Patent Grant
11236367
This application is the U.S. national stage application of International Patent Application No. PCT/EP2017/062061, filed May 19, 2017.
The Sequence Listing for this application is labeled “Seq-List.txt” which was created on Oct. 16, 2018 and is 98 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.
The present invention relates to the field of the enzymology, in particular to fatty acid decarboxylase.
Alkanes and alkenes are major components of fossil fuels but they also occur naturally in plants, insects, cyanobacteria and some bacteria. Diatoms and the colonial Chlorophyceae Botryococcus braunii are also known to produce alka(e)nes with more than 21 carbons.
Most alka(e)ne biosynthetic pathways involve the conversion of activated fatty acids (acyl-ACPs or acyl-CoAs) to an aldehyde intermediate and the final decarbonylation to alka(e)ne. These reactions are catalyzed by a variety of enzymes. In plants, very long chain alkanes from 27 to 33 carbons are produced from fatty acids by the action of two homologous putative oxidoreductases ECERIFERUM1 (CER1) and ECERIFERUM3 (CER3) (Bernard et al., 2012, The Plant Cell, 24(7), 3106-18; Bourdenx et al., 2011, Plant Physiology, 156(1), 29-45). In insects, synthesis of cuticular alka(e)nes from 21 to 37 carbons involves an acyl-ester reductase and a cytochrome P450 (Qiu et al., 2012, PNAS, 109, 14858-14863). In Cyanobacteria, the pathway is composed of an acyl-ACP reductase and an aldehyde deformylating oxygenase (Li et al., 2012, Biochemistry, 51(40), 7908-16; Rude et al., 2011, Applied and Environmental Microbiology, 77(5), 1718-27). Only the bacteria Jeotgalicoccus spp and Pseudomonas sp are able to produce hydrocarbons by direct decarboxylation of free fatty acids (Grant et al 2015, Journal of the American Chemical Society, 137(15), 4940-3; Rui et al., 2014, PNAS, 111, 18237-18242; Rude et al., 2011, Applied and Environmental Microbiology, 77(5), 1718-27). However these bacterial fatty acid decarboxylases can produce alkenes (bearing terminal unsaturations) but not alkanes. In microalgae, no enzyme catalyzing the synthesis of hydrocarbons is known. Attempts have been made to purify the alkane synthesis system of the microalga Botryococcus braunii and it has been suggested that the synthesis proceeds through decarbonylation of a fatty aldehyde intermediate by a cobalt-porphyrin enzyme (Dennis & Kolattukudy, 1992, PNAS, 89(12), 5306-10). However, the protein has never been identified.
Therefore, there is still a strong need of enzymes suitable for producing alkanes/alkenes from fatty acids.
The present invention relates to the identification of a new class of enzymes for the synthesis of alkanes and alkenes, which was identified in microalgae. It is the first time that an alkane synthase is identified in these microorganisms. The enzyme catalyzes the conversion of free fatty acids into alkanes and/or alkenes by decarboxylation. The enzyme belongs to a superfamily of FAD-dependent proteins present in prokaryotes and eukaryotes (GMC (Glucose-Methanol-Choline) oxidoreductases) and which includes various enzymes (mainly alcohol oxidases). So far, no GMC oxidoreductase from microalgae has been characterized from a biochemical point of view and no other member of the GMC oxidoreductase superfamily has been identified as an alkane synthase. So this is a new enzyme for the synthesis of alkanes and alkenes with applications in biofuels, green chemistry, diagnosis and nutrition.
Accordingly, the present invention relates to the use of a polypeptide or a cell expressing said polypeptide for producing alkanes and/or alkenes from fatty acids, wherein the polypeptide has a fatty acid decarboxylase activity and comprises a sequence having at least 40% of identity with SEQ ID No 1.
Preferably, the polypeptide comprises the consensus sequence G-X-L-(X)4-C-[D/E]-X-G-[A/G]-F-X-[K/R] (SEQ ID No 4), X being any amino acid. Alternatively or in addition, one, two, three, four, five or six amino acids in positions C372, R391, Y406, Q426, H512 and N515 of SEQ ID No 1 are conserved. Alternatively or in addition, at least 40% of the amino acid residues between positions 388-428 are hydrophobic residues selected from the groups consisting of V, I, L, M, F, W, C A and Y.
In a more specific embodiment, the polypeptide comprises or essentially consists in an amino acid sequence selected from the group consisting of SEQ ID Nos 1-3 and 5-14 and amino acid sequences having at least 80% of identity with one of them.
Preferably, the polypeptide is from algae, preferably microalgae or cyanobacteria.
Preferably, the fatty acids and the corresponding decarboxylated alkanes and/or alkenes comprise from 8 to 24 carbon atoms preferably from 12 to 22 carbon atoms.
Optionally, the fatty acids and the corresponding decarboxylated alkanes and/or alkenes are substituted and/or interrupted by one or several functional groups. Preferably, the fatty acids and the corresponding decarboxylated alkanes and/or alkenes are substituted by one or several groups such as an hydroxyl, a C1-C3 alcohol, a C1-C3 acyl, a C1-C3 ester, a C1-C3 amine, an amino group, a C1-C3 amide, a carboxyl, an aldehyde, an epoxy, an halogen, a C1-C3 alkoxy, a C1-C3 thioalkyl, a C1-C3 imine, a nitrile, a sulfur group such as C1-C3 sulfone or C1-C3 sulfoxide, a thiol, a nitro, a cyano, a C1-C3 halogenoalkyl, or may be interrupted by an heteroatom such as O, N or S, an acetylenic group, an ether such as a divinyl ether group, or an oxo group.
The present invention also relates to a method for producing alkanes and/or alkenes from fatty acids, wherein a polypeptide as defined above is contacted with fatty acids and submitted to light in presence of the FAD cofactor of the polypeptide. Preferably, the light has a wavelength between 300 and 540 nm, more preferably between 400 and 520 nm. For instance, the light is a white light or any light containing blue or UV photons (e.g. from 400 to 520 nm).
The present invention further relates to a recombinant host cell comprising a nucleic acid sequence encoding a heterologous polypeptide as defined above. Preferably, the host cell is a bacterium, a microalgae, a filamentous fungus or a yeast.
In a first embodiment, the heterologous polypeptide is co-expressed with a thioesterase, preferably in a microalga, a cyanobacteria or E. coli. In another embodiment, the heterologous polypeptide is co-expressed with a lipase, preferably in a bacterium or a microalga.
The present invention relates to a method for producing alkanes and/or alkenes from fatty acids, wherein a recombinant host cell according to the present invention is cultured and the alkanes and/or alkenes were recovered.
In addition, the present invention relates to the use of a polypeptide as defined above for dosage of free fatty acids in a sample. More particularly, the method for dosing free fatty acids in a sample comprises (a) contacting the sample with a fatty acid decarboxylase of the present invention in conditions suitable for converting fatty acids into alkanes/alkenes, (b) recovering the alkanes/alkenes and/or CO2; and (c) quantifying the alkanes/alkenes and/or CO2. Alternatively, the method for dosing free fatty acids in a sample comprises (a) contacting the sample with a fatty acid decarboxylase of the present invention in conditions suitable for converting fatty acids into alkanes/alkenes, and (b) measuring the fluorescence emitted by the fatty acid decarboxylase. Optionally, the method comprises a previous step of contacting the sample with a lipase, in particular in conditions suitable for converting fatty acids into free fatty acids.
The present invention also relates to the use of a polypeptide as defined above for decarboxylation of fatty acids.
The inventors identified a new class of enzymes capable of converting free fatty acids into alkanes and alkenes by an activity of fatty acid decarboxylation.
About: When used herein, “about” means more or less 10%, preferably more or less 5%. For instance, about 100 means between 90 and 110, preferably between 95 and 105.
Coding sequence: The term “coding sequence” means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof. The genetic code can be optimized for the host cell.
Control sequences: The term “control sequences” means nucleic acid sequences necessary for expression of a polynucleotide encoding an enzyme of the present invention. Control sequences may be native (i.e., from the same gene) or heterologous (i.e., from a different gene and/or a different species) to the polynucleotide encoding the enzyme. Preferably, control sequences are heterologous. Well-known control sequences and currently used by the person skilled in the art will be preferred. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding the enzyme. The functional combination of control sequences and coding sequences can be referred as expression cassette.
Expression: The term “expression” includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term “expression vector” means a linear or circular DNA molecule that comprises a polynucleotide encoding the enzyme of the invention and is operably linked to control sequences that provide for its expression. Then the expression vector comprises an expression cassette suitable for expressing the enzyme of the invention.
Isolated: The term “isolated” means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., multiple copies of a gene encoding the substance; use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
Recombinant: Recombinant refers to a nucleic acid construct, a vector and a protein produced by genetic engineering.
Heterologous: in the context of a host cell, a vector or a nucleic acid construct, it designates a coding sequence for the enzyme introduced into the host cell, the vector or the nucleic acid construct by genetic engineering. In the context of a host cell, it means that the coding sequence for the enzyme originates from a source different from the cell in which it is introduced or that the coding sequence for the enzyme comes from the same species as the cell in which it is introduced but it is considered heterologous due to its environment which is not natural, for example because it is under the control of a promoter which is not its natural promoter, or is introduced at a location which differs from its natural location.
Nucleic acid construct: The term “nucleic acid construct” means a nucleic acid molecule, either single- or double-stranded, which is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
Operably linked: The term “operably linked” means a configuration in which a control sequence is placed at an appropriate position relative to a coding sequence, in such a way that the control sequence directs expression of the coding sequence.
Overexpress: The term overexpress means to express or cause to be expressed a nucleic acid or polypeptide in a cell at a greater concentration than is normally expressed in a corresponding wild-type cell.
Sequence identity: The sequence identity between two amino acid sequences is described by the parameter “sequence identity”. For purposes of the present invention, the “percentage identity” between two amino acid sequences (A) and (B) is determined by comparing the two sequences aligned in an optimal manner, through a window of comparison. Said alignment of sequences can be carried out by well-known methods, for example, using the algorithm for global alignment of Needleman-Wunsch. Protein analysis software matches similar sequences using measures of similarity assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. Once the total alignment is obtained, the percentage of identity can be obtained by dividing the full number of identical amino acid residues aligned by the full number of residues contained in the longest sequence between the sequence (A) and (B).
Sequence identity is typically determined using sequence analysis software. For comparing two amino acid sequences, one can use, for example, the tool “Emboss needle” for pairwise sequence alignment of proteins providing by EMBL-EBI and available on: Worldwide Web site: ebi.ac.uk/Tools/services/web/toolform.ebi?tool=emboss_needle&context=protein, using default settings: (I) Matrix: BLOSUM62, (ii) Gap open: 10, (iii) gap extend: 0.5, (iv) output format: pair, (v) end gap penalty: false, (vi) end gap open: 10, (vii) end gap extend: 0.5.
Alternatively, Sequence identity can also be typically determined using sequence analysis software Clustal Omega using the HHalign algorithm and its default settings as its core alignment engine. The algorithm is described in Söding, J. (2005) ‘Protein homology detection by HMM-HMM comparison’. Bioinformatics 21, 951-960, with the default ettings (see Worldwide Web site: ebi.ac.uk/Tools/msa/clustalo/).
Amino acids: The amino acid sequences defined herein are represented by a one-letter symbol as shown below: A, Ala, (alanine); R, Arg, (arginine); N, Asn, (asparagine); D, Asp, (aspartic acid); C, Cys, (cysteine); Q, Gln, (glutamine); E, Glu, (glutamic acid); G, Gly, (glycine); H, His, (histidine); I, Ile, (isoleucine); L, Leu, (leucine); K, Lys, (lysine); M, Met, (methionine); F, Phe, (phenylalanine); P, Pro, (proline); S, Ser, (serine); T, Thr, (threonine); W, Trp, (tryptophan); Y, Tyr, (tyrosine); and V, Val, (valine).
By “consist essentially” is intended that the polypeptide has the indicated SEQ ID No and can further comprise an alteration, i.e., a substitution, insertion, and/or deletion, of no more than 20 amino acids, preferably no more than 10 amino acids. In particular, the polypeptide may have alterations at no more than 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acids, e.g., may have substitution, insertion, and/or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position. The substitution can be a conservative substitution. Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R. L. Hill (1979, In, The Proteins, Academic Press, New York). Common substitutions are the followings Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, LeuA al, Ala/Glu, and Asp/Gly.
Alternatively, the amino acid changes are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid changes may improve the thermal stability of the polypeptide, alter the substrate specificity, change the pH optimum, and the like. Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for the capacity to produce 4-HBA from L-tyrosine to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for instance, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide.
Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; U.S. Pat. No. 5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127). Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
Conserved: By conserved amino acid is intended that a defined sequence is aligned with the reference sequence and the residue of the defined sequence corresponding the position indicated in the reference sequence is identical to the residue present in the reference sequence. The alignment can be performed by any available method, and in particular by the method disclosed for identity determination just above, more preferably by Clustal Omega. The residue position is indicated in the reference sequence.
Purify or Purified: As used herein, the term “purify,” “purified,” or “purification” means the removal or isolation of a molecule from its environment by, for example, isolation or separation. “Substantially purified” molecules are at least about 60% free, preferably at least about 75% free, and more preferably at least about 90% free from other components with which they are associated. As used herein, these terms also refer to the removal of contaminants from a sample. For example, the removal of contaminants can result in an increase in the percentage of alkanes/alkenes in a sample. For example, when alkanes/alkenes are produced in a host cell, the alkanes/alkenes can be purified by the removal of host cell proteins. After purification, the percentage of alkanes/alkenes in the sample is increased. The terms “purify,” “purified,” and “purification” do not require absolute purity. They are relative terms. Thus, for example, when olefins are produced in host cells, a purified alkane/alkene is one that is substantially separated from other cellular components (e.g., nucleic acids, polypeptides, lipids, carbohydrates, or other hydrocarbons). In another example, a purified alkanes/alkenes preparation is one in which the alkanes/alkenes is substantially free from contaminants, such as those that might be present following fermentation. In some embodiments, alkanes/alkenes is purified when at least about 50% by weight of a sample is composed of the alkanes/alkenes. In other embodiments, an olefin is purified when at least about 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, or 99% or more by weight of a sample is composed of the alkanes/alkenes.
Fatty Acid Decarboxylase Activity:
By “fatty acid decarboxylase activity” is referred to the removal of the carboxylic acid group from fatty acid, in particular the direct removal without an aldehyde intermediate and without introducing a terminal unsaturation. The fatty acid decarboxylase activity can be measured by any method available to the skilled person. More preferably, the activity can be measured by the following method.
In vitro enzymatic assays, reactions are performed in sealed vials containing 100 nmoles of substrate (typically C16:0 free fatty acid) dissolved in the appropriate solvent (ethanol or dimethyl sulfoxide), 2 nmoles of C16 alkane as internal standard, and 5 to 10 μg of purified enzyme (containing its FAD cofactor) with 500 μL of the activity buffer (50 mM Tris-HCl pH 8.2 with 100 mM NaCl), or a total protein extract. Vials are incubated at 25° C. in the presence of white light (or any light containing blue photons) at 2000 μmole.photon.m−2·s−1 on a rotating agitator at 250 rpm. Concentrated sodium hydroxide (10 μL at 10 M) is then injected into the vial to stop the reaction and the samples are cooled down on ice. Hydrocarbons are extracted with hexane and quantified by gas chromatography coupled to flame ionization detector and mass spectrometry (GC-FID-MS).
Fatty Acid Decarboxylase Polypeptide:
The present invention relates to a polypeptide having a fatty acid decarboxylase activity, called herein “fatty acid decarboxylase”, and comprising, essentially consisting in or consisting in a sequence having at least 40% of identity with SEQ ID No 1, SEQ ID No 5 or SEQ ID No 7, preferably SEQ ID No 1.
For instance, the fatty acid decarboxylase comprises, essentially consists in or consists in a sequence having at least 42%, 45%, 50% or 55% of identity with SEQ ID No 1, SEQ ID No 5 or SEQ ID No 7, preferably SEQ ID No 1.
In another aspect, the fatty acid decarboxylase comprises, essentially consists in or consists in a sequence at least 55, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99% of identity with any of the SEQ ID Nos 1-3 and 5-14.
In a further aspect, the fatty acid decarboxylase comprises, essentially consists in or consists in the sequence of any of the SEQ ID Nos 1-3 and 5-14. In a preferred embodiment, the fatty acid decarboxylase comprises, essentially consists in or consists in the sequence of any of the SEQ ID Nos 1, 5, 7-14, more preferably any of the SEQ ID Nos 1, 5, and 7.
In an embodiment, the fatty acid decarboxylase comprises the consensus sequence G-X1-L-(X)4-C-[D/E]-X2-G-[A/G]-F-X3-[K/R/S/E] (SEQ ID No 4), X being any amino acid (SEQ ID No 26). In a preferred embodiment, the fatty acid decarboxylase comprises the consensus sequence G-X1-L-(X)4-C-[D/E]-X2-G-[A/G]-F-X3-[K/R] (SEQ ID No 4), X being any amino acid.
Preferably, X1 can be selected from the group consisting of P, L and G. Preferably, (X)4 can be more specifically [T/A]-[T/S/C]-[P/T/A]-[G/A]. Preferably, X2 can be selected from the group consisting of H, N and R. Preferably, X3 can be a hydrophobic amino acid, especially selected from the group consisting of L, V A and F.
In a specific embodiment, the fatty acid decarboxylase comprises the consensus sequence G-X1-L-(X)4-C-[D/E]-X2-G-[A/G]-F-X3-[K/R/S/E] (SEQ ID No 26), wherein
In a very specific embodiment, the fatty acid decarboxylase comprises the consensus sequence G-X1-L-(X)4-C-[D/E]-X2-G-[A/G]-F-X3-[K/R] (SEQ ID No 4), wherein
In another or additional preferred embodiment, the fatty acid decarboxylase comprises conserved amino acids with reference to SEQ ID No 1. Based on the reference sequence of SEQ ID No 1, one, two, three, four, five or all of the residues C372, R391, Y406, Q426, H512 and N515 of SEQ ID No 1 are conserved. The same can be true for the corresponding residue at the positions in another fatty acid decarboxylase corresponding to these positions in SEQ ID No 1.
In another or additional preferred embodiment, the fatty acid decarboxylase comprises a region forming a hydrophobic tunnel in which the substrate, the free fatty acid, could enter. This region is located between residues from positions 391 to 426 in SEQ ID No 1. Accordingly, at least 40% of the amino acid residues between positions 388-428 are hydrophobic residues, preferably selected from the groups consisting of V, I, L, M, F, W, C A and Y.
The fatty acid decarboxylase is any origin such as from bacteria or algae.
Preferably, the fatty acid decarboxylase is from algae, preferably microalgae or cyanobacteria. For instance, the fatty acid decarboxylase is a GMC oxidoreductase having a fatty acid decarboxylase activity from Chlorella, Chlamydomonas, Phaeodactylum, Coccomyxa, Volvox, Ectocarpus, Emiliania, Aureococcus, Chondrus, Galdieria or Nannochloropsis. A lot of species of microalgae are known and can be found for instance on the database AlgaeBase (see Worldwide Web site: algaebase.org/).
In a particular embodiment, the fatty acid decarboxylase is from Chlorella variabilis, in particular Chlorella variabilis NC64A. In another particular embodiment, the fatty acid decarboxylase is from Chlamydomonas reinhardtii. In another particular embodiment, the fatty acid decarboxylase is from Phaeodactylum tricornutum. In another particular embodiment, the fatty acid decarboxylase is from Coccomyxa subellipsoidea, in particular Coccomyxa subellipsoidea C-169. In another particular embodiment, the fatty acid decarboxylase is from Volvox carteri. In another particular embodiment, the fatty acid decarboxylase is from Ectocarpus siliculosus. In another particular embodiment, the fatty acid decarboxylase is from Emiliania huxleyi. In another particular embodiment, the fatty acid decarboxylase is from Aureococcus anophagefferens. In another particular embodiment, the fatty acid decarboxylase is from Nannochloropsis gaditana.
Preferably, the fatty acid decarboxylase has no more than about 750, 700, 650, or 600 amino acid residues in length.
The present invention also relates to a hybrid polypeptide or fusion polypeptide in which the amino acid sequence of the fatty acid decarboxylase as defined above is fused at the N-terminus or the C-terminus of a region of another polypeptide. The fatty acid decarboxylase activity remains in the hybrid polypeptide or fusion polypeptide. Preferably, the region of another polypeptide is fused at the N-terminus of the fatty acid decarboxylase. Alternatively, the region of another polypeptide is fused at the C-terminus of the fatty acid decarboxylase. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the enzyme and the addition region of another polypeptide so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
The addition region of the fusion polypeptide can be selected in order to enhance the stability of the enzyme according to the present disclosure, to promote the secretion (such as a N-terminal hydrophobic signal peptide) of the fusion protein from a cell (such as a bacterial cell or a yeast cell), or to assist in the purification of the fusion protein. More particularly, the additional region can be a tag useful for purification or immobilization of the enzyme. Such a tag is well-known by the person skilled in the art, for instance a His tag (His6), a FLAG tag, a HA tag (epitope derived from the Influenza protein haemagglutinin), a maltose-binding protein (MPB), a MYC tag (epitope derived from the human proto-oncoprotein MYC), a STREP tag or a GST tag (small glutathione-S-transferase). The additional region can be the thioredoxin.
A fusion polypeptide can further comprise a cleavage site between the enzyme and the addition region. Upon secretion or purification of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48. For instance, the cleavage site can be a TEV (Tobacco Etch Virus) cleavage site. Other cleavage sites are well-known by the person skilled in the art.
In a particular embodiment, the present invention relates to a polypeptide comprising an histidine tag, a thioredoxin, a cleavage site and the fatty acid decarboxylase as defined above (e.g. see SEQ ID No 3 for such a construction with Chlorella fatty acid decarboxylase).
The present invention further relates to a recombinant nucleic acid construct or vector comprising a nucleic acid sequence encoding the fatty acid decarboxylase as defined above. More particularly, the nucleic acid construct or vector is suitable for expressing said fatty acid decarboxylase. In addition, it is provided a recombinant host cell comprising a nucleic acid, a recombinant nucleic acid construct or a recombinant vector comprising a nucleic acid sequence encoding the fatty acid decarboxylase as defined above.
Nucleic Acids Encoding Fatty Acid Decarboxylase and Nucleic Acid Constructs
The present invention relates to a polynucleotide encoding a fatty acid decarboxylase of the present invention. The nucleic acid can be DNA (cDNA or gDNA), RNA, or a mixture of the two. It can be in single stranded form or in duplex form or a mixture of the two. It can comprise modified nucleotides, comprising for example a modified bond, a modified purine or pyrimidine base, or a modified sugar. It can be prepared by any method known to one skilled in the art, including chemical synthesis, recombination, and mutagenesis.
Optionally, the encoding sequence can be optimized for the host cell expression. In particular, as the fatty acid decarboxylases of the present invention are from algae, in particular microalgae, the nucleic acid sequence encoding the enzyme can be optimized for a bacterial host, such as E. coli, a yeast host or even a microalga which is different from the one from which the enzyme originates.
The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a fatty acid decarboxylase according to the present disclosure operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. A polynucleotide may be manipulated in a variety of ways to provide for expression of the fatty acid decarboxylase. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may include a promoter that is recognized by a host cell or an in vitro expression system for expression of a polynucleotide encoding a fatty acid decarboxylase of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the fatty acid decarboxylase. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. Optionally, the promoter can be inducible. Optionally, the promoter is a strong promoter allowing the overexpression of the fatty acid decarboxylase. Optionally, the promoter is a strong inducible promoter.
Examples of suitable promoters in a bacterial host cell are the promoters obtained from the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis cryl11A gene (Agaisse and Lereclus, 1994, Molecular Microbiology 13: 97-107), E. coli lac operon, E. coli trc promoter (Egon et al., 1988, Gene 69: 301-315), Streptomyces coelicolor agarase gene (dagA), and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25). Further promoters are described in “Useful proteins from recombinant bacteria” in Gilbert et al., 1980, Scientific American 242: 74-94; and in Sambrook et al., 1989. Examples of tandem promoters are disclosed in WO 99/43835.
Examples of suitable promoters in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene; and mutant, truncated, and hybrid promoters thereof.
In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
An inducible promoter can be responsive to, e.g., light intensity or high or low temperature, and/or can be responsive to specific compounds. The inducible promoter may be, for example, a hormone-responsive promoter (e.g., an ecdysone-responsive promoter, such as described in U.S. Pat. No. 6,379,945), a metallothionien promoter (U.S. Pat. No. 6,410,828), a pathogenesis-related (PR) promoter that can be responsive to a chemical such as, for example, salicylic acid, ethylene, thiamine, and/or BTH (U.S. Pat. No. 5,689,044), or the like, or some combination thereof. An inducible promoter can also be responsive to light or dark (U.S. Pat. Nos. 8,318,482; 5,750,385; 5,639,952), metals (Eukaryotic Cell 2:995-1002 (2003)) or temperature (U.S. Pat. No. 5,447,858; Abe et al. Plant Cell Physiol. 49: 625-632 (2008); Shroda et al. Plant J. 21: 121-131 (2000). The foregoing examples are not limiting as to the types of promoters or specific promoters that may be used. The promoter sequence can be from any organism, provided that it is functional in the host organism. In certain embodiments, inducible promoters are formed by fusing one or more portions or domains from a known inducible promoter to at least a portion of a different promoter that can operate in the host cell, e.g. to confer inducibility on a promoter that operates in the host species.
One skilled in the art will readily appreciate that a variety of known promoter sequences can be usefully deployed for microalgal species. For example, the promoters commonly used to drive transgene expression in microalgae include various versions of the of cauliflower mosaic virus promoter 35S (CaMV35S), which has been used in both dinoflagellates and chlorophyta (Chow et al, Plant Cell Rep., 18:778-780, 1999; Jarvis and Brown, Curr. Genet., 317-321, 1991; Lohuis and Miller, Plant J., 13:427-435, 1998). The SV40 promoter from simian virus has also reported to be active in several algae (Gan et al., J. Appl. Phycol., 151 345-349, 2003; Qin et al, Hydrobiologia 398-399, 469-472, 1999). The promoters of RBCS2 (ribulose bisphosphate carboxylase, small subunit) (Fuhrmann et al, Plant J., 19:353-361, 1999) and PsaD (abundant protein of photosystem I complex; Fischer and Rochaix, FEBS Lett. 581:5555-5560, 2001) from Chlamydomonas can also be useful. The fusion promoters of HSP70A/RBCS2 and HSP70A/p2TUB (tubulin) (Schroda et al, Plant J., 21: 121-131, 2000) can also be useful for an improved expression of transgenes, in which HSP70A promoter may serve as a transcriptional activator when placed upstream of other promoters. High-level expression of a gene of interest can also be achieved in, for example diatoms species, under the control of a promoter of an fcp gene encoding a diatom fucoxanthin-chlorophyll a/b binding protein (Falciatore et al, Mar. Biotechnol, 1:239-251, 1999; Zaslayskaia et al, J. Phycol. 36:379-386, 2000) or the vcp gene encoding a eustigmatophyte violaxanthin-chlorophyll a/b binding protein (see U.S. Pat. No. 8,318,482). If so desired, inducible promoters can provide rapid and tightly controlled expression of genes in transgenic microalgae. For example, promoter regions of the NR genes encoding nitrate reductase can be used as such inducible promoters. The NR promoter activity is typically suppressed by ammonium and induced when ammonium is replaced by nitrate (Poulsen and Kroger, FEBS Lett 272:3413-3423, 2005), thus gene expression can be switched off or on when microalgal cells are grown in the presence of ammonium/nitrate. Various algal promoters are known and can be used, including those disclosed in US 2013/0023035; US 2013-0323780, US 2014-0154806; and US 2014-0363892.
The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3′-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alkaline protease (aprH), Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).
Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
The control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
Examples of suitable mRNA stabilizer regions are obtained from a Bacillus thuringiensis cryl11A gene (WO 94/25612) and a Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177: 3465-3471).
The control sequence may also be a leader, a non-translated region of an mRNA that is important for translation by the host cell. The leader is operably linked to the 5′-terminus of the polynucleotide encoding the fatty acid decarboxylase. Any leader that is functional in the host cell may be used.
Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3′-terminus of the polynucleotide encoding the fatty acid decarboxylase and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.
The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of the fatty acid decarboxylase and directs the fatty acid decarboxylase into the cell's secretory pathway. The 5′-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the fatty acid decarboxylase. Alternatively, the 5′-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used. The signal peptide can also be a chloroplast transit peptide, the chloroplast transit peptide of the fatty acid decarboxylase or any other chloroplast transit peptide.
Effective signal peptide coding sequences for bacterial host cells are the signal peptide coding sequences obtained from the genes for Bacillus NCIB 1 1837 maltogenic amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus alpha-amylase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.
It may also be desirable to add regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide would be operably linked with the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a nucleic acid construct as disclosed above, or a polynucleotide encoding a fatty acid decarboxylase of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the fatty acid decarboxylase at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extra-chromosomal element, a mini-chromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.
The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophy, and the like.
Examples of bacterial selectable markers are Bacillus licheniformis or Bacillus subtilis genes or markers that confer antibiotic resistance such as ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5′-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus gene.
The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
When integration into the host cell genome occurs, integration of the sequences into the genome may rely on homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term “origin of replication” or “plasmid replicator” means a polynucleotide that enables a plasmid or vector to replicate in vivo. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUB1 10, pE194, pTA1060, and pAMβ1 permitting replication in Bacillus. Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6. Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).
Host Cells
The present invention relates to a recombinant host cell expressing a fatty acid decarboxylase of the present invention, more specifically a recombinant host cell engineered to produce alkanes/alkenes. The recombinant host cell may express an endogenous fatty acid decarboxylase but with an overexpression thereof (for instance by controlling the expression by a strong heterologous promoter and/or by increasing the gene number encoding the fatty acid decarboxylase in the cell). Alternatively, the recombinant host cell may express a heterologous fatty acid decarboxylase of the present invention. In addition or in another alternative, the recombinant host cell has been genetically engineered to increase the production of fatty acids or favoring the production of preferential fatty acids. For instance, the host cell can be a bacterium (including a photosynthetic bacterium), a filamentous fungus, a yeast or a microalga from a different species than the one from which originates the fatty acid decarboxylase.
Accordingly, the present invention relates to recombinant host cells comprising a polynucleotide encoding a fatty acid decarboxylase according to the present disclosure operably linked to one or more control sequences that direct the production of the fatty acid decarboxylase of the present invention. A construct or vector comprising a polynucleotide encoding a fatty acid decarboxylase according to the present disclosure is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.
The term “host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
The host cell may be any cell useful in the recombinant production of a fatty acid decarboxylase of the present invention, e.g., a prokaryote or a eukaryote.
The prokaryotic host cell may be any Gram-positive or Gram-negative bacterium. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to, Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma. The bacterial host cell may be any Bacillus cell including, but not limited to, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells. The bacterial host cell may also be any Streptococcus cell including, but not limited to, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, Streptococcus equi and Streptococcus zooepidemicus cells. The bacterial host cell may further be any Streptomyces cell including, but not limited to, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells. In a particular embodiment, the host cell is a cyanobacteria. Cyanobacteriae include, but are not limited to, species of the genera Synechococcus, Synechocystis, Anabaena, Spirulina.
The introduction of DNA into a Bacillus cell may be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), competent cell transformation (see, e.g., Young and Spizizen, 1961, J. Bacteriol. 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol. 169: 5271-5278). The introduction of DNA into an E. coli cell may be effected by protoplast transformation (see, e.g., Hanahan, 1983, J. Mol. Biol. 166: 557-580) or electroporation (see, e.g., Dower et al, 1988, Nucleic Acids Res. 16: 6127-6145). The introduction of DNA into a Streptomyces cell may be effected by protoplast transformation, electroporation (see, e.g., Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), conjugation (see, e.g., Mazodier et al., 1989, J. Bacteriol. 171: 3583-3585), or transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98: 6289-6294). The introduction of DNA into a Pseudomonas cell may be effected by electroporation (see, e.g., Choi et al., 2006, J. Microbiol. Methods 64: 391-397) or conjugation (see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71: 51-57). The introduction of DNA into a Streptococcus cell may be effected by natural competence (see, e.g., Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), protoplast transformation (see, e.g., Catt and Jollick, 1991, Microbios 68: 189-207), electroporation (see, e.g., Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or conjugation (see, e.g., Clewell, 1981, Microbiol. Rev. 45: 409-436). However, any method known in the art for introducing DNA into a host cell can be used.
The host cell may also be a eukaryote, such as a mammalian, insect, plant, or fungal cell. The host cell may be a fungal cell. “Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK). The fungal host cell may be a yeast cell. “Yeast” as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980). The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell. The fungal host cell may be a filamentous fungal cell. “Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell. For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosurn, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenurn, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianurn, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
The cell can also be a mammalian cell, for example COS, CHO (U.S. Pat. Nos. 4,889,803; 5,047,335). In a particular embodiment, the cell is non-human and non-embryonic. In addition, the fatty acid decarboxylase of the invention could be produce by a non-human transgenic animal, for instance in the milk produces by the animal.
Algal species suitable for the method of the invention include microalgae such as, for example, species of the genera Achnanthes, Amphiprora, Amphora, Ankistrodesmus, Asteromonas, Aurantiochytrium, Boekelovia, Bolidomonas, Borodinella, Botrydium, Botryococcus, Bracteococcus, Chaetoceros, Carteria, Chlamydomonas, Chlorococcum, Chlorogonium, Chlorella, Chroomonas, Chrysosphaera, Cricosphaera, Crypthecodinium, Cryptomonas, Cyclotella, Desmodesmus, Dunaliella, Elipsoidon, Emiliania, Eudorina, Eremosphaera, Ernodesmius, Euglena, Eustigmatos, Franceia, Fragilaria, Fragilaropsis, Gloeothamnion, Gonium, Haematococcus, Hantzschia, Heterosigma, Hymenomonas, Isochrysis, Lepocinclis, Lobosphaera, Micr actinium, Micrasterias, Monodus, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Ochromonas, Oedogonium, Oocystis, Ostreococcus, Pandorina, Parachlorella, Parietochloris, Parietichytrium, Pascheria, Pavlova, Pelagomonas, Phaiodactylum, Phagus, Picochlorum, Platymonas, Pleurochrysis, Pleurococcus, Prototheca, Pseudochlorella, Pseudochoricystis, Pseudoneochloris, Pseudostaurastrum, Pyramimonas, Pyrobotrys, Scenedesmus, Schizochlamydella, Schizochytrium, Skeletonema, Spyrogyra, Stichococcus, Tetrachlorella, Tetraselmis, Thalassiosira, Thrautochytrium, Tribonema, Ulva, Vaucheria, Viridiella, Vischeria, and Volvox. Non-limiting examples of particularly suitable species include, for instance, diatoms such as, for example, a species of any of the genera Amphora, Chaetoceros, Cyclotella, Cylindrotheca, Fistulifera, Fragilaria, Fragilaropsis, Navicula, Nitzschia, Phaeodactylum, Pseudo-nitzia, or Thalassiosira, or eustigmatophytes, e.g., Eustigmatos, Monodus, Nannochloropsis, or Vischeria.
More specifically, microalgae that may be used include, but are not limited to, Achnanthes orientalis, Agmenellum, Amphiprora hyaline, Amphora cojfeiformis, Amphora cojfeiformis linea, A mphora coffeijbrmis punctata, Amphora cojfeiformis taylori. Amphora cojfeiformis tenuis, Amphora delicatissima. Amphora delicatissima capitaia, Amphora sp., Anahaena, Anabaena variabilis, Ankistrodesrnus, Ankistrodesrnus jalcatus, Boekelovia hooglandii, Borodinella sp., Botryococciis braunii, Botryococcus sudeiicus, Bracteococcus minor, Bracteococcus medionucleatus, Carteria, Chaetoceros gracilis, Chaetoceros muelleri, Chaetoceros muelleri suhsalsum, Chaetoceros sp., Chlamydomonas reinhardtii, Chlamydomonase moewusi, Chlamydomonas nivalis, Chlamydomonas caudate. Chlorella anitrata, Chlorella antarctica, Chlorella aureoviridis, Chlorella Candida, Chlorella capsulate, Chlorella desiccate, Chlorella ellipsoidea, Chlorella emersonii, Chlorella fusca, Chlorella fusca var. vacuolata, Chlorella glucotropha, Chlorella infusionum, Chlorella infusionum var. actophila, Chlorella in fusionurn var. auxenophila, Chlorella kessleri, Chlorella lobophora (strain SAG 37.88), Chlorella luteoviriais, Chlorella luteoviridis var. aureoviridis. Chlorella luteoviridis var. lutescens, Chlorella miniata, Chlorella minutissima, Chlorella mutabilis, Chlorella nocturna, Chlorella ova lis, Chlorella parva, Chlorella photophila, Chlorella pringsheimii, Chlorella protothecoides var. acidicola, Chlorella regularis, Chlorella regularis var. minima, Chlorella regularis var. umhricata, Chloreila reisiglii, Chlorella saccharophila, Chlorella saccharophila var. ellipsoidea. Chlorella salina, Chlorella simplex. Chlorella sorokiniana, Chlorella sp., Chlorella sphaerica. Chlorella stigmaiophora, Chlorella variabilis, Chlorella vanniellii, Chlorella vulgaris, Chlorella vulgaris f. tenia, Chlorella vulgaris var. autotrophica, Chlorella vulgaris var. viridis, Chlorella vulgaris var. vulgaris, Chlorella vulgaris var. vulgaris f. tertia, Chlorella vulgaris var. vulgaris f. viridis, Chlorella xanthella, Chlorella zojingiensis, Chlorella trehouxioides, Chlorella vulgaris, Chlorococcum infusionum, Chlorococcum sp., Chlorogonium, Chroomonas sp., Chrysosphaera sp., Coccomyxa suhellipsoidea C-169, Cricosphaera sp., Crypihecodinium cohnii. Cryptomonas sp., Cyclotella cryptica, Cyclotella meneghiniana, Cyclotella sp., Dunaiiella sp., Dimaliella bardawil, Dunaiiella hioculata, Dunaiiella granulate, Dunaiiella maritime, Dunaiiella minuta, Dunaiiella parva, Dunaiiella peircei, Dunaliella primolecta, Dunaliella saiina, Dimaliella terricola, Dunaliella tertiolecta, Dimaliella viridis, Dunaliella tertiolecta, Eremosphaera viridis, Eremosphaera sp., Ellipsoidon sp. Euglena. Franceia sp., Fragilaria crotonensis, Fragilaria sp., Gleocapsa sp., Gloeothamnion sp., Haematococcus plwialis, Hymenomonas sp., Isochrysis affgalhana, Isochrysis galbana, Lepocinclis, Micr actinium, Micr actinium, Micromonas, Micromonas pusilla, Monoraphidium minuium, Monoraphiaium sp., Nannochloris sp., Nannochloropsis saiina, Nannochloropsis sp., Navicula acceptata, Navicula hiskanterae, Navicula pseudotenelloides, Navicula pelliculosa, Navicula saprophila, Navicula sp., Nephrochloris sp., Nephroselrnis sp., Nitschia communis, Nitzschia alexandfjna, Nitzschia communis, Nitzschia dissipata, Nitzschia frustulum, Nitzschia hantzschiana. Nitzschia inconspicua, Nitzschia intermedia, Nitzschia microcephalia, Nitzschia pusilla, Nitzschia pusilla elliptica, Nitzschia pusilla monoensis, Nitzschia quadrangular, Nitzschia sp., Nostoc sp., Nostoc Pimctiforme, Ochromonas sp., Oocystis parva, Oocystis pusilla, Oocystis sp., Osc Ilatoria limnetica, Oscillatoria sp., Oscillatoria suborevis, Osterococcus, Osterococcus lucimariniis, Osterococcus tauri, Parachlorella kessleri, Pascheria acidophila, Pavlova sp., Phagus, Phaaodactylum tricornuturn, Pnormidium, Piaiymonas sp., Pleurochrysis carter ae, Pleurochrysis dentate, Pleurochrysis sp., Prochlorococcus marinus, Prototheca wickerhamii, Prototheca stagnant, Prototheca portoricensis, Prototheca moirforrms, Prototheca zopfii, Pseudochlorella aquatica, Pyramirnorias sp., Pyroboirys, Rhodococcus opacus. Sarcinoid chrysophyte, Scenedesmus armatus, Scynechocystis sp., Scynechococcus, Schizochytrim, Spirogyra, Spirulina platen sis, Stichococcus sp., Synechococcus sp., Tetraedron, Thalassiosira pseudonana, Tetraselmis sp., Tetraselmis suecica, Thalassiosira weissflogii, Viridiella fridericiana, and Volvox carteri. In some embodiments, members of the genus Nannochloropsis are selected amoung N. gaditana, N. granulata, N. limnetica, N. oceanica, N. oculata, and N. salina.
Algal species suitable for the method of the invention also include, but are not limited to, algae species of the genera Rhodophyta such as Cyanidioschyzon, Gracilaria, Kappaphycus, Porphyridium, and Porphyra; Charophyta such as Closterium and Penium; Chlorophyta such as Eudorina, Gonium, Haematococcus, Lobosphaera, Micrasterias, Ostreococcus, Pandorina, Parachlorella, Platymonas, Pseudochoricystis, Scenedesmus, Ulva, and Volvox; Phaeophyta such as Laminaria.
The host cell can also be selected among species of the genera Dinophyta such as Amphidinium and Symbiodinium; Chlorarachniophyta such as Lotharella; Euglenozoa such as Euglena.
According to the present invention, alkanes/alkenes having particular branching patterns, levels of saturation, and carbon chain length can be produced from fatty acid substrates having those particular characteristics with the fatty acid decarboxylase of the invention. Accordingly, each step within a fatty acid biosynthetic pathway can be modified to produce or overproduce a fatty acid substrate of interest. For example, known genes involved in the fatty acid biosynthetic pathway can be expressed, overexpressed, or attenuated in host cells to produce a desired fatty acid substrate (see, for instance WO08/119082, U.S. Pat. No. 8,183,028). Exemplary genes are provided in FIG. 1 of WO08/119082 or in Table 1 and col 25-30 of U.S. Pat. No. 8,183,028 (the disclosure being incorporated herein by reference).
Then, the host cell can be modified for increasing or directing the lipid production and/or fatty acid production. The modified host cell can be selected for its capacity to produce free fatty acids or a particular profile of free fatty acids, for instance after random mutagenesis, or can be prepared by genetic engineering by introducing new genes or increasing the expression of some genes (genes involved in the free fatty acids anabolism) and/or by deleting other genes or reducing their expression (genes involved in the free fatty acids catabolism). In addition, the host cell can be modified in order to increase the production of preferential fatty acids and decrease the production of unwanted fatty acids.
For example, for production of lipid, a host cell (such as but not limited to an algal or heterokont host cell) can optionally include one or more non-native genes encoding polypeptides that functions in lipid biosynthesis, including, but not limited to, polypeptides that encode enzymes for the production of fatty acids, fatty acid derivatives, and/or glycerolipids including, but not limited to, diacylglycerol acyltransferase (DGAT) gene, a glycerolphosphate acyltransferase (GPAT) gene, a lysophosphatidic acid acyltransferase (dehydrogenase) (LPAAT) gene, a phosphatidic acid phosphatase (PAP) gene, and/or a monoacylglycerol acyltransferase (MGAT) gene.
In a preferred embodiment, the host cell has been modified for expressing or overexpressing a lipase. A lipase hydrolyses an acyl-lipid (such as a triglyceride or a glycerophospholipid or a glycerogalactolipid) for producing free fatty acids and glycerol. Preferably, the lipase will be a lipolytic enzyme with a broad triacylglycerol, phospholipase and galactolipase activity. Examples include the guinea pig pancreatic lipase-related protein type 2, the Fusarium cutinase or the Staphylococcus hyicus lipase (Liu et al. 2011, PNAS 108:6905). In a preferred embodiment, the host cell is bacterial and expresses, preferably overexpresses, a lipase. Accordingly, one object of the present invention is a recombinant host cell expressing, preferably overexpressing, a fatty acid decarboxylase of the present invention and a lipase, one of them or both being heterologous to the host cell. In a preferred embodiment, the host cell is bacterial.
In a preferred embodiment, the host cell has been engineered to express, overexpress or attenuate expression of a thioesterase to increase fatty acid production or favor the production of preferential fatty acids. Preferably, the host cell has been modified for expressing or overexpressing a thioesterase. Accordingly, one object of the present invention is a recombinant host cell expressing, preferably overexpressing, a fatty acid decarboxylase of the present invention and a thioesterase, one of them or both being heterologous to the host cell. In a preferred embodiment, the host cell is a microalga or a cyanobacterium.
By terminating fatty acid biosynthesis, the acyl-acyl carrier protein (ACP) thioesterase functionally determines the length and identity of the fatty acid end product (Salas et al., (2002) Archives of Biochemistry and Biophysics 403: 25-34). Based on amino acid sequence alignments, the plant thioesterases have been shown to cluster into two families, FatAs, which show marked preference for 18:1-ACP with minor activity towards 18:0- and 16:0-ACPs; and FatBs, which hydrolyze primarily saturated acyl-ACPs with chain lengths that vary between 8-16 carbons (Voelker, In Genetic Engineering Volume 18. Edited by: Setlow J K. New York, Plenum Press; 1996: 111-133; Ginalski, et al., Nucl Acids Res (2003) 31:3291-3292; and Jones, et al, (1995) Plant Cell 7: 359-371).
The thioesterase belongs to the enzyme from EC 3.1.2, more particularly from EC 3.1.2.2 (Palmitoyl-CoA hydrolase), EC 3.1.2.14 (Oleoyl-[acyl-carrier-protein] hydrolase), EC 3.1.2.18 (ADP-dependent short-chain-acyl-CoA hydrolase), EC 3.1.2.19 (ADP-dependent medium-chain-acyl-CoA hydrolase), EC 3.1.2.20, EC 3.1.2.21 (Dodecanoyl-[acyl-carrier-protein] hydrolase), EC 3.1.2.22 (Palmitoyl-protein hydrolase).
Examples of thioesterase have been disclosed in WO14120829, and WO16044779. They also include an Escherichia coli thioesterase encoded by tesB (see GenBank Accession No. AAA24665.1), a Lactobacillus brevis thioesterase (GenBank Accession No. ABJ63754.1), and a Lactobacillus plantarum esterase (GenBank Accession No. CCC78182.1). Another example of thioesterase from plant suitable for preparing medium chain fatty acid is disclosed in Radakovits et al, 2011, Metabolic Engineering 13(1):89-95.
In a preferred embodiment, the thioesterase is chosen for favoring short and medium chain fatty acids.
In a particular aspect of the present invention, it is also provided a method for producing a fatty acid decarboxylase according to the present invention, comprising culturing the host cell as defined above, under conditions conducive to the production of the fatty acid decarboxylase, and recovering and/or purifying the fatty acid decarboxylase. Alternatively, it is also provided a method for producing a fatty acid decarboxylase according to the present invention, comprising the in vitro expression of the fatty acid decarboxylase with a nucleic acid encoding the fatty acid decarboxylase as defined above. Optionally, the method further comprises a step of immobilizing the fatty acid decarboxylase on a solid support.
The enzyme may be recovered using methods known in the art. For example, the enzyme may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
The enzyme may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides. In an alternative aspect, the enzyme is not recovered, but rather a host cell of the present invention expressing the enzyme is used as a source of the enzyme.
Use for Producing Alkanes/Alkenes
The present invention also relates to the use of a fatty acid decarboxylase as defined above, or solid support comprising the fatty acid decarboxylase, or a recombinant host cell comprising a nucleic acid, a recombinant nucleic acid construct or a recombinant vector comprising a nucleic acid sequence encoding the fatty acid decarboxylase as defined above, for producing alkanes/alkenes from fatty acids.
Fatty Acid Substrates:
The alkanes/alkenes are produced by the enzyme according to the present invention from fatty acids. Especially, the fatty acids are free fatty acids comprising an aliphatic chain or a branched chain and a carboxyl acid group. They can be saturated or unsaturated. They can be monounsaturated or polyunsaturated. They may comprise from 2 to 36 carbon atoms. Generally, the fatty acids are classified into four groups based on the length of the aliphatic chain: (1) Short-chain fatty acids (SCFA) are fatty acids with aliphatic tails of fewer than six carbons (e.g. butyric acid): (2) Medium-chain fatty acids (MCFA) are fatty acids with aliphatic tails of 6-12 carbons, which can be found in medium-chain triglycerides; (3) Long-chain fatty acids (LCFA) are fatty acids with aliphatic tails 13 to 21; (4) Very long chain fatty acids (VLCFA) are fatty acids with aliphatic tails longer than 22 carbons. The present invention is highly relevant for the MCFA and LCFA, more specifically for the LCFA. In a preferred embodiment, the fatty acids comprise from 8 or 10 to 24 carbon atoms preferably from 12 to 22 carbon atoms. In some embodiments, the fatty acid substrate is a C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 or C22 fatty acid, preferably a C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 or C22 fatty acid, still more preferably a C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 or C22 fatty acid. More preferably, the fatty acid comprises from 8 to 20 carbon atoms preferably from 12 to 18 carbon atoms, still more preferably from 14 to 18 carbon atoms, and even more preferably from 16 or 17 carbon atoms. In a specific aspect, the fatty acid substrate is a C12, C13, C14, C15, C16, C17, C18, C19, C20, or C21 fatty acid, preferably a C12, C13, C14, C15, C16, C17, C18, or C19 fatty acid, still more preferably a C12, C14, C16, C17, or C18, fatty acid. The aliphatic chain can be straight, branched or even include a cyclic moiety.
In a particular embodiment, the fatty acid comprise a branched chain. The branched chain may include a main chain with substitutions by C1-C3 alkyl group, preferably by methyl. In particular, the fatty acid may be a terpenoid fatty acids such as phytanic acid and pristanic acid.
In addition, the aliphatic chain of the fatty acid may be substituted by one or several groups such as an hydroxyl, a C1-C3 alcohol, a C1-C3 acyl, a C1-C3 ester, a C1-C3 amine, an amino group, a C1-C3 amide, a carboxyl, an aldehyde, an epoxy, an halogen, a C1-C3 alkoxy, a C1-C3 thioalkyl, a C1-C3 imine, a nitrile, a sulfur group such as C1-C3 sulfone or C1-C3 sulfoxide, a thiol, a nitro, a cyano, a C1-C3 halogenoalkyl, or may be interrupted by an heteroatom such as O, N or S, an acetylenic group, an ether such as a divinyl ether group, or an oxo group. Preferably, the aliphatic chain of the fatty acid may be substituted by one or several groups such as an hydroxyl, a carboxyl, an epoxy, an halogen, a thiol, or a nitrile, or may be interrupted by a S atom, an acetylenic group, or an ether such as a divinyl ether group. Preferably, the aliphatic chain is substituted by one group, in particular at the end of the aliphatic chain. In a very specific embodiment, the aliphatic chain of the fatty acid is substituted by an hydroxyl, especially at the end of the aliphatic chain.
In another embodiment, the aliphatic chain of the fatty acid is unsubstituted.
The fatty acid substrates can be an isolated or purified fatty acid or a mixture of fatty acids as mentioned above.
By “free fatty acid” is intended to refer to a form in which the fatty acid is in its form bearing a carboxyl group, i.e., not in an esterified form or other derivatives of fatty acids.
Alkanes/Alkenes:
The alkanes/alkenes of the present invention are obtained by decarboxylation of the corresponding fatty acids. Accordingly, the alkanes are obtained from saturated fatty acids and the alkenes from unsaturated fatty acid. The enzyme of the present invention does not introduce a terminal unsaturation. Therefore, in a preferred embodiment, the obtained alkenes do not present a terminal unsaturation.
The alkanes/alkenes obtained by the uses and methods of the present invention comprise from 8 or 10 to 24 carbon atoms preferably from 12 to 22 carbon atoms. In some embodiments, the alkane/alkene is a C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 or C22 alkane/alkene, preferably a C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 or C22 alkane/alkene, still more preferably a C12, C13, C14, C15, C16, C17, C18, C19, C20, C21 or C22 alkane/alkene. More preferably, the alkane/alkene comprises from 8 to 20 carbon atoms preferably from 12 to 18 carbon atoms, still more preferably from 14 to 18 carbon atoms, and even more preferably from 16 to 17 carbon atoms. In a specific aspect, the alkane/alkene is a C12, C13, C14, C15, C16, C17, C18, C19, C20, or C21 alkane/alkene, preferably a C12, C13, C14, C15, C16, C17, C18, or C19 alkane/alkene, still more preferably a C12, C14, C16, C17, or C18, alkane/alkene. The aliphatic/hydrocarbon chain can be straight, branched or even include a cyclic moiety.
In a particular embodiment, the alkane/alkene comprises a branched chain. The branched chain may include a main chain with substitutions by C1-C3 alkyl group, preferably by methyl. In particular, the fatty acids may be terpenoid alkanes such as phytane and pristane.
In addition, as the aliphatic chain of the fatty acids may be substituted or interrupted by one or several groups as detailed above, the corresponding alkane/alkenes after decarboxylation also comprise be substituted or interrupted by one or several groups.
Accordingly, the alkane/alkenes can be substituted by one or several groups such as an hydroxyl, a C1-C3 alcohol, a C1-C3 acyl, a C1-C3 ester, a C1-C3 amine, an amino group, a C1-C3 amide, a carboxyl, an aldehyde, an epoxy, an halogen, a C1-C3 alkoxy, a C1-C3 thioalkyl, a C1-C3 imine, a nitrile, a sulfur group such as C1-C3 sulfone or C1-C3 sulfoxide, a thiol, a nitro, a cyano, a C1-C3 halogenoalkyl, or may be interrupted by an heteroatom such as O, N or S, an acetylenic group, an ether such as a divinyl ether group, or an oxo group. Preferably, the alkane/alkenes may be substituted by one or several groups such as an hydroxyl, a carboxyl, an epoxy, an halogen, a thiol, or a nitrile, or may be interrupted by a S atom, an acetylenic group, or an ether such as a divinyl ether group. Preferably, the alkane/alkene is substituted by one group, in particular at the end of the aliphatic chain. In a very specific embodiment, the alkane/alkene is substituted by an hydroxyl, especially at the end of the aliphatic chain and is an alcohol.
The alkanes/alkenes can be an isolated or purified alkane/alkene or a mixture of alkanes/alkenes as mentioned above. In a very specific embodiment, the enzyme can produce C13-C17 alkanes and alkenes, especially when expressed in bacteria such as E coli.
Production of Alkanes/Alkenes in a Cell Free System
In a first aspect, the present invention relates to the use of a fatty acid decarboxylase as defined above for producing alkanes/alkenes from fatty acids, especially free fatty acid. Accordingly the present invention relates to a method for producing alkanes/alkenes wherein the fatty acid decarboxylase as defined above is contacted with a fatty acid or a mixture of fatty acids and is exposed to light, thereby converting the fatty acid or the mixture of fatty acids into the corresponding alkanes/alkenes. The fatty acid or mixture of fatty acids can be in a purified form or can be present in a raw composition/product. The fatty acid decarboxylase can be purified, isolated or present in a protein extract, in particular a total protein extract. Generally, FAD cofactor is already present with the fatty acid decarboxylase as a complex. Optionally, the FAD co-factor can be added with the fatty acid decarboxylase.
The enzyme needs exposure to a blue photon-containing light for its activity. In a preferred embodiment, the blue light has a wavelength from 400 to 520 nm, preferably from 450 nm to 495 nm, especially about 450 nm. The amount of light provided can be for instance from 10 to 3000 μmole.photon.m−2·s−1, preferably about 2000 μmole.photon.m−2·s−1.
However, the light may have a broader wavelength range between 300 to 540 nm. Indeed, the inventors observed that the FAD, cofactor of the enzyme, is capable of absorbing light in the range of wavelengths from 300 to 540 nm and the enzyme should be able to decarboxylate fatty acids in this range. Indeed, the FAD absorption spectrum is comprised between the wavelength range of 300 to 540 nm.
The enzyme also needs FAD (flavine adenine dinucleotide) as cofactor, which is usually bound to the enzyme purified from microalgal extracts or from the heterologous expression.
The method may comprise an additional step of recovering the alkanes/alkenes. The alkanes/alkenes can be extracted or purified by any method available to the skilled person. The alkanes/alkenes can be recovered in the organic phase. For instance, they can be extracted with an organic solvent, for instance with hexane. But alkanes/alkenes might also be recovered from the gas phase of the culture by condensation.
Production of Alkanes/Alkenes in a Recombinant Host Cell System
The present invention relates to the use of a recombinant host cell as described above for producing alkanes/alkenes from fatty acids, especially free fatty acid. It also relates to a method for producing alkanes/alkenes from fatty acids, wherein a recombinant host cell as described above is cultured under conditions effective to express the fatty acid decarboxylase of the present invention.
Accordingly, the present invention relates to a cell culture comprising a recombinant host cell as described above cultured under conditions effective to express the fatty acid decarboxylase of the present invention.
Optionally, the recombinant host cell can be cultured in a medium comprising fatty acids. Alternatively or in addition, the recombinant host cell produces or comprises fatty acids.
In the method, the recombinant host cell is preferably cultured in conditions for obtaining a biomass, preferably a biomass rich in lipid, especially fatty acids. Then, in a second step, the conversion of the fatty acids into alkanes/alkenes is initiated. For instance, if the fatty acid decarboxylase is already expressed in the recombinant host cell, the second step can be initiated by applying a blue photon-containing light to the recombinant host cell for allowing the fatty acid decarboxylase activity. Indeed, the inventors showed that the alkane production can be controlled by light, especially its wavelength. Blue light (>400 nm and <530 nm) allows the production of alkane while red light (>600 nm and <700 nm) does not. Then, in the method of the present invention, the alkane production can be modulated in vivo by light. Alternatively, if the expression of the fatty acid decarboxylase is controlled by an inducible promoter, the second step can be initiated by inducing the expression of the fatty acid decarboxylase and submitting cells to photons (300-540 nm). Moreover, light intensity (photons flux) modulates enzyme activity. A high photons flux increases enzyme activity whereas a low photons flux decreases enzyme activity.
Alternatively, the method can comprise the culture of the recombinant host cell in conditions conjointly promoting the production of a biomass, preferably rich in lipid, especially fatty acids, and the conversion of the fatty acids into alkanes/alkenes.
By “rich” is intended that the biomass comprises at least 20, 30, 40, 50, 60 or 70% in weight of lipids, especially fatty acids, by dry biomass.
The method may comprise an additional step of isolating or recovering the alkanes/alkenes from the recombinant host cell or from the culture medium.
The alkanes/alkenes can be extracted or purified by any method available to the skilled person. For instance, they can be extracted with an organic solvent, for instance with hexane. The alkanes/alkenes can be recovered in the organic phase.
One exemplary separation process is a two phase (bi-phasic) separation process. This process involves fermenting the genetically engineered host cells under conditions sufficient to produce alkanes/alkenes, allowing the alkanes/alkenes to collect in an organic phase, and separating the organic phase from the aqueous fermentation broth. This method can be practiced in both a batch and continuous fermentation setting.
The methods and uses according to the present invention for producing alkanes/alkenes can be used for preparing biofuel, materials useful in chemistry, in particular in cosmetics and other field such as plastics, resins, fibers, elastomers, pharmaceuticals, lubricants or gels.
The alkenes described herein can be used as or converted into a fuel. One of ordinary skill in the art will appreciate that, depending upon the intended purpose of the fuel, different alkenes can be produced and used. For example, branched alkenes may be desirable for automobile fuel that is intended to be used in cold climates. In addition, when the alkenes described herein are used as a feedstock for fuel production, one of ordinary skill in the art will appreciate that the characteristics of the olefin feedstock will affect the characteristics of the fuel produced. Hence, the characteristics of the fuel product can be selected for by producing particular alkenes for use as a feedstock.
Using the methods described herein, biofuels having desired fuel qualities can be produced from alkenes. Biologically produced alkenes represent a new source of biofuels, which can be used as jet fuel, diesel, or gasoline. Some biofuels made using alkenes have not been produced from renewable sources and are new compositions of matter.
Fatty Acid Dosage
The fatty acid decarboxylase of the invention is also useful for quantification of free fatty acids and can be included in a kit for quantification of free fatty acids. In particular, the present invention relates to a method for quantifying fatty acids in a sample, comprising contacting the sample with a fatty acid decarboxylase of the present invention in conditions suitable for converting fatty acids into alkanes/alkenes, recovering the alkanes/alkenes and quantifying the alkanes/alkenes. The sample can be a food sample or a biological sample, in particular a biological fluid sample such as blood, serum, plasma, urine and the like. The produced alkanes/alkenes can be extracted with an organic solvent and quantified, in particular by gas chromatography coupled to flame ionization detector and mass spectrometry (GC-FID-MS).
In a particular embodiment, the fatty acid decarboxylase of the invention is also useful for quantification of total fatty acids and can be included in a kit for quantification of total fatty acids. In particular, the present invention relates to a method for quantifying fatty acids in a sample, comprising contacting the sample with a lipase in conditions suitable for converting fatty acids into free fatty acids and quantifying the free fatty acids as detailed above. Accordingly, the method may comprise contacting the sample with a lipase in conditions suitable for converting fatty acids into free fatty acids, contacting a fatty acid decarboxylase of the present invention in conditions suitable for converting fatty acids into alkanes/alkenes, recovering the alkanes/alkenes and quantifying the alkanes/alkenes. The produced alkanes/alkenes can be extracted with an organic solvent and quantified.
When the fatty acid decarboxylase converts fatty acids into alkanes/alkenes, it produces CO2 as co-product. Then, in an alternative method, the present invention relates to a method for quantifying fatty acids in a sample, comprising contacting the sample with a fatty acid decarboxylase of the present invention in conditions suitable for converting fatty acids into alkanes/alkenes, recovering CO2 and quantifying the CO2. The amount of CO2 can be measured by any method known by the person skilled in the art, for instance Gas chromatography-mass spectrometry (GC-MC).
In an additional aspect, the inventors observed that the fluorescence of the fatty acid decarboxylase varies as a function of the substrate concentration. Therefore, the fluorescence variation provides an additional means for quantifying fatty acids in a sample. Then, in an additional alternative method, the present invention relates to a method for quantifying fatty acids in a sample, comprising contacting the sample with a fatty acid decarboxylase of the present invention in conditions suitable for converting fatty acids into alkanes/alkenes, and measuring the fluorescence emitted by the fatty acid decarboxylase. Preferably, the fluorescence is measure at a wavelength from 500 to 700, kinetics are preferably performed at about 540 nm.
Of course, the method for quantifying fatty acids in a sample can combine several methods as detailed above, e.g. quantifying the alkanes/alkenes and CO2, quantifying the alkanes/alkenes and measuring the enzyme fluorescence, quantifying CO2 and measuring the enzyme fluorescence, or the combination of the three parameters.
The fatty acid dosage is useful for diagnosing diseases, for instance liver diseases (WO15089102), diabetes and preeclampsia (WO13170369).
Fatty Acid Removal
The fatty acid decarboxylase of the invention can also be useful for removing free fatty acids from a composition, for instance from alimentary oils, in particular refined alimentary oils. Indeed, the use of the fatty acid decarboxylase of the invention can allow the decarboxylation of fatty acids without any chemical process. Therefore, the present invention relates to the use of a polypeptide as defined above for decarboxylation of fatty acids, thereby removing fatty acids, or to a method for removing free fatty acids from a composition comprising contacting the fatty acid decarboxylase of the invention with the composition in conditions suitable for decarboxylating the free fatty acids of the composition.
Further aspects and advantages of this invention are disclosed in the following experimental section, which should be regarded as illustrative and not limiting the scope of this application.
Upper panel: portion of the chromatogram corresponding to the labeled pentadecane product; control: homogenate pre-heated at 95° C. for 30 minutes. Lower panel: mass spectrum of the labeled pentadecane.
variabilis NC64A without the putative chloroplast transit
variabilis NC64A with the putative chloroplast transit peptide
variabilis NC64A without the putative chloroplast transit
reinhardtii without the putative chloroplast transit peptide
reinhardtii with the putative chloroplast transit peptide
tricornutum without the putative chloroplast transit peptide
tricornutum with the putative chloroplast transit peptide
subellipsoidea without the putative chloroplast transit peptide
siliculosus without the putative chloroplast transit peptide
anophagefferens without the putative chloroplast transit peptide
gaditana without the putative chloroplast transit peptide
Here, the inventors identified in the model microalga Chlorella variabilis NC64A an enzyme catalyzing the synthesis of alka(e)nes. The enzyme was partially purified using deuterium-labeled palmitic acid as a substrate and solid phase microextraction to capture the pentadecane product. A candidate protein belonging to the Glucose-Methanol-Choline oxidoreductase family was identified by proteomic analysis of three independent partial purifications. Heterologous expression of this Chlorella candidate gene in Escherichia coli resulted in the production of linear hydrocarbons from 13 to 17 carbons, showing that a single enzyme is sufficient to produce fuel-like alka(e)nes. The Chlorella alkane synthase is 69 kDa chloroplast-predicted protein using FAD as a cofactor. In vitro assays show that it can use C12 to C22 fatty acids to form alka(e)nes. The activity of this enzyme was found to be strictly dependent on presence of photons from 400 to 540 nm but could also work from 300 to 400 nm. These results thus expand the current knowledge on the catalytic repertoire of the Glucose-Methanol-Choline oxidoreductase family and open a new avenue for the renewable and light-driven production of alka(e)nes in microorganisms.
Results
Partial Purification of an Alkane Synthase Activity from Chlorella variabilis NC64A
The inventors have shown that various microalgae, including Chlorella variabilis NC64A, had the capacity to synthesize C15-C17 alkanes and alkenes. In the same work, they have also shown that deuterated palmitic acids added exogenously to Chlorella cultures can be converted into alkanes and alkenes. In order to identify the enzymatic pathway of alkane synthesis in microalgae, they have chosen a traditional purification approach based on the use of deuterium-labeled palmitic acid as substrate.
The first step was to confirm that an enzyme activity can be measured in a Chlorella cell homogenate. Deuterated palmitic acid was added to a cell homogenate and incubated overnight in a sealed vial. The expected pentadecane product was extracted by solid phase micro-extraction (SPME) and analyzed by gas chromatography coupled to mass spectrometry (GC-MS). A peak at 12.03 minutes corresponding to labelled pentadecane could be detected on intact cells but was absent on pre-heated control homogenate (
This experiment thus showed that Chlorella homogenate has an alkane synthesis enzyme activity. Because the alkane synthesis pathways identified in most organisms have an aldehyde intermediate, the inventors performed the same experiment using labelled C16 aldehyde but labelled pentadecane could not be detected.
The labelled palmitic acid was thus used to assay activity in all the purification procedure (
Some preliminary tests were then performed before purifying further the activity. Several co-factors such ferredoxine, ferredoxine reductase, NADP, NADPH and ATP were added in different combinations on the solubilized microsomal fraction. None of them were found to increase the activity and they were not added to the assays on purified fractions. The inventors also observed that in three days, the solubilized microsomal fraction activity stored at 4° C. decreased by 90%, indicating that the whole purification process had to be performed within a few days.
The partial purification of the solubilized activity involved a first step of gel filtration with a preparative column Superdex 200 and then two anion exchange columns, a fast flow Q and a final more resolutive mono Q. Most fractions were assayed for alkane synthase activity using the assay previously described. Protein content of the most active fractions was analyzed by electrophoresis on an acrylamide gel under denaturing conditions (
Three independent partial purifications were performed. Fractions with the highest activity after the final purification step were sent for proteomic analysis. By taking a cut off of 2 peptides counts at least, only ten proteins were common between the three purifications (
The Chlorella Alkane Synthase is a Member of the GMC Oxidoreductase Family
The gene encoding the Chlorella GMC oxidoreductase was not completely covered by publicly available ESTs. A cDNA around 2 kb was cloned using a total RNA extract from Chlorella. It encoded a 69 kDa protein (
BlastP searches using the Chlorella GMC oxidoreductase or other biochemically characterized GMC oxidoreductases from other species were performed in public databases to retrieve a variety of GMC oxidoreductase protein sequences. Multiple alignment of algal sequences indicated that some Chlorella residues such as C372, R391, Y406, Q426, H512 and N515 were highly conserved in other algae (
The Chlorella Alkane Synthase is a Light-Driven Photoenzyme Acting on a Variety of Fatty Acids
In order to characterize further its activity, the Chlorella GMC oxidoreductase was expressed in Escherichia coli as a His-tagged protein and purified on a nickel column (
In order to determine the co-product of the reaction, the inventors used palmitic acid labelled with 13C on the carboxylic group. They observed the production of 13CO2 demonstrating that the enzyme releases CO2 as a co-product, i.e. is a fatty acid decarboxylase. (
To characterize further alkane synthase activity, substituted fatty acids were used as substrate. Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) was found to be converted into branched alkanes, indicating that the alkane synthase is active on terpenoic acids (
In vitro, the alkane synthase cannot use TAGs (triacylglycerol) directly as substrate (
To determine if the alkane synthase was a light-driven enzyme (photoenzyme) or a light-activated enzyme, the production of CO2 was monitored during the reaction. The activity of the enzyme is driven by the presence of photons and stops immediately when light is turned off. (
Substrate Concentration Modify Enzyme Fluorescence.
Based on the light dependence of the enzyme we suspect that enzyme fluorescence could change during the activity of the enzyme with or without substrate. To this aim, we made fluorescence spectrum and kinetics (
The GMC Oxidoreductases from Chlamydomonas and Phaeodactylum are Also Alkane Synthases
To investigate the possibility that other algal GMC oxidoreductases also have a fatty acid decarboxylase activity and are thus alkane synthases, the GMC oxidoreductases of another Chlorophyceae (Chlamydomonas reinhardtii) and a diatom (Phaeodactylum tricornutum) were expressed in Escherichia coli and total fatty acids and hydrocarbons of the bacterial cells were analyzed by GC-MS-FID. The Chlamydomonas enzyme caused the formation in E. coli cells of pentadecane and heptadecane as well as their monounsaturated analogs (
Co-Expressing a Lipase with a GMC Oxidoreductase Boost Alkane Synthesis in E. coli
Free fatty acid pools are usually small in living cells because free fatty acids are deleterious to membrane structure. In order to see if the production of alkanes and alkenes could be boosted in E. coli by increasing the amount of free fatty acids available, a bacterial lipase (Uniprot P04635) was coexpressed with the Chlorella or the Chlamydomonas alkane synthase (
Discussion
Alkanes and alkenes are interesting compounds for biofuel production and alkenes are particularly interesting for chemical industry. In this work, using partial purification and proteomic analysis, the inventors were able to identify a microalgal alkane synthase from Chlorella. It is a member of the GMC oxidoreductase family. When expressed in E. coli, this protein alone is able to yield alkanes and alkenes. The main interest of this enzyme is its apparent capacity to catalyze a formal decarboxylation of free fatty acids to form saturated hydrocarbons and the fact that it is a photoenzyme. Mechanism and possibly cofactor requirements are expected to be different from the bacterial cytochrome P450 alkane synthase. The Chlorella GMC oxidoreductases thus extend the pool of alkane-synthetizing enzymes and offers new possibilities for biotechnological applications.
The Algal Group of GMC Oxidoreductases
The GMC oxidoreductase family was first described in 1992. Comparison of protein sequence from glucose dehydrogenase, choline dehydrogenase, glucose oxidase and methanol oxidase from various organisms (respectively: Drosophila melanogaster, Escherichia coli, Aspergillus niger, and Hansenula polymorpha) showed low similarity but conserved motifs. These enzymes contain a flavoenzyme site and a canonical ADP-binding βαβ fold close to their amino termini. Structural studies confirm that these proteins are composed of an N-terminal FAD-binding domain, and a C-terminal substrate-binding domain. The FAD-binding domain forms the alpha-beta fold typical of dinucleotide binding proteins, while the substrate-binding domain consists of a beta sheet surrounded by alpha helices. The general topology of these proteins is conserved, though inserted structural elements occur in both choline dehydrogenase and alcohol dehydrogenase.
Members of the GMC oxidoreductase family catalyze diverse reactions, mostly oxidation of alcohols to aldehydes. This family includes glucose and methanol oxidases, fatty alcohol oxidase, choline dehydrogenase. But the family also includes a lyase from almond acting on hydroxymandelonitrile, which shows that the family harbors very diverse catalytic mechanisms. Strict dependence of the activity on light is likely to be mediated by the FAD cofactor found to be associated with the recombinant enzyme. Presence of FAD was consistent with the fact that the Chlorella enzyme has a FAD binding domain like all GMC oxidoreductases (
Interestingly, all the microalgal species that have been shown to produce long or very long chain alka(e)nes have a homolog to the Chlorella GMC oxidoreductase, but the only species that has no detectable alka(e)nes (Ostreococcus tauri) has no GMC homolog. It seems thus very likely that the members of the algal group of GMC oxidoreductases are all alkane synthases. This idea is supported by the demonstration that the GMC oxidases from Chlamydomonas reinhardtii and Phaeodactylum tricornutum bear a fatty acid decarboxylase activity (
Possible Biotechnological Applications of the Microalgal Alkane Synthase
The discovery of a microalgal pathway for alkane synthesis is of biotechnological interest because microalgae are promising platform for lipid production but harvest of biomass, extraction of oil and conversion to biodiesel is very costly. Production in microalgae of fuel-like volatile alkanes that could be easily recovered from the culture medium might thus circumvent these issues.
In vitro, the Chlorella enzyme is able to act on a variety of fatty acids, including medium chains (
As alkane synthase is a photoenzyme, light can be used to finely modulate alkane production in vitro and in vivo. First, presence or absence of photons from 320-540 can be used to select the moment of the alkane production. Second, light intensity can be used to increase or decrease the rate of alkane synthesis. Experiments were performed here under continuous light but it is possible that other conditions such flashes could be interesting for hydrocarbons synthesis.
Finally, products (alkanes and alkenes), coproduct (CO2), and enzyme fluorescence can be used to estimate the concentration of free fatty acids in a sample (or total fatty acids if used in combination with a lipase).
Materials & Methods
Strains and Culture Conditions
Chlamydomonas reinhardtii wild-type strains CC124 (nit1 nit2; mt−) and CC125 (nit1 nit2; 415 mt+) were used. Chlorella variabilis NC64A was from the laboratory of J. L. Van Etten (University of Nebraska). All strains were grown routinely in conical flasks in incubation shakers at 25° C. (Infors HT) under air enriched with 2% (v/v) CO2, with agitation at 140 rpm and light intensity at 120 μmol photons m−2s−1 for Chlamydomonas and 70 for Chlorella. Chlamydomonas and Chlorella were cultivated in Tris-Acetate-Phosphate (TAP) medium and minimal medium. Cells were routinely counted using a Multisizer™ 3 (Coulter).
Purification of Native Alkane Synthase
A Fast Protein Liquid Chromatography system (AKTApurifier 900, GE Healthcare) was used. The alkane synthase activity assay is described in next section. Chlorella cells (200.109) were centrifuged for one hour at 6000 g and cell pellets were frozen in liquid nitrogen and stored for one hour at minus 80° C. Cells were resuspended in lysis buffer containing 20 mM Tris (pH 8.0), 100 mM NaCl and 1 mM EDTA (buffer A) and disrupted using a Cell Disruption (Constant) at 2 kbar pressure. Homogenate was centrifuged twice for 40 min at 50 000 g. Supernatant was collected and centrifuged for 90 min at 105 000 g. The resulting microsomal pellet was resuspended overnight at 4° C. under agitation in a buffer A added with 2.7 mM Triton X100. Ultracentrifugation was performed at 105 000 g for 90 min and the supernatant was loaded on a gel filtration column. Most active fractions were pooled, concentrated using a 30 kDa Amicon® ultracentrifugal filter and buffer was changed by dilution to a 20 mM Tris (pH 8.0), 50 mM NaCl, 1 mM EDTA, 0.05% (w/v) Triton X100 buffer (buffer B). The second purification step involved an anion exchange column (HiTrap Q FF, GE Healthcare). Proteins were eluted using a gradient (0-100%) of a buffer 20 mM Tris (pH 8.0), 1 M NaCl, 1 mM EDTA and 0.05% (w/v) Triton X100 (buffer C). Most active fractions were pooled, concentrated using a 30 kDa an Amicon® ultracentrifugal filter and buffer was changed by dilution to buffer B. The third purification step involved a strong anion exchange column (Mono Q GI, GE Healthcare). Proteins were eluted using a gradient of buffer C. Most active fractions were kept for proteomic analysis.
Activity Assay for Protein Purification
Enzymatic assays were performed in transparent glass vials sealed using caps with septum. Reaction mixtures contained 500 μL of each purification fraction, 200 μM of perdeuterated palmitic acid (10 mM stock solution in ethanol) and 45 nmol hexadecane as internal standard (4.5 mM stock solution in chloroform). Vials were agitated at 120 rpm overnight at 25° C. under a white light (intensity 120 μmol photons m−2s−1). Reaction was stopped by the addition of 10 μL NaOH 10 M through the septum using a syringe. Hydrocarbons produced were analyzed by incubating in the headspace of the vial a solid phase microextraction (SPME) fiber (DVB PDMS fused silica, 65 μm double-polar, Supelco) mounted on a holder. After 15 min incubation at room temperature the SPME fiber was immediately inserted into the injector of the GC-MS and desorbed at 250° C. GC-MS analysis was carried out as described below.
Proteomic Analysis
Protein preparation, in-gel digestion and nanoLC-MS/MS analyses were performed as previously described. In brief, proteins solubilized in Laemmli buffer were stacked on top of a 4-12% (w/v) NuPAGE gel (Invitrogen) and stained by R-250 Coomassie Blue (BioRad). Gel bands were then excised and proteins in-gel digested using trypsin (Promega). Resulting peptides were analysed by nanoliquid chromatography coupled to tandem mass spectrometry (Ultimate 3000 coupled to LTQ-Orbitrap Velos Pro, Thermo Scientific) using a 120 min gradient. Peptides and proteins were identified through concomitant searches against Uniprot (Chlorella variabilis taxonomy, September 2016 version), classical contaminants (homemade) and the corresponding reversed databases using Mascot (version 2.5.1). The Proline software was used to filter the results (conservation of rank 1 peptides, peptide identification FDR <1% as calculated on peptide scores by employing the reverse databasestrategy, peptide length ≥7, and minimum of 1 specific peptide per identified protein group) before performing a compilation, grouping and comparison of the protein groups from the different samples. Only proteins identified with a minimal specific spectral count of 2 were taken into account for further comparison.
Protein Analysis and Western Blots
Protein extracts were added with LDS NuPAGE loading dye 1× final, boiled for 10 min at 95° C., resolved using reducing 10% (w/v) SDS-PAGE with MOPS running buffer and stained with silver nitrate. For detection of His-tagged proteins, polypeptides resolved by SDS-PAGE were transferred onto a nitrocellulose membrane using a semi-dry blotting system, and His-tags were revealed using rabbit anti-His antibodies, horseradish peroxidase-conjugated anti-rabbit antibodies and ECL substrate (Amersham Biosciences).
Cloning of Alkane Synthase cDNA and Purification of Recombinant Alkane Synthase
Total RNAs were extracted from Chlorella cells by a phenol-chloroform method and cDNAswere synthesized using SuperScript® III reverse transcriptase. The cDNA encoding the GMC oxidoreductase was amplified using primers designed in putative 5′ and 3′UTRs Primer forward: ATGGCGTCAATTACATCGCG (SEQ ID No 24); Primer reverse: TCATGCTGCCACTGTCGC (SEQ ID No 25), cloned into a TOPO XL plasmid and sequenced. The sequence corresponding to residues 62-654 of the Alkane synthase was amplified from a synthetic gene codon-optimized for E. coli expression using a primer forward 5′-CTG TAC TTC CAA TCA GCC AGC GCA GTT GAA GAT ATT C-3′ (SEQ ID No 27) and a reverse primer: 5′-TAT CCA CCT TTA CTG TTA TCA TGC TGC AAC GGT TGC CGG TG-3′ (SEQ ID No 28). and cloned into pLIC07 vector, which introduced downstream of the ATG start codon a cassette coding for a 6 His-tagged thioredoxin and a tobacco etch virus (TEV) protease-cleavage site. The recombinant alkane synthase was produced in BL21-CodonPlus (DE3)-RIL E. coli cells cultured in TB medium at 37° C. up to OD 0.9. At this stage, the temperature was decreased to 17° C. and the cells were grown for an additional 18 h. The cells were harvested by centrifugation (4000 g for 10 min) and the pellet was frozen. Cell pellet was resuspended in lysis buffer during 30 min at 4° C. (10 mL of lysis buffer for one liter of cells at OD=1). Lysis buffer contained 300 mM NaCl, 50 mM Tris pH 8.0, 10 mM imidazol, 5% (w/v) glycerol, 0.25 mg mL−1 lysozyme, 20 mM MgSO4, 10 μg mL−1 DNase, and antiproteases. After resuspension, cells were lysed by sonication and centrifuged for 30 min at 8000 g. Supernatant was collected and enzyme was purified by FPLC. First purification was made on a nickel column and protein was eluted by a step gradient using 50% (v/v) of a second buffer containing 300 mM NaCl, 50 mM Tris pH 8.0, 500 mM imidazole 5% (w/v) glycerol. Tobacco etch virus protease (at 1 mg per 10 mg total protein) was used to cut off the His tag and the thioredoxin. A dialysis was performed overnight in the presence of TEV to change the buffer to a buffer containing 300 mM NaCl, 50 mM Tris pH 8.0, 10 mM imidazol, 5% (w/v) glycerol. A second FPLC chromatography using a nickel column was made to separate the protein from the His-tagged thioredoxin. The last purification step was a gel filtration column (Superdex200 26/600 mm GE Healthcare). Buffer used for this step contained 150 mM NaCl, 10 mM Tris pH 8.0, 5% (w/v) glycerol. The protein was concentrated using ultracentrifugal filters 50 kDa Amicon® and stored at −80° C. after adding 20% (w/v) glycerol.
Expression of Chlorella variabilis, Chlamydomonas reinhardtii and Phaeodactylum tricornutum GMC Oxidoreductase in E. coli.
Chlamydomonas reinhardtii and Phaeodactylum tricornutum Alkane synthase was amplified from a synthetic gene codon-optimized for E. coli using for Chlamydomonas reinhardtii a primer forward 5′-TAC TTC CAA TCA ATG ATG CTG GGT CCG AAA ACC-3′ (SEQ ID No 29) and a primer reverse, 5′-TAT CCA CCT TTA CTG TTC TAC TAA ACT GCA ACC GGC TGA CG-3′ (SEQ ID No 30). For Phaeodactylum tricornutum, forward primer 5′-TAC TTC CAA TCA ATG AAA AAA AGC CTG CGT AGC-3′ (SEQ ID No 31), reverse primer 5′-TAT CCA CCT TTA CTG TTC TAC TAT GCG CTT GCG GTG-3′ (SEQ ID No 32). Genes were cloned into pLIC07 vector, which introduced downstream of the ATG start codon a cassette coding for a 6 His-tagged thioredoxin and a tobacco etch virus (TEV) protease-cleavage site. E. coli strain expressing the GMC oxidase from Chlorella variabilis NC64A, Chlamydomonas reinhardtii or Phaeodactylum triconutum were grown at 37° C. with agitation at 180 rpm and light at 100 μmole.photon.m−2·s−1. When OD reached 0.6, 500 μM of isopropyl β-D-1-thiogalactopyranoside was added. Cells were then grown for 24 hours at 37° C., harvested, transmethylated using methanol added with 5% sulfuric acid and hydrocarbons were extracted with hexane and analyzed by GC-MS as previously described.
Co-Expression in E. coli of a GMC Oxidoreductase and a Lipase
E. coli strain transformed with a vector expressing the GMC oxidase from Chlorella variabilis NC64A (or Chlamydomonas reinhardtii) and/or a vector expressing the lipase from the bacterium Staphylococcus hyicus, were grown in TB medium at 37° C. Expression was induced with 1 mM of isopropyl β-D-1-thiogalactopyranoside (added with 0.2% arabinose for co-expression). Cells were then grown overnight at 25° C. at 100 μmole.photon.m−2·s−1 and 6 h at 2000 μmole.photon.m−2·s−1. Cells were harvested (4 ml at OD=5), transmethylated using methanol added with 5% sulfuric acid and hydrocarbons were analyzed by SPME and GC-MS as previously described.
Enzymatic Assay with Purified Enzyme
All assays were performed in transparent glass vials sealed using caps with septum. Optimum pH was determined using a Teorell Stenhagen universal buffer (33 mM citric acid monohydrate, 33 mM phosphoric acid, 100 mM NaOH, 16.7 mM of boric acid, pH 8.5 adjusted with 1N HCl). Other assays were performed in 100 mM Tris HCl pH 8.5, 100 mM NaCl. Reaction mixtures (500 μL) typically contained 160 nM purified enzyme (stock solution 2.5 mg ml−1) and 400 μM substrate (stock solution 10 mM in ethanol). In some assays, a lipase was used with the alkane synthase. In this case, substrate was a triacylglycerol. Generally, samples were shaken at 200 rpm during 15 min under LED-made white light at 2000 μmol
photons m−2s−1. After the incubations, samples were heated at 95° C. during 15 min to stop the enzymatic reaction. Samples were cooled down and internal standard (hexadecane) was added (45 nmol from a 4.5 mM stock solution in chloroform). NaOH was then added to the reaction mixture (10 μL from a stock solution of 10 M) and samples were vortexed for 5 min. Then 250 μL of hexane was added and samples were vortexed for 5 min to extract alkanes and alkenes. The hexane phase was collected by centrifugation and analyzed by GC-MS-FID. The analysis was done by direct injection of 100 μl of the headspace into a GC-MS. In
Fluorescence of the Alkane Synthase
Enzyme was analyzed by UV-Vis spectroscopy (Uvikon XS spectrophotometer from Secomam). Absorbance spectrum was measured on purified enzyme in a buffer containing 100 mM tris pH 8.5 and 100 mM NaCl. Fluorescence spectrum (500 to 700 nm) was measured on a Varian Cary Eclipse using an excitation flux at 450 nm with a 10 nm slit For kinetic, fluorescence was measured at 540 nm using an excitation flux at 450 nm with a 10 nm slit.
Membrane Inlet Mass Spectrometry (MIMS)
Online measurements of 12CO2 (m/z=44) and 13CO2 (m/z=45) were monitored using mass spectrometry (model Prima B, Thermo Scientific). The membrane inlet system consists of a thermo-regulated oxygen electrode chamber (Hansa Tech), which is connected to the vacuum line of the mass spectrometer via a gas-permeable thin Teflon membrane (0.001 inch thickness, YSI Inc.), which seals the bottom of the chamber. For analyses, 20 μL of purified enzyme at 2.5 mg mL−1 and 30 μL substrate at 10 mM in dimethylsulfoxide (13C-palmitic acid) was added to 1.45 mL of Tris/Acetate/Borate buffer 100 mM, pH 6.5 containing NaCl 100 mM, placed into the measuring chamber, thermo-regulated at 25° C., and stirred continuously. Gases dissolved in the medium diffuse through the Teflon membrane to the ion source of the mass spectrometer.
Cultures in Photobioreactors
Chlamydomonas reinhardtii CC124 (nit1 nit2; mt−) and Chlamydomonas reinhardtii overexpressing the alkane synthase gene were cultured in minimal medium (Harris, 1989) in one liter photobioreactors (BIOSTAT Aplus, Sartorius Stedim Biotech) operated as turbidostats. A880 was measured continuously using a biomass probe (Excellprobe, Exner) and cultures were maintained at constant A880 by injection of fresh medium. The pH was maintained at a constant value of 7 by injection of KOH (0.2 N) or HCl (0.2 N). The cultures were stirred using a metal propeller (250 rpm). The gas flow rate was adjusted to 0.5 L min−1. Air enriched with 2% (v/v) CO2 was generated using mass flow meters (EL flow, Bronkhorst). White light was supplied by eight fluorescent tubes (Osram Dulux L 18 W) placed radially around the photobioreactor. We used a blue filter (363 special medium blue, Lee filters, USA) and a red filter (113 magenta, Lee filters, USA) to provide respectively blue and red light. Both lights were at same intensity (35 μmol photons m−2s−1).
Transmethylation
To quantify hydrocarbons together with fatty acids, transmethylation of whole cells was used. Briefly, cell pellets (one hundred million cells for Chlamydomonas, two hundred million cells for Chlorella variabilis NC64A and 20 mL OD−1 unit of E. coli) were added with 2 mL of a solution containing methanol with 5% (v/v) sulfuric acid and 25 μg of triheptadecanoate (from a stock solution 2.5 mg mL−1 in chloroform) and 5 μg of 16:0-alkane (stock solution 1 mg mL−1 in chloroform) were included as internal standards. Samples were incubated at 85° C. for 90 min in sealed glass tubes. After cooling down, FAMEs and hydrocarbons were extracted by adding 250 μL hexane and 500 μL NaCl 0.9% (w/v). Samples were vortexed for 10 min and the organic phase was separated from the aqueous phase by centrifugation at 3000 g for 2 min. The hexane phase was recovered and 1 μl was injected in the GC-MS/FID.
GC-MS Analyses
Analyses by gas chromatography coupled to mass spectrometry (GC-MS), which were performed after solid phase microextraction (SPME), were carried out using the following setup. A Thermo-Fischer gas chromatography Focus series coupled to a Thermo-Fischer DSQII mass spectrometer (simple quadrupole) was used with a DB-5HT (Agilent) apolar capillary column (length 30 m, internal diameter 0.25 mm, film thickness 0.1 μm). Helium carrier gas was at 1 mL min−1. Oven temperature was programmed with an initial 2 min hold time at 50° C., then a ramp from 50° C. to 300° C. at 10° C. min−1, and a final 3 min hold time at 300° C. Samples were injected in splitless mode (2 min) at 250° C. The MS was run in full scan over 40-500 amu (electron impact ionization, 70 eV) and peaks were quantified based on total ion current using the internal standards. For co-substrate determination, a column HP-PLOT Q was used (0.32 mm diameter×30 m) and CO2, 13CO2 and argon were analysed using an oven temperature of 40° C. and single ion monitoring (m/z 40, 44, 45).
GC-MS/FID Analyses
Analyses by gas chromatography coupled to mass spectrometry and flame ionization detection (GC-MS/FID) were performed only after transmethylation reactions in order to quantify fatty acids and hydrocarbons together. Analyses were carried out on an Agilent 7890A gas chromatographer coupled to an Agilent 5975C mass spectrometer (simplequadrupole). A Zebron 7HG-G007-11 (Phenomenex) polar capillary column (length 30 m, internal diameter 0.25 mm, film thickness 0.25 μm) was used. Hydrogen carrier gas was at 1 mL min−1. Oven temperature was programmed with an initial 2 min hold time at 60° C., a first ramp from 60° C. to 150° C. at 20° C. min−1 with a 5 min hold time at 150° C., then a second ramp from 150° C. to 240° C. at 6° C. min−1 and a final 3 min hold time at 240° C. Samples were injected in splitless mode (1 min) at 250° C. The MS was run in full scan over 40-350 amu (electron impact ionization at 70 eV) and peaks were quantified based on the FID signal using the internal standards.
Phylogeny
To build the phylogenetic tree, 56 amino acid sequences of GMC oxidoreductases from prokaryotes and eukaryotes were retrieved from Cyanobase (see Worldwide Web site: genome.kazusa.or.jp/cyanobase/), NCBI (see Worldwide Web site: ncbi.nlm.nih.gov/), Phytozome (see Worldwide Web site: phytozome.Jgi.doe.gov) or Cyanidioschyzon merolae see Worldwide Website: merolae.biol.s.u-tokyo.ac.jp/). Sequences were aligned with the MAFFT version 7 program. The resulting alignment was manually refined using SeaView version 4 and regions where homology was doubtful were removed from further analysis. A total of 266 amino acids positions were kept for the phylogenetic analysis. The tree was obtained using Neighbor-Joining (NJ), approaches in the Phylogenetic Inference Package Phylip version 3.69. The PROTDIST program was used to create distance matrices. The NEIGHBOR program was used for NJ analysis and the sequence input order was randomized (20 jumbles). The SEQBOOT and CONSENSE programs were used for bootstrap value calculations on 100 replications and consensus tree reconstructions, respectively. The phylogenetic trees were drawn with Dendroscope version 3.
| Number | Date | Country | Kind |
|---|---|---|---|
| 16305583 | May 2016 | EP | regional |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/EP2017/062061 | 5/19/2017 | WO | 00 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2017/198802 | 11/23/2017 | WO | A |
| Number | Date | Country |
|---|---|---|
| WO 2014102201 | Jul 2014 | WO |
| Entry |
|---|
| Chen, B. et al. “Combinatorial metabolic engineering of Saccharomyces cerevisiae for terminal alkene production” Metabolic Engineering, Sep. 1, 2015, pp. 53-61, vol. 31. |
| Database UniProt [Online] Accession No. E1ZTE9, “SubName: Full=Putative uncharacterized protein {ECO:0000313 | EMBL:EFN50890.1}”, Nov. 30, 2010, p. 1, XP-002761243. |
| Sorigué, D. et al. “Microalgae Synthesize Hydrocarbons from Long-Chain Fatty Acids via a Light-Dependent Pathway” Plant Physiology, Aug. 2016, pp. 2393-2405, vol. 171, Supplemental Figures. S1-S11. |
| Written Opinion in International Application No. PCT/EP2017/062061, dated Aug. 31, 2017, pp. 1-6. |
| Moulin, S. et al. “Fatty acid photodecarboxylase is an ancient photoenzyme responsible for hydrocarbon formation in the thylakoid membranes of algae” bioRxiv, Jun. 23, 2020, pp. 1-61. |
| Sorigué, D. et al. “An algal photoenzyme converts fatty acids to hydrocarbons” Science, Sep. 1, 2017, pp. 1-5, vol. 357. |
| Zhang, W. et al. “Hydrocarbon Synthesis via Photoenzymatic Decarboxylation of Carboxylic Acids” J. Am. Chem. Soc., 2019, pp. 3116-3120, vol. 141. |
| Database UniProt [Online] Accession No. A0A248QE08, “RecName: Full=Fatty acid photodecarboxylase, chloroplastic {ECO:0000303|PubMed:28860382}”, Jun. 17, 2020, pp. 1-5. |
| Zachos, I. et al. “Photobiocatalytic decarboxylation for olefin synthesis” Chem. Commun., 2015, pp. 1918-1921, vol. 51. |
| Database UniProt [Online] Accession No. E1ZTE9, “SubName: Full=Putative uncharacterized protein”, Nov. 30, 2010, p. 1, Version 1. |
| Database UniProt [Online] Accession No. E1ZTE9, “SubName: Full=Putative uncharacterized protein {ECO:0000313|EMBL:EFN50890.1}”, Jan. 7, 2015, p. 1, Version 12. |
| Database UniProt [Online] Accession No. A8JHB7, “SubName: Full=Predicted protein {ECO:0000313|EMBL:EDO96742.1}”, Apr. 13, 2016, p. 1, Version 45. |
| Database UniProt [Online] Accession No. R1FBM9, “SubName: Full=Choline dehydrogenase {ECO:0000313|EMBL:EOD32856.1}”, Apr. 13, 2016, pp. 1-2, Version 17. |
| Database UniProt [Online] Accession No. W7TN63, “SubName: Full=Choline dehydrogenase {ECO:0000313|EMBL:EWM27492.1}”, Apr. 13, 2016, p. 1, Version 8. |
| Database UniProt [Online] Accession No. R1FBM9, “SubName: Full=Choline dehydrogenase {ECO:0000313|EMBL:EOD32856.1}”, Jun. 17, 2020, pp. 1-2, Version 36. |
| Database UniProt [Online] Accession No. A8JHB7, “RecName: Full=Fatty acid photodecarboxylase, chloroplastic {ECO: 0000303/PubMed ID 28860382CiteNPL}”, Jun. 17, 2020, pp. 1-3, Version 68. |
| Database UniProt [Online] Accession No. W7TN63, “SubName: Full=Choline dehydrogenase {ECO:0000313|EMBL:EWM27492.1}”, Apr. 22, 2020, pp. 1-2, Version 20. |
| Number | Date | Country | |
|---|---|---|---|
| 20190161771 A1 | May 2019 | US |
