FUNGAL RESISTANT PLANTS EXPRESSING HCP6

Information

  • Patent Application
  • 20150361443
  • Publication Number
    20150361443
  • Date Filed
    January 10, 2014
    11 years ago
  • Date Published
    December 17, 2015
    9 years ago
Abstract
The present invention relates to a method of increasing resistance against fungal pathogens of the family Phacosporaceae in plants and/or plant cells. This is achieved by increasing the expression of an HCP6 protein or fragment thereof in a plant, plant part and/or plant cell in comparison to wild type plants, wild type plant parts and/or wild type plant cells. Furthermore, the invention relates to transgenic plants, plant parts, and/or plant cells having an increased resistance against fungal pathogens, in particular, pathogens of the family Phacopsoraceae, and to recombinant expression vectors comprising a sequence that is identical or homologous to a sequence encoding an HCP6 protein.
Description

This application claims priority to EP 13152971.1 filed Jan. 29, 2013, which is incorporated herein by reference in their entirety.


SUMMARY OF THE INVENTION

The present invention relates to a method of increasing resistance against fungal pathogens, in particular, pathogens of the family Phacopsoraceae, for example soybean rust, in plants, plant parts, and/or plant cells. This is achieved by increasing the expression and/or activity of an HCP6 protein in a plant, plant part and/or plant cell in comparison to wild type plants, wild type plant parts and/or wild type plant cells.


Furthermore, the invention relates to transgenic plants, plant parts, and/or plant cells having an increased resistance against fungal pathogens, in particular, pathogens of the family Phacopsoraceae, for example soybean rust, and to recombinant expression vectors comprising a sequence that is identical or homologous to a sequence encoding an HCP6 protein.


BACKGROUND OF THE INVENTION

The cultivation of agricultural crop plants serves mainly for the production of foodstuffs for humans and animals. Monocultures in particular, which are the rule nowadays, are highly susceptible to an epidemic-like spreading of diseases. The result is markedly reduced yields. To date, the pathogenic organisms have been controlled mainly by using pesticides. Nowadays, the possibility of directly modifying the genetic disposition of a plant or pathogen is also open to man.


Resistance generally describes the ability of a plant to prevent, or at least curtail the infestation and colonization by a harmful pathogen. Different mechanisms can be discerned in the naturally occurring resistance, with which the plants fend off colonization by phytopathogenic organisms. These specific interactions between the pathogen and the host determine the course of infection (Schopfer and Brennicke (1999) Pflanzenphysiologie, Springer Verlag, Berlin-Heidelberg, Germany).


With regard to the race specific resistance, also called host resistance, a differentiation is made between compatible and incompatible interactions. In the compatible interaction, an interaction occurs between a virulent pathogen and a susceptible plant. The pathogen survives, and may build up reproduction structures, while the host mostly dies off. An incompatible interaction occurs on the other hand when the pathogen infects the plant but is inhibited in its growth before or after weak development of symptoms (mostly by the presence of R genes of the NBS-LRR family, see below). In the latter case, the plant is resistant to the respective pathogen (Schopfer and Brennicke, vide supra). However, this type of resistance is specific for a certain strain or pathogen.


In both compatible and incompatible interactions a defensive and specific reaction of the host to the pathogen occurs. In nature, however, this resistance is often overcome because of the rapid evolutionary development of new virulent races of the pathogens (Neu et al. (2003) American Cytopathol. Society, MPMI 16 No. 7: 626-633).


Most pathogens are plant-species specific. This means that a pathogen can induce a disease in a certain plant species, but not in other plant species (Heath (2002) Can. J. Plant Pathol. 24: 259-264). The resistance against a pathogen in certain plant species is called non-host resistance. The non-host resistance offers strong, broad, and permanent protection from phytopathogens. Genes providing non-host resistance provide the opportunity of a strong, broad and permanent protection against certain diseases in non-host plants. In particular, such a resistance works for different strains of the pathogen.


Fungi are distributed worldwide. Approximately 100 000 different fungal species are known to date. Thereof rusts are of great importance. They can have a complicated development cycle with up to five different spore stages (spermatium, aecidiospore, uredospore, teleutospore and basidiospore).


During the infection of plants by pathogenic fungi, different phases are usually observed. The first phases of the interaction between phytopathogenic fungi and their potential host plants are decisive for the colonization of the plant by the fungus. During the first stage of the infection, the spores become attached to the surface of the plants, germinate, and the fungus penetrates the plant. Fungi may penetrate the plant via existing ports such as stomata, lenticels, hydatodes and wounds, or else they penetrate the plant epidermis directly as the result of the mechanical force and with the aid of cell-wall-digesting enzymes. Specific infection structures are developed for penetration of the plant.


Immediately after recognition of a potential pathogen the plant starts to elicit defense reactions. Mostly the presence of the pathogen is sensed via so called PAMP receptors, a class of trans-membrane receptor like kinases recognizing conserved pathogen associated molecules (e.g. flagellin or chitin). Downstream of the PAMP receptors, the phytohormones salicylic acid (SA), jasmonate (JA) and ethylene (ET) play a critical role in the regulation of the different defense reactions. Depending on the ratio of the different phytohormones, different defense reactions are elicited by the host cell. Generally SA dependent defense is linked with resistance against biotrophic pathogens, whereas JA/ET dependent defense reactions are active against necrotrophic pathogens (and insects).


Another more specific resistance mechanism is based on the presence of so called resistance genes (R-genes). Most R genes belong to the nucleotide-binding site-leucine-rich repeat (NBS-LRR) gene family and function in monitoring the presence of pathogen effector proteins (virulence factors; avirulence factors). After recognizing the pathogen derived proteins a strong defense reaction (mostly accompanied by a programmed cell death) is elicited.


The soybean rust Phakopsora pachyrhizi directly penetrates the plant epidermis. After crossing the epidermal cell, the fungus reaches the intercellular space of the mesophyll, where the fungus starts to spread through the leaves. To acquire nutrients the fungus penetrates mesophyll cells and develops haustoria inside the mesophyl cell. During the penetration process the plasmamembrane of the penetrated mesophyll cell stays intact. Therefore the soybean rust fungus establishes a biotrophic interaction with soybean.


The biotrophic phytopathogenic fungi, such as soybean rust and all other rust fungi, depend for their nutrition on the metabolism of living cells of the plants. This type of fungi belong to the group of biotrophic fungi, like other rust fungi, powdery mildew fungi or oomycete pathogens like the genus Phytophthora or Peronospora The necrotrophic phytopathogenic fungi depend for their nutrition on dead cells of the plants, e.g. species from the genus Fusarium, Rhizoctonia or Mycospaerella Soybean rust has occupied an intermediate position, since it penetrates the epidermis directly, whereupon the penetrated cell becomes necrotic. After the penetration, the fungus changes over to an obligatory-biotrophic lifestyle. The subgroup of the biotrophic fungal pathogens which follows essentially such an infection strategy is heminecrotrohic. In contrast to a heminecrotrophic pathogen, a hemibiotrophic pathogen lives for a short period of time in a biotrophic manner and subsequently starts killing the host cell and/or host organism, i.e., changes for the rest of its life-cycle to a necrotrophic life-style.


Soybean rust has become increasingly important in recent times. The disease may be caused by the biotrophic rusts Phakopsora pachyrhizi and Phakopsora meibomiae. They belong to the class Basidiomycota, order Uredinales, family Phakopsoraceae. Both rusts infect a wide spectrum of leguminosic host plants. P. pachyrhizi, also referred to as Asian rust, is the more aggressive pathogen on soy (Glycine max), and is therefore, at least currently, of great importance for agriculture. P. pachyrhizi can be found in nearly all tropical and subtropical soy growing regions of the world. P. pachyrhizi is capable of infecting 31 species from 17 families of the Leguminosae under natural conditions and is capable of growing on further 60 species under controlled conditions (Sinclair et al. (eds.), Proceedings of the rust workshop (1995), National SoyaResearch Laboratory, Publication No. 1 (1996); Rytter J. L. et al., Plant Dis. 87, 818 (1984)). P. meibomiae has been found in the Caribbean Basin and in Puerto Rico, and has not caused substantial damage as yet.



P. pachyrhizi can currently be controlled in the field only by means of fungicides. Soy plants with resistance to the entire spectrum of the isolates are not available. When searching for resistant soybean accessions, six dominant R-genes of the NBS-LRR family, named Rpp1-5 and Rpp?(Hyuuga), which mediate resistance of soy to P. pachyrhizi, were discovered by screening thousands of soybean varieties. As the R-genes are derived from a host (soybean), the resistance was lost rapidly, as P. pachyrhizi develops new virulent races. Therefore there is a strong need to discover R-genes that are derived from non-hosts plants (e.g. Arabidopsis) as they are thought to be more durable.


In recent years, fungal diseases, e.g. soybean rust, has gained in importance as pest in agricultural production. There was therefore a demand in the prior art for developing methods to control fungi and to provide fungal resistant plants.


Much research has been performed on the field of powdery and downy mildew infecting the epidermal layer of plants. However, the problem to cope with soybean rust which infects the mesophyll remains unsolved.


The object of the present invention is inter alia to provide a method of increasing resistance against fungal pathogens, preferably rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably against fungal pathogens of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust.


Surprisingly, we found that fungal pathogens, in particular of the family Phacopsoraceae, for example soybean rust, can be controlled by increasing the expression of an HCP6 protein.


The present invention therefore provides a method of increasing resistance against fungal pathogens, preferably against rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably against fungal pathogens of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust, in transgenic plants, transgenic plant parts, or transgenic plant cells by overexpressing one or more HCP6 nucleic acids.


A further object is to provide transgenic plants resistant against fungal pathogens, preferably rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust, a method for producing such plants as well as a vector construct useful for the above methods.


Therefore, the present invention also refers to a recombinant vector construct and a transgenic plant, transgenic plant part, or transgenic plant cell comprising an exogenous HCP6 nucleic acid. Furthermore, a method for the production of a transgenic plant, transgenic plant part or transgenic plant cell using the nucleic acid of the present invention is claimed herein. In addition, the use of a nucleic acid or the recombinant vector of the present invention for the transformation of a plant, plant part, or plant cell is claimed herein.


The objects of the present invention, as outlined above, are achieved by the subject-matter of the main claims. Preferred embodiments of the invention are defined by the subject matter of the dependent claims.


BRIEF SUMMARY OF THE INVENTION

The object of the present invention is inter alia to provide a method of increasing resistance against fungal pathogens, preferably rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably against fungal pathogens of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust.


Surprisingly, we found that resistance against fungal pathogens, in particular of the family Phacopsoraceae, for example soybean rust, can be enhanced by increasing the expression of a HCP6 protein.


The present invention therefore provides a method of increasing resistance against fungal pathogens, preferably rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably against fungal pathogens of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust, in transgenic plants, transgenic plant parts, or transgenic plant cells by overexpressing one or more HCP6 nucleic acids.


A further object is to provide transgenic plants resistant against fungal pathogens, preferably rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust, a method for producing such plants as well as a vector construct useful for the above methods.


Therefore, the present invention also refers to a recombinant vector construct and a transgenic plant, transgenic plant part, or transgenic plant cell comprising an exogenous HCP6 nucleic acid. Furthermore, a method for the production of a transgenic plant, transgenic plant part or transgenic plant cell using the nucleic acid of the present invention is claimed herein. In addition, the use of a nucleic acid or the recombinant vector of the present invention for the transformation of a plant, plant part, or plant cell is claimed herein.


The objects of the present invention, as outlined above, are achieved by the subject-matter of the main claims. Preferred embodiments of the invention are defined by the subject matter of the dependent claims.





BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS


FIG. 1 shows the scoring system used to determine the level of diseased leaf area of wildtype and transgenic soy plants against the rust fungus P. pachyrhizi (as described in GODOY, C. V., KOGA, L. J. & CANTERI, M. G. Diagrammatic scale for assessment of soybean rust severity. Fitopatologia Brasileira 31:063-068. 2006).



FIG. 2 shows the schematic illustration of the plant transformation vector harboring the HCP6 cDNA under control of the parsley ubiquitine promoter.



FIG. 3 shows the alignment of the Arabidopsis genome sequence (TAIR accession No 6530301567, AT1G56520, SEQ ID NO: 5), the putative cDNAs (derived from the genomic sequence; HCP6: accession No. NM104528, AT1G56520.1, SEQ ID NO: 1; CDS2: TAIR accession No 6530298775, AT1G56520.2, SEQ ID NO: 3), and the optimized sequence of the HCP6 (HCP6_opt) that is codon optimized for optimal expression in soybean (SEQ ID NO: 6).



FIG. 4 shows the alignment of the Arabidopsis HCP6 protein (SEQ ID NO: 2), the HCP6_opt protein, encoded by the codon optimized HCP6 sequence (SEQ ID NO: 6), which is identical to HCP6 protein (SEQ ID NO: 2) and the second predicted protein (CDS2: protein accession No F4I552, AT1G56520.2, SEQ ID NO: 4) based on bioinformatics analysis of the genomic sequence of At1g56520 (SEQ ID NO: 5).



FIG. 5 shows the full-length-sequence of the HCP6 gene from Arabidopsis thaliana having SEQ ID NO: 1.



FIG. 6 shows the sequence of the HCP6 protein (SEQ ID NO: 2).



FIG. 7 shows the sequence of the optimized HCP6 gene, which is codon optimized for optimal expression in soybean (Glycine max) having SEQ ID NO: 6.



FIG. 8 shows the result of the scoring of 44 transgenic soy plants (derived from 5 independent events, 7-10 plants per event) expressing the HCP6 overexpression vector construct. T1 soybean plants expressing HCP6 protein were inoculated with spores of Phakopsora pachyrhizi The evaluation of the diseased leaf area on all leaves was performed 14 days after inoculation. The average of the percentage of the leaf area showing fungal colonies or strong yellowing/browning on all leaves was considered as diseased leaf area. At all 44 soybean T1 plants expressing HCP6 (expression checked by RT-PCR) were evaluated in parallel to non-transgenic control plants. The average of the diseased leaf area is shown in FIG. 8. Overexpression of HCP6 significantly (* : p<0.05) reduces the diseased leaf area in comparison to non-transgenic control plants by 26.1%.



FIG. 9 contains a brief description of the sequences of the sequence listing.





DETAILED DESCRIPTION OF THE INVENTION

The present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the invention and the examples included herein.


DEFINITIONS

Unless otherwise noted, the terms used herein are to be understood according to conventional usage by those of ordinary skill in the relevant art. In addition to the definitions of terms provided herein, definitions of common terms in molecular biology may also be found in Rieger et al., 1991 Glossary of genetics: classical and molecular, 5th Ed., Berlin: Springer-Verlag; and in Current Protocols in Molecular Biology, F. M. Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1998 Supplement).


It is to be understood that as used in the specification and in the claims, “a” or “an” can mean one or more, depending upon the context in which it is used. Thus, for example, reference to “a cell” can mean that at least one cell can be utilized. It is to be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.


Throughout this application, various publications are referenced. The disclosures of all of these publications and those references cited within those publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains. Standard techniques for cloning, DNA isolation, amplification and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like, and various separation techniques are those known and commonly employed by those skilled in the art. A number of standard techniques are described in Sambrook et al., 1989 Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory, Plainview, N.Y.; Maniatis et al., 1982 Molecular Cloning, Cold Spring Harbor Laboratory, Plainview, N.Y.; Wu (Ed.) 1993 Meth. Enzymol. 218, Part I; Wu (Ed.) 1979 Meth Enzymol. 68; Wu et al., (Eds.) 1983 Meth. Enzymol. 100 and 101; Grossman and Moldave (Eds.) 1980 Meth. Enzymol. 65; Miller (Ed.) 1972 Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; Old and Primrose, 1981 Principles of Gene Manipulation, University of California Press, Berkeley; Schleif and Wensink, 1982 Practical Methods in Molecular Biology; Glover (Ed.) 1985 DNA Cloning Vol. I and II, IRL Press, Oxford, UK; Hames and Higgins (Eds.) 1985 Nucleic Acid Hybridization, IRL Press, Oxford, UK; and Setlow and Hollaender 1979 Genetic Engineering: Principles and Methods, Vols. 1-4, Plenum Press, New York. Abbreviations and nomenclature, where employed, are deemed standard in the field and commonly used in professional journals such as those cited herein.


“Homologues” of a protein encompass peptides, oligopeptides, polypeptides, proteins and/or enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar functional activity as the unmodified protein from which they are derived.


“Homologues” of a nucleic acid encompass nucleotides and/or polynucleotides having nucleic acid substitutions, deletions and/or insertions relative to the unmodified nucleic acid in question, wherein the protein coded by such nucleic acids has similar functional activity as the unmodified protein coded by the unmodified nucleic acid from which they are derived. In particular, homologues of a nucleic acid may encompass substitutions on the basis of the degenerative amino acid code.


The terms “identity”, “homology” and “similarity” are used herein interchangeably. “Identity” or “homology” or “similarity” between two nucleic acids sequences or amino acid sequences refers in each case over the entire length of the respective HCP6 nucleic acid sequence or HCP6 amino acid sequence.


Preferably, “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over a particular region, determining the number of positions at which the identical base or amino acid occurs in both sequences in order to yield the number of matched positions, dividing the number of such positions by the total number of positions in the region being compared and multiplying the result by 100.


Methods for the alignment of sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the global (i.e. spanning the complete sequences) alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10) calculates percent sequence identity or similarity or homology and performs a statistical analysis of the identity or similarity or homology between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information (NCBI). Homologues may readily be identified using, for example, the ClustalW multiple sequence alignment algorithm (version 1.83), with the default pairwise alignment parameters, and a scoring method in percentage. Global percentages of similarity/homology/identity may also be determined using one of the methods available in the MatGAT software package (Campanella et al., BMC Bioinformatics. 2003 Jul. 10; 4:29. MatGAT: an application that generates similarity/homology/identity matrices using protein or DNA sequences). Minor manual editing may be performed to optimise alignment between conserved motifs, as would be apparent to a person skilled in the art. Furthermore, instead of using full-length sequences for the identification of homologues, specific domains may also be used. The sequence identity values may be determined over the entire nucleic acid or amino acid sequence or over selected domains or conserved motif(s), using the programs mentioned above using the default parameters. For local alignments, the SmithWaterman algorithm is particularly useful (Smith T F, Waterman M S (1981) J. Mol. Biol 147(1); 195-7).


The sequence identity may also be calculated by means of the Vector NTI Suite 7.1 program of the company Informax (USA) employing the Clustal Method (Higgins D G, Sharp P M. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 April; 5(2):151-1) with the following settings:


Multiple Alignment Parameter:


















Gap opening penalty
10



Gap extension penalty
10



Gap separation penalty range
 8



Gap separation penalty
off



% identity for alignment delay
40



Residue specific gaps
off



Hydrophilic residue gap
off



Transition weighing
 0










Pairwise Alignment Parameter:


















FAST algorithm
on



K-tuple size
1



Gap penalty
3



Window size
5



Number of best diagonals
5










Alternatively the identity may be determined according to Chenna, Ramu, Sugawara, Hideaki, Koike, Tadashi, Lopez, Rodrigo, Gibson, Toby J, Higgins, Desmond G, Thompson, Julie D. Multiple sequence alignment with the Clustal series of programs. (2003) Nucleic Acids Res 31 (13):3497-500, the web page: http://www.ebi.ac.uk/Tools/clustalw/index.html# and the following settings


















DNA Gap Open Penalty
15.0



DNA Gap Extension Penalty
6.66



DNA Matrix
Identity



Protein Gap Open Penalty
10.0



Protein Gap Extension Penalty
0.2



Protein matrix
Gonnet



Protein/DNA ENDGAP
−1



Protein/DNA GAPDIST
4










Sequence identity between the nucleic acid or protein useful according to the present invention and the HCP6 nucleic acids or HCP6 proteins may be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide or protein sequences by, for example, the SmithWaterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group).


A “deletion” refers to removal of one or more amino acids from a protein or to the removal of one or more nucleic acids from DNA, ssRNA and/or dsRNA.


An “insertion” refers to one or more amino acid residues or nucleic acid residues being introduced into a predetermined site in a protein or the nucleic acid.


A “substitution” refers to replacement of amino acids of the protein with other amino acids having similar properties (such as similar hydrophobicity, hydrophilicity, antigenicity, propensity to form or break α-helical structures or beta-sheet structures).


On the nucleic acid level a substitution refers to a replacement of one or more nucleotides with other nucleotides within a nucleic acid, wherein the protein coded by the modified nucleic acid has a similar function. In particular homologues of a nucleic acid encompass substitutions on the basis of the degenerative amino acid code.


Amino acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the protein and may range from 1 to 10 amino acids; insertions or deletion will usually be of the order of about 1 to 10 amino acid residues. The amino acid substitutions are preferably conservative amino acid substitutions. Conservative substitution tables are well known in the art (see for example Taylor W. R. (1986) The classification of amino acid conservation J Theor Biol., 119:205-18 and Table 1 below).









TABLE 1







Examples of conserved amino acid substitutions








Residue
Conservative Substitutions





A
G, V, I, L, M


C
S, T


E
D


D
E


G
A, V, I, L, M


F
Y, W


I
V, A, G, L, M


H
R, K


K
R, H


M
L, I, V, A, G


L
M, I, V, A, G


N
Q


Q
N


P


S
T, C


R
K, H


T
S, C


W
Y, F


V
I, A, G, L, M


Y
F, W









Amino acid substitutions, deletions and/or insertions may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation.


Methods for the manipulation of DNA sequences to produce substitution, insertion or deletion variants of a protein are well known in the art. For example, techniques for making substitution mutations at predetermined sites in DNA are well known to those skilled in the art and include M13 mutagenesis, T7-Gene in vitro mutagenesis (USB, Cleveland, Ohio), QuickChange Site Directed mutagenesis (Stratagene, San Diego, Calif.), PCR-mediated site-directed mutagenesis or other site-directed mutagenesis protocols.


Orthologues and paralogues encompass evolutionary concepts used to describe the ancestral relationships of genes. Paralogues are genes within the same species that have originated through duplication of an ancestral gene; orthologues are genes from different organisms that have originated through speciation, and are also derived from a common ancestral gene.


The terms “encode” or “coding for” is used for the capability of a nucleic acid to contain the information for the amino acid sequence of a protein via the genetic code, i.e., the succession of codons each being a sequence of three nucleotides, which specify which amino acid will be added next during protein synthesis. The terms “encode” or “coding for” therefore includes all possible reading frames of a nucleic acid. Furthermore, the terms “encode” or “coding for” also applies to a nucleic acid, which coding sequence is interrupted by noncoding nucleic acid sequences, which are removed prior translation, e.g., a nucleic acid sequence comprising introns.


The term “domain” refers to a set of amino acids conserved at specific positions along an alignment of sequences of evolutionarily related proteins. While amino acids at other positions can vary between homologues, amino acids that are highly conserved at specific positions indicate amino acids that are likely essential in the structure, stability or function of a protein.


Specialist databases exist for the identification of domains, for example, SMART (Schultz et al. (1998) Proc. Natl. Acad. Sci. USA 95, 5857-5864; Letunic et al. (2002) Nucleic Acids Res 30, 242-244), InterPro (Mulder et al., (2003) Nucl. Acids. Res. 31, 315-318), Prosite (Bucher and Bairoch (1994), A generalized profile syntax for biomolecular sequences motifs and its function in automatic sequence interpretation. (In) ISMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., pp 53-61, AAAI Press, Menlo Park; Hulo et al., Nucl. Acids. Res. 32:D134-D137, (2004)), or Pfam (Bateman et al., Nucleic Acids Research 30(1): 276-280 (2002)). A set of tools for in silico analysis of protein sequences is available on the ExPASy proteomics server (Swiss Institute of Bioinformatics (Gasteiger et al., ExPASy: the proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res. 31:3784-3788 (2003)). Domains or motifs may also be identified using routine techniques, such as by sequence alignment.


As used herein the terms “fungal-resistance”, “resistant to a fungus” and/or “fungalresistant” mean reducing, preventing, or delaying an infection by fungi. The term “resistance” refers to fungal resistance. Resistance does not imply that the plant necessarily has 100% resistance to infection. In preferred embodiments, enhancing or increasing fungal resistance means that resistance in a resistant plant is greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, greater than 90%, or greater than 95% in comparison to a wild type plant.


As used herein the terms “soybean rust-resistance”, “resistant to a soybean rust”, “soybean rust-resistant”, “rust-resistance”, “resistant to a rust”, or “rust-resistant” mean reducing or preventing or delaying an infection of a plant, plant part, or plant cell by Phacopsoracea, in particular Phakopsora pachyrhizi and Phakopsora meibomiae—also known as soybean rust or Asian Soybean Rust (ASR), as compared to a wild type plant, wild type plant part, or wild type plant cell. Resistance does not imply that the plant necessarily has 100% resistance to infection. In preferred embodiments, enhancing or increasing rust resistance means that rust resistance in a resistant plant is greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80%, greater than 90%, or greater than 95% in comparison to a wild type plant that is not resistant to soybean rust. Preferably the wild type plant is a plant of a similar, more preferably identical, genotype as the plant having increased resistance to the soybean rust, but does not comprise an exogenous HCP6 nucleic acid, functional fragments thereof and/or an exogenous nucleic acid capable of hybridizing with an HCP6 nucleic acid.


The level of fungal resistance of a plant can be determined in various ways, e.g. by scoring/measuring the infected leaf area in relation to the overall leaf area. Another possibility to determine the level of resistance is to count the number of soybean rust colonies on the plant or to measure the amount of spores produced by these colonies. Another way to resolve the degree of fungal infestation is to specifically measure the amount of rust DNA by quantitative (q) PCR. Specific probes and primer sequences for most fungal pathogens are available in the literature (Frederick R D, Snyder C L, Peterson G L, et al. 2002 Polymerase chain reaction assays for the detection and discrimination of the rust pathogens Phakopsora pachyrhizi and P. meibomiae, Phytopathology 92(2) 217-227).


The term “hybridization” as used herein includes “any process by which a strand of nucleic acid molecule joins with a complementary strand through base pairing” (J. Coombs (1994) Dictionary of Biotechnology, Stockton Press, New York). Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acid molecules) is impacted by such factors as the degree of complementarity between the nucleic acid molecules, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio within the nucleic acid molecules.


As used herein, the term “Tm” is used in reference to the “melting temperature.” The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. The equation for calculating the Tm of nucleic acid molecules is well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41(% G+C), when a nucleic acid molecule is in aqueous solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references include more sophisticated computations, which take structural as well as sequence characteristics into account for the calculation of Tm. Stringent conditions, are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.


In particular, the term “stringency conditions” refers to conditions, wherein 100 contigous nucleotides or more, 150 contigous nucleotides or more, 200 contigous nucleotides or more or 250 contigous nucleotides or more which are a fragment or identical to the complementary nucleic acid molecule (DNA, RNA, ssDNA or ssRNA) hybridizes under conditions equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50° C. with washing in 2×SSC, 0.1% SDS at 50° C. or 65° C., preferably at 65° C., with a specific nucleic acid molecule (DNA; RNA, ssDNA or ss RNA). Preferably, the hybridizing conditions are equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50° C. with washing in 1×SSC, 0.1% SDS at 50° C. or 65° C., preferably 65° C., more preferably the hybridizing conditions are equivalent to hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, 1 mM EDTA at 50° C. with washing in 0.1×SSC, 0.1% SDS at 50° C. or 65° C., preferably 65° C. Preferably, the complementary nucleotides hybridize with a fragment or the whole HCP6 nucleic acids. Alternatively, preferred hybridization conditions encompass hybridisation at 65° C. in 1×SSC or at 42° C. in 1×SSC and 50% formamide, followed by washing at 65° C. in 0.3×SSC or hybridisation at 50° C. in 4×SSC or at 40° C. in 6×SSC and 50% formamide, followed by washing at 50° C. in 2×SSC. Further preferred hybridization conditions are 0.1% SDS, 0.1 SSD and 65° C.


The term “plant” is intended to encompass plants at any stage of maturity or development, as well as any tissues or organs (plant parts) taken or derived from any such plant unless otherwise clearly indicated by context. Plant parts include, but are not limited to, plant cells, stems, roots, flowers, ovules, stamens, seeds, leaves, embryos, meristematic regions, callus tissue, anther cultures, gametophytes, sporophytes, pollen, microspores, protoplasts, hairy root cultures, and/or the like. The present invention also includes seeds produced by the plants of the present invention. Preferably, the seeds comprise the exogenous HCP6 nucleic acids. In one embodiment, the seeds can develop into plants with increased resistance to fungal infection as compared to a wild-type variety of the plant seed. As used herein, a “plant cell” includes, but is not limited to, a protoplast, gamete producing cell, and a cell that regenerates into a whole plant. Tissue culture of various tissues of plants and regeneration of plants therefrom is well known in the art and is widely published.


Reference herein to an “endogenous” nucleic acid and/or protein refers to the nucleic acid and/or protein in question as found in a plant in its natural form (i.e., without there being any human intervention).


The term “exogenous” nucleic acid refers to a nucleic acid that has been introduced in a plant by means of genetechnology. An “exogenous” nucleic acid can either not occur in a plant in its natural form, be different from the nucleic acid in question as found in a plant in its natural form, or can be identical to a nucleic acid found in a plant in its natural form, but integrated not within their natural genetic environment. The corresponding meaning of “exogenous” is applied in the context of protein expression. For example, a transgenic plant containing a transgene, i.e., an exogenous nucleic acid, may, when compared to the expression of the endogenous gene, encounter a substantial increase of the expression of the respective gene or protein in total. A transgenic plant according to the present invention includes an exogenous HCP6 nucleic acid integrated at any genetic loci and optionally the plant may also include the endogenous gene within the natural genetic background.


For the purposes of the invention, “recombinant” means with regard to, for example, a nucleic acid sequence, a nucleic acid molecule, an expression cassette or a vector construct comprising any one or more HCP6 nucleic acids, all those constructions brought about by man by genetechnological methods in which either

  • (a) the sequences of the HCP6 nucleic acids or a part thereof, or
  • (b) genetic control sequence(s) which is operably linked with the HCP6 nucleic acid sequence according to the invention, for example a promoter, or
  • (c) a) and b)


    are not located in their natural genetic environment or have been modified by man by genetechnological methods. The modification may take the form of, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. The natural genetic environment is understood as meaning the natural genomic or chromosomal locus in the original plant or the presence in a genomic library or the combination with the natural promoter.


For instance, a naturally occurring expression cassette—for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a protein useful in the methods of the present invention, as defined above—becomes a recombinant expression cassette when this expression cassette is modified by man by non-natural, synthetic (“artificial”) methods such as, for example, mutagenic treatment. Suitable methods are described, for example, in U.S. Pat. No. 5,565,350, WO 00/15815 or US200405323. Furthermore, a naturally occurring expression cassette—for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a protein useful in the methods of the present invention, as defined above—becomes a recombinant expression cassette when this expression cassette is not integrated in the natural genetic environment but in a different genetic environment.


For instance, a naturally occurring expression cassette—for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a protein useful in the methods of the present invention, as defined above—becomes a recombinant expression cassette when this expression cassette is modified by man by non-natural, synthetic (“artificial”) methods such as, for example, mutagenic treatment. Suitable methods are described, for example, in U.S. Pat. No. 5,565,350, WO 00/15815 or US200405323. Furthermore, a naturally occurring expression cassette—for example the naturally occurring combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a protein useful in the methods of the present invention, as defined above—becomes a recombinant expression cassette when this expression cassette is not integrated in the natural genetic environment but in a different genetic environment.


The term “isolated nucleic acid” or “isolated protein” refers to a nucleic acid or protein that is not located in its natural environment, in particular its natural cellular environment. Thus, an isolated nucleic acid or isolated protein is essentially separated from other components of its natural environment. However, the skilled person in the art is aware that preparations of an isolated nucleic acid or an isolated protein can display a certain degree of impurity depending on the isolation procedure used. Methods for purifying nucleic acids and proteins are well known in the art. The isolated gene may be isolated from an organism or may be manmade, for example by chemical synthesis. In this regard, a recombinant nucleic acid may also be in an isolated form.


As used herein, the term “transgenic” refers to an organism, e.g., a plant, plant cell, callus, plant tissue, or plant part that exogenously contains the nucleic acid, recombinant construct, vector or expression cassette described herein or a part thereof which is preferably introduced by non-essentially biological processes, preferably by Agrobacteria transformation. The recombinant construct or a part thereof is stably integrated into a chromosome, so that it is passed on to successive generations by clonal propagation, vegetative propagation or sexual propagation. Preferred successive generations are transgenic too. Essentially biological processes may be crossing of plants and/or natural recombination.


A transgenic plant, plants cell or tissue for the purposes of the invention is thus understood as meaning that an exogenous HCP6 nucleic acid, recombinant construct, vector or expression cassette including one or more HCP6 nucleic acids is integrated into the genome by means of genetechnology.


A “wild type” plant, “wild type” plant part, or “wild type” plant cell means that said plant, plant part, or plant cell does not express exogenous HCP6 nucleic acid or exogenous HCP6 protein.


Natural locus means the location on a specific chromosome, preferably the location between certain genes, more preferably the same sequence background as in the original plant which is transformed.


Preferably, the transgenic plant, plant cell or tissue thereof expresses the HCP6 nucleic acids, HCP6 constructs or HCP6 expression cassettes described herein.


The term “expression” or “gene expression” means the transcription of a specific gene or specific genes or specific genetic vector construct. The term “expression” or “gene expression” in particular means the transcription of a gene or genes or genetic vector construct into structural RNA (rRNA, tRNA), or mRNA with or without subsequent translation of the latter into a protein. The process includes transcription of DNA and processing of the resulting RNA product. The term “expression” or “gene expression” can also include the translation of the mRNA and therewith the synthesis of the encoded protein, i.e., protein expression.


The term “increased expression” or “enhanced expression” or “overexpression” or “increase of content” as used herein means any form of expression that is additional to the original wild-type expression level. For the purposes of this invention, the original wild-type expression level might also be zero (absence of expression).


Methods for increasing expression of genes or gene products are well documented in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids which serve as promoter or enhancer elements may be introduced in an appropriate position (typically upstream) of a non-heterologous form of a polynucleotide so as to upregulate expression of a nucleic acid encoding the protein of interest. For example, endogenous promoters may be altered in vivo by mutation, deletion, and/or substitution (see, Kmiec, U.S. Pat. No. 5,565,350; Zarling et al., WO9322443), or isolated promoters may be introduced into a plant cell in the proper orientation and distance from a gene of the present invention so as to control the expression of the gene.


The term “functional fragment” refers to any nucleic acid or protein which comprises merely a part of the fulllength nucleic acid or fulllength protein, respectively, but still provides the same function, e.g., fungal resistance, when expressed or repressed in a plant, respectively. Preferably, the fragment comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95%, at least 98%, at least 99% of the original sequence. Preferably, the functional fragment comprises contiguous nucleic acids or amino acids as in the original nucleic acid or original protein, respectively. In one embodiment the fragment of any of the HCP6 nucleic acids has an identity as defined above over a length of at least 20%, at least 30%, at least 50%, at least 75%, at least 90% of the nucleotides of the respective HCP6 nucleic acid.


The term “splice variant” as used herein encompasses variants of a nucleic acid sequence in which selected introns and/or exons have been excised, replaced, displaced or added, or in which introns have been shortened or lengthened. Thus, a splice variant can have one or more or even all introns removed or added. According to this definition, a cDNA is considered as a splice variant of the respective intron-containing genomic sequence and vice versa. Such splice variants may be found in nature or may be manmade. Methods for predicting and isolating such splice variants are well known in the art (see for example Foissac and Schiex (2005) BMC Bioinformatics 6: 25).


In cases where overexpression of nucleic acid is desired, the term “similar functional activity” or “similar function” means that any homologue and/or fragment provide fungal resistance when expressed in a plant. Preferably similar functional activity means at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or 100% or higher fungal resistance compared with functional activity provided by the exogenous expression of the HCP6 nucleotide sequence as defined by SEQ ID NO: 1 or 6.


The term “increased activity” or “enhanced activity” as used herein means any protein having increased activity and which provides an increased fungal resistance compared with the wildtype plant merely expressing the respective endogenous HCP6 nucleic acid. As far as overexpression is concerned, for the purposes of this invention, the original wild-type expression level might also be zero (absence of expression).


With respect to a vector construct and/or the recombinant nucleic acid molecules, the term “operatively linked” is intended to mean that the nucleic acid to be expressed is linked to the regulatory sequence, including promoters, terminators, enhancers and/or other expression control elements (e.g., polyadenylation signals), in a manner which allows for expression of the nucleic acid (e.g., in a host plant cell when the vector is introduced into the host plant cell). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) and Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnology, Eds. Glick and Thompson, Chapter 7, 89-108, CRC Press: Boca Raton, Fla., including the references therein. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells or under certain conditions. It will be appreciated by those skilled in the art that the design of the vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of nucleic acid desired, and the like.


The term “introduction” or “transformation” as referred to herein encompass the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a vector construct of the present invention and a whole plant regenerated there from. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem). The polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome. The host genome includes the nucleic acid contained in the nucleus as well as the nucleic acid contained in the plastids, e.g., chloroplasts, and/or mitochondria. The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.


The term “terminator” encompasses a control sequence which is a DNA sequence at the end of a transcriptional unit which signals 3′ processing and polyadenylation of a primary transcript and termination of transcription. The terminator can be derived from the natural gene, from a variety of other plant genes, or from T-DNA. The terminator to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.


DETAILED DESCRIPTION
HCP6 Nucleic Acids

The HCP6 nucleic acid to be overexpressed in order to achieve increased resistance to fungal pathogens, e.g., of the family Phacopsoraceae, for example soybean rust, is preferably a nucleic acid coding for an HCP6 protein, and is preferably as defined by SEQ ID NO:


6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a fragment, homolog, derivative, orthologue or paralogue thereof, or a splice variant thereof. Preferably, the nucleic acid coding for an HCP6 protein of the present invention has at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or is a functional fragment thereof, or a splice variant thereof. Most preferred is at least 90% identity, at least 92%, at least 95%, at least 97% identity, more preferred is at least 98% or at least 99% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35.


Preferably, the HCP6 nucleic acid to be overexpressed in order to achieve increased resistance to fungal pathogens, e.g., of the family Phacopsoraceae, for example soybean rust, is preferably a nucleic acid coding for an HCP6 protein, and is preferably as defined by SEQ ID NO: 6, or a fragment, homolog, derivative, orthologue or paralogue thereof, or a splice variant thereof. Preferably, the nucleic acid coding for an HCP6 protein of the present invention has at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6 or is a functional fragment thereof, or a splice variant thereof. Most preferred is at least 90% identity, at least 92%, at least 95%, at least 97% identity, more preferred is at least 98% or at least 99% identity with SEQ ID NO: 6.


More preferably, the HCP6 nucleic acid to be overexpressed in order to achieve increased resistance to fungal pathogens, e.g., of the family Phacopsoraceae, for example soybean rust, is preferably a nucleic acid coding for an HCP6 protein, and is preferably as defined by SEQ ID NO: 1, or a fragment, homolog, derivative, orthologue or paralogue thereof, or a splice variant thereof. Preferably, the nucleic acid coding for an HCP6 protein of the present invention has at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 1 or is a functional fragment thereof, or a splice variant thereof. Most preferred is at least 92%, at least 95%, at least 97% identity, more preferred is at least 98% or at least 99% identity with SEQ ID NO: 1.


SEQ ID NO: 6 corresponds to SEQ ID NO: 1, wherein the codon usage has been optimized for expression in soy.


SEQ ID NO: 7 corresponds to SEQ ID NO: 3, wherein the codon usage has been optimized for expression in soy.


Preferably the HCP6 nucleic acid is an isolated nucleic acid molecule consisting of or comprising a nucleic acid selected from the group consisting of:

  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof, wherein overexpression of the sequence confers enhanced fungal resistance in the plant relative to a control plant;
  • (ii) a nucleic acid encoding a HCP6 protein comprising an amino acid sequence having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27 or a functional fragment, derivative, orthologue, or paralogue thereof, wherein overexpression of the sequence confers enhanced fungal resistance in the plant relative to a control plant; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 6, 1, 3, 5, or 7; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants;
  • (iii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) or (ii) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iv) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (iii) above, but differing from the HCP6 nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferably the HCP6 nucleic acid is an isolated nucleic acid molecule consisting of or comprising a nucleic acid selected from the group consisting of:

  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 1, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof;
  • (ii) a nucleic acid encoding a HCP6 protein having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2, or a functional fragment, derivative, orthologue, or paralogue thereof; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 1, preferably the HCP6 protein confers enhanced fungal resistance relative to control plants;
  • (iii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) or (ii) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iv) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (iii) above, but differing from the HCP6 nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferably the HCP6 nucleic acid is an isolated nucleic acid molecule comprising a nucleic acid selected from the group consisting of:

  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 6, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof, wherein overexpression of the sequence confers enhanced fungal resistance in the plant relative to a control plant;
  • (ii) a nucleic acid encoding a HCP6 protein having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2, or a functional fragment, derivative, orthologue, or paralogue thereof, wherein overexpression of the sequence confers enhanced fungal resistance in the plant relative to a control plant; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 6, preferably the HCP6 protein confers enhanced fungal resistance relative to control plants;
  • (iii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) or (ii) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iv) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (iii) above, but differing from the HCP6 nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferably the HCP6 nucleic acid is an isolated nucleic acid molecule comprising a nucleic acid selected from the group consisting of:

  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 3 or 7, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof;
  • (ii) a nucleic acid encoding a HCP6 protein having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 4, or a functional fragment, derivative, orthologue, or paralogue thereof; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 3 or 7, preferably the HCP6 protein confers enhanced fungal resistance relative to control plants; (iii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) or (ii) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iv) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (iii) above, but differing from the HCP6 nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Percentages of identity of a nucleic acid are indicated with reference to the entire nucleotide region given in a sequence specifically disclosed herein.


Preferably the portion of the HCP6 nucleic acid is about 1000-1500, about 1500-2000, about 2000-2500, about 2500-3000, about 3000-3500, about 3500-4000, or about 4000-4311 nucleotides, preferably consecutive nucleotides, preferably counted from the 5′ or 3′ end of the nucleic acid, in length, of the nucleic acid sequences given in SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35.


Preferably, the HCP6 nucleic acid comprises at least about 1000, at least about 1500, at least about 2000, at least about 2500, at least about 2750, at least about 3000, at least about 3250, at least about 3500, at least about 3750, at least about 4000, at least about 4100, at least about 4200, or at least about 4300 nucleotides, preferably continuous nucleotides, preferably counted from the 5′ or 3′ end of the nucleic acid or up to the full length of the nucleic acid sequence set out in SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35.


Preferably, the HCP6 nucleic acid comprises at least about 1000, at least about 1500, at least about 2000, at least about 2100, at least about 2200, at least about 2300, at least about 2400, at least about 2500, or at least about 2600 nucleotides, preferably continuous nucleotides, preferably counted from the 5′ or 3′ end of the nucleic acid or up to the full length of the nucleic acid sequence set out in SEQ ID NO: 1.


Preferably the portion of the HCP6 nucleic acid is about 1000-1500, about 1500-2000, about 2000-2100, about 2100-2200, about 2200-2300, about 2300-2400, about 2400-2500, about 2500-2600, or about 2600-2694 nucleotides, preferably consecutive nucleotides, preferably counted from the 5′ or 3′ end of the nucleic acid, in length, of the nucleic acid sequences given in SEQ ID NO: 1.


Preferably, the HCP6 nucleic acid comprises at least about 1000, at least about 1500, at least about 2000, at least about 2100, at least about 2200, at least about 2300, at least about 2400, at least about 2500, or at least about 2600 nucleotides, preferably continuous nucleotides, preferably counted from the 5′ or 3′ end of the nucleic acid or up to the full length of the nucleic acid sequence set out in SEQ ID NO: 6.


Preferably the portion of the HCP6 nucleic acid is about 1000-1500, about 1500-2000, about 2000-2100, about 2100-2200, about 2200-2300, about 2300-2400, about 2400-2500, about 2500-2600, or about 2600-2694 nucleotides, preferably consecutive nucleotides, preferably counted from the 5′ or 3′ end of the nucleic acid, in length, of the nucleic acid sequences given in SEQ ID NO: 6.


Preferably, the HCP6 nucleic acid is a HCP6 nucleic acid splice variant. Preferred splice variants are splice variants of a nucleic acid represented by SEQ ID NO: 5. Preferred HCP6 nucleic acids being a splice variant of SEQ ID NO: 5 are shown in FIG. 3.


Preferably, the HCP6 nucleic acid is an isolated nucleic acid molecule comprising a splice variant of SEQ ID NO: 5, wherein the splice variant is selected from the group consisting of:

  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 1 or 3, or a functional fragment, derivative, orthologue, or paralogue thereof;
  • (ii) a nucleic acid encoding a HCP6 protein having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2 or 4, or a functional fragment, derivative, orthologue, or paralogue thereof; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 6, 1, 3, 5, or 7; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants;
  • (iii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) or (ii) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iv) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (iii) above, but differing from the HCP6 nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferred splice variants of SEQ ID NO: 5 consist of or comprise anyone of the nucleotide sequences shown in SEQ ID NO: 1 or 3. Most preferred is the HCP6 nucleic acid splice variant as shown in SEQ ID NO: 1.


Preferably the HCP6 nucleic acid is an isolated nucleic acid molecule comprising a nucleic acid selected from the group consisting of:

  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 5, or a splice variant thereof;
  • (ii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iii) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (ii) above, but differing from the HCP6 nucleic acids of (i) to (ii) above due to the degeneracy of the genetic code;


    wherein the splice variant thereof is selected from the group consisting of:
  • (i) a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 1 or 3, or a functional fragment, derivative, orthologue, or paralogue thereof;
  • (ii) a nucleic acid encoding a HCP6 protein having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2 or 4, or a functional fragment, derivative, orthologue, or paralogue thereof; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 6, 1, 3, 5, or 7; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants;
  • (iii) a nucleic acid molecule which hybridizes with a complementary sequence of any of the nucleic acid molecules of (i) or (ii) under high stringency hybridization conditions; preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and
  • (iv) a nucleic acid encoding the same HCP6 protein as the HCP6 nucleic acids of (i) to (iii) above, but differing from the HCP6 nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


More preferably the HCP6 nucleic acid is an isolated nucleic acid molecule comprising a nucleic acid selected from the group consisting of:


a nucleic acid having in increasing order of preference least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 5, or a splice variant thereof; wherein the splice variant thereof is selected from the group consisting of:


a nucleic acid having in increasing order of preference at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 1 or 3; preferably SEQ ID NO: 1.


All the nucleic acid sequences mentioned herein (single-stranded and double-stranded DNA and RNA sequences, for example cDNA and mRNA) can be produced in a known way by chemical synthesis from the nucleotide building blocks, e.g. by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. Chemical synthesis of oligonucleotides can, for example, be performed in a known way, by the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press, New York, pages 896-897). The accumulation of synthetic oligonucleotides and filling of gaps by means of the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning techniques are described in Sambrook et al. (1989), see below.


The HCP6 nucleic acids described herein are useful in the constructs, methods, plants, harvestable parts and products of the invention.


HCP6 Proteins

The HCP6 protein is preferably defined by SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a fragment, homolog, derivative, orthologue or paralogue thereof. Preferably, the HCP6 protein of the present invention is encoded by a nucleic acid, which has at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof. More preferably, the HCP6 protein of the present invention has at least 60%, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or is a functional fragment thereof, an orthologue or a paralogue thereof. Most preferred is at least 90% identity, at least 92%, at least 95%, at least 97% identity, more preferred is at least 98% or at least 99% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27.


More preferably, the HCP6 protein of the present invention has at least 60%, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97% at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2 or is a functional fragment thereof, an orthologue or a paralogue thereof.


More preferably, the HCP6 protein of the present invention has at least 60%, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 92%, at least 95%, at least 97% at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 4, or is a functional fragment thereof, an orthologue or a paralogue thereof.


Preferably, the HCP6 protein is a protein consisting of or comprising an amino acid sequence selected from the group consisting of:

  • (i) an amino acid sequence having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment, derivative, orthologue, or paralogue thereof, wherein overexpression of the sequence confers enhanced fungal resistance in the plant relative to a control plant; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 6, 1, 3, 5, or 7; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants; or
  • (ii) an amino acid sequence encoded by a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof, wherein overexpression of the sequence confers enhanced fungal resistance in the plant relative to a control plant; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants.


Preferably, the HCP6 protein is a protein comprising an amino acid sequence selected from the group consisting of:

  • (i) an amino acid sequence having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 2, or a functional fragment, derivative, orthologue, or paralogue thereof; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 6 or 1; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants; or (ii) an amino acid sequence encoded by a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 6 or 1, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants.


Preferably, the HCP6 protein is a protein comprising an amino acid sequence selected from the group consisting of:

  • (i) an amino acid sequence having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino acid sequence represented by SEQ ID NO: 4, or a functional fragment, derivative, orthologue, or paralogue thereof; preferably the HCP6 protein has essentially the same biological activity as an HCP6 protein encoded by SEQ ID NO: 7 or 3; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants; or
  • (ii) an amino acid sequence encoded by a nucleic acid having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acid sequence represented by SEQ ID NO: 7 or 3, or a functional fragment, derivative, orthologue, or paralogue thereof, or a splice variant thereof; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants.


A preferred derivative of a HCP6 protein is a HCP6 protein consisting of or comprising an amino acid sequence selected from the group consisting of:


an amino acid sequence having in increasing order of preference at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27,


wherein the non-identical amino acid residues are conservative amino acid substitutions, preferably as shown in Table 1, of the corresponding amino acid residue of SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27; preferably the HCP6 protein has essentially the same biological activity as SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or as a HCP6 protein encoded by SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35; preferably the HCP6 protein confers enhanced fungal resistance relative to control plants.


Preferably, the HCP6 protein consists of or comprises an amino acid sequence represented by SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27 with one or more conservative amino acid substitutions, preferably as shown in Table 1, of the corresponding amino acid residues of SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27. Preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 1-10, 10-20, 20-30, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 60-170, 170-180, 180-190, 190-200, 200-210, or 210-220 amino acid residues of SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27 are conservative amino acid substitutions, preferably as shown in Table 1, of the corresponding amino acid residue of SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27.


More preferably, the HCP6 protein consists of or comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with an amino acid sequence as represented by SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 105, at least 110, at least 115, or at least 120 of the non-identical amino acid residues, or wherein 1-10, 10-20, 20-30, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 60-170, 170-180, 180-190, 190-200, 200-210, or 210-220 or even all of the non-identical amino acid residues are conservative amino acid substitutions, preferably as shown in Table 1, of the corresponding amino acid residue of SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27.


Percentages of identity of a polypeptide or protein are indicated with reference to the entire amino acid sequence specifically disclosed herein.


Preferably, the HCP6 protein comprises at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 1050, or at least about 1100 amino acid residues, preferably continuous amino acid residues, preferably counted from the N-terminus or the C-terminus of the amino acid sequence, or up to the full length of the amino acid sequence set out in SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27.


Preferably, the HCP6 polypeptide comprises about 500-600, about 600-700, about 700-800, about 800-900, about 900-1000, about 1050-1100, or about 1100-1117, amino acid residues, preferably consecutive amino acid residues, preferably counted from the N-terminus or C-terminus of the amino acid sequence, or up to the full length of any of the amino acid sequences encoded by the nucleic acid sequences set out in SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27.


Preferably, the HCP6 protein comprises at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 860, at least about 870, at least about 880, or at least about 890 amino acid residues, preferably continuous amino acid residues, preferably counted from the N-terminus or the C-terminus of the amino acid sequence, or up to the full length of the amino acid sequence set out in SEQ ID NO: 2, 13, 15, 17, 19, 21, 23, 25, or 27.


Preferably, the HCP6 polypeptide comprises about 500-550, about 550-600, about 600-650, about 650-700, about 700-750, about 750-800, about 800-850, about 850-860, about 860-870, about 870-890, or about 890-897 amino acid residues, preferably consecutive amino acid residues, preferably counted from the N-terminus or C-terminus of the amino acid sequence, or up to the full length of any of the amino acid sequences encoded by the nucleic acid sequences set out in SEQ ID NO: 2, 13, 15, 17, 19, 21, 23, 25, or 27.


The HCP6 proteins described herein are useful in the constructs, methods, plants, harvestable parts and products of the invention.


Methods for Increasing Fungal Resistance; Methods for Modulating Gene Expression

One embodiment of the invention is a method for increasing fungal resistance, preferably resistance to Phacopsoracea, for example soy bean rust, in a plant, plant part, or plant cell by increasing the expression of an HCP6 protein or a functional fragment, orthologue, paralogue or homologue thereof in comparison to wild-type plants, wild-type plant parts or wild-type plant cells.


The present invention also provides a method for increasing resistance to fungal pathogens, in particular a heminecrotrophic pathogen, in particular to rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably fungal pathogens of the family Phacopsoraceae, preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soy bean rust in plants or plant cells, wherein in comparison to wild type plants, wild type plant parts, or wild type plant cells an HCP6 protein is overexpressed.


The present invention further provides a method for increasing resistance to fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soy bean rust in plants or plant cells by overexpression of an HCP6 protein.


In preferred embodiments, the protein amount and/or function of the HCP6 protein in the plant is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% or more in comparison to a wild type plant that is not transformed with the HCP6 nucleic acid.


In one embodiment of the invention, the HCP6 protein is encoded by a nucleic acid comprising

  • (i) an exogenous nucleic acid having at least 60%, preferably at least 70%, for example at least 75%, more preferably at least 80%, for example at least 85%, even more preferably at least 90%, for example at least 95% or at least 96% or at least 97% or at least 98% most preferably 99% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof; or by
  • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60% identity, preferably at least 70%, for example at least 75%, more preferably at least 80%, for example at least 85%, even more preferably at least 90%, for example at least 95% or at least 96% or at least 97% or at least 98% most preferably 99% homology with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof, preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


A method for increasing fungal resistance, preferably resistance to Phacopsoracea, for example soy bean rust, in a plant, plant part, or plant cell, by increasing the expression of an HCP6 protein or a functional fragment, orthologue, paralogue or homologue thereof, or a splice variant thereof, wherein the HCP6 protein is encoded by a nucleic acid comprising

  • (i) an exogenous nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
  • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60%, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code;


    is a further embodiment of the invention.


A method for increasing fungal resistance, preferably resistance to Phacopsoracea, for example soy bean rust, in a plant, plant part, or plant cell, by increasing the expression of an HCP6 protein or a functional fragment, orthologue, paralogue or homologue thereof, or a splice variant thereof, wherein the HCP6 protein is encoded by

  • (i) an exogenous nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 1 or a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof; (ii) an exogenous nucleic acid encoding a protein having at least 60%, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code


    is a further embodiment of the invention.


A method for increasing fungal resistance, preferably resistance to Phacopsoracea, for example soy bean rust, in a plant, plant part, or plant cell, by increasing the expression of an HCP6 protein or a functional fragment, orthologue, paralogue or homologue thereof, or a splice variant thereof, wherein the HCP6 protein is encoded by

  • (i) an exogenous nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6 or a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
  • (ii) an exogenous nucleic acid encoding a protein having at least 60%, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code


    is a further embodiment of the invention.


In a further method of the invention, the method comprises the steps of

  • (a) stably transforming a plant cell with a recombinant expression cassette comprising
    • (i) a nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) a nucleic acid coding for a protein comprising an amino acid sequence having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 polypeptide as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,


      in functional linkage with a promoter;
  • (b) regenerating the plant from the plant cell; and
  • (c) expressing said nucleic acid, optionally wherein the nucleic acid which codes for an HCP6 protein is expressed in an amount and for a period sufficient to generate or to increase soybean rust resistance in said plant.


Preferably, the method comprises the steps of

  • (a) stably transforming a plant cell with a recombinant expression cassette comprising
    • (i) a nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 1, or a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) a nucleic acid coding for a protein having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 polypeptide as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,
      • in functional linkage with a promoter;
  • (b) regenerating the plant from the plant cell; and
  • (c) expressing said nucleic acid, optionally wherein the nucleic acid which codes for an HCP6 protein is expressed in an amount and for a period sufficient to generate or to increase soybean rust resistance in said plant.


Preferably, the method comprises the steps of

  • (a) stably transforming a plant cell with a recombinant expression cassette comprising
    • (i) a nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, or a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) a nucleic acid coding for a protein having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 polypeptide as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,
      • in functional linkage with a promoter;
  • (b) regenerating the plant from the plant cell; and
  • (c) expressing said nucleic acid, optionally wherein the nucleic acid which codes for an HCP6 protein is expressed in an amount and for a period sufficient to generate or to increase soybean rust resistance in said plant.


Preferably, the promoter is a rust induced and/or mesophyll-specific promoter, preferably the the rust induced mesophyll specific promoter 820.


Preferably, the method for increasing fungal resistance, preferably resistance to Phacopsoracea, for example soy bean rust, in a plant, plant part, or plant cell further comprises the step of selecting a transgenic plant expressing

  • (i) an exogenous nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof;
  • (ii) an exogenous nucleic acid coding for a protein having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
  • (iv) an exogenous nucleic acid encoding the same HCP6 polypeptide as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


A preferred embodiment is a method for increasing resistance to soy bean rust in a soy bean plant, soy bean plant part, or soy bean plant cell, by increasing the expression of an HCP6 protein, wherein the HCP6 protein is encoded by a nucleic acid comprising

  • (i) an exogenous nucleic acid having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35;
  • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,


    wherein increasing the expression of the HCP6 protein is achieved by transforming the soy bean plant, plant part or plant cell with a nucleic acid comprising the nucleic acid set out under item (i) or (ii) or (iii) or (iv).


Also a preferred embodiment is a method for increasing resistance to soy bean rust in a soy bean plant, soy bean plant part, or soy bean plant cell, by increasing the expression of an HCP6 protein, wherein the HCP6 protein is encoded by a nucleic acid comprising

  • (i) an exogenous nucleic acid having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35;
  • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27; preferably the encoded protein confers enhanced fungal resistance relative to control plants; or
  • (iii) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (ii) above, but differing from the nucleic acids of (i) to (ii) above due to the degeneracy of the genetic code,


    wherein increasing the expression of the HCP6 protein is achieved by transforming the soy bean plant, plant part or plant cell with a nucleic acid comprising the nucleic acid set out under item (i) or (ii) or (iii).


The fungal pathogens or fungus-like pathogens (such as, for example, Chromista) can belong to the group comprising Plasmodiophoramycota, Oomycota, Ascomycota, Chytridiomycetes, Zygomycetes, Basidiomycota or Deuteromycetes (Fungi imperfecti). Pathogens which may be mentioned by way of example, but not by limitation, are those detailed in Tables 2 and 3, and the diseases which are associated with them.









TABLE 2







Diseases caused by biotrophic and/or heminecrotrophic


phytopathogenic fungi










Disease
Pathogen







Leaf rust

Puccinia recondita




Yellow rust

P. striiformis




Powdery mildew

Erysiphe graminis/Blumeria graminis




Rust (common corn)

Puccinia sorghi




Rust (Southern corn)

Puccinia polysora




Tobacco leaf spot

Cercospora nicotianae




Rust (soybean)

Phakopsora pachyrhizi, P. meibomiae




Rust (tropical corn)

Physopella pallescens, P. zeae =






Angiopsora zeae


















TABLE 3







Diseases caused by necrotrophic and/or hemibiotrophic fungi and Oomycetes








Disease
Pathogen





Plume blotch

Septoria (Stagonospora) nodorum



Leaf blotch

Septoria tritici



Ear fusarioses

Fusarium spp.



Late blight

Phytophthora infestans



Anthrocnose leaf blight

Colletotrichum graminicola (teleomorph: Glomerella



Anthracnose stalk rot

graminicola Politis); Glomerella tucumanensis (anamorph:





Glomerella falcatum Went)




Curvularia leaf spot


Curvularia clavata, C. eragrostidis, = C. maculans




(teleomorph: Cochliobolus eragrostidis), Curvularia




inaequalis, C. intermedia (teleomorph: Cochliobolus





intermedius), Curvularia lunata (teleomorph: Cochliobolus





lunatus), Curvularia pallescens (teleomorph:





Cochliobolus pallescens), Curvularia senegalensis,





C. tuberculata (teleomorph: Cochliobolus tuberculatus)




Didymella leaf spot


Didymella exitalis




Diplodia leaf spot or streak


Stenocarpella macrospora =





Diplodialeaf macrospora



Brown stripe downy

Sclerophthora rayssiae var. zeae



mildew


Crazy top downy mildew

Sclerophthora macrospora =





Sclerospora macrospora



Green ear downy mildew (graminicola

Sclerospora graminicola



downy mildew)


Leaf spots, minor

Alternaria alternata,





Ascochyta maydis, A. tritici,





A. zeicola, Bipolaris victoriae = Helminthosporium





victoriae




(teleomorph: Cochliobolus victoriae), C. sativus (anamorph:




Bipolaris sorokiniana = H. sorokinianum =





H. sativum), Epicoccum nigrum,





Exserohilum prolatum = Drechslera prolata (teleomorph:





Setosphaeria prolata)





Graphium penicillioides,





Leptosphaeria maydis, Leptothyrium zeae, Ophiosphaerella





herpotricha, (anamorph: Scolecosporiella




sp.),




Paraphaeosphaeria michotii, Phoma sp., Septoria





zeae, S. zeicola,





S. zeina



Northern corn leaf blight (white

Setosphaeria turcica (anamorph: Exserohilum turcicum =



blast, crown stalk rot, stripe)

Helminthosporium turcicum)



Northern corn leaf spot Helminthosporium

Cochliobolus carbonum (anamorph: Bipolaris zeicola =



ear rot (race 1)

Helminthosporium carbonum)




Phaeosphaeria leaf spot


Phaeosphaeria maydis = Sphaerulina maydis




Rostratum leaf spot (Helminthosporium


Setosphaeria rostrata, (anamorph:



leaf disease, ear and

xserohilum rostratum = Helminthosporium rostratum)



stalk rot)


Java downy mildew

Peronosclerospora maydis =





Sclerospora maydis



Philippine downy mildew

Peronosclerospora philippinensis = Sclerospora philippinensis




Sorghum downy mildew


Peronosclerospora sorghi =





Sclerospora sorghi




Spontaneum downy mildew


Peronosclerospora spontanea =





Sclerospora spontanea



Sugarcane downy mildew

Peronosclerospora sacchari =





Sclerospora sacchari




Sclerotium ear rot (southern blight)


Sclerotium rolfsii Sacc. (teleomorph: Athelia rolfsii)



Seed rot-seedling blight

Bipolaris sorokiniana, B. zeicola = Helminthosporium





carbonum, Diplodia maydis, Exserohilum pedicillatum,





Exserohilum turcicum = Helminthosporium turcicum,





Fusarium avenaceum, F. culmorum, F. moniliforme,





Gibberella zeae (anamorph: F. graminearum),





Macrophomina phaseolina, Penicillium spp.,





Phomopsis sp., Pythium spp., Rhizoctonia solani, R. zeae,





Sclerotium rolfsii, Spicaria sp.




Selenophoma leaf spot


Selenophoma sp.



Yellow leaf blight

Ascochyta ischaemi, Phyllosticta maydis (teleomorph:





Mycosphaerella zeae-maydis)



Zonate leaf spot

Gloeocercospora sorghi










The following are especially preferred:

    • Plasmodiophoromycota such as Plasmodiophora brassicae (clubroot of crucifers), Spongospora subterranea, Polymyxa graminis,
    • Oomycota such as Bremia lactucae (downy mildew of lettuce), Peronospora (downy mildew) in snapdragon (P. antirrhini), onion (P. destructor), spinach (P. effusa), soybean (P. manchurica), tobacco (“blue mold”; P. tabacina) alfalfa and clover (P. trifolium), Pseudoperonospora humuli (downy mildew of hops), Plasmopara (downy mildew in grapevines) (P. viticola) and sunflower (P. halstedii), Sclerophthora macrospora (downy mildew in cereals and grasses), Pythium (for example damping-off of Beta beet caused by P. debaryanum), Phytophthora infestans (late blight in potato and in tomato and the like), Albugo spec.
    • Ascomycota such as Microdochium nivale (snow mold of rye and wheat), Fusarium, Fusarium graminearum, Fusarium culmorum (partial ear sterility mainly in wheat), Fusarium oxysporum (Fusarium wilt of tomato), Blumeria graminis (powdery mildew of barley (f.sp. hordei) and wheat (f.sp. tritici)), Erysiphe pisi (powdery mildew of pea), Nectria galligena (Nectria canker of fruit trees), Uncinula necator (powdery mildew of grapevine), Pseudopeziza tracheiphila (red fire disease of grapevine), Claviceps purpurea (ergot on, for example, rye and grasses), Gaeumannomyces graminis (take-all on wheat, rye and other grasses), Magnaporthe grisea, Pyrenophora graminea (leaf stripe of barley), Pyrenophora teres (net blotch of barley), Pyrenophora tritici-repentis (leaf blight of wheat), Venturia inaequalis (apple scab), Sclerotinia sclerotium (stalk break, stem rot), Pseudopeziza medicaginis (leaf spot of alfalfa, white and red clover).
    • Basidiomycetes such as Typhula incarnata (typhula blight on barley, rye, wheat), Ustilago maydis (blister smut on maize), Ustilago nuda (loose smut on barley), Ustilago tritici (loose smut on wheat, spelt), Ustilago avenae (loose smut on oats), Rhizoctonia solani (rhizoctonia root rot of potato), Sphacelotheca spp. (head smut of sorghum), Melampsora lini (rust of flax), Puccinia graminis (stem rust of wheat, barley, rye, oats), Puccinia recondita (leaf rust on wheat), Puccinia dispersa (brown rust on rye), Puccinis hordei (leaf rust of barley), Puccinia coronata (crown rust of oats), Puccinia striiformis (yellow rust of wheat, barley, rye and a large number of grasses), Uromyces appendiculatus (brown rust of bean), Sclerotium rolfsii (root and stem rots of many plants).
    • Deuteromycetes (Fungi imperfecti) such as Septoria (Stagonospora) nodorum (glume blotch) of wheat (Septoria tritici), Pseudocercosporella herpotrichoides (eyespot of wheat, barley, rye), Rynchosporium secalis (leaf spot on rye and barley), Alternaria solani (early blight of potato, tomato), Phoma betae (blackleg on Beta beet), Cercospora beticola (leaf spot on Beta beet), Alternaria brassicae (black spot on oilseed rape, cabbage and other crucifers), Verticillium dahliae (verticillium wilt), Colletotrichum, Colletotrichum lindemuthianum (bean anthracnose), Phoma lingam (blackleg of cabbage and oilseed rape), Botrytis cinerea (grey mold of grapevine, strawberry, tomato, hops and the like).


Especially preferred are biotrophic pathogens, more preferably heminecrotrophic pathogens, e.g., Phakopsora pachyrhizi and/or those pathogens which have essentially a similar infection mechanism as Phakopsora pachyrhizi, as described herein. Particularly preferred are pathogens from the subclass Pucciniomycetes, preferably from the order Pucciniales (rust), previously known as Uredinales, among which in particular the Melompsoraceae. Preferred are Phakopsoraceae, more preferably Phakopsora. Especially preferred are Phakopsora pachyrhizi and/or Phakopsora meibomiae.


Also preferred rust fungi are selected from the group of Puccinia, Gymnosporangium, Juniperus, Cronartium, Hemileia, and Uromyces; preferably Puccinia sorghi, Gymnosporangium junlperi-virginianae, Juniperus virginiana, Cronartium ribicola, Hemilela vastatrix Puccinia graminis, Puccinia coronata, Uromyces phaseoli, Puccinia hemerocallidis, Puccinia persistens subsp. Triticina, Puccinia striiformis, Puccinia graminis causes, and/or Uromyces appendeculatus.


Further preferred pathogens, preferably pathogens of maize, are pathogens causing stalk rot diseases, in particular Fusarium stalk rot, Gibberella stalk rot, Diplodia stalk rot, and Charcoal rot and pathogens causing anthracnose. Preferred pathogens causing Fusarium stalk rot are Fusarium verticillioides, Fusarium proliferatum or Fusarium subglutinans. A preferred pathogen causing Gibberella stalk rot is Fusarium graminearum. A preferred pathogen causing Diplodia stalk rot is Diplodia maydis. A preferred pathogen causing Charcoal rot is Macrophomina phaseolina. A preferred pathogen causing anthracnose is Colletotrichum graminicola.


HCP6 Expression Constructs and Vector Constructs

A recombinant vector construct comprising:

  • (a) (i) a nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) a nucleic acid coding for a protein comprising an amino acid sequence having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,


      operably linked with
  • (b) a promoter and
  • (c) a transcription termination sequence is a further embodiment of the invention.


Furthermore, a recombinant vector construct is provided comprising:

  • (a) (i) a nucleic acid having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35;
    • (ii) a nucleic acid coding for a protein comprising an amino acid sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,


      operably linked with
  • (b) a promoter and
  • (c) a transcription termination sequence is a further embodiment of the invention.


Furthermore, a recombinant vector construct is provided comprising:

  • (a) (i) a nucleic acid having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 1,
    • (ii) a nucleic acid coding for a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,


      operably linked with
  • (b) a promoter and
  • (c) a transcription termination sequence is a further embodiment of the invention.


Furthermore, a recombinant vector construct is provided comprising:

  • (a) (i) a nucleic acid having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6;
    • (ii) a nucleic acid coding for a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) a nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,


      operably linked with
  • (b) a promoter and
  • (c) a transcription termination sequence is a further embodiment of the invention.


In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part. The environment preferably flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, most preferably at least 5000 bp.


Promoters according to the present invention may be constitutive, inducible, in particular pathogen-inducible, developmental stage-preferred, cell type-preferred, tissue-preferred or organ-preferred. Constitutive promoters are active under most conditions. Non-limiting examples of constitutive promoters include the CaMV 19S and 35S promoters (Odell et al., 1985, Nature 313:810-812), the sX CaMV 35S promoter (Kay et al., 1987, Science 236:1299-1302), the Sep1 promoter, the rice actin promoter (McElroy et al., 1990, Plant Cell 2:163-171), the Arabidopsis actin promoter, the ubiquitin promoter (Christensen et al., 1989, Plant Molec. Biol. 18:675-689); pEmu (Last et al., 1991, Theor. Appl. Genet. 81:581-588), the figwort mosaic virus 35S promoter, the Smas promoter (Velten et al., 1984, EMBO J. 3:2723-2730), the GRP1-8 promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), promoters from the T-DNA of Agrobacterium, such as mannopine synthase, nopaline synthase, and octopine synthase, the small subunit of ribulose biphosphate carboxylase (ssuRUBISCO) promoter, and/or the like.


Preferably, the expression vector of the invention comprises a constitutive promoter, mesophyll-specific promoter, epidermis-specific promoter, root-specific promoter, a pathogen inducible promoter, or a fungal-inducible promoter.


A promoter is inducible, if its activity, measured on the amount of RNA produced under control of the promoter, is at least 30%, at least 40%, at least 50% preferably at least 60%, at least 70%, at least 80%, at least 90% more preferred at least 100%, at least 200%, at least 300% higher in its induced state, than in its un-induced state. A promoter is cell-, tissue- or organ-specific, if its activity, measured on the amount of RNA produced under control of the promoter, is at least 30%, at least 40%, at least 50% preferably at least 60%, at least 70%, at least 80%, at least 90% more preferred at least 100%, at least 200%, at least 300% higher in a particular cell-type, tissue or organ, then in other cell-types or tissues of the same plant, preferably the other cell-types or tissues are cell types or tissues of the same plant organ, e.g. a root. In the case of organ specific promoters, the promoter activity has to be compared to the promoter activity in other plant organs, e.g. leaves, stems, flowers or seeds. Preferably, the promoter is a constitutive promoter, mesophyll-specific promoter, or epidermis-specific promoter.


In preferred embodiments, the increase in the protein amount and/or activity of the HCP6 protein takes place in a constitutive or tissue-specific manner. In especially preferred embodiments, an essentially pathogen-induced increase in the protein amount and/or protein activity takes place, for example by recombinant expression of the HCP6 nucleic acid under the control of a fungal-inducable promoter. In particular, the expression of the HCP6 nucleic acid takes place on fungal infected sites, where, however, preferably the expression of the HCP6 nucleic acid remains essentially unchanged in tissues not infected by fungus.


Developmental stage-preferred promoters are preferentially expressed at certain stages of development. Tissue and organ preferred promoters include those that are preferentially expressed in certain tissues or organs, such as leaves, roots, seeds, or xylem. Examples of tissue preferred and organ preferred promoters include, but are not limited to fruitpreferred, ovule-preferred, male tissue-preferred, seed-preferred, integument-preferred, tuber-preferred, stalk-preferred, pericarp-preferred, leaf-preferred, stigma-preferred, pollenpreferred, anther-preferred, a petal-preferred, sepal-preferred, pedicel-preferred, siliquepreferred, stem-preferred, root-preferred promoters and/or the like. Seed preferred promoters are preferentially expressed during seed development and/or germination. For example, seed preferred promoters can be embryo-preferred, endosperm preferred and seed coatpreferred. See Thompson et al., 1989, BioEssays 10:108. Examples of seed preferred promoters include, but are not limited to cellulose synthase (celA), Cim1, gamma-zein, globulin-1, maize 19 kD zein (cZ19B1) and/or the like.


Other suitable tissue-preferred or organ-preferred promoters include, but are not limited to, the napin-gene promoter from rapeseed (U.S. Pat. No. 5,608,152), the USP-promoter from Vicia faba (Baeumlein et al., 1991, Mol Gen Genet. 225(3):459-67), the oleosinpromoter from Arabidopsis (PCT Application No. WO 98/45461), the phaseolin-promoter from Phaseolus vulgaris (U.S. Pat. No. 5,504,200), the Bce4-promoter from Brassica (PCT Application No. WO 91/13980), or the legumin B4 promoter (LeB4; Baeumlein et al., 1992, Plant Journal, 2(2):233-9), as well as promoters conferring seed specific expression in monocot plants like maize, barley, wheat, rye, rice, etc. Suitable promoters to note are the Ipt2 or Ipt1-gene promoter from barley (PCT Application No. WO 95/15389 and PCT Application No. WO 95/23230) or those described in PCT Application No. WO 99/16890 (promoters from the barley hordein-gene, rice glutelin gene, rice oryzin gene, rice prolamin gene, wheat gliadin gene, wheat glutelin gene, oat glutelin gene, Sorghum kasirin-gene, and/or rye secalin gene).


Promoters useful according to the invention include, but are not limited to, are the major chlorophyll a/b binding protein promoter, histone promoters, the Ap3 promoter, the 3-conglycin promoter, the napin promoter, the soybean lectin promoter, the maize 15 kD zein promoter, the 22 kD zein promoter, the 27 kD zein promoter, the g-zein promoter, the waxy, shrunken 1, shrunken 2, bronze promoters, the Zm13 promoter (U.S. Pat. No. 5,086,169), the maize polygalacturonase promoters (PG) (U.S. Pat. Nos. 5,412,085 and 5,545,546), the SGB6 promoter (U.S. Pat. No. 5,470,359), as well as synthetic or other natural promoters.


Epidermis-spezific promoters may be selected from the group consisting of:


WIR5 (=GstA1); acc. X56012; Dudler & Schweizer,


GLP4, acc. AJ310534; Wei Y., Zhang Z., Andersen C. H., Schmelzer E., Gregersen P. L., Collinge D. B., Smedegaard-Petersen V. and Thordal-Christensen H., Plant Molecular Biology 36, 101 (1998),


GLP2a, acc. AJ237942, Schweizer P., Christoffel A. and Dudler R., Plant J. 20, 541 (1999); Prx7, acc. AJ003141, Kristensen B. K., Ammitzböll H., Rasmussen S. K. and Nielsen K. A., Molecular Plant Pathology, 2(6), 311 (2001);


GerA, acc. AF250933; Wu S., Druka A., Horvath H., Kleinhofs A., Kannangara G. and von Wettstein D., Plant Phys Biochem 38, 685 (2000);


OsROC1, acc. AP004656


RTBV, acc. AAV62708, AAV62707; Klöti A., Henrich C., Bieri S., He X., Chen G., Burkhardt P. K., Wünn J., Lucca P., Hohn T., Potrykus I. and Fütterer J., PMB 40, 249 (1999); Chitinase ChtC2-Promoter from potato (Ancillo et al., Planta. 217(4), 566, (2003));


AtProT3 Promoter (Grallath et al., Plant Physiology. 137(1), 117 (2005));

SHN-Promoters from Arabidopsis (AP2/EREBP transcription factors involved in cutin and wax production) (Aaron et al., Plant Cell. 16(9), 2463 (2004)); and/or


GSTA1 from wheat (Dudler et al., WP2005306368 and Altpeter et al., Plant Molecular Biology. 57(2), 271 (2005)).


Mesophyll-specific promoters may be selected from the group consisting of:


PPCZm1 (=PEPC); Kausch A. P., Owen T. P., Zachwieja S. J., Flynn A. R. and Sheen J., Plant Mol. Biol. 45, 1 (2001);


OsrbcS, Kyozuka et al., PlaNT Phys 102, 991 (1993); Kyozuka J., McElroy D., Hayakawa T., Xie Y., Wu R. and Shimamoto K., Plant Phys. 102, 991 (1993);

OsPPDK, acc. AC099041;


TaGF-2.8, acc. M63223; Schweizer P., Christoffel A. and Dudler R., Plant J. 20, 541 (1999);


TaFBPase, acc. X53957;


TaWIS1, acc. AF467542; US 200220115849;


HvBIS1, acc. AF467539; US 200220115849;


ZmMIS1, acc. AF467514; US 200220115849;


HvPR1a, acc. X74939; Bryngelsson et al., Mol. Plant Microbe Interacti. 7 (2), 267 (1994);


HvPR1b, acc. X74940; Bryngelsson et al., Mol. Plant Microbe Interact. 7(2), 267 (1994);


HvB1,3gluc; acc. AF479647;


HvPrx8, acc. AJ276227; Kristensen et al., Molecular Plant Pathology, 2(6), 311 (2001);


and/or


HvPAL, acc. X97313; Wei Y., Zhang Z., Andersen C. H., Schmelzer E., Gregersen P. L., Collinge D. B., Smedegaard-Petersen V. and Thordal-Christensen H. Plant Molecular Biology 36, 101 (1998).


Constitutive promoters may be selected from the group consisting of

    • PcUbi promoter from parsley (WO 03/102198)
    • CaMV 35S promoter: Cauliflower Mosaic Virus 35S promoter (Benfey et al. 1989 EMBO J. 8(8): 2195-2202),
    • STPT promoter: Arabidopsis thaliana Short Triose phosphate translocator promoter (Accession NM123979)
    • Act1 promoter: Oryza sativa actin 1 gene promoter (McElroy et al. 1990 PLANT CELL 2(2) 163-171 a) and/or
    • EF1A2 promoter: Glycine max translation elongation factor EF1 alpha (US 20090133159).


In preferred embodiments, the increase in the protein quantity or function of the HCP6 protein takes place in a constitutive or tissue-specific manner. In especially preferred embodiments, an essentially pathogen-induced increase in the protein quantity or protein function takes place, for example by exogenous expression of the HCP6 nucleic acid under the control of a fungal-inducible promoter, preferably a rust-inducible promoter. In particular, the expression of the HCP6 nucleic acid takes place on fungal infected sites, where, however, preferably the expression of the HCP6 nucleic acid sequence remains essentially unchanged in tissues not infected by fungus.


Preferably, the HCP6 nucleic acid is under the control of a rust induced mesophyll specific promoter. More preferably, the promoter is the rust induced mesophyll specific promoter 820.


A preferred terminator is the terminator of the cathepsin D inhibitor gene from Solanum tuberosum.


Preferred promoter-terminator combinations with the gene of interest in between are a promoter from parsley, preferably, the parsley ubiquitine promoter or the maize ubiquitin promoter, in combination with the terminator of the cathepsin D inhibitor gene from Solanum tuberosum. Another preferred promoter-terminator combination is the rust induced mesophyll specific promoter 820 in combination with the terminator of the cathepsin D inhibitor gene from Solanum tuberosum.


An intron sequence may also be added to the 5′ untranslated region (UTR) and/or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg (1988) Mol. Cell biol. 8: 4395-4405; Callis et al. (1987) Genes Dev 1:1183-1200). Such intron enhancement of gene expression is typically greatest when placed near the 5′ end of the transcription unit. Use of the maize introns Adh1-S intron 1, 2, and 6, the Bronze-1 intron are known in the art. For general information see: The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, N.Y. (1994).


One type of vector construct is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vector constructs are capable of autonomous replication in a host plant cell into which they are introduced. Other vector constructs are integrated into the genome of a host plant cell upon introduction into the host cell, and thereby are replicated along with the host genome. In particular the vector construct is capable of directing the expression of gene to which the vectors is operatively linked. However, the invention is intended to include such other forms of expression vector constructs, such as viral vectors (e.g., potato virus X, tobacco rattle virus, and/or Gemini virus), which serve equivalent functions.


Transgenic Organisms; Transgenic Plants, Plant Parts, and Plant Cells

A preferred embodiment is a transgenic plant, transgenic plant part, or transgenic plant cell overexpressing an exogenous HCP6 protein. Preferably, the HCP6 protein overexpressed in the plant, plant part or plant cell is encoded by a nucleic acid comprising

  • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment, thereof, an orthologue or a paralogue thereof, or a splice variant thereof; or by
  • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Most preferably, the exogenous nucleic acid has at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35; or comprises an exogenous nucleic acid encoding a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27.


A preferred embodiment is a transgenic plant, transgenic plant part, or transgenic plant cell overexpressing an exogenous HCP6 protein. Preferably, the HCP6 protein overexpressed in the plant, plant part or plant cell is encoded by

  • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 1 or a functional fragment, thereof, an orthologue or a paralogue thereof, or a splice variant thereof; or by
  • (ii) an exogenous nucleic acid encoding a protein having at least 60% identity with SEQ ID NO: 2, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


A preferred embodiment is a transgenic plant, transgenic plant part, or transgenic plant cell overexpressing an exogenous HCP6 protein. Preferably, the HCP6 protein overexpressed in the plant, plant part or plant cell is encoded by

  • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6 or a functional fragment, thereof, an orthologue or a paralogue thereof, or a splice variant thereof; or by
  • (ii) an exogenous nucleic acid encoding a protein having at least 60% identity with SEQ ID NO: 2, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
  • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Most preferably, the exogenous nucleic acid has at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 1; or comprises an exogenous nucleic acid encoding a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2 or 4.


Most preferably, the exogenous nucleic acid has at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6; or comprises an exogenous nucleic acid encoding a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2.


In preferred embodiments, the protein amount of a HCP6 protein in the transgenic plant is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% or more in comparison to a wild type plant that is not transformed with the HCP6 nucleic acid.


More preferably, the transgenic plant, transgenic plant part, or transgenic plant cell according to the present invention has been obtained by transformation with a recombinant vector described herein.


Suitable methods for transforming or transfecting host cells including plant cells are well known in the art of plant biotechnology. Any method may be used to transform the recombinant expression vector into plant cells to yield the transgenic plants of the invention. General methods for transforming dicotyledonous plants are disclosed, for example, in U.S. Pat. Nos. 4,940,838; 5,464,763, and the like. Methods for transforming specific dicotyledonous plants, for example, cotton, are set forth in U.S. Pat. Nos. 5,004,863; 5,159,135; and 5,846,797. Soy transformation methods are set forth in U.S. Pat. Nos. 4,992,375; 5,416,011; 5,569,834; 5,824,877; 6,384,301 and in EP 0301749B1 may be used. Transformation methods may include direct and indirect methods of transformation. Suitable direct methods include polyethylene glycol induced DNA uptake, liposome-mediated transformation (U.S. Pat. No. 4,536,475), biolistic methods using the gene gun (Fromm M E et. al., Bio/Technology. 8(9):833-9, 1990; Gordon-Kamm et al. Plant Cell 2:603, 1990), electroporation, incubation of dry embryos in DNA-comprising solution, and microinjection. In the case of these direct transformation methods, the plasmids used need not meet any particular requirements. Simple plasmids, such as those of the pUC series, pBR322, M13mp series, pACYC184 and the like can be used. If intact plants are to be regenerated from the transformed cells, an additional selectable marker gene is preferably located on the plasmid. The direct transformation techniques are equally suitable for dicotyledonous and monocotyledonous plants.


Transformation can also be carried out by bacterial infection by means of Agrobacterium (for example EP 0 116 718), viral infection by means of viral vectors (EP 0 067 553; U.S. Pat. No. 4,407,956; WO 95/34668; WO 93/03161) or by means of pollen (EP 0 270 356; WO 85/01856; U.S. Pat. No. 4,684,611). Agrobacterium based transformation techniques (especially for dicotyledonous plants) are well known in the art. The Agrobacterium strain (e.g., Agrobacterium tumefaciens or Agrobacterium rhizogenes) comprises a plasmid (Ti or Ri plasmid) and a T-DNA element which is transferred to the plant following infection with Agrobacterium. The T-DNA (transferred DNA) is integrated into the genome of the plant cell. The T-DNA may be localized on the Ri- or Ti-plasmid or is separately comprised in a so-called binary vector. Methods for the Agrobacterium-mediated transformation are described, for example, in Horsch R B et al. (1985) Science 225:1229. The Agrobacterium-mediated transformation is best suited to dicotyledonous plants but has also been adapted to monocotyledonous plants. The transformation of plants by Agrobacteria is described in, for example, White F F, Vectors for Gene Transfer in Higher Plants, Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15-38; Jenes B et. al. Techniques for Gene Transfer, Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 128-143; Potrykus (1991) Annu Rev Plant Physiol Plant Molec Biol 42:205-225. Transformation may result in transient or stable transformation and expression. Although a nucleotide sequence of the present invention can be inserted into any plant and plant cell falling within these broad classes, it is particularly useful in crop plant cells.


The genetically modified plant cells can be regenerated via all methods with which the skilled worker is familiar. Suitable methods can be found in the abovementioned publications by S. D. Kung and R. Wu, Potrykus or Höfgen and Willmitzer.


After transformation, plant cells or cell groupings may be selected for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the gene of interest, following which the transformed material is regenerated into a whole plant. To select transformed plants, the plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants. For example, the seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection by spraying. A further possibility consists in growing the seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can grow into plants. Alternatively, the transformed plants are screened for the presence of a selectable marker such as the ones described above. The transformed plants may also be directly selected by screening for the presence of the HCP6 nucleic acid.


Following DNA transfer and regeneration, putatively transformed plants may also be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organisation. Alternatively or additionally, expression levels of the newly introduced DNA may be monitored using Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.


The generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1) transformed plant may be selfed and homozygous second-generation (or T2) transformants selected, and the T2 plants may then further be propagated through classical breeding techniques. The generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).


Preferably, constructs or vectors or expression cassettes are not present in the genome of the original plant or are present in the genome of the transgenic plant not at their natural locus of the genome of the original plant.


Preferably, the transgenic plant of the present invention or the plant obtained by the method of the present invention has increased resistance against fungal pathogens, preferably rust pathogens (i.e., fungal pathogens of the order Pucciniales), preferably against fungal pathogens of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust. Preferably, resistance against Phakopsora pachyrhizi and/or Phakopsora meibomiae is increased.


Preferably, the plant, plant part, or plant cell is a plant or derived from a plant selected from the group consisting of beans, soya, pea, clover, kudzu, lucerne, lentils, lupins, vetches, groundnut, rice, wheat, barley, arabidopsis, lentil, banana, canola, cotton, potatoe, corn, sugar cane, alfalfa, and sugar beet.


In one embodiment of the present invention the plant is selected from the group consisting of beans, soya, pea, clover, kudzu, lucerne, lentils, lupins, vetches, and/or groundnut. Preferably, the plant is a legume, comprising plants of the genus Phaseolus (comprising French bean, dwarf bean, climbing bean (Phaseolus vulgaris), Lima bean (Phaseolus lunatus L.), Tepary bean (Phaseolus acutifolius A. Gray), runner bean (Phaseolus coccineus)); the genus Glycine (comprising Glycine soja, soybeans (Glycine max (L.) Merill)); pea (Pisum) (comprising shelling peas (Pisum sativum L. convar. sativum), also called smooth or roundseeded peas; marrowfat pea (Pisum sativum L. convar. medullare Alef. emend. C. O. Lehm), sugar pea (Pisum sativum L. convar. axiphium Alef emend. C. O. Lehm), also called snow pea, edible-podded pea or mangetout, (Pisum granda sneida L. convar. sneidulo p. shneiderium)); peanut (Arachis hypogaea), clover (Trifolium spec.), medick (Medicago), kudzu vine (Pueraria lobata), common lucerne, alfalfa (M. sativa L.), chickpea (Cicer), lentils (Lens) (Lens culinaris Medik.), lupins (Lupinus); vetches (Vicia), field bean, broad bean (Vicia faba), vetchling (Lathyrus) (comprising chickling pea (Lathyrus sativus), heath pea (Lathyrus tuberosus)); genus Vigna (comprising moth bean (Vigna aconitifolia (Jacq.) Maréchal), adzuki bean (Vigna angularis (Willd.) Ohwi & H. Ohashi), urd bean (Vigna mungo (L.) Hepper), mung bean (Vigna radiata (L.) R. Wilczek), bambara groundnut (Vigna subterrane (L.) Verdc.), rice bean (Vigna umbellata (Thunb.) Ohwi & H. Ohashi), Vigna vexillata (L.) A. Rich., Vigna unguiculata (L.) Walp., in the three subspecies asparagus bean, cowpea, catjang bean)); pigeonpea (Cajanus cajan (L.) Millsp.), the genus Macrotyloma (comprising geocarpa groundnut (Macrotyloma geocarpum (Harms) Maréchal & Baudet), horse bean (Macrotyloma uniflorum (Lam.) Verdc.); goa bean (Psophocarpus tetragonolobus (L.) DC.), African yam bean (Sphenostylis stenocarpa (Hochst. ex A. Rich.) Harms), Egyptian black bean, dolichos bean, lablab bean (Lablab purpureus (L.) Sweet), yam bean (Pachyrhizus), guar bean (Cyamopsis tetragonolobus (L.) Taub.); and/or the genus Canavalia (comprising jack bean (Canavalia ensiformis (L.) DC.), sword bean (Canavalia gladiata (Jacq.) DC.).


Further preferred is a plant selected from the group consisting of beans, soya, pea, clover, kudzu, lucerne, lentils, lupins, vetches, and groundnut. Most preferably, the plant, plant part, or plant cell is or is derived from soy.


Preferably, the transgenic plant of the present invention or the plant obtained by the method of the present invention is a soybean plant and has increased resistance against fungal pathogens of the order Pucciniales (rust), preferably, of the family Phacopsoraceae, more preferably against fungal pathogens of the genus Phacopsora, most preferably against Phakopsora pachyrhizi and Phakopsora meibomiae, also known as soybean rust. Preferably, resistance against Phakopsora pachyrhizi and/or Phakopsora meibomiae is increased.


Methods for the Production of Transgenic Plants

One embodiment according to the present invention provides a method for producing a transgenic plant, a transgenic plant part, or a transgenic plant cell resistant to a fungal pathogen, preferably of the family Phacosporaceae, for example soybean rust, wherein the recombinant nucleic acid used to generate a transgenic plant comprises a promoter that is functional in the plant cell, operably linked to an HCP6 nucleic acid, which is preferably SEQ ID NO: 1, and


a terminator regulatory sequence.


In one embodiment, the present invention refers to a method for the production of a transgenic plant, transgenic plant part, or transgenic plant cell having increased fungal resistance, comprising

  • (a) introducing a recombinant vector construct according to the present invention into a plant, a plant part or a plant cell and
  • (b) generating a transgenic plant from the plant, plant part or plant cell.


Preferably, the method for the production of the transgenic plant, transgenic plant part, or transgenic plant cell further comprises the step

  • (c) expressing the HCP6 protein, preferably encoded by a nucleic acid comprising
    • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
    • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferably, said introducing and expressing does not comprise an essentially biological process.


More preferably, the method for the production of the transgenic plant, transgenic plant part, or transgenic plant cell further comprises the step

  • (c) expressing the HCP6 protein, preferably encoded by
    • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 1, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) an exogenous nucleic acid encoding a protein having at least 60% identity with SEQ ID NO: 2, or a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
    • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


More preferably, the method for the production of the transgenic plant, transgenic plant part, or transgenic plant cell further comprises the step

  • (c) expressing the HCP6 protein, preferably encoded by
    • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) an exogenous nucleic acid encoding a protein having at least 60% identity with SEQ ID NO: 2, or a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
    • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferably, the method for the production of the transgenic plant, transgenic plant part, or transgenic plant cell further comprises the step of selecting a transgenic plant expressing

    • (i) an exogenous nucleic acid having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, or an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) an exogenous nucleic acid coding for a protein having at least 60% identity, preferably at least 70% sequence identity, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity, or even 100% sequence identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecute codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
    • (iv) an exogenous nucleic acid encoding the same HCP6 polypeptide as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Preferably, the method for the production of the transgenic plant, transgenic plant part, or transgenic plant cell additionally comprises the step of harvesting the seeds of the transgenic plant and planting the seeds and growing the seeds to plants, wherein the grown plant(s) comprises

  • (i) the exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
  • (ii) the exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) the exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
  • (iv) the exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code;


    preferably, the step of harvesting the seeds of the transgenic plant and planting the seeds and growing the seeds to plants, wherein the grown plant(s) comprises
  • (i) the exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
  • (ii) the exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
  • (iii) the exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecule codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or
  • (iv) the exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code;


    is repeated more than one time, preferably, 1, 2, 3, 4, 5, 6, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 times.


The transgenic plants may be selected by known methods as described above (e.g., by screening for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the HCP6 gene or by directly screening for the HCP6 nucleic acid).


Furthermore, the use of the exogenous HCP6 nucleic acid or the recombinant vector construct comprising the HCP6 nucleic acid for the transformation of a plant, plant part, or plant cell to provide a fungal resistant plant, plant part, or plant cell is provided.


Harvestable Parts and Products

Harvestable parts of the transgenic plant according to the present invention are part of the invention. Preferably, the harvestable parts comprise the HCP6 nucleic acid or HCP6 protein. The harvestable parts may be seeds, roots, leaves and/or flowers comprising the HCP6 nucleic acid or HCP6 protein or parts thereof. Preferred parts of soy plants are soy beans comprising the HCP6 nucleic acid or HCP6 protein.


Products derived from a transgenic plant according to the present invention, parts thereof or harvestable parts thereof are part of the invention. A preferred product is meal or oil, preferably, soybean meal or soybean oil. Preferably, the soybean meal and/or oil comprises the HCP6 nucleic acid or HCP6 protein.


Methods for Manufacturing a Product

In one embodiment the method for the production of a product comprises

  • a) growing the plants of the invention or obtainable by the methods of invention and
  • b) producing said product from or by the plants of the invention and/or parts, e.g. seeds, of these plants.


In a further embodiment the method comprises the steps a) growing the plants of the invention, b) removing the harvestable parts as defined above from the plants and c) producing said product from or by the harvestable parts of the invention.


The product may be produced at the site where the plant has been grown, the plants and/or parts thereof may be removed from the site where the plants have been grown to produce the product. Typically, the plant is grown, the desired harvestable parts are removed from the plant, if feasible in repeated cycles, and the product made from the harvestable parts of the plant. The step of growing the plant may be performed only once each time the methods of the invention is performed, while allowing repeated times the steps of product production e.g. by repeated removal of harvestable parts of the plants of the invention and if necessary further processing of these parts to arrive at the product. It is also possible that the step of growing the plants of the invention is repeated and plants or harvestable parts are stored until the production of the product is then performed once for the accumulated plants or plant parts. Also, the steps of growing the plants and producing the product may be performed with an overlap in time, even simultaneously to a large extend or sequentially. Generally the plants are grown for some time before the product is produced.


In one embodiment the products produced by said methods of the invention are plant products such as, but not limited to, a foodstuff, feedstuff, a food supplement, feed supplement, fiber, cosmetic and/or pharmaceutical. Foodstuffs are regarded as compositions used for nutrition and/or for supplementing nutrition. Animal feedstuffs and animal feed supplements, in particular, are regarded as foodstuffs.


In another embodiment the inventive methods for the production are used to make agricultural products such as, but not limited to, plant extracts, proteins, amino acids, carbohydrates, fats, oils, polymers, vitamins, and the like.


It is possible that a plant product consists of one or more agricultural products to a large extent.


Methods for Breeding/Methods for Plant Improvement/Methods Plant Variety Production

The transgenic plants of the invention may be crossed with similar transgenic plants or with transgenic plants lacking the nucleic acids of the invention or with non-transgenic plants, using known methods of plant breeding, to prepare seeds. Further, the transgenic plant cells or plants of the present invention may comprise, and/or be crossed to another transgenic plant that comprises one or more exogenous nucleic acids, thus creating a “stack” of transgenes in the plant and/or its progeny. The seed is then planted to obtain a crossed fertile transgenic plant comprising the HCP6 nucleic acid. The crossed fertile transgenic plant may have the particular expression cassette inherited through a female parent or through a male parent. The second plant may be an inbred plant. The crossed fertile transgenic may be a hybrid. Also included within the present invention are seeds of any of these crossed fertile transgenic plants. The seeds of this invention can be harvested from fertile transgenic plants and be used to grow progeny generations of transformed plants of this invention including hybrid plant lines comprising the exogenous nucleic acid.


Thus, one embodiment of the present invention is a method for breeding a fungal resistant plant comprising the steps of

  • (a) crossing a transgenic plant described herein or a plant obtainable by a method described herein with a second plant;
  • (b) obtaining a seed or seeds resulting from the crossing step described in (a);
  • (c) planting said seed or seeds and growing the seed or seeds to plants; and
  • (d) selecting from said plants the plants expressing an HCP6 protein, preferably encoded by a nucleic acid comprising
    • (i) an exogenous nucleic acid having at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;
    • (ii) an exogenous nucleic acid encoding a protein comprising an amino acid sequence having at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof; preferably the encoded protein confers enhanced fungal resistance relative to control plants;
    • (iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); preferably encoding a HCP6 protein; preferably wherein the nucleic acid molecute codes for a polypeptide which has essentially identical properties to the polypeptide described in SEQ ID NO: 2 or 4; preferably the encoded protein confers enhanced fungal resistance relative to control plants; and/or by
    • (iv) an exogenous nucleic acid encoding the same HCP6 protein as the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.


Another preferred embodiment is a method for plant improvement comprising

  • (a) obtaining a transgenic plant by any of the methods of the present invention;
  • (b) combining within one plant cell the genetic material of at least one plant cell of the plant of (a) with the genetic material of at least one cell differing in one or more gene from the plant cells of the plants of (a) or crossing the transgenic plant of (a) with a second plant;
  • (c) obtaining seed from at least one plant generated from the one plant cell of (b) or the plant of the cross of step (b);
  • (d) planting said seeds and growing the seeds to plants; and
  • (e) selecting from said plants, plants expressing the nucleic acid encoding the HCP6 protein; and optionally
  • (f) producing propagation material from the plants expressing the nucleic acid encoding the HCP6 protein.


The transgenic plants may be selected by known methods as described above (e.g., by screening for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the HCP6 gene or screening for the HCP6 nucleic acid itself).


According to the present invention, the introduced HCP6 nucleic acid may be maintained in the plant cell stably if it is incorporated into a non-chromosomal autonomous replicon or integrated into the plant chromosomes. Whether present in an extra-chromosomal nonreplicating or replicating vector construct or a vector construct that is integrated into a chromosome, the exogenous HCP6 nucleic acid preferably resides in a plant expression cassette. A plant expression cassette preferably contains regulatory sequences capable of driving gene expression in plant cells that are functional linked so that each sequence can fulfill its function, for example, termination of transcription by polyadenylation signals. Preferred polyadenylation signals are those originating from Agrobacterium tumefaciens t-DNA such as the gene 3 known as octopine synthase of the Ti-plasmid pTiACH5 (Gielen et al., 1984, EMBO J. 3:835) or functional equivalents thereof, but also all other terminators functionally active in plants are suitable. As plant gene expression is very often not limited on transcriptional levels, a plant expression cassette preferably contains other functional linked sequences like translational enhancers such as the overdrive-sequence containing the 5′-untranslated leader sequence from tobacco mosaic virus increasing the polypeptide per RNA ratio (Gallie et al., 1987, Nucl. Acids Research 15:8693-8711). Examples of plant expression vectors include those detailed in: Becker, D. et al., 1992, New plant binary vectors with selectable markers located proximal to the left border, Plant Mol. Biol. 20:1195-1197; Bevan, M. W., 1984, Binary Agrobacterium vectors for plant transformation, Nucl. Acid. Res. 12:8711-8721; and Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, eds.: Kung and R. Wu, Academic Press, 1993, S. 15-38.


EXAMPLES

The following examples are not intended to limit the scope of the claims to the invention, but are rather intended to be exemplary of certain embodiments. Any variations in the exemplified methods that occur to the skilled artisan are intended to fall within the scope of the present invention.


Example 1
General Methods

The chemical synthesis of oligonucleotides can be affected, for example, in the known fashion using the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The cloning steps carried out for the purposes of the present invention such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking DNA fragments, transformation of E. coli cells, bacterial cultures, phage multiplication and sequence analysis of recombinant DNA, are carried out as described by Sambrook et al. Cold Spring Harbor Laboratory Press (1989), ISBN 0-87969-309-6. The sequencing of recombinant DNA molecules is carried out with an MWG-Licor laser fluorescence DNA sequencer following the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA 74, 5463 (1977)).


Example 2
Cloning of Overexpression Vector Constructs

The cDNA was produced from Arabidopsis thaliana (ecotype Col-0) RNA by using the Superscript II cDNA synthesis kit (Invitrogen). All steps of cDNA preparation and purification were performed according as described in the manual.


First, the HCP6 sequence from ATG to Stop (SEQ ID NO: 1) was specifically amplified from the cDNA by PCR as described in the protocol of the Phusion hot-start, Pfu Ultra, Pfu Turbo or Herculase DNA polymerase (Stratagene).


The composition for the protocol of the Pfu Ultra, Pfu Turbo or Herculase DNA polymerase was as follows: 1×PCR buffer, 0.25 mM of each dNTP, 100 ng cDNA of Arabidopsis thaliana (var Columbia-0), 10 pmol forward primer, 10 pmol reverse primer, 3% DMSO (v/v), 1.5 mM MgCl2, 1 u Phusion hot-start, Pfu Ultra, Pfu Turbo or Herculase DNA polymerase.


The amplification cycles were as follows:


1 cycle of 120 seconds at 98° C., followed by 5 cycles with decreasing annealing temperature (1° C. per cycle) from 70° C. to 66° C. (each cycle: denaturation 20 sec at 98° C., 60 sec annealing 70° C. down to 66° C., and extension at 72° C. for 180 sec), followed by 30 cycles of in each case 20 seconds at 98° C., 60 seconds at 65° C. and 180 seconds at 72° C., followed by 1 cycle of 5 minutes at 72° C., then 4° C.


The primers (as shown in SEQ ID NO: 8 and 9) were designed in a way that they specifically bind to sequences around the start ATG and around the stop codon of the HCP6 coding sequence.











i) forward primer:



(SEQ ID NO: 8)



5′- TGCATGGCTTCTTCTTCTTCCTCACCT -3′







ii) reverse primer:



(SEQ ID NO: 9)



5′- CGCGCTAGTGAATTGACAACACAACG -3′






The amplified fragment (2700 bp) was eluted and purified from an 1% agarose gel by using the Nucleospin Extract II Kit (Macherey and Nagel, Dueren, Germany). As the amount of amplified DNA was very low, a second PCR was performed to increase the amount of the fragment and to add attB recombination sites in front and behind the gene that facilitates BP reaction cloning of the HCP-6 fragment into an DONOR vector (Gateway system, (Invitrogen, Life Technologies, Carlsbad, Calif., USA).


The HCP6 full-length sequence including the attached attB-sites was specifically amplified from the eluted PCR fragment (see above) by PCR as described in the protocol of the Phusion hot-start, Pfu Ultra, Pfu Turbo or Herculase DNA polymerase (Stratagene).


The composition for the protocol of the Pfu Ultra, Pfu Turbo or Herculase DNA polymerase was as follows: 1×PCR buffer, 0.25 mM of each dNTP, 10-50 ng template DNA derived from the previous PCR of, 10 pmol forward primer, 10 pmol reverse primer, 3% DMSO (v/v), 1.5 mM MgCl2, 1 u Phusion hot-start, Pfu Ultra, Pfu Turbo or Herculase DNA polymerase.


The amplification cycles were as follows:


1 cycle of 120 seconds at 98° C., followed by 10 cycles with decreasing annealing temperature (1° C. per cycle) from 70° C. to 61° C. (each cycle: denaturation 30 sec at 98° C., 60 sec annealing 70° C. down to 61° C., and extension at 72° C. for 180 sec), followed by 20 cycles of in each case 30 seconds at 98° C., 60 seconds at 60° C. and 180 seconds at 72° C., followed by 1 cycle of 5 minutes at 72° C., then 4° C.


The primers (as shown in SEQ ID NO: 10 and 11) were designed in a way that an attB1-recombination site (Gateway system, Invitrogen Life Technologies, Carlsbad, Calif., USA) is located in front of the start-ATG and an attB2 recombination site is located directly downstream of the stop-codon.











i) forward primer:



(SEQ ID NO: 10)



5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGGCTTCTTC







TTCTTCCTCACCT-3′







ii) reverse primer:



(SEQ ID NO: 11)



5′GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTGAATTGAC







AACACAACG -3′






The amplified fragments were transferred to a pENTRY-B vector by using the BP reaction (Gateway system, Invitrogen, Life Technologies, Carlsbad, Calif., USA) according to the protocol provided by the supplier in a way that the full-length HCP6 fragment is located in sense direction between the attL1 and attL2 recombination sites.


It is also possible to generate all DNA fragments mentioned in this invention by DNA synthesis (e.g. Geneart, Regensburg, Germany).


To obtain the binary plant transformation vector, a triple LR reaction (Gateway system, Invitrogen, Life Technologies, Carlsbad, Calif., USA) was performed according to manufacturer's protocol by using a pENTRY-A vector containing a parsley ubiquitine promoter, the HCP6 full-length gene in a pENTRY-B vector and a pENTRY-C vector containing the terminator of the cathepsin D inhibitor gene from Solanum tuberosum. As target a binary pDEST vector was used which is composed of: (1) a Spectinomycin/Streptomycin resistance cassette for bacterial selection (2) a pVS1 origin for replication in Agrobacteria (3) a ColE1 origin of replication for stable maintenance in E. coli and (4) between the right and left border an AHAS selection under control of a pcUbi-promoter (see FIG. 2). The recombination reaction was transformed into E. coli (DHSalpha), mini-prepped and screened by specific restriction digestions. A positive clone containing the construct was sequenced and submitted soy transformation.


Example 3
Soy Transformation

The expression vector constructs (see example 2) were transformed into soy.


3.1 Sterilization and Germination of Soy Seeds

Virtually any seed of any soy variety can be employed in the method of the invention. A variety of soybean cultivar (including Jack, Williams 82, Jake, Stoddard and Resnik) is appropriate for soy transformation. Soy seeds were sterilized in a chamber with a chlorine gas produced by adding 3.5 ml 12N HCl drop wise into 100 ml bleach (5.25% sodium hypochlorite) in a desiccator with a tightly fitting lid. After 24 to 48 hours in the chamber, seeds were removed and approximately 18 to 20 seeds were plated on solid GM medium with or without 5 μM 6-benzyl-aminopurine (BAP) in 100 mm Petri dishes. Seedlings without BAP are more elongated and roots develop, especially secondary and lateral root formation. BAP strengthens the seedling by forming a shorter and stockier seedling.


Seven-day-old seedlings grown in the light (>100 pEinstein/rrs) at 25° C. were used for explant material for the three-explant types. At this time, the seed coat was split, and the epicotyl with the unifoliate leaves have grown to, at minimum, the length of the cotyledons. The epicotyl should be at least 0.5 cm to avoid the cotyledonary-node tissue (since soycultivars and seed lots may vary in the developmental time a description of the germination stage is more accurate than a specific germination time).


For inoculation of entire seedlings, see Method A (example 3.3.1 and 3.3.2) or leaf explants, see Method B (example 3.3.3).


For method C (see example 3.3.4), the hypocotyl and one and a half or part of both cotyledons were removed from each seedling. The seedlings were then placed on propagation media for 2 to 4 weeks. The seedlings produce several branched shoots to obtain explants from. The majority of the explants originated from the plantlet growing from the apical bud. These explants were preferably used as target tissue.


3.2—Growth and Preparation of Agrobacterium Culture


Agrobacterium cultures were prepared by streaking Agrobacterium (e.g., A. tumefaciens or A. rhizogenes) carrying the desired binary vector (e.g. H. Klee. R. Horsch and S. Rogers 1987 Agrobacterium-Mediated Plant Transformation and its further Applications to Plant Biology; Annual Review of Plant Physiology Vol. 38: 467-486) onto solid YEP growth medium (YEP media: 10 g yeast extract, 10 g Bacto Peptone, 5 g NaCl, Adjust pH to 7.0, and bring final volume to 1 liter with H2O, for YEP agar plates add 20 g Agar, autoclave) and incubating at 25° C. until colonies appeared (about 2 days). Depending on the selectable marker genes present on the Ti or Ri plasmid, the binary vector, and the bacterial chromosomes, different selection compounds were be used for A. tumefaciens and A. rhizogenes selection in the YEP solid and liquid media. Various Agrobacterium strains can be used for the transformation method.


After approximately two days, a single colony (with a sterile toothpick) was picked and 50 ml of liquid YEP was inoculated with antibiotics and shaken at 175 rpm (25° C.) until an OD600 between 0.8-1.0 is reached (approximately 2 d). Working glycerol stocks (15%) for transformation are prepared and one-ml of Agrobacterium stock aliquoted into 1.5 ml Eppendorf tubes then stored at −80° C.


The day before explant inoculation, 200 ml of YEP were inoculated with 5 μl to 3 ml of working Agrobacterium stock in a 500 ml Erlenmeyer flask. The flask was shaken overnight at 25° C. until the OD600 was between 0.8 and 1.0. Before preparing the soy explants, the Agrobacteria were pelleted by centrifugation for 10 min at 5,500×g at 20° C. The pellet was resuspended in liquid CCM to the desired density (OD600 0.5-0.8) and placed at room temperature at least 30 min before use.


3.3—Explant Preparation and Co-Cultivation (Inoculation)
3.3.1 Method A: Explant Preparation on the Day of Transformation.

Seedlings at this time had elongated epicotyls from at least 0.5 cm but generally between 0.5 and 2 cm. Elongated epicotyls up to 4 cm in length had been successfully employed. Explants were then prepared with: i) with or without some roots, ii) with a partial, one or both cotyledons, all preformed leaves were removed including apical meristem, and the node located at the first set of leaves was injured with several cuts using a sharp scalpel.


This cutting at the node not only induced Agrobacterium infection but also distributed the axillary meristem cells and damaged pre-formed shoots. After wounding and preparation, the explants were set aside in a Petri dish and subsequently co-cultivated with the liquid CCM/Agrobacterium mixture for 30 minutes. The explants were then removed from the liquid medium and plated on top of a sterile filter paper on 15×100 mm Petri plates with solid co-cultivation medium. The wounded target tissues were placed such that they are in direct contact with the medium.


3.3.2 Modified Method A: Epicotyl Explant Preparation

Soyepicotyl segments prepared from 4 to 8 d old seedlings were used as explants for regeneration and transformation. Seeds of soya cv. L00106CN, 93-41131 and Jack were germinated in 1/10 MS salts or a similar composition medium with or without cytokinins for 4 to 8 d. Epicotyl explants were prepared by removing the cotyledonary node and stem node from the stem section. The epicotyl was cut into 2 to 5 segments. Especially preferred are segments attached to the primary or higher node comprising axillary meristematic tissue.


The explants were used for Agrobacterium infection. Agrobacterium AGL1 harboring a plasmid with the gene of interest (GOI) and the AHAS, bar or dsdA selectable marker gene was cultured in LB medium with appropriate antibiotics overnight, harvested and resuspended in a inoculation medium with acetosyringone. Freshly prepared epicotyl segments were soaked in the Agrobacterium suspension for 30 to 60 min and then the explants were blotted dry on sterile filter papers. The inoculated explants were then cultured on a coculture medium with L-cysteine and TTD and other chemicals such as acetosyringone for increasing T-DNA delivery for 2 to 4 d. The infected epicotyl explants were then placed on a shoot induction medium with selection agents such as imazapyr (for AHAS gene), glufosinate (for bar gene), or D-serine (for dsdA gene). The regenerated shoots were subcultured on elongation medium with the selective agent.


For regeneration of transgenic plants the segments were then cultured on a medium with cytokinins such as BAP, TDZ and/or Kinetin for shoot induction. After 4 to 8 weeks, the cultured tissues were transferred to a medium with lower concentration of cytokinin for shoot elongation. Elongated shoots were transferred to a medium with auxin for rooting and plant development. Multiple shoots were regenerated.


Many stable transformed sectors showing strong cDNA expression were recovered. Soyplants were regenerated from epicotyl explants. Efficient T-DNA delivery and stable transformed sectors were demonstrated.


3.3.3 Method B: Leaf Explants

For the preparation of the leaf explant the cotyledon was removed from the hypocotyl. The cotyledons were separated from one another and the epicotyl is removed. The primary leaves, which consist of the lamina, the petiole, and the stipules, were removed from the epicotyl by carefully cutting at the base of the stipules such that the axillary meristems were included on the explant. To wound the explant as well as to stimulate de novo shoot formation, any pre-formed shoots were removed and the area between the stipules was cut with a sharp scalpel 3 to 5 times.


The explants are either completely immersed or the wounded petiole end dipped into the Agrobacterium suspension immediately after explant preparation. After inoculation, the explants are blotted onto sterile filter paper to remove excess Agrobacterium culture and place explants with the wounded side in contact with a round 7 cm Whatman paper overlaying the solid CCM medium (see above). This filter paper prevents A. tumefaciens overgrowth on the soy-explants. Wrap five plates with Parafilm™ “M” (American National Can, Chicago, Ill., USA) and incubate for three to five days in the dark or light at 25° C.


3.3.4 Method C: Propagated Axillary Meristem

For the preparation of the propagated axillary meristem explant propagated 3-4 week-old plantlets were used. Axillary meristem explants can be pre-pared from the first to the fourth node. An average of three to four explants could be obtained from each seedling. The explants were prepared from plantlets by cutting 0.5 to 1.0 cm below the axillary node on the internode and removing the petiole and leaf from the explant. The tip where the axillary meristems lie was cut with a scalpel to induce de novo shoot growth and allow access of target cells to the Agrobacterium. Therefore, a 0.5 cm explant included the stem and a bud.


Once cut, the explants were immediately placed in the Agrobacterium suspension for 20 to 30 minutes. After inoculation, the explants were blotted onto sterile filter paper to remove excess Agrobacterium culture then placed almost completely immersed in solid CCM or on top of a round 7 cm filter paper overlaying the solid CCM, depending on the Agrobacterium strain. This filter paper prevents Agrobacterium overgrowth on the soy-explants. Plates were wrapped with Parafilm™ “M” (American National Can, Chicago, Ill., USA) and incubated for two to three days in the dark at 25° C.


3.4—Shoot Induction

After 3 to 5 days co-cultivation in the dark at 25° C., the explants were rinsed in liquid SIM medium (to remove excess Agrobacterium) (SIM, see Olhoft et al 2007 A novel Agrobacterium rhizogenes-mediated transformation method of soy using primary-node explants from seedlings In Vitro Cell. Dev. Biol. Plant (2007) 43:536-549; to remove excess Agrobacterium) or Modwash medium (1×B5 major salts, 1×B5 minor salts, 1×MSIII iron, 3% Sucrose, 1×B5 vitamins, 30 mM MES, 350 mg/L Timentin™ pH 5.6, WO 2005/121345) and blotted dry on sterile filter paper (to prevent damage especially on the lamina) before placing on the solid SIM medium. The approximately 5 explants (Method A) or 10 to 20 (Methods B and C) explants were placed such that the target tissue was in direct contact with the medium. During the first 2 weeks, the explants could be cultured with or without selective medium. Preferably, explants were transferred onto SIM without selection for one week.


For leaf explants (Method B), the explant should be placed into the medium such that it is perpendicular to the surface of the medium with the petiole imbedded into the medium and the lamina out of the medium.


For propagated axillary meristem (Method C), the explant was placed into the medium such that it was parallel to the surface of the medium (basipetal) with the explant partially embedded into the medium.


Wrap plates with Scotch 394 venting tape (3M, St. Paul, Minn., USA) were placed in a growth chamber for two weeks with a temperature averaging 25° C. under 18 h light/6 h dark cycle at 70-100 μE/m2s. The explants remained on the SIM medium with or without selection until de novo shoot growth occurred at the target area (e.g., axillary meristems at the first node above the epicotyl). Transfers to fresh medium can occur during this time. Explants were transferred from the SIM with or without selection to SIM with selection after about one week. At this time, there was considerable de novo shoot development at the base of the petiole of the leaf explants in a variety of SIM (Method B), at the primary node for seedling explants (Method A), and at the axillary nodes of propagated explants (Method C).


Preferably, all shoots formed before transformation were removed up to 2 weeks after co-cultivation to stimulate new growth from the meristems. This helped to reduce chimerism in the primary transformant and increase amplification of transgenic meristematic cells. During this time the explant may or may not be cut into smaller pieces (i.e. detaching the node from the explant by cutting the epicotyl).


3.5—Shoot Elongation

After 2 to 4 weeks (or until a mass of shoots was formed) on SIM medium (preferably with selection), the explants were transferred to SEM medium (shoot elongation medium, see Olhoft et al 2007 A novel Agrobacterium rhizogenes-mediated transformation method of soy using primary-node explants from seedlings. In Vitro Cell. Dev. Biol. Plant (2007) 43:536-549) that stimulates shoot elongation of the shoot primordia. This medium may or may not contain a selection compound.


After every 2 to 3 weeks, the explants were transferred to fresh SEM medium (preferably containing selection) after carefully removing dead tissue. The explants should hold together and not fragment into pieces and retain somewhat healthy. The explants were continued to be transferred until the explant dies or shoots elongate. Elongated shoots >3 cm were removed and placed into RM medium for about 1 week (Method A and B), or about 2 to 4 weeks depending on the cultivar (Method C) at which time roots began to form. In the case of explants with roots, they were transferred directly into soil. Rooted shoots were transferred to soil and hardened in a growth chamber for 2 to 3 weeks before transferring to the greenhouse. Regenerated plants obtained using this method were fertile and produced on average 500 seeds per plant.


After 5 days of co-cultivation with Agrobacterium tumefaciens transient expression of the gene of interest (GOI) was widespread on the seedling axillary meristem explants especially in the regions wounding during explant preparation (Method A). Explants were placed into shoot induction medium without selection to see how the primary-node responds to shoot induction and regeneration. Thus far, greater than 70% of the explants were formed new shoots at this region. Expression of the GOI was stable after 14 days on SIM, implying integration of the T-DNA into the soy genome. In addition, preliminary experiments resulted in the formation of cDNA expressing shoots forming after 3 weeks on SIM.


For Method C, the average regeneration time of a soy plantlet using the propagated axillary meristem protocol was 14 weeks from explant inoculation. Therefore, this method has a quick regeneration time that leads to fertile, healthy soy plants.


Example 4
Pathogen Assay
4.1. Growth of Plants

10 T1 plants per event were potted and grown for 3-4 weeks in the phytochamber (16 h-day-und 8 h-night-Rhythm at a temperature of 16 and 22° C. and a humidity of 75%) till the first 2 trifoliate leaves were fully expanded.


4.2 Inoculation

The plants were inoculated with spores of P. pachyrhizi.


In order to obtain appropriate spore material for the inoculation, soybean leaves which had been infected with rust 15-20 days ago, were taken 2-3 days before the inoculation and transferred to agar plates (1% agar in H2O). The leaves were placed with their upper side onto the agar, which allowed the fungus to grow through the tissue and to produce very young spores. For the inoculation solution, the spores were knocked off the leaves and were added to a Tween-H2O solution. The counting of spores was performed under a light microscope by means of a Thoma counting chamber. For the inoculation of the plants, the spore suspension was added into a compressed-air operated spray flask and applied uniformly onto the plants or the leaves until the leaf surface is well moisturized. For macroscopic assays we used a spore density of 1-5×10 spores/ml. For the microscopy, a density of >5×105 spores/ml is used. The inoculated plants were placed for 24 hours in a greenhouse chamber with an average of 22° C. and >90% of air humidity. The following cultivation was performed in a chamber with an average of 25° C. and 70% of air humidity.


Example 5
Microscopical Screening

For the evaluation of the pathogen development, the inoculated leaves of plants were stained with aniline blue 48 hours after infection.


The aniline blue staining serves for the detection of fluorescent substances. During the defense reactions in host interactions and non-host interactions, substances such as phenols, callose or lignin accumulated or were produced and were incorporated at the cell wall either locally in papillae or in the whole cell (hypersensitive reaction, HR). Complexes were formed in association with aniline blue, which lead e.g. in the case of callose to yellow fluorescence. The leaf material was transferred to falcon tubes or dishes containing destaining solution II (ethanol/acetic acid 6/1) and was incubated in a water bath at 90° C. for 10-15 minutes. The destaining solution II was removed immediately thereafter, and the leaves were washed 2× with water. For the staining, the leaves were incubated for 1.5-2 hours in staining solution II (0.05% aniline blue=methyl blue, 0.067 M di-potassium hydrogen phosphate) and analyzed by microscopy immediately thereafter.


The different interaction types were evaluated (counted) by microscopy. An Olympus UV microscope BX61 (incident light) and a UV Longpath filter (excitation: 375/15, Beam splitter: 405 LP) are used. After aniline blue staining, the spores appeared blue under UV light. The papillae could be recognized beneath the fungal appressorium by a green/yellow staining. The hypersensitive reaction (HR) was characterized by a whole cell fluorescence.


Example 6
Evaluating the Susceptibility to Soybean Rust

The progression of the soybean rust disease was scored by the estimation of the diseased area (area which was covered by sporulating uredinia) on the backside (abaxial side) of the leaf. Additionally the yellowing of the leaf was taken into account (for scheme see FIG. 1).


At all 44 T1 soybean plants (5 independent events, 7-10 plants each) expressing HCP6 protein were inoculated with spores of Phakopsora pachyrhizi The macroscopic disease symptoms of soy against P. pachyrhizi of the inoculated soybean plants were scored 14 days after inoculation.


The average of the percentage of the leaf area showing fungal colonies or strong yellowing/browning on all leaves was considered as diseased leaf area. At all 44 soybean T1 plants expressing HCP6 (expression checked by RT-PCR) were evaluated in parallel to non-transgenic control plants. Non-transgenic soy plants grown in parallel to the transgenic plants were used as control. The average of the diseased leaf area is shown in FIG. 8 for plants expressing recombinant HCP6 compared with wildtype plants. Overexpression of HCP6 reduces the diseased leaf area in comparison to non-transgenic control plants by 26.1% in average over all events and plants generated. This data clearly indicates that the in-planta expression of the HCP6 expression vector construct lead to a lower disease scoring of transgenic plants compared to non-transgenic controls. So, the expression of HCP6 (as shown in SEQ ID NO: 1 (nucleic acid) and SEQ ID NO: 2 (protein), respectively) in soybean significantly (p<0.05) increases the resistance of soy against soybean rust.


Example 7
Construction of Maize Expression Cassettes

The nucleic acid sequence encoding the long version of the cDNA of HCP6 (as shown in SEQ ID NO:7) was synthesized in a way that enables further cloning. The expression cassettes were then assembled in a vector by cloning the synthesized DNA encoding the HCP6 gene from Arabidopsis thaliana downstream of a SCBV254 promoter (Sugarcane Bacilliform Virus promoter fragment ScBV-254) and upstream of a t-nos terminator (3′UTR of Nopaline Synthase from Agrobacterium tumefaciens). An intron from the rice Met1 gene was also cloned in between of the promoter and the HCP6 sequence.


Plant transformation binary vectors such as pBi-nAR were used (Höfgen & Willmitzer 1990, Plant Sci. 66:221-230). Further examples for plant binary vectors are the pSUN300 or pSUN2-GW vectors and the pPZP vectors (Hajdukiewicz et al., Plant Molecular Biology 25: 989-994, 1994). As target a binary plant transformation vector was used which is composed of: (1) a Kanamycin resistance cassette for bacterial selection (2) a pVS1 origin for replication in Agrobacteria (3) a ColE1 origin of replication for stable maintenance in E. coli and (4) between the right and left border an ZmAHAS gene as selectable marker under control of a ZmAHAS-promoter.


Construction of the binary vectors was performed by ligation of the HCP6 expression cassette, as described above, into the binary vector. The recombinant vector containing the HCP6 expression cassette was transformed into Top10 cells (Invitrogen) using standard conditions. Transformed cells were selected on LB agar containing 50 μg/ml kanamycin grown overnight at 37° C. Plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen) following manufacturer's instructions. Analysis of subsequent clones and restriction mapping was performed according to standard molecular biology techniques (Sambrook et al., 1989, “Molecular Cloning: A Laboratory Manual,” 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).


Example 8
Maize Transformation


Agrobacterium cells harboring a plasmid containing the gene of interest and the mutated maize AHAS gene were grown in YP medium supplemented with appropriate antibiotics for 1-2 days. One loop of Agrobacterium cells was collected and suspended in 1.8 ml M-LS002 medium (LS-inf). The cultures were incubated while shaking at 1,200 rpm for 5 min-3 hrs. Corn cobs were harvested at 8-11 days after pollination. The cobs were sterilized in 20% Clorox solution for 5 min, followed by spraying with 70% Ethanol and then thoroughly rinsed with sterile water. Immature embryos 0.8-2.0 mm in size were dissected into the tube containing Agrobacterium cells in LS-inf solution.


The constructs were transformed into immature embryos by a protocol modified from Japan Tobacco Agrobacterium mediated plant transformation method (U.S. Pat. Nos. 5,591,616; 5,731,179; 6,653,529; and U.S. Patent Application Publication No. 2009/0249514). Two types of plasmid vectors were used for transformation. One type had only one T-DNA border on each of left and right side of the border, and selectable marker gene and gene of interest were between the left and right T-DNA borders. The other type was so called “two T-DNA constructs” as described in Japan Tobacco U.S. Pat. No. 5,731,179. In the two DNA constructs, the selectable marker gene was located between one set of T-DNA borders and the gene of interest was included in between the second set of T-DNA borders. Either plasmid vector can be used. The plasmid vector was electroporated into Agrobacterium.



Agrobacterium infection of the embryos was carried out by inverting the tube several times. The mixture was poured onto a filter paper disk on the surface of a plate containing co-cultivation medium (M-LS-011). The liquid agro-solution was removed and the embryos were checked under a microscope and placed scutellum side up. Embryos were cultured in the dark at 22° C. for 2-4 days, and transferred to M-MS-101 medium without selection and incubated for four to seven days. Embryos were then transferred to M-LS-202 medium containing 0.75 μM imazethapyr and grown for three weeks at 27° C. to select for transformed callus cells.


Plant regeneration was initiated by transferring resistant calli to M-LS-504 medium supplemented with 0.75 μM imazethapyr and growing under light at 27° C. for two to three weeks. Regenerated shoots were then transferred to a rooting box with M-MS-618 medium (0.5 μM imazethapyr). Plantlets with roots were transferred to soil-less potting mixture and grown in a growth chamber for a week, then transplanted to larger pots and maintained in a greenhouse until maturity.


Transgenic maize plant production is also described, for example, in U.S. Pat. Nos. 5,591,616 and 6,653,529; U.S. Patent Application Publication No. 2009/0249514; and WO/2006136596, each of which are hereby incorporated by reference in their entirety. Transformation of maize may be made using Agrobacterium transformation; as described in U.S. Pat. Nos. 5,591,616; 5,731,179; U.S. Patent Application Publication No. 2002/0104132, and the like. Transformation of maize (Zea mays L.) can also be performed with a modification of the method described by Ishida et al. (Nature Biotech., 1996, 14:745-750). The inbred line A188 (University of Minnesota) or hybrids with A188 as a parent are good sources of donor material for transformation (Fromm et al., Biotech, 1990, 8:833), but other genotypes can be used successfully as well. Ears are harvested from corn plants at approximately 11 days after pollination (DAP) when the length of immature embryos is about 1 to 1.2 mm. Immature embryos are co-cultivated with Agrobacterium tumefaciens that carry “super binary” vectors and transgenic plants are recovered through organogenesis. The super binary vector system is described in WO 94/00977 and WO 95/06722. Vectors are constructed as described. Various selection marker genes are used including the maize gene encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S. Pat. No. 6,025,541). Similarly, various promoters are used to regulate the trait gene to provide constitutive, developmental, inducible, tissue or environmental regulation of gene transcription.


Excised embryos can be used and can be grown on callus induction medium, then maize regeneration medium, containing imidazolinone as a selection agent. The Petri dishes are incubated in the light at 25° C. for 2-3 weeks, or until shoots develop. The green shoots are transferred from each embryo to maize rooting medium and incubated at 25° C. for 2-3 weeks, until roots develop. The rooted shoots are transplanted to soil in the greenhouse. T1 seeds are produced from plants that exhibit tolerance to the imidazolinone herbicides and which are PCR positive for the transgenes.


Example 9
Fusarium and Colletotrichum Resistance Screening

Transgenic plants are grown in greenhouse or phyto-chamber under standard growing conditions in a controlled environment (20-25° C., 60-90% humidity). Shortly after plants enter the reproductive phase the transgenic plants are inoculated near the base of the stalk using a fungal suspension of spores (105 spores in PBS solution) of Fusarium ssp. or Colletotrichum graminicola. Plants are incubated for 2-4 weeks at 20-25° C. and 60-90% humidity.


For scoring the disease, stalks were split and the progression of the disease is scored by observation of the characteristic brown to black color of the fungus as it grows up the stalk. Disease ratings were conducted by assigning a visual score. Per experiment the diseased leaf area of more than 10 transgenic plants (and wild-type plants as control) is scored. For analysis the average of the diseased leaf area of the non-transgenic mother plant is set to 100% to calculate the relative diseased leaf area of the transgenic lines


The expression of the HCP6 gene will lead to enhanced resistance of corn against Fusarium ssp. And Colletotrichum graminicola.

Claims
  • 1. A method for increasing fungal resistance in a plant, a plant part, or a plant cell wherein the method comprises the step of increasing the expression and/or activity of a HCP6 protein in the plant, plant part, or plant cell in comparison to a wild type plant, wild type plant part or wild type plant cell.
  • 2. The method of claim 1, wherein the HCP6 protein comprises an amino acid sequence having at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof.
  • 3. The method of claim 1, wherein the HCP6 protein is encoded by (i) an exogenous nucleic acid having a nucleic acid sequence with at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;(ii) an exogenous nucleic acid encoding a protein having an amino acid sequence with at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof;(iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); or by(iv) an exogenous nucleic acid encoding the same HCP6 protein as any of the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.
  • 4. The method of claim 1, comprising (a) stably transforming a plant cell with an expression cassette comprising (i) an exogenous nucleic acid having a nucleic acid sequence with at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;(ii) an exogenous nucleic acid encoding a protein having an amino acid sequence with at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof;(iii) an exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii), or(iv) an exogenous nucleic acid encoding the same HCP6 protein as any of the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,in functional linkage with a promoter;(b) regenerating the plant from the plant cell; and(c) expressing said exogenous nucleic acid.
  • 5. A recombinant vector construct comprising: (a) (i) a nucleic acid having a nucleic acid sequence with at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, or a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof; (ii) a nucleic acid encoding a protein having an amino acid sequence with at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof;(iii) a nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii), or(iv) a nucleic acid encoding the same HCP6 protein as any of the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code,operably linked with(b) a promoter and(c) a transcription termination sequence.
  • 6. The method of claim 4, wherein the promoter is a constitutive promoter, pathogen-inducible promoter, a mesophyll-specific promoter or an epidermis specific-promoter.
  • 7. A transgenic plant, transgenic plant part, or transgenic plant cell transformed with the recombinant vector construct of claim 5.
  • 8. A method for the production of a transgenic plant, transgenic plant part, or transgenic plant cell having increased fungal resistance, comprising (a) introducing the recombinant vector construct of claim 5 into a plant, a plant part, or a plant cell;(b) generating a transgenic plant, transgenic plant part, or transgenic plant cell from the plant, plant part or plant cell; and(c) expressing the HCP6 protein encoded by (i) the exogenous nucleic acid having a nucleic acid sequence with at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;(ii) the exogenous nucleic acid encoding a protein having an amino acid sequence with at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof;(iii) the exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); or by(iv) the exogenous nucleic acid encoding the same HCP6 protein as any of the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.
  • 9. The method of claim 8, further comprising the step of harvesting the seeds of the transgenic plant and planting the seeds and growing the seeds to plants, wherein the grown plants comprise (i) the exogenous nucleic acid having a nucleic acid sequence with at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;(ii) the exogenous nucleic acid encoding a protein having an amino acid sequence with at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof;(iii) the exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); or(iv) the exogenous nucleic acid encoding the same HCP6 protein as any of the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.
  • 10. (canceled)
  • 11. A harvestable part of the transgenic plant of claim 7.
  • 12. A product derived from the plant of claim 7.
  • 13. A method for the production of a product comprising a) growing the plant of claim 7; andb) producing said product from or by the plant and/or part, of the plant.
  • 14. The method of claim 13 comprising a) growing the plant and removing the harvestable parts from the plant; andb) producing said product from or by the harvestable parts of the plant.
  • 15. The method of claim 13, wherein the product is meal or oil.
  • 16. The method of claim 1, wherein the fungal resistance is resistance against rust fungus, downy mildew, powdery mildew, leaf spot, late blight and/or septoria.
  • 17. The method of claim 16, wherein the fungal resistance is a resistance against soybean rust.
  • 18. The method of claim 17, wherein the resistance against soybean rust is resistance against Phakopsora meibomiae and/or Phakopsora pachyrhizi.
  • 19. The method of claim 1, wherein the plant is selected from the group consisting of beans, soya, pea, clover, kudzu, lucerne, lentils, lupins, vetches, groundnut, rice, wheat, barley, arabidopsis, lentil, banana, canola, cotton, potatoe, corn, sugar cane, alfalfa, and sugar beet.
  • 20. A method for breeding a fungal resistant plant comprising (a) crossing the plant of claim 7 with a second plant;(b) obtaining seed from the cross of step (a);(c) planting said seeds and growing the seeds to plants; and(d) selecting from said plants expressing an HCP6 protein encoded by (i) the exogenous nucleic acid having a nucleic acid sequence with at least 60% identity with SEQ ID NO: 6, 1, 3, 5, 7, 12, 14, 16, 18, 20, 22, 24, 26, 28, 29, 30, 31, 32, 33, 34, or 35, a functional fragment thereof, an orthologue or a paralogue thereof, or a splice variant thereof;(ii) the exogenous nucleic acid encoding a protein having an amino acid sequence with at least 60% identity with SEQ ID NO: 2, 4, 13, 15, 17, 19, 21, 23, 25, or 27, or a functional fragment thereof, an orthologue or a paralogue thereof;(iii) the exogenous nucleic acid capable of hybridizing under stringent conditions with a complementary sequence of any of the nucleic acids according to (i) or (ii); or by(iv) the exogenous nucleic acid encoding the same HCP6 protein as any of the nucleic acids of (i) to (iii) above, but differing from the nucleic acids of (i) to (iii) above due to the degeneracy of the genetic code.
Priority Claims (1)
Number Date Country Kind
13152971.1 Jan 2013 EP regional
PCT Information
Filing Document Filing Date Country Kind
PCT/EP2014/050397 1/10/2014 WO 00