Patent Grant
9511129
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Dec. 9, 2013, is named ANZ7000UT_SeqList_Text.txt and is 20,677 bytes in size.
The following discussion of the background of the invention is merely provided to aid the reader in understanding the invention and is not admitted to describe or constitute prior art to the present invention.
Pathogenic organisms are, by definition, capable of causing disease in an infected host. For clinical use of such organisms, attenuated vaccine strains are often created which exhibit reduced or eliminated virulence, but which still retain sufficient viability to stimulate a desired immune response against the pathogen or heterologous antigen(s) of interest. Attenuated vector platforms have been demonstrated to elicit protective responses specific for encoded heterologous antigens in a number of experimental models, including infectious and malignant diseases.
Although most attenuated vaccine vectors are viral, bacterial vaccine vector platforms have been developed for both prophylactic and therapeutic applications. Attenuated strains of many otherwise pathogenic bacteria are now available and the ease of manipulation for generating recombinant strains provides a means for using bacteria as efficacious delivery vehicles for a number of foreign proteins such as antigens associated with infectious diseases and cancer. Live attenuated bacterial vaccine strains have been developed from, inter alia, Listeria, Escherichia, Salmonella, Shigella, Lactobacillus, and Yersinia species.
While such vaccine strains may exhibit reduced virulence, their safety, particularly in immune compromised individuals, remains a concern. One example of a strategy to further reduce the risk of bacterial vaccines is the so-called Killed But Metabolically Active (“KBMA”) approach. KBMA vaccine strains are constructed by abrogating the capacity for nucleotide excision repair through deletion of DNA repair genes such as uvrA and uvrB. The gene deletion renders the bacteria exquisitely sensitive to photochemical inactivation through the combined treatment of psoralens and UVA. Because of their inability to repair the psoralen-induced DNA cross-links formed, KBMA bacterial strains are unable to replicate and are thus functionally noninfectious. This characteristic provides an improved safety profile in comparison to live attenuated strains. The very limited number of cross-links, however, preserves their metabolic activity, including antigen expression, and thus their immune potential. Manufacturing of KBMA strains exhibiting consistent properties, however, may be difficult, as titration of the number of cross-links is dependent on a number of difficult to control variables.
There remains a need in the art to provide attenuated bacterial vaccine strains with advantageous safety profiles for use treatment or prevention of diseases having a risk-benefit profile not appropriate for live attenuated vaccines.
The present invention provides facultatively attenuated bacterial species and methods of preparation and use thereof. The term “facultatively attenuated” as used herein refers to a bacterium which comprises a set of defined recombinant modifications which have substantially no effect on the ability of the bacterium to grow by multiplication when the bacterium is outside of its host organism, but which result in deletion of one or more genes essential for multiplication of the bacterium when the bacterium is introduced into its host organism, for example within host cells of a vaccinate recipient. These recombinant modifications take advantage of regulatory sequences which preferentially induce expression of genes within the mammalian host.
As described hereinafter, the bacterium is most preferably an intracellular pathogen, such as Listeria monocytogenes.
In a first aspect of the invention, the invention relates to methods of configuring a bacterium to delete one or more genes in the bacterial genome which are essential for multiplication of the bacterium, the deletion occurring preferentially when the bacterium is introduced into a host. These methods comprise:
The recombinase, when specifically induced and expressed in the mammalian host cell, catalyzes a site specific recombination event which deletes the gene(s) essential for multiplication of the bacterium flanked by the first and second attachment sites. Following this site specific recombination event the bacterium is deficient for multiplication.
The phrase “substantially no effect on the ability of the bacterium to grow by multiplication” as used herein refers to a bacterium in which colony formation is at least 75% of that of a bacterium which is otherwise identical, but which lacks the defined recombinant modifications described above. For convenience, such a bacterium which lacks the recombinantly introduced recombinase sequence and the recombinantly introduced first and second attachment sites are referred to herein as a “wild type” bacterium. In preferred embodiments, colony formation is at least 80% of that of a wild type bacterium, more preferably at least 90% of a wild type bacterium, and most preferably at least 95% of a wild type bacterium. Colony formation is determined in an in vitro colony formation assay, and is expressed as colony-forming units (CFU).
As used herein with regard to a gene (or genes), the term “essential for multiplication” refers to a gene that, when deleted, results in a bacterium in which colony formation is reduced to 1% of wild type or less, and/or in which the growth of the bacterium (measured by CFU) in host cells contained in the organism is reduced by at least 1000-fold relative to wild type. Preferably, colony formation is reduced to 0.01% of wild type or less. A bacterium in which such a gene (or genes) has been deleted is referred to herein as being “deficient for multiplication.”
In the context of the present invention, deletion of a gene (or genes) essential for multiplication occurs preferentially when the bacterium is introduced into a host organism. As used herein, a deletion event occurs “preferentially in a host” if introduction of the bacterium into the host organism converts a bacterium in which colony formation is at least 75% of that of a wild type bacterium into a bacterium in which colony formation is reduced to 1% of wild type or less. Preferably, colony formation is reduced to 0.01% of wild type or less.
The term “regulatory sequences which preferentially induce expression of the recombinase in the host cell” refer to regulatory sequences which induce expression of a gene under control thereof by at least 10-fold upon introduction of the bacterium into a host organism. By way of example only, expression of genes under the actA promoter of Listeria is dependent upon a regulatory factor known as PrfA for transcriptional activation. Relative to broth-grown Listeria, gene expression under actA/PrfA regulation is induced approximately 200-fold when Listeria is present in host cells. Thus, in certain embodiments the regulatory sequences comprise a Listeria monocytogenes promoter which is PrfA-dependent. PrfA-dependent promoters may be selected from the group consisting of the inlA promoter, the inlB promoter, the inlC promoter, the hpt promoter, the hly promoter, the plcA promoter, the mpl promoter, and the actA promoter. Similar systems to induce gene expression in host organisms for other bacterial species are described hereinafter. In preferred embodiments, such preferentially induced expression increases at least 50-fold, more preferably at least 100-fold, and still more preferably at least 1000-fold, upon introduction of the bacterium into a host organism.
The term “host organism” as used herein refer to an organism in which the bacterium of interest is able to multiply in the absence of deletion of a gene (or genes) essential for multiplication as described herein. In certain embodiments, a host organism is a mammalian species, most preferably a human. Also, in certain embodiments, the bacterium is an intracellular pathogen, and the regulatory sequences preferentially induce expression of the recombinase when the bacterium is in a mammalian host cell. Preferred bacterial genuses are selected from the group consisting of Listeria, Neisseria, Mycobacterium, Francisella, Bacillus, Salmonella, Shigella, Yersinia, Brucella, Legionella, Rickettsia, and Chlamydia. This list is not meant to be limiting. Most preferably, the bacterium is a facultative intracellular bacterium such as Listeria, Salmonella, Shigella, Francisella, Mycobacterium, Legionella, Burkholderia and Brucella. In certain exemplary embodiments described hereinafter, the bacterium is Listeria monocytogenes, including modified such as Listeria monocytogenes ΔActA/ΔInlB (a L. monocytogenes in which the native ActA and InlB genes have been deleted or rendered functionally deleted by mutation).
As noted above, a recombinase sequence which is recombinantly introduced into a bacterium is heterologous to the bacterium. As used herein, this term refers to a recombinase which is not a normal constituent of the bacterial genome. In various embodiments, the recombinase may be selected from the group consisting of φC31 integrase, R4 integrase, TP901 integrase, φBT1 integrase, BxB1 integrase, PSA integrase, Cre recombinase, Flp recombinase, XerC recombinase, λ integrase, HK022 integrase, P22 integrase, HP1 integrase, L5 integrase, γδ recombinase, Tn3 recombinase, gin recombinase, RV integrase, SPBc integrase, TG1 integrase, φC1 integrase, MR11 integrase, φ370 integrase, φK38 integrase, Wβ integrase, and BL3 integrase. Suitable recombinase attachment sites can include recombinantly introduced attB and attP sites.
In certain embodiments, the gene(s) essential for multiplication of the bacterium comprise at least one gene involved in DNA replication. Such genes may be selected from the group consisting of ori, dnaA, dnaN, gyrA, gyrB, polC, dnaE, ftsK, ftsZ, ligA, dnaG, parC, parE, holB, dnaX, SMC, and ftsY.
As described hereinafter, a plurality of genes essential for multiplication of the bacterium are often grouped together as a single operon. In this case, the first attachment site may be preferentially recombinantly introduced upstream of a portion of the operon, and the second attachment site recombinantly introduced downstream of a portion of the operon, such that the site specific recombination event deletes a plurality of such genes in a single event. Preferably, the first attachment site is upstream of the operon, and the second attachment site is downstream of the operon. The first and second attachment sites can flank a nucleic acid sequence about 20 kb in length or less, about 10 kb in length or less, and about 6 kb in length. The term “about” in this context refers to +/−10% of a given length.
In certain embodiments, the bacterium is utilized as an expression platform for expressing one or more genes which are heterologous to the bacterium, for example for purposes of generating an immune response to the heterologous proteins expressed from those genes. In these embodiments, the bacterium can comprise within the bacterial genome an exogenous nucleic acid sequence encoding a heterologous polypeptide(s), wherein the exogenous nucleic acid sequence is operably connected to regulatory sequences which preferentially induce expression of the heterologous polypeptide when the bacterium is in a mammalian host.
In a related aspect, the invention relates to methods of deleting one or more genes in a bacterial genome which are essential for multiplication of a bacterium. These methods comprise introducing the facultatively attenuated bacterium described herein to a host organism host under conditions wherein the recombinase is expressed by the bacterium, and wherein the expressed recombinase deletes the one or more genes essential for multiplication of the bacterium by the site specific recombination event.
In yet another aspect, the present invention relates to a facultatively attenuated bacterium, or population thereof such as a bacterial culture, as described herein. Such a bacterium comprises:
As also noted above, a recombinase sequence which is recombinantly introduced into a bacterium is heterologous to the bacterium. As used herein, this term refers to a recombinase which is not a normal constituent of the bacterial genome. In various embodiments, the recombinase may be selected from the group consisting of φC31 integrase, R4 integrase, TP901 integrase, φBT1 integrase, BxB1 integrase, PSA integrase, Cre recombinase, Flp recombinase, XerC recombinase, λ integrase, HK022 integrase, P22 integrase, HP1 integrase, L5 integrase, γδ recombinase, Tn3 recombinase, gin recombinase, RV integrase, SPBc integrase, TG1 integrase, φC1 integrase, MR11 integrase, φ370 integrase, φK38 integrase, Wβ integrase, and BL3 integrase. Suitable recombinase attachment sites can include recombinantly introduced attB and attP sites.
As described hereinafter, a plurality of genes essential for multiplication of the bacterium are often grouped together as a single operon. In this case, the first attachment site may be preferentially recombinantly introduced upstream of a portion of the operon, and the second attachment site recombinantly introduced downstream of a portion of the operon, such that the site specific recombination event deletes a plurality of such genes in a single event. Preferably, the first attachment site is upstream of the operon, and the second attachment site is downstream of the operon. The first and second attachment sites can flank a nucleic acid sequence about 20 kb in length or less, about 10 kb in length or less, about 6 kb in length, or of any length that is sufficient to inactivate multiplication of the bacterium in the host cell. The term “about” in this context refers to +/−10% of a given length.
The bacterium of the present invention may be utilized as an expression platform for expressing one or more genes which are heterologous to the bacterium, for example for purposes of generating an immune response to the heterologous proteins expressed from those genes. In these embodiments, the bacterium can comprise within the bacterial genome an exogenous nucleic acid sequence encoding a heterologous polypeptide, wherein the exogenous nucleic acid sequence is operably connected to regulatory sequences which preferentially induce expression of the heterologous polypeptide when the bacterium is in a mammalian host.
).
The present invention relates to compositions and methods for preparing and using facultatively attenuated bacterial species. The present invention can provide attenuated bacterial vaccine strains with advantageous safety profiles for use treatment or prevention of diseases having a risk-benefit profile not appropriate for live attenuated vaccines.
While described hereinafter in detail with regard to Listeria monocytogenes, the skilled artisan will understand that the methods and compositions described herein are generally applicable to bacterial species, and in particular to facultative intracellular bacterial species.
Listeria monocytogenes (Lm) is a facultative intracellular bacterium characterized by its ability to induce a profound innate immune response that leads to robust and highly functional CD4 and CD8 T cell immunity specific for vaccine-encoded Ags. Lm is a food-borne bacterium with increased pathogenicity among immune compromised individuals, including patients with cancer or other viral-induced immune deficiencies, pregnant women, the elderly and infants.
Live-attenuated recombinant Lm vaccine platforms engineered to encode a designated antigen(s) relevant to a selected targeted pathogenic agent or malignancy have formed the basis for several human clinical trials. In particular, genetically defined live-attenuated Lm ΔactAΔinlB, which is deleted of two virulence genes and is attenuated >3 logs in the mouse listeriosis model, retains its immunologic potency and has been shown to induce robust CD4 and CD8 T cell immunity in both mouse models of human disease as well as in humans, and has been shown to be safe and well-tolerated in clinical settings among patients with various solid tumor malignancies.
To prime a desired CD8 T cell response, Lm-based vaccines must retain the ability to escape from the vacuole of infected dendritic cells (DCs) in a process mediated by expression of a pore-forming cytolysin known as listeriolysin O (LLO), and desired antigens are engineered to be expressed and secreted from bacteria in the cytoplasm, where they are subsequently processed and presented on MHC class I molecules. Thus, inactivated Lm vaccines, such as those inactivated by heat (Heat-Killed Lm; HKLM) and are not metabolically active and cannot induce a desired CD8 T cell response that can effectively protect against challenge with a pathogen containing the vaccine immunogen or conferring efficacy in tumor-bearing animals. This dichotomy is well-known in the field and represents a challenge to vaccinologists developing Lm vaccine platforms that retain immunologic potency that is comparable to live-attenuated Lm vaccine platforms, yet have the safety of HKLM.
Facultatively attenuated Lm, referred to herein as Recombinase-Induced Intracellular Death (Lm-RIID), has been developed to address the need for safe and immunologically potent Lm-based vaccine platforms. Lm-RIID vaccines concurrently express the vaccine antigen of interest and induce the deletion of genes essential for bacterial viability after the Lm vaccine strain escapes into the cytosol of the host cell. Lm-RIID vaccines grow in broth culture with the same properties as live-attenuated Lm vaccines such as Lm ΔactAΔinlB based vaccines, but commit suicide once inside host cells. This is achieved by flanking essential target Lm genes with recombinase (e.g., loxP) sites, and driving expression of a sequence-specific recombinase (e.g., Cre recombinase) as well as vaccine antigen expression, from promoters that are specifically induced in the host organism, in this case in the host cytoplasm. This results in a self-limiting infection even when administered intravenously into a host animal. As described hereinafter, Lm-RIID vaccines can be derived from previously described live-attenuated Lm vaccine strains, for example Lm ΔactAΔinlB. Expression of the ActA protein is induced >200-fold with infected host mammalian cells, compared to broth culture. However, the PrfA-dependent actA promoter is NOT substantially induced in broth culture. Lm-RIID vaccines can be manufactured with the same methods used for growth of live-attenuated Lm vaccines, such as the Lm ΔactAΔinlB strain.
It is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings. The invention is capable of embodiments in addition to those described and of being practiced and carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein, as well as the abstract, are for the purpose of description and should not be regarded as limiting.
As such, those skilled in the art will appreciate that the conception upon which this disclosure is based may readily be utilized as a basis for the designing of other structures, methods and systems for carrying out the several purposes of the present invention. It is important, therefore, that the claims be regarded as including such equivalent constructions insofar as they do not depart from the spirit and scope of the present invention.
1. Definitions
Abbreviations used to indicate a mutation in a gene, or a mutation in a bacterium comprising the gene, are as follows. By way of example, the abbreviation “L. monocytogenes ΔactA” means that part, or all, of the actA gene was deleted. The delta symbol (Δ) means deletion. An abbreviation including a superscripted minus sign (Listeria ActA−) means that the actA gene was mutated, e.g., by way of a deletion, point mutation, or frameshift mutation, but not limited to these types of mutations.
“Administration” as it applies to a human, mammal, mammalian subject, animal, veterinary subject, placebo subject, research subject, experimental subject, cell, tissue, organ, or biological fluid, refers without limitation to contact of an exogenous ligand, reagent, placebo, small molecule, pharmaceutical agent, therapeutic agent, diagnostic agent, or composition to the subject, cell, tissue, organ, or biological fluid, and the like. “Administration” can refer, e.g., to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. Treatment of a cell encompasses contact of a reagent to the cell, as well as contact of a reagent to a fluid, where the fluid is in contact with the cell. “Administration” also encompasses in vitro and ex vivo treatments, e.g., of a cell, by a reagent, diagnostic, binding composition, or by another cell.
An “agonist,” as it relates to a ligand and receptor, comprises a molecule, combination of molecules, a complex, or a combination of reagents, that stimulates the receptor. For example, an agonist of granulocyte-macrophage colony stimulating factor (GM-CSF) can encompass GM-CSF, a mutein or derivative of GM-CSF, a peptide mimetic of GM-CSF, a small molecule that mimics the biological function of GM-CSF, or an antibody that stimulates GM-CSF receptor.
An “antagonist,” as it relates to a ligand and receptor, comprises a molecule, combination of molecules, or a complex, that inhibits, counteracts, downregulates, and/or desensitizes the receptor. “Antagonist” encompasses any reagent that inhibits a constitutive activity of the receptor. A constitutive activity is one that is manifest in the absence of a ligand/receptor interaction. “Antagonist” also encompasses any reagent that inhibits or prevents a stimulated (or regulated) activity of a receptor. By way of example, an antagonist of GM-CSF receptor includes, without implying any limitation, an antibody that binds to the ligand (GM-CSF) and prevents it from binding to the receptor, or an antibody that binds to the receptor and prevents the ligand from binding to the receptor, or where the antibody locks the receptor in an inactive conformation.
As used herein, an “analog” or “derivative” with reference to a peptide, polypeptide or protein refers to another peptide, polypeptide or protein that possesses a similar or identical function as the original peptide, polypeptide or protein, but does not necessarily comprise a similar or identical amino acid sequence or structure of the original peptide, polypeptide or protein. An analog preferably satisfies at least one of the following: (a) a proteinaceous agent having an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the original amino acid sequence (b) a proteinaceous agent encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding the original amino acid sequence; and (c) a proteinaceous agent encoded by a nucleotide sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the nucleotide sequence encoding the original amino acid sequence.
“Antigen presenting cells” (APCs) are cells of the immune system used for presenting antigen to T cells. APCs include dendritic cells, monocytes, macrophages, marginal zone Kupffer cells, microglia, Langerhans cells, T cells, and B cells. Dendritic cells occur in at least two lineages. The first lineage encompasses pre-DC1, myeloid DC1, and mature DC1. The second lineage encompasses CD34+CD45RA− early progenitor multipotent cells, CD34+CD45RA+ cells, CD34+CD45RA+CD4+IL-3Ra+pro-DC2 cells, CD4+CD11c− plasmacytoid pre-DC2 cells, lymphoid human DC2 plasmacytoid-derived DC2s, and mature DC2s.
“Attenuation” and “attenuated” encompasses a bacterium, virus, parasite, infectious organism, prion, tumor cell, gene in the infectious organism, and the like, that is modified to reduce toxicity to a host. The host can be a human or animal host, or an organ, tissue, or cell. The bacterium, to give a non-limiting example, can be attenuated to reduce binding to a host cell, to reduce spread from one host cell to another host cell, to reduce extracellular growth, or to reduce intracellular growth in a host cell. Attenuation can be assessed by measuring, e.g., an indicum or indicia of toxicity, the LD50, the rate of clearance from an organ, or the competitive index (see, e.g., Auerbuch, et al. (2001) Infect. Immunity 69:5953-5957). Generally, an attenuation results an increase in the LD50 and/or an increase in the rate of clearance by at least 25%; more generally by at least 50%; most generally by at least 100% (2-fold); normally by at least 5-fold; more normally by at least 10-fold; most normally by at least 50-fold; often by at least 100-fold; more often by at least 500-fold; and most often by at least 1000-fold; usually by at least 5000-fold; more usually by at least 10,000-fold; and most usually by at least 50,000-fold; and most often by at least 100,000-fold.
“Attenuated gene” encompasses a gene that mediates toxicity, pathology, or virulence, to a host, growth within the host, or survival within the host, where the gene is mutated in a way that mitigates, reduces, or eliminates the toxicity, pathology, or virulence. The reduction or elimination can be assessed by comparing the virulence or toxicity mediated by the mutated gene with that mediated by the non-mutated (or parent) gene. “Mutated gene” encompasses deletions, point mutations, and frameshift mutations in regulatory regions of the gene, coding regions of the gene, non-coding regions of the gene, or any combination thereof.
“Conservatively modified variants” applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, a conservatively modified variant refers to nucleic acids encoding identical amino acid sequences, or amino acid sequences that have one or more conservative substitutions. An example of a conservative substitution is the exchange of an amino acid in one of the following groups for another amino acid of the same group (U.S. Pat. No. 5,767,063 issued to Lee, et al.; Kyte and Doolittle (1982) J. Mol. Biol. 157:105-132).
“Effective amount” encompasses, without limitation, an amount that can ameliorate, reverse, mitigate, prevent, or diagnose a symptom or sign of a medical condition or disorder. Unless dictated otherwise, explicitly or by context, an “effective amount” is not limited to a minimal amount sufficient to ameliorate a condition.
An “extracellular fluid” encompasses, e.g., serum, plasma, blood, interstitial fluid, cerebrospinal fluid, secreted fluids, lymph, bile, sweat, fecal matter, and urine. An “extracelluar fluid” can comprise a colloid or a suspension, e.g., whole blood or coagulated blood.
The term “fragments” in the context of polypeptides include a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues of the amino acid sequence of a larger polypeptide.
“Gene” refers to a nucleic acid sequence encoding an oligopeptide or polypeptide. The oligopeptide or polypeptide can be biologically active, antigenically active, biologically inactive, or antigenically inactive, and the like. The term gene encompasses, e.g., the sum of the open reading frames (ORFs) encoding a specific oligopeptide or polypeptide; the sum of the ORFs plus the nucleic acids encoding introns; the sum of the ORFs and the operably linked promoter(s); the sum of the ORFS and the operably linked promoter(s) and any introns; the sum of the ORFS and the operably linked promoter(s), intron(s), and promoter(s), and other regulatory elements, such as enhancer(s). In certain embodiments, “gene” encompasses any sequences required in cis for regulating expression of the gene. The term gene can also refer to a nucleic acid that encodes a peptide encompassing an antigen or an antigenically active fragment of a peptide, oligopeptide, polypeptide, or protein. The term gene does not necessarily imply that the encoded peptide or protein has any biological activity, or even that the peptide or protein is antigenically active. A nucleic acid sequence encoding a non-expressable sequence is generally considered a pseudogene. The term gene also encompasses nucleic acid sequences encoding a ribonucleic acid such as rRNA, tRNA, or a ribozyme.
“Growth” of a bacterium such as Listeria encompasses, without limitation, functions of bacterial physiology and genes relating to colonization, replication, increase in protein content, and/or increase in lipid content. Unless specified otherwise explicitly or by context, growth of a Listeria encompasses growth of the bacterium outside a host cell, and also growth inside a host cell. Growth related genes include, without implying any limitation, those that mediate energy production (e.g., glycolysis, Krebs cycle, cytochromes), anabolism and/or catabolism of amino acids, sugars, lipids, minerals, purines, and pyrimidines, nutrient transport, transcription, translation, and/or replication. In some embodiments, “growth” of a Listeria bacterium refers to intracellular growth of the Listeria bacterium, that is, growth inside a host cell such as a mammalian cell. While intracellular growth of a Listeria bacterium can be measured by light microscopy or colony forming unit (CFU) assays, growth is not to be limited by any technique of measurement. Biochemical parameters such as the quantity of a Listerial antigen, Listerial nucleic acid sequence, or lipid specific to the Listeria bacterium, can be used to assess growth. In some embodiments, a gene that mediates growth is one that specifically mediates intracellular growth. In some embodiments, a gene that specifically mediates intracellular growth encompasses, but is not limited to, a gene where inactivation of the gene reduces the rate of intracellular growth but does not detectably, substantially, or appreciably, reduce the rate of extracellular growth (e.g., growth in broth), or a gene where inactivation of the gene reduces the rate of intracellular growth to a greater extent than it reduces the rate of extracellular growth. To provide a non-limiting example, in some embodiments, a gene where inactivation reduces the rate of intracellular growth to a greater extent than extracellular growth encompasses the situation where inactivation reduces intracellular growth to less than 50% the normal or maximal value, but reduces extracellular growth to only 1-5%, 5-10%, or 10-15% the maximal value. The invention, in certain aspects, encompasses a Listeria attenuated in intracellular growth but not attenuated in extracellular growth, a Listeria not attenuated in intracellular growth and not attenuated in extracellular growth, as well as a Listeria not attenuated in intracellular growth but attenuated in extracellular growth.
A composition that is “labeled” is detectable, either directly or indirectly, by spectroscopic, photochemical, biochemical, immunochemical, isotopic, or chemical methods. For example, useful labels include 32P, 33P, 35S, 14C, 3H, 125I, stable isotopes, epitope tags, fluorescent dyes, electron-dense reagents, substrates, or enzymes, e.g., as used in enzyme-linked immunoassays, or fluorettes (see, e.g., Rozinov and Nolan (1998) Chem. Biol. 5:713-728).
“Ligand” refers to a small molecule, peptide, polypeptide, or membrane associated or membrane-bound molecule, that is an agonist or antagonist of a receptor. “Ligand” also encompasses a binding agent that is not an agonist or antagonist, and has no agonist or antagonist properties. By convention, where a ligand is membrane-bound on a first cell, the receptor usually occurs on a second cell. The second cell may have the same identity (the same name), or it may have a different identity (a different name), as the first cell. A ligand or receptor may be entirely intracellular, that is, it may reside in the cytosol, nucleus, or in some other intracellular compartment. The ligand or receptor may change its location, e.g., from an intracellular compartment to the outer face of the plasma membrane. The complex of a ligand and receptor is termed a “ligand receptor complex.” Where a ligand and receptor are involved in a signaling pathway, the ligand occurs at an upstream position and the receptor occurs at a downstream position of the signaling pathway.
“Nucleic acid” refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single stranded, double-stranded form, or multi-stranded form. Non-limiting examples of a nucleic acid are a, e.g., cDNA, mRNA, oligonucleotide, and polynucleotide. A particular nucleic acid sequence can also implicitly encompasses “allelic variants” and “splice variants.”
“Operably linked” in the context of a promoter and a nucleic acid encoding a mRNA means that the promoter can be used to initiate transcription of that nucleic acid.
The terms “percent sequence identity” and “% sequence identity” refer to the percentage of sequence similarity found by a comparison or alignment of two or more amino acid or nucleic acid sequences. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. An algorithm for calculating percent identity is the Smith-Waterman homology search algorithm (see, e.g., Kann and Goldstein (2002) Proteins 48:367-376; Arslan, et al. (2001) Bioinformatics 17:327-337).
By “purified” and “isolated” is meant, when referring to a polypeptide, that the polypeptide is present in the substantial absence of the other biological macromolecules with which it is associated in nature. The term “purified” as used herein means that an identified polypeptide often accounts for at least 50%, more often accounts for at least 60%, typically accounts for at least 70%, more typically accounts for at least 75%, most typically accounts for at least 80%, usually accounts for at least 85%, more usually accounts for at least 90%, most usually accounts for at least 95%, and conventionally accounts for at least 98% by weight, or greater, of the polypeptides present. The weights of water, buffers, salts, detergents, reductants, protease inhibitors, stabilizers (including an added protein such as albumin), and excipients, and molecules having a molecular weight of less than 1000, are generally not used in the determination of polypeptide purity. See, e.g., discussion of purity in U.S. Pat. No. 6,090,611 issued to Covacci, et al.
“Peptide” refers to a short sequence of amino acids, where the amino acids are connected to each other by peptide bonds. A peptide may occur free or bound to another moiety, such as a macromolecule, lipid, oligo- or polysaccharide, and/or a polypeptide. Where a peptide is incorporated into a polypeptide chain, the term “peptide” may still be used to refer specifically to the short sequence of amino acids. A “peptide” may be connected to another moiety by way of a peptide bond or some other type of linkage. A peptide is at least two amino acids in length and generally less than about 25 amino acids in length, where the maximal length is a function of custom or context. The terms “peptide” and “oligopeptide” may be used interchangeably.
“Protein” generally refers to the sequence of amino acids comprising a polypeptide chain. Protein may also refer to a three dimensional structure of the polypeptide. “Denatured protein” refers to a partially denatured polypeptide, having some residual three dimensional structure or, alternatively, to an essentially random three dimensional structure, i.e., totally denatured. The invention encompasses reagents of, and methods using, polypeptide variants, e.g., involving glycosylation, phosphorylation, sulfation, disulfide bond formation, deamidation, isomerization, cleavage points in signal or leader sequence processing, covalent and non-covalently bound cofactors, oxidized variants, and the like. The formation of disulfide linked proteins is described (see, e.g., Woycechowsky and Raines (2000) Curr. Opin. Chem. Biol. 4:533-539; Creighton, et al. (1995) Trends Biotechnol. 13:18-23).
“Recombinant” when used with reference, e.g., to a nucleic acid, cell, animal, virus, plasmid, vector, or the like, indicates modification by the introduction of an exogenous, non-native nucleic acid, alteration of a native nucleic acid, or by derivation in whole or in part from a recombinant nucleic acid, cell, virus, plasmid, or vector. Recombinant protein refers to a protein derived, e.g., from a recombinant nucleic acid, virus, plasmid, vector, or the like. “Recombinant bacterium” encompasses a bacterium where the genome is engineered by recombinant methods, e.g., by way of a mutation, deletion, insertion, and/or a rearrangement. “Recombinant bacterium” also encompasses a bacterium modified to include a recombinant extra-genomic nucleic acid, e.g., a plasmid or a second chromosome, or a bacterium where an existing extra-genomic nucleic acid is altered.
“Sample” refers to a sample from a human, animal, placebo, or research sample, e.g., a cell, tissue, organ, fluid, gas, aerosol, slurry, colloid, or coagulated material. The “sample” may be tested in vivo, e.g., without removal from the human or animal, or it may be tested in vitro. The sample may be tested after processing, e.g., by histological methods. “Sample” also refers, e.g., to a cell comprising a fluid or tissue sample or a cell separated from a fluid or tissue sample. “Sample” may also refer to a cell, tissue, organ, or fluid that is freshly taken from a human or animal, or to a cell, tissue, organ, or fluid that is processed or stored.
A “selectable marker” encompasses a nucleic acid that allows one to select for or against a cell that contains the selectable marker. Examples of selectable markers include, without limitation, e.g.: (1) A nucleic acid encoding a product providing resistance to an otherwise toxic compound (e.g., an antibiotic), or encoding susceptibility to an otherwise harmless compound (e.g., sucrose); (2) A nucleic acid encoding a product that is otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) A nucleic acid encoding a product that suppresses an activity of a gene product; (4) A nucleic acid that encodes a product that can be readily identified (e.g., phenotypic markers such as beta-galactosidase, green fluorescent protein (GFP), cell surface proteins, an epitope tag, a FLAG tag); (5) A nucleic acid that can be identified by hybridization techniques, for example, PCR or molecular beacons.
“Specifically” or “selectively” binds, when referring to a ligand/receptor, nucleic acid/complementary nucleic acid, antibody/antigen, or other binding pair (e.g., a cytokine to a cytokine receptor) indicates a binding reaction which is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated conditions, a specified ligand binds to a particular receptor and does not bind in a significant amount to other proteins present in the sample. Specific binding can also mean, e.g., that the binding compound, nucleic acid ligand, antibody, or binding composition derived from the antigen-binding site of an antibody, of the contemplated method binds to its target with an affinity that is often at least 25% greater, more often at least 50% greater, most often at least 100% (2-fold) greater, normally at least ten times greater, more normally at least 20-times greater, and most normally at least 100-times greater than the affinity with any other binding compound.
In a typical embodiment an antibody will have an affinity that is greater than about 109 liters/mol, as determined, e.g., by Scatchard analysis (Munsen, et al. (1980) Analyt. Biochem. 107:220-239). It is recognized by the skilled artisan that some binding compounds can specifically bind to more than one target, e.g., an antibody specifically binds to its antigen, to lectins by way of the antibody's oligosaccharide, and/or to an Fc receptor by way of the antibody's Fc region.
“Spread” of a bacterium encompasses “cell to cell spread,” that is, transmission of the bacterium from a first host cell to a second host cell, as mediated, for example, by a vesicle. Functions relating to spread include, but are not limited to, e.g., formation of an actin tail, formation of a pseudopod-like extension, and formation of a double-membraned vacuole.
The term “subject” as used herein refers to a human or non-human organism. Thus, the methods and compositions described herein are applicable to both human and veterinary disease. In certain embodiments, subjects are “patients,” i.e., living humans that are receiving medical care for a disease or condition. This includes persons with no defined illness who are being investigated for signs of pathology.
The “target site” of a recombinase is the nucleic acid sequence or region that is recognized, bound, and/or acted upon by the recombinase (see, e.g., U.S. Pat. No. 6,379,943 issued to Graham, et al.; Smith and Thorpe (2002) Mol. Microbiol. 44:299-307; Groth and Calos (2004) J. Mol. Biol. 335:667-678; Nunes-Duby, et al. (1998) Nucleic Acids Res. 26:391-406).
“Therapeutically effective amount” is defined as an amount of a reagent or pharmaceutical composition that is sufficient to induce a desired immune response specific for encoded heterologous antigens, show a patient benefit, i.e., to cause a decrease, prevention, or amelioration of the symptoms of the condition being treated. When the agent or pharmaceutical composition comprises a diagnostic agent, a “diagnostically effective amount” is defined as an amount that is sufficient to produce a signal, image, or other diagnostic parameter. Effective amounts of the pharmaceutical formulation will vary according to factors such as the degree of susceptibility of the individual, the age, gender, and weight of the individual, and idiosyncratic responses of the individual (see, e.g., U.S. Pat. No. 5,888,530 issued to Netti, et al.).
“Treatment” or “treating” (with respect to a condition or a disease) is an approach for obtaining beneficial or desired results including and preferably clinical results. For purposes of this invention, beneficial or desired results with respect to a disease include, but are not limited to, one or more of the following: improving a condition associated with a disease, curing a disease, lessening severity of a disease, delaying progression of a disease, alleviating one or more symptoms associated with a disease, increasing the quality of life of one suffering from a disease, and/or prolonging survival. Likewise, for purposes of this invention, beneficial or desired results with respect to a condition include, but are not limited to, one or more of the following: improving a condition, curing a condition, lessening severity of a condition, delaying progression of a condition, alleviating one or more symptoms associated with a condition, increasing the quality of life of one suffering from a condition, and/or prolonging survival.
“Vaccine” encompasses preventative vaccines. Vaccine also encompasses therapeutic vaccines, e.g., a vaccine administered to a mammal that comprises a condition or disorder associated with the antigen or epitope provided by the vaccine. A number of bacterial species have been developed for use as vaccines and can be used in the present invention, including, but not limited to, Shigella flexneri, Escherichia coli, Listeria monocytogenes, Yersinia enterocolitica, Salmonella typhimurium, Salmonella typhi or mycobacterium species. This list is not meant to be limiting. See, e.g., WO04/006837; WO07/103,225; and WO07/117,371, each of which is hereby incorporated by reference in its entirety, including all tables, figures, and claims. The bacterial vector used in the vaccine composition may be a facultative, intracellular bacterial vector. The bacterium may be used to deliver a polypeptide described herein to antigen-presenting cells in the host organism. As described herein, L. monocytogenes provides a preferred vaccine platform for expression of the antigens of the present invention.
2. Targeting Essential Genes for Facultative Deletion
Bacteria engineered for Recombinase-Induced Intracellular Death (RIID) are programmed to “commit suicide” by linking expression of a recombinantly introduced recombinase gene to a promoter that is facultatively expressed when the bacterium is in a host organism. By way of example below, expression of the recombinase can be made facultative in Listeria using a PrfA-dependent promoter which may be selected from the inlA promoter, the inlB promoter, the inlC promoter, the hpt promoter, the hly promoter, the plcA promoter, the mpl promoter, and the actA promoter. PrfA is a transcription factor activated intracellularly which induces expression of linked genes in appropriately engineered vaccine strains.
The sequence of L. monocytogenes PrfA is as follows (SEQ ID NO: 1):
As noted above, in the following examples expression of the actA gene is responsive to PrfA, and the actA promoter is a PrfA responsive regulatory element. The actA promoter is a suitable promoter for facultative high-level expression of recombinase genes, as ActA is the most abundantly expressed Listeria protein and its expression is induced >200-fold within infected cells as compared to in vitro culture conditions.
Other regulatory systems which may be used in a manner similar to that of Listeria PrfA include the following:
Mycobacterium
tuberculosis
Francisella
tularensis
Salmonella
enterica
Shigella
flexneri
Burkholderia
cenocepacia
Brucella
melitensis
Legionella
pneumophila
Yersinia
pestis, enterocolitica
Bacillus
anthracis
Staphylococcus
aureus
In the following examples, expression of Cre recombinase is linked to the actA promoter for expression in Listeria. In alternatives, recombinases such as φC31 integrase, R4 integrase, TP901 integrase, φBT1 integrase, BxB1 integrase, PSA integrase, Cre recombinase, Flp recombinase, XerC recombinase, λ integrase, HK022 integrase, P22 integrase, HP1 integrase, L5 integrase, γδ recombinase, Tn3 recombinase, gin recombinase, RV integrase, SPBc integrase, TG1 integrase, φC1 integrase, MR11 integrase, φ370 integrase, φK38 integrase, Wβ integrase, and BL3 integrase may find use in the present invention in a manner similar to that shown below for Cre recombinase.
Upon expression, Cre excises a bacterial gene required for viability that has been targeted for deletion by the recombinant introduction of flanking recombinase binding sites (e.g., loxP). Advantageously, mutant recombinase sites such as lox66 and lox71 mutant lox P sites may be utilized. Unlike native loxP, lox66 and lox71 sites which are joined following excision of the targeted gene(s) cannot be used subsequently as a template for Cre-mediated recombination, thus driving the equilibrium of excision to completion.
Targeting deletion genes essential for DNA replication (e.g., gyrA, gyrB) results in bacterial cell death in infected cells, as compared to its isogenic parent Listeria strain. However, because the actA promoter is not induced during fermentation, growth of RIID Lm in bacterial growth media is indistinguishable from the parent strain. Expression of Lm-encoded antigens can also be induced in the infected APC using a PrfA-dependent promoter such as ActA, where synthesized antigens are secreted from the listerial bacterium into the cytosol through linkage with a bacterial signal peptide/chaperone and then processed and presented via the MHC class I pathway. Although RIID Lm strain is programmed for death post-infection of APCs, the vaccine still elicits potent CD8 T cell responses that are comparable to vaccination with an isogenic live-attenuated Lm vaccine strain.
The following is a non-limiting list of exemplary genes involved in DNA replication which may be targeted for excision in the RIID approach.
Preferred but non-limiting examples of genes to target for deletion include those that are involved in replication and bacterial cell division such as polC, dnaE, ftsK, ftsZ, ligA, dnaG, parC, parE, holB, dnaX, SMC, and ftsY. There are additional gene targets that are essential for the multiplication of Listeria that may be targeted for intracellular excision as an alternative, or in addition to, genes involved in DNA replication. Since Lm RIID strains have utility as a vaccine platform, in which Ag expression de novo is required for vaccine potency (Brockstedt et. al., 2005), one must consider the impact of the excised gene(s) on antigen expression/secretion to select gene targets. In a preferred embodiment, genes encoding proteins involved in RNA transcription and protein synthesis should be avoided because of a potential decrease of immunologic potency, which may not be desired for particular uses. Other preferred non-limiting examples include targeting bacterial genes affecting virulence, such as hly and dacA. It will be clear to the skilled artisan that any gene targeted for deletion in the cytosol of the infected host cell can be accomplished by the methods described herein, accordingly: First, the inter-genic regions upstream and downstream of the essential gene(s) to be deleted is identified; second PCR primers that include the desired loxP variants are designed; third, the corresponding allelic exchange vectors to insert the lox sites in the non-essential/inter-genic space are constructed; and, fourth, the lox sites are sequentially inserted into the Listeria vaccine strain by allelic exchange. Alternatively, it will be apparent to the skilled artisan that if the gene to be targeted for deletion is small, than both lox sites can be added with a single allelic exchange step. In still a further embodiment, the PactA-Cre cassette for induction of Cre recombinase expression in the cytosol of the infected cell can be introduced at alternate locations that are either amenable to site-specific integration (e.g. comK using pPL1) or any chromosomal location that is amenable to insertion using allelic exchange methodology. In yet another embodiment, PrfA-dependent promoters other than actA can be used for the cytosolic induced expression of Cre recombinase; inlC is a non-limiting example of an alternative promoter.
As an alternative to the Cre/lox strategy discussed above, genes essential for the multiplication of Listeria that can also be targeted for intracellular excision with FLP recombinase and frt sites. First, the inter-genic regions upstream and downstream of the essential gene(s) to be deleted is identified; second PCR primers that include the desired frt sites are designed; third, the corresponding allelic exchange vectors to insert the frt sites in the non-essential/inter-genic space are constructed; and, fourth, the frt sites are sequentially inserted into the Listeria vaccine strain by allelic exchange. Alternatively, it will be apparent to the skilled artisan that if the gene to be targeted for deletion is small, than both frt sites can be added with a single allelic exchange step. In still a further embodiment, the PactA-FLP cassette for induction of FLP recombinase expression in the cytosol of the infected cell can be introduced at alternate locations that are either amenable to site-specific integration (e.g. comK using pPL1) or any chromosomal location that is amenable to insertion using allelic exchange methodology.
4. Antigenic Constructs
Target Antigens
A preferred feature of the RIID bacteria described herein when used as a vaccine platform is the ability to initiate both the innate immune response as well as an antigen-specific T cell response against the recombinantly expressed antigen(s). For example, L. monocytogenes expressing the antigen(s) described herein can induce Type 1 interferon (IFN-α/β) and a cascade of co-regulated chemokine and cytokine protein which shape the nature of the vaccine-induce immune response. In response to this immune stimulation, NK cells and antigen presenting cells (APCs) are recruited to the liver following intravenous vaccination routes, or, alternatively to the vaccination site following other routes of vaccination, for example, by intramuscular, subcutaneous, or intradermal immunization routes. In certain embodiments, the vaccine platform of the present invention induces an increase at 24 hours following delivery of the vaccine platform to the subject in the serum concentration of one or more, and preferably all, cytokines and chemokines selected from the group consisting of IL-12p70, IFN-γ, IL-6, TNF α, and MCP-1; and induces a CD4+ and/or CD8+ antigen-specific T cell response against one or more antigens expressed by the vaccine platform. In other embodiments, the vaccine platform of the present invention also induces the maturation of resident immature liver NK cells as demonstrated by the upregulation of activation markers such as DX5, CD11b, and CD43 in a mouse model system, or by NK cell-mediated cytolytic activity measured using 51Cr-labeled YAC-1 cells that were used as target cells.
The ability of L. monocytogenes to serve as a vaccine vector has been reviewed in Wesikirch, et al., Immunol. Rev. 158:159-169 (1997). A number of desirable features of the natural biology of L. monocytogenes make it an attractive platform for application to a therapeutic vaccine. The central rationale is that the intracellular lifecycle of L. monocytogenes enables effective stimulation of CD4+ and CD8+ T cell immunity. Multiple pathogen associated molecular pattern (PAMP) receptors including TLRs (TLR2, TLR5, TLR9) nucleotide-binding oligomerization domains (NOD), and Stimulator of Interferon Genes (STING) are triggered in response to interaction with L. monocytogenes macromolecules upon infection, resulting in the pan-activation of innate immune effectors and release of Th-1 polarizing cytokines, exerting a profound impact on the development of a CD4+ and CD8+ T cell response against the expressed antigens.
Strains of L. monocytogenes have recently been developed as effective intracellular delivery vehicles of heterologous proteins providing delivery of antigens to the immune system to induce an immune response to clinical conditions that do not permit injection of the disease-causing agent, such as cancer and HIV. See, e.g., U.S. Pat. No. 6,051,237; Gunn et al., J. Immunol., 167:6471-6479 (2001); Liau, et al., Cancer Research, 62: 2287-2293 (2002); U.S. Pat. No. 6,099,848; WO 99/25376; WO 96/14087; and U.S. Pat. No. 5,830,702), each of which is hereby incorporated by reference in its entirety, including all tables, figures, and claims. A recombinant L. monocytogenes vaccine expressing an lymphocytic choriomeningitis virus (LCMV) antigen has also been shown to induce protective cell-mediated immunity to the antigen (Shen et al., Proc. Natl. Acad. Sci. USA, 92: 3987-3991 (1995).
In certain embodiments, the L. monocytogenes used in the vaccine compositions of the present invention is RIID strain which further comprises an attenuating mutation in actA and/or inlB, and preferably a deletion of all or a portion of actA and inlB (referred to herein as “Lm ΔactA/ΔinlB”), and contains recombinant DNA encoding for the expression of the one or more antigen(s) of interest. The antigen(s) are preferably under the control of bacterial expression sequences and are stably integrated into the L. monocytogenes genome.
The invention also contemplates a Listeria attenuated in at least one regulatory factor, e.g., a promoter or a transcription factor. The following concerns promoters. ActA expression is regulated by two different promoters (Vazwuez-Boland, et al. (1992) Infect. Immun. 60:219-230). Together, InlA and InlB expression is regulated by five promoters (Lingnau, et al. (1995) Infect. Immun. 63:3896-3903). The transcription factor prfA is required for transcription of a number of L. monocytogenes genes, e.g., hly, plcA, ActA, mpl, prfA, and iap. PrfA's regulatory properties are mediated by, e.g., the PrfA-dependent promoter (PinlC) and the PrfA-box. The present invention, in certain embodiments, provides a nucleic acid encoding inactivated, mutated, or deleted in at least one of ActA promoter, inlB promoter, PrfA, PinlC, PrfA box, and the like (see, e.g., Lalic Mullthaler, et al. (2001) Mol. Microbiol. 42:111-120; Shetron-Rama, et al. (2003) Mol. Microbiol. 48:1537-1551; Luo, et al. (2004) Mol. Microbiol. 52:39-52). PrfA can be made constitutively active by a Gly145Ser mutation, Gly155Ser mutation, or Glu77Lys mutation (see, e.g., Mueller and Freitag (2005) Infect. Immun. 73:1917-1926; Wong and Freitag (2004) J. Bacteriol. 186:6265-6276; Ripio, et al. (1997) J. Bacteriol. 179:1533-1540).
Examples of target antigens that may find use in the invention are listed in the following table. The target antigen may also be a fragment or fusion polypeptide comprising an immunologically active portion of the antigens listed in the table. This list is not meant to be limiting.
Francisella tularensis antigens
Francisella tularensis
F. tularensis include, e.g., 80 antigens, including 10 kDa and 60 kDa
Other organisms for which suitable antigens are known in the art include, but are not limited to, Chlamydia trachomatis, Streptococcus pyogenes (Group A Strep), Streptococcus agalactia (Group B Strep), Streptococcus pneumonia, Staphylococcus aureus, Escherichia coli, Haemophilus influenzae, Neisseria meningitidis, Neisseria gonorrheae, Vibrio cholerae, Salmonella species (including typhi, typhimurium), enterica (including Helicobactor pylori Shigella flexneri and other Group D shigella species), Burkholderia mallei, Burkholderia pseudomallei, Klebsiella pneumonia, Clostridium species (including C. difficile), Vibrio parahaemolyticus and V. vulnificus. This list is not meant to be limiting.
In certain embodiments, antigen sequence(s) may be expressed as a single polypeptide fused to an amino-terminal portion of the L. monocytogenes ActA protein which permits expression and secretion of a fusion protein from the bacterium within the vaccinated host. In these embodiments, the antigenic construct may be a polynucleotide comprising a promoter operably linked to a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises (a) modified ActA and (b) one or more antigenic epitopes to be expressed as a fusion protein following the modified ActA sequence.
By “modified ActA” is meant a contiguous portion of the L. monocytogenes ActA protein which comprises at least the ActA signal sequence, but does not comprise the entirety of the ActA sequence, or that has at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or at least about 98% sequence identity to such an ActA sequence. The ActA signal sequence is MGLNRFMRAMMVVFITANCITINPDIIFA (SEQ ID NO: 2). In some embodiments, the promoter is ActA promoter from WO07/103,225; and WO07/117,371, each of which is incorporated by reference in its entirety herein.
By way of example, the modified ActA may comprise at least the first 59 amino acids of ActA, or a sequence having at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or at least about 98% sequence identity to at least the first 59 amino acids of ActA. In some embodiments, the modified ActA comprises at least the first 100 amino acids of ActA, or a sequence having at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or at least about 98% sequence identity to the first 100 amino acids of ActA. In other words, in some embodiments, the modified ActA sequence corresponds to an N-terminal fragment of ActA (including the ActA signal sequence) that is truncated at residue 100 or thereafter.
ActA-N100 has the following sequence (SEQ ID NO: 3):
In this sequence, the first residue is depicted as a valine; the polypeptide is synthesized by Listeria with a methionine in this position. Thus, ActA-N100 may also have the following sequence (SEQ ID NO:4):
ActA-N100 may also comprise one or more additional residues lying between the C-terminal residue of the modified ActA and the antigen sequence. In the following sequences, ActA-N100 is extended by two residues added by inclusion of a BamH1 site (SEQ ID NO: 5):
As sequences encoded by one organism are not necessarily codon optimized for optimal expression in a chosen vaccine platform bacterial strain, the present invention also provides nucleic acids that are altered by codon optimized for expressing by a bacterium such as L. monocytogenes.
In various embodiments, at least one percent of any non-optimal codons are changed to provide optimal codons, more normally at least five percent are changed, most normally at least ten percent are changed, often at least 20% are changed, more often at least 30% are changed, most often at least 40%, usually at least 50% are changed, more usually at least 60% are changed, most usually at least 70% are changed, optimally at least 80% are changed, more optimally at least 90% are changed, most optimally at least 95% are changed, and conventionally 100% of any non-optimal codons are codon-optimized for Listeria expression (Table 2).
Listeria codon
Listeria codon
The invention supplies a number of Listeria species and strains for making or engineering an attenuated bacterium of the present invention. The Listeria of the present invention is not to be limited by the species and strains disclosed in Table 3.
L. monocytogenes 10403S wild type.
L. monocytogenes DP-L4056 (phage cured).
L. monocytogenes DP-L4027, which is
L. monocytogenes DP-L4029, which is DP-
L. monocytogenes DP-L4042 (delta PEST)
L. monocytogenes DP-L4097 (LLO-S44A).
L. monocytogenes DP-L4364 (delta lplA;
L. monocytogenes DP-L4405 (delta inlA).
L. monocytogenes DP-L4406 (delta inlB).
L. monocytogenes DP-L4038 (delta ActA-LLO
L. monocytogenes DP-L4384 (S44A-LLO
L. monocytogenes. Mutation in lipoate protein
L. monocytogenes DP-L4017 (10403S
L. monocytogenes EGD.
L. monocytogenes EGD-e.
L. monocytogenes strain EGD, complete
L. monocytogenes.
L. monocytogenes DP-L4029 deleted in uvrAB.
L. monocytogenes DP-L4029 deleted in uvrAB
L. monocytogenes Delta actA delta inlB delta
L. monocytogenes Delta actA delta inlB delta
L. monocytogenes Delta actA delta inlB delta
L. monocytogenes Delta actA delta inlB delta
L. monocytogenes ActA−/inlB− double mutant.
L. monocytogenes lplA mutant or hly mutant.
L. monocytogenes DAL/DAT double mutant.
L. monocytogenes str. 4b F2365.
Listeria ivanovii
Listeria innocua Clip11262.
Listeria innocua, a naturally occurring
Listeria seeligeri.
Listeria innocua with L. monocytogenes
Listeria innocua with L. monocytogenes
4. Therapeutic Compositions
The vaccine compositions described herein can be administered to a host, either alone or in combination with a pharmaceutically acceptable excipient, in an amount sufficient to induce an appropriate immune response. The immune response can comprise, without limitation, specific immune response, non-specific immune response, both specific and non-specific response, innate response, primary immune response, adaptive immunity, secondary immune response, memory immune response, immune cell activation, immune cell proliferation, immune cell differentiation, and cytokine expression. The vaccines of the present invention can be stored, e.g., frozen, lyophilized, as a suspension, as a cell paste, or complexed with a solid matrix or gel matrix.
In certain embodiments, after the subject has been administered an effective dose of a first vaccine to prime the immune response, a second vaccine is administered. This is referred to in the art as a “prime-boost” regimen. In such a regimen, the compositions and methods of the present invention may be used as the “prime” delivery, as the “boost” delivery, or as both a “prime” and a “boost.” Any number of “boost” immunizations can be delivered in order to maintain the magnitude or effectiveness of a vaccine-induced immune response.
As an example, a first vaccine comprised of killed but metabolically active Listeria that encodes and expresses the antigen polypeptide(s) may be delivered as the “prime,” and a second vaccine comprised of attenuated (live or killed but metabolically active) Listeria that encodes the antigen polypeptide(s) may be delivered as the “boost.” It should be understood, however, that each of the prime and boost need not utilize the methods and compositions of the present invention. Rather, the present invention contemplates the use of other vaccine modalities together with the bacterial vaccine methods and compositions of the present invention. The following are examples of suitable mixed prime-boost regimens: a DNA (e.g., plasmid) vaccine prime/bacterial vaccine boost; a viral vaccine prime/bacterial vaccine boost; a protein vaccine prime/bacterial vaccine boost; a DNA prime/bacterial vaccine boost plus protein vaccine boost; a bacterial vaccine prime/DNA vaccine boost; a bacterial vaccine prime/viral vaccine boost; a bacterial vaccine prime/protein vaccine boost; a bacterial vaccine prime/bacterial vaccine boost plus protein vaccine boost; etc. This list is not meant to be limiting
The prime vaccine and boost vaccine may be administered by the same route or by different routes. The term “different routes” encompasses, but is not limited to, different sites on the body, for example, a site that is oral, non-oral, enteral, parenteral, rectal, intranode (lymph node), intravenous, arterial, subcutaneous, intradermal, intramuscular, intratumor, peritumor, infusion, mucosal, nasal, in the cerebrospinal space or cerebrospinal fluid, and so on, as well as by different modes, for example, oral, intravenous, and intramuscular.
An effective amount of a prime or boost vaccine may be given in one dose, but is not restricted to one dose. Thus, the administration can be two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more, administrations of the vaccine. Where there is more than one administration of a vaccine or vaccines in the present methods, the administrations can be spaced by time intervals of one minute, two minutes, three, four, five, six, seven, eight, nine, ten, or more minutes, by intervals of about one hour, two hours, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, and so on. In the context of hours, the term “about” means plus or minus any time interval within 30 minutes. The administrations can also be spaced by time intervals of one day, two days, three days, four days, five days, six days, seven days, eight days, nine days, ten days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, and combinations thereof. The invention is not limited to dosing intervals that are spaced equally in time, but encompass doses at non-equal intervals, such as a priming schedule consisting of administration at 1 day, 4 days, 7 days, and 25 days, just to provide a non-limiting example.
In certain embodiments, administration of the boost vaccination can be initiated at about 5 days after the prime vaccination is initiated; about 10 days after the prime vaccination is initiated; about 15 days; about 20 days; about 25 days; about 30 days; about 35 days; about 40 days; about 45 days; about 50 days; about 55 days; about 60 days; about 65 days; about 70 days; about 75 days; about 80 days, about 6 months, and about 1 year after administration of the prime vaccination is initiated. Preferably one or both of the prime and boost vaccination comprises delivery of a composition of the present invention.
A “pharmaceutically acceptable excipient” or “diagnostically acceptable excipient” includes but is not limited to, sterile distilled water, saline, phosphate buffered solutions, amino acid based buffers, or bicarbonate buffered solutions. An excipient selected and the amount of excipient used will depend upon the mode of administration. Administration may be oral, intravenous, subcutaneous, dermal, intradermal, intramuscular, mucosal, parenteral, intraorgan, intralesional, intranasal, inhalation, intraocular, intramuscular, intravascular, intranodal, by scarification, rectal, intraperitoneal, or any one or combination of a variety of well-known routes of administration. The administration can comprise an injection, infusion, or a combination thereof.
Administration of the vaccine of the present invention by a non-oral route can avoid tolerance. Methods are known in the art for administration intravenously, subcutaneously, intradermally, intramuscularly, intraperitoneally, orally, mucosally, by way of the urinary tract, by way of a genital tract, by way of the gastrointestinal tract, or by inhalation.
An effective amount for a particular patient may vary depending on factors such as the condition being treated, the overall health of the patient, the route and dose of administration and the severity of side effects. Guidance for methods of treatment and diagnosis is available (see, e.g., Maynard, et al. (1996) A Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca Raton, Fla.; Dent (2001) Good Laboratory and Good Clinical Practice, Urch Publ., London, UK).
The vaccines of the present invention can be administered in a dose, or dosages, where each dose comprises at least 100 bacterial cells/kg body weight or more; in certain embodiments 1000 bacterial cells/kg body weight or more; normally at least 10,000 cells; more normally at least 100,000 cells; most normally at least 1 million cells; often at least 10 million cells; more often at least 100 million cells; typically at least 1 billion cells; usually at least 10 billion cells; conventionally at least 100 billion cells; and sometimes at least 1 trillion cells/kg body weight. The present invention provides the above doses where the units of bacterial administration is colony forming units (CFU), the equivalent of CFU prior to psoralen treatment, or where the units are number of bacterial cells.
The vaccines of the present invention can be administered in a dose, or dosages, where each dose comprises between 107 and 108 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); 2×107 and 2×108 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); 5×107 and 5×108 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); 108 and 109 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); between 2.0×108 and 2.0×109 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5.0×108 to 5.0×109 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 109 and 1010 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×109 and 2×1010 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5×109 and 5×1010 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 1011 and 1012 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×1011 and 2×1012 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5×1011 and 5×1012 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 1012 and 1013 bacteria per 70 kg (or per 1.7 square meters surface area); between 2×1012 and 2×1013 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5×1012 and 5×1013 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 1013 and 1014 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×1013 and 2×1014 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); 5×1013 and 5×1014 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 1014 and 1015 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×1014 and 2×1015 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); and so on, wet weight.
Also provided is one or more of the above doses, where the dose is administered by way of one injection every day, one injection every two days, one injection every three days, one injection every four days, one injection every five days, one injection every six days, or one injection every seven days, where the injection schedule is maintained for, e.g., one day only, two days, three days, four days, five days, six days, seven days, two weeks, three weeks, four weeks, five weeks, or longer. The invention also embraces combinations of the above doses and schedules, e.g., a relatively large initial bacterial dose, followed by relatively small subsequent doses, or a relatively small initial dose followed by a large dose.
A dosing schedule of, for example, once/week, twice/week, three times/week, four times/week, five times/week, six times/week, seven times/week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, and the like, is available for the invention. The dosing schedules encompass dosing for a total period of time of, for example, one week, two weeks, three weeks, four weeks, five weeks, six weeks, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, and twelve months.
Provided are cycles of the above dosing schedules. The cycle can be repeated about, e.g., every seven days; every 14 days; every 21 days; every 28 days; every 35 days; 42 days; every 49 days; every 56 days; every 63 days; every 70 days; and the like. An interval of non dosing can occur between a cycle, where the interval can be about, e.g., seven days; 14 days; 21 days; 28 days; 35 days; 42 days; 49 days; 56 days; 63 days; 70 days; and the like. In this context, the term “about” means plus or minus one day, plus or minus two days, plus or minus three days, plus or minus four days, plus or minus five days, plus or minus six days, or plus or minus seven days.
The present invention encompasses a method of administering Listeria that is oral. Also provided is a method of administering Listeria that is intravenous. Moreover, what is provided is a method of administering Listeria that is oral, intramuscular, intravenous, intradermal and/or subcutaneous. The invention supplies a Listeria bacterium, or culture or suspension of Listeria bacteria, prepared by growing in a medium that is meat based, or that contains polypeptides derived from a meat or animal product. Also supplied by the present invention is a Listeria bacterium, or culture or suspension of Listeria bacteria, prepared by growing in a medium that does not contain meat or animal products, prepared by growing on a medium that contains vegetable polypeptides, prepared by growing on a medium that is not based on yeast products, or prepared by growing on a medium that contains yeast polypeptides.
Methods for co-administration with an additional therapeutic agent are well known in the art (Hardman, et al. (eds.) (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill, New York, N.Y.; Poole and Peterson (eds.) (2001) Pharmacotherapeutics for Advanced Practice: A Practical Approach, Lippincott, Williams & Wilkins, Phila., PA; Chabner and Longo (eds.) (2001) Cancer Chemotherapy and Biotherapy, Lippincott, Williams & Wilkins, Phila., Pa.).
Additional agents which are beneficial to raising a cytolytic T cell response may be used as well. Such agents are termed herein carriers. These include, without limitation, B7 costimulatory molecule, interleukin-2, interferon-γ, GM-CSF, CTLA-4 antagonists, OX-40/OX-40 ligand, CD40/CD40 ligand, sargramostim, levamisol, vaccinia virus, Bacille Calmette-Guerin (BCG), liposomes, alum, Freund's complete or incomplete adjuvant, detoxified endotoxins, mineral oils, surface active substances such as lipolecithin, pluronic polyols, polyanions, peptides, and oil or hydrocarbon emulsions. Carriers for inducing a T cell immune response which preferentially stimulate a cytolytic T cell response versus an antibody response are preferred, although those that stimulate both types of response can be used as well. In cases where the agent is a polypeptide, the polypeptide itself or a polynucleotide encoding the polypeptide can be administered. The carrier can be a cell, such as an antigen presenting cell (APC) or a dendritic cell. Antigen presenting cells include such cell types as macrophages, dendritic cells and B cells. Other professional antigen-presenting cells include monocytes, marginal zone Kupffer cells, microglia, Langerhans' cells, interdigitating dendritic cells, follicular dendritic cells, and T cells. Facultative antigen-presenting cells can also be used. Examples of facultative antigen-presenting cells include astrocytes, follicular cells, endothelium and fibroblasts. The carrier can be a bacterial cell that is transformed to express the polypeptide or to deliver a polynucleoteide which is subsequently expressed in cells of the vaccinated individual. Adjuvants, such as aluminum hydroxide or aluminum phosphate, can be added to increase the ability of the vaccine to trigger, enhance, or prolong an immune response. Additional materials, such as cytokines, chemokines, and bacterial nucleic acid sequences, like CpG, a toll-like receptor (TLR) 9 agonist as well as additional agonists for TLR 2, TLR 4, TLR 5, TLR 7, TLR 8, TLR9, including lipoprotein, LPS, monophosphoryl lipid A, lipoteichoic acid, imiquimod, resiquimod, and other like immune modulators such as cyclic dinucleotide STING agonists including c-di-GMP, c-di-AMP, c-di-IMP, and c-AMP-GMP, used separately or in combination with the described compositions are also potential adjuvants. Other representative examples of adjuvants include the synthetic adjuvant QS-21 comprising a homogeneous saponin purified from the bark of Quillaja saponaria and Corynebacterium parvum (McCune et al., Cancer, 1979; 43:1619). It will be understood that the adjuvant is subject to optimization. In other words, the skilled artisan can engage in routine experimentation to determine the best adjuvant to use.
An effective amount of a therapeutic agent is one that will decrease or ameliorate the symptoms normally by at least 10%, more normally by at least 20%, most normally by at least 30%, typically by at least 40%, more typically by at least 50%, most typically by at least 60%, often by at least 70%, more often by at least 80%, and most often by at least 90%, conventionally by at least 95%, more conventionally by at least 99%, and most conventionally by at least 99.9%.
The reagents and methods of the present invention provide a vaccine comprising only one vaccination; or comprising a first vaccination; or comprising at least one booster vaccination; at least two booster vaccinations; or at least three booster vaccinations. Guidance in parameters for booster vaccinations is available. See, e.g., Marth (1997) Biologicals 25:199-203; Ramsay, et al. (1997) Immunol. Cell Biol. 75:382-388; Gherardi, et al. (2001) Histol. Histopathol. 16:655-667; Leroux-Roels, et al. (2001) ActA Clin. Belg. 56:209-219; Greiner, et al. (2002) Cancer Res. 62:6944-6951; Smith, et al. (2003) J. Med. Virol. 70:Suppl. 1:S38-541; Sepulveda-Amor, et al. (2002) Vaccine 20:2790-2795).
Formulations of therapeutic agents may be prepared for storage by mixing with physiologically acceptable carriers, excipients, or stabilizers in the form of, e.g., lyophilized powders, slurries, aqueous solutions or suspensions (see, e.g., Hardman, et al. (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill, New York, N.Y.; Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York, N.Y.; Avis, et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY; Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel Dekker, Inc., New York, N.Y.).
The following examples serve to illustrate the present invention. These examples are in no way intended to limit the scope of the invention.
DNA Manipulations, Purification and Vector Assembly.
Recombinase recognition sites (loxP, lox66 and lox71 variants, or frt) were inserted in the intergenic regions 5′ and 3′ of essential Listeria monocytogenes (Lm) gene sets using allelic exchange (Camilli, 1993). Recombinase sites were added to allelic exchange vectors by PCR using 10403S (Bishop, 1987) DNA as template. PCR was performed using the high-fidelity enzyme Phusion DNA polymerase (NEB, Ipswich, Mass.) in a Mycycler thermocycler (BioRad, Hercules Calif.). The oligonucleotides (oligos) (Integrated DNA Technologies, Coralville, Iowa) used for cloning are listed in the following table.
ataacttcgtatagcatacattatacgaacggtaggaaatgactctaatttgcgaat
taccgttcgtataatgtatgctatacgaagttatagcttgattttattcttctatgtcgc
tatGCGGCCGCgggaagcagttggggttaact (SEQ ID NO: 29)
aacTCTAGActtagtctccatcttctaata (SEQ ID NO: 30)
aaaggaagttcctattctctagaaagtataggaacttctgcggaaatgactctaatttgc
gcagaagttcctatactttctagagaataggaacttcctttagcttgattttattcttct
aaaggaagttcctattctctagaaagtataggaacttctgcttttagtaaaaaaacgcca
gcagaagttcctatactttctagagaataggaacttccttttggttattttcgtcgaata
The following table provides a list of sequences used in the following examples.
PCR products were purified with QIAquick purification columns (Qiagen, Valencia, Calif.), digested with appropriate restriction enzymes (NEB) and ligated to pKSVoriT, a derivative of the temperature sensitive allelic exchange vector pKSV7 (Smith, 1992), using T4 DNA ligase (NEB, Ipswich, Mass.). All vectors used for cloning were treated with calf intestinal alkaline phosphatase, (CIP), NEB, Ipswich Mass.)). Bacterial strains used for cloning, conjugation and the Lm parental strains are listed in Table 6 hereinafter. Escherichia coli SM10 was made chemically competent with the Z-Competent Kit (Zymo Research, Irvine Calif.). Transformations of both XL1-blue and SM10 were cultured in Luria-Bertani broth (LB) at 37° C. with appropriate antibiotic selection (pKSVoriT: 75 μg/ml carbenicillin; pPL2-based vectors: 20 μg/ml chloramphenicol. Lm strains were grown in vegetable peptone phosphate broth (VPP) (Basingstoke, UK). Lm was selected on VPP plates supplemented with 7.5 μg/ml chloramphenicol and 200 μg/ml streptomycin (Teknova, Hollister Calif.). Allelic exchange vectors were confirmed by diagnostic colony PCR, restriction digest, and sequencing (SeqXcel, San Diego Calif.). Confirmed plasmids were transformed into SM10 cells and conjugated into Lm as described. Recombinase genes were cloned downstream of the actA in the site-specific integration vector pPL2 or derivatives thereof (Lauer, 2002).
A non-limiting example that is illustrative of Lm RIID strains was based on targeting bacterial genes involved in the winding/unwinding of the bacterial genome during DNA replication, gyrB (lmo0006) and gyrA (lmo0007), encoding the two subunits of the Lm gyrase. The first step in the construction involved the placement of lox71 (Albert et al., 1995) between coding sequences of MATE efflux (lmo0003) and yaaA (lmo0004), upstream of recF (lmo0005), and was accomplished by allelic exchange, as described previously (Camilli et al., 1993). To engineer the allelic exchange vector used to generate the Lm RIID strain, the upstream flanking region of the target genes was amplified by PCR using primers PL2863/PL2864, and the downstream flanking region with primers PL2865/PL2866. The PCR products were then cloned into a derivative of the shuttle vector plasmid pKSV7 (Smith et al., 1992) that was modified to contain an oriT (pKSVoriT), resulting in plasmid pBHE1937. The lox71 sequence was inserted between the lmo0003/lmo0004 flanking regions, by amplifying a 400 bp region containing lox71 from an existing vector by PCR and subsequent cloning into pBHE1937, resulting in plasmid pBHE2099. The plasmid was sequence verified and transformed into E. coli SM10 for conjugation into Lm. The SM10 strain was mated with Lm strain BH1959, a live-attenuated derivative of DP-L4056 in which the actA, inlB, uvrAB coding sequences were deleted. In addition, this strain contains an antigen expression cassette at the inlB locus (as described in Lauer et al., 2008) for monitoring immunogenicity of the suicidal strain and its non-suicidal control. Allelic exchange was performed on transconjugants ultimately resulting in Lm strain BH3141.
The second mutant loxP site (lox66) was introduced downstream of lox71 (Table 5) between gyrA (lmo0007) and cardiolipin synthase (lmo0008) using splicing by overlap extension (SOE) PCR as described previously (Horton, 1993). The region adjacent to gyrA was amplified with primers PL3141/PL3142 and the downstream region (adjacent to lmo0008) was amplified with PL3139/PL3140. The lox66 sequence was included in primers PL3139 and PL3142. The primary SOE PCR products were then combined by a second PCR step, and this SOE product was then cloned into pKSV7oriT, resulting in the plasmid pBHE2193. Allelic exchange with pBHE2193 into the lox7′-containing strain BH3141 was performed, resulting in Lm strain BH3210. This strain contained the genomic region composed of yaaA-recF-gyrB-gyrA flanked by lox71 and lox66 (
The final step in generating the Lm-RIID strain involved the cloning and integration of a plasmid encoding Cre recombinase that was functionally linked to the actA promoter, restricting recombinase gene expression to the cytosol of infected cells in the vaccinated recipient. The nucleotide sequence of Cre was codon optimized for expression in Lm (Blue Heron, Bothell, Wash.). The Cre sequence was amplified with primers PL1536/PL1537 and cloned as an EagI/BamHI fragment into a pPL2-based plasmid (allowing site-specific integration at the tRNAArg locus) containing the actA promoter (221 bp, Table 5), resulting in plasmid pBHE2130. This plasmid was conjugated into both the parental strain (BH1959) and the lox71/lox66-containing variant (BH3210), resulting in BH3099 (non-suicidal control) and BH3226 (Lm RIID), respectively.
As a second non-limiting illustrative example of Lm-RIID vaccines, a second set of essential genes for excision was targeted by placing a lox66 site on the other side of the bacterial origin in the strain BH3141, which contains a lox71 between BH3141 lmo0003 and lmo0004. The region deleted in this second strain includes lmo2587, the origin of replication (oriC), the essential replication initiator genes dnaA and dnaN (encoding a subunit of DNA polymerase III), and lmo0003 (
A fourth Lm-RIID strain was constructed in the Lm ΔactA ΔinlB strain background, which allowed various vaccine antigen compositions to be subsequently introduced at the tRNAArg locus and tested and tested in immunogenicity studies. The same sequential allelic exchange process that gave rise to BH3210 was repeated in the Lm11 strain background. First, pBHE2193 was used to insert the lox66 site downstream of gyrA, then pBHE2099 was used to insert the lox71 site upstream of yaaA. The strain containing the lox71-yaaA-recF-gyrB-gyrA-lox66 composition (
It will be apparent to the skilled artisan that additional recombinase methods can be used to selectively delete Lm genes required for multiplication in the cytosol of the infected host cell. A non-limiting example is to utilize the yeast recombinase FLP with the frt recombination sites instead of the Cre/loxP system to generate Lm-RIID vaccines. A strain that was analogous in composition to BH3226 (
In Vitro Growth Curves
Cultures grown overnight in BHI (BD Difco, Franklin Lakes, N.J.) were diluted 1:100 into fresh BHI and grown at 37° C. shaking at 250 rpm. Optical density (OD600 nm) was measured in a BioRad SmartSpec 3000 (BioRad, Hercules, Calif.). Alternatively, overnight BHI cultures were diluted 1:100 and 150 μL/well was aliquoted into a 96-well, flat bottomed plate and monitored for growth using a Versa max microplate reader (Molecular Devices, Sunnyvale Calif.).
Intracellular Growth Curves
Growth curves in the dendritic cell line DC2.4 (Shen, 1997) were performed in 24-well tissue-culture plates (Costar 3524, Corning, N.Y.). 2×105 DC2.4 cells were seeded per well in RPMI 1640 (Thermo Scientific, Waltham, Mass.) supplemented with 10% heat-inactivated fetal bovine serum (Hyclone), 23.8 mM sodium bicarbonate (Sigma), 1× non-essential amino acids (Cellgro), 2 mM L-glutamine (Cellgro), 1×10−2M HEPES buffer (Gibco), 1 mM sodium pyruvate (Sigma), and 50 μM β-mercaptoethanol (Sigma, St. Louis, Mo.). For infection, Lm strains were grown overnight in BHI at 30° C. without agitation, then diluted into RPMI to a final concentration 4×106 cfu/mL, 0.5 mL was used to infect each well for a final multiplicity of infection (moi) of 20. Cells were infected for 45 min, washed with 1 ml DPBS (HyClone, South Logan Utah), and RPMI complete medium containing 50 μg/mL gentamycin was added to prevent growth of extracellular bacteria. Intracellular bacterial growth was monitored at several time-points by aspiration of the media, washing cell monolayers with DPBS and lysing the cell monolayer hypotonically with 1 mL of sterile water. Serial 10 fold dilutions were plated on BHI agar plates supplemented with 200 μg/ml streptomycin (Teknova, Hollister Calif.). Plates were incubated overnight at 37° C. and enumerated for calculation of cfu/well.
Western Blots
Semi-quantitative intracellular Western blots were performed in DC2.4 cells. 3×105 DC2.4 cells were seeded in each well of a 12-well tissue culture plate and incubated overnight. Cells were infected with 6×106 of test Lm strains per well (MOI 20). Cells were incubated for 1 hour, rinsed with DPBS, and RPMI complete medium containing 50 μg/mL gentamycin was added. Cells were cultured seven additional hours at 37° C./5% CO2 before washing each well with 1 mL DPBS and lysing cells in 150 μL 1×LDS (250 μL 4×LDS buffer (Life Technologies, Grand Island N.Y.), 650 μL TE buffer (Fisher Scientific, Waltham Mass.) 100 μL sample reducing agent (Life Technologies, Grand Island N.Y.)). Cell lysates were heated in a block at 95° C. for 10 min and 20 μL aliquots were run on 4-12% Bis-Tris PAGE gels in 1×MES buffer (Invitrogen) and transferred to nitrocellulose membranes for detection. Membranes were incubated in Odyssey blocking buffer (Li-Cor, Lincoln Nebr.). Heterologous antigens were detected using the A18K polyclonal rabbit antibody which recognizes the mature 18 amino acid amino terminus of the ActA protein, used as a fusion for antigen expression at 1:4000 dilution. Expression levels were normalized to the Listeria P60 protein using a monocloncal antibody MAB8001 at 1:4000 dilution (Fisher Scientific). P60 expression level correlates with cfu. Secondary antibodies, α-MS 800 Cw and α-Rb 680 (Li-Cor) were used at 1:1000 dilutions. Westerns were scanned and quantitated on a Li-Cor Odyssey system.
Animals
C57BL/6, BALB/c, CD1, CD1nu/nu and SCID beige mice were obtained from Charles River Laboratories (Wilmington, Mass.). Mice were treated according to National Institutes of Health guidelines. All animal protocols were approved by the Aduro BioTech IACUC. All vaccinations of Listeria were given intravenously at 5×106 cfu unless otherwise stated.
ELISpot Assay
Immunogenicity was monitored during the experiments by ELISpot assays performed with lymphocytes isolated from whole mouse blood using Lympholyte-Mammal (Cedarlane Labs, Burlington, N.C.) and a murine IFN-γ ELISpot pair (BD Biosciences, San Jose, Calif.). At the termination of the experiments, ELISpot assays were performed on splenocytes. 2×105 cells/well were incubated with the appropriate peptide overnight at 37° C. in anti-murine IFN-γ coated ELISpot plate (Millipore, Billerica, Mass.). Cells were incubated with no peptide as a negative control. Murine ELISpots were developed using alkaline phosphatase detection reagents (Invitrogen, Carlsbad, Calif.) and scanned and quantified using Immunospot plate reader and software (CTL Ltd, Cleveland, Ohio).
WT Listeria Challenge
C57BL/6 mice were vaccinated once with 5×106 cfu of each Lm strain. 34 days later, mice were challenged with 2×LD50 of the WT Lm strain DP-L4056 (Lauer, 2002). Three days later, spleens and livers were harvested and homogenized. Dilutions were plated on BHI plates containing 200 μg/mL streptomycin to determine cfu/organ.
Vaccinia Challenge
C57BL/6 mice were vaccinated on day 0 and day 29 with 5×106 cfu of various Lm strains. Mice were challenged 49 days post second vaccination with WT vaccinia intraperitoneally with 1×106 pfu. Ovaries were harvested 5 days later and plaque assays were performed to determine the level of protection (Brockstedt, 2005).
Tumor Studies
BALB/c mice were challenged intravenously on day 0 with 2×105 the CT26 tumor cell line engineered to express human mesothelin. Mice were vaccinated 4 days later with 5×106 cfu Lm RIID, along with appropriate controls, and boosted with the same vaccination dose 14 days later. Mice were weighed and monitored daily. At the time of death, lungs were harvested and metastases enumerated.
To be effective, vaccines require a balance between immunogenicity, potency and safety. For practical reasons, it is further desirable that vaccines can be easily manufactured at large scale using establish fermentation methods. Lm constitutes an immunologically potent vaccine platform due to its properties of cytosolic access, where it multiplies, and can be engineered further to express and secrete encoded antigens which are subsequently processed and presented on MHC class I molecules, and priming of antigen-specific CD8+ T cell responses (Brockstedt and Dubensky, 2008). Wild-type or live-attenuated Lm strains such as Lm ΔactA/ΔinlB grow and multiply in broth culture and also grow and multiply in cells where they can also deliver antigenic target proteins to the host cytosol inducing an immune response. Lm-RIID vaccines have been developed to readily grow in broth culture and to deliver vaccine antigens to the host cell, but have been further engineered to initiate a program within the cytosol of the infected cell to “commit suicide,” preventing bacterial multiplication and increasing the safety of the vaccine platform (
To evaluate the growth characteristics of the Lm-RIID vaccine platform, the Lm-RIID strains BH3226 and BH3618 that delete the gyrase region, termed Deletion 1 (
As an additional non-limiting illustration of the approach, the kinetics of growth in broth culture and intracellular growth of Lm-RIID strains that targeted a second set of essential genes were determined. The Lm-RIID Deletion 2 strain that was engineered to delete the chromosomal origin of replication (oriC), as well as the essential replication initiation genes dnaA and dnaN (
As yet a further non-limiting illustration of the approach, the kinetics of growth in broth culture and intracellular growth of Lm-RIID strains that targeted a third set of essential genes were determined. Lm-RIID strains were constructed that contained a Deletion 3 composition, which spanned both Deletion 1 and Deletion 2 described herein, and also included 5 additional identified open reading frames in the Listeria genome (lmo2852 through rpmH) (
The skilled artisan will recognize that alternative recombinase systems can be used to selectively delete Lm genes required for multiplication in the cytosol of the infected host cell. The growth characteristics of Lm-RIID strain BH3602 in broth culture and after infection of DC2.4 cells was compared to the live-attenuated parental strain Lm11 (Lm ΔactA/ΔinlB). BH3602 targeted essential genes yaaA, recF, gyrB, gyrA for deletion, which was similar to the genes targeted in Deletion 1 of Lm-RIID strains BH3226 and BH3618, except Lm-RIID strain BH3602 utilizes the alternate recombinase system FLP/frt (
The following table provides a list of bacterial strains prepared as described herein:
A prerequisite for vaccine potency is delivery of the target antigen in an immunologically relevant context. For Lm-based vaccines, antigens must be expressed and delivered to the host antigen presenting cell (e.g., dendritic cells) cytosol, were encoded antigens are expressed, secreted from the bacterium into the cytosol, where subsequent antigen processing and presentation on MHC class I molecules results in CD8+ T cell priming. It will be appreciated by the skilled artisan that the magnitude of antigen expression can impact the magnitude of the vaccine-induced immune response. The intracellular level of encoded heterologous antigen expression by Lm-RIID vaccines following infection of mouse DC2.4 dendritic cells was measured. As a non-limiting example, the antigen expression level of four independent Lm-RIID strains encoding distinct heterologous was measured. All antigen expression cassette constructs encoded a fusion protein consisting of the amino terminal 100 amino acids of the Listeria ActA protein (ActAN100) cloned the in-frame with the heterologous antigen, as described previously (Lauer et. al., 2008). Detection of intracellular antigen expression was by Western blot analysis of infected cell lysates, using a polyclonal antibody raised against the mature amino terminus of ActA (described in Example 1). Expression of all antigens was functionally linked the actA promoter, which is minimally expressed in broth culture, and induced approximately 200-fold in the host cell cytosol (Shetron-Rama et al., 2002). The actA promoter was also used for Cre or FLP recombinase expression, to link the temporal expression of the vaccine antigen with the intracellular death of the bacterium in the cytosol of the infected host cell of the vaccinated recipient. All antigen expression cassettes were cloned into a derivative of the site-specific integration vector pPL2 and integrated at the tRNAArg locus of both Lm11 (live-attenuated) and BH3618 (Lm-RIID) strains, as described previously (Lauer et. al., 2008).
Genes for all antigens were codon-optimized for expression in Listeria and synthesized de novo (DNA2.0, Menlo Park, Calif.). Fusions were then assembled by PCR and cloning for a fusion of the cancer antigens NY-ESO-1 and MAGE A3 (
The principal organs that are infected in the mouse following intravenous (IV) administration of L. monocytogenes (Lm) are the liver and spleen (Portnoy et al., 2002). The acute toxicity determined by median lethality of the live-attenuated Lm ΔactA/ΔinlB vaccine platform is attenuated by more than 3 logs in the mouse listeriosis model as compared to wild-type Lm (WT Lm), which is reflected by rapid clearance in the liver and spleen in infected mice, measured by quantification of colony forming units (cfu) in cell lysates prepared from harvested organs (Brockstedt et al., 2004).
As shown in the examples contained herein, Lm-RIID can be derived from the live-attenuated Lm ΔactA/ΔinlB (i.e., deletion or mutation of actA and inlB virulence genes) vaccine strain. However, in contrast to Lm ΔactA/ΔinlB, Lm-RIID vaccines are pre-programmed (i.e., engineered) to spontaneously initiate its own suicide within the context of infected cells of the vaccinated mammal. To illustrate the increased safety profile of vaccine strains based on Lm-RIID vaccines compared to Lm ΔactA/ΔinlB vaccines, the kinetics of clearance in both immune competent C57BL/6 mice and in immune deficient SCID-Beige mice lacking functional innate and adaptive immunity were compared. Groups of 5 female C57BL/6 mice were given 5×106 cfu of Lm-RIID (BH3226) or Lm ΔactA/ΔinlB (BH3099) vaccine strains by IV injection, and the bacterial burden in the livers and spleens were determined by plating on nutrient agar serial dilutions of clarified lysates processed from harvested organs at 0.2, 4 and 24 hours post injection. The amount of Lm ΔactA/ΔinlB (BH3099) vaccine strain measured in the liver or spleen was at similar levels at the 4 and 24 hour time points; i.e., the Lm ΔactA/ΔinlB (BH3099) vaccine strain bacterial burden did not diminish during this period (
These results provide unequivocal evidence that Lm-RIID (BH3226) is cleared significantly more rapidly from the livers and spleens of mice following IV administration as compared to live-attenuated Lm ΔactA/ΔinlB (BH3099). To assess the dependence of the host immune response on the clearance of live-attenuated Lm ΔactA/ΔinlB and Lm-RIID vaccine strains, in a separate experiment, groups of 4 female SCID/Beige immune deficient mice were given 5×106 cfu of Lm-RIID (BH3226) or Lm ΔactA/ΔinlB (BH3099) vaccine strains by IV injection, and the bacterial burden in the spleens were determined by plating on nutrient agar serial dilutions of clarified lysates processed from organs harvested at 20 minutes, 1, 2 and 4 days post injection. The bacterial burden measured in the spleens of SCID/Beige immune mice given live-attenuated Lm ΔactA/ΔinlB (BH3099) increased at 1 day compared to the level measured at 20 minutes after injection, indicating multiplication of the input bacteria. The peak level of bacteria observed at 1 day post injection with Lm ΔactA/ΔinlB (BH3099) was at least 5×106 cfu per spleen, and then decreased over the next 2 time points evaluated to a level of about 5×104 cfu per spleen measured at the last 4 day post injection time point evaluated (
Recombinant L. monocytogenes has been shown to induce potent CD4+ and CD8+ T cell immunity to encoded heterologous antigens in mice and in humans (Brockstedt et al., 2004; Le et al., 2012). The immunogenicity of Lm-RIID in mice was compared to live-attenuated Lm ΔactA/ΔinlB and Killed But Metabolically Active (KBMA; Lm ΔactA/ΔinlB/ΔuvrAB) was compared. To enable the immunogenicity of the Lm-RIID, Lm ΔactA/ΔinlB, and KBMA vaccines to be compared, each vaccine strain contained the same Ag expression cassette encoding five defined H-2b-restricted major histocompatibility complex (MHC) class I epitopes that have previously been shown to elicit a range of CD8+ T-cell responses in mice, when encoded by live-attenuated Lm ΔactA/ΔinlB, and KBMA vaccines (Lauer et al., 2008). The use of an array of precise class I restricted epitopes provides an optimized method for assessing immunogenicity in vivo, simplifying comparisons of the Lm-RIID, Lm ΔactA/ΔinlB, and KBMA vaccine platforms.
The Ag expression cassette construct encodes four tandemly spaced vaccinia virus (A42R, C4L, K3L, and B8R) class I epitopes and the chicken OVA (SL8) epitope, and was synthesized and then cloned under the control of the PrfA-regulated actA promoter as a fusion protein with the 100 N-terminal amino acids of ActA (Lauer et al., 2008). The construct is known as Quadvac and was cloned into a derivative of the pPL2 integration vector and then integrated into the tRNAArg site of Lm-RIID, Lm ΔactA/ΔinlB, and KBMA vaccine strains as described previously (Lauer et al., 2002; Lauer et al., 2008).
To evaluate relative immunogenicity, groups of 5 female C57BL/6 (H-2b) mice were immunized twice at an interval of 36 days with the Lm-RIID, Lm ΔactA/ΔinlB, and KBMA vaccine strains each encoding Quadvac, at a dose level of 5×106 colony forming units (CFU). The KBMA vaccine dose level was measured prior to photochemical inactivation, as described previously (Brockstedt et al., 2005). Five days following the second immunization, spleens were harvested from vaccinated mice, and the magnitude of the CD8+T cell responses specific for the 5 encoded epitopes was measured by ELISpot analysis of splenocytes following overnight stimulation with 1 μM of peptides corresponding to each of the MHC class I epitopes having the amino acid sequence as follows, as described previously: A42R88-96, YAPVSPIVI (SEQ ID NO: 52); C4L125-132, LNFRFENV (SEQ ID NO: 53); K3L6-15, YSLPNAGDVI (SEQ ID NO: 54); B8R20-27, TSYKFESV (SEQ ID NO: 55); and, SL8257-264, SIINFEKL (SEQ ID NO: 56) (Lauer et al., 2008; Moutaftsi et al., 2006). Lm-RIID vaccines induced CD8+T cell responses specific for the 5 MHC class I epitopes that were comparable in magnitude to mice immunized with live-attenuated Lm ΔactA/ΔinlB vaccine strains, and that were significantly higher than the magnitude of the CD8+T cell responses measured in mice immunized with KBMA vaccines (
These results demonstrate that although Lm-RIID vaccines are engineered initiate a program to commit suicide within infected cells of the vaccinated recipient and do not require a functional immune response for clearance, surprisingly, Lm-RIID vaccines retain the capacity to induce a robust specific CD8 T cell response that is comparable to live-attenuated Lm vaccines. The skilled artisan will understand that these results demonstrate that Lm-RIID vaccines have general utility for preventative or therapeutic vaccination in humans to induce a T cell response specific for desired Ags, due to the characteristics of having similar immunologic potency to live-attenuated Lm vaccines, but having a significantly improved safety profile due to its feature of immune-response independent spontaneous clearance.
The Examples provided herein demonstrate that Lm-RIID vaccines self-initiate a pre-programmed suicide within the host cell, do not require a functioning immune response for clearance from the vaccinated host, yet retain the capacity to induce cellular immunity specific for an encoded antigen that is comparable to vaccination with live-attenuated Lm ΔactA/ΔinlB vaccine strains. However, the skilled artisan will recognize that one important measure of effective immunization is whether a vaccine candidate can confer protection against subsequent challenge with a virulent pathogen.
It is well-recognized in the field that a single immunization of mice with sub-lethal doses of wild-type Lm (WT Lm) or appropriate live-attenuated strains affords life-long protection against lethal challenge with WT Lm, measured by bacterial burden in the liver or spleen at three days post challenge (Bahjat et al., 2006). The correlates of protection are CD4+ and CD8+ T cell immunity, and humoral immunity plays no role in protection (Berche et al., 1987). To evaluate the relative capacity of Lm-RIID vaccination to provide protective immunity, groups of 5 female C57BL/6 mice were vaccinated with Hanks-balanced salt solution (HBSS) as a negative control, or with 5×106 cfu of Lm-RIID or live-attenuated Lm ΔactA/ΔinlB vaccines, or with 1×108 cfu (determined prior to photochemical inactivation) of KBMA vaccines. Vaccinated and control mice were challenged at 41 days post vaccination in order to assess the capacity of the vaccine-induced memory T cell response to provide protection against lethal bacterial challenge with 20 LD50 doses (2×105 cfu) of WT Lm.
Vaccination with Lm-RIID provided 4 logs of protection against WT Lm challenge as compared to the HBSS negative control group (
Strikingly, the level of protection afforded by immunization with Lm-RIID or live-attenuated Lm ΔactA/ΔinlB vaccines was indistinguishable, and was greater than 1000-fold compared to the HBSS negative control group, and was more than 100-fold better than the level of protection afforded by vaccination with KBMA vaccines (
Having demonstrated that Lm-RIID vaccines stimulate CD4+ and CD8+ T cell immunity specific for vector encoded antigens which function to provide protection against challenge with a pathogen encoding the cognate antigen, that is comparable to live-attenuated Lm ΔactA/ΔinlB vaccine strains, the skilled artisan will recognize that Lm-RIID vaccines will also have application for cancer immunotherapy. It is well-appreciated that barriers to effective immune therapies include tolerance to the targeted tumor-associated antigen(s) that can limit induction of cytotoxic CD8+ T cells of appropriate magnitude and function, poor trafficking of the generated T cells to sites of malignant cells, and poor persistence of the induced T cell response (Blankenstein et al., 2012; Topalian et al., 2011). One measure of potency is to evaluate the capacity of a selected platform to reverse tumor progression and increase survival time compared to controls, when administered to tumor-bearing animals.
The CT-26 murine colon tumor cell line was used to test the benefit of therapeutic vaccination with Lm-RIID vaccines (Slansky et al., 2000). The CT-26 tumor cells were given by intravenous (IV) inoculation, which results in the establishment of lung tumor nodules that can be quantitated in the lungs harvested from treated mice at desired time points post implantation, or, alternatively, mice can be monitored for survival, and sacrificed when moribund, due to excessive tumor growth preventing adequate respiration. Therapeutic efficacy in the CT26 tumor model requires breaking of self-tolerance to the H-2Ld-restricted immunodominant epitope AH1 from the gp70 endogenous tumor antigen (Slansky et al., 2000). Lm-RIID vaccines were constructed that expressed the altered peptide ligand AH1-A5 epitope (SPSYAYHQF (SEQ ID NO: 57)), containing a heteroclitic valine to alanine change in the fifth position of the MHC class I epitope, embedded in-frame within a unique Ava II restriction endonuclease site in chicken ovalbumin (OVA), as described previously (Brockstedt et al., 2004). To evaluate the therapeutic efficacy of Lm-RIID, 30 Female BALB/c mice were each given 2×105 CT26 cells suspended in 100 μl of HBSS by tail vein injection, and then randomized to 3 groups of 10 mice. 4 days later, the 3 groups of mice were given 100μl of HBSS, or 5×106 cfu of live-attenuated Lm ΔactA/ΔinlB expressing OVA (BH892), or 5×106 cfu of Lm RIID expressing OVA-AH1-A5 (BH3709). Fourteen days later, the same injections were given to all 3 groups of mice, and all mice were then monitored daily for survival.
Tumor-bearing animals in negative controls groups treated with HBSS or live-attenuated Lm ΔactA/ΔinlB expressing OVA had a median survival time of about 24 days post CT-26 tumor cell implantation (
1. Albert, H., Dale, E. C., Lee, E., and Ow, D. W. (1995). Site-specific integration of DNA into wild-type and mutant lox sites placed in the plant genome. The Plant Journal: For Cell And Molecular Biology 7, 649-659.
2. Bahjat, K. S., Liu, W., Lemmens, E. E., Schoenberger, S. P., Portnoy, D. A., Dubensky, T. W., Jr., and Brockstedt, D. G. (2006). Cytosolic entry controls CD8+-T-cell potency during bacterial infection. Infect Immun 74, 6387-6397.
3. Belyakov, I. M., Ahlers, J. D., Brandwein, B. Y., Earl, P., Kelsall, B. L., Moss, B., Strober, W., and Berzofsky, J. A. (1998). The importance of local mucosal HIV-specific CD8(+) cytotoxic T lymphocytes for resistance to mucosal viral transmission in mice and enhancement of resistance by local administration of IL-12. J Clin Invest 102, 2072-2081.
4. Berche, P., Gaillard, J. L., and Sansonetti, P. J. (1987). Intracellular growth of Listeria monocytogenes as a prerequisite for in vivo induction of T cell-mediated immunity. J Immunol 138, 2266-2271.
5. Bishop, D. K., and Hinrichs, D. J. (1987). Adoptive transfer of immunity to Listeria monocytogenes. The influence of in vitro stimulation on lymphocyte subset requirements. J Immunol 139, 2005-2009.
6. Blankenstein, T., Coulie, P. G., Gilboa, E., and Jaffee, E. M. (2012). The determinants of tumour immunogenicity. Nature reviews. Cancer 12, 307-313.
7. Brockstedt, D. G., Bahjat, K. S., Giedlin, M. A., Liu, W., Leong, M., Luckett, W., Gao, Y., Schnupf, P., Kapadia, D., Castro, G., et al. (2005). Killed but metabolically active microbes: a new vaccine paradigm for eliciting effector T-cell responses and protective immunity. Nat Med 11, 853-860.
8. Brockstedt, D. G., Giedlin, M. A., Leong, M. L., Bahjat, K. S., Gao, Y., Luckett, W., Liu, W., Cook, D. N., Portnoy, D. A., and Dubensky, T. W., Jr. (2004). Listeria-based cancer vaccines that segregate immunogenicity from toxicity. Proc Natl Acad Sci USA 101, 13832-13837.
9. Camilli, A., Tilney, L. G., and Portnoy, D. A. (1993). Dual roles of plcA in Listeria monocytogenes pathogenesis. Mol Microbiol 8, 143-157.
10. Horton, R. M. (1993). In Vitro Recombination and Mutagenesis of DNA: SOEing Together Tailor-Made Genes. Methods Mol Biol 15, 251-261.
11. Lauer, P., Chow, M. Y., Loessner, M. J., Portnoy, D. A., and Calendar, R. (2002). Construction, characterization, and use of two Listeria monocytogenes site-specific phage integration vectors. J Bacteriol 184, 4177-4186.
12. Lauer, P., Hanson, B., Lemmens, E. E., Liu, W., Luckett, W. S., Leong, M. L., Allen, H. E., Skoble, J., Bahjat, K. S., Freitag, N. E., et al. (2008). Constitutive Activation of the PrfA regulon enhances the potency of vaccines based on live-attenuated and killed but metabolically active Listeria monocytogenes strains. Infect Immun 76, 3742-3753.
13. Le, D. T., Brockstedt, D. G., Nir-Paz, R., Hampl, J., Mathur, S., Nemunaitis, J., Sterman, D. H., Hassan, R., Lutz, E., Moyer, B., et al. (2012). A live-attenuated Listeria vaccine (ANZ-100) and a live-attenuated Listeria vaccine expressing mesothelin (CRS-207) for advanced cancers: phase I studies of safety and immune induction. Clin Cancer Res 18, 858-868.
14. Moutaftsi, M., Peters, B., Pasquetto, V., Tscharke, D. C., Sidney, J., Bui, H. H., Grey, H., and Sette, A. (2006). A consensus epitope prediction approach identifies the breadth of murine T(CD8+)-cell responses to vaccinia virus. Nat Biotechnol 24, 817-819.
15. Portnoy, D. A., Auerbuch, V., and Glomski, I. J. (2002). The cell biology of Listeria monocytogenes infection: the intersection of bacterial pathogenesis and cell-mediated immunity. J Cell Biol 158, 409-414.
16. Portnoy, D. A., Jacks, P. S., and Hinrichs, D. J. (1988). Role of hemolysin for the intracellular growth of Listeria monocytogenes. J Exp Med 167, 1459-1471.
17. Shen, Z., Reznikoff, G., Dranoff, G., and Rock, K. L. (1997). Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J Immunol 158, 2723-2730.
18. Shetron-Rama, L. M., Marquis, H., Bouwer, H. G., and Freitag, N. E. (2002). Intracellular induction of Listeria monocytogenes actA expression. Infect Immun 70, 1087-1096.
19. Simon, R., Priefer, U., and Pulhler, A. (1983). A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nature Biotech 1, 784-791.
20. Slansky, J. E., Rattis, F. M., Boyd, L. F., Fahmy, T., Jaffee, E. M., Schneck, J. P., Margulies, D. H., and Pardoll, D. M. (2000). Enhanced antigen-specific antitumor immunity with altered peptide ligands that stabilize the MHC-peptide-TCR complex. Immunity 13, 529-538.
21. Smith, K., and Youngman, P. (1992). Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74, 705-711.
22. Topalian, S. L., Weiner, G. J., and Pardoll, D. M. (2011). Cancer immunotherapy comes of age. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 29, 4828-4836.
One skilled in the art readily appreciates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.
It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
All patents and publications mentioned in the specification are indicative of the levels of those of ordinary skill in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.
Other embodiments are set forth within the following claims.
This application claims the benefit of U.S. Provisional Application No. 61/723,234, filed Nov. 6, 2012, which is hereby incorporated in its entirety including all tables, figures, and claims.
| Number | Name | Date | Kind |
|---|---|---|---|
| 5767063 | Lee et al. | Jun 1998 | A |
| 5830702 | Portnoy et al. | Nov 1998 | A |
| 5888530 | Netti et al. | Mar 1999 | A |
| 6051237 | Paterson | Apr 2000 | A |
| 6090611 | Covacci et al. | Jul 2000 | A |
| 6099848 | Frankel et al. | Aug 2000 | A |
| 6379943 | Graham et al. | Apr 2002 | B1 |
| 7790694 | Geller et al. | Sep 2010 | B2 |
| 8580939 | Dubensky, Jr. et al. | Nov 2013 | B2 |
| 20020150588 | Allison et al. | Oct 2002 | A1 |
| 20030203472 | Portnoy et al. | Oct 2003 | A1 |
| 20040013690 | Portnoy et al. | Jan 2004 | A1 |
| 20050048081 | Frankel et al. | Mar 2005 | A1 |
| 20050281783 | Kinch et al. | Dec 2005 | A1 |
| 20070135333 | Geller et al. | Jun 2007 | A1 |
| 20120121643 | Dubensky, Jr. et al. | May 2012 | A1 |
| 20120321662 | Portnoy et al. | Dec 2012 | A1 |
| Number | Date | Country |
|---|---|---|
| 1483367 | May 2010 | EP |
| 9614087 | May 1996 | WO |
| 9925376 | May 1999 | WO |
| 2004006837 | Jan 2004 | WO |
| 2007103225 | Sep 2007 | WO |
| 2007117371 | Oct 2007 | WO |
| 2009143085 | Nov 2009 | WO |
| 2012068360 | May 2012 | WO |
| Entry |
|---|
| GenBank ID AJ012255.1 Apr. 15, 2005, dlt operon Listeria Monocytogenes. |
| Weaver et al., Venezuelan Equine Encephalitis. Annu Rev Entomol. 2004;49:141-174. |
| Weiskirch et al., Listeria monocytogenes: a potent vaccine vector for neoplastic and infectious disease. Immunol Rev. Aug. 1997;158:159-169. |
| Wells et al., Swine Influenza Virus Infections. Transmission From Ill Pigs to Humans at a Wisconsin Agricultural Fair and Subsequent Probable Person-To-Person Transmission. JAMA. Jan. 23-30, 1991;265(4):478-481. |
| Wentworth et al., An Influenza A (HINI) Virus, Closely Related to Swine Influenza Virus, Responsible for a Fatal Case of Human Influenza. J Virol. Apr. 1994;68(4):2051-2058. |
| Wong and Freitag, A Novel Mutation within the Central Listeria monocytogenes Regulator PrfA That Results in Constitutive Expression of Virulence Gene Products. J Bacteriol. Sep. 2004;186(18):6265-6276. |
| Woycechowsky and Raines, Native Disulfide Bond Formation in Proteins. Curr Opin Chem Biol. Oct. 2000;4(5):533-539. |
| Zaremba, Identification of an Enhancer Agonist Cytotoxic T Lymphocyte Peptide from Human Carcinoembryonic Antigen. Cancer Res. Oct. 15, 1997;57(20):4570-4577. |
| Zeier et al., New Ecological Aspects of Hantavirus Infection: A Change of a Paradigm and a Challenge of Prevention—A Review. Virus Genes. Mar. 2005;30(2):157-180. |
| Zhao et al., Pathogenicity and Immunogenicity of a Vaccine Strain of Listeria monocytogenes That Relies on a Suicide Plasmid to Supply an Essential Gene Product. Infect Immun. Sep. 2005;73(9):5789-5798. |
| Zimmerman et al., Expression of annexin II in conventional renal cell carcinoma is correlated with Fuhrman grade and clinical outcome. Virchows Arch. Oct. 2004;445(4):368-374. |
| Ziyaeyan et al., The Seroprevalence of Parvovirus BI9 Infection among To-Be-Married Girls, Pregnant Women, and Their Neonates in Shi raz, Iran. Jpn J Infect Dis. Apr. 2005;58(2):95-97. |
| Muminova et al., Characterization of human mesothelin transcripts in ovarian and pancreatic cancer. BMC Cancer. May 12, 2004;4:19. |
| Munson and Rodbard, Ligand: A Versatile Computerized Approach for Characterization of Ligand-Binding Systems. Anal Biochem. Sep. 1, 1980;107(1):220-239. |
| Nair et al., Induction of cytotoxic T cell responses and tumor immunity against unrelated tumors using telomerase reverse transcriptase RNA transfected dendritic cells. Nat Med. Sep. 2000;6(9):1011-1017. |
| Nakatsura et al., Cellular and humoral immune responses to a human pancreatic cancer antigen, coactosin-like protein, originally defined by the SEREX method. Eur J Immunol. Mar. 2002;32(3):826-836. |
| Nakatsura et al., Glypican-3, overexpressed specifically in human hepatocellular carcinoma, is a novel tumor marker. Biochem Biophys Res Commun. Jun. 20, 2003;306(1):16-25. |
| Nakatsura et al., Identification of Glypican-3 as a Novel Tumor Marker for Melanoma. Clin Cancer Res. Oct. 1, 2004;10(19):6612-6621. |
| Neumann et al., Identification of an HLA-DR-Restricted Peptide Epitope with a Promiscuous Binding Pattern Derived from the Cancer Testis Antigen HOM-MEL-40/SSX2. Int J Cancer. Nov. 20, 2004;112(4):661-668. |
| Nicoletto et al., BRCA-1 and BRCA-2 mutations as prognostic factors in clinical practice and genetic counselling. Cancer Treat Rev. Oct. 2001;27(5):295-304. |
| Nunes-Duby et al., Similarities and differences among 105 members of the Int family of site-specific recombinases. Nucleic Acids Res. Jan. 15, 1998;26(2):391-406. |
| Oberste et al., Evidence for Frequent Recombination within Species Human Enterovirus B Based on Complete Genomic Sequences of All Thirty-Seven Serotypes. J Virol. Jan. 2004;78(2):855-867. |
| Oberthuer et al., The Tumor-Associated Antigen PRAME is Universally Expressed in High-Stage Neuroblastoma and Associated with Poor Outcome. Clin Cancer Res. Jul. 1, 2004;10(13):4307-4313. |
| Oliveira-Perreira and Daniel-Ribeiro, Protective CD8+ T Cell Responses against the Pre-erythrocytic Stages of Malaria Parasites: an Overview. Mem Inst Oswaldo Cruz. Feb. 2001;96(2):221-227. |
| O'Riordan et al., Listeria Intracellular Growth and Virulence Require Host-Derived Lipoic Acid. Science. Oct. 17, 2003;302(5644):462-464. |
| Orvell et al., Antigenic relationships between six genotypes of the small hydrophobic protein gene of mumps virus. J Gen Virol. Oct. 2002;83(Pt 10):2489-2496. |
| Otte et al., MAGE—A Gene Expression Pattern in Primary Breast Cancer. Cancer Res. Sep. 15, 2001;61(18):6682-6687. |
| Oyston and Quarry, Tularemia vaccine: past, present and future. Antonie Van Leeuwenhoek. May 2005;87(4):277-281. |
| Padilla et al., Imaging of the Varicella Zoster Virion in the Viral Highways: Comparison With Herpes Simplex Viruses 1 and 2, Cytomegalovirus, Pseudorabies Virus, and Human Herpes Viruses 6 and 7. J Med Virol. 2003;70 Suppl 1: S103-S110. |
| Patel et al., Development of a simple restriction fragment length polymorphism assay for subtyping of coxsackie B viruses. J Virol Methods. Sep. 15, 2004;120(2):167-172. |
| Peh et al., Frequent presence of subtype A virus in Epstein-Barr virus-associated malignancies. Pathology. Oct. 2002; 34(5):446-450. |
| Pisarev et al., Full-Length Dominant-Negative Survivin for Cancer Immunotherapy. Clin Cancer Res. Dec. 15, 2003;9(17):6523-6533. |
| Porsch-Ozcurumez et al., Comparison of Enzyme-Linked Immunosorbent Assay, Western Blotting, Microagglutination, Indirect Immunofluorescence Assay, and Flow Cytometry for Serological Diagnosis of Tularemia. Clin Diagn Lab Immunol. Nov. 2004;11(6):1008-1015. |
| Portnoy et al., Role of Hemolysin for the Intracellular Growth of Listeria Monocytogenes. J Exp Med. Apr. 1, 1988;167(4):1459-1471. |
| Portnoy et al., The cell biology of Listeria monocytogenes infection: the intersection of bacterial pathogenesis and cell-mediated immunity. J Cell Biol. Aug. 5, 2002;158(3):409-414. |
| Ramsay et al., DNA vaccination against virus infection and enhancement of antiviral immunity following consecutive immunization with DNA and viral vectors. Immunol Cell Biol. Aug. 1997;75(4):382-388. |
| Renkvist et al., A listing of human tumor antigens recognized by T cells. Cancer Immunol Immunother. Mar. 2001;50(1):3-15. |
| Reynolds et al., HLA-Independent Heterogeneity of CD8+ T Cell Responses to MAGE-3, Melan-A/MART-1, gp100, Tyrosinase, MC1R, and TRP-2 in Vaccine-Treated Melanoma Patients. J Immunol. Dec. 15, 1998;161(12):6970-6976. |
| Rezig et al., Molecular Characterization of Coxsackievirus B5 Isolates. J Med Virol. Feb. 2004;72(2):268-274. |
| Ries et al., Investigation of the expression of melanoma antigen-encoding genes (MAGE-A1 to -A6) in oral squamous cell carcinomas to determine potential targets for gene-based cancer immunotherapy. Int J Oncol. Mar. 2005;26(3):817-824. |
| Ripio et al., A Gly145Ser Substitution in the Transcriptional Activator PrfA Causes Constitutive Overexpression of Virulence Factors in Listeria monocytogenes. J Bacteriol. Mar. 1997;179(5):1533-1540. |
| Roden and Wu, Preventative and therapeutic vaccines for cervical cancer. Expert Rev Vaccines. Aug. 2003;2(4):495-516. |
| Roner et al., Identification of signals required for the insertion of heterologous genome segments into the reovirus genome. Proc Natl Acad Sci USA. Dec. 9, 1995;92(26):12362-12366. |
| Rozinov and Nolan, Evolution of peptides that modulate the spectral qualities of bound, small-molecule fluorophores. Chem Biol. Dec. 1998;5(12):713-728. |
| Salazar-Onfray et al., Synthetic Peptides Derived from the Melanocyte-Stimulating Hormone Receptor MC1R Can Stimulate HLA-A2-Restricted Cytotoxic T Lymphocytes That Recognize Naturally Processed Peptides on Human Melanoma Cells. Cancer Res. Oct. 1, 1997;57(19):4348-4355. |
| Santin et al., The serine protease stratum corneum chymotryptic enzyme (kallikrein 7) is highly overexpressed in squamous cervical cancer cells. Gynecol Oncol. Aug. 2004;94(2):283-288. |
| Sarcevic et al., Expression of Cancer/Testis Tumor Associated Antigens in Cervical Squamous Cell Carcinoma. Oncology. 2003;64(4):443-449. |
| Sarobe et al., Carcinoembryonic Antigen as a Target to Induce Anti-Tumor Immune Responses. Curr Cancer Drug Targets. Aug. 2004;4(5):443-454. |
| Sasaki et al., SAGE mRNA expression in advanced-stage lung cancers. Eur J Surg Oncol. Dec. 2003;29(10):900-903. |
| Sasatomi et al., Expression of Tumor Rejection Antigens in Colorectal Carcinomas. Cancer. Mar. 15, 2002;94(6):1636-1641. |
| Scanlan et al., Antigens Recognized by Autologous Antibody in Patients with Renal-Cell Carcinoma. Int J Cancer. Nov. 12, 1999;83(4):456-464. |
| Scanlan et al., Cancer-related Serological Recognition of Human Colon Cancer: Identification of Potential Diagnostic and Immunotherapeutic Targets. Cancer Res. Jul. 15, 2002;62(14):4041-4047. |
| Scanlan et al., Expression of cancer-testis antigens in lung cancer: definition of bromodomain testis-specific gene (BRDT) as a new CT gene, CT9. Cancer Lett. Mar. 31, 2000;150(2):155-164. |
| Scanlan et al., Humoral immunity to human breast cancer: antigen definition and quantitative analysis of mRNA expression. Cancer Immun. Mar. 30, 2001;1:4 (17 pp). |
| Scanlan et al., The cancer/testis genes: Review, standardization, and commentary. Cancer Immun. Jan. 23, 2004;4:1 (15 pp). |
| Scarcella et al., Expression of MAGE and GAGE in High-Grade Brain Tumors: A Potential Target for Specific Immunotherapy and Diagnostic Markers. Clin Cancer Res. Feb. 1999;5(2):335-341. |
| Schmittgen et al., Expression of Prostate Specific Membrane Antigen and Three Alternatively Spliced Variants of PSMA in Prostate Cancer Patients. Int J Cancer. Nov. 1, 2003;107(2):323-329. |
| Schwartz et al., Novel Targeted and Immunotherapeutic Strategies in Chronic Myeloid Leukemia. Semin Hematol. Jan. 2003;40(1):87-96. |
| Sepehr et al., Distinct pattern of TP53 mutations in squamous cell carcinoma of the esophagus in Iran. Oncogene. Nov. 1, 2001;20(50):7368-7374. |
| Sepulveda-Amor et al., A randomized trial demonstrating successful boosting responses following simultaneous aerosols of measles and rubella (MR) vaccines in school age children. Vaccine. Jun. 21, 2002;20(21-22):2790-2795. |
| Shen et al., Cloned Dendritic Cells Can Present Exogenous Antigens on Both MHC Class I and Class II Molecules. J Immunol. Mar. 15, 1997;158(6)2723-2730. |
| Shen et al., Recombinant Listeria monocytogenes as a live vaccine vehicle for the induction of protective anti-viral cell-mediated immunity. Proc Natl Acad Sci USA. Apr. 25, 1995;92(9):3987-3991. |
| Das et al., Evaluation of a Western Equine Encephalitis recombinant E1 protein for protective immunity and diagnostics. Antiviral Res. Nov. 2004;64(2):85-92. |
| Davies et al., Characterisation of a recombinant Fv fragment of anti-MUC1 antibody HMFG1. Cancer Lett. Jul. 29, 1994;82(2):179-184. |
| De Backer et al., Characterization of the GAGE Genes That Are Expressed in Various Human Cancers and in Normal Testis. Cancer Res. Jul. 1, 1999;59(13):3157-3165. |
| de Villiers et al., Classification of papillomaviruses. Virology. Jun. 20, 2004;324(1):17-24. |
| Demidenko and Blagosklonny, Flavopiridol Induces p53 via Initial Inhibition of Mdm2 and P21 and, Independently of p53, Sensitizes Apoptosis-Reluctant Cells to Tumor Necrosis Factor. Cancer Res. May 15, 2004;64(10):3653-3660. |
| Disis and Cheever, HER-2/Neu Protein: A Target for Antigen-Specific Immunotherapy of Human Cancer. Adv Cancer Res. 1997;71:343-371. |
| Disis et al., Humoral Epitope-Spreading Following Immunization with a HER-2/neu Peptide Based Vaccine in Cancer Patients. J Clin Immunol. Sep. 2004;24(5):571-578. |
| Dosaka-Akita et al., Expression of N-Acetylglucosaminyltransferase V is Associated with Prognosis and Histology in Non-Small Cell Lung Cancers. Clin Cancer Res. Mar. 1, 2004;10(5):1773-1779. |
| Duxbury et al., CEACAM6 as a novel target for indirect type 1 immunotoxin-based therapy in pancreatic adenocarcinoma. Biochem Biophys Res Commun. May 7, 2004;317(3):837-843. |
| Elgh et al., Serological Diagnosis of Hantavirus Infections by an Enzyme-Linked Immunosorbent Assay Based on Detection of Immunoglobulin G and M Responses to Recombinant Nucleocapsid Proteins of Five Viral Serotypes. J Clin Microbiol. May 1997;35(5):1122-1130. |
| Engels et al., Serologic Evidence for Exposure to Simian Virus 40 in North American Zoo Workers. J Infect Dis. Dec. 15, 2004;190(12):2065-2069. |
| Enjoji et al., RCAS1, a Useful Serum Marker to Predict the Recurrence of Cancer: Two Cases of Cholangiocarcinoma and Pancreatic Cancer. Dig Dis Sci. Oct. 2004;49(10):1654-1656. |
| Ericson et al., Expression of Cyclin-Dependent Kinase 6, but not Cyclin-Dependent Kinase 4, Alters Morphology of Cultured Mouse Astrocytes. Mol Cancer Res. Jul. 2003;1(9):654-664. |
| Estrada-Franco et al., Venezuelan Equine Encephalitis Virus, Southern Mexico. Emerg Infect Dis. Dec. 2004;10(12):2113-2121. |
| Fang et al., Expression of Dnmt1, demethylase, MeCP2 and methylation of tumor-related genes in human gastric cancer. World J Gastroenterol. Dec. 1, 2004;10(23):3394-3398. |
| Faure et al., Inducible Hsp70 as Target of Anticancer Immunotherapy: Identification of HLA-A*0201-Restricted Epitopes. Int J Cancer. Mar. 1, 2004;108(6):863-870. |
| Fleishhauer et al., The DAM Gene Family Encodes a New Group of Tumor-specific Antigens Recognized by Human Leukocyte Antigen Al-restricted Cytotoxic T Lymphocytes. Cancer Res. Jul. 15, 1998;58(14):2969-2972. |
| Fong et al., Altered peptide ligand vaccination with Flt3 ligand expanded dendritic cells for tumor immunotherapy. Proc Natl Acad Sci U S A. Jul. 17, 2001;98(15):8809-8814. |
| Fuessel et al., Multiple tumor marker analyses (PSA, hK2, PSCA, trp-p8) in primary prostate cancers using quantitative RT-PCR. Int J Oncol. Jul. 2003;23(1):221-228. |
| Gaillard et al., Entry of L. monocytogenes into Cells is Mediated by Internalin, a Repeat Protein Reminiscent of Surface Antigens from Gram-Positive Cocci. Cell. Jun. 28, 1991;65(7):1127-1141. |
| Gambus et al., Epitope mapping of a mouse monoclonal anti-MUC2 antibody suggests the existence of an immunodominant region in the COOH terminus of the MUC2 tandem-repeat sequence. Int J Cancer. Jan. 3, 1995;60(1):146-148. |
| Geisbert and Jahrling, Differentiation of filoviruses by electron microscopy. Virus Res. Dec. 1995;39(2-3):129-150. |
| Ghazizadeh et al., Role of cdk4, p16INK4, and Rb Expression in the Prognosis of Bronchioloalveolar Carcinomas. Respiration. Jan.-Feb. 2005;72(1):68-73. |
| Gherardi et al., Towards a new generation of vaccines: the cytokine IL-12 as an adjuvant to enhance cellular immune responses to pathogens during prime-booster vaccination regimens. Histol Histopathol. Apr. 2001;16(2):655-667. |
| Gilliam et al., A phase II study of G17DT in gastric carcinoma. Eur J Surg Oncol. Jun. 2004;30(5):536-543. |
| Gonzalez et al., A comparative sequence analysis to revise the current taxonomy of the family Coronaviridae. Arch Virol. Nov. 2003;148(11):2207-2235. |
| Good et al., Development and regulation of cell-mediated immune responses to the blood stages of malaria: implications mplications for vaccine research. Annu Rev Immunol. 2005;23:69-99. |
| Good et al., The immunological challenge to developing a vaccine to the blood stages of malaria parasites. Immunol Rev. Oct. 2004;201:254-267. |
| Greiner et al., Vaccine-Based Therapy Directed against Carcinoembryonic Antigen Demonstrates Antitumor Activity on Spontaneous Intestinal Tumors in the Absence of Autoimmunity. Cancer Res. Dec. 1, 2002;62(23):6944-6951. |
| Grimm et al., Mouse alpha-fetoprotein-specific DNA-based immunotherapy of hepatocellular carcinoma leads to tumor regression in mice. Gastroenterology. Oct. 2000;119(4):1104-1112. |
| Groh et al., Efficient cross-priming of tumor antigen-specific T cells by dendritic cells sensitized with diverse anti-MICA opsonized tumor cells. Proc Natl Acad Sci USA. May 3, 2005;102(18):6461-6466. |
| Groth and Calos, Phage Integrases: Biology and Applications. J Mol Biol. Jan. 16, 2004;335(3):667-678. |
| Gueguen et al., An Antigen Recognized by Autologous CTLs on a Human Bladder Carcinoma. J Immunol. Jun. 15, 1998;160(12):6188-6194. |
| Gulmann et al., Adenomatous Polyposis Coli Gene, beta-Catenin, and E-Cadherin Expression in Proximal and Distal Gastric Cancers and Precursor Lesions. Appl Immunohistochem Mol Morphol. Sep. 2003;11(3):230-237. |
| Gunn et al., Two Listeria Monocytogenes Vaccine Vectors That Express Different Molecular Forms of Human Papilloma Virus-16 (HPV-16) E7 Induce Qualitatively Different T Cell Immunity That Correlates With Their Ability to Induce Regression of Established Tumors Immortalized by HPV-16. J Immunol. Dec. 1, 2001;167(11):6471-6479. |
| Gupta et al., Refolding, purification, and crystallization of apical membrane antigen 1 from Plasmodium falciparum. Protein Expr Purif. May 2005;41(1):186-198. |
| Haddad et al., Novel antigen identification method for discovery of protective malaria antigens by rapid testing of DNA vaccines encoding exons from the parasite genome. Infect Immun. Mar. 2004;72(3):1594-1602. |
| Hakansson et al., Establishment and phenotypic characterization of human U937 cells with inducible P210 BCR/ABL expression reveals upregulation of CEACAM1 (CD66a). (2004) Leukemia 18:538-547. |
| Harris et al., The Biological and Therapeutic Importance of Gastrin Gene Expression in Pancreatic Adenocarcinomas. Cancer Res. Aug. 15. 2004;64(16):5624-5631. |
| Hashido et al., Evaluation of an Enzyme-Linked Immunosorbent Assay Based on Binding Inhibition for Type-Specific Quantification of Poliovirus Neutralization-Relevant Antibodies. Microbiol Immunol. 1999;43(1):73-77. |
| Hassan et al., Mesothelin: A New Target for Immunotherapy. Clin Cancer Res. Jun. 15, 2004;10(12 Pt 1):3937-3942. |
| Havlasova et al., Mapping of immunoreactive antigens of Francisella tularensis live vaccine strain. Proteomics. Jul. 2002;2(7):857-867. |
| Havlasova et al., Proteomic analysis of anti-Francisella tularensis LVS antibody response in murine model of tularemia. Proteomics. May 2005;5(8):2090-2103. |
| He et al., Complexes of Poliovirus Serotypes with Their Common Cellular Receptor, CD155. J Virol. Apr. 2003;77 (8):4827-4835. |
| Hirose et al., Incidence of Diffuse Large B-Cell Lymphoma of Germinal Center B-Cell Origin in Whole Diffuse Large B-Cell Lymphoma: Tissue Fluorescence in Situ Hybridization Using t(14;18) Compared with Immunohistochemistry. Int J Hematol. Jan. 2005;81(1):48-57. |
| Hoffman et al., Strategy for development of a pre-erythrocytic Plasmodium falciparum DNA vaccine for human use. Vaccine. Jun. 1997;15(8):842-845. |
| Hoke, History of U.S. Military Contributions to the Study of Viral Encephalitis. Mil Med. Apr. 2005;170(4 Suppl):92-105. |
| Horton, In Vitro Recombination and Mutagenesis of DNA: SOEing Together Tailor-Made Genes. Methods Mol Biol. 1993;15:251-261. |
| Howard et al., Differentiation of Listeria monocytogenes, Listeria innocua, Listeria ivanovii, and Listeria seeligeri by pulsed-field gel electrophoresis. Appl Environ Microbiol. Feb. 1992;58(2):709-712. |
| Hussain and Paterson, What is needed for effective antitumor immunotherapy? Lessons learned using Listeria monocytogenes as a live vector for HPV-associated tumors. Cancer Immunol Immunother. Jun. 2005;54(6):577-586. |
| Hutchinson et al., Multiplex Analysis of Cytokines in the Blood of Cynomolgus Macaques Naturally Infected With Ebola Virus (Reston Serotype). J Med Virol. Nov. 2001;65(3):561-566. |
| Iacobuzio-Donahue et al., Highly Expressed Genes in Pancreatic Ductal Adenocarcinomas: A Comprehensive Characterization and Comparison of the Transcription Profiles Obtained from Three Major Technologies. Cancer Res. Dec. 15, 2003;63(24):8614-8622. |
| Iqbal et al., BCL2 Translocation Defines a Unique Tumor Subset within the Germinal Center B-Cell-Like Diffuse Large B-Cell Lymphoma. Am J Pathol. Jul. 2004;165(1):159-166. |
| Isherwood et al., Vaccination strategies for Francisella tularensis. Adv Drug Deily Rev. Jun. 17, 2005;57 (9):1403-1414. |
| Ito et al., Prostate Carcinoma Detection and Increased Prostate-Specific Antigen Levels after 4 Years in Dutch and Japanese Males Who Had No Evidence of Disease at Initial Screening. Cancer. Jan. 15, 2005;103(2):242-250. |
| Jainkittivong and Langlais, Herpes B virus infection. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. Apr. 1998; 85(4):399-403. |
| Jamieson et al., Human Torovirus: A New Nosocomial Gastrointestinal Pathogen. J Infect Dis. Nov. 1998;178(5):1263-1269. |
| Jansen and Shaw, Human Papillomavirus Vaccines and Prevention of Cervical Cancer. Annu Rev Med. 2004;55:319-331. |
| Johnson et al., Natural Atypical Listeria innocua Strains with Listeria monocytogenes Pathogenicity Island 1 Genes. Appl Environ Microbiol. Jul. 2004;70(7):4256-4266. |
| Jones and Portnoy, Characterization of Listeria monocytogenes Pathogenesis in a Strain Expressing Perfringolysin O in Place of Listeriolysin O. Infect Immun. Dec. 1994;62(12):5608-5613. |
| Jung et al., Strategies Against Human Papillomavirus Infection and Cervical Cancer. J Microbiol. Dec. 2004;42 (4):255-266. |
| Jungck et al., E-cadherin expression is homogeneously reduced in adenoma from patients with familial adenomatous polyposis: an immunohistochemical study of E-cadherin, beta-catenin and cyclooxygenase-2 expression. Int J Colorectal Dis. Sep. 2004;19(5):438-445. |
| Kann and Goldstein, Performance Evaluation of a New Algorithm for the Detection of Remote Homologs With Sequence Comparison. Proteins. Aug. 1, 2002;48(2):367-376. |
| Kaufman et al., Parvovirus B19 does not bind to membrane-associated globoside in vitro. Virology. Feb. 5, 2005;332 (1):189-198. |
| Kedl et al., Comparative Sequence Analysis of the Reovirus S4 Genes from 13 Serotype 1 and Serotype 3 Field Isolates. (1995) J. Virol. 69:552-559. |
| Kim et al., Comparison of HPV DNA vaccines employing intracellular targeting strategies. Gene Ther. Jun. 2004;11(12):1011-1018. |
| Krzych et al., T Lymphocytes from Volunteers Immunized with Irradiated Plasmodium Falciparum Sporozoites Recognize Liver and Blood Stage Malaria Antigens. J Immunol. Oct. 15, 1995;155(8):4072-4077. |
| Kubuschok et al., Expression of Cancer Testis Antigens in Pancreatic Carcinoma Cell Lines, Pancreatic Adenocarcinoma and Chronic Pancreatitis. Int J Cancer. Apr. 20, 2004;109(4):568-575. |
| Kumamuru et al., T-Cell Receptor Vbeta Gene Usage by T Cells Reactive with the Tumor-Rejection Antigen SART-1 in Oral Squamous Cell Carcinoma. Int J Cancer. Feb. 20, 2004;108(5):686-695. |
| Kyte and Doolittle, A Simple Method for Displaying the Hydropathic Character of a Protein. J Mol Biol. May 5, 1982;157(1):105-132. |
| Laheru and Jaffee, Immunotherapy for Pancreatic Cancer—Science Driving Clinical Progress. Nat Rev Cancer. Jun. 2005;5(6):459-467. |
| Lalic-Multhaler et al., In vitro transcription of PrfA-dependent and -independent genes of Listeria monocytogenes. Mol Microbiol. Oct. 2001;42(1):111-120. |
| Le et al., A Live-Attenuated Listeria Vaccine (ANZ-100) and a Live-Attenuated Listeria Vaccine Expressing Mesothelin (CRS-207) for Advanced Cancers: Phase I Studies of Safety and Immune Induction. Clin Cancer Res. Feb. 1, 2012;18 (3):858-868. |
| Lee et al., Immunomic analysis of human sarcoma. Proc Natl Acad Sci USA. Mar. 4, 2003;100(5):2651-2656. |
| Leroux-Roels et al., Prevention of Hepatitis B Infections: Vaccination and its Limitations. Acta Clin Belg. Jul.-Aug. 2001;56(4):209-219. |
| Li et al., Advanced Glycation End Products Induce Tubular Epithelial-Myofibroblast Transition through the RAGE-ERK112 MAP Kinase Signaling Pathway. Am J Pathol. Apr. 2004;164(4):1389-1397. |
| Li et al., Expression Profile of Cancer-Testis Genes in 121 Human Colorectal Cancer Tissue and Adjacent Normal Tissue. Clin Cancer Res. Mar. 1, 2005;11(5):1809-1814. |
| Liang et al., Microvessel density, cyclo-oxygenase 2 expression, K-ras mutation and p53 overexpression in colonic cancer. Br J Surg. Mar. 2004;91(3):355-361. |
| Liau et al., Tumor Immunity within the Central Nervous System Stimulated by Recombinant Listeria Monocytogenes Vaccination. Cancer Res. Apr. 15, 2002;62(8):2287-2293. |
| Lim et al., Molecular and phenotypic spectrum of de novo Philadelphia positive acute leukemia. Int J Mol Med. Dec. 1999;4(6):665-667. |
| Lin et al., Melanoma-Associated Antigens in Esophageal Adenocarcinoma: Identification of Novel MAGE-A10 Splice Variants. Clin Cancer Res. Sep. 1, 2004;10(17):5708-5716. |
| Lingnau et al., Expression of the Listeria monocytogenes EGD inIA and inIB Genes, Whose Products Mediate Bacterial Entry into Tissue Culture Cell Lines, by PrfA-Dependent and -Independent Mechanisms. Infect Immun. Oct. 1995,63(10):3896-3903. |
| Lucas et al., MAGE-B5, MAGE-B6, MAGE-C2, and MAGE-C3: Four New Members of the MAGE Family with Tumor-Specific Expression. Int J Cancer. Jul. 1, 2000;87(1):55-60. |
| Luo et al., in vitro transcription of the Listeria monocytogenes virulence genes inlC and mpl reveals overlapping PrfA-dependent and -independent promoters that are differentially activated by GTP. Mol Microbiol. Apr. 2004;52(1):39-52. |
| Machlenkin et al., Human CTL Epitopes Prostatic Acid Phosphatase-3 and Six-Transmembrane Epithelial Antigen of Prostate-3 as Candidates for Prostate Cancer Immunotherapy. Cancer Res. Jul. 15, 2005;65(14):6435-6442. |
| Mandruzzato et al., A CASP-8 Mutation Recognized by Cytolytic T Lymphocytes on a Human Head and Neck Carcinoma. J Exp Med. Aug. 29, 1997;186(5):785-793. |
| Marth, Booster Policy for Adults. Biologicals. Jun. 1997;25(2):199-203. |
| Matsumoto et al., Expression of the SART-1 Antigens in Uterine Cancers. Jpn J Cancer Res. Dec. 1998;89(12):1292-1295. |
| Matsushita et alPreferentially Expressed Antigen of Melanoma (PRAME) in the Development of Diagnostic and Therapeutic Methods for Hematological Malignancies. Leuk Lymphoma. Mar. 2003;44(3):439-444. |
| Mayo et al., Mdm-2 Phosphorylation by DNA-dependent Protein Kinase Prevents Interaction with p531. Cancer Res. Nov. 15, 1997;57(22):5013-5016. |
| McCool et al., Roles of calreticulin and calnexin during mucin synthesis in LS180 and HT29/A1 human colonic adenocarcinoma cells. Biochem J. Aug. 1, 1999;341 ( Pt 3):593-600. |
| Millon et al., Detection of Prostate-Specific Antigen- or Prostate-Specific Membrane Antigen-Positive Circulating Cells in Prostatic Cancer Patients: Clinical Implications. Eur Urol. Oct. 1999;36(4):278-285. |
| Molijn et al., Molecular diagnosis of human papillomavirus (HPV) infections. J Clin Virol. Mar. 2005;32 Suppl 1: S43-51-S51. |
| Moreau-Aubry et al., A Processed Pseudogene Codes for a New Antigen Recognized by a CD8+ T Cell Clone on Melanoma. J Exp Med. May 1, 2000;191(9):1617-1624. |
| Morse et al., A Phase I Study of Active Immunotherapy with Carcinoembryonic Antigen Peptide (CAP-1)-Pulsed, Autologous Human Cultured Dendritic Cells in Patients with Metastatic Malignancies Expressing Carcinoembryonic Antigen. Clin Cancer Res. Jun. 1999;5(6):1331-1338. |
| Moutaftsi et al., A consensus epitope prediction approach identifies the breadth of murine TCD8+-cell responses to vaccinia virus. Nat Biotechnol. Jul. 2006;24(7):817-819. |
| Mueller and Freitag, Pleiotropic Enhancement of Bacterial Pathogenesis Resulting from the Constitutive Activation of the Listeria monocytogenes Regulatory Factor PrfA. Infect Immun. Apr. 2005;73(4):1917-1926. |
| Mukhopadhyay et al., A Structural Perspective of the Flavivirus Life Cycle. Nat Rev Microbiol. Jan. 2005;3(1):13-22. |
| Mulders et al., Tumor antigens and markers in renal cell carcinoma. Urol Clin North Am. Aug. 2003;30(3):455-465. |
| Muller et al., MeCP2 and MBD2 expression in human neoplastic and non-neoplastic breast tissue and its association with oestrogen receptor status. Br J Cancer. Nov. 17, 2003;89(10):1934-1939. |
| Shetron-Rama et al., Intracellular Induction of Listeria monocytogenes actA Expression. Infect Immun. Mar. 2002;70 (3):1087-1096. |
| Shetron-Rama et al., Isolation of Listeria monocytogenes mutants with high-level in vitro expression of host cytosol-induced gene products. Mol Microbiol. Jun. 2003;48(6):1537-1551. |
| Shigemasa et al., Expression of the protease inhibitor antileukoprotease and the serine protease stratum corneum chymotryptic enzyme (SCCE) is coordinated in ovarian tumors. Int J Gynecol Cancer. Nov.-Dec. 2001;11(6):454-461. |
| Shirakawa et al., A Cox-2 Promoter-Based Replication-Selective Adenoviral Vector to Target the Cox-2-Expressing Human Bladder Cancer Cells. Clin Cancer Res. Jul. 1, 2004;10(13):4342-4348. |
| Shirasawa et al., Receptor for advanced glycation end-products is a marker of type I lung alveolar cells. Genes Cells. Feb. 2004;9(2):165-174. |
| Shivapurkar et al., Presence of Simian Virus 40 DNA Sequences in Human Lymphoid and Hematopoietic Malignancies and Their Relationship to Aberrant Promoter Methylation of Multiple Genes. Cancer Res. Jun. 1, 2004;64 (11):3757-3760. |
| Siegel et al., Induction of antitumour immunity using survivin peptide-pulsed dendritic cells in a murine lymphoma model. Br J Haematol. Sep. 2003;122(6):911-914. |
| Simon et al., A Broad Host Range Mobilization System for In Vivo Genetic Engineering: Transposon Mutagenesis in Gram Negative Bacteria. Nature Biotechnology 1983;1:784-791. |
| Simon et al., Cervical response to vaccination against HPV16 E7 in case of severe dysplasia. Eur J Obstet Gynecol Reprod Biol. Aug. 15, 2003;109(2):219-223. |
| Sjolander et al., Serological divergence of Dobrava and Saaremaa hantaviruses: evidence for two distinct serotypes. Epidemiol Infect. Feb. 2002;128(1):99-103. |
| Skoble et al., Three Regions within ActA Promote Arp2/3 Complex-Mediated Actin Nucleation and Listeria monocytogenes Motility. J Cell Biol. Aug. 7, 2000;150(3):527-538. |
| Slager et al., Identification of Multiple HLA-DR-Restricted Epitopes of the Tumor-Associated Antigen CAMEL by CD4+ Th1/Th2 Lymphocytes. J Immunol. Apr. 15, 2004;172(8):5095-5102. |
| Slager et al., Induction of CAMEL/NY-ESO-ORF2-specific CD8+ T cells upon stimulation with dendritic cells infected with a modified Ad5 vector expressing a chimeric Ad5/35 fiber. Cancer Gene Ther. Mar. 2004:11(3):227-236. |
| Slansky et al., Enhanced Antigen-Specific Antitumor Immunity with Altered Peptide Ligands that Stabilize the MHC-Peptide-TCR Complex. Immunity. Oct. 2000;13(4):529-538. |
| Small et al., Immunotherapy of Hormone-Refractory Prostate Cancer With Antigen-Loaded Dendritic Cells. J Clin Oncol. Dec. 1, 2000;18(23):3894-3903. |
| Smith and Thorpe, Diversity in the serine recombinases. Mol Microbiol. Apr. 2002;44(2):299-307. |
| Smith and Youngman, Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spolIM gene. Biochimie. Jul.-Aug. 1992;74(7-8):705-711. |
| Smith et al., Measurement of Cell-Mediated Immunity With a Varicella-Zoster Virus-specific Interferon-gamma Elispot Assay: Responses in an Elderly Population Receiving a Booster Immunization. J Med Virol. 2003;70 Suppl 1:S38-S41. |
| Smith et al., Neutralization of HIV-1 Subtypes: Implications for Vaccine Formulations. J Med Virol. Nov. 1998;56 (3):264-268. |
| Smits et al., Phylogenetic and Evolutionary Relationships among Torovirus Field Variants: Evidence for Multiple Intertypic Recombination Events. J Virol. Sep. 2003;77(17):9567-9577. |
| Stams et al., Expression Levels ofTEL, AML1, and the Fusion ProductsTEL-AML1 and AML1-TEL versus Drug Sensitivity and Clinical Outcome in t(12;21)-Positive Pediatric Acute Lymphoblastic Leukemia. Clin Cancer Res. Apr. 15, 2005;11(8):2974-2980. |
| Steffens et al., Immunohistochemical Analysis of Tumor Antigen Saturation Following Injection of Monoclonal Antibody G250. Anticancer Res. Mar.-Apr. 1999:19(2A):1197-1200. |
| Stirnadel et al., Assessment of different sources of variation in the antibody responses to specific malaria antigens in in children in Papua New Guinea. Int J Epidemiol. Jun. 2000;29(3):579-586. |
| Stolier et al., Initial Experience with Surgical Treatment Planning in the Newly Diagnosed Breast Cancer Patient at High Risk for BRCA-1 or BRCA-2 Mutation. Breast J. Nov.-Dec. 2004;10(6):475-480. |
| Studahl et al., Herpesvirus DNA Detection in Cerebral Spinal Fluid: Differences in Clinical Presentation between Alpha-, Beta-, and Gamma-Herpesviruses. Scand J Infect Dis. 2000;32(3):237-248. |
| Suzuki et al., Identification of Natural Antigenic Peptides of a Human Gastric Signet Ring Cell Carcinoma Recognized by HLA-A31-Restricted Cytotoxic T Lymphocytes. J Immunol. Sep. 1, 1999;163(5):2783-2791. |
| Takahashi et al., 707-AP Peptide Recognized by Human Antibody Induces Human Leukocyte Antigen A2-Restricted Cytotoxic T Lymphocyte Killing of Melanoma. Clin Cancer Res. Aug. 1997;3(8):1363-1370. |
| Tamura et al., Identification of Cyclophilin B-derived Peptides Capable of Inducing Histocompatibility Leukocyte Antigen-A2-restricted and Tumor-specific Cytotoxic T Lymphocytes. Jpn J Cancer Res. Jul. 2001;92(7):762-767. |
| Tanaka et al., Expression of Tumor-rejection Antigens in Gynecologic Cancers. Jpn J Cancer Res. Nov. 2000;91 (11):1177-1184. |
| Tannapfel et al., BRAF Gene Mutations Are Rare Events in Gastroenteropancreatic Neuroendocrine Tumors. Am J Clin Pathol. Feb. 2005;123(2):256-260. |
| Topalian et al., Cancer Immunotherapy Comes of Age. J Clin Oncol. Dec. 20, 2011;29(36):4828-4836. |
| Treurnicht et al., HHV-8 Subtypes in South Africa: Identification of a Case Suggesting a Novel B Variant. J Med Virol. Feb. 2002;66(2):235-240. |
| Trimble et al., Comparison of the CD8+ T cell responses and antitumor effects generated by DNA vaccine administered through gene gun, biojector, and syringe. Vaccine. Sep. 8, 2003;21(25-26):4036-4042. |
| Trincado et al., Human Cytomegalovirus Strains Associated With Congenital and Perinatal Infections. J Med Virol. Aug. 2000;61(4):481-487. |
| Tsang et al., Phenotypic Stability of a Cytotoxic T-Cell Line Directed against an Immunodominant Epitope of Human Carcinoembryonic Antigen. Clin Cancer Res. Dec. 1997;3(12 Pt 1):2439-2449. |
| Tsao and Sober, Melanoma Treatment Update. Dermatol Clin. Apr. 2005;23(2):323-333. |
| Tsuruma et al., Phase I clinical study of anti-apoptosis protein, survivin-derived peptide vaccine therapy for patients with advanced or recurrent colorectal cancer J Transl Med. Jun. 13, 2004;2(1):19 (11 pages). |
| Vallejo et al., Nucleotide Sequence and Restriction Fragment-Length Polymorphism Analysis of Human T-Cell Lymphotropic Virus Type II (HTLV-II) in Southern Europe: Evidence for the HTLV-IIA and HTLV-IIB Subtypes. J Acquir Immune Defic Syndr Hum Retrovirol. Dec. 1, 1996;13(4):384-391. |
| Van Den Eynde et al., A New Antigen Recognized by Cytolytic T Lymphocytes on a Human Kidney Tumor Results from Reverse Strand Transcription. J Exp Med. Dec. 20, 1999;190(12):1793-1800. |
| Vandamme et al., African Origin of Human T-Lymphotropic Virus Type 2 (HTLV-2) Supported by a Potential New HTLV-2d Subtype in Congolese Bambuti Efe Pygmies. J Virol. May 1998;72(5):4327-4340. |
| Vazquez-Boland et al., Nucleotide Sequence of the Lecithinase Operon of Listeria monocytogenes and Possible Role of Lecithinase in Cell-to-Cell Spread. Infect Immun. Jan. 1992;60(1):219-230. |
| Vilas Boas et al., Cytomegalovirus Glycoprotein B Genotypes and Central Nervous System Disease in AIDS Patients. J Med Virol. Nov. 2003;71(3):404-407. |
| Vilchez and Butel, Emergent Human Pathogen Simian Virus 40 and Its Role in Cancer. Clin Microbiol Rev. Jul. 2004;17(3):495-508. |
| Virok et al., Chlamydial Infection Induces Pathobiotype-Specific Protein Tyrosine Phosphorylation in Epithelial Cells. Infect Immun. Apr. 2005;73(4):1939-1946. |
| Von Lindern et al., The Translocation (6;9), Associated with a Specific Subtype of Acute Myeloid Leukemia, Results in the Fusion of Two Genes, dek and can, and the Expression of a Chimeric, Leukemia-Specific dek-can mRNA. Mol Cell Biol. Apr. 1992;12(4):1687-1697. |
| Waltregny et al., Screening of histone deacetylases (HDAC) expression in human prostate cancer reveals distinct class I HDAC profiles between epithelial and stromal cells. Eur J Histochem. Jul.-Sep. 2004;48(3):273-290. |
| Wang et al., Alterations of APC, c-met, and p53 Genes in Tumor Tissue and Serum of Patients with Gastric Cancers. J Surg Res. Aug. 2004;120(2):242-248. |
| Wang et al., Cloning Genes Encoding MHC Class II—Restricted Antigens: Mutated CDC27 as a Tumor Antigen. Science. May 21, 1999;284(5418):1351-1354. |
| Wang et al., Identification of a Novel Major Histocompatibility Complex Class II—restricted Tumor Antigen Resulting from a Chromosomal Rearrangement Recognized by CD4+ T Cells. J Exp Med. May 17, 1999;189(10):1659-1667. |
| Weaver et al., Genetic determinants of Venezuelan equine encephalitis emergence. Arch Virol Suppl. 2004; (18):43-64. |
| Abutaily et al., Cadherins, catenins and APC in pleural malignant mesothelioma. J Pathol. Nov. 2003;201(3):355-362. |
| Aguilar et al., Endemic Venezuelan equine encephalitis in northern Peru. Emerg Infect Dis. May 2004;10(5):880-888. |
| Ahn et al., All CVB Serotypes and Clinical Isolates Induce Irreversible Cytopathic Effects in Primary Cardiomyocytes. J Med Virol. Feb. 2005;75(2):290-294. |
| Albert et al., Site-specific integration of DNA into wild-type and mutant lox sites placed in the plant genome. Plant J. Apr. 1995;7(4):649-659. |
| Altwein and Luboldt, Prognostic Factors for Carcinoma of the Prostate. Urol Int. 1999:63(1):62-71. |
| Alvarez-Lafuente et al., Human parvovirus B19, varicella zoster virus, and human herpes virus 6 in temporal artery biopsy specimens of patients with giant cell arteritis: analysis with quantitative real time polymerase chain reaction. Ann Rheum Dis. May 2005;64(5):780-782. |
| Andersen and thor Straten, Survivin—a universal tumor antigen. Histol Histopathol. Apr. 2002;17(2):669-675. |
| Argani et al., Discovery of New Markers of Cancer through Serial Analysis of Gene Expression Prostate Stem Cell Antigen is Overexpressed in Pancreatic Adenocarcinoma. Cancer Res. Jun. 1, 2001;61(11):4320-4324. |
| Arora et al., Identification of Differentially Expressed Genes in Oral Squamous Cell Carcinoma. Mol Carcinog. Feb. 2005;42(2):97-108. |
| Arslan et al., A new approach to sequence comparison: normalized sequence alignment. Bioinformatics. Apr. 2001;17(4):327-337. |
| Attoui et al., Comparative sequence analysis of American, European and Asian isolates of viruses in the genus Coltivirus. J Gen Virol. Oct. 1998;79 ( Pt 10):2481-2489. |
| Auerbuch et al., Development of a Competitive Index Assay to Evaluate the Virulence of Listeria monocytogenes actA Mutants during Primary and Secondary Infection of Mice. Infect Immun. Sep. 2001;69(9):5953-5957. |
| Bahjat et al., Cytosolic Entry Controls CD8+-T-Cell Potency during Bacterial Infection. Infect Immun. Nov. 2006;74 (11):6387-6397. |
| Barbanti-Brodano et al., Simian virus 40 infection in humans and association with human diseases: results and hypotheses. Virology. Jan. 5, 2004;318(1):1-9. |
| Barthold et al., Infectivity, Disease Patterns, and Serologic Profiles of Reovirus Serotypes 1, 2, and 3 in Infant and Weanling Mice. Lab Anim Sci. Oct. 1993;43(5):425-430. |
| Baurain et al., High Frequency of Autologous Anti-Melanoma CTL Directed Against an Antigen Generated by a Point Mutation in a New Helicase Gene. J Immunol. Jun. 1, 2000;164(11):6057-6066. |
| Belyakov et al., The Importance of Local Mucosal HIV-Specific CD8+ Cytotoxic T Lymphocytes for Resistance to Mucosal Viral Transmission in Mice and Enhancement of Resistance by Local Administration of IL-12. J Clin Invest. Dec. 15, 1998;102(12):2072-2081. |
| Berche et al., Intracellular Growth of Listeria monocytogenes as a Prerequisite for In Vivo Induction of T Cell-Mediated Immunity. J Immunol. Apr. 1, 1987;138(7):2266-2271. |
| Bevanger et al., Competitive Enzyme Immunoassay for Antibodies to a 43,000-Molecular-Weight Francisella tularensis Outer Membrane Protein for the Diagnosis of Tularemia. J Clin Microbiol. May 1989;27(5):922-926. |
| Bhigjee et al., Sequence of the env gene of some KwaZulu-Natal, South African strains of HTLV type I. AIDS Res Hum Retroviruses. Sep. 1, 1999;15(13):1229-1233. |
| Biagini et al., Simultaneous measurement of specific serum IgG responses to five select agents. Anal Bioanal Chem. Jun. 2005;382(4):1027-1034. |
| Bishop and Hinrichs, Adoptive transfer of immunity to Listeria monocytogenes. The influence of in vitro stimulation on lymphocyte subset requirements. J Immunol. Sep. 15, 1987;139(6):2005-2009. |
| Blankenstein et al., The determinants of tumour immunogenicity. Nature reviews. Nat Rev Cancer. Mar. 1, 2012;12(4):307-313. |
| Bondurant et al., Definition of an Immunogenic RegionWithin the OvarianTumor Antigen Stratum Corneum Chymotryptic Enzyme. Clin Cancer Res. May 1, 2005;11(9):3446-3454. |
| Brezniceanu et al., HMGB1 inhibits cell death in yeast and mammalian cells and is abundantly expressed in human breast carcinoma. FASEB J. Jul. 2003;17(10):1295-1297. |
| Brian and Baric, Coronavirus Genome Structure and Replication. Curr Top Microbiol Immunol. 2005;287:1-30. |
| Brinkmann et al., Novel Genes in the PAGE and GAGE Family of Tumor Antigens Found by Homology Walking in the dbEST Database. Cancer Res. Apr. 1, 1999;59(7):1445-1448. |
| Brockstedt et al., Killed but metabolically active microbes: a new vaccine paradigm for eliciting effector T-cell responses and protective immunity. Nat Med. Aug. 2005;11(8):853-860. |
| Brockstedt et al., Listeria-based cancer vaccines that segregate immunogenicity from toxicity. Proc Natl Acad Sci U S A. Sep. 21, 2004;101(38):13832-13837. |
| Bronte et al., Genetic Vaccination with “Self” Tyrosinase-related Protein 2 Causes Melanoma Eradication but not Vitiligo. Cancer Res. Jan. 15, 2000;60(2):253-258. |
| Brown et al., Complete Genomic Sequencing Shows that Polioviruses and Members of Human Enterovirus Species C are Closely Related in the Noncapsid Coding Region. J Virol. Aug. 2003;77(16):8973-8984. |
| Brown, Variants of B19. Dev Biol (Basel). 2004;118:71-77. |
| Camilli et al., Dual roles of plcA in Listeria monocytogenes pathogenesis. Mol Microbiol. Apr. 1993;8(1):143-157. |
| Capdepont et al., New Insights in HTLV-I Phylogeny by Sequencing and Analyzing the Entire Envelope Gene. AIDS Res Hum Retroviruses. Jan. 2005;21(1):28- 42. |
| Capurro et al., Glypican-3: A Novel Serum and Histochemical Marker for Hepatocellular Carcinoma. Gastroenterology. Jul. 2003;125(1):89-97. |
| Carbone et al., New developments about the association of SV40 with human mesothelioma. Oncogene. Aug. 11, 2003;22(33):5173-5180. |
| Chan et al., In Situ Hybridization Study of PSP94 (Prostatic Secretory Protein of 94 Amino Acids) Expression in Human Prostates. Prostate. Oct. 1, 1999;41(2):99-109. |
| Chang et al., A Phase I Trial of Tumor Lysate-Pulsed Dendritic Cells in the Treatment of Advanced Cancer. Clin Cancer Res. Apr. 2002;8(4):1021-1032. |
| Chen et al., Immunodominant CD41 responses identified in a patient vaccinated with full-length NY-ESO-1 formulated with ISCOMATRIX adjuvant. Proc Natl Acad Sci USA. Jun. 22, 2004;101(25):9363-9368. |
| Chern et al., Glycoprotein B Subtyping of Cytomegalovirus (CMV) in the Vitreous of Patients with AIDS and CMV Retinitis. J Infect Dis. Oct. 1998;178(4):1149-1153. |
| Chiari et al., Two Antigens Recognized by Autologous Cytolytic T Lymphocytes on a Melanoma Result from a Single Point Mutation in an Essential Housekeeping Gene. Cancer Res. Nov. 15, 1999;59(22):5785-5792. |
| Christiansen et al., Polarity of Prostate Specific Membrane Antigen, Prostate Stem Cell Antigen, and Prostate Specific Antigen in Prostate Tissue and in a Cultured Epithelial Cell Line. Prostate. Apr. 1, 2003;55(1):9-19. |
| Clements et al., Adenomatous Polyposis Coli/β-Catenin Interaction and Downstream Targets: Altered Gene Expression in Gastrointestinal Tumors. Clin Colorectal Cancer. Aug. 2003;3(2):113-120. |
| Clifton et al., A chlamydial type III translocated protein is tyrosine-phosphorylated at the site of entry and associated with recruitment of actin. Proc Natl Acad Sci USA. Jul. 6, 2004;101(27):10166-10171. |
| Clinton et al., A Comparative Study of Four Serological Tumor Markers for the Detection of Breast Cancer. Biomed Sci Instrum. 2003;39:408-414. |
| Cobaleda et al., A primitive hematopoietic cell is the target for the leukemic transformation in human Philadelphia-positive acute lymphoblastic leukemia. Blood. Feb. 1, 2000;95(3):1007-1013. |
| Codrington et al., Analysis of ETV6/AML1 abnormalities in acute lymphoblastic leukaemia: incidence, alternative spliced forms and minimal residual disease value. Br J Haematol. Dec. 2000;111(4):1071-1079. |
| Creighton et al., Mechanisms and catalysts of disulfide bond formation in proteins. Trends Biotechnol. Jan. 1995;13(1):18-23. |
| Dalerba et al., MAGE, BAGE and GAGE gene expression in human rhabdomyosarcomas. Int J Cancer. Jul. 1, 2001;93(1):85-90. |
| Damasus-Awatai and Freeman-Wang, Human papilloma virus and cervical screening. Curr Opin Obstet Gynecol. Dec. 2003;15(6):473-477. |
| International Search Report and Written Opinion issued in PCT/US2013/068800 dated Feb. 20. 2014. |
| Lauer et al., Constitutive Activation of the PrfA Regulon Enhances the Potency of Vaccines Based on Live-Attenuated and Killed but Metabolically Active Listeria monocytogenes Strains. Infect Immun. Aug. 2008;76(8):3742-3753. |
| Lauer et al., Construction, Characterization, and Use of Two Listeria monocytogenes Site-Specific Phage Integration Vectors. J Bacteriol. Aug. 2002;184(15):4177-4186. |
| Mandali et al., The site-specific integration reaction of Listeria phage A 118 integrase, a serine recombinase. Mob DNA. Jan. 3, 2013;4(1):2 (17 pages). |
| Search Report and Written Opinion issued by IPOS in Singapore application No. 11201502770P dated Nov. 8, 2015. |
| Extended European Search Report isued in EP 13853070 dated May 20, 2016. |
| Beare et al., Two Systems for Targeted Gene Deletion in Coxiella burnetii. Appl Environ Microbiol. Jul. 2012;78(13):4580-4589. |
| Lambert et al., Cre-lox-based system for multiple gene deletions and selectable-marker removal in Lactobacillus plantarum. Appl Environ Microbiol. Feb. 2007;73(4):1126-1135. |
| Lui et al., An in vivo gene deletion system for determining temporal requirement of bacterial virulence factors. Proc Natl Acad Sci U S A. Jul. 8, 2008;105(27):9385-9390. |
| Yin et al., Protective immunity induced by a LLO-deficient Listeria monocytogenes. Microbiol lmmunol. Apr. 2010;(4):175-183. |
| Number | Date | Country | |
|---|---|---|---|
| 20140127816 A1 | May 2014 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61723234 | Nov 2012 | US |
