggatgcc gcggtgcagg 15960cggtcgctgc ggccgcgtcc aagacctcta cggaggtgca aacggacccg tggatgtttc 16020gcgtttcagc cccccggcgc ccgcgccgtt cgaggaagta cggcgccgcc agcgcgctac 16080tgcccgaata tgccctacat ccttccattg cgcctacccc cggctatcgt ggctacacct 16140accgccccag aagacgagca actacccgac gccgaaccac cactggaacc cgccgccgcc 16200gtcgccgtcg ccagcccgtg ctggccccga tttccgtgcg cagggtggct cgcgaaggag 16260gcaggaccct ggtgctgcca acagcgcgct accaccccag catcgtttaa aagccggtct 16320ttgtggttct tgcagatatg gccctcacct gccgcctccg tttcccggtg ccgggattcc 16380gaggaagaat gcaccgtagg aggggcatgg ccggccacgg cctgacgggc ggcatgcgtc 16440gtgcgcacca ccggcggcgg cgcgcgtcgc accgtcgcat gcgcggcggt atcctgcccc 16500tccttattcc actgatcgcc gcggcgattg gcgccgtgcc cggaattgca tccgtggcct 16560tgcaggcgca gagacactga ttaaaaacaa gttgcatgtg gaaaaatcaa aataaaaagt 16620ctggactctc acgctcgctt ggtcctgtaa ctattttgta gaatggaaga catcaacttt 16680gcgtctctgg ccccgcgaca cggctcgcgc ccgttcatgg gaaactggca agatatcggc 16740accagcaata tgagcggtgg cgccttcagc tggggctcgc tgtggagcgg cattaaaaat 16800ttcggttcca ccgttaagaa ctatggcagc aaggcctgga acagcagcac aggccagatg 16860ctgagggata agttgaaaga gcaaaatttc caacaaaagg tggtagatgg cctggcctct 16920ggcattagcg gggtggtgga cctggccaac caggcagtgc aaaataagat taacagtaag 16980cttgatcccc gccctcccgt agaggagcct ccaccggccg tggagacagt gtctccagag 17040gggcgtggcg aaaagcgtcc gcgccccgac agggaagaaa ctctggtgac gcaaatagac 17100gagcctccct cgtacgagga ggcactaaag caaggcctgc ccaccacccg tcccatcgcg 17160cccatggcta ccggagtgct gggccagcac acacccgtaa cgctggacct gcctcccccc 17220gccgacaccc agcagaaacc tgtgctgcca ggcccgaccg ccgttgttgt aacccgtcct 17280agccgcgcgt ccctgcgccg cgccgccagc ggtccgcgat cgttgcggcc cgtagccagt 17340ggcaactggc aaagcacact gaacagcatc gtgggtctgg gggtgcaatc cctgaagcgc 17400cgacgatgct tctgatagct aacgtgtcgt atgtgtgtca tgtatgcgtc catgtcgccg 17460ccagaggagc tgctgagccg ccgcgcgccc gctttccaag atggctaccc cttcgatgat 17520gccgcagtgg tcttacatgc acatctcggg ccaggacgcc tcggagtacc tgagccccgg 17580gctggtgcag tttgcccgcg ccaccgagac gtacttcagc ctgaataaca agtttagaaa 17640ccccacggtg gcgcctacgc acgacgtgac cacagaccgg tcccagcgtt tgacgctgcg 17700gttcatccct gtggaccgtg aggatactgc gtactcgtac aaggcgcggt tcaccctagc 17760tgtgggtgat aaccgtgtgc tggacatggc ttccacgtac tttgacatcc gcggcgtgct 17820ggacaggggc cctactttta agccctactc tggcactgcc tacaacgccc tggctcccaa 17880gggtgcccca aatccttgcg aatgggatga agctgctact gctcttgaaa taaacctaga 17940agaagaggac gatgacaacg aagacgaagt agacgagcaa gctgagcagc aaaaaactca 18000cgtatttggg caggcgcctt attctggtat aaatattaca aaggagggta ttcaaatagg 18060tgtcgaaggt caaacaccta aatatgccga taaaacattt caacctgaac ctcaaatagg 18120agaatctcag tggtacgaaa cagaaattaa tcatgcagct gggagagtcc taaaaaagac 18180taccccaatg aaaccatgtt acggttcata tgcaaaaccc acaaatgaaa atggagggca 18240aggcattctt gtaaagcaac aaaatggaaa gctagaaagt caagtggaaa tgcaattttt 18300ctcaactact gaggcagccg caggcaatgg tgataacttg actcctaaag tggtattgta 18360cagtgaagat gtagatatag aaaccccaga cactcatatt tcttacatgc ccactattaa 18420ggaaggtaac tcacgagaac taatgggcca acaatctatg cccaacaggc ctaattacat 18480tgcttttagg gacaatttta ttggtctaat gtattacaac agcacgggta atatgggtgt 18540tctggcgggc caagcatcgc agttgaatgc tgttgtagat ttgcaagaca gaaacacaga 18600gctttcatac cagcttttgc ttgattccat tggtgataga accaggtact tttctatgtg 18660gaatcaggct gttgacagct atgatccaga tgttagaatt attgaaaatc atggaactga 18720agatgaactt ccaaattact gctttccact gggaggtgtg attaatacag agactcttac 18780caaggtaaaa cctaaaacag gtcaggaaaa tggatgggaa aaagatgcta cagaattttc 18840agataaaaat gaaataagag ttggaaataa ttttgccatg gaaatcaatc taaatgccaa 18900cctgtggaga aatttcctgt actccaacat agcgctgtat ttgcccgaca agctaaagta 18960cagtccttcc aacgtaaaaa tttctgataa cccaaacacc tacgactaca tgaacaagcg 19020agtggtggct cccgggctag tggactgcta cattaacctt ggagcacgct ggtcccttga 19080ctatatggac aacgtcaacc catttaacca ccaccgcaat gctggcctgc gctaccgctc 19140aatgttgctg ggcaatggtc gctatgtgcc cttccacatc caggtgcctc agaagttctt 19200tgccattaaa aacctccttc tcctgccggg ctcatacacc tacgagtgga acttcaggaa 19260ggatgttaac atggttctgc agagctccct aggaaatgac ctaagggttg acggagccag 19320cattaagttt gatagcattt gcctttacgc caccttcttc cccatggccc acaacaccgc 19380ctccacgctt gaggccatgc ttagaaacga caccaacgac cagtccttta acgactatct 19440ctccgccgcc aacatgctct accctatacc cgccaacgct accaacgtgc ccatatccat 19500cccctcccgc aactgggcgg ctttccgcgg ctgggccttc acgcgcctta agactaagga 19560aaccccatca ctgggctcgg gctacgaccc ttattacacc tactctggct ctatacccta 19620cctagatgga accttttacc tcaaccacac ctttaagaag gtggccatta cctttgactc 19680ttctgtcagc tggcctggca atgaccgcct gcttaccccc aacgagtttg aaattaagcg 19740ctcagttgac ggggagggtt acaacgttgc ccagtgtaac atgaccaaag actggttcct 19800ggtacaaatg ctagctaact ataacattgg ctaccagggc ttctatatcc cagagagcta 19860caaggaccgc atgtactcct tctttagaaa cttccagccc atgagccgtc aggtggtgga 19920tgatactaaa tacaaggact accaacaggt gggcatccta caccaacaca acaactctgg 19980atttgttggc taccttgccc ccaccatgcg cgaaggacag gcctaccctg ctaacttccc 20040ctatccgctt ataggcaaga ccgcagttga cagcattacc cagaaaaagt ttctttgcga 20100tcgcaccctt tggcgcatcc cattctccag taactttatg tccatgggcg cactcacaga 20160cctgggccaa aaccttctct acgccaactc cgcccacgcg ctagacatga cttttgaggt 20220ggatcccatg gacgagccca cccttcttta tgttttgttt gaagtctttg acgtggtccg 20280tgtgcaccag ccgcaccgcg gcgtcatcga aaccgtgtac ctgcgcacgc ccttctcggc 20340cggcaacgcc acaacataaa gaagcaagca acatcaacaa cagctgccgc catgggctcc 20400agtgagcagg aactgaaagc cattgtcaaa gatcttggtt gtgggccata ttttttgggc 20460acctatgaca agcgctttcc aggctttgtt tctccacaca agctcgcctg cgccatagtc 20520aatacggccg gtcgcgagac tgggggcgta cactggatgg cctttgcctg gaacccgcac 20580tcaaaaacat gctacctctt tgagcccttt ggcttttctg accagcgact caagcaggtt 20640taccagtttg agtacgagtc actcctgcgc cgtagcgcca ttgcttcttc ccccgaccgc 20700tgtataacgc tggaaaagtc cacccaaagc gtacaggggc ccaactcggc cgcctgtgga 20760ctattctgct gcatgtttct ccacgccttt gccaactggc cccaaactcc catggatcac 20820aaccccacca tgaaccttat taccggggta cccaactcca tgctcaacag tccccaggta 20880cagcccaccc tgcgtcgcaa ccaggaacag ctctacagct tcctggagcg ccactcgccc 20940tacttccgca gccacagtgc gcagattagg agcgccactt ctttttgtca cttgaaaaac 21000atgtaaaaat aatgtactag agacactttc aataaaggca aatgctttta tttgtacact 21060ctcgggtgat tatttacccc cacccttgcc gtctgcgccg tttaaaaatc aaaggggttc 21120tgccgcgcat cgctatgcgc cactggcagg gacacgttgc gatactggtg tttagtgctc 21180cacttaaact caggcacaac catccgcggc agctcggtga agttttcact ccacaggctg 21240cgcaccatca ccaacgcgtt tagcaggtcg ggcgccgata tcttgaagtc gcagttgggg 21300cctccgccct gcgcgcgcga gttgcgatac acagggttgc agcactggaa cactatcagc 21360gccgggtggt gcacgctggc cagcacgctc ttgtcggaga tcagatccgc gtccaggtcc 21420tccgcgttgc tcagggcgaa cggagtcaac tttggtagct gccttcccaa aaagggcgcg 21480tgcccaggct ttgagttgca ctcgcaccgt agtggcatca aaaggtgacc gtgcccggtc 21540tgggcgttag gatacagcgc ctgcataaaa gccttgatct gcttaaaagc cacctgagcc 21600tttgcgcctt cagagaagaa catgccgcaa gacttgccgg aaaactgatt ggccggacag 21660gccgcgtcgt gcacgcagca ccttgcgtcg gtgttggaga tctgcaccac atttcggccc 21720caccggttct tcacgatctt ggccttgcta gactgctcct tcagcgcgcg ctgcccgttt 21780tcgctcgtca catccatttc aatcacgtgc tccttattta tcataatgct tccgtgtaga 21840cacttaagct cgccttcgat ctcagcgcag cggtgcagcc acaacgcgca gcccgtgggc 21900tcgtgatgct tgtaggtcac ctctgcaaac gactgcaggt acgcctgcag gaatcgcccc 21960atcatcgtca caaaggtctt gttgctggtg aaggtcagct gcaacccgcg gtgctcctcg 22020ttcagccagg tcttgcatac ggccgccaga gcttccactt ggtcaggcag tagtttgaag 22080ttcgccttta gatcgttatc cacgtggtac ttgtccatca gcgcgcgcgc agcctccatg 22140cccttctccc acgcagacac gatcggcaca ctcagcgggt tcatcaccgt aatttcactt 22200tccgcttcgc tgggctcttc ctcttcctct tgcgtccgca taccacgcgc cactgggtcg 22260tcttcattca gccgccgcac tgtgcgctta cctcctttgc catgcttgat tagcaccggt 22320gggttgctga aacccaccat ttgtagcgcc acatcttctc tttcttcctc gctgtccacg 22380attacctctg gtgatggcgg gcgctcgggc ttgggagaag ggcgcttctt tttcttcttg 22440ggcgcaatgg ccaaatccgc cgccgaggtc gatggccgcg ggctgggtgt gcgcggcacc 22500agcgcgtctt gtgatgagtc ttcctcgtcc tcggactcga tacgccgcct catccgcttt 22560tttgggggcg cccggggagg cggcggcgac ggggacgggg acgacacgtc ctccatggtt 22620gggggacgtc gcgccgcacc gcgtccgcgc tcgggggtgg tttcgcgctg ctcctcttcc 22680cgactggcca tttccttctc ctataggcag aaaaagatca tggagtcagt cgagaagaag 22740gacagcctaa ccgccccctc tgagttcgcc accaccgcct ccaccgatgc cgccaacgcg 22800cctaccacct tccccgtcga ggcacccccg cttgaggagg aggaagtgat tatcgagcag 22860gacccaggtt ttgtaagcga agacgacgag gaccgctcag taccaacaga ggataaaaag 22920caagaccagg acaacgcaga ggcaaacgag gaacaagtcg ggcgggggga cgaaaggcat 22980ggcgactacc tagatgtggg agacgacgtg ctgttgaagc atctgcagcg ccagtgcgcc 23040attatctgcg acgcgttgca agagcgcagc gatgtgcccc tcgccatagc ggatgtcagc 23100cttgcctacg aacgccacct attctcaccg cgcgtacccc ccaaacgcca agaaaacggc 23160acatgcgagc ccaacccgcg cctcaacttc taccccgtat ttgccgtgcc agaggtgctt 23220gccacctatc acatcttttt ccaaaactgc aagatacccc tatcctgccg tgccaaccgc 23280agccgagcgg acaagcagct ggccttgcgg cagggcgctg tcatacctga tatcgcctcg 23340ctcaacgaag tgccaaaaat ctttgagggt cttggacgcg acgagaagcg cgcggcaaac 23400gctctgcaac aggaaaacag cgaaaatgaa agtcactctg gagtgttggt ggaactcgag 23460ggtgacaacg cgcgcctagc cgtactaaaa cgcagcatcg aggtcaccca ctttgcctac 23520ccggcactta acctaccccc caaggtcatg agcacagtca tgagtgagct gatcgtgcgc 23580cgtgcgcagc ccctggagag ggatgcaaat ttgcaagaac aaacagagga gggcctaccc 23640gcagttggcg acgagcagct agcgcgctgg cttcaaacgc gcgagcctgc cgacttggag 23700gagcgacgca aactaatgat ggccgcagtg ctcgttaccg tggagcttga gtgcatgcag 23760cggttctttg ctgacccgga gatgcagcgc aagctagagg aaacattgca ctacaccttt 23820cgacagggct acgtacgcca ggcctgcaag atctccaacg tggagctctg caacctggtc 23880tcctaccttg gaattttgca cgaaaaccgc cttgggcaaa acgtgcttca ttccacgctc 23940aagggcgagg cgcgccgcga ctacgtccgc gactgcgttt acttatttct atgctacacc 24000tggcagacgg ccatgggcgt ttggcagcag tgcttggagg agtgcaacct caaggagctg 24060cagaaactgc taaagcaaaa cttgaaggac ctatggacgg ccttcaacga gcgctccgtg 24120gccgcgcacc tggcggacat cattttcccc gaacgcctgc ttaaaaccct gcaacagggt 24180ctgccagact tcaccagtca aagcatgttg cagaacttta ggaactttat cctagagcgc 24240tcaggaatct tgcccgccac ctgctgtgca cttcctagcg actttgtgcc cattaagtac 24300cgcgaatgcc ctccgccgct ttggggccac tgctaccttc tgcagctagc caactacctt 24360gcctaccact ctgacataat ggaagacgtg agcggtgacg gtctactgga gtgtcactgt 24420cgctgcaacc tatgcacccc gcaccgctcc ctggtttgca attcgcagct gcttaacgaa 24480agtcaaatta tcggtacctt tgagctgcag ggtccctcgc ctgacgaaaa gtccgcggct 24540ccggggttga aactcactcc ggggctgtgg acgtcggctt accttcgcaa atttgtacct 24600gaggactacc acgcccacga gattaggttc tacgaagacc aatcccgccc gcctaatgcg 24660gagcttaccg cctgcgtcat tacccagggc cacattcttg gccaattgca agccatcaac 24720aaagcccgcc aagagtttct gctacgaaag ggacgggggg tttacttgga cccccagtcc 24780ggcgaggagc tcaacccaat ccccccgccg ccgcagccct atcagcagca gccgcgggcc 24840cttgcttccc aggatggcac ccaaaaagaa gctgcagctg ccgccgccac ccacggacga 24900ggaggaatac tgggacagtc aggcagagga ggttttggac gaggaggagg aggacatgat 24960ggaagactgg gagagcctag acgaggaagc ttccgaggtc gaagaggtgt cagacgaaac 25020accgtcaccc tcggtcgcat tcccctcgcc ggcgccccag aaatcggcaa ccggttccag 25080catggctaca acctccgctc ctcaggcgcc gccggcactg cccgttcgcc gacccaaccg 25140tagatgggac accactggaa ccagggccgg taagtccaag cagccgccgc cgttagccca 25200agagcaacaa cagcgccaag gctaccgctc atggcgcggg cacaagaacg ccatagttgc 25260ttgcttgcaa gactgtgggg gcaacatctc cttcgcccgc cgctttcttc tctaccatca 25320cggcgtggcc ttcccccgta acatcctgca ttactaccgt catctctaca gcccatactg 25380caccggcggc agcggcagca acagcagcgg ccacacagaa gcaaaggcga ccggatagca 25440agactctgac aaagcccaag aaatccacag cggcggcagc agcaggagga ggagcgctgc 25500gtctggcgcc caacgaaccc gtatcgaccc gcgagcttag aaacaggatt tttcccactc 25560tgtatgctat atttcaacag agcaggggcc aagaacaaga gctgaaaata aaaaacaggt 25620ctctgcgatc cctcacccgc agctgcctgt atcacaaaag cgaagatcag cttcggcgca 25680cgctggaaga cgcggaggct ctcttcagta aatactgcgc gctgactctt aaggactagt 25740ttcgcgccct ttctcaaatt taagcgcgaa aactacgtca tctccagcgg ccacacccgg 25800cgccagcacc tgttgtcagc gccattatga gcaaggaaat tcccacgccc tacatgtgga 25860gttaccagcc acaaatggga cttgcggctg gagctgccca agactactca acccgaataa 25920actacatgag cgcgggaccc cacatgatat cccgggtcaa cggaatacgc gcccaccgaa 25980accgaattct cctggaacag gcggctatta ccaccacacc tcgtaataac cttaatcccc 26040gtagttggcc cgctgccctg gtgtaccagg aaagtcccgc tcccaccact gtggtacttc 26100ccagagacgc ccaggccgaa gttcagatga ctaactcagg ggcgcagctt gcgggcggct 26160ttcgtcacag ggtgcggtcg cccgggcagg gtataactca cctgacaatc agagggcgag 26220gtattcagct caacgacgag tcggtgagct cctcgcttgg tctccgtccg gacgggacat 26280ttcagatcgg cggcgccggc cgctcttcat tcacgcctcg tcaggcaatc ctaactctgc 26340agacctcgtc ctctgagccg cgctctggag gcattggaac tctgcaattt attgaggagt 26400ttgtgccatc ggtctacttt aaccccttct cgggacctcc cggccactat ccggatcaat 26460ttattcctaa ctttgacgcg gtaaaggact cggcggacgg ctacgactga atgttaagtg 26520gagaggcaga gcaactgcgc ctgaaacacc tggtccactg tcgccgccac aagtgctttg 26580cccgcgactc cggtgagttt tgctactttg aattgcccga ggatcatatc gagggcccgg 26640cgcacggcgt ccggcttacc gcccagggag agcttgcccg tagcctgatt cgggagttta 26700cccagcgccc cctgctagtt gagcgggaca ggggaccctg tgttctcact gtgatttgca 26760actgtcctaa ccctggatta catcaagatc tttgttgcca tctctgtgct gagtataata 26820aatacagaaa ttaaaatata ctggggctcc tatcgccatc ctgtaaacgc caccgtcttc 26880acccgcccaa gcaaaccaag gcgaacctta cctggtactt ttaacatctc tccctctgtg 26940atttacaaca gtttcaaccc agacggagtg agtctacgag agaacctctc cgagctcagc 27000tactccatca gaaaaaacac caccctcctt acctgccggg aacgtacgag tgcgtcaccg 27060gccgctgcac cacacctacc gcctgaccgt aaaccagact ttttccggac agacctcaat 27120aactctgttt accagaacag gaggtgagct tagaaaaccc ttagggtatt aggccaaagg 27180cgcagctact gtggggttta tgaacaattc aagcaactct acgggctatt ctaattcagg 27240tttctctaga atcggggttg gggttattct ctgtcttgtg attctcttta ttcttatact 27300aacgcttctc tgcctaaggc tcgccgcctg ctgtgtgcac atttgcattt attgtcagct 27360ttttaaacgc tggggtcgcc acccaagatg attaggtaca taatcctagg tttactcacc 27420cttgcgtcag cccacggtac cacccaaaag gtggatttta aggagccagc ctgtaatgtt 27480acattcgcag ctgaagctaa tgagtgcacc actcttataa aatgcaccac agaacatgaa 27540aagctgctta ttcgccacaa aaacaaaatt ggcaagtatg ctgtttatgc tatttggcag 27600ccaggtgaca ctacagagta taatgttaca gttttccagg gtaaaagtca taaaactttt 27660atgtatactt ttccatttta tgaaatgtgc gacattacca tgtacatgag caaacagtat 27720aagttgtggc ccccacaaaa ttgtgtggaa aacactggca ctttctgctg cactgctatg 27780ctaattacag tgctcgcttt ggtctgtacc ctactctata ttaaatacaa aagcagacgc 27840agctttattg aggaaaagaa aatgccttaa tttactaagt tacaaagcta atgtcaccac 27900taactgcttt actcgctgct tgcaaaacaa attcaaaaag ttagcattat aattagaata 27960ggatttaaac cccccggtca tttcctgctc aataccattc ccctgaacaa ttgactctat 28020gtgggatatg ctccagcgct acaaccttga agtcaggctt cctggatgtc agcatctgac 28080tttggccagc acctgtcccg cggatttgtt ccagtccaac tacagcgacc caccctaaca 28140gagatgacca acacaaccaa cgcggccgcc gctaccggac ttacatctac cacaaataca 28200ccccaagttt ctgcctttgt caataactgg gataacttgg gcatgtggtg gttctccata 28260gcgcttatgt ttgtatgcct tattattatg tggctcatct gctgcctaaa gcgcaaacgc 28320gcccgaccac ccatctatag tcccatcatt gtgctacacc caaacaatga tggaatccat 28380agattggacg gactgaaaca catgttcttt tctcttacag tatgattaaa tgagacatga 28440ttcctcgagt ttttatatta ctgacccttg ttgcgctttt ttgtgcgtgc tccacattgg 28500ctgcggtttc tcacatcgaa gtagactgca ttccagcctt cacagtctat ttgctttacg 28560gatttgtcac cctcacgctc atctgcagcc tcatcactgt ggtcatcgcc tttatccagt 28620gcattgactg ggtctgtgtg cgctttgcat atctcagaca ccatccccag tacagggaca 28680ggactatagc tgagcttctt agaattcttt aattatgaaa tttactgtga cttttctgct 28740gattatttgc accctatctg cgttttgttc cccgacctcc aagcctcaaa gacatatatc 28800atgcagattc actcgtatat ggaatattcc aagttgctac aatgaaaaaa gcgatctttc 28860cgaagcctgg ttatatgcaa tcatctctgt tatggtgttc tgcagtacca tcttagccct 28920agctatatat ccctaccttg acattggctg gaacgcaata gatgccatga accacccaac 28980tttccccgcg cccgctatgc ttccactgca acaagttgtt gccggcggct ttgtcccagc 29040caatcagcct cgcccacctt ctcccacccc cactgaaatc agctacttta atctaacagg 29100aggagatgac tgacacccta gatctagaaa tggacggaat tattacagag cagcgcctgc 29160tagaaagacg cagggcagcg gccgagcaac agcgcatgaa tcaagagctc caagacatgg 29220ttaacttgca ccagtgcaaa aggggtatct tttgtctcgt aaagcaggcc aaagtcacct 29280acgacagtaa taccaccgga caccgcctta gctacaagtt gccaaccaag cgtcagaaat 29340tggtggtcat ggtgggagaa aagcccatta ccataactca gcactcggta gaaaccgaag 29400gctgcattca ctcaccttgt caaggacctg aggatctctg cacccttatt aagaccctgt 29460gcggtctcaa agatcttatt ccctttaact aataaaaaaa aataataaag catcacttac 29520ttaaaatcag ttagcaaatt tctgtccagt ttattcagca gcacctcctt gccctcctcc 29580cagctctggt attgcagctt cctcctggct gcaaactttc tccacaatct aaatggaatg 29640tcagtttcct cctgttcctg tccatccgca cccactatct tcatgttgtt gcagatgaag 29700cgcgcaagac cgtctgaaga taccttcaac cccgtgtatc catatgacac ggaaaccggt 29760cctccaactg tgccttttct tactcctccc tttgtatccc ccaatgggtt tcaagagagt 29820ccccctgggg tactctcttt gcgcctatcc gaacctctag ttacctccaa tggcatgctt 29880gcgctcaaaa tgggcaacgg cctctctctg gacgaggccg gcaaccttac ctcccaaaat 29940gtaaccactg tgagcccacc tctcaaaaaa accaagtcaa acataaacct ggaaatatct 30000gcacccctca cagttacctc agaagcccta actgtggctg ccgccgcacc tctaatggtc 30060gcgggcaaca cactcaccat gcaatcacag gccccgctaa ccgtgcacga ctccaaactt 30120agcattgcca cccaaggacc cctcacagtg tcagaaggaa agctagccct gcaaacatca 30180ggccccctca ccaccaccga tagcagtacc cttactatca ctgcctcacc ccctctaact 30240actgccactg gtagcttggg cattgacttg aaagagccca tttatacaca aaatggaaaa 30300ctaggactaa agtacggggc tcctttgcat gtaacagacg acctaaacac tttgaccgta 30360gcaactggtc caggtgtgac tattaataat acttccttgc aaactaaagt tactggagcc 30420ttgggttttg attcacaagg caatatgcaa cttaatgtag caggaggact aaggattgat 30480tctcaaaaca gacgccttat acttgatgtt agttatccgt ttgatgctca aaaccaacta 30540aatctaagac taggacaggg ccctcttttt ataaactcag cccacaactt ggatattaac 30600tacaacaaag gcctttactt gtttacagct tcaaacaatt ccaaaaagct tgaggttaac 30660ctaagcactg ccaaggggtt gatgtttgac gctacagcca tagccattaa tgcaggagat 30720gggcttgaat ttggttcacc taatgcacca aacacaaatc ccctcaaaac aaaaattggc 30780catggcctag aatttgattc aaacaaggct atggttccta aactaggaac tggccttagt 30840tttgacagca caggtgccat tacagtagga aacaaaaata atgataagct aactttgtgg 30900accacaccag ctccatctcc taactgtaga ctaaatgcag agaaagatgc taaactcact 30960ttggtcttaa caaaatgtgg cagtcaaata cttgctacag tttcagtttt ggctgttaaa 31020ggcagtttgg ctccaatatc tggaacagtt caaagtgctc atcttattat aagatttgac 31080gaaaatggag tgctactaaa caattccttc ctggacccag aatattggaa ctttagaaat 31140ggagatctta ctgaaggcac agcctataca aacgctgttg gatttatgcc taacctatca 31200gcttatccaa aatctcacgg taaaactgcc aaaagtaaca ttgtcagtca agtttactta 31260aacggagaca aaactaaacc tgtaacacta accattacac taaacggtac acaggaaaca 31320ggagacacaa ctccaagtgc atactctatg tcattttcat gggactggtc tggccacaac 31380tacattaatg aaatatttgc cacatcctct tacacttttt catacattgc ccaagaataa 31440agaatcgttt gtgttatgtt tcaacgtgtt tatttttcaa ttgcagaaaa tttcaagtca 31500tttttcattc agtagtatag ccccaccacc acatagctta tacagatcac cgtaccttaa 31560tcaaactcac agaaccctag tattcaacct gccacctccc tcccaacaca cagagtacac 31620agtcctttct ccccggctgg ccttaaaaag catcatatca tgggtaacag acatattctt 31680aggtgttata ttccacacgg tttcctgtcg agccaaacgc tcatcagtga tattaataaa 31740ctccccgggc agctcactta agttcatgtc gctgtccagc tgctgagcca caggctgctg 31800tccaacttgc ggttgcttaa cgggcggcga aggagaagtc cacgcctaca tgggggtaga 31860gtcataatcg tgcatcagga tagggcggtg gtgctgcagc agcgcgcgaa taaactgctg 31920ccgccgccgc tccgtcctgc aggaatacaa catggcagtg gtctcctcag cgatgattcg 31980caccgcccgc agcataaggc gccttgtcct ccgggcacag cagcgcaccc tgatctcact 32040taaatcagca cagtaactgc agcacagcac cacaatattg ttcaaaatcc cacagtgcaa 32100ggcgctgtat ccaaagctca tggcggggac cacagaaccc acgtggccat cataccacaa 32160gcgcaggtag attaagtggc gacccctcat aaacacgctg gacataaaca ttacctcttt 32220tggcatgttg taattcacca cctcccggta ccatataaac ctctgattaa acatggcgcc 32280atccaccacc atcctaaacc agctggccaa aacctgcccg ccggctatac actgcaggga 32340accgggactg gaacaatgac agtggagagc ccaggactcg taaccatgga tcatcatgct 32400cgtcatgata tcaatgttgg cacaacacag gcacacgtgc atacacttcc tcaggattac 32460aagctcctcc cgcgttagaa ccatatccca gggaacaacc cattcctgaa tcagcgtaaa 32520tcccacactg cagggaagac ctcgcacgta actcacgttg tgcattgtca aagtgttaca 32580ttcgggcagc agcggatgat cctccagtat ggtagcgcgg gtttctgtct caaaaggagg 32640tagacgatcc ctactgtacg gagtgcgccg agacaaccga gatcgtgttg gtcgtagtgt 32700catgccaaat ggaacgccgg acgtagtcat atttcctgaa gcaaaaccag gtgcgggcgt 32760gacaaacaga tctgcgtctc cggtctcgcc gcttagatcg ctctgtgtag tagttgtagt 32820atatccactc tctcaaagca tccaggcgcc ccctggcttc gggttctatg taaactcctt 32880catgcgccgc tgccctgata acatccacca ccgcagaata agccacaccc agccaaccta 32940cacattcgtt ctgcgagtca cacacgggag gagcgggaag agctggaaga accatgtttt 33000tttttttatt ccaaaagatt atccaaaacc tcaaaatgaa gatctattaa gtgaacgcgc 33060tcccctccgg tggcgtggtc aaactctaca gccaaagaac agataatggc atttgtaaga 33120tgttgcacaa tggcttccaa aaggcaaacg gccctcacgt ccaagtggac gtaaaggcta 33180aacccttcag ggtgaatctc ctctataaac attccagcac cttcaaccat gcccaaataa 33240ttctcatctc gccaccttct caatatatct ctaagcaaat cccgaatatt aagtccggcc 33300attgtaaaaa tctgctccag agcgccctcc accttcagcc tcaagcagcg aatcatgatt 33360gcaaaaattc aggttcctca cagacctgta taagattcaa aagcggaaca ttaacaaaaa 33420taccgcgatc ccgtaggtcc cttcgcaggg ccagctgaac ataatcgtgc aggtctgcac 33480ggaccagcgc ggccacttcc ccgccaggaa ccatgacaaa agaacccaca ctgattatga 33540cacgcatact cggagctatg ctaaccagcg tagccccgat gtaagcttgt tgcatgggcg 33600gcgatataaa atgcaaggtg ctgctcaaaa aatcaggcaa agcctcgcgc aaaaaagaaa 33660gcacatcgta gtcatgctca tgcagataaa ggcaggtaag ctccggaacc accacagaaa 33720aagacaccat ttttctctca aacatgtctg cgggtttctg cataaacaca aaataaaata 33780acaaaaaaac atttaaacat tagaagcctg tcttacaaca ggaaaaacaa cccttataag 33840cataagacgg actacggcca tgccggcgtg accgtaaaaa aactggtcac cgtgattaaa 33900aagcaccacc gacagctcct cggtcatgtc cggagtcata atgtaagact cggtaaacac 33960atcaggttga ttcacatcgg tcagtgctaa aaagcgaccg aaatagcccg ggggaataca 34020tacccgcagg cgtagagaca acattacagc ccccatagga ggtataacaa aattaatagg 34080agagaaaaac acataaacac ctgaaaaacc ctcctgccta ggcaaaatag caccctcccg 34140ctccagaaca acatacagcg cttccacagc ggcagccata acagtcagcc ttaccagtaa 34200aaaagaaaac ctattaaaaa aacaccactc gacacggcac cagctcaatc agtcacagtg 34260taaaaaaggg ccaagtgcag agcgagtata tataggacta aaaaatgacg taacggttaa 34320agtccacaaa aaacacccag aaaaccgcac gcgaacctac gcccagaaac gaaagccaaa 34380aaacccacaa cttcctcaaa tcgtcacttc cgttttccca cgttacgtca cttcccattt 34440taagaaaact acaattccca acacatacaa gttactccgc cctaaaacct acgtcacccg 34500ccccgttccc acgccccgcg ccacgtcaca aactccaccc cctcattatc atattggctt 34560caatccaaaa taaggtatat tattgatgat gttaattaag aattcggatc tgcgacgcga 34620ggctggatgg ccttccccat tatgattctt ctcgcttccg gcggcatcgg gatgcccgcg 34680ttgcaggcca tgctgtccag gcaggtagat gacgaccatc agggacagct tcaaggccag 34740caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc 34800cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta 34860taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg 34920ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc 34980tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac 35040gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac 35100ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg 35160aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga 35220aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt 35280agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag 35340cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct 35400gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg 35460atcttcacct agatcctttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 35520gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 35580tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 35640ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 35700accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 35760agtctattaa ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 35820acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 35880tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 35940cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 36000tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 36060ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 36120gctcttgccc ggcgtcaaca cgggataata ccgcgccaca tagcagaact ttaaaagtgc 36180tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 36240ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 36300gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 36360cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 36420gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 36480ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 36540cattaaccta taaaaatagg cgtatcacga ggccctttcg tcttcaagaa ttggatccga 36600attcttaatt tcttaattaa 36620 31 36620 DNA Artificial Sequence Codon optimized DNA encoding pMRKAd5HIV-1 nef, noncoding 31gtagtagtta ttatatggaa taaaacctaa cttcggttat actattactc ccccacctca 60aacactgcac cgcgccccgc acccttgccc cgcccactgc atcatcacac cgccttcaca 120ctacaacgtt cacaccgcct tgtgtacatt cgctgcctac accgttttca ctgcaaaaac 180cacacgcggc cacatgtgtc cttcactgtt aaaagcgcgc caaaatccgc ctacaacatc 240atttaaaccc gcattggctc attctaaacc ggtaaaagcg cccttttgac ttattctcct 300tcactttaga cttattaaaa cacaatgagt atcgcgcatt ataaacagat cccggcgccc 360ctgaaactgg caaatgcacc tctgagcggg tccacaaaaa gagtccacaa aaggcgcaag 420gcccagtttc aaccgcaaaa taataatatc cgccggcgct aggtaacgta tgcaacatag 480gtatagtatt atacatgtaa atataaccga gtacaggttg taatggcggt acaactgtaa 540ctaataactg atcaataatt atcattagtt aatgccccag taatcaagta tcgggtatat 600acctcaaggc gcaatgtatt gaatgccatt taccgggcgg accgactggc gggttgctgg 660gggcgggtaa ctgcagttat tactgcatac aagggtatca ttgcggttat ccctgaaagg 720taactgcagt tacccacctc ataaatgcca tttgacgggt gaaccgtcat gtagttcaca 780tagtatacgg ttcatgcggg ggataactgc agttactgcc atttaccggg cggaccgtaa 840tacgggtcat gtactggaat accctgaaag gatgaaccgt catgtagatg cataatcagt 900agcgataatg gtaccactac gccaaaaccg tcatgtagtt acccgcacct atcgccaaac 960tgagtgcccc taaaggttca gaggtggggt aactgcagtt accctcaaac aaaaccgtgg 1020ttttagttgc cctgaaaggt tttacagcat tgttgaggcg gggtaactgc gtttacccgc 1080catccgcaca tgccaccctc cagatatatt cgtctcgagc aaatcacttg gcagtctagc 1140ggacctctgc ggtaggtgcg acaaaactgg aggtatcttc tgtggccctg gctaggtcgg 1200aggcgccggc ccttgccacg taaccttgcg cctaaggggc acggttctca ctctagacgg 1260tggtaccggc cgttcaccag gttctccagg cacgggccga ccaggtggca ctccctctcc 1320tactcctccc ggctcgggcg gcggctgtcc cactcctcct ggctcgggcg gcgtcacccg 1380cacccgcggc acaggtccct ggacctcttc gtgccgcggt agtggaggag gttgtggcgg 1440cggtggttgc ggctgacgcg gaccgacctc cgggtcctcc tgctcctcca cccgaagggg 1500cactccgggg tccacgggga ctccgggtac tggatgttcc cgcggcacct ggacagggtg 1560aaggacttcc tcttcccgcc ggacctcccg gactaggtga gggtcttctc cgtcctgtag 1620gacctggaca cccacatggt gtgggtcccg atgaaggggc tgaccgtctt gatgtggggg 1680ccggggccgt agtccaaggg ggactggaag ccgaccacga agttcgacca cgggcacctc 1740gggctcttcc acctcctccg gttgctcccg ctcttgttga cgcggcgggt ggggtacagg 1800gtcgtgccgt agctcctggg gctcttcctc cacgacctca cctccaagct gaggttcgac 1860cggaaggtgg tgcaccggtc cctcgacgtg gggctcatga tgttcctgac gatttcgggc 1920ccgtctagac gacacggaag atcaacggtc ggtagacaac aaacggggag ggggcacgga 1980aggaactggg accttccacg gtgagggtga caggaaagga ttattttact cctttaacgt 2040agcgtaacag actcatccac agtaagataa gaccccccac cccaccccgt cctgtcgttc 2100cccctcctaa cccttctgtt atcgtccgta cgacccctac gccacccgag ataccggcta 2160gccgcgcggc atgactttac acacccgcac cgaattccca ccctttctta tatattccac 2220ccccagaata catcaaaaca tagacaaaac gtcgtcggcg gcggcggtac tcgtggttga 2280gcaaactacc ttcgtaacac tcgagtataa actgttgcgc gtacgggggt acccggcccc 2340acgcagtctt acactacccg aggtcgtaac taccagcggg gcaggacggg cgtttgagat 2400gatggaactg gatgctctgg cacagacctt gcggcaacct ctgacgtcgg aggcggcggc 2460gaagtcggcg acgtcggtgg cgggcgccct aacactgact gaaacgaaag gactcgggcg 2520aacgtttgtc acgtcgaagg gcaagtaggc gggcgctact gttcaactgc cgagaaaacc 2580gtgttaacct aagaaactgg gcccttgaat tacagcaaag agtcgtcgac aacctagacg 2640cggtcgtcca aagacgggac ttccgaagga ggggagggtt acgccaaatt ttgtatttat 2700tttttggtct gagacaaacc taaacctagt tcgttcacag aacgacagaa ataaatcccc 2760aaaacgcgcg cgccatccgg gccctggtcg ccagagccag caactcccag gacacataaa 2820aaaggtcctg caccatttcc actgagacct acaagtctat gtacccgtat tcgggcagag 2880accccacctc catcgtggtg acgtctcgaa gtacgacgcc ccaccacaac atctactagg 2940tcagcatcgt cctcgcgacc cgcaccacgg atttttacag aaagtcatcg ttcgactaac 3000ggtccccgtc cgggaaccac attcacaaat gtttcgccaa ttcgacccta cccacgtatg 3060cacccctata ctctacgtag aacctgacat aaaaatccaa ccgatacaag ggtcggtata 3120gggaggcccc taagtacaac acgtcttggt ggtcgtgtca cataggccac gtgaaccctt 3180taaacagtac atcgaatctt cctttacgca ccttcttgaa cctctgcggg aacactggag 3240gttctaaaag gtacgtaagc aggtattact accgttaccc gggtgcccgc cgccggaccc 3300gcttctataa agaccctagt gattgcagta tcaacacaag gtcctactct agcagtatcc 3360ggtaaaaatg tttcgcgccc gcctcccacg gtctgacgcc atattaccaa ggtaggccgg 3420gtccccgcat caatgggagt gtctaaacgt aaagggtgcg aaactcaagt ctacccccct 3480agtacagatg gacgccccgc tacttctttt gccaaaggcc ccatcccctc tagtcgaccc 3540ttctttcgtc caaggactcg tcgacgctga atggcgtcgg ccacccgggc atttagtgtg 3600gataatggcc gacgttgacc atcaattctc tcgacgtcga cggcagtagg gactcgtccc 3660cccggtgaag caattcgtac agggactgag cgtacaaaag ggactggttt aggcggtctt 3720ccgcgagcgg cgggtcgcta tcgtcaagaa cgttccttcg tttcaaaaag ttgccaaact 3780ctggcaggcg gcatccgtac gaaaactcgc aaactggttc gtcaaggtcc gccagggtgt 3840cgagccagtg gacgagatgc cgtagagcta ggtcgtatag aggagcaaag cgcccaaccc 3900cgccgaaagc gacatgccgt catcagccac gagcaggtct gcccggtccc agtacagaaa 3960ggtgcccgcg tcccaggagc agtcgcatca gacccagtgc cacttcccca cgcgaggccc 4020gacgcgcgac cggtcccacg cgaactccga ccaggacgac cacgacttcg cgacggccag 4080aagcgggacg cgcagccggt ccatcgtaaa ctggtaccac agtatcaggt cggggaggcg 4140ccgcaccggg aaccgcgcgt cgaacgggaa cctcctccgc ggcgtgctcc ccgtcacgtc 4200tgaaaactcc cgcatctcga acccgcgctc tttatggcta aggcccctca tccgtaggcg 4260cggcgtccgg ggcgtctgcc agagcgtaag gtgctcggtc cactcgagac cggcaagccc 4320cagtttttgg tccaaagggg gtacgaaaaa ctacgcaaag aatggagacc aaaggtactc 4380ggccacaggt gcgagccact gcttttccga caggcacagg ggcatatgtc tgaactctcc 4440ggacaggagc tcgccacaag gcgccaggag gagcatatct ttgagcctgg tgagactctg 4500tttccgagcg caggtccggt cgtgcttcct ccgattcacc ctccccatcg ccagcaacag 4560gtgatccccc aggtgagcga ggtcccacac ttctgtgtac agcgggagaa gccgtagttc 4620cttccactaa ccaaacatcc acatccggtg cactggccca caaggacttc cccccgatat 4680tttcccccac ccccgcgcaa gcaggagtga gagaaggcgt agcgacagac gctcccggtc 4740gacaacccca ctcatgaggg agacttttcg cccgtactga agacgcgatt ctaacagtca 4800aaggtttttg ctcctcctaa actataagtg gaccgggcgc cactacggaa actcccaccg 4860gcgtaggtag accagtcttt tctgttagaa aaacaacagt tcgaaccacc gtttgctggg 4920catctcccgc aacctgtcgt tgaaccgcta cctcgcgtcc caaaccaaaa acagcgctag 4980ccgcgcgagg aaccggcgct acaaatcgac gtgcataagc gcgcgttgcg tggcggtaag 5040ccctttctgc caccacgcga gcagcccgtg gtccacgtgc gcggttggcg ccaacacgtc 5100ccactgttcc agttgcgacc accgatggag aggcgcatcc gcgagcaacc aggtcgtctc 5160cgccggcggg aacgcgctcg tcttaccgcc atcccccaga tcgacgcaga gcaggccccc 5220cagacgcagg tgccatttct ggggcccgtc gtccgcgcgc agcttcatca gatagaacgt 5280aggaacgttc agatcgcgga cgacggtacg cgcccgccgt tcgcgcgcga gcatacccaa 5340ctcaccccct ggggtaccgt accccaccca ctcgcgcctc cgcatgtacg gcgtttacag 5400catttgcatc tccccgagag actcataagg ttctatacat cccatcgtag aaggtggcgc 5460ctacgaccgc gcgtgcatta gcatatcaag cacgctccct cgctcctcca gccctggctc 5520caacgatgcc cgcccgacga gacgagcctt ctgatagacg gacttctacc gtacactcaa 5580cctactatac caacctgcga ccttctgcaa cttcgaccgc agacactctg gatggcgcag 5640tgcgtgcttc ctccgcatcc tcagcgcgtc gaacaactgg tcgagccgcc actggacgtg 5700cagatcccgc gtcatcaggt cccaaaggaa ctactacagt atgaatagga cagggaaaaa 5760aaaggtgtcg agcgccaact cctgtttgag aagcgccaga aaggtcatga gaacctagcc 5820tttgggcagc cggaggcttg ccattctcgg atcgtacatc ttgaccaact gccggaccat 5880ccgcgtcgta gggaaaagat gcccatcgcg catacggacg cgccggaagg cctcgctcca 5940cacccactcg cgtttccaca gggactggta ctgaaactcc atgaccataa acttcagtca 6000cagcagcgta ggcgggacga gggtctcgtt tttcaggcac gcgaaaaacc ttgcgcctaa 6060accgtcccgc ttccactgta gcaacttctc atagaaaggg cgcgctccgt atttcaacgc 6120acactacgcc ttcccagggc cgtggagcct tgccaacaat taatggaccc gccgctcgtg 6180ctagagcagt ttcggcaact acaacaccgg gtgttacatt tcaaggttct tcgcgcccta 6240cgggaactac cttccgttaa aaaattcaag gagcatccac tcgagaagtc ccctcgactc 6300gggcacgaga ctttcccggg tcagacgttc tactcccaac cttcgctgct tactcgaggt 6360gtccagtgcc cggtaatcgt aaacgtccac cagcgctttc caggatttga ccgctggata 6420ccggtaaaaa agaccccact acgtcatctt ccattcgccc agaacaaggg tcgccagggt 6480aggttccaag cgccgatcca gagcgcgccg tcagtgatct ccgagtagag gcggcttgaa 6540gtactggtcg tacttcccgt gctcgacgaa gggtttccgg gggtaggttc atatccagag 6600atgtagcatc cactgtttct ctgcgagcca cgctcctacg ctcggctagc ccttcttgac 6660ctagagggcg gtggttaacc tcctcaccga taactacacc actttcatct tcagggacgc 6720tgcccggctt gtgagcacga ccgaaaacat ttttgcacgc gtcatgaccg tcgccacgtg 6780cccgacatgt aggacgtgct ccaactggac tgctggcgcg tgttccttcg tctcaccctt 6840aaactcgggg agcggaccgc ccaaaccgac caccagaaga tgaagccgac gaacaggaac 6900tggcagaccg acgagctccc ctcaatgcca cctagcctgg tggtgcggcg cgctcgggtt 6960tcaggtctac aggcgcgcgc cgccagcctc gaactactgt tgtagcgcgt ctaccctcga 7020caggtaccag acctcgaggg cgccgcagtc cagtccgccc tcgaggacgt ccaaatggag 7080cgtatctgcc cagtcccgcg cccgatctag gtccactatg gattaaaggt ccccgaccaa 7140ccaccgccgc agctaccgaa cgttctccgg cgtaggggcg ccgcgctgat gccatggcgc 7200gccgcccgcc acccggcgcc cccacaggaa cctactacgt agattttcgc cactgcgccc 7260gctcgggggc ctccatcccc cccgaggcct gggcggccct ctcccccgtc cccgtgcagc 7320cgcggcgcgc gcccgtcctc gaccacgacg cgcgcatcca acgaccgctt gcgctgctgc 7380gccgccaact agaggactta gaccgcggag acgcacttct gctgcccggg ccactcgaac 7440ttggactttc tctcaagctg tcttagttaa agccacagca actgccgccg gaccgcgttt 7500tagaggacgt gcagaggact caacagaact atccgctaga gccggtactt gacgagctag 7560agaaggagga cctctagagg cgcaggccga gcgaggtgcc accgccgctc cagcaacctt 7620tacgcccggt actcgacgct cttccgcaac tccggaggga gcaaggtctg cgccgacatc 7680tggtgcgggg gaagccgtag cgcccgcgcg tactggtgga cgcgctctaa ctcgaggtgc 7740acggcccgct tctgccgcat caaagcgtcc gcgactttct ccatcaactc ccaccaccgc 7800cacacaagac ggtgcttctt catgtattgg gtcgcagcgt tgcacctaag caactatagg 7860gggttccgga gttccgcgag gtaccggagc atcttcaggt gccgcttcaa ctttttgacc 7920ctcaacgcgc ggctgtgcca attgaggagg aggtcttctg cctactcgag ccgctgtcac 7980agcgcgtgga gcgcgagttt ccgatgtccc cggagaagaa gaagaagtta gaggagaagg 8040tattcccgga ggggaagaag aagaagaccg ccgccacccc ctcccccctg tgccgccgct 8100gctgccgcgt ggccctccgc cagctgtttc gcgagctagt agaggggcgc cgctgccgcg 8160taccagagcc actgccgcgc cggcaagagc gcccccgcgt caaccttctg cggcgggcag 8220tacagggcca atacccaacc gccccccgac ggtacgccgt ccctatgccg cgattgctac 8280gtagagttgt taacaacaca tccatgaggc ggcggctccc tggactcgct caggcgtagc 8340tggcctagcc ttttggagag ctctttccgc agattggtca gtgtcagcgt tccatccgac 8400tcgtggcacc gcccgccgtc gcccgccgcc agccccaaca aagaccgcct ccacgacgac 8460tactacatta atttcatccg ccagaactct gccgcctacc agctgtcttc gtggtacagg 8520aacccaggcc ggacgactta cgcgtccgcc agccggtacg gggtccgaag caaaactgta 8580gccgcgtcca gaaacatcat cagaacgtac tcggaaagat ggccgtgaag aagaagagga 8640aggagaacag gacgtagaga acgtagatag cgacgccgcc gccgcctcaa accggcatcc 8700accgcgggag aaggagggta cgcacactgg ggcttcgggg agtagccgac ttcgtcccga 8760tccagccgct gttgcgcgag ccgattatac cggacgacgt ggacgcactc ccatctgacc 8820ttcagtaggt acaggtgttt cgccaccata cgcgggcaca actaccacat tcacgtcaac 8880cggtattgcc tggtcaattg ccagaccact gggccgacgc tctcgagcca catggactct 8940gcgctcattc gggagctcag tttatgcatc agcaacgttc aggcgtggtc catgaccata 9000gggtggtttt tcacgccgcc gccgaccgcc atctccccgg tcgcatccca ccggccccga 9060ggcccccgct ctagaaggtt gtattccgct actataggca tctacatgga cctgtaggtc 9120cactacggcc gccgccacca cctccgcgcg cctttcagcg cctgcgccaa ggtctacaac 9180gcgtcgccgt ttttcacgag gtaccagccc tgcgagaccg gccagtccgc gcgcgttagc 9240aactgcgaga tctggcacgt tttcctctcg gacattcgcc cgtgagaagg caccagacca 9300cctatttaag cgttcccata gtaccgcctg ctggccccaa gctcggggca taggccggca 9360ggcggcacta ggtacgccaa tggcgggcgc acagcttggg tccacacgct gcagtctgtt 9420gccccctcac gaggaaaacc gaaggaaggt ccgcgccgcc gacgacgcga tcgaaaaaac 9480cggtgaccgg cgcgcgtcgc attcgccaat ccgacctttc gctttcgtaa ttcaccgagc 9540gagggacatc ggcctcccaa taaaaggttc ccaactcagc gccctggggg ccaagctcag 9600agcctggccg gcctgacgcc gcttgccccc aaacggaggg gcagtacgtt ctggggcgaa 9660cgtttaagga ggcctttgtc cctgctcggg gaaaaaacga aaagggtcta cgtaggccac 9720gacgccgtct acgcgggggg aggagtcgtc gccgttctcg ttctcgtcgc cgtctgtacg 9780tcccgtggga ggggaggagg atggcgcagt cctccccgct gtaggcgcca actgcgccgt 9840cgtctaccac taatgcttgg gggcgccgcg gcccgggccg tgatggacct gaacctcctc 9900ccgctcccgg accgcgccga tcctcgcggg agaggactcg ccgtgggttc ccacgtcgac 9960ttcgcactat gcgcactccg catgcacggc gccgtcttgg acaaagcgct ggcgctccct 10020ctcctcgggc tcctctacgc cctagctttc aaggtgcgtc ccgcgctcga cgccgtaccg 10080gacttagcgc tcgccaacga cgcgctcctc ctgaaactcg ggctgcgcgc ttggccctaa 10140tcagggcgcg cgcgtgtgca ccgccggcgg ctggaccatt ggcgtatgct cgtctgccac 10200ttggtcctct aattgaaagt tttttcgaaa ttgttggtgc acgcatgcga acaccgcgcg 10260ctcctccacc gatatcctga ctacgtagac accctgaaac attcgcgcga cctcgttttg 10320ggtttatcgt tcggcgagta ccgcgtcgac aaggaatatc acgtcgtgtc gtccctgttg 10380ctccgtaagt ccctacgcga cgatttgtat catctcgggc tcccggcgac cgacgagcta 10440aactatttgt aggacgtctc gtatcaccac gtcctcgcgt cgaactcgga ccgactgttc 10500caccggcggt agttgataag gtacgaatcg gacccgttca aaatgcgggc gttctatatg 10560gtatggggaa tgcaagggta tctgttcctc catttctagc tccccaagat gtacgcgtac 10620cgcgacttcc acgaatggaa ctcgctgctg gacccgcaaa tagcgttgct cgcgtaggtg 10680ttccggcact cgcactcggc cgccgcgctc gagtcgctgg cgctcgacta cgtgtcggac 10740gtttcccggg accgaccgtg cccgtcgccg ctatctctcc ggctcaggat gaaactgcgc 10800ccgcgactgg acgcgacccg gggttcggct gcgcgggacc tccgtcgacc ccggcctgga 10860cccgaccgcc accgtgggcg cgcgcgaccg ttgcagccgc cgcacctcct tatactgctc 10920ctgctactca tgctcggtct cctgccgctc atgattcgcc actacaaaga ctagtctact 10980acgttctgcg ttgcctgggc cgccacgccc gccgcgacgt ctcggtcggc aggccggaat 11040tgaggtgcct gctgaccgcg gtccagtacc tggcgtagta cagcgactga cgcgcgttag 11100gactgcgcaa ggccgtcgtc ggcgtccggt tggccgagag gcgttaagac cttcgccacc 11160agggccgcgc gcgtttgggg tgcgtgctct tccacgaccg ctagcatttg cgcgaccggc 11220ttttgtcccg gtaggccggg ctgctccggc cggaccagat gctgcgcgac gaagtcgcgc 11280accgagcaat gttgtcgccg ttgcacgtct ggttggacct ggccgaccac cccctacacg 11340cgctccggca ccgcgtcgca ctcgcgcgcg tcgtcgtccc gttggacccg aggtaccaac 11400gtgatttgcg gaaggactca tgtgtcgggc ggttgcacgg cgcccctgtc ctcctgatgt 11460ggttgaaaca ctcgcgtgac gccgattacc actgactctg tggcgtttca ctccacatgg 11520tcagacccgg tctgataaaa aaggtctggt catctgttcc ggacgtctgg catttggact 11580cggtccgaaa gtttttgaac gtccccgaca ccccccacgc ccgagggtgt ccgctggcgc 11640gctggcacag atcgaacgac tgcgggttga gcgcggacaa cgacgacgat tatcgcggga 11700agtgcctgtc accgtcgcac agggccctgt gtatggatcc agtgaacgac tgtgacatgg 11760cgctccggta tccagtccgc gtacacctgc tcgtatgaaa ggtcctctaa tgttcacagt 11820cggcgcgcga ccccgtcctc ctgtgcccgt cggacctccg ttgggatttg atggacgact 11880ggttggccgc cgtcttctag gggagcaacg tgtcaaattt gtcgctcctc ctcgcgtaaa 11940acgcgatgca cgtcgtctcg cactcggaat tggactacgc gctgccccat tgcgggtcgc 12000accgcgacct gtactggcgc gcgttgtacc ttggcccgta catacggagt ttggccggca 12060aatagttggc ggattacctg atgaacgtag cgcgccggcg gcacttgggg ctcataaagt 12120ggttacggta gaacttgggc gtgaccgatg gcgggggacc aaagatgtgg ccccctaagc 12180tccacgggct cccattgcta cctaaggaga ccctgctgta tctgctgtcg cacaaaaggg 12240gcgttggcgt ctgggacgat ctcaacgttg tcgcgctcgt ccgtctccgc cgcgacgctt 12300tcctttcgaa ggcgtccggt tcgtcgaaca ggctagatcc gcgacgccgg ggcgccagtc 12360tacgatcatc gggtaaaggt tcgaactatc ccagagaatg gtcgtgagcg tggtgggcgg 12420gcgcggacga cccgctcctc ctcatggatt tgttgagcga cgacgtcggc gtcgcgcttt 12480ttttggacgg aggccgtaaa gggttgttgc cctatctctc ggatcacctg ttctactcat 12540ctaccttctg catgcgcgtc ctcgtgtccc tgcacggtcc gggcgcgggc gggtgggcag 12600cagtttccgt gctggcagtc gccccagacc acaccctcct gctactgagc cgtctgctgt 12660cgtcgcagga cctaaaccct ccctcaccgt tgggcaaacg cgtggaagcg gggtccgacc 12720cctcttacaa aatttttttt tttttcgtac tacgttttat tttttgagtg gttccggtac 12780cgtggctcgc aaccaaaaga acataagggg aatcatacgc cgcgcgccgc tacatactcc 12840ttccaggagg agggaggatg ctctcacacc actcgcgccg cggtcaccgc cgccgcgacc 12900caagagggaa gctacgaggg gacctgggcg gcaaacacgg aggcgccatg gacgccggat 12960ggcccccctc tttgtcgtag gcaatgagac tcaaccgtgg ggataagctg tggtgggcac 13020acatggacca cctgttgttc agttgcctac accgtaggga cttgatggtc ttgctggtgt 13080cgttgaaaga ctggtgccag taagttttgt tactgatgtc gggccccctc cgttcgtgtg 13140tctggtagtt agaactgctg gccagcgtga ccccgccgct ggacttttgg taggacgtat 13200ggttgtacgg tttacacttg ctcaagtaca aatggttatt caaattccgc gcccactacc 13260acagcgcgaa cggatgattc ctgttagtcc acctcgactt tatgctcacc cacctcaagt 13320gcgacgggct cccgttgatg aggctctggt actggtatct ggaatacttg ttgcgctagc 13380acctcgtgat gaactttcac ccgtctgtct tgccccaaga cctttcgctg tagccccatt 13440tcaaactgtg ggcgttgaag tctgacccca aactggggca gtgaccagaa cagtacggac 13500cccatatatg tttgcttcgg aaggtaggtc tgtagtaaaa cgacggtcct acgccccacc 13560tgaagtgggt gtcggcggac tcgttgaaca acccgtaggc gttcgccgtt gggaaggtcc 13620tcccgaaatc ctagtggatg ctactagacc tcccaccatt gtaagggcgt gacaacctac 13680acctgcggat ggtccgctcg aactttctac tgtggcttgt cccgccccca ccgcgtccgc 13740cgtcgttgtc gtcaccgtcg ccgcgccttc tcttgaggtt gcgccgtcgg cgccgttacg 13800tcggccacct cctgtacttg ctagtacggt aagcgccgct gtggaaacgg tgtgcccgac 13860tcctcttcgc gcgactccgg cttcgtcgcc ggcttcgacg gcgggggcga cgcgttgggc 13920tccagctctt cggagtcttc tttggccact agtttgggga ctgtctcctg tcgttctttg 13980cgtcaatgtt ggattattcg ttactgtcgt ggaagtgggt catggcgtcg accatggaac 14040gtatgttgat gccgctggga gtctggcctt aggcgagtac ctgggacgaa acgtgaggac 14100tgcattggac gccgagcctc gtccagatga ccagcaacgg tctgtactac gttctggggc 14160actggaaggc gaggtgcgcg gtctagtcgt tgaaaggcca ccacccgcgg ctcgacaacg 14220ggcacgtgag gttctcgaag atgttgctgg tccggcagat gagggttgag taggcggtca 14280aatggagaga ctgggtgcac aagttagcga aagggctctt ggtctaaaac cgcgcgggcg 14340gtcgggggtg gtagtggtgg cagtcacttt tgcaaggacg agagtgtcta gtgccctgcg 14400atggcgacgc gttgtcgtag cctcctcagg tcgctcactg gtaatgactg cggtctgcgg 14460cgtggacggg gatgcaaatg ttccgggacc cgtatcagag cggcgcgcag gatagctcgg 14520cgtgaaaaac tcgttcgtac aggtaggaat atagcgggtc gttattgtgt ccgaccccgg 14580acgcgaaggg ttcgttctac aaaccgcccc ggttcttcgc gaggctggtt gtgggtcacg 14640cgcacgcgcc cgtgatggcg cgcgggaccc cgcgcgtgtt tgcgccggcg tgacccgcgt 14700ggtggcagct actgcggtag ctgcgccacc acctcctccg cgcgttgatg tgcgggtgcg 14760gcggtggtca caggtgtcac ctgcgccggt aagtctggca ccacgcgcct cgggccgcga 14820tacgatttta cttctctgcc gcctccgcgc atcgtgcagc ggtggcggcg gctgggccgt 14880gacggcgggt tgcgcgccgc cgccgggacg aattggcgcg tgcagcgtgg ccggctgccc 14940gccggtacgc ccggcgagct tccgaccggc gcccataaca gtgacacggg gggtccaggt 15000ccgctgctcg ccggcggcgt cgtcggcgcc ggtaatcacg atactgagtc ccagcgtccc 15060cgttgcacat aacccacgcg ctgagccaat cgccggacgc gcacgggcac gcgtgggcgg 15120ggggcgcgtt gatctaacgt tcttttttga tgaatctgag catgacaaca tacataggtc 15180gccgccgccg cgcgttgctt cgatacaggt tcgcgtttta gtttcttctc tacgaggtcc 15240agtagcgcgg cctctagata ccggggggct tcttccttct cgtcctaatg ttcggggctt 15300tcgatttcgc ccagtttttc tttttctttc tactactact acttgaactg ctgctccacc 15360ttgacgacgt gcgatggcgc gggtccgctg cccatgtcac ctttccagct gcgcattttg 15420cacaaaacgc tgggccgtgg tggcatcaga aatgcgggcc actcgcgagg tgggcgtgga 15480tgttcgcgca catactactc cacatgccgc tgctcctgga cgaactcgtc cggttgctcg 15540cggagcccct caaacggatg cctttcgccg tattcctgta cgaccgcaac ggcgacctgc 15600tcccgttggg ttgtggatcg gatttcgggc attgtgacgt cgtccacgac gggcgcgaac 15660gtggcaggct tcttttcgcg ccggatttcg cgctcagacc actgaaccgt gggtggcacg 15720tcgactacca tgggttcgcg gtcgctgacc ttctacagaa ccttttttac tggcaccttg 15780gacccgacct cgggctccag gcgcacgccg gttagttcgt ccaccgcggc cctgacccgc 15840acgtctggca cctgcaagtc tatgggtgat ggtcatcgtg gtcataacgg tggcggtgtc 15900tcccgtacct ctgtgtttgc aggggccaac ggagtcgcca ccgcctacgg cgccacgtcc 15960gccagcgacg ccggcgcagg ttctggagat gcctccacgt ttgcctgggc acctacaaag 16020cgcaaagtcg gggggccgcg ggcgcggcaa gctccttcat gccgcggcgg tcgcgcgatg 16080acgggcttat acgggatgta ggaaggtaac gcggatgggg gccgatagca ccgatgtgga 16140tggcggggtc ttctgctcgt tgatgggctg cggcttggtg gtgaccttgg gcggcggcgg 16200cagcggcagc ggtcgggcac gaccggggct aaaggcacgc gtcccaccga gcgcttcctc 16260cgtcctggga ccacgacggt tgtcgcgcga tggtggggtc gtagcaaatt ttcggccaga 16320aacaccaaga acgtctatac cgggagtgga cggcggaggc aaagggccac ggccctaagg 16380ctccttctta cgtggcatcc tccccgtacc ggccggtgcc ggactgcccg ccgtacgcag 16440cacgcgtggt ggccgccgcc gcgcgcagcg tggcagcgta cgcgccgcca taggacgggg 16500aggaataagg tgactagcgg cgccgctaac cgcggcacgg gccttaacgt aggcaccgga 16560acgtccgcgt ctctgtgact aatttttgtt caacgtacac ctttttagtt ttatttttca 16620gacctgagag tgcgagcgaa ccaggacatt gataaaacat cttaccttct gtagttgaaa 16680cgcagagacc ggggcgctgt gccgagcgcg ggcaagtacc ctttgaccgt tctatagccg 16740tggtcgttat actcgccacc gcggaagtcg accccgagcg acacctcgcc gtaattttta 16800aagccaaggt ggcaattctt gataccgtcg ttccggacct tgtcgtcgtg tccggtctac 16860gactccctat tcaactttct cgttttaaag gttgttttcc accatctacc ggaccggaga 16920ccgtaatcgc cccaccacct ggaccggttg gtccgtcacg ttttattcta attgtcattc 16980gaactagggg cgggagggca tctcctcgga ggtggccggc acctctgtca cagaggtctc 17040cccgcaccgc ttttcgcagg cgcggggctg tcccttcttt gagaccactg cgtttatctg 17100ctcggaggga gcatgctcct ccgtgatttc gttccggacg ggtggtgggc agggtagcgc 17160gggtaccgat ggcctcacga cccggtcgtg tgtgggcatt gcgacctgga cggagggggg 17220cggctgtggg tcgtctttgg acacgacggt ccgggctggc ggcaacaaca ttgggcagga 17280tcggcgcgca gggacgcggc gcggcggtcg ccaggcgcta gcaacgccgg gcatcggtca 17340ccgttgaccg tttcgtgtga cttgtcgtag cacccagacc cccacgttag ggacttcgcg 17400gctgctacga agactatcga ttgcacagca tacacacagt acatacgcag gtacagcggc 17460ggtctcctcg acgactcggc ggcgcgcggg cgaaaggttc taccgatggg gaagctacta 17520cggcgtcacc agaatgtacg tgtagagccc ggtcctgcgg agcctcatgg actcggggcc 17580cgaccacgtc aaacgggcgc ggtggctctg catgaagtcg gacttattgt tcaaatcttt 17640ggggtgccac cgcggatgcg tgctgcactg gtgtctggcc agggtcgcaa actgcgacgc 17700caagtaggga cacctggcac tcctatgacg catgagcatg ttccgcgcca agtgggatcg 17760acacccacta ttggcacacg acctgtaccg aaggtgcatg aaactgtagg cgccgcacga 17820cctgtccccg ggatgaaaat tcgggatgag accgtgacgg atgttgcggg accgagggtt 17880cccacggggt ttaggaacgc ttaccctact tcgacgatga cgagaacttt atttggatct 17940tcttctcctg ctactgttgc ttctgcttca tctgctcgtt cgactcgtcg ttttttgagt 18000gcataaaccc gtccgcggaa taagaccata tttataatgt ttcctcccat aagtttatcc 18060acagcttcca gtttgtggat ttatacggct attttgtaaa gttggacttg gagtttatcc 18120tcttagagtc accatgcttt gtctttaatt agtacgtcga ccctctcagg attttttctg 18180atggggttac tttggtacaa tgccaagtat acgttttggg tgtttacttt tacctcccgt 18240tccgtaagaa catttcgttg ttttaccttt cgatctttca gttcaccttt acgttaaaaa 18300gagttgatga ctccgtcggc gtccgttacc actattgaac tgaggatttc accataacat 18360gtcacttcta catctatatc tttggggtct gtgagtataa agaatgtacg ggtgataatt 18420ccttccattg agtgctcttg attacccggt tgttagatac gggttgtccg gattaatgta 18480acgaaaatcc ctgttaaaat aaccagatta cataatgttg tcgtgcccat tatacccaca 18540agaccgcccg gttcgtagcg tcaacttacg acaacatcta aacgttctgt ctttgtgtct 18600cgaaagtatg gtcgaaaacg aactaaggta accactatct tggtccatga aaagatacac 18660cttagtccga caactgtcga tactaggtct acaatcttaa taacttttag taccttgact 18720tctacttgaa ggtttaatga cgaaaggtga ccctccacac taattatgtc tctgagaatg 18780gttccatttt ggattttgtc cagtcctttt acctaccctt tttctacgat gtcttaaaag 18840tctattttta ctttattctc aacctttatt aaaacggtac ctttagttag atttacggtt 18900ggacacctct ttaaaggaca tgaggttgta tcgcgacata aacgggctgt tcgatttcat 18960gtcaggaagg ttgcattttt aaagactatt gggtttgtgg atgctgatgt acttgttcgc 19020tcaccaccga gggcccgatc acctgacgat gtaattggaa cctcgtgcga ccagggaact 19080gatatacctg ttgcagttgg gtaaattggt ggtggcgtta cgaccggacg cgatggcgag 19140ttacaacgac ccgttaccag cgatacacgg gaaggtgtag gtccacggag tcttcaagaa 19200acggtaattt ttggaggaag aggacggccc gagtatgtgg atgctcacct tgaagtcctt 19260cctacaattg taccaagacg tctcgaggga tcctttactg gattcccaac tgcctcggtc 19320gtaattcaaa ctatcgtaaa cggaaatgcg gtggaagaag gggtaccggg tgttgtggcg 19380gaggtgcgaa ctccggtacg aatctttgct gtggttgctg gtcaggaaat tgctgataga 19440gaggcggcgg ttgtacgaga tgggatatgg gcggttgcga tggttgcacg ggtataggta 19500ggggagggcg ttgacccgcc gaaaggcgcc gacccggaag tgcgcggaat tctgattcct 19560ttggggtagt gacccgagcc cgatgctggg aataatgtgg atgagaccga gatatgggat 19620ggatctacct tggaaaatgg agttggtgtg gaaattcttc caccggtaat ggaaactgag 19680aagacagtcg accggaccgt tactggcgga cgaatggggg ttgctcaaac tttaattcgc 19740gagtcaactg cccctcccaa tgttgcaacg ggtcacattg tactggtttc tgaccaagga 19800ccatgtttac gatcgattga tattgtaacc gatggtcccg aagatatagg gtctctcgat 19860gttcctggcg tacatgagga agaaatcttt gaaggtcggg tactcggcag tccaccacct 19920actatgattt atgttcctga tggttgtcca cccgtaggat gtggttgtgt tgttgagacc 19980taaacaaccg atggaacggg ggtggtacgc gcttcctgtc cggatgggac gattgaaggg 20040gataggcgaa tatccgttct ggcgtcaact gtcgtaatgg gtctttttca aagaaacgct 20100agcgtgggaa accgcgtagg gtaagaggtc attgaaatac aggtacccgc gtgagtgtct 20160ggacccggtt ttggaagaga tgcggttgag gcgggtgcgc gatctgtact gaaaactcca 20220cctagggtac ctgctcgggt gggaagaaat acaaaacaaa cttcagaaac tgcaccaggc 20280acacgtggtc ggcgtggcgc cgcagtagct ttggcacatg gacgcgtgcg ggaagagccg 20340gccgttgcgg tgttgtattt cttcgttcgt tgtagttgtt gtcgacggcg gtacccgagg 20400tcactcgtcc ttgactttcg gtaacagttt ctagaaccaa cacccggtat aaaaaacccg 20460tggatactgt tcgcgaaagg tccgaaacaa agaggtgtgt tcgagcggac gcggtatcag 20520ttatgccggc cagcgctctg acccccgcat gtgacctacc ggaaacggac cttgggcgtg 20580agtttttgta cgatggagaa actcgggaaa ccgaaaagac tggtcgctga gttcgtccaa 20640atggtcaaac tcatgctcag tgaggacgcg gcatcgcggt aacgaagaag ggggctggcg 20700acatattgcg accttttcag gtgggtttcg catgtccccg ggttgagccg gcggacacct 20760gataagacga cgtacaaaga ggtgcggaaa cggttgaccg gggtttgagg gtacctagtg 20820ttggggtggt acttggaata atggccccat gggttgaggt acgagttgtc aggggtccat 20880gtcgggtggg acgcagcgtt ggtccttgtc gagatgtcga aggacctcgc ggtgagcggg 20940atgaaggcgt cggtgtcacg cgtctaatcc tcgcggtgaa gaaaaacagt gaactttttg 21000tacattttta ttacatgatc tctgtgaaag ttatttccgt ttacgaaaat aaacatgtga 21060gagcccacta ataaatgggg gtgggaacgg cagacgcggc aaatttttag tttccccaag 21120acggcgcgta gcgatacgcg gtgaccgtcc ctgtgcaacg ctatgaccac aaatcacgag 21180gtgaatttga gtccgtgttg gtaggcgccg tcgagccact tcaaaagtga ggtgtccgac 21240gcgtggtagt ggttgcgcaa atcgtccagc ccgcggctat agaacttcag cgtcaacccc 21300ggaggcggga cgcgcgcgct caacgctatg tgtcccaacg tcgtgacctt gtgatagtcg 21360cggcccacca cgtgcgaccg gtcgtgcgag aacagcctct agtctaggcg caggtccagg 21420aggcgcaacg agtcccgctt gcctcagttg aaaccatcga cggaagggtt tttcccgcgc 21480acgggtccga aactcaacgt gagcgtggca tcaccgtagt tttccactgg cacgggccag 21540acccgcaatc ctatgtcgcg gacgtatttt cggaactaga cgaattttcg gtggactcgg 21600aaacgcggaa gtctcttctt gtacggcgtt ctgaacggcc ttttgactaa ccggcctgtc 21660cggcgcagca cgtgcgtcgt ggaacgcagc cacaacctct agacgtggtg taaagccggg 21720gtggccaaga agtgctagaa ccggaacgat ctgacgagga agtcgcgcgc gacgggcaaa 21780agcgagcagt gtaggtaaag ttagtgcacg aggaataaat agtattacga aggcacatct 21840gtgaattcga gcggaagcta gagtcgcgtc gccacgtcgg tgttgcgcgt cgggcacccg 21900agcactacga acatccagtg gagacgtttg ctgacgtcca tgcggacgtc cttagcgggg 21960tagtagcagt gtttccagaa caacgaccac ttccagtcga cgttgggcgc cacgaggagc 22020aagtcggtcc agaacgtatg ccggcggtct cgaaggtgaa ccagtccgtc atcaaacttc 22080aagcggaaat ctagcaatag gtgcaccatg aacaggtagt cgcgcgcgcg tcggaggtac 22140gggaagaggg tgcgtctgtg ctagccgtgt gagtcgccca agtagtggca ttaaagtgaa 22200aggcgaagcg acccgagaag gagaaggaga acgcaggcgt atggtgcgcg gtgacccagc 22260agaagtaagt cggcggcgtg acacgcgaat ggaggaaacg gtacgaacta atcgtggcca 22320cccaacgact ttgggtggta aacatcgcgg tgtagaagag aaagaaggag cgacaggtgc 22380taatggagac cactaccgcc cgcgagcccg aaccctcttc ccgcgaagaa aaagaagaac 22440ccgcgttacc ggtttaggcg gcggctccag ctaccggcgc ccgacccaca cgcgccgtgg 22500tcgcgcagaa cactactcag aaggagcagg agcctgagct atgcggcgga gtaggcgaaa 22560aaacccccgc gggcccctcc gccgccgctg cccctgcccc tgctgtgcag gaggtaccaa 22620ccccctgcag cgcggcgtgg cgcaggcgcg agcccccacc aaagcgcgac gaggagaagg 22680gctgaccggt aaaggaagag gatatccgtc tttttctagt acctcagtca gctcttcttc 22740ctgtcggatt ggcgggggag actcaagcgg tggtggcgga ggtggctacg gcggttgcgc 22800ggatggtgga aggggcagct ccgtgggggc gaactcctcc tccttcacta atagctcgtc 22860ctgggtccaa aacattcgct tctgctgctc ctggcgagtc atggttgtct cctatttttc 22920gttctggtcc tgttgcgtct ccgtttgctc cttgttcagc ccgcccccct gctttccgta 22980ccgctgatgg atctacaccc tctgctgcac gacaacttcg tagacgtcgc ggtcacgcgg 23040taatagacgc tgcgcaacgt tctcgcgtcg ctacacgggg agcggtatcg cctacagtcg 23100gaacggatgc ttgcggtgga taagagtggc gcgcatgggg ggtttgcggt tcttttgccg 23160tgtacgctcg ggttgggcgc ggagttgaag atggggcata aacggcacgg tctccacgaa 23220cggtggatag tgtagaaaaa ggttttgacg ttctatgggg ataggacggc acggttggcg 23280tcggctcgcc tgttcgtcga ccggaacgcc gtcccgcgac agtatggact atagcggagc 23340gagttgcttc acggttttta gaaactccca gaacctgcgc tgctcttcgc gcgccgtttg 23400cgagacgttg tccttttgtc gcttttactt tcagtgagac ctcacaacca ccttgagctc 23460ccactgttgc gcgcggatcg gcatgatttt gcgtcgtagc tccagtgggt gaaacggatg 23520ggccgtgaat tggatggggg gttccagtac tcgtgtcagt actcactcga ctagcacgcg 23580gcacgcgtcg gggacctctc cctacgttta aacgttcttg tttgtctcct cccggatggg 23640cgtcaaccgc tgctcgtcga tcgcgcgacc gaagtttgcg cgctcggacg gctgaacctc 23700ctcgctgcgt ttgattacta ccggcgtcac gagcaatggc acctcgaact cacgtacgtc 23760gccaagaaac gactgggcct ctacgtcgcg ttcgatctcc tttgtaacgt gatgtggaaa 23820gctgtcccga tgcatgcggt ccggacgttc tagaggttgc acctcgagac gttggaccag 23880aggatggaac cttaaaacgt gcttttggcg gaacccgttt tgcacgaagt aaggtgcgag 23940ttcccgctcc gcgcggcgct gatgcaggcg ctgacgcaaa tgaataaaga tacgatgtgg 24000accgtctgcc ggtacccgca aaccgtcgtc acgaacctcc tcacgttgga gttcctcgac 24060gtctttgacg atttcgtttt gaacttcctg gatacctgcc ggaagttgct cgcgaggcac 24120cggcgcgtgg accgcctgta gtaaaagggg cttgcggacg aattttggga cgttgtccca 24180gacggtctga agtggtcagt ttcgtacaac gtcttgaaat ccttgaaata ggatctcgcg 24240agtccttaga acgggcggtg gacgacacgt gaaggatcgc tgaaacacgg gtaattcatg 24300gcgcttacgg gaggcggcga aaccccggtg acgatggaag acgtcgatcg gttgatggaa 24360cggatggtga gactgtatta ccttctgcac tcgccactgc cagatgacct cacagtgaca 24420gcgacgttgg atacgtgggg cgtggcgagg gaccaaacgt taagcgtcga cgaattgctt 24480tcagtttaat agccatggaa actcgacgtc ccagggagcg gactgctttt caggcgccga 24540ggccccaact ttgagtgagg ccccgacacc tgcagccgaa tggaagcgtt taaacatgga 24600ctcctgatgg tgcgggtgct ctaatccaag atgcttctgg ttagggcggg cggattacgc 24660ctcgaatggc ggacgcagta atgggtcccg gtgtaagaac cggttaacgt tcggtagttg 24720tttcgggcgg ttctcaaaga cgatgctttc cctgcccccc aaatgaacct gggggtcagg 24780ccgctcctcg agttgggtta ggggggcggc ggcgtcggga tagtcgtcgt cggcgcccgg 24840gaacgaaggg tcctaccgtg ggtttttctt cgacgtcgac ggcggcggtg ggtgcctgct 24900cctccttatg accctgtcag tccgtctcct ccaaaacctg ctcctcctcc tcctgtacta 24960ccttctgacc ctctcggatc tgctccttcg aaggctccag cttctccaca gtctgctttg 25020tggcagtggg agccagcgta aggggagcgg ccgcggggtc tttagccgtt ggccaaggtc 25080gtaccgatgt tggaggcgag gagtccgcgg cggccgtgac gggcaagcgg ctgggttggc 25140atctaccctg tggtgacctt ggtcccggcc attcaggttc gtcggcggcg gcaatcgggt 25200tctcgttgtt gtcgcggttc cgatggcgag taccgcgccc gtgttcttgc ggtatcaacg 25260aacgaacgtt ctgacacccc cgttgtagag gaagcgggcg gcgaaagaag agatggtagt 25320gccgcaccgg aagggggcat tgtaggacgt aatgatggca gtagagatgt cgggtatgac 25380gtggccgccg tcgccgtcgt tgtcgtcgcc ggtgtgtctt cgtttccgct ggcctatcgt 25440tctgagactg tttcgggttc tttaggtgtc gccgccgtcg tcgtcctcct cctcgcgacg 25500cagaccgcgg gttgcttggg catagctggg cgctcgaatc tttgtcctaa aaagggtgag 25560acatacgata taaagttgtc tcgtccccgg ttcttgttct cgacttttat tttttgtcca 25620gagacgctag ggagtgggcg tcgacggaca tagtgttttc gcttctagtc gaagccgcgt 25680gcgaccttct gcgcctccga gagaagtcat ttatgacgcg cgactgagaa ttcctgatca 25740aagcgcggga aagagtttaa attcgcgctt ttgatgcagt agaggtcgcc ggtgtgggcc 25800gcggtcgtgg acaacagtcg cggtaatact cgttccttta agggtgcggg atgtacacct 25860caatggtcgg tgtttaccct gaacgccgac ctcgacgggt tctgatgagt tgggcttatt 25920tgatgtactc gcgccctggg gtgtactata gggcccagtt gccttatgcg cgggtggctt 25980tggcttaaga ggaccttgtc cgccgataat ggtggtgtgg agcattattg gaattagggg 26040catcaaccgg gcgacgggac cacatggtcc tttcagggcg agggtggtga caccatgaag 26100ggtctctgcg ggtccggctt caagtctact gattgagtcc ccgcgtcgaa cgcccgccga 26160aagcagtgtc ccacgccagc gggcccgtcc catattgagt ggactgttag tctcccgctc 26220cataagtcga gttgctgctc agccactcga ggagcgaacc agaggcaggc ctgccctgta 26280aagtctagcc gccgcggccg gcgagaagta agtgcggagc agtccgttag gattgagacg 26340tctggagcag gagactcggc gcgagacctc cgtaaccttg agacgttaaa taactcctca 26400aacacggtag ccagatgaaa ttggggaaga gccctggagg gccggtgata ggcctagtta 26460aataaggatt gaaactgcgc catttcctga gccgcctgcc gatgctgact tacaattcac 26520ctctccgtct cgttgacgcg gactttgtgg accaggtgac agcggcggtg ttcacgaaac 26580gggcgctgag gccactcaaa acgatgaaac ttaacgggct cctagtatag ctcccgggcc 26640gcgtgccgca ggccgaatgg cgggtccctc tcgaacgggc atcggactaa gccctcaaat 26700gggtcgcggg ggacgatcaa ctcgccctgt cccctgggac acaagagtga cactaaacgt 26760tgacaggatt gggacctaat gtagttctag aaacaacggt agagacacga ctcatattat 26820ttatgtcttt aattttatat gaccccgagg atagcggtag gacatttgcg gtggcagaag 26880tgggcgggtt cgtttggttc cgcttggaat ggaccatgaa aattgtagag agggagacac 26940taaatgttgt caaagttggg tctgcctcac tcagatgctc tcttggagag gctcgagtcg 27000atgaggtagt cttttttgtg gtgggaggaa tggacggccc ttgcatgctc acgcagtggc 27060cggcgacgtg gtgtggatgg cggactggca tttggtctga aaaaggcctg tctggagtta 27120ttgagacaaa tggtcttgtc ctccactcga atcttttggg aatcccataa tccggtttcc 27180gcgtcgatga caccccaaat acttgttaag ttcgttgaga tgcccgataa gattaagtcc 27240aaagagatct tagccccaac cccaataaga gacagaacac taagagaaat aagaatatga 27300ttgcgaagag acggattccg agcggcggac gacacacgtg taaacgtaaa taacagtcga 27360aaaatttgcg accccagcgg tgggttctac taatccatgt attaggatcc aaatgagtgg 27420gaacgcagtc gggtgccatg gtgggttttc cacctaaaat tcctcggtcg gacattacaa 27480tgtaagcgtc gacttcgatt actcacgtgg tgagaatatt ttacgtggtg tcttgtactt 27540ttcgacgaat aagcggtgtt tttgttttaa ccgttcatac gacaaatacg ataaaccgtc 27600ggtccactgt gatgtctcat attacaatgt caaaaggtcc cattttcagt attttgaaaa 27660tacatatgaa aaggtaaaat actttacacg ctgtaatggt acatgtactc gtttgtcata 27720ttcaacaccg ggggtgtttt aacacacctt ttgtgaccgt gaaagacgac gtgacgatac 27780gattaatgtc acgagcgaaa ccagacatgg gatgagatat aatttatgtt ttcgtctgcg 27840tcgaaataac tccttttctt ttacggaatt aaatgattca atgtttcgat tacagtggtg 27900attgacgaaa tgagcgacga acgttttgtt taagtttttc aatcgtaata ttaatcttat 27960cctaaatttg gggggccagt aaaggacgag ttatggtaag gggacttgtt aactgagata 28020caccctatac gaggtcgcga tgttggaact tcagtccgaa ggacctacag tcgtagactg 28080aaaccggtcg tggacagggc gcctaaacaa ggtcaggttg atgtcgctgg gtgggattgt 28140ctctactggt tgtgttggtt gcgccggcgg cgatggcctg aatgtagatg gtgtttatgt 28200ggggttcaaa gacggaaaca gttattgacc ctattgaacc cgtacaccac caagaggtat 28260cgcgaataca aacatacgga ataataatac accgagtaga cgacggattt cgcgtttgcg 28320cgggctggtg ggtagatatc agggtagtaa cacgatgtgg gtttgttact accttaggta 28380tctaacctgc ctgactttgt gtacaagaaa agagaatgtc atactaattt actctgtact 28440aaggagctca aaaatataat gactgggaac aacgcgaaaa aacacgcacg aggtgtaacc 28500gacgccaaag agtgtagctt catctgacgt aaggtcggaa gtgtcagata aacgaaatgc 28560ctaaacagtg ggagtgcgag tagacgtcgg agtagtgaca ccagtagcgg aaataggtca 28620cgtaactgac ccagacacac gcgaaacgta tagagtctgt ggtaggggtc atgtccctgt 28680cctgatatcg actcgaagaa tcttaagaaa ttaatacttt aaatgacact gaaaagacga 28740ctaataaacg tgggatagac gcaaaacaag gggctggagg ttcggagttt ctgtatatag 28800tacgtctaag tgagcatata ccttataagg ttcaacgatg ttactttttt cgctagaaag 28860gcttcggacc aatatacgtt agtagagaca ataccacaag acgtcatggt agaatcggga 28920tcgatatata gggatggaac tgtaaccgac cttgcgttat ctacggtact tggtgggttg 28980aaaggggcgc gggcgatacg aaggtgacgt tgttcaacaa cggccgccga aacagggtcg 29040gttagtcgga gcgggtggaa gagggtgggg gtgactttag tcgatgaaat tagattgtcc 29100tcctctactg actgtgggat ctagatcttt acctgcctta ataatgtctc gtcgcggacg 29160atctttctgc gtcccgtcgc cggctcgttg tcgcgtactt agttctcgag gttctgtacc 29220aattgaacgt ggtcacgttt tccccataga aaacagagca tttcgtccgg tttcagtgga 29280tgctgtcatt atggtggcct gtggcggaat cgatgttcaa cggttggttc gcagtcttta 29340accaccagta ccaccctctt ttcgggtaat ggtattgagt cgtgagccat ctttggcttc 29400cgacgtaagt gagtggaaca gttcctggac tcctagagac gtgggaataa ttctgggaca 29460cgccagagtt tctagaataa gggaaattga ttattttttt ttattatttc gtagtgaatg 29520aattttagtc aatcgtttaa agacaggtca aataagtcgt cgtggaggaa cgggaggagg 29580gtcgagacca taacgtcgaa ggaggaccga cgtttgaaag aggtgttaga tttaccttac 29640agtcaaagga ggacaaggac aggtaggcgt gggtgataga agtacaacaa cgtctacttc 29700gcgcgttctg gcagacttct atggaagttg gggcacatag gtatactgtg cctttggcca 29760ggaggttgac acggaaaaga atgaggaggg aaacataggg ggttacccaa agttctctca 29820gggggacccc atgagagaaa cgcggatagg cttggagatc aatggaggtt accgtacgaa 29880cgcgagtttt acccgttgcc ggagagagac ctgctccggc cgttggaatg gagggtttta 29940cattggtgac actcgggtgg agagtttttt tggttcagtt tgtatttgga cctttataga 30000cgtggggagt gtcaatggag tcttcgggat tgacaccgac ggcggcgtgg agattaccag 30060cgcccgttgt gtgagtggta cgttagtgtc cggggcgatt ggcacgtgct gaggtttgaa 30120tcgtaacggt gggttcctgg ggagtgtcac agtcttcctt tcgatcggga cgtttgtagt 30180ccgggggagt ggtggtggct atcgtcatgg gaatgatagt gacggagtgg gggagattga 30240tgacggtgac catcgaaccc gtaactgaac tttctcgggt aaatatgtgt tttacctttt 30300gatcctgatt tcatgccccg aggaaacgta cattgtctgc tggatttgtg aaactggcat 30360cgttgaccag gtccacactg ataattatta tgaaggaacg tttgatttca atgacctcgg 30420aacccaaaac taagtgttcc gttatacgtt gaattacatc gtcctcctga ttcctaacta 30480agagttttgt ctgcggaata tgaactacaa tcaataggca aactacgagt tttggttgat 30540ttagattctg atcctgtccc gggagaaaaa tatttgagtc gggtgttgaa cctataattg 30600atgttgtttc cggaaatgaa caaatgtcga agtttgttaa ggtttttcga actccaattg 30660gattcgtgac ggttccccaa ctacaaactg cgatgtcggt atcggtaatt acgtcctcta 30720cccgaactta aaccaagtgg attacgtggt ttgtgtttag gggagttttg tttttaaccg 30780gtaccggatc ttaaactaag tttgttccga taccaaggat ttgatccttg accggaatca 30840aaactgtcgt gtccacggta atgtcatcct ttgtttttat tactattcga ttgaaacacc 30900tggtgtggtc gaggtagagg attgacatct gatttacgtc tctttctacg atttgagtga 30960aaccagaatt gttttacacc gtcagtttat gaacgatgtc aaagtcaaaa ccgacaattt 31020ccgtcaaacc gaggttatag accttgtcaa gtttcacgag tagaataata ttctaaactg 31080cttttacctc acgatgattt gttaaggaag gacctgggtc ttataacctt gaaatcttta 31140cctctagaat gacttccgtg tcggatatgt ttgcgacaac ctaaatacgg attggatagt 31200cgaataggtt ttagagtgcc attttgacgg ttttcattgt aacagtcagt tcaaatgaat 31260ttgcctctgt tttgatttgg acattgtgat tggtaatgtg atttgccatg tgtcctttgt 31320cctctgtgtt gaggttcacg tatgagatac agtaaaagta ccctgaccag accggtgttg 31380atgtaattac tttataaacg gtgtaggaga atgtgaaaaa gtatgtaacg ggttcttatt 31440tcttagcaaa cacaatacaa agttgcacaa ataaaaagtt aacgtctttt aaagttcagt 31500aaaaagtaag tcatcatatc ggggtggtgg tgtatcgaat atgtctagtg gcatggaatt 31560agtttgagtg tcttgggatc ataagttgga cggtggaggg agggttgtgt gtctcatgtg 31620tcaggaaaga ggggccgacc ggaatttttc gtagtatagt acccattgtc tgtataagaa 31680tccacaatat aaggtgtgcc aaaggacagc tcggtttgcg agtagtcact ataattattt 31740gaggggcccg tcgagtgaat tcaagtacag cgacaggtcg acgactcggt gtccgacgac 31800aggttgaacg ccaacgaatt gcccgccgct tcctcttcag gtgcggatgt acccccatct 31860cagtattagc acgtagtcct atcccgccac cacgacgtcg tcgcgcgctt atttgacgac 31920ggcggcggcg aggcaggacg tccttatgtt gtaccgtcac cagaggagtc gctactaagc 31980gtggcgggcg tcgtattccg cggaacagga ggcccgtgtc gtcgcgtggg actagagtga 32040atttagtcgt gtcattgacg tcgtgtcgtg gtgttataac aagttttagg gtgtcacgtt 32100ccgcgacata ggtttcgagt accgcccctg gtgtcttggg tgcaccggta gtatggtgtt 32160cgcgtccatc taattcaccg ctggggagta tttgtgcgac ctgtatttgt aatggagaaa 32220accgtacaac attaagtggt ggagggccat ggtatatttg gagactaatt tgtaccgcgg 32280taggtggtgg taggatttgg tcgaccggtt ttggacgggc ggccgatatg tgacgtccct 32340tggccctgac cttgttactg tcacctctcg ggtcctgagc attggtacct agtagtacga 32400gcagtactat agttacaacc gtgttgtgtc cgtgtgcacg tatgtgaagg agtcctaatg 32460ttcgaggagg gcgcaatctt ggtatagggt cccttgttgg gtaaggactt agtcgcattt 32520agggtgtgac gtcccttctg gagcgtgcat tgagtgcaac acgtaacagt ttcacaatgt 32580aagcccgtcg tcgcctacta ggaggtcata ccatcgcgcc caaagacaga gttttcctcc 32640atctgctagg gatgacatgc ctcacgcggc tctgttggct ctagcacaac cagcatcaca 32700gtacggttta ccttgcggcc tgcatcagta taaaggactt cgttttggtc cacgcccgca 32760ctgtttgtct agacgcagag gccagagcgg cgaatctagc gagacacatc atcaacatca 32820tataggtgag agagtttcgt aggtccgcgg gggaccgaag cccaagatac atttgaggaa 32880gtacgcggcg acgggactat tgtaggtggt ggcgtcttat tcggtgtggg tcggttggat 32940gtgtaagcaa gacgctcagt gtgtgccctc ctcgcccttc tcgaccttct tggtacaaaa 33000aaaaaaataa ggttttctaa taggttttgg agttttactt ctagataatt cacttgcgcg 33060aggggaggcc accgcaccag tttgagatgt cggtttcttg tctattaccg taaacattct 33120acaacgtgtt accgaaggtt ttccgtttgc cgggagtgca ggttcacctg catttccgat 33180ttgggaagtc ccacttagag gagatatttg taaggtcgtg gaagttggta cgggtttatt 33240aagagtagag cggtggaaga gttatataga gattcgttta gggcttataa ttcaggccgg 33300taacattttt agacgaggtc tcgcgggagg tggaagtcgg agttcgtcgc ttagtactaa 33360cgtttttaag tccaaggagt gtctggacat attctaagtt ttcgccttgt aattgttttt 33420atggcgctag ggcatccagg gaagcgtccc ggtcgacttg tattagcacg tccagacgtg 33480cctggtcgcg ccggtgaagg ggcggtcctt ggtactgttt tcttgggtgt gactaatact 33540gtgcgtatga gcctcgatac gattggtcgc atcggggcta cattcgaaca acgtacccgc 33600cgctatattt tacgttccac gacgagtttt ttagtccgtt tcggagcgcg ttttttcttt 33660cgtgtagcat cagtacgagt acgtctattt ccgtccattc gaggccttgg tggtgtcttt 33720ttctgtggta aaaagagagt ttgtacagac gcccaaagac gtatttgtgt tttattttat 33780tgtttttttg taaatttgta atcttcggac agaatgttgt cctttttgtt gggaatattc 33840gtattctgcc tgatgccggt acggccgcac tggcattttt ttgaccagtg gcactaattt 33900ttcgtggtgg ctgtcgagga gccagtacag gcctcagtat tacattctga gccatttgtg 33960tagtccaact aagtgtagcc agtcacgatt tttcgctggc tttatcgggc ccccttatgt 34020atgggcgtcc gcatctctgt tgtaatgtcg ggggtatcct ccatattgtt ttaattatcc 34080tctctttttg tgtatttgtg gactttttgg gaggacggat ccgttttatc gtgggagggc 34140gaggtcttgt tgtatgtcgc gaaggtgtcg ccgtcggtat tgtcagtcgg aatggtcatt 34200ttttcttttg gataattttt ttgtggtgag ctgtgccgtg gtcgagttag tcagtgtcac 34260attttttccc ggttcacgtc tcgctcatat atatcctgat tttttactgc attgccaatt 34320tcaggtgttt tttgtgggtc ttttggcgtg cgcttggatg cgggtctttg ctttcggttt 34380tttgggtgtt gaaggagttt agcagtgaag gcaaaagggt gcaatgcagt gaagggtaaa 34440attcttttga tgttaagggt tgtgtatgtt caatgaggcg ggattttgga tgcagtgggc 34500ggggcaaggg tgcggggcgc ggtgcagtgt ttgaggtggg ggagtaatag tataaccgaa 34560gttaggtttt attccatata ataactacta caattaattc ttaagcctag acgctgcgct 34620ccgacctacc ggaaggggta atactaagaa gagcgaaggc cgccgtagcc ctacgggcgc 34680aacgtccggt acgacaggtc cgtccatcta ctgctggtag tccctgtcga agttccggtc 34740gttttccggt ccttggcatt tttccggcgc aacgaccgca aaaaggtatc cgaggcgggg 34800ggactgctcg tagtgttttt agctgcgagt tcagtctcca ccgctttggg ctgtcctgat 34860atttctatgg tccgcaaagg gggaccttcg agggagcacg cgagaggaca aggctgggac 34920ggcgaatggc ctatggacag gcggaaagag ggaagccctt cgcaccgcga aagagtatcg 34980agtgcgacat ccatagagtc aagccacatc cagcaagcga ggttcgaccc gacacacgtg 35040cttggggggc aagtcgggct ggcgacgcgg aataggccat tgatagcaga actcaggttg 35100ggccattctg tgctgaatag cggtgaccgt cgtcggtgac cattgtccta atcgtctcgc 35160tccatacatc cgccacgatg tctcaagaac ttcaccaccg gattgatgcc gatgtgatct 35220tcctgtcata aaccatagac gcgagacgac ttcggtcaat ggaagccttt ttctcaacca 35280tcgagaacta ggccgtttgt ttggtggcga ccatcgccac caaaaaaaca aacgttcgtc 35340gtctaatgcg cgtctttttt tcctagagtt cttctaggaa actagaaaag atgccccaga 35400ctgcgagtca ccttgctttt gagtgcaatt ccctaaaacc agtactctaa tagtttttcc 35460tagaagtgga tctaggaaaa tttagttaga tttcatatat actcatttga accagactgt 35520caatggttac gaattagtca ctccgtggat agagtcgcta gacagataaa gcaagtaggt 35580atcaacggac tgaggggcag cacatctatt gatgctatgc cctcccgaat ggtagaccgg 35640ggtcacgacg ttactatggc gctctgggtg cgagtggccg aggtctaaat agtcgttatt 35700tggtcggtcg gccttcccgg ctcgcgtctt caccaggacg ttgaaatagg cggaggtagg 35760tcagataatt aacaacggcc cttcgatctc attcatcaag cggtcaatta tcaaacgcgt 35820tgcaacaacg gtaacgatgt ccgtagcacc acagtgcgag cagcaaacca taccgaagta 35880agtcgaggcc aagggttgct gttccgctca atgtactagg gggtacaaca cgttttttcg 35940ccaatcgagg gaagccagga ggctagcaac agtcttcatt caaccggcgt cacaatagtg 36000agtaccaata ccgtcgtgac gtattaagag aatgacagta cggtaggcat tctacgaaaa 36060gacactgacc actcatgagt tggttcagta agactcttat cacatacgcc gctggctcaa 36120cgagaacggg ccgcagttgt gccctattat ggcgcggtgt atcgtcttga aattttcacg 36180agtagtaacc ttttgcaaga agccccgctt ttgagagttc ctagaatggc gacaactcta 36240ggtcaagcta cattgggtga gcacgtgggt tgactagaag tcgtagaaaa tgaaagtggt 36300cgcaaagacc cactcgtttt tgtccttccg ttttacggcg ttttttccct tattcccgct 36360gtgcctttac aacttatgag tatgagaagg aaaaagttat aataacttcg taaatagtcc 36420caataacaga gtactcgcct atgtataaac ttacataaat ctttttattt gtttatcccc 36480aaggcgcgtg taaaggggct tttcacggtg gactgcagat tctttggtaa taatagtact 36540gtaattggat atttttatcc gcatagtgct ccgggaaagc agaagttctt aacctaggct 36600taagaattaa agaattaatt 36620 32 1479 DNA Artificial Sequence Codon optimized DNA encoding a tPA-gag fusion open reading frame 32atggatgcaa tgaagagagg gctctgctgt gtgctgctgc tgtgtggagc agtcttcgtt 60tcgcccagcg agatctccat tgtgtgggcc tccagggagc tggagaggtt tgctgtgaac 120cctggcctgc tggagacctc tgaggggtgc aggcagatcc tgggccagct ccagccctcc 180ctgcaaacag gctctgagga gctgaggtcc ctgtacaaca cagtggctac cctgtactgt 240gtgcaccaga agattgatgt gaaggacacc aaggaggccc tggagaagat tgaggaggag 300cagaacaagt ccaagaagaa ggcccagcag gctgctgctg gcacaggcaa ctccagccag 360gtgtcccaga actaccccat tgtgcagaac ctccagggcc agatggtgca ccaggccatc 420tccccccgga ccctgaatgc ctgggtgaag gtggtggagg agaaggcctt ctcccctgag 480gtgatcccca tgttctctgc cctgtctgag ggtgccaccc cccaggacct gaacaccatg 540ctgaacacag tggggggcca tcaggctgcc atgcagatgc tgaaggagac catcaatgag 600gaggctgctg agtgggacag gctgcatcct gtgcacgctg gccccattgc ccccggccag 660atgagggagc ccaggggctc tgacattgct ggcaccacct ccaccctcca ggagcagatt 720ggctggatga ccaacaaccc ccccatccct gtgggggaaa tctacaagag gtggatcatc 780ctgggcctga acaagattgt gaggatgtac tcccccacct ccatcctgga catcaggcag 840ggccccaagg agcccttcag ggactatgtg gacaggttct acaagaccct gagggctgag 900caggcctccc aggaggtgaa gaactggatg acagagaccc tgctggtgca gaatgccaac 960cctgactgca agaccatcct gaaggccctg ggccctgctg ccaccctgga ggagatgatg 1020acagcctgcc agggggtggg gggccctggt cacaaggcca gggtgctggc tgaggccatg 1080tcccaggtga ccaactccgc caccatcatg atgcagaggg gcaacttcag gaaccagagg 1140aagacagtga agtgcttcaa ctgtggcaag gtgggccaca ttgccaagaa ctgtagggcc 1200cccaggaaga agggctgctg gaagtgtggc aaggagggcc accagatgaa ggactgcaat 1260gagaggcagg ccaacttcct gggcaaaatc tggccctccc acaagggcag gcctggcaac 1320ttcctccagt ccaggcctga gcccacagcc cctcccgagg agtccttcag gtttggggag 1380gagaagacca cccccagcca gaagcaggag cccattgaca aggagctgta ccccctggcc 1440tccctgaggt ccctgtttgg caacgacccc tcctcccag 1479 33 493 PRT Artificial Sequence tPA-gag fusion open reading frame 33Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly 1 5 10 15Ala Val Phe Val Ser Pro Ser Glu Ile Ser Ile Val Trp Ala Ser Arg 20 25 30Glu Leu Glu Arg Phe Ala Val Asn Pro Gly Leu Leu Glu Thr Ser Glu 35 40 45Gly Cys Arg Gln Ile Leu Gly Gln Leu Gln Pro Ser Leu Gln Thr Gly 50 55 60Ser Glu Glu Leu Arg Ser Leu Tyr Asn Thr Val Ala Thr Leu Tyr Cys65 70 75 80Val His Gln Lys Ile Asp Val Lys Asp Thr Lys Glu Ala Leu Glu Lys 85 90 95Ile Glu Glu Glu Gln Asn Lys Ser Lys Lys Lys Ala Gln Gln Ala Ala 100 105 110Ala Gly Thr Gly Asn Ser Ser Gln Val Ser Gln Asn Tyr Pro Ile Val 115 120 125Gln Asn Leu Gln Gly Gln Met Val His Gln Ala Ile Ser Pro Arg Thr 130 135 140Leu Asn Ala Trp Val Lys Val Val Glu Glu Lys Ala Phe Ser Pro Glu145 150 155 160Val Ile Pro Met Phe Ser Ala Leu Ser Glu Gly Ala Thr Pro Gln Asp 165 170 175Leu Asn Thr Met Leu Asn Thr Val Gly Gly His Gln Ala Ala Met Gln 180 185 190Met Leu Lys Glu Thr Ile Asn Glu Glu Ala Ala Glu Trp Asp Arg Leu 195 200 205His Pro Val His Ala Gly Pro Ile Ala Pro Gly Gln Met Arg Glu Pro 210 215 220Arg Gly Ser Asp Ile Ala Gly Thr Thr Ser Thr Leu Gln Glu Gln Ile225 230 235 240Gly Trp Met Thr Asn Asn Pro Pro Ile Pro Val Gly Glu Ile Tyr Lys 245 250 255Arg Trp Ile Ile Leu Gly Leu Asn Lys Ile Val Arg Met Tyr Ser Pro 260 265 270Thr Ser Ile Leu Asp Ile Arg Gln Gly Pro Lys Glu Pro Phe Arg Asp 275 280 285Tyr Val Asp Arg Phe Tyr Lys Thr Leu Arg Ala Glu Gln Ala Ser Gln 290 295 300Glu Val Lys Asn Trp Met Thr Glu Thr Leu Leu Val Gln Asn Ala Asn305 310 315 320Pro Asp Cys Lys Thr Ile Leu Lys Ala Leu Gly Pro Ala Ala Thr Leu 325 330 335Glu Glu Met Met Thr Ala Cys Gln Gly Val Gly Gly Pro Gly His Lys 340 345 350Ala Arg Val Leu Ala Glu Ala Met Ser Gln Val Thr Asn Ser Ala Thr 355 360 365Ile Met Met Gln Arg Gly Asn Phe Arg Asn Gln Arg Lys Thr Val Lys 370 375 380Cys Phe Asn Cys Gly Lys Val Gly His Ile Ala Lys Asn Cys Arg Ala385 390 395 400Pro Arg Lys Lys Gly Cys Trp Lys Cys Gly Lys Glu Gly His Gln Met 405 410 415Lys Asp Cys Asn Glu Arg Gln Ala Asn Phe Leu Gly Lys Ile Trp Pro 420 425 430Ser His Lys Gly Arg Pro Gly Asn Phe Leu Gln Ser Arg Pro Glu Pro 435 440 445Thr Ala Pro Pro Glu Glu Ser Phe Arg Phe Gly Glu Glu Lys Thr Thr 450 455 460Pro Ser Gln Lys Gln Glu Pro Ile Asp Lys Glu Leu Tyr Pro Leu Ala465 470 475 480Ser Leu Arg Ser Leu Phe Gly Asn Asp Pro Ser Ser Gln 485 490 34 4053 DNA Artificial Sequence Codon optimized DNA encoding a gag-IA pol fusion 34atgggtgcta gggcttctgt gctgtctggt ggtgagctgg acaagtggga gaagatcagg 60ctgaggcctg gtggcaagaa gaagtacaag ctaaagcaca ttgtgtgggc ctccagggag 120ctggagaggt ttgctgtgaa ccctggcctg ctggagacct ctgaggggtg caggcagatc 180ctgggccagc tccagccctc cctgcaaaca ggctctgagg agctgaggtc cctgtacaac 240acagtggcta ccctgtactg tgtgcaccag aagattgatg tgaaggacac caaggaggcc 300ctggagaaga ttgaggagga gcagaacaag tccaagaaga aggcccagca ggctgctgct 360ggcacaggca actccagcca ggtgtcccag aactacccca ttgtgcagaa cctccagggc 420cagatggtgc accaggccat ctccccccgg accctgaatg cctgggtgaa ggtggtggag 480gagaaggcct tctcccctga ggtgatcccc atgttctctg ccctgtctga gggtgccacc 540ccccaggacc tgaacaccat gctgaacaca gtggggggcc atcaggctgc catgcagatg 600ctgaaggaga ccatcaatga ggaggctgct gagtgggaca ggctgcatcc tgtgcacgct 660ggccccattg cccccggcca gatgagggag cccaggggct ctgacattgc tggcaccacc 720tccaccctcc aggagcagat tggctggatg accaacaacc cccccatccc tgtgggggaa 780atctacaaga ggtggatcat cctgggcctg aacaagattg tgaggatgta ctcccccacc 840tccatcctgg acatcaggca gggccccaag gagcccttca gggactatgt ggacaggttc 900tacaagaccc tgagggctga gcaggcctcc caggaggtga agaactggat gacagagacc 960ctgctggtgc agaatgccaa ccctgactgc aagaccatcc tgaaggccct gggccctgct 1020gccaccctgg aggagatgat gacagcctgc cagggggtgg ggggccctgg tcacaaggcc 1080agggtgctgg ctgaggccat gtcccaggtg accaactccg ccaccatcat gatgcagagg 1140ggcaacttca ggaaccagag gaagacagtg aagtgcttca actgtggcaa ggtgggccac 1200attgccaaga actgtagggc ccccaggaag aagggctgct ggaagtgtgg caaggagggc 1260caccagatga aggactgcaa tgagaggcag gccaacttcc tgggcaaaat ctggccctcc 1320cacaagggca ggcctggcaa cttcctccag tccaggcctg agcccacagc ccctcccgag 1380gagtccttca ggtttgggga ggagaagacc acccccagcc agaagcagga gcccattgac 1440aaggagctgt accccctggc ctccctgagg tccctgtttg gcaacgaccc ctcctcccag 1500atggctccca tctcccccat tgagactgtg cctgtgaagc tgaagcctgg catggatggc 1560cccaaggtga agcagtggcc cctgactgag gagaagatca aggccctggt ggaaatctgc 1620actgagatgg agaaggaggg caaaatctcc aagattggcc ccgagaaccc ctacaacacc 1680cctgtgtttg ccatcaagaa gaaggactcc accaagtgga ggaagctggt ggacttcagg 1740gagctgaaca agaggaccca ggacttctgg gaggtgcagc tgggcatccc ccaccccgct 1800ggcctgaaga agaagaagtc tgtgactgtg ctggctgtgg gggatgccta cttctctgtg 1860cccctggatg aggacttcag gaagtacact gccttcacca tcccctccat caacaatgag 1920acccctggca tcaggtacca gtacaatgtg ctgccccagg gctggaaggg ctcccctgcc 1980atcttccagt cctccatgac caagatcctg gagcccttca ggaagcagaa ccctgacatt 2040gtgatctacc agtacatggc tgccctgtat gtgggctctg acctggagat tgggcagcac 2100aggaccaaga ttgaggagct gaggcagcac ctgctgaggt ggggcctgac cacccctgac 2160aagaagcacc agaaggagcc ccccttcctg tggatgggct atgagctgca ccccgacaag 2220tggactgtgc agcccattgt gctgcctgag aaggactcct ggactgtgaa tgacatccag 2280aagctggtgg gcaagctgaa ctgggcctcc caaatctacc ctggcatcaa ggtgaggcag 2340ctgtgcaagc tgctgagggg caccaaggcc ctgactgagg tgatccccct gactgaggag 2400gctgagctgg agctggctga gaacagggag atcctgaagg agcctgtgca tggggtgtac 2460tatgacccct ccaaggacct gattgctgag atccagaagc agggccaggg ccagtggacc 2520taccaaatct accaggagcc cttcaagaac ctgaagactg gcaagtatgc caggatgagg 2580ggggcccaca ccaatgatgt gaagcagctg actgaggctg tgcagaagat caccactgag 2640tccattgtga tctggggcaa gacccccaag ttcaagctgc ccatccagaa ggagacctgg 2700gagacctggt ggactgagta ctggcaggcc acctggatcc ctgagtggga gtttgtgaac 2760accccccccc tggtgaagct gtggtaccag ctggagaagg agcccattgt gggggctgag 2820accttctatg tggctggggc tgccaacagg gagaccaagc tgggcaaggc tggctatgtg 2880accaacaggg gcaggcagaa ggtggtgacc ctgactgaca ccaccaacca gaagactgcc 2940ctccaggcca tctacctggc cctccaggac tctggcctgg aggtgaacat tgtgactgcc 3000tcccagtatg ccctgggcat catccaggcc cagcctgatc agtctgagtc tgagctggtg 3060aaccagatca ttgagcagct gatcaagaag gagaaggtgt acctggcctg ggtgcctgcc 3120cacaagggca ttgggggcaa tgagcaggtg gacaagctgg tgtctgctgg catcaggaag 3180gtgctgttcc tggatggcat tgacaaggcc caggatgagc atgagaagta ccactccaac 3240tggagggcta tggcctctga cttcaacctg ccccctgtgg tggctaagga gattgtggcc 3300tcctgtgaca agtgccagct gaagggggag gccatgcatg ggcaggtgga ctgctcccct 3360ggcatctggc agctggcctg cacccacctg gagggcaagg tgatcctggt ggctgtgcat 3420gtggcctccg gctacattga ggctgaggtg atccctgctg agacaggcca ggagactgcc 3480tacttcctgc tgaagctggc tggcaggtgg cctgtgaaga ccatccacac tgccaatggc 3540tccaacttca ctggggccac agtgagggct gcctgctggt gggctggcat caagcaggag 3600tttggcatcc cctacaaccc ccagtcccag ggggtggtgg cctccatgaa caaggagctg 3660aagaagatca ttgggcaggt gagggaccag gctgagcacc tgaagacagc tgtgcagatg 3720gctgtgttca tccacaactt caagaggaag gggggcatcg ggggctactc cgctggggag 3780aggattgtgg acatcattgc cacagacatc cagaccaagg agctccagaa gcagatcacc 3840aagatccaga acttcagggt gtactacagg gactccagga accccctgtg gaagggccct 3900gccaagctgc tgtggaaggg ggagggggct gtggtgatcc aggacaactc tgacatcaag 3960gtggtgccca ggaggaaggc caagatcatc agggactatg gcaagcagat ggctggggat 4020gactgtgtgg cctccaggca ggatgaggac taa 4053 35 1350 PRT Artificial Sequence Codon optimized gag-IA pol fusion 35Met Gly Ala Arg Ala Ser Val Leu Ser Gly Gly Glu Leu Asp Lys Trp 1 5 10 15Glu Lys Ile Arg Leu Arg Pro Gly Gly Lys Lys Lys Tyr Lys Leu Lys 20 25 30His Ile Val Trp Ala Ser Arg Glu Leu Glu Arg Phe Ala Val Asn Pro 35 40 45Gly Leu Leu Glu Thr Ser Glu Gly Cys Arg Gln Ile Leu Gly Gln Leu 50 55 60Gln Pro Ser Leu Gln Thr Gly Ser Glu Glu Leu Arg Ser Leu Tyr Asn65 70 75 80Thr Val Ala Thr Leu Tyr Cys Val His Gln Lys Ile Asp Val Lys Asp 85 90 95Thr Lys Glu Ala Leu Glu Lys Ile Glu Glu Glu Gln Asn Lys Ser Lys 100 105 110Lys Lys Ala Gln Gln Ala Ala Ala Gly Thr Gly Asn Ser Ser Gln Val 115 120 125Ser Gln Asn Tyr Pro Ile Val Gln Asn Leu Gln Gly Gln Met Val His 130 135 140Gln Ala Ile Ser Pro Arg Thr Leu Asn Ala Trp Val Lys Val Val Glu145 150 155 160Glu Lys Ala Phe Ser Pro Glu Val Ile Pro Met Phe Ser Ala Leu Ser 165 170 175Glu Gly Ala Thr Pro Gln Asp Leu Asn Thr Met Leu Asn Thr Val Gly 180 185 190Gly His Gln Ala Ala Met Gln Met Leu Lys Glu Thr Ile Asn Glu Glu 195 200 205Ala Ala Glu Trp Asp Arg Leu His Pro Val His Ala Gly Pro Ile Ala 210 215 220Pro Gly Gln Met Arg Glu Pro Arg Gly Ser Asp Ile Ala Gly Thr Thr225 230 235 240Ser Thr Leu Gln Glu Gln Ile Gly Trp Met Thr Asn Asn Pro Pro Ile 245 250 255Pro Val Gly Glu Ile Tyr Lys Arg Trp Ile Ile Leu Gly Leu Asn Lys 260 265 270Ile Val Arg Met Tyr Ser Pro Thr Ser Ile Leu Asp Ile Arg Gln Gly 275 280 285Pro Lys Glu Pro Phe Arg Asp Tyr Val Asp Arg Phe Tyr Lys Thr Leu 290 295 300Arg Ala Glu Gln Ala Ser Gln Glu Val Lys Asn Trp Met Thr Glu Thr305 310 315 320Leu Leu Val Gln Asn Ala Asn Pro Asp Cys Lys Thr Ile Leu Lys Ala 325 330 335Leu Gly Pro Ala Ala Thr Leu Glu Glu Met Met Thr Ala Cys Gln Gly 340 345 350Val Gly Gly Pro Gly His Lys Ala Arg Val Leu Ala Glu Ala Met Ser 355 360 365Gln Val Thr Asn Ser Ala Thr Ile Met Met Gln Arg Gly Asn Phe Arg 370 375 380Asn Gln Arg Lys Thr Val Lys Cys Phe Asn Cys Gly Lys Val Gly His385 390 395 400Ile Ala Lys Asn Cys Arg Ala Pro Arg Lys Lys Gly Cys Trp Lys Cys 405 410 415Gly Lys Glu Gly His Gln Met Lys Asp Cys Asn Glu Arg Gln Ala Asn 420 425 430Phe Leu Gly Lys Ile Trp Pro Ser His Lys Gly Arg Pro Gly Asn Phe 435 440 445Leu Gln Ser Arg Pro Glu Pro Thr Ala Pro Pro Glu Glu Ser Phe Arg 450 455 460Phe Gly Glu Glu Lys Thr Thr Pro Ser Gln Lys Gln Glu Pro Ile Asp465 470 475 480Lys Glu Leu Tyr Pro Leu Ala Ser Leu Arg Ser Leu Phe Gly Asn Asp 485 490 495Pro Ser Ser Gln Met Ala Pro Ile Ser Pro Ile Glu Thr Val Pro Val 500 505 510Lys Leu Lys Pro Gly Met Asp Gly Pro Lys Val Lys Gln Trp Pro Leu 515 520 525Thr Glu Glu Lys Ile Lys Ala Leu Val Glu Ile Cys Thr Glu Met Glu 530 535 540Lys Glu Gly Lys Ile Ser Lys Ile Gly Pro Glu Asn Pro Tyr Asn Thr545 550 555 560Pro Val Phe Ala Ile Lys Lys Lys Asp Ser Thr Lys Trp Arg Lys Leu 565 570 575Val Asp Phe Arg Glu Leu Asn Lys Arg Thr Gln Asp Phe Trp Glu Val 580 585 590Gln Leu Gly Ile Pro His Pro Ala Gly Leu Lys Lys Lys Lys Ser Val 595 600 605Thr Val Leu Ala Val Gly Asp Ala Tyr Phe Ser Val Pro Leu Asp Glu 610 615 620Asp Phe Arg Lys Tyr Thr Ala Phe Thr Ile Pro Ser Ile Asn Asn Glu625 630 635 640Thr Pro Gly Ile Arg Tyr Gln Tyr Asn Val Leu Pro Gln Gly Trp Lys 645 650 655Gly Ser Pro Ala Ile Phe Gln Ser Ser Met Thr Lys Ile Leu Glu Pro 660 665 670Phe Arg Lys Gln Asn Pro Asp Ile Val Ile Tyr Gln Tyr Met Ala Ala 675 680 685Leu Tyr Val Gly Ser Asp Leu Glu Ile Gly Gln His Arg Thr Lys Ile 690 695 700Glu Glu Leu Arg Gln His Leu Leu Arg Trp Gly Leu Thr Thr Pro Asp705 710 715 720Lys Lys His Gln Lys Glu Pro Pro Phe Leu Trp Met Gly Tyr Glu Leu 725 730 735His Pro Asp Lys Trp Thr Val Gln Pro Ile Val Leu Pro Glu Lys Asp 740 745 750Ser Trp Thr Val Asn Asp Ile Gln Lys Leu Val Gly Lys Leu Asn Trp 755 760 765Ala Ser Gln Ile Tyr Pro Gly Ile Lys Val Arg Gln Leu Cys Lys Leu 770 775 780Leu Arg Gly Thr Lys Ala Leu Thr Glu Val Ile Pro Leu Thr Glu Glu785 790 795 800Ala Glu Leu Glu Leu Ala Glu Asn Arg Glu Ile Leu Lys Glu Pro Val 805 810 815His Gly Val Tyr Tyr Asp Pro Ser Lys Asp Leu Ile Ala Glu Ile Gln 820 825 830Lys Gln Gly Gln Gly Gln Trp Thr Tyr Gln Ile Tyr Gln Glu Pro Phe 835 840 845Lys Asn Leu Lys Thr Gly Lys Tyr Ala Arg Met Arg Gly Ala His Thr 850 855 860Asn Asp Val Lys Gln Leu Thr Glu Ala Val Gln Lys Ile Thr Thr Glu865 870 875 880Ser Ile Val Ile Trp Gly Lys Thr Pro Lys Phe Lys Leu Pro Ile Gln 885 890 895Lys Glu Thr Trp Glu Thr Trp Trp Thr Glu Tyr Trp Gln Ala Thr Trp 900 905 910Ile Pro Glu Trp Glu Phe Val Asn Thr Pro Pro Leu Val Lys Leu Trp 915 920 925Tyr Gln Leu Glu Lys Glu Pro Ile Val Gly Ala Glu Thr Phe Tyr Val 930 935 940Ala Gly Ala Ala Asn Arg Glu Thr Lys Leu Gly Lys Ala Gly Tyr Val945 950 955 960Thr Asn Arg Gly Arg Gln Lys Val Val Thr Leu Thr Asp Thr Thr Asn 965 970 975Gln Lys Thr Ala Leu Gln Ala Ile Tyr Leu Ala Leu Gln Asp Ser Gly 980 985 990Leu Glu Val Asn Ile Val Thr Ala Ser Gln Tyr Ala Leu Gly Ile Ile 995 1000 1005Gln Ala Gln Pro Asp Gln Ser Glu Ser Glu Leu Val Asn Gln Ile Ile 1010 1015 1020Glu Gln Leu Ile Lys Lys Glu Lys Val Tyr Leu Ala Trp Val Pro Ala1025 1030 1035 1040His Lys Gly Ile Gly Gly Asn Glu Gln Val Asp Lys Leu Val Ser Ala 1045 1050 1055Gly Ile Arg Lys Val Leu Phe Leu Asp Gly Ile Asp Lys Ala Gln Asp 1060 1065 1070Glu His Glu Lys Tyr His Ser Asn Trp Arg Ala Met Ala Ser Asp Phe 1075 1080 1085Asn Leu Pro Pro Val Val Ala Lys Glu Ile Val Ala Ser Cys Asp Lys 1090 1095 1100Cys Gln Leu Lys Gly Glu Ala Met His Gly Gln Val Asp Cys Ser Pro1105 1110 1115 1120Gly Ile Trp Gln Leu Ala Cys Thr His Leu Glu Gly Lys Val Ile Leu 1125 1130 1135Val Ala Val His Val Ala Ser Gly Tyr Ile Glu Ala Glu Val Ile Pro 1140 1145 1150Ala Glu Thr Gly Gln Glu Thr Ala Tyr Phe Leu Leu Lys Leu Ala Gly 1155 1160 1165Arg Trp Pro Val Lys Thr Ile His Thr Ala Asn Gly Ser Asn Phe Thr 1170 1175 1180Gly Ala Thr Val Arg Ala Ala Cys Trp Trp Ala Gly Ile Lys Gln Glu1185 1190 1195 1200Phe Gly Ile Pro Tyr Asn Pro Gln Ser Gln Gly Val Val Ala Ser Met 1205 1210 1215Asn Lys Glu Leu Lys Lys Ile Ile Gly Gln Val Arg Asp Gln Ala Glu 1220 1225 1230His Leu Lys Thr Ala Val Gln Met Ala Val Phe Ile His Asn Phe Lys 1235 1240 1245Arg Lys Gly Gly Ile Gly Gly Tyr Ser Ala Gly Glu Arg Ile Val Asp 1250 1255 1260Ile Ile Ala Thr Asp Ile Gln Thr Lys Glu Leu Gln Lys Gln Ile Thr1265 1270 1275 1280Lys Ile Gln Asn Phe Arg Val Tyr Tyr Arg Asp Ser Arg Asn Pro Leu 1285 1290 1295Trp Lys Gly Pro Ala Lys Leu Leu Trp Lys Gly Glu Gly Ala Val Val 1300 1305 1310Ile Gln Asp Asn Ser Asp Ile Lys Val Val Pro Arg Arg Lys Ala Lys 1315 1320 1325Ile Ile Arg Asp Tyr Gly Lys Gln Met Ala Gly Asp Asp Cys Val Ala 1330 1335 1340Ser Arg Gln Asp Glu Asp1345 1350 36 64 DNA Artificial Sequence Nucleotide sequence at junction between nef coding sequence and plasmid backbone of nef expression vector V1Jns/nef 36caccccgagt actacaagga ctgctaaagc ccgggcagat ctgctgtgcc ttctagttgc 60cagc 64 37 64 DNA Artificial Sequence Nucleotide sequence at junction between nef coding sequence and plasmid backbone of nef expression vector V1Jns/modified nef 37caccccgagt actacaagga ctgctaaagc ccgggcagat ctgctgtgcc ttctagttgc 60cagc 64 38 64 DNA Artificial Sequence Nucleotide sequence at junction between nef coding sequence and plasmid backbone of nef expression vector V1Jns/modified nef fused to a leader sequence 38caccccgagt actacaagga ctgctaaagc ccgggcagat ctgctgtgcc ttctagttgc 60cagc 64

Claims

1. A recombinant adenoviral vector at least partially deleted in E1 and devoid of E1 activity, comprising:a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to between from about base pair 400 to about base pair 458 of a wildtype adenovirus genome; and b) at least one gene encoding an HIV protein selected from the group consisting of HIV gag, nef, pol, and immunologically relevant modifications thereof.

2. A vector in accordance with claim 1 comprising a packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome.

3. A vector in accordance with claim 1 further comprising nucleotides corresponding to between from about base pair 3511 to about 3524 to about base pair 5798 of a wildtype adenovirus genome.

4. A vector in accordance with claim 3 comprising base pairs corresponding to 1-450 and 3511-5798 of a wildtype adenovirus genome.

5. A vector in accordance with claim 4 which is deleted of base pairs 451-3510.

6. A vector in accordance with claim 1 which is at least partially deleted in E3.

7. A vector in accordance with claim 6 wherein the E3 deleted region is from base pairs 28,133-30,818.

8. A vector in accordance with claim 1 wherein the gene encoding the HIV protein or modification thereof comprises codons optimized for expression in a human.

9. A vector in accordance with claim 1 wherein the vector comprises a gene expression cassette comprising:a) a nucleic acid encoding a protein; b) a heterologous promoter operatively linked to the nucleic acid encoding the protein; and (c) a transcription termination sequence.

10. A vector in accordance with claim 9 wherein the gene expression cassette is inserted into the E1 region.

11. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette is in an E1 parallel orientation.

12. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette is in an E1 antiparallel orientation.

13. An adenoviral vector in accordance with claim 9 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

14. An adenoviral vector in accordance with claim 13 wherein the promoter is an immediate early human cytomegalovirus promoter.

15. An adenoviral vector in accordance with claim 9 wherein the promoter is a murine cytomegalovirus promoter.

16. An adenoviral vector in accordance with claim 9 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

17. An adenoviral vector in accordance with claim 9 wherein the transcription termination sequence is a synthetic polyadenylation signal (SPA).

18. A cell comprising the adenoviral vector of claim 1.

19. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 1 into a cell line which expresses adenovirus E1 protein at complementing levels.

20. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 1 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

21. A method according to claim 20 wherein the cell expresses a transgene inclusive of nucleotides 459-3510 of adenovirus serotype 5.

22. An adenoviral vector in accordance with claim 1 wherein the HIV protein is HIV gag or an immunologically relevant modification thereof.

23. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV gag protein or immunologically relevant modification thereof.

24. A recombinant adenoviral vector at least partially deleted in E1 and devoid of E1 activity, comprising:a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome; b) a region corresponding to from about base pair 3511 to about base pair 5798 of a wildtype adenovirus genome; and c) a gene expression cassette comprising i) SEQ ID NO: 27; ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence; wherein the vector has a deletion corresponding to from about base pair 451 to about base pair 3510 of a wildtype adenovirus genome.

25. An adenoviral vector in accordance with claim 24 wherein the gene expression cassette is in an E1 parallel orientation.

26. An adenoviral vector in accordance with claim 24 wherein the gene expression cassette is in an E1 antiparallel orientation.

27. An adenoviral vector in accordance with claim 24 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

28. An adenoviral vector in accordance with claim 24 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

29. An adenoviral vector in accordance with claim 24 which is at least partially deleted in E3.

30. A cell comprising the adenoviral vector of claim 24.

31. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 24 into a cell line which expresses adenovirus E1 protein at complementing levels.

32. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 24 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

33. A method according to claim 32 wherein the cell expresses a transgene inclusive of nucleotides 459-3510 of adenovirus serotype 5.

34. An adenoviral vector in accordance with claim 1 wherein the HIV protein is HIV pol or an immunologically relevant modification thereof.

35. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV pol protein or immunologically relevant modification thereof.

36. A recombinant adenoviral vector at least partially deleted in E1 and devoid of E1 activity, comprising:a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome; b) a region corresponding to from about base pair 3511 to about base pair 5798 of a wildtype adenovirus genome; and c) a gene expression cassette comprising i) a nucleotide sequence selected the group consisting of SEQ ID NO: 1, SEQ ID NO: 5 and SEQ ID NO: 7; ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence; wherein the vector has a deletion corresponding to from about base pair 451 to about base pair 3510 of a wildtype adenovirus genome.

37. An adenoviral vector in accordance with claim 36 wherein the gene expression cassette is in an E1 parallel orientation.

38. An adenoviral vector in accordance with claim 36 wherein the gene expression cassette is in an E1 antiparallel orientation.

39. An adenoviral vector in accordance with claim 36 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

40. An adenoviral vector in accordance with claim 36 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

41. An adenoviral vector in accordance with claim 36 which is at least partially deleted in E3.

42. A cell comprising the adenoviral vector of claim 36.

43. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 36 into a cell line which expresses adenovirus E1 protein at complementing levels.

44. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 36 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

45. A method according to claim 44 wherein the cell expresses a transgene inclusive of nucleotides 459-3510 of adenovirus serotype 5.

46. An adenoviral vector in accordance with claim 1 wherein the HIV protein is HIV nef or an immunologically relevant modification thereof.

47. An adenoviral vector in accordance with claim 9 wherein the gene expression cassette comprises an open reading frame encoding an HIV nef protein or immunologically relevant modification thereof.

48. A recombinant adenoviral vector at least partially deleted in E1 and devoid of E1 activity, comprising:a) an adenovirus cis-acting packaging region corresponding to from about base pair 1 to about base pair 450 of a wildtype adenovirus genome; b) a region corresponding to from about base pair 3511 to about base pair 5798 of a wildtype adenovirus genome; and c) a gene expression cassette comprising i) a nucleotide sequence selected the group consisting of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 and SEQ ID NO: 15; ii) a heterologous promoter operatively linked to i); and iii) a transcription termination sequence; wherein the vector has a deletion corresponding to from about base pair 451 to about base pair 3510 of a wildtype adenovirus genome.

49. An adenoviral vector in accordance with claim 48 wherein the gene expression cassette is in an E1 parallel orientation.

50. An adenoviral vector in accordance with claim 48 wherein the gene expression cassette is in an E1 antiparallel orientation.

51. An adenoviral vector in accordance with claim 48 wherein the promoter is a cytomegalovirus promoter devoid of intronic sequences.

52. An adenoviral vector in accordance with claim 48 wherein the transcription termination sequence is a bovine growth hormone polyadenylation and transcription termination sequence.

53. An adenoviral vector in accordance with claim 48 which is at least partially deleted in E3.

54. A cell comprising the adenoviral vector of claim 48.

55. Recombinant, replication-defective adenovirus particles harvested and purified subsequent to transfection of the adenoviral vector of claim 48 into a cell line which expresses adenovirus E1 protein at complementing levels.

56. A method of producing recombinant, replication defective adenovirus particles containing the adenoviral genome of the adenoviral vector of claim 48 which comprises introducing the adenoviral vector into a host cell which expresses adenoviral E1 protein, and harvesting the resultant recombinant, replication-defective adenovirus.

57. A method according to claim 56 wherein the cell expresses a transgene inclusive of nucleotides 459-3510 of adenovirus serotype 5.