Patent Application
20160177336
The present invention relates to polynucleotides for multigene applications comprising a novel functional arrangement, as well as vectors, host cells, and recombinant animals comprising said polynucleotides.
In addition, the present invention is directed to methods for generating multigene expression cassettes, methods for producing multiprotein complexes in vitro and in vivo, and methods for producing a vaccine.
Furthermore, the present invention encompasses methods for screening protein complex interactions or modifications of proteins, and methods for the in vitro or in vivo screening of candidate compounds capable of protein complex interactions or modifications of proteins or capable of inhibiting protein complex interactions or inhibiting modifications of proteins.
Also, the present invention relates to the use of the polynucleotides, vectors, host cells or recombinant animals of the invention for (i) preparing a medicament for gene therapy, for (ii) the recombinant production of multiprotein complexes, (iii) for producing a vaccine, or (iv) for screening compounds of interest.
Last but not least, the invention is directed to a kit of parts comprising at least a polynucleotide, a vector, and/or a host cell according to the invention.
The identification of novel multiprotein complexes in eukaryotic cells has accelerated considerably, in particular due to the advent of genome-wide analysis of protein-protein interactions, the introduction of powerful multiple-affinity protein purification methods and the development of ultrasensitive analytical techniques. Based on extensive two-hybrid searches, the number of interaction partners for a given protein was estimated for baker's yeast to range on average from five to eight (Schwikowski et al. A network of protein-protein interactions in yeast. Nat. Biotechnol. 18, 1257-1261 (2000); Bader et al. Analyzing protein-protein interaction data obtained from different sources. Nat. Biotechnol. 20, 991-997 (2002); Von Mering et al. Comparative assessment of large-scale data sets of protein-protein interactions. Nature 417, 399-403 (2002); Grigoriev, A. On the number of protein-protein interactions in the yeast proteome. Nucleic Acids Res. 31, 4157-4161 (2003)). The concept of the cell as a collection of multicomponent protein machines, one for essentially every major process, has thereby emerged. This poses significant challenges for protein production technologies aimed at molecular level structural and functional studies of eukaryotic multiprotein complexes as intracellular quantities are typically refractory to large-scale extraction from source.
Polycistronic vectors carrying several genes encoding multiprotein complex components have been used for select cases of delivery in gene therapy (De Felipe, P. Polycistronic viral vectors. Curr. Gene Ther. 2, 355-378 (2002); Planelles, V. Hybrid lentivirus vectors. Methods Mol. Biol. 229, 273-284 (2003)). Recently, a polycistronic vector has been employed for the expression of a transcription factor complex composed of four subunits in E. coli (Selleck et al. A histone fold TAF octamer within the yeast TFIID transcriptional coactivator. Nat. Struct. Biol. 8, 695-700 (2001)). The DNA constructs in these studies were generated by conventional methods using endonucleases and ligase. Protein complexes in eukaryotes, however, often contain ten or more subunits with individual polypeptides ranging in size up to several hundred kDa, which severely restricts the applicability of conventional cloning strategies and largely rules out E. coli as a useful host system for heterologous protein expression.
Recombinant baculoviruses are particularly attractive for high-level production of large protein assemblies (O'Reilly et al. Baculovirus expression vectors. A laboratory manual. Oxford Press, New York (1994)). Genes driven by Autographa californica nuclear polyhedrosis virus (AcNVP) late promoters are often abundantly expressed, authentically processed, and targeted to their appropriate cellular compartment. Even architecturally complex particles such as capsid structures have been successfully assembled in insect cells using the baculovirus system (Roy et al. Baculovirus multigene expression vectors and their use for understanding the assembly process of architecturally complex virus particles. Gene 190, 119-129 (1997)). Expression of several genes in one cell can be achieved by co-infection with viruses carrying one foreign gene each. However, this approach inevitably leads to considerable variations in individual protein production levels as a result of statistical variance in virus stochiometry between infected cells. A superior alternative is infection with one baculovirus containing all heterologous genes of choice (Roy et al., see above; Bertolotti-Ciarlet et al. Immunogenicity and protective efficacy of rotavirus 2/6-virus-like particles produced by a dual baculovirus expression vector and administered intramuscularly, intranasally, or orally to mice. Vaccine 21, 3885-3900 (2003)). This is possible due to the flexible nature of the AcNVP envelope which allows for accommodation of large DNA insertions into the circular 130 kb dsDNA baculovirus genome. Traditionally, recombinant baculovirus generation is carried out in two steps. Foreign genes are first cloned into a small transfer vector propagated in E. coli and then inserted into the large baculovirus genome by homologous recombination in insect cells in a reaction yielding 30-80% recombinant progeny if linearized parent viral DNA is used (O'Reilly et al., see above). This procedure was substantially simplified by the introduction of a baculovirus shuttle vector (bacmid bMON14272) propagated in E. coli (Luckow et al. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in E. coli. J. Virol. 67, 4566-4579 (1993)). The bacmid contains the Tn7 attachment site for transposition of foreign genes from a transfer vector (Bac-to-Bac™, Invitrogen) (Luckow et al., see above; Bac-to-Bac™ Baculovirus Expression Systems Manual, Invitrogen, Life technologies Incorporated (2000)). A bicistronic transfer vector, pFastBac™ Dual, containing polyhedrin (polh) and p10 late viral promoters in two separate expression cassettes with sets of restriction sites for sequential subcloning of two foreign genes for co-expression was introduced.
For the production of multiprotein complexes containing large as well as many subunits, there still is a strong need for transfer vectors that allow for assembling genes in a non-sequential, modular manner to alleviate limitations imposed by the paucity of useful restriction sites in a collection of coding sequences each encompassing several thousand base pairs.
Therefore, it is an objective of the present invention to provide new tools and methods for the rapid and flexible generation of multiprotein complexes.
There is also a need for new tools and methods for recombinantly producing multiprotein complexes of ten and more subunits with individual polypeptides ranging in size up to several hundred kDa.
It is a further objective of the present invention to provide new tools and methods for generating large multiprotein complexes with many subunits and at the same time minimizing the requirements for unique restriction sites.
A further aim of the present invention is to provide for a highly flexible system for multiprotein complex production where the encoding sequences for individual subunits can be substituted in a modular manner avoiding de novo regeneration of the entire ensemble of encoding sequences.
There is also a need for tools and methods where facile, modular exchange of organism-, tissue- or cell type-specific promoters is possible, for recombinantly producing a particular multiprotein complex in various organisms, eukaryotic (mammalian, yeast, etc.) and prokaryotic, or under chosen conditions (e.g. early, late, very late phases of viral infection of a host cell, etc.).
The solubility and activity of biological macromolecules is often compromised if the interacting components are produced and purified in isolation, and reconstitution under in vitro conditions then does not produce physiologically meaningful data. Therefore, for the investigation of the interplay between macromolecular complexes among each other, there is a need for powerful and expandable systems for enabling co-expression of two or several protein assemblies ideally in one cell, each consisting of several components.
In a first aspect, the above mentioned objective is solved by providing a novel polynucleotide for multigene applications comprising a functional arrangement according to Fig. I
X-T1-MCS1-P1-[A-B]-P2-MCS2-T2-Y (Fig. I)
A polynucleotide according to the invention may be a DNA, an RNA, or a polynucleotide comprising one or more synthetic nucleotide analogs, preferably a DNA, more preferably a double-stranded DNA.
As used herein, the term “expression cassette” is to be understood to relate to a DNA fragment which contains a promoter sequence used to recruit the DNA transcription machinery, followed by an oligonucleotide encoding for a signal sequence to recruit the RNA translation machinery (e.g. Kozak consensus in eukaryotes or Shide-Dalgarno in prokaryotes), followed by an oligonucleotide sequence which contains at least one DNA sequence cleaved by a restriction enzyme (multiple cloning site MCS) to be used for insertion of DNA fragments encoding for gene products of choice, and a terminator sequence which directs the processes related to the end of transcription and modification of the RNA transcript (e.g. polyadenylation in eukaryotes).
As used herein, the term “multiplication module” is to be understood to relate to a set of DNA fragments placed outside of expression cassettes, and/or in between expression cassettes, that allow for iterative combination of several or many expression cassettes.
Compatible restriction sites are restriction sites that, when cleaved by the cognate enzymes, result in overhanging or recessing single-stranded regions of DNA of the same nucleotide length which are cohesive, i.e. they can anneal to each other using complementary Watson-Crick base pairing, and thus can be rejoined by ligases to yield a covalently linked functional DNA molecule. Alternatively, restriction sites that when cleaved result in blunt-ended DNA fragments, are also compatible, i.e. they can be rejoined by ligases to yield covalently linked functional DNA molecules.
Non-limiting examples of restriction endonucleases that produce compatible overhangs are Spel/AvrIl; Agel/Xmal/SgrA; BamHl/Bglll; BsrGl/Banl; Eagl/Notl, EcoRl/Mfel; Ndel/Asel; Nhel/Xbal; Pstl/Nsil; Sall/Xhol.
Non-limiting examples of restriction endonucleases that produce compatible blunt ends, e.g. all combinations can be ligated to each other, are BstZ17I, EcoRV, Fspl, Hpal, MluNl, Pmel, Scal, SnaBl, Stul, Xmnl.
The terms “head to head”, “head to tail”, and “tail to tail” define the arrangement of the promoters and terminators of the individual expression cassettes towards each other. For example, T1-T2 is a “tail to tail” arrangement, P1-P2 is a “head to head” arrangement, and P1/P2-T2/T1 is a “head to tail” arrangement. It is understood, that
Preferably, the at least two expression cassettes are arranged in a “head to head” arrangement.
In a preferred embodiment, the present invention relates to polynucleotides, wherein the restriction sites A and B in the multiplication module M are selected from the group consisting of BstZ17I, Spel, Clal and Nrul or restriction enzymes that have identical cleavage sites as said enzymes (“isoschizomers”).
In a further preferred embodiment, the present invention relates to polynucleotides, wherein the restriction sites X and Y are selected from the group consisting of Pmel and AvrIl or restriction enzymes that have identical cleavage sites as said enzymes (“isoschizomers”).
In another preferred embodiment, the present invention relates to polynucleotides, wherein the promoters P1 and P2 are selected from the group consisting of polh, p10 and pXIV very late baculoviral promoters, vp39 baculoviral late promoter, vp39polh baculoviral late/very late hybrid promoter, Pcap/polh, pcna, etl, p35, egt, da26 baculoviral early promoters; CMV, SV40, UbC, EF-1α, RSVLTR, MT, PDS47, Ac5, PGAL and PADH.
Furthermore, a preferred embodiment of the present invention relates to polynucleotides, wherein the terminator sequences T1 and T2 are selected from SV40, HSVtk or BGH (bovine growth hormone).
In addition to the functional arrangement of
Particularly preferred are polynucleotides, wherein the integration site is compatible for the polynucleotide's integration into a virus selected from the group consisting of adenovirus, adeno-associated virus (AAV), autonomous parvovirus, herpes simplex virus (HSV), retrovirus, rhadinovirus, Epstein-Barr virus, lentivirus, semliki forest virus and baculovirus.
More preferred are polynucleotides according to the invention, wherein the integration site is compatible for the polynucleotide's integration into a baculovirus.
The baculovirus expression system has been used extensively for the expression of recombinant proteins in insect cells. Recently, recombinant baculovirus vectors engineered to contain mammalian cell-active promoter elements, have been used successfully for transient and stable gene delivery in a broad spectrum of primary and established mammalian cell lines. The application of modified baculoviruses for in vivo gene delivery has also been demonstrated. In contrast to other commonly used viral vectors, baculoviruses have the unique property of replicating in insect cells while being incapable of initiating a replication cycle and producing infectious virus in mammalian cells. The viruses can be readily manipulated, accommodate large insertions of foreign DNA, initiate little to no microscopically observable cytopathic effect in mammalian cells and have a good biosafety profile (Kost et al. Recombinant baculoviruses as mammalian cell gene-delivery vectors. Trends in Biotechnology, 20(4), April 2002). These attributes make baculoviruses particularly useful for practicing the present invention.
In a more preferred embodiment, said integration site(s) optionally comprised in the polynucleotide of the present invention is(are) selected from the group consisting of the transposon elements of Tn7, λ-integrase specific attachment sites and SSRs (site specific recombinases), preferably the cre-lox specific recombination (LoxP) site or the FLP recombinase specific recombination (FRT) site.
Preferably, the integration site(s) is(are) compatible for the polynucleotide's integration into a eukaryotic host cell selected from the group consisting of mammalian, preferably human cells; porcine, preferably CPK, FS-13, PK-15 cells; bovine, preferably MDB, BT cells; ovine, preferably FLL-YFT cells; C. elegans; yeast, preferably S. cerevisiae, S. pombe, C. albicans, P. Pastoris cells; and insect cells. For human host cells, the integration site is preferably compatible for the polynucleotide's integration into a host cell selected from the group consisting of HeLa, Huh7, HEK293, HepG2, KATO-III, IMR32, MT-2, pancreatic β-cells, keratinocytes, bone-marrow fibroblasts, CHP212, primary neural cells, W12, SK-N-MC, Saos-2, W138, primary hepatocytes, FLC4, 143TK-, DLD-1, embryonic lung fibroblasts, primary foreskin fibroblasts, Saos-2 osteosarcoma, MRCS, and MG63 cells.
For insect host cells, the integration site is preferably compatible for the polynucleotide's integration into a host cell selected from the group consisting of S. frugiperda cells, more preferably Sf9, Sf21, Express Sf+, High Five H5 cells, and D. melanogaster cells, most preferably S2 Schneider cells.
In a preferred embodiment, the polynucleotide according to the invention additionally comprises one or more resistance markers for selecting host cells with desired properties based on their resistance to toxic substances. More preferably, said resistance markers are selected from ampicillin, chloramphenicol, gentamycin, spectinomycin, and kanamycin resistance markers.
When a prokaryotic host cell is desired for incorporating a nucleotide of the present invention, it is preferred that the polynucleotide according to the invention additionally comprises a conditional R6Kγ origin of replication for making propagation dependent on the pir gene in a prokaryotic host.
In a very preferred embodiment, the polynucleotide according to the invention comprises
In a further aspect, the present invention is directed to a vector comprising a polynucleotide sequence according to the present invention.
In a preferred embodiment said vector is selected from the group consisting of plasmids, expression vectors, and transfer vectors.
These vectors are useful for the incorporation of heterologous DNA elements, preferably genes. Said vectors may be expression vectors or transfer vectors, preferably useful for eukaryotic gene transfer, transient or viral vector mediated gene transfer.
More preferred said vector is a plasmid or a virus.
In a specifically preferred embodiment, said virus is selected from the group consisting of adenovirus, adeno-associated virus (AAV), autonomous parvovirus, herpes simplex virus (HSV), retrovirus, rhadinovirus, Epstein-Barr virus, lentivirus, semliki forest virus and baculovirus.
In a most preferred embodiment, the vector of the present invention is a baculovirus expression vector.
When engineering baculovirus expression vectors, it was surprisingly found that the functional disruption of two baculoviral genes, v-cath and chiA, leads to improved maintenance of cellular compartments during infection and protein expression. The quality of the proteins produced by such a novel baculovirus system is significantly improved through reduction of viral-dependent proteolytic activity and cell lysis.
Therefore, in a different aspect, the present invention is also directed to baculoviruses in general, wherein the two baculoviral genes v-cath and chiA are functionally disrupted.
In a preferred embodiment, the present invention is directed to a baculovirus vector according to the invention, wherein the two baculoviral genes v-cath and chiA are functionally disrupted.
Preferably, vectors according to the present invention additionally comprise a site for SSRs (site specific recombinases), preferably LoxP for cre-lox site specific recombination.
More preferably, the cre-lox site is located in one or both of the two baculoviral genes v-cath and chiA and disrupts their function.
In another preferred embodiment, the present invention relates to vectors comprising a transposon element, preferably the Tn7 attachment site.
Preferably, said attachment site is located within a marker gene. That way successful integration by transposition can be assessed through the marker gene.
More preferably, the marker gene is selected from the group consisting of luciferase, β-GAL, CAT, fluorescent protein encoding genes, preferably GFP, BFP, YFP, CFP and variants thereof, and the lacZα gene. Variants of marker genes are those that deviate in sequence by less than 30, preferably less than 20, more preferably less than 10% but retain substantially the same functional marker properties as the original marker gene.
In a most preferred embodiment, the vector of the present invention has the sequence according to SEQ ID NO: 1 (pFBDM). See also
In a further most preferred embodiment, the vector of the present invention has the sequence according to SEQ ID NO: 2 (pUCDM). See also
In the following, the vectors of the present invention will be exemplified with reference to the most preferred baculoviral vectors pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2). However, the following description of these specific vectors of the present invention is not to be construed as limiting the scope of the invention.
The above described preferred new baculovirus transfer vectors were constructed specifically for multigene applications. They comprise modified recipient baculovirus DNA engineered for improved protein production, and allow for a simple and rapid method to integrate genes via two access sites (attTn7 and LoxP) into this baculoviral DNA in E. coli cells tailored for this purpose.
The vectors of the present invention allow for the elucidation of protein interaction networks (interactome). Since many of the identified multiprotein complexes are not present in sufficient quantities in their native cells for detailed molecular biological analysis, their study is dependent on recombinant technologies for large-scale heterologous protein production. Currently, recombinant expression methods require a disproportionate investment in both labor and materials prior to multiprotein expression, and subsequent to expression do not provide flexibility for rapidly altering the multiprotein components for revised expression studies.
The vectors of the present invention, in particular baculovirus expression systems according to the invention, facilitate and accelerate multiprotein expression immensely.
The transfer vectors of the invention, in particular pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2), that contain a multiplication module, greatly facilitate modular combination of heterologous genes with a minimum requirement for unique restriction sites. Viral promoters (e.g. p10 and polh very late promoters) in these vectors can be exchanged to other promoter sequences (early, late) if required. Likewise, terminator sequences (currently SV40, HSVtk) can be substituted.
The use of baculoviral vectors with functionally disrupted v-cath and chiA genes allows for improved maintenance of cellular compartments during infection and protein production. The quality of proteins produced by such a vector system is significantly improved through a reduction of viral dependent proteolytic activity and reduced cell lysis.
Furthermore, the vectors of the present invention allow for a completely new protocol for rapid combinatorial generation of recombinant DNA, preferably baculoviral DNA, by accessing the vector genome via two specific sites.
In addition to a Tn7 transposon site, a LoxP sequence was introduced at a separate site on the baculovirus genome which can accept multigene expression cassettes from the pUCDM (SEQ ID NO. 2) plasmid by site-specific recombination. A protocol was developed for carrying out Tn7 transposition (from pFBDM (SEQ ID NO. 1) derivatives carrying multigene cassettes) and LoxP site-specific recombination (from pUCDM (SEQ ID NO. 2) derivatives carrying multigene cassettes) efficiently in a single step in E. coli. These protocols can be used not only to integrate multigene cassettes with coding sequences for multiprotein complex subunits into vectors (e.g. baculovirus vectors), but also to integrate specific enzymes (kinases, acetylases etc.) for modifying the proteins under investigation. See
The transfer vector pFBDM (SEQ ID NO. 1) contains two expression cassettes in a head-to-head arrangement with multiple cloning sites MCS1 and MCS2 flanked by polh or p10 promoters and SV40 or HSVtk polyA signal sequences, respectively. Multiplication module M is located in between the promoter sequences. The sequences used for Tn7 transposition (Tn7L and Tn7R) encompass the expression cassettes and a gentamycin resistance marker. (See
The transfer vector pUCDM (SEQ ID NO. 2) has an identical expression cassette including a multiplication module the same as for pFBDM (SEQ ID NO. 1). This expression cassette is flanked by a LoxP inverted repeat. Vector pUCDM (SEQ ID NO. 2) contains a chloramphenicol resistance marker and a conditional R6Kγ origin of replication which makes its propagation dependent on the expression of the pir gene in the prokaryotic host. See
The vectors pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2) are particularly suited for generating multigene expression cassettes due to the multiplication module inserted in between the two promoters. The logic of multiplication is illustrated in
In addition, the baculovirus genome was modified to obtain improved protein production properties. Two baculoviral genes, v-cath and chiA, were disrupted which leads to improved maintenance of cellular compartments during infection and protein production. The v-cath gene encodes for a viral protease, V-CATH, which is activated upon cell death by a process dependent on a juxtaposed gene on the viral DNA, chiA, which encodes for a chitinase. Both genes were disrupted to eliminate V-CATH activity and to gain the option of utilizing chitin-affinity chromatography for purification without interference from the chiA gene product. The quality of proteins produced by the MultiBac baculovirus is significantly improved through a reduction of viral-dependent proteolytic activity and reduced cell lysis. In place of the disrupted viral DNA sequence, a LoxP sequence for cre-lox site-specific recombination was placed. See
As used herein, the term “MultiBac” stands synonymously for the exemplary and preferred embodiment of the said baculovirus viral vector, i.e. a modified baculovirus genome lacking the genes for v-cath and chiA. In addition, “MultiBac” in the context of “MultiBac system” encompasses said modified baculovirus viral vector as well as the E. coli cell types derived from the DH10α strain which contain said baculovirus vector (DH10MultiBacET, DH10MultiBacCre etc.) along with the factors required for carrying out the recombination reactions described herein (Tn7 transposition, Site specific recombination) and additionally the exemplary and preferred vectors, pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2), according to the present invention.
All vectors of the present invention, in particular the preferred transfer vectors pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2), are useful for introducing multiprotein complexes into host cells.
In another aspect, the present invention relates to a host cell comprising a polynucleotide sequence and/or a vector according to the invention.
Preferred host cells for practicing the invention are those selected from the group consisting of mammalian cells, preferably human cells, rodent cells, porcine cells, bovine cells, ovine cells; C. elegans cells; yeast cells; insect cells; and E. coli cells.
Preferred yeast cells for practicing the invention are S. cervisiae, S. pombe, C. albicans and P. pastoris
Preferred E. coli cells for practicing the invention are Top10, DH5α, DH10α, HB101, TG1, BW23473, BW23474 cells.
Preferred insect cells for practicing the invention are S. frugiperda cells, preferably Sf9, Sf21, Express Sf+ or High Five H5 cells, and D. melanogaster, preferably S2 Schneider cells.
Preferred human cells for practicing the invention are selected from the group consisting of HeLa, Huh7, HEK293, HepG2, KATO-Ill, IMR32, MT-2, pancreatic β-cells, keratinocytes, bone-marrow fibroblasts, CHP212, primary neural cells, W12, SK-N-MC, Saos-2, WI38, primary hepatocytes, FLC4, 143TK-, DLD-1, embryonic lung fibroblasts, primary foreskin fibroblasts, Saos-2 osteosarcoma, MRCS, and MG63 cells.
Of course, cells comprising a polynucleotide and/or a vector according to the present invention are by no means limited to isolated cells or cell tissues.
In another aspect, the present invention also relates to a recombinant animal comprising a polynucleotide sequence and/or a vector according to the invention.
Such recombinant animals are useful for elucidating the role of multienzyme complexes or screening compounds for biological activities in vivo.
Preferably, animals according to the invention are selected from mammals, preferably human, rodent, porcine and bovine; C. elegans; and insects, preferably S. frugiperda and D. melanogaster.
The tools of the present invention, i.e. the polynucleotides, vectors, host cells and recombinant animals, allow for the convenient, rapid and simple modular combination of heterologous genes with a minimum requirement for unique restriction sites.
In another aspect, the present invention is directed to a method for generating multigene expression cassettes, comprising the steps of
Preferably, the restriction sites X and Y in step (c) are Pmel and AvrIl or isoschizomers of these enzymes and the restriction sites at the multiplication module of the second vector in step (d) are selected from BstZ17I, Spel, Clal and Nrul or isoschizomers of these enzymes.
Most preferably, baculovirus transfer vector pFBDM (SEQ ID NO. 1) can be employed for step (a) and/or (b).
Also, most preferably, baculovirus transfer vector pUCDM (SEQ ID NO. 2) can be employed for step (a) and/or (b).
For a better understanding of the method of the invention in general, an exemplary method using preferred vector pFBDM (SEQ ID NO. 1) is illustrated in
The method of the invention allows for the conventional introduction of genes into one or more expression cassettes of vectors of the invention and subsequently facilitates the modular assembly of these expression cassettes into a single vector while at the same time minimizing the number of required restriction sites to do so.
A further aspect of the present invention is directed to a method for producing multiprotein complexes in vitro comprising the steps of
Preferably, the transfer in step (b) is effected by means of a vector, preferably a virus.
Preferably, the host cell is selected from mammalian, yeast, E. coli, and insect cells.
When the host cell is an insect cell, it is preferably S. frugiperda cells, more preferably Sf9, Sf21, Express Sf+ or High Five H5 cells, or D. melanogaster cells, more preferably S2 Schneider cells.
When the host cell is a mammalian cell, it is preferably a human cell selected from the group consisting of HeLa, Huh7, HEK293, HepG2, KATO-Ill, IMR32, MT-2, pancreatic β-cells, keratinocytes, bone-marrow fibroblasts, CHP212, primary neural cells, W12, SK-N-MC, Saos-2, WI38, primary hepatocytes, FLC4, 143TK-, DLD-1, embryonic lung fibroblasts, primary foreskin fibroblasts, Saos-2 osteosarcoma, MRCS, and MG63 cells.
When the host cell is a yeast cell, it is preferably S. cerevisiae, S. pombe, C. albicans or P. pastoris.
The present invention is not limited to in vitro methods.
A different aspect of the present invention relates to a method for producing multiprotein complexes in vivo comprising the steps of
Preferably, the transfer in step (b) is effected by means of a vector, preferably a virus vector, more preferably a baculovirus vector.
As mentioned above, baculoviruses are particularly useful as mammalian cell gene-delivery vehicles.
For producing multiprotein complexes in vivo, said animal is preferably selected from mammals, C. elegans, or insects.
Preferred insects for practicing said method are S. frugiperda and D. melanogaster.
Preferred mammals for practicing the invention are human, rodent, porcine, or bovine.
The recent discovery of an ever increasing number of multiprotein complexes in eukaryotic cells (the ‘interactome’), calls for improved heterologous expression techniques in particular for protein complexes with intracellular quantities refractory to extraction from source (e.g. close to all human multiprotein complexes). Eukaryotic proteins are often large (>100 kDa) multidomain entities and exist in the cell as complexes of on average 5 to 8 proteins. In general, protein complexes containing large proteins can not be produced in a functionally active state with generic (e.g. prokaryotic) expression technologies. Further, components of multiprotein assemblies often display folding problems and compromised biological activity when produced in isolation. Current eukaryotic expression technologies (baculovirus system, yeast and mammalian expression systems etc.) are not designed for rapid and flexible expression of several large genes encoding for multiprotein complexes.
The vectors of the present invention, however, are tailored to meet these requirements. Said vectors are capable of carrying multiple gene expression cassettes for insertion into e.g. a modified baculovirus with improved protein production properties via independent entry sites (Cre-loxP and Tn7 and/or others). In combination with the high-level production rates obtained for example in insect cells, vectors of the present invention can thus be used in a flexible manner for the generation of multiprotein complexes for structural and functional studies providing significant information for use in research and drug development, for instance as physiologically meaningful targets for discovery of ligands that influence their activity (inhibitors, antibodies etc.).
The invention is also particularly useful for preparing a vaccine directed against multi subunit protein complexes in mammals. Complex multiprotein units will often display different epitopes in comparison to individual proteins and will therefore resemble the relevant epitopes of many naturally occurring protein complexes more closely, thus providing better antigen targets for antibody production. In addition, multiple proteins for multivalent vaccines and optionally even protein adjuvants can be introduced in only one vector and be expressed simultaneously to assure maximum efficacy.
Recently, virion-like particles (VLPs) consisting of four proteins from the severe acute respiratory syndrome (SARS) coronavirus were made using a recombinant baculovirus expression vector (Mortola et al. Efficient assembly and release of SARS coronavirsus-like particles by a heterologous expression system FEBS Letters 576, 174-178 (2004)), offering a potential candidate vaccine for this disease. The use of vectors according to the present invention, due to their modular ability to carry multiple gene expression units, will greatly facilitate the generation of such vaccines, consisting of even more numerous components than SARS-VLPs.
Therefore, the present invention also relates to a method for producing a vaccine comprising the steps of
The present invention provides for a convenient and simple protocol for recombinantly producing multiprotein complexes found in nature. These multiprotein complexes can be assayed for protein complex interactions or modifications of the proteins. They can also be assayed for interaction with compounds suspected of biological activity or even medical value.
In another aspect the present invention is directed to a method for assaying protein complex interactions or modifications of proteins.
In a preferred embodiment, the present invention relates to a method for the in vitro screening for protein complex interactions or modifications of proteins, comprising the steps of
In another preferred embodiment, the present invention encompasses a method for the in vitro screening of candidate compounds capable of
(i) protein complex interactions or (ii) modification(s) of protein(s) (of a multiprotein complex) or (iii) capable of inhibiting protein complex interactions or (iv) inhibiting modification(s) of protein(s), comprising the steps of
The present invention also encompasses in vivo screening assays.
The polynucleotides and/or vectors of the present invention can also be used for the in vivo screening of protein—protein or multiprotein complex—multiprotein complex interactions (See
In a further preferred embodiment, the present invention teaches a method for in vivo screening of candidate compounds capable of (i) protein complex interactions or modification(s) of protein(s) (of a multiprotein complex) or (iii) capable of inhibiting protein complex interactions or inhibiting modification(s) of protein(s), comprising the steps of
Bioactive multiprotein complexes but also medically advantageous combinations of proteins such as e.g. antibody mixtures, optionally with interleukins and/or adjuvants can be administered to mammals simultaneously by means of the polynucleotides of the present invention and/or gene-delivery vectors of the present invention.
Therefore, in a further aspect, the present invention also relates to the use of a polynucleotide and/or a vector according to the invention for the preparation of a medicament comprising a multigene transfer vehicle for gene therapy.
Tremendous efforts are being made to develop gene delivery systems for therapeutic applications. Gene therapy has been the focus of intense enthusiasm but also critique in the past. To date, major progress has been made in evaluating gene therapy in clinical trials on the way to achieving safe and applicable clinical in vivo and ex vivo strategies for human diseases (Worgall S. A realistic chance for gene therapy in the future. Pediatr. Nephrol. (2004)). Overall, gene therapy now stands as a very promising avenue for the correction of genetic as well as acquired disorders entailing permanent or transient expression of a therapeutic gene product (Worgall S. see above). Recombinant virus based vectors, in particular those that are not replication-competent in mammalian hosts (e.g. baculoviral vectors), have emerged recently as a powerful tool for mammalian cell gene delivery and successfully applied to a whole range of mammalian cell lines, including human, primates, rodent, bovine, procine and ovine (reviewed in Kost and Condreay. Recombinant baculoviruses as mammalian cell gene-delivery vectors. Trends Biotechnol. 20, 173-180 (2002)). To obtain complex gene transfer/therapy effects, both ex vivo and in vivo, an increasing demand has arisen for polycistronic viral vectors to accomplish more powerful results by combined gene therapy than from single gene therapy (de Felipe, P. Polycistronic viral vectors. Curr. Gene Ther. 2, 355-378 (2002); Planelles, V. Hybrid lentivirus vectors. Methods Mol. Biol. 229, 273-284 (2003)). The requirement for the incorporation of accessory genes into a carrier virus that is to be administered in vivo, for instance to block inactivation by the complement system, has also been demonstrated by using a pseudotyped baculovirus with baculoviral gp64 envelope proteins that carried a human decay-accelerating factor protein domain fusion (Hueser et al., Incorporation of decay-accelerating factor into the baculovirus envelope generates complement-resistant gene transfer vectors. Nat. Biotechnol. 19, 451-455 (2001)), exemplifying the necessity to provide recombinant modifications on the virus production level in addition to the multiple genes to be transferred for therapeutic purposes.
Preferably, the vector used for preparing a medicament is a recombinant baculovirus.
More preferably, the vector used for preparing a medicament according to the invention is a baculovirus comprising at least one multigene expression cassette coding for
In a preferred embodiment, the protein(s) of step (ii) are humanized baculoviral proteins expressed from a pseudotyped baculovirus, preferably a humanized baculovirus envelope protein gp64, e.g. gp64 fused with a human protein such as for example decay accelerating factor.
In a more general aspect the present invention is directed to the use of a polynucleotide and/or a vector and/or a host cell and/or an animal according to the invention for the recombinant production of multiprotein complexes.
Using genes encoding for fluorescent proteins EYFP and ECFP a close to linear increase of fluorescent protein production with the number of genes encoding for this protein that were integrated in vectors of the present invention was surprisingly seen. More precisely, the production yield (per 1 L insect cell culture) of fluorescent protein was 6-8 mg/L if one copy of the gene was present, about 11 mg if two copies were present, and about 18 mg if three copies of the gene were present in a vector of the present invention used for expression. This suggests a previously unnoticed, simple way to dramatically enhance the quantity of a recombinant protein expressed using an expression system according to the invention, namely by simply providing two, three or more copies of the same gene instead of only one. This is of special interest for industrial scale protein production for instance for pharmaceutical purposes, in particular for membrane proteins which are of paramount interest for drug development (e.g. GPCRs), the production of which is currently largely hampered by the low production yields.
Also, the recombinant multiprotein complexes produced according to the present invention are particularly useful for biophysical, structural, crystallographical, electron-microscopical, and NMR based analysis of multiprotein complexes for research and also for drug development.
Preferably, the invention relates to the use of a polynucleotide and/or a vector and/or a host cell and/or an animal according to the invention for producing a vaccine.
Also preferred is the use of a polynucleotide and/or a vector and/or a host cell and/or an animal according to the invention for screening at least one protein in vitro or in vivo, optionally together with a candidate compound, for protein association, protein modification, or a biological effect in a host cell or animal or for the inhibition of protein association, protein modification, or a biological effect in a host cell or animal.
In another aspect, the present invention relates to a kit of parts comprising at least a polynucleotide and/or a vector and/or a host cell according to the invention, optionally also comprising an instruction manual, antibiotics, buffers, and/or marker compounds.
Genes of interest are assembled into multigene expression cassettes using the multiplication module present on transfer vectors pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2). The resulting vectors are introduced into MultiBac baculoviral DNA in DH10MultiBacCre E. coli cells which contain the factors for Tn7 transposition (for pFBDM (SEQ ID NO. 1) derivatives) and cre-lox site-specific recombination (for pUCDM (SEQ ID NO. 2) derivatives). Colonies containing bacmid carrying integrated multigene cassettes are identified by blue/white screening (Tn7 transposition disrupts a lacZα gene) and chloramphenicol resistance (conferred by Cre catalyzed integration of pUCDM (SEQ ID NO. 2) derivative). Transposition and site-specific recombination are carried out either sequentially or, alternatively, concomitantly in a one-step reaction. Bacmid DNA is prepared from selected clones and used to transfect insect cells for protein production.
The circle map of pFBDM (SEQ ID NO. 1) shows promoters (polh, p10), terminators (SV40, HSVtk), multiple cloning sites (MCS1, MCS2), transposon elements (Tn7L, Tn7R) and resistance markers (ampicillin and gentamycin). Genes of interest are cloned into MCS1 or MCS2 using unique restriction sites. The multiplication module (M) is located in between the p10 and polh promoters.
The circle map of pUCDM (SEQ ID NO. 2) shows promoters (polh, p10), terminators (SV40, HSVtk), multiple cloning sites (MCS1, MCS2), the inverted repeat for cre-lox site-specific recombination (LoxP) and a resistance marker (chloramphenicol). Genes of interest are cloned into MCS1 or MCS2 using unique restriction sites. The multiplication module (M) is located in between the p10 and polh promoters.
The logic of multiplication is shown for pFBDM (SEQ ID NO. 1). The expression cassette containing two genes of choice (denoted a,b) is excised by digestion with AvrIl and Pmel (boxed) and placed into a multiplication module of a construct containing further genes (c,d) via BstZ17I/Spel (or, alternatively Nrul/Spel) sites present in the multiplication module (M). Spel produces a cohesive end compatible with AvrIl, while BstZ17I, Nrul and Pmel are blunt-cutters. Multigene derivatives of pUCDM (SEQ ID NO. 2) can be generated following the same logic.
The modified viral genome is shown in a schematic representation. The Tn7 attachment site is located within a LacZα gene; insertion of Tn7 elements from pFBDM (SEQ ID NO. 1) derivatives therefore produces a white phenotype when plated on agar containing BluoGal and IPTG. In place of the disrupted v-cath and chiA viral genes, a LoxP sequence was inserted to accept pUCDM (SEQ ID NO. 2) derivatives by Cre catalysis, producing a chloramphenicol resistant phenotype.
The gene encoding for yellow fluorescent protein EYFP was cloned into pUCDM (SEQ ID NO. 2) and integrated into MultiBac by Cre catalysis. Virus was clonally separated by plaque assay. 32 plaques were tested for EYFP expression by fluorescence spectroscopy. Excitation was at 488 nm. Spectra recorded from cell lysate from viruses 1 to 12 are shown (above). In this experiment, 91% (29 of 32) of the specimens showed strong fluorescence emission indicating expression of the EYFP protein (Table below).
Comparison of the lysate from cells infected with MultiBac virus and a commercially available baculovirus (“Wildtype”). Viral-dependent protein production in both samples is virtually identical at 48 hours post infection (Fig. A). Incubation of cell lysate for 96 hours at RT after harvest shows a virtually unaltered protein content in the sample from cells infected with MultiBac. In contrast, proteolysis is evident in the sample from cells infected with wildtype virus (Fig. B). Effect of protease deletion on cell morphology at 72 hours post infection is shown in micrographs of cells infected with MultiBac lacking v-cath and chiA (MultiBac) or with commercial virus containing the protease and chitinase genes (Wildtype). Cells in the upper micrograph are uniformly round and appear intact. In contrast, cell lysis is prevalent in the lower micrograph (Fig. C).
Isw2 complex was expressed from the attTn7 site or, alternatively, from the attTn7 and LoxP sites of MultiBac. Cell lysate as well as protein complex purified from both composite bacmids exhibits virtually identical protein production levels. Sample from uninfected Sf21 cells is included as a control.
Integration sites are depicted schematically on top of Coomassie stained gel sections showing the components of the respective multiprotein complexes. Yields are indicated. Expression of EYFP is shown below by Western Blot sections of the respective cell lysates, with yields calculated from absorbance spectra.
A hybrid virus (left) results in expression of EYFP and ECFP in insect cells (right, top) and dsRED expression in COS cells infected with virus amplified in Sf21 cells (right, bottom).
In the following specific embodiments of the invention will be described by way of example and these examples are not to be construed to be limiting to the scope of the present invention.
In the following new baculovirus transfer vectors according to the present invention constructed specifically for multigene applications are described in detail. These transfer vectors present a modified recipient baculovirus DNA engineered for improved protein production, and a simple and rapid method to integrate genes via two access sites (attTn7 and LoxP) into this baculoviral DNA in E. coli cells tailored for this purpose. Said vectors (pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2)) contain a multiplication module and greatly facilitate modular combination of heterologous genes with a minimum requirement for unique restriction sites. Viral promoters (currently p10 and polh very late promoters) can be exchanged in these vectors to other promoter sequences (early, late) if required. Likewise, terminator sequences (currently SV40, HSVtk) can be substituted.
These vectors comprise an engineered baculovirus genome (MultiBac) with improved protein production properties. Two baculoviral genes were disrupted which leads to improved maintenance of cellular compartments during infection and protein production. The quality of proteins produced by this system is significantly improved through a reduction of viral dependent proteolytic activity and reduced cell lysis.
The vectors according to the invention allow for a new method for rapid combinatorial generation of recombinant baculovirus DNA by accessing the viral genome via two specific sites (see
The transfer vector pFBDM (SEQ ID NO:1,
The transfer vector pUCDM (SEQ ID NO:2,
In short, both vectors were prepared as follows. Transfer vector pFBDM (SEQ ID NO. 1) was derived from pFastBac™DUAL (Invitrogen). The sequence 5′-TACTAGTATCGATTCGCG-ACC was inserted into the BstZ17I site between the polh and p10 promoters generating the multiplication module containing, in order, BstZ17I, Spel, Clal and Nrul cleavage sites. A site for the rare-cutter Pmel was added by replacing the SnaBl recognition sequence with the oligonucleotide 5′-AGCTTTGTTTAAACAAAGCT. Vector pUCDM (SEQ ID NO. 2) was generated by combining the 998 bp EcoRV/AlwNI fragment of pUNI10 univector containing the R6Kγ origin with the 1258 bp AlwNI fragment from pLysS (Novagen) after treatment with mung bean nuclease (New England Biolabs). This pLysS fragment contains the chloramphenicol resistance marker. The resulting construct was digested with Smal and Xbal, and ligated to the 1016 bp Pmel/AvrIl fragment of pFBDM (SEQ ID NO. 1). Unique restriction sites for AvrIl and Pmel restriction endonucleases were reintroduced by site-directed mutagenesis using the QuickChange protocol (Stratagene). The vectors pUCDM (SEQ ID NO. 2) and pFBDM (SEQ ID NO. 1) contain identical expression cassettes including the multiplication module.
The baculoviral vector, termed MultiBac, which represents a bacmid as it contains an origin of replication (F-replicon) that allows its propagation in E. coli strains (e.g. DH10α and derivatives), was constructed in the following way. Plasmid pKlloxP, containing the linear fragment used to replace the v-cath and chiA genes in bMON14272 by ET recombination, was generated from pFastBac™DUAL by recircularization of the 3385 bp Stul/Fspl fragment thus eliminating these sites and disrupting the ampicillin resistance gene. This pKl vector has a gentamycin marker and the original pFastBac™DUAL p10 MCS containing Xhol, Ncol and Kpnl restriction sites. pKl was modified to yield pKlloxP as follows. The 1008 bp BspHI fragment of pFastBac™DUAL containing the ampicillin resistance marker was introduced into the Ncol site. Next, homology region HomA from the baculovirus chiA gene was amplified from bMON14272 with primers 5′-GCGCGCCTCGAGGCC TCCCACGTGCCCGACCCCGGCCCG and 5′-GCGCGCCTCGAGGGAGGAGCT GCGCGCAATGC, and digested with Xhol. The resulting 408 bp fragment was inserted into the Xhol site of pKl. Homology region HomB from the v-cath gene was amplified with primers 5′-GCGCGCGGTACCGCGTTCGAAGCCATCATTA and 5′-GCGCGCGGTACCAGGCCTGAAAAATCCGTCCTCTCC, digested with Kpnl and the resulting 372 bp fragment inserted into the pKl Kpnl site. Finally, a Cre-loxP sequence was introduced into the Nhel site by the oligonucleotide 5′-CTAGAATAACT TCGTATAGCATACATTATACGAAGTTAGTTTAAACT. The gene encoding for Cre recombinase and a six-histidine tag directly adjacent to the start codon was generated from synthetic oligonucleotides (Microsynth, CH) and ligated to Ncol/Kpnl digested pBAD22 vector. The ampicillin resistance marker was inactivated by Fspl/Scal digestion. A Zeocin resistance gene under control of a synthetic prokaryotic promoter (EM7) was excised from pPICZA (Invitrogen) by Pvull/EcoRV digestion and ligated to the 5388-bp Fspl/Scal fragment yielding pBADZ-His6Cre.
Transfer vector pFBDM (SEQ ID NO. 1), pKlLoxP and pBADZ-His6Cre are propagated in generic E. Coli strains such as TOP10 cells (Invitrogen), pUCDM (SEQ ID NO. 2) is propagated in bacterial hosts BW23473 or BW23474 expressing the pir gene.
Next, for generation of baculoviral bacmid MultiBac, the vector pBAD-ETγ carrying truncated recE under the arabinose-inducible PBAD promoter and recT under the EM7 promoter was modified by placing the Zeocin resistance gene from pPICZA into the Fspl and Scal sites as described for pBADZ-His6Cre yielding pBADZ-ETγL. This vector was transformed into DH10B
To generate composite MultiBac bacmids, pBADZ-His6Cre was transformed into DH10MultiBac by electroporation for expression of Cre recombinase yielding clones resistant to kanamycin, tetracyclin and Zeocin. A single colony was used to inoculate 500 ml 2×TY in the presence of these antibiotics at 20° C. L-arabinose was added to 0.1% at OD600=0.25. At OD600=0.5 frozen electro-competent DH10MultiBacCre cells containing overexpressed Cre recombinase were prepared. Plasmid pUCDM (SEQ ID NO. 2) or derivatives were electroporated into DH10MultiBacCre cells and plated on agar containing kanamycin, tetracyclin and chloramphenicol. Triple resistant clones were assayed on plates containing IPTG and Bluogal for integrity of the lacZα gene with Tn7, yielding blue colonies in all cases tested. Clones were analyzed for the correct Cre-loxP site-specific recombination event by PCR amplification and sequencing as described above. Loss of pBADZ-His6Cre was confirmed by replating in the presence of Zeocin. Electro-competent cells were prepared from the individual clones in the presence of kanamycin, tetracyclin and chloramphenicol. Transposition of Tn7 elements from pFBDM (SEQ ID NO. 1) derivatives into Tn7, identification of recombinants by blue/white screening, and transfection of purified composite bacmid was carried out according to established protocols (e.g. O'Reilly, D. R., Miller, L. K. & Luckow, V. A. “Baculovirus expression vectors. A laboratory manual.” Oxford University Press, New York-Oxford (1994); “Bac-to-Bac™ Baculoviorus Expression Systems Manual.” Invitrogen, Life Technologies Incorporated (2000)). For simultaneous transformation of DH10MultiBacCre with pUCDM (SEQ ID NO. 2) and pFBDM (SEQ ID NO. 1) derivatives, at least 1 μg of each was used.
A function of the F-replicon on the bacmid is to limit the copy-number to one or two, reducing the potential for undesired recombination. Introduction of pFBDM (SEQ ID NO. 1) derivatives into MultiBac disrupts the lacZα gene allowing unambiguous identification of cells containing only composite bacmid. However in the case of Cre-catalyzed fusion of pUCDM (SEQ ID NO. 2) derivatives, co-existence of a copy of both the composite and parent bacmids can not be ruled out based on chloramphenicol resistance. Virus from initial transfections with MultiBac containing the EYFP gene inserted by Cre catalysis was therefore clonally separated by plaque purification. As 29 of 32 (91%) plaque purified specimens expressed EYFP, Cre-loxP site-specific recombination occurred with nearly saturating efficacy. Notwithstanding the presence of several copies of viral promoters (p10, polh) and terminators (SV40, HSVtk), MultiBac derivatives could be serially passaged at least five times in Sf21 cells at a multiplicity of infection (MOI)≦1.
The vectors pFBDM (SEQ ID NO. 1) and pUCDM (SEQ ID NO. 2) are particularly suited for generating multigene expression cassettes due to the multiplication module inserted in between the two promoters. The logic of multiplication is illustrated in
The baculovirus genome was modified to obtain improved protein production properties. Two baculoviral genes, v-cath and chiA, were disrupted which leads to improved maintenance of cellular compartments during infection and protein production. The v-cath gene encodes for a viral protease, V-CATH, which is activated upon cell death by a process dependent on a juxtaposed gene on the viral DNA, chiA, which encodes for a chitinase. Both genes were disrupted to eliminate V-CATH activity and to gain the option of utilizing chitin-affinity chromatography for purification without interference from the chiA gene product. The quality of proteins produced by this so-called MultiBac baculovirus is significantly improved through a reduction of viral-dependent proteolytic activity and reduced cell lysis. In place of the disrupted viral DNA sequence, a LoxP sequence for cre-lox site-specific recombination was placed. For further details see
The genes of choice are cloned into the multiple cloning sites MCS1 or MCS2 (see
Approximately 5-10 ng of the pUCDM (SEQ ID NO. 2) derivative are incubated on ice (15 min) with 50-100 μl electro-competent DH10MultiBacCre cells. Following electroporation (200 ohms, 25 μF, 1.8 kV pulse), cells are incubated at 37° C. for 8 hours and plated on agar containing kanamycin (50 μg/ml), chloramphenicol (25 μg/ml) and ampicillin (100 μg/ml). Colonies appear after incubation at 37° C. (12-15 hours). Then bacmids can be prepared for insect cell transfection (see III.6.) or clones can be prepared for integration of a pFBDM (SEQ ID NO. 1) derivative by Tn7 transposition (see below).
Approximately 5-10 ng of the pFBDM (SEQ ID NO. 1) derivative are incubated on ice (15 min) with 50-100 μl electro-competent DH10MultiBacCre cells. Following electroporation (200 ohms, 25 μF, 1.8 kV pulse), cells are incubated at 37° C. for 8 hours and plated on agar containing kanamycin (50 μg/ml), gentamycin (7 μg/ml), ampicillin (100 μg/ml), tetracyclin (10 μg/ml), BluoGal (100 μg/ml) and IPTG (40 μg/ml). White colonies are selected after incubation at 37° C. (18-24 hours). Then bacmids can be prepared for insect cell infection (see below).
Cre-lox site-specific recombination and Tn7 transposition can be carried out simultaneously in DH10MultiBacCre cells, if desired. Since the efficacy of a double transformation is reduced as compared to transformation with one plasmid only, significantly larger amounts of DNA have to be utilized in this reaction. Approximately 2-4 μg of the pFBDM (SEQ ID NO. 1) derivative and 2-4 μg of the pUCDM (SEQ ID NO. 2) derivative of choice are incubated on ice (15 min) with 50-100 μl electro-competent DH10MultiBacCre cells. Following electroporation (200 ohms, 25 μF, 1.8 kV pulse) cells are incubated at 37° C. for 8 hours and plated on agar containing chloramphenicol (25 μg/ml), kanamycin (50 μg/ml), gentamycin (7 μg/ml), tetracyclin (10 μg/ml), BluoGal (100 μg/ml) and IPTG (40 μg/ml). White colonies are selected after incubation at 37° C. (18-24 hours). Next, bacmids can be prepared for insect cell infection (see below).
For certain applications, it can be advantageous to add protein genes for expression to a MultiBac baculoviral DNA which already carries a set of foreign genes integrated by Cre catalysis. Then, the DH10MultiBacCre cells harboring recombinant MultiBac with an integrated pUCDM derivative (see III.2.) are restreaked on agar containing chloramphenicol (25 μg/ml), kanamycin (50 μg/ml), ampicillin (100 μg/ml), tetracyclin (10 μg/ml), BluoGal (100 μg/ml) and IPTG (40 μg/ml). A blue colony with a transposition-competent MultiBac derivative is then incubated in 500 ml 2×TY medium containing chloramphenicol (25 μg/ml), kanamycin (50 μg/ml), ampicillin (50 μg/ml), and tetracyclin (10 μg/ml) at 37° C. until OD600 reaches 0.5. The culture is then cooled on ice (15 min), and centrifuged (4000 rpm, 8 min). The cell pellet is resuspended in 250 ml ice-cold 10% glycerol solution (sterile) and centrifuged (4000 rpm, 8 min). The cell pellet is then resuspended in 200 ml ice-cold 10% glycerol solution (sterile) and centrifuged again (4000 rpm, 8 min). Then, the cell pellet is resuspended in 50 ml ice-cold 10% glycerol solution (sterile), and finally after centrifugation in 1 ml 10% glycerol solution (sterile). Cells are frozen in 50-100 μl aliquots in liquid nitrogen and stored at −80° C. Transposition of pFBDM (SEQ ID NO. 1) derivatives can be carried out as described below.
Preparation of bacmid DNA, infection of insect cells and protein expression is carried out according to established protocols (e.g. O'Reilly, D. R., Miller, L. K. & Luckow, V. A. “Baculovirus expression vectors. A laboratory manual.” Oxford University Press, New York-Oxford (1994); “Bac-to-Bac™ Baculoviorus Expression Systems Manual.” Invitrogen, Life Technologies Incorporated, (2000)).
The propagation of MultiBac in DH10MultiBacCre cells is dependent on the presence of the F-replicon on the bacmid. A function of the F-replicon is the tight control of the copy-number (one or two), reducing the potential for undesired recombination. Introduction of pFBDM (SEQ ID NO. 1) derivatives into MultiBac disrupts the lacZα gene thus allowing for unambiguous identification of cells containing only composite bacmid. In case of Cre-catalyzed integration of pUCDM (SEQ ID NO. 2) derivatives, however, a co-existence of one composite bacmid and one parent MultiBac molecule can not be ruled out based on chloramphenicol resistance. Virus from initial transfections with MultiBac containing a gene for yellow fluorescent protein EYFP inserted by Cre catalysis was therefore clonally separated by plaque purification. 29 of 32 (91%) plaque purified specimens expressed EYFP, arguing for a cre-lox site-specific recombination reaction with close to saturating efficacy. (for further detail see
During heterologous protein production using a commercially available baculovirus expression system, viral-dependent proteolytic breakdown consistent with the action of a cysteine protease was observed. The baculoviral v-cath gene encodes for a cysteine protease which is directly involved in liquefaction of the insect cell host. V-CATH is activated upon cell death by a process dependent on a juxtaposed gene on the viral DNA, chiA, which encodes for a chitinase. Disruption of both genes eliminated V-CATH activity and further provided the option of utilizing chitin-affinity chromatography for purification without interference from the chiA gene product. The effect of the disruption was assayed by comparing samples from cells infected with MultiBac virus to cells infected with a commercially available baculovirus carrying v-cath and chiA. A strongly reduced proteolytic activity, concomitant with much improved maintenance of cell integrity, was observed in lysate from cells infected with MultiBac. (for more detail, see
In a test experiment the yeast Isw2 chromatin remodelling complex consisting of the 130 kDa Isw2p and the 145 kDa Itc1p proteins was expressed. One version of MultiBac was created with both proteins integrated at the attTn7 site, and a second version with Isw2p integrated at the attTn7 site and Itc1p inserted at the LoxP site. Spatial decoupling of the two genes on the virus did not adversely affect either relative production levels of the subunits or functional assembly of the Isw2 complex in insect cells, exemplifying the utility of both Cre-lox and Tn7 sites for simultaneous integration and expression of proteins. For further detail see
In addition to the yeast Isw2 remodeling complex also the three membered yeast Isw1 b complex (360 kD) and a human transcription factor complex (700 kDa) were expressed using MultiBac. Further, in all cases also EYFP fluorescent protein was co-expressed. The constant yield of EYFP and the respective complexes in the co-expression experiments illustrated that expression is not saturating in this system and suggests that even much larger complexes containing many more subunits can be expressed using MultiBac. For further detail see
A MultiBac derivative virus containing fluorescent proteins EYFP and ECFP under control of baculoviral promoters and dsRED under control of CMV late promoter were generated. Insect cells infected with this hybrid virus showed expression of EYFP and ECFP. Mammalian COS cells infected with virus amplified in insect cells showed strong fluorescence of dsRED protein, demonstrating the potential use of MultiBac for multigene transfer into mammalian cells (“BacMam”). For further detail see
A MultiBac system kit according to the invention may comprise one or more of the following:
DH10MultiBacCre cells, BW23474, BW23474 cells†, pFBDM (SEQ ID NO. 1) vector, pUCDM (SEQ ID NO. 2) vector, control plasmid for Tn7 transposition*, control plasmid for cre-lox site-specific recombination*, a generic transfectant reagent#† E. coli strains expression the pir gene for propagation of pUCDM (SEQ ID NO. 2) derivatives (any other strain with pir+ background can be used).* In the experiments, vectors carrying genes for fluorescent proteins ECFP and EYFP were used as controls. These genes are marketed under license by Molecular Probes. They are particularly useful as controls since the observation of fluorescence either by fluorescent microscopy or by using a fluorescence spectrophotometer is entirely straight forward. However, any type of control plasmid carrying a gene encoding for a protein that can be identified with ease (glucurodinase, catechol dioxygenase, XyIE, luciferase etc.) can be utilized.# For example CellFECTIN (Invitrogen), LipoTAXI® Transfection Reagent (Stratagene) etc.
| Number | Date | Country | |
|---|---|---|---|
| 60552072 | Mar 2004 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10592066 | Sep 2006 | US |
| Child | 14966258 | US |
