Patent Application
20240254515
This invention generally pertains to flexible vector systems to express peptides and nucleic acids, and their application to vaccines and immunotherapeutics.
An outbreak of pneumonia like disease termed COVID-19 caused by a novel coronavirus, SARS-COV-2, has spread across the world and become a global pandemic. The COVID-19 pandemic illustrates how essential it is for public health bodies to foster a fast response capability based on technically innovative vaccines. First generation vaccines targeting SARS-CoV-2 have been developed by BioNTech/Pfizer, Moderna, Oxford/Astra Zeneca and others. These first-generation vaccines all target spike protein: the Oxford/Astra Zeneca vaccine uses an adenoviral vector; the vaccines by Moderna and Pfizer are RNA based; the vaccine by Imperial College London relies upon self-amplifying RNA.
These first-generation SARS-COV-2 vaccines, and their fast development cycle (a few months from design to test), were instrumental to lower the burden of the COVID-19 pandemic on healthcare systems and keep mortality figures lower than in the pre-vaccine phase. However, many of these first-generation vaccines have significant weaknesses—mainly the fact they do not induce sterilising immunity (i.e., vaccinated persons are still able to catch and spread the disease) and that emergent COVID-19 strains can escape vaccine immunity.
The Self-amplifying mRNA (SAM) vaccine platform is composed of a non-viral, engineered replicon that drive high levels of expression of encoding antigens. Very low doses are required (mgs) as tens of thousands of copies are made by transfected cells. They may be delivered via intramuscular (i.m.), in the same manner as earlier RNA or DNA vaccines, and can be encapsulated within an adenovirus or another vector to further boost performance. Such vaccines are not only capable of inducing humoral and cellular immunity, but also avoiding the induction of anti-vector immunity, while lacking the risk of genome integration into the host genome. In addition to this, the expression of the antigen caused by the inoculation of mRNA is transient, and thus there are no concerns of T cell exhaustion due to continuous exposure of the antigen. Furthermore, nucleic acid-based vaccine manufacturing is safe and time-saving, and bypasses the need to grow highly pathogenic organisms at a large scale, resulting in a lower risk of contamination with live infectious reagents and accidental release of dangerous pathogens.
This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.
An objective of the present invention is to provide flexible expression vector systems and their application to vaccines and immunotherapeutics.
In accordance with an aspect of the invention, there is provided an expression vector that encodes all or a portion of replicon proteins from a positive stranded RNA virus, optionally the vector is a self-amplifying plasmid DNA vector or self-amplifying plasmid RNA vector. In certain embodiments, the expression of the replicon proteins is under the control of CMV and T7 promoters, and wherein expression of a payload is under the control of a sub-genomic promoter. In certain embodiments, the virus is SARS-COV-2, Venezuelan Equine Encephalitis virus (VEEV) or Rubella virus (RUBV). In certain embodiments, the vector encodes replicon proteins from SARS-COV-2 and has the structure set forth in any one of Tables 1 to 4. In certain embodiments, the vector encodes replicon proteins from VEEV and has the structure set forth in Table 5. In certain embodiments, the vector encodes replicon proteins from RUBV and has the structure set forth in Table 6. In certain embodiments, the vector encodes one or more payloads. In certain embodiments, one or more payloads contain a ribosome binding site or other translation initiation sequence, such as a Kozak motif. In certain embodiments, each payload is a collection of peptides. Optionally, the peptides are separated by cleavage motifs for one or more proteases, expresses either by the virus or the host cell. The payload can possibly start with suitable ribosome binding site sequences and possibly contain, for instance at the 5′ and/or 3′ ends, sequences enhancing transcription and/or translation and/or controlling post-translational modifications, for instance localisation in cellular compartments. Optionally the payload has the structure of set forth in any one of Tables 7-10. In certain embodiments, one or more payloads contain sequences enhancing or controlling transcription or translation. In certain embodiments, one or more payloads contain sequences controlling post-translational processing such as localisation in cellular compartments. In certain embodiments, the peptides are separated by protease cleavage motifs and hence subsequently cleaved by either viral or host cell proteases.
In accordance with an aspect of the invention, there is provided a vector having the sequence as set forth in any one of SEQ ID NOs 1 to 12:
In accordance with an aspect of the invention, there is provided a pharmaceutical composition comprising the vector of the present invention and a pharmaceutically acceptable carrier, optionally the vector is formulated in a lipid nanoparticle.
In accordance with an aspect of the invention, there is provided a method of delivering a payload of interest to a cell, the method comprising contacting the cell with the vector of the invention which expresses the payload.
In accordance with an aspect of the invention, there is provided a method of treating, protecting against, and/or preventing disease associated with an infectious agent in a subject, said method comprising administering the vector of the invention, wherein said vector expresses a therapeutic polypeptide or RNA effective against said infectious agent.
In accordance with an aspect of the invention, there is provided a method of stimulating an antigen-specific immune response, said method comprising administering said method comprising administering the vector of the invention, wherein said vector expresses one or more immunogens or epitopes from said infectious agent, optionally the infectious agent is a positive stranded virus and said vector expresses replicon proteins from the same positive stranded virus.
In accordance with another aspect of the invention, there is provided a dual mammalian prokaryotic promoter. In specific embodiments, there is provided a dual promoter CMV and T7. In accordance with another aspect of the invention, there is provided an expression vector system comprises a dual mammalian prokaryotic promoter.
These and other features of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings.
The present invention provides expression vectors, optionally self-amplifying vectors and the uses of such vectors. The vectors may be utilized in vitro and/or in vivo. In certain embodiments, the vectors are for use in therapeutics, including but not limited to the use of the vectors in vaccines and immunotherapeutics.
Positive stranded viruses, including viruses belonging to the orders Nidovirales, Martellivirales and Hepelivirales are characterized by the presence of (1) a replicon (i.e., a set of genes able to replicate the original RNA genome) which is first expressed as a polyprotein and then cleaved into mature peptides by one or more viral proteases; and (2) a set of (possibly nested) subgenomic RNAs, which encode for a number of structural proteins The number of viral proteases, mature peptides and sub-genomic RNAs varies depending on the virus considered. However, the particular nature and replication strategy of the viruses considered, with the presence of a replicon/payload structure, viral proteases and sub-genomic RNAs, allows for the creation of a derived vector with a doubly configurable mechanism which is particularly well suited to the delivery of peptide-based vaccines.
Accordingly, in some embodiments, the present invention provides expression vectors based on positive stranded viruses, including but not limited to viruses belonging to the orders Nidovirales, Martellivirales and Hepelivirales and uses thereof. In particular, in certain embodiments, the present invention provides a vector, including but not limited to a self-amplifying plasmid DNA vector, that encodes all or a portion of replicon proteins from a positive virus of interest and includes a multi-cloning site to allow insertion of a sequence of a payload of interest.
In some embodiments of the invention, the vector is a plasmid DNA vector encoding the replicon from a positive stranded virus where the expression of the replicon proteins is driven by a eukaryotic promoter.
As used herein, the term promoter includes promoters and promoters plus enhancer elements.
In some embodiments of the invention, the vector is a plasmid DNA vector encoding the replicon from a positive stranded virus where the expression of the replicon proteins is driven by a mammalian promoter.
In some embodiments of the invention, the vector is a plasmid DNA vector encoding the replicon from a positive stranded virus where the expression of the replicon proteins is driven by a eukaryotic promoter and a prokaryotic promoter or a dual eukaryotic prokaryotic promoter. In some embodiments the promoter is a fused dual mammalian prokaryotic promoter.
Accordingly, there is provided a dual mammalian prokaryotic promoter, optionally a fused dual mammalian prokaryotic promoter. In specific embodiments, there is provided a dual promoter CMV and T7. A worker skilled in the art would readily appreciate that such dual promoters may be used in a variety of expression vector systems, including but not limited to expression systems like pox viruses, adenoviruses, lenti, plasmid, transposon etc. Accordingly, in certain embodiments, there is provided a dual promoter for use in expression systems.
In some embodiments of the invention, the vector is a plasmid DNA vector encoding the replicon from a positive stranded virus where the expression of the replicon proteins is driven by a mammalian promoter and a prokaryotic promoter or a dual mammal prokaryotic promoter. In some embodiments the promoter is a fused dual mammalian prokaryotic promoter.
The eukaryotic promoter may be constitutive, inducible or tissue specific. Exemplary eukaryotic promoters include but are not limited to CMV, EF1a, SV40, PGK1 (human or mouse), Ubc, human beta actin, CAG, TRE, UAS, Ac5, Polyhedrin, CaMKlla, GAL1, 10, TEF1, GDS, ADH1, CaMV35S, Ubi, H1 and U6.
Exemplary mammalian promoters include but are not limited to CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, H1 and U6. Exemplary prokaryotic promoters include but are not limited to T7, T7lac, Sp6, araBAD, trp, lac, Ptac and pL.
In certain embodiments, the mammalian promoter is tissue specific. Exemplary tissue specific promoters include but are not limited to B29 promoter, CD14 promoter, CD43 promoter, CD45 promoter, CD68 promoter, Desmin promoter, promoter, Elastase-1 promoter, Endoglin promoter, Fibronectin promoter, Flt-1 promoter, GFAP promoter, GPllb promoter, ICAM-2 promoter, mIFN-β promoter, Mb promoter, Nphsl promoter, OG-2 promoter, SP-B promoter, SYN1 promoter, WASP promoter, SV40/bAlb promoter, SV40/hAlb promoter, SV40/CD43 promoter, SV40/CD45 promoter and NSE/RU5′ promoter.
In specific embodiments, the vector is a DNA plasmid driven by a CMV promoter with or without a T7 promoter. In such embodiments, once the plasmid enters the cell, the plasmid DNA will drive expression of the positive stranded RNA replicon that will in turn drive replication of the negative strand RNA that will begin the self-amplifying mRNA cycle.
In more specific embodiments, the vector is a self-amplifying plasmid DNA vector with dual promoter (CMV and T7) encoding all or a portion of the replicon proteins from the SARS-COV-2 genome. In this embodiment, the CMV promoter and T7 promoter will drive synthesis of in vivo or in vitro transcribed mRNA respectively encoding all the replicon proteins necessary for self-amplification of mRNAs. Subsequently, one or more sub-genomic promoters drive expression of downstream payloads by the RNA dependent RNA polymerase from the SARS-COV-2 replicon proteins.
In other more specific embodiments, the vector is a self-amplifying plasmid DNA vector with dual promoter (CMV and T7) and encoding all or a portion of the replicon proteins from the VEE genome. In this embodiment, the CMV promoter and T7 promoter will drive synthesis of in vivo or in vitro transcribed mRNA respectively encoding all the replicon proteins necessary for self-amplification of mRNAs. Subsequently, one or more sub-genomic promoters drive expression of downstream payloads by the RNA dependent RNA polymerase from the VEE replicon proteins.
In certain embodiments, the self-amplifying plasmid DNA vector comprises the Chicken Beta Actin (CBA) and T7 promoter.
In certain embodiments of the invention, the vector is derived from viruses belonging to the family Arteriviridae, including but not limited to viruses belonging to the genus Arterivirus. In certain embodiments, the vector is derived from viruses belonging to the family Coronaviridae.
In specific embodiments the vector is derived from viruses belonging to the subfamily Coronavirinae. In more specific embodiments, the vector is derived from viruses belonging to the genuses Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. In certain embodiments, the vector is derived from viruses belonging to subfamily Torovirinae. In more specific embodiments, the vector is derived from viruses belonging to the genus Torovirus). Other related viruses infecting humans or other organisms targeted by the delivery system may be considered in other embodiments.
In some embodiments, shorter forms of replicons, derived from the original nidoviral replicon by deleting one or more viral genes, are used. In specific embodiments, some shortened replicons have a size similar to, or shorter than, that of alphaviral vectors.
In particular embodiments of the invention, the vector is derived from SARS-COV-2 (the causative agent of COVID-19). The complete genome of SARS-COV-2 is known in the art and is published under GenBank Accession NC_045512 (Nature 579 (7798), 265-269 (2020)). The sequence of variants of SARS-COV-2 are also known in the art.
In certain embodiments, a vaccine vector based on the SARS-COV-2 replicon or portion thereof induces better immunity against SARS-COV-2 than what would be achieved by using a different viral vector.
In certain embodiments of invention, the vector is made of the full viral replicon (i.e., the 5′ leader sequence, followed by the viral replicase gene), followed by the payload, followed by the viral 3′ terminal segment.
In certain embodiments of the invention, the full replicon is the SARS-COV-2 replicon, as per (using the notation employed in GenBank accession NC_045512.2) the following Table 1:
In other embodiments, the replicon consists of the above without the ORF10 gene (i.e., without viral nucleotides 29558 . . . 29674). In such embodiment the structure of the vector is as follows:
In other embodiments of the invention, the replicon is a shortened SARS-COV-2 replicon whereby the viral genes from nsp2 to nsp4 have been deleted. The sequence of this embodiment in terms of genomic ranges of NC_045512.2 is detailed in the following Table 8a:
In other embodiments, the replicon consists of the above without the ORF10 gene (i.e., without viral nucleotides 29558 . . . 29674). In such embodiments, the structure of the vector is as follows:
Non-limiting exemplary vectors based on SARS-COV-2 are shown in Figures
In some embodiments of the invention, the vector is derived from viruses belonging to the family Togaviridae, including but not limited to viruses belonging to the genus Alphavirus. In certain embodiments, the virus can be any virus belonging to any of the seven major alphavirus complexes, namely: the Barmah Forest virus complex; the Eastern equine encephalitis complex; the Middelburg virus complex; the Ndumu virus complex; the Semliki Forest virus complex; the Venezuelan equine encephalitis complex; the Western equine encephalitis complex (and/or any other similar virus that should be discovered or classified as belonging to the order Martellivirales in the future). Other related viruses infecting humans or the organism targeted by the delivery system may be considered in other embodiments. In some embodiments, shorter forms of replicons, derived from the original viral replicon by deleting one or more viral genes is used.
In particular embodiments of the invention, the vector is derived from VEEV (the causative agent of Venezuelan Equine Encephalitis). The complete genome of VEEV is known in the art and is published under GenBank Accession NC_001449.
In certain embodiments, a vaccine vector based on the VEEV replicon or portion thereof induces better immunity against VEE than what would be achieved by using a different viral vector.
In certain embodiments of the invention, the vector is made of the full viral replicon (i.e. the 5′ leader sequence, followed by the viral replicase gene), followed by the payload, followed by the viral 3′ terminal segment.
In certain embodiments of the invention, the full replicon is the VEEV replicon, as per (using the notation employed in GenBank accession NC_001449.1) the following Table:
Non-limiting exemplary vectors based on VEEV are shown in Figures
In certain embodiments of the invention, the vector is derived from viruses belonging to the family Matonaviridae, including but not limited to viruses belonging to the genus Rubivirus. Other related viruses infecting humans or the organism targeted by the delivery system may be considered in other embodiments. In some embodiments, shorter forms of replicons, derived from the original viral replicon by deleting one or more viral genes may be used.
In particular embodiments of the invention, the vector is derived from RUBV (the causative agent of rubella). The complete genome of RUBV is known in the art and is published under GenBank Accession NC_001545.
In certain embodiments, a vaccine vector based on the RUBV replicon induces better immunity against rubella than what would be achieved by using a different viral vector.
In certain embodiments of the invention, the vector is made of the full viral replicon (i.e. the 5′ leader sequence, followed by the viral replicase gene), followed by the payload, followed by the viral 3′ terminal segment. This sequence is only indicative and does not represent the only possibility to embody the idea described in this invention.
In another embodiment, the replicon is obtained by taking the 5′-most part of the virus, up to the viral transcription-regulating sequence for the first sub-genomic mRNA. No 3′ terminal segment is added, in order to increase viral replication in certain situations.
In one embodiment of this invention, the full replicon is the RUBV replicon, as per (using the notation employed in GenBank accession NC_001545.2) the following Table 10:
The vectors of the present invention may be utilized to express a variety of payloads, including one or more nucleic acids, one or more peptides and one or more polypeptides.
In certain embodiments, the payload is RNA, including but not limited to siRNA and shRNA. In certain embodiments, the payload is one or more polypeptides. The polypeptide(s) may be any polypeptide. Exemplary polypeptides including but not limited to immunogens; epitopes; antibodies, SFv; immunomodulatory molecules including but not limited to cytokines; growth factors; fusion proteins; CRISPR CAS9 or other recombinase system and any other therapeutic proteins.
In certain embodiments, the payload comprises one or more immunogens and/or epitopes alone or in combination with one or more other polypeptides. The one or more immunogens and/or epitopes can be from one or more pathogens or one or more cancer immunogens and/or epitopes.
In certain embodiments, at least one payload is a recombinant protein, siRNA, IncRNA, microRNA or an aptamer. Exemplary proteins include but are not limited to an antibody, Bispecific T Cells Engager (BiTE), nanobody, chemokine, cytokine, growth factor or angiogenesis inhibitors.
In certain embodiments, the payload is a suicide protein. In certain embodiments, the payload is thymidine kinase. In such embodiments, ganciclovir is administered to kill cells expressing thymidine kinase.
A vaccine vector based on a particular viral replicon or portion thereof may induce better immunity against the particular viral pathogen than what would be achieved by using a different viral vector. Accordingly, in certain embodiments, a vector based on a particular viral replicon or portion thereof is utilized to express immunogens and/or epitopes from the same viral pathogen. For example, a viral vector derived from SARS-COV-2 replicon or portion thereof is utilized to express SARS-COV-2 immunogens and/or epitopes; a vector derived from VEEV is utilized to express VEEV immunogens and/or epitopes; a vector derived from RUBV is utilized to express RUBV epitopes; and so on). In other embodiments, the vectors may be utilized to express unrelated immunogens and/or epitopes.
In certain embodiments, the vector is derived from the SARS-COV-2 replicon or portion thereof and expresses one or more immunogens/epitopes from one or more SARS-COV-2 proteins.
Exemplary immunogens/epitopes include immunogens/epitopes from one or more of SARS-CoV2 Spike, N, M, NSP1, NSP2, Proteinase 3CL-Pro, NSP7, NSP8, NSP9, NSP10, helicase, exonuclease, endonuclease, methyltransferase, ORF6, N protein, ORF10, papain-like protease, NSP4, RNA dependent RNA polymerase, ORF7a, ORF8, fragments and variants thereof. In certain embodiments, the one or more SARs-COV-2 proteins comprise Spike protein.
In certain embodiments, the vector is derived from the VEEV replicon or portion thereof and expresses one or more immunogens/epitopes from one or more VEEV proteins.
In certain embodiments, the vector is derived from the RUBV replicon or portion thereof and expresses one or more immunogens/epitopes from one or more RUBV proteins.
In certain embodiments, the payload comprises a collection of peptides. An exemplary method of formulating a payload made of a collection of peptides is as follows: The peptides can be split into subset of peptides, named Subset1, Subset2, etc. In one embodiment of this invention, the total lengths of the peptides in each subset are chosen so as to make the overall lengths of the subsets as close as possible. In other embodiments, the lengths are chosen according to the measured abundances of each subgenomic RNAs produced by the vector of choice, in order to make the number of expressed peptides as balanced as possible.
In one embodiment of the invention, a generic virus belonging to any of the orders Nidovirales, Martellivirlaes, or Hepelivirales is utilized as the source for the vector, as described above. the viral Transcription-Regulation Sequence (TRS) that comes before each viral sub-genomic mRNA, and the amino-acid recognition/cleavage sequence for the main viral protease (Protease Recognition Sequence, PRS) is determined or known in the art. Both sequences depend on the virus of choice; given the sequence of the viral genome, a worker skilled in the art could readily determine the sequences. In some embodiments of the invention, the PRS corresponds to a cleavage sequence for any host-specific endogenous protease. A worker skilled in the could readily determine such sequences.
In certain embodiments, the payload is formulated as per the following Table (Peptide(1,1) denotes the first peptide of the first subset, Peptide(2,1) the second peptide of the first subset, and so on; the last peptide of subset i will be Peptide(ni,i); backtranslate( ) is a function translating a peptide sequence back to DNA, and possibly performing other operations such as codon optimization and removal of spurious signals):
In certain embodiments of the invention, the number of subgenomic mRNAs is close to that of the subgenomic mRNAs present in the virus the vector is derived from.
In another embodiment, the vector is derived from the SARS-COV-2 genome. In such an embodiment, the TRS comprises ACGAAC, and the PRS comprises the motif [AVTP][TKRV]LQ[AS], where letters in square brackets indicate alternative amino acids and the letters are listed in order of decreasing frequency—in specific embodiments the PRS comprises ATLQA. The payload is then formulated in terms of the following Table:
In another embodiment, the vector is derived from the VEEV genome. In such embodiments, the TRS comprises CTCTCTACGGCTAACCTGAATGGA, and the PRS comprises the motif QEAGAG. The payload is then formulated in terms of the following Table:
In yet another embodiment, the vector is derived from the RUBV genome. In such a case, the TRS comprises GCCTTTAATCTTACCTACTCTAACCAGGTCATCACCCAC, and the PRS comprises to the amino acid sequence LALAA, which is compatible with [L][AVS][LS][AG][AQ], the recognition motif for the endogenous eukaryotic signal peptidase I, SPase I. The payload is then formulated in terms of the following Table:
In other embodiments, payloads for vectors derived from other viruses can be constructed following the same rules, provided that suitable choices are made for the TRS and the PRS sequence—how to do it will be straightforward to many people skilled in the field.
The present invention further comprises pharmaceutical compositions and vaccine formulations. The pharmaceutical compositions and vaccines formulations may also comprise pharmaceutically acceptable carriers, excipients and/or adjuvants. Adjuvants and carriers suitable for administering genetic vaccines and immunogens are known in the art. Conventional carriers and adjuvants are for example reviewed in Kiyono et al. 1996.
A vaccine adjuvant is a component that potentiates the immune responses to an antigen and/or modulates it towards the desired immune responses. A vaccine may include one or more adjuvants. Exemplary adjuvants include mineral salts including but not limited to aluminium salts (such as amorphous aluminum hydroxyphosphate sulfate (AAHS), aluminum hydroxide, aluminum phosphate, potassium aluminum sulfate (Alum)) and calcium phosphate gels; Oil emulsions and surfactant based formulations, including but not limited to MF59, QS21 (purified saponin), AS02 [SBAS2] (oil-in-water emulsion+MPL+QS-21), Montanide ISA-51 and ISA-720 (immunoprec water-in-oil emulsion); Particulate adjuvants, including but not limited to virosomes (unilamellar liposomal vehicles incorporating influenza haemagglutinin), AS04 ([SBAS4] Al salt with MPL), ISCOMS (structured complex of saponins and lipids), polylactide co-glycolide (PLG). And; microbial derivatives (natural and synthetic), including but not limited to monophosphoryl lipid A (MPL), Detox (MPL+M. phlei cell wall skeleton), AGP [RC-529] (synthetic acylated monosaccharide), DC_Chol (lipoidal immunostimulators able to self mmunopr into liposomes), OM-174 (lipid A derivative), CpG motifs (synthetic oligonucleotides containing immunostimulatory CpG motifs), modified LT and CT (genetically modified bacterial toxins to provide non-toxic adjuvant effects); endogenous human immunomodulators, including but not limited to hGM-CSF or hIL-12 (cytokines that can be administered either as protein or plasmid encoded), Immudaptin (C3d tandem array) and inert vehicles, such as gold particles.
The pharmaceutical compositions and vaccine formulations may also comprise a stabilizer. Suitable stabilizers are known in the art and include but are not limited to amino acids, antioxidants, cyclodextrins, proteins, sugars/sugar alcohols, and surfactants. See for example Morefield, AAPS J 2011 June; 13(2): 191-200; https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3085699/).
The vectors can be incorporated into liposomes, microspheres or other polymer matrices. Liposomes can consist of phospholipids or other lipids, and can be nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer.
Previously, it has been found that a SARS-COV-2 SAM lipid nanoparticle (LNP) vaccine induced high neutralizing antibody titers in mice (Mckay et al., Nat Commun 11, 3523 (2020). https://doi.org/10.1038/s41467-020-17409-9). Briefly, the LNP (described in US patent U.S. Pat. No. 10,221,127) contains an ionizable cationic lipid phosphatidylcholine/cholesterol/PEG-lipid. The SAM RNA were encapsulated in LNP using a self-assembly process in which an aqueous solution of SAM RNA at pH=4.0 is rapidly mixed with an ethanolic lipid mixture. LNP.
Accordingly, in certain embodiments, the pharmaceutical compositions and vaccines formulations comprise lipid nanoparticle delivery formulations of vector. Optionally, the lipid is cationic. Appropriate cationic lipids are known in the art. Non-limiting examples include phosphatidylcholine/cholesterol/PEG-lipid, C12-200, dimethyldioctadecylammonium (DDA), 1,2-dioleoyl-3-trimethylammonium propane (DOTAP) or 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA). Also see for example, U.S. Pat. No. 10,221,127 (incorporated by reference) and Reichmuth A M et al. (Therapeutic Delivery. 2016; 7(5):319-334. DOI: 10.4155/tde-2016-0006). In specific embodiments, the LNPs comprise an ionizable cationic lipid (phosphatidylcholine:cholesterol/PEG-lipid (50:10:38.5:1.5 mol/mol). In certain embodiments, the vector to total lipid ratio in the LNP is approximately 0.05 (wt/wt). In certain embodiments, the LNPs have a diameter of ˜80 nm.
In certain embodiments, charge-altering releasable transporters (CARTs) are used to deliver the vectors. In certain embodiments, the vector is formulated as a VLP.
The present invention further provides a method of delivering a payload of interest to a cell, the method comprising contacting the cell (either in vitro or in vivo) with a vector of the present invention which expresses the payload. The cell may be a prokaryotic or eukaryotic cell. In certain embodiments, expression of the payload prevents, delays and/or treats disease.
The vector may be administered to a variety of subjects. Including but not limited to prokaryotes and eukaryotes. In certain embodiments, the vector the subject is a human or other animals, including but not limited to other mammals, such as non-human primates, cats, dogs, equines (including but not limited to horses, donkeys and zebras), camels, sheep, goats, and bovines (including but not limited to cows).
In certain embodiments, the vectors of the present invention are used as a vaccine. Accordingly, also provided herein is a method of treating, protecting against, and/or preventing disease associated with the infectious agent in a subject in need thereof by administering the vaccine to the subject. For example, a worker skilled in the art would readily appreciate that a SARS-COV-2 vaccine may be used treating, protecting against, and/or preventing disease associated with SARS-COV-2 (i.e. COVID 19). Administration of the vaccine to the subject can induce or elicit a specific immune response against the vaccine target in the subject.
The induced immune response can be used to treat, prevent, and/or protect against disease related to the vaccine target. For example, a SARS-COV-2 vaccine to the subject can induce or elicit a specific immune response against the SARS-COV-2 virus in the subject. The induced immune response provides the subject administered the vaccine with protection against the vaccine target, such as a SARS-COV-2 vaccine provides resistance to SARS-COV-2.
The induced immune response can include an induced humoral immune response and/or an induced cellular immune response. The induced humoral immune response can include IgG antibodies and/or neutralizing antibodies that are reactive to the antigen. The induced cellular immune response can include a CD8+ T cell response. The number of vaccine doses for effective treatment can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
The vector can be formulated in accordance with standard techniques well known to those skilled in the pharmaceutical art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration. The vector can be administered prophylactically or therapeutically.
The vector can be administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)); Felgner et al. (U.S. Pat. No. 5,580,859, issued Dec. 3, 1996); Felgner (U.S. Pat. No. 5,703,055, issued Dec. 30, 1997); and Carson et al. (U.S. Pat. No. 5,679,647, issued Oct. 21, 1997). The vector can be complexed to particles or beads that can be administered to an individual, for example, using a vaccine gun. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the expression vector.
The vector can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular or subcutaneous delivery. Other routes include oral administration, intranasal, and intravaginal routes. The vector can be delivered to the interstitial spaces of tissues of an individual (Felgner et al., U.S. Pat. Nos. 5,580,859 and 5,703,055. The vector can also be administered to muscle, or can be administered via intradermal or subcutaneous injections, or transdermally, such as by iontophoresis. Epidermal administration of the vector can also be employed. Epidermal administration can involve mechanically or chemically irritating the outermost layer of epidermis.
The vector can also be formulated for administration via the nasal passages. Formulations suitable for nasal administration, wherein the carrier is a solid, can include a coarse powder having a particle size, for example, in the range of about 10 to about 500 microns which is administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. The formulation can be a nasal spray, nasal drops, or by aerosol administration by nebulizer. The formulation can include aqueous or oily solutions of the vaccine.
The vector can be a liquid preparation such as a suspension, syrup or elixir. The vaccine can also be a preparation for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration), such as a sterile suspension or emulsion.
The vector can be administered via electroporation, such as by a method described in U.S. Pat. No. 7,664,545. The electroporation can be by a method and/or apparatus described in U.S. Pat. Nos. 6,302,874; 5,676,646; 6,241,701; 6,233,482; 6,216,034; 6,208,893; 6,192,270; 6,181,964; 6,150,148; 6,120,493; 6,096,020; 6,068,650; and 5,702,359. The electroporation may be carried out via a minimally invasive device.
The vector may be used in imaging. For example, the vector may express a fluorescent protein.
The DNA sequence of the construct is listed in the following Table:
The features present in the construct are listed in the following table:
The DNA sequence of the construct is listed in the following Table 4:
The features present in the construct are listed in the following table:
The DNA sequence of the construct is listed in the following table:
Time Course after Transfection with Self-Amplifying VEE Vector:
Rationale: The first transcription driven by CMV promoter results in the SAM for EGFP and so the number of EGFP positive cells continuously increases over time while the typical transgene disappears soon without antibiotics selection after several cell divisions because they can't self replicate
RT-PCR to Show the mRNA from the Self-Amplifying VEE Vector:
The HEK 293 cells are seeded at the cell density of 5×105 per well to achieve 70 to 90% confluency in a 6-well plate a day prior to the transfection. Transfection was performed with DNA or IVT mRNA from the vector according to the protocol for Lipofectamine 300 of Thermofisher scientific. The cells were harvested 48 hrs after the transfection for RNA extraction. Total mRNA was checked on the 0.8% agarose gel for its integrity. 1 ug of total mRNA was treated with amplification grade DNase I to remove any residual DNA. mRNA was subject to CDNA synthesis by the superscript III enzyme. The gene specific primer annealed to the (−) negative strand was used to synthesize cDNA from the mRNA of transfected cells and IVT mRNA as a negative control. PCR to amplifying GFP was done to show mRNA produced from the DNA and mRNA amplifies continuously.
Vaccine protocol detailed in
For the ELISA protocol (see
The plates were read at 450 nm and the resulting data was exported to the excel file. The data was further analyzed using Graphpad prism software. In Brief, a standard curve was set up with known antibody concentrations binding to the spike protein. This standard curve was then used to interpolate and quantify the serum sample values for IgG, IgM and IgA. Analysis of Variance (ANOVA) statistical test along with Tukey's and Dunnett's posthoc tests were used to test significant differences between the groups and p values greater than 0.05 were considered significant. Our results show a significant increase in IgG and IgM antibodies in response to our vaccinations against SARS-COV-2 spike protein. The IgG results show that the IgG response was greater with self-amplifying DNA vaccines compared to the self-amplifying RNA vaccines. The results also suggest a robust IgM antibody response against SARS-COV-2 spike protein in response to our vaccine. In comparison, our vaccines did not induce any good IgA antibodies.
In a small-scale preclinical study, groups of 15 week old K18-hACE2 transgenic mice will be immunized with different vaccines targeting SARS-COV-2. Including a group identical to one in a previous trial at UofT, to enable comparison between the two different facilities. Mice will be immunized by intramuscular injection and boosted with the same vaccine after 28 days (4 weeks). Mice will be monitored for any behavioural changes and weight loss. Blood samples will be taken by saphenous vein bleed before vaccination at day −1 also at day 7, day 14, and day 28 post-prime vaccination. After 42 days (6 weeks), mice will be euthanized and tissues and blood harvested for immune assay studies.
Summary: Intramuscular immunization of mice with 4 different vaccines, total 11 groups of 4 mice per group (44 mice). Mice will be monitored throughout study, blood samples are collected at day −1, 7, 14 and 28, boost IM injection on day 28. End experiment at day 42, collect blood, leg muscle for injection site and various organs as detailed below.
Monitoring Throughout Study: Monitor daily for three days post injection and two days post blood sample collection otherwise monitor weekly. Record body weight and any body condition/behavioural changes, with an end-point at 20% overall weight loss or 10% weight loss from previous weight.
Day −3: Blood sample collection, saphenous bleed from left leg using serum/EDTA capillary tubes, approx. 50 μl.
Intramuscular vaccinations as detailed below, volume max. 50 μl into right hind leg (caudal thigh muscle, mark injection site). All groups, dose was 2.5 μg RNA or DNA per mouse, in liposome/LNP. C #relate to our Construct Numbers each vaccine is derived from.
Day 13/14: Blood sample collection, saphenous bleed from left hind leg using serum/EDTA capillary tubes, approx. 50 μl.
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. The word “comprising” is used herein as an open ended term, substantially equivalent to the phrase “including, but not limited to”, and the word “comprises” has a corresponding meaning. As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a thing” includes more than one such thing. Citation of references herein is not an admission that such references are prior art to an embodiment of the present invention. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings. Titles, headings, or the like are provided to enhance the reader's comprehension of this document, and should not be read as limiting the scope of the present invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CA2022/050841 | 5/26/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63193177 | May 2021 | US |
