Patent Application
20240189457
Beta-hemoglobinopathies, including sickle cell disease (SCD) and β-thalassemia, can be caused by genetic mutations in the β-globin gene (HBB). In addition to hematopoietic stem cell transplantation, gene therapy is one of the most promising treatments for these diseases. Gene therapy is a therapeutic strategy of human hereditary diseases, through gene addition or genome editing to treat hereditary diseases.
Previously, it was found that a few patients with naturally existing mutations in the HBB gene cluster or related genes maintain high γ-globin expression from their childhood to adulthood and do not show serious symptoms of anemia. This suggests that a therapeutic strategy for β-hemoglobinopathies is through reactivation of the expression of γ-globin. Currently, there are two common strategies to reactivate the expression of γ-globin. The first is to knock down a gene (e.g., BCL11A) that suppresses the expression of γ-globin gene (HBG1/2) and the second is to disrupt the binding sequences of transcription factors at the promoters of the HBG1/2 genes. Different methods have been tested to implement the aforementioned therapeutic strategies, such as CRISPR/Cas (Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein)-induced nucleotide insertions/deletions (indels) or base editor (BE)-induced point mutations.
CRISPR/Cas system has been the most prevalent genomic editing tool because of its convenience and high editing efficiency in living organisms. Directed by a guide RNA, the Cas nuclease can generate DNA double strand breaks (DSBs) at the targeted genomic sites in various cells (both cell lines and cells from living organisms). These DSBs are then repaired by the endogenous DNA repair system, which could be utilized to perform desired genome editing.
In general, two major DNA repair pathways can be activated by DSBs, non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ can introduce random indels in the genomic DNA region around the DSBs, thereby leading to open reading frame (ORF) shift and ultimately gene inactivation. In contrast, when HDR is triggered, the genomic DNA sequence at target site could be replaced by the sequence of the exogenous donor DNA through a homologous recombination mechanism, which can be used to induce base substitutions. However, the practical efficiency of HDR-mediated base substitution is low (normally <5%) because the occurrence of homologous recombination is both cell type-specific and cell cycle-dependent and NHEJ is triggered more frequently than HDR.
Base editor (BE), which combines the CRISPR/Cas system with the APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like) cytosine deaminase family members, was recently developed to induce base substitutions with high efficiency. Through the fusion with Cas9 nickase (nCas9) or catalytically dead Cpf1 (dCpf1, also known as dCas12a), the cytosine (C) deaminase activity of APOBEC/AID family members can be purposely directed to the target genomic sites to induce C to Thymine (T) substitutions.
The safety and efficiency of gene editing are of great importance in gene therapy. Previous studies have reported that the DSBs induced by Cas9 nuclease can activate a p53-mediated DNA damage response pathway and then lead to cell death. Moreover, APOBEC/AID family members can trigger C-to-T base substitutions in single-stranded DNA (ssDNA) regions, which are formed randomly during various cellular processes including DNA replication, repair and transcription. Thus, the specificity of previous base editing systems is compromised, limiting the applications of BEs for therapeutic purposes.
The instant disclosure, in some embodiments, describes improved gene therapy technologies useful for increasing the production of the γ-globin gene, which is useful for treating various hematological diseases, in particular inherited ones, such as beta-thalassemia and sickle cell anemia. Using a newly designed base editor, referred to as a transformer Base Editor (tBE), the present technology employs specifically designed guide RNA sequences to target the BCL11A erythroid enhancer or the C-terminal three tandem C2H2 zinc fingers (Znf4˜6) for inactivation, or to the γ-globin promoter for activation. Such a base editor has improved efficiency and specificity, as demonstrated in the experimental examples.
In accordance with one embodiment of the present disclosure, provided is a base editing system, or one or more polynucleotides encoding the base editing system. In some embodiments, the base editing system comprises a CRISPR-associated (Cas) protein, a nucleobase deaminase, a single-guide RNA (sgRNA), and a helper single-guide RNA (hsgRNA). The sgRNA and the hsgRNA target sites at the BCL11A erythroid enhancer. In some embodiments, the sgRNA and the hsgRNA target sites at the BCL11A-binding motif in the γ-globin promoter. In some embodiments, the sgRNA and the hsgRNA target sites at the ZBTB7A-binding motif in the γ-globin promoter. In some embodiments, the sgRNA and the hsgRNA target sites at a GATA1-half-E-box motif of BCL11A. In some embodiments, the sgRNA and the hsgRNA target sites at KLF1-binding motifs of BCL11A. In some embodiments, the sgRNA and the hsgRNA target sites at a GATA1-binding motif of NFIX. In some embodiments, the sgRNA and the hsgRNA target sites at the coding sequences of Znf4˜6 in BCL11A. Example sgRNA and hsgRNA sequences are provided in Tables 1-11.
In one embodiment, provided is a method for promoting production of γ-globin in a human cell, comprising introducing into the cell a CRISPR-associated (Cas) protein, a nucleobase deaminase, a single-guide RNA (sgRNA), and a helper single-guide RNA (hsgRNA), wherein (a) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:1-10, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:11-28; (b) the sgRNA comprises the nucleic acid sequence of SEQ ID NO:29-30, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:31-36, (c) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:37-54, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:63-116, (d) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 117-122, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:123-138, or (e) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:139-150, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:151-190, (f) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:353-430, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:431-628, In some embodiments, the Cas protein, the nucleobase deaminase, the sgRNA, and the hsgRNA are preferably introduced into the cell by one or more encoding polynucleotides.
In some embodiments, (a) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:1-10, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:11-28; (b) the sgRNA comprises the nucleic acid sequence of SEQ ID NO:29-30, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:31-36; (c) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:37-54, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:63-116; (d) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 118-122, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:123-138; or (e) the sgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:139-150, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:151-190. In some embodiments, the sgRNA comprises the nucleic acid sequence of SEQ ID NO:4, and the hsgRNA comprises the nucleic acid of SEQ ID NO:11. In some embodiments, the sgRNA comprises the nucleic acid sequence of SEQ ID NO:4, and the hsgRNA comprises the nucleic acid of SEQ ID NO:12.
In some embodiments, the sgRNA comprises the nucleic acid sequence of SEQ ID NO:30, and the hsgRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:31-36, preferably SEQ ID NO:33 or 34. In some embodiments, both sets of sgRNA/hsgRNA are included.
In some embodiments, the nucleobase deaminase is a cytidine deaminase. Non-limiting examples include APOBEC3B (A3B), APOBEC3C (A3C), APOBEC3D (A3D), APOBEC3F (A3F), APOBEC3G (A3G), APOBEC3H (A3H), APOBEC1 (A1), APOBEC3 (A3), APOBEC2 (A2), APOBEC4 (A4) and AICDA (AID).
In some embodiments, the base editing system further comprises a nucleobase deaminase inhibitor, fused to the nucleobase deaminase, via a protease cleavage site. In some embodiments, the nucleobase deaminase inhibitor is an inhibitory domain of a nucleobase deaminase. In some embodiments, the nucleobase deaminase inhibitor is an inhibitory domain of a cytidine deaminase. Non-limiting examples include SEQ ID NO: 192-193.
In some embodiments, the base editing system further comprises a protease that is capable of cleaving at the protease cleavage site. In some embodiments, the protease is selected from the group consisting of TuMV protease, PPV protease, PVY protease, ZIKV protease and WNV protease. In some embodiments, the protease cleaves the cleavage site only when the base editor is at the target site determined by the guide RNAs.
In some embodiments, the Cas protein is selected from the group consisting of SpCas9, FnCas9, St1Cas9, St3Cas9, NmCas9, SaCas9, AsCpf1, LbCpf1, FnCpf1, VQR SpCas9, EQR SpCas9, VRER SpCas9, SpCas9-NG, xSpCas9, RHA FnCas9, KKH SaCas9, NmeCas9, StCas9, CjCas9, AsCpf1, FnCpf1, SsCpf1, PcCpf1, BpCpf1, CmtCpf1, LiCpf1, PmCpf1, Pb3310Cpf1, Pb4417Cpf1, BsCpf1, EeCpf1, BhCas12b, AkCas12b, EbCas12b, LsCas12b, RfCas13d, LwaCas13a, PspCas13b, PguCas13b, and RanCas13b.
In some embodiments, the Cas protein is catalytically impaired, such as nCas9 and dCpf1.
Also provided, in one embodiment, is a method of using the base editors, or one or more polynucleotides that encode the base editors, to promote production of γ-globin in a human cell, which may be an erythroid cell, a hematopoietic stem cell, or a stem cell, among others. In some embodiments, the method is carried out ex vivo or in vivo in a patient. In some embodiments, the patient suffers from 0-thalassemia, sickle cell anemia, Haemoglobin C, or Haemoglobin E.
Yet another embodiment provides base editors that incorporate a cytidine deaminase inhibitor. Examples include hA3F-CDA1 and its analogs. In some embodiments, a fusion protein is provided, comprising: a first fragment comprising a cytidine deaminase or a catalytic domain thereof, a second fragment comprising a cytidine deaminase inhibitor comprising an amino acid sequence selected from the group consisting of SEQ ID NO:192, and 265-309 and sequences having at least 85% sequence identity to any of SEQ ID NO:192, and 265-309, and a protease cleavage site between the first fragment and the second fragment. Also provided are methods of using such fusion proteins for base editing and treatments.
It is to be noted that the term “a” or “an” entity refers to one or more of that entity; for example, “an antibody,” is understood to represent one or more antibodies. As such, the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
As used herein, the term “polypeptide” is intended to encompass a singular “polypeptide” as well as plural “polypeptides,” and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term “polypeptide” refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, “protein”, “amino acid chain” or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of “polypeptide,” and the term “polypeptide” may be used instead of, or interchangeably with any of these terms. The term “polypeptide” is also intended to refer to the products of post-expression modifications of the polypeptide, including without limitation glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. A polypeptide may be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It may be generated in any manner, including by chemical synthesis.
“Homology” or “identity” or “similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non-homologous” sequence shares less than 40% identity, though preferably less than 25% identity, with one of the sequences of the present disclosure.
A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Ausubel et al. eds. (2007) Current Protocols in Molecular Biology. Preferably, default parameters are used for alignment. One alignment program is BLAST, using default parameters.
The term “an equivalent nucleic acid or polynucleotide” refers to a nucleic acid having a nucleotide sequence having a certain degree of homology, or sequence identity, with the nucleotide sequence of the nucleic acid or complement thereof. A homolog of a double stranded nucleic acid is intended to include nucleic acids having a nucleotide sequence which has a certain degree of homology with or with the complement thereof. In one aspect, homologs of nucleic acids are capable of hybridizing to the nucleic acid or complement thereof. Likewise, “an equivalent polypeptide” refers to a polypeptide having a certain degree of homology, or sequence identity, with the amino acid sequence of a reference polypeptide. In some aspects, the sequence identity is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%. In some aspects, the equivalent polypeptide or polynucleotide has one, two, three, four or five addition, deletion, substitution and their combinations thereof as compared to the reference polypeptide or polynucleotide. In some aspects, the equivalent sequence retains the activity (e.g., epitope-binding) or structure (e.g., salt-bridge) of the reference sequence.
The term “encode” as it is applied to polynucleotides refers to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
One embodiment of the present disclosure provides a newly designed base editor, referred to as transformer Base Editor (tBE), which can specifically edit cytosines in target regions with no observable off-target mutations. In the tBE system, a cytidine deaminase is fused with a nucleobase deaminase inhibitor to inhibit the activity of the nucleobase deaminase until the tBE complex is assembled at the target genomic site. In some embodiments, the tBE employs a sgRNA to bind at the target genomic site and a helper sgRNA (hsgRNA) to bind at a nearby region upstream to the target genomic site. The binding of two sgRNAs can guide the components of tBE to correctly assemble at the target genomic site for efficient base editing. Upon such assembly, a protease in the tBE system is activated, capable of cleaving the nucleobase deaminase inhibitor off from the nucleobase deaminase, which becomes activated.
The experimental example further tested a listing of designed sgRNA/hsgRNA sequences that target certain elements at the γ-globin promoter and/or other proteins whose expression impacts the expression of the γ-globin gene. For instance, the expression of the γ-globin is increased when the expression of BCL11A erythroid enhancer is impaired by a targeted mutation. Alternatively, when the BCL11A binding motif at the γ-globin promoter is mutated, the expression of the γ-globin gene can also be increased. Interestingly, the tBE technology can simultaneously target both the BCL11A's CREs and the BCL11A binding motif at γ-globin promoter, which is contemplated to achieve even higher efficiency in activating γ-globin gene expression.
Moreover, sgRNA/hsgRNA sequences have also been designed and tested that target other protein factors that can influence the expression of γ-globin. For instance, KLF1 is an erythroid transcription factor that activates BCL11A expression directly by binding BCL11A's promoter; another protein, NFIX, regulates the expression of KLF1; yet, ZBTB7A (zinc finger and BTB domain containing 7A) binds a γ-globin promoter and represses its expression. Targeted genomic editing that disrupts the expression of any of these protein factors can lead to activation of the γ-globin, useful for treating diseases such as beta-thalassemia and sickle cell anemia. The data demonstrate that these designed sgRNA/hsgRNA sequences led to excellent editing efficiency and specificity.
In accordance with one embodiment of the present disclosure, therefore, provided is a base editing system, or one or more polynucleotides encoding the base editing system, useful for increasing the expression of the γ-globin gene in a target cell.
In some embodiments, the base editing system includes a CRISPR-associated (Cas) protein, a nucleobase deaminase, a single-guide RNA (sgRNA)/helper single-guide RNA (hsgRNA) pair targeting the BCL11A erythroid enhancer and/or the γ-globin promoter.
“Guide RNAs” are non-coding short RNA sequences which bind to the complementary target DNA sequences. A guide RNA first binds to the Cas enzyme and the gRNA sequence guides the complex via pairing to a specific location on the DNA, where Cas performs its endonuclease activity by cutting the target DNA strand. A “single guide RNA” frequently simply referred to as “guide RNA”, refers to synthetic or expressed single guide RNA (sgRNA) that consists of both the crRNA and tracrRNA as a single construct. The tracrRNA portion is responsible for Cas endonuclease activity and the crRNA portion binds to the target specific DNA region. Therefore, the trans activating RNA (tracrRNA, or scaffold region) and crRNA are two key components and are joined by tetraloop which results in formation of sgRNA. Guide RNA targets the complementary sequences by simple Watson-Crick base pairing. TracrRNA are base pairs having a stemloop structure in itself and attaches to the endonuclease enzyme. crRNA includes a spacer, complementary to the target sequence, flanked region due to repeat sequences.
Example spacer sequences for the sgRNA/hsgRNA pair targeting the BCL11A erythroid enhancer are provided in Tables 1-2. In some embodiments, the sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:1-10, the hsgRNA includes the nucleic acid sequence of any one of SEQ ID NO:11-28. The sgRNA may any one of SEQ ID NO:2, 4, 6, 8, or 10, which is 20 nt in length. In some embodiments, the sgRNA includes at least a 10 nt fragment of any of these sequences, such as SEQ ID NO:1, 3, 5, 7, or 9. Such as apparent in these examples, the 10 nt fragment is preferably proximate to the PAM site. Such preference applies here as well in other examples as shown herein. The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:11, 13, 15, 17, 19, 21, 23, 25, and 27), or 20 nt in length (e.g., SEQ ID NO:12, 14, 16, 18,20, 22, 24, 26 and 28). In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:1, and the hsgRNA comprises the nucleic acid of SEQ ID NO:17. In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:1, and the hsgRNA comprises the nucleic acid of SEQ ID NO:18. In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:4, and the hsgRNA comprises the nucleic acid of SEQ ID NO:11. In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:4, and the hsgRNA comprises the nucleic acid of SEQ ID NO:12.
Example spacer sequences for the sgRNA/hsgRNA pair targeting the γ-globin promoter (e.g., the BCL11A binding motif) are provided in Tables 3-4. In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:29-30, the hsgRNA includes the nucleic acid sequence of any one of SEQ ID NO:31-36. The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:31, 33 and 35), or 20 nt in length (e.g., SEQ ID NO:32, 34 and 36). In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:29-30, and the hsgRNA comprises the nucleic acid of SEQ ID NO:33. In some embodiments, the sgRNA includes the nucleic acid sequence of SEQ ID NO:29-30, and the hsgRNA comprises the nucleic acid of SEQ ID NO:34.
Example spacer sequences for the sgRNA/hsgRNA pair targeting one of the KLF1 motifs in BCL11A's CREs are provided in Tables 5. In some embodiments, the sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:37-42, the hsgRNA belonging to the same sub Table with its sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:55-62. The sgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:37, 39 and 41), or 20 nt in length (e.g., SEQ ID NO:38, 40 and 42). The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77 and 79), or 20 nt in length (e.g., SEQ ID NO:56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78 and 80).
Example spacer sequences for the sgRNA/hsgRNA pair targeting another of the KLF1 motifs in BCL11A's CREs are provided in Tables 6. In some embodiments, the sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:43-50, the hsgRNA belonging to the same sub Table with its sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:81-104. The sgRNA include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:43, 45, 47 and 49), or 20 nt in length (e.g., SEQ ID NO:44, 46, 48 and 50). The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 and 103), or 20 nt in length (e.g., SEQ ID NO:82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 and 104).
Example spacer sequences for the sgRNA/hsgRNA pair targeting yet another of the KLF1 motifs in BCL11A's CREs are provided in Table 7. In some embodiments, the sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:51-54, the hsgRNA belonging to the same sub Table with its sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:105-116. The sgRNA include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:51 and 53), or 20 nt in length (e.g., SEQ ID NO:52 and 54). The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:105, 107, 109, 111, 113 and 115), or 20 nt in length (e.g., SEQ ID NO:106, 108, 110, 112, 114 and 116).
Example spacer sequences for the sgRNA/hsgRNA pair targeting a GATA1-binding motif of NFIX (Nuclear Factor IX) CRE are provided in Table 8. In some embodiments, the sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:117-122, the hsgRNA belonging to the same sub Table with its sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:123-138. The sgRNA include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:117, 119 and 121), or 20 nt in length (e.g., SEQ ID NO:118, 120 and 122). The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:123, 125, 127, 129, 131, 133, 135 and 137), or 20 nt in length (e.g., SEQ ID NO: 124, 126, 128, 130, 132, 134, 136 and 138).
Example spacer sequences for the sgRNA/hsgRNA pair targeting a ZBTB7A-binding motif of HBG1/2's CRE are provided in Tables 9 and 10. In some embodiments, the sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:139-150, the hsgRNA belonging to the same sub Table with its sgRNA includes the nucleic acid sequence of any one of SEQ ID NO:151-190. The sgRNA include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:139, 141, 143, 145, 147 and 149), or 20 nt in length (e.g., SEQ ID NO:140, 142, 144, 146, 148 and 150). The hsgRNA may include a spacer (complementary region) that is about 10 nt in length (e.g., SEQ ID NO:151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187 and 189), or 20 nt in length (e.g., SEQ ID NO:152, 154, 156, 158 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188 and 190).
Additional example spacer sequences for the sgRNA/hsgRNA pair targeting various other sites are provided in Table 11. Such example sites include, e.g., T743, T743, C747 and G748, S755, L757, L757, L757 and T758, V759, H760, R761, R761 and R762, R761 and S763, H764, G766, G766 and E767, R768, P769, C775, A778, A778, A778 and A780, C779 and A780, Q781, S782, S783, L785, L785 and T786, S783, T791 and H792, T791 and H792, H792, Q794, G796, G796 and D798, P808, S813, S813, E816, or R826 of BCL11A. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:353-430, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:431-628.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:1-10, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:11-28.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:29-30, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:31-36.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:37-38, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:55-62. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:39-40, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:63-70. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:41-42, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:71-80.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:43-44, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:81-104. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:45-46, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:81-104. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:47-48, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:81-104. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:49-50, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:87-98.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:51-52, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:105-116. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:53-54, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:105-116.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO: 117-118, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:123-138. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:119-120, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:123-138. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:121-122, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:123-138.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO: 139-140, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:151-164. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:141-142, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:151-164. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:143-144, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:151-164. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:145-146, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:151-164. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:147-148, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:165-178.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO: 149-150, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:179-190.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:353-354, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:431-436. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:355-356, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:437-442. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:357-358, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:443-448.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:359-360, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:449-454. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:361-362, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:455-460. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:363-364, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:461-466.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:365-366, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:467-472. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:367-368, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:473-476. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:369-370, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:477-480.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:371-372, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:481-484. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:373-374, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:485-488. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:375-376, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:489-492.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:377-378, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:493-496. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:379-380, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:497-502. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:381-382, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:503-506.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:383-384, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:507-512. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:385-386, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:513-518. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:387-388, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:519-524.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:389-390, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:525-530. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:391-392, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:531-536. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:393-394, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:537-540.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:395-396, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:541-546. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:397-398, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:547-552. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:399-400, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:553-558.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:401-402, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:559-560. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:403-404, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:561-566. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:405-406, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:567-572.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:407-408, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:573-574. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:409-410, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:575-580. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:411-412, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:581-586.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:413-414, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:587-592. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:415-416, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:593-598. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:415-416, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:593-598.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:417-418, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:599-602. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:419-420, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:603-606. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:421-422, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:607-612.
In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:423-424, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:613-616. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:425-426, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:617-620. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:427-428, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:621-622. In some embodiments, the sgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:429-430, and the hsgRNA includes a nucleic acid sequence selected from the group consisting of SEQ ID NO:623-628.
In some embodiments, the base editing system targets two or more of the above target sites, e.g., BCL11A, BCL11A binding motif of γ-globin, KLF1 binding motifs of BCL11A, GATA1-binding motif of NFIX, and/or ZBTB7A-binding motif of γ-globin.
In some embodiments, the base editing system targets both the BCL11A erythroid enhancer and the γ-globin promoter. Accordingly, two pairs of sgRNA/hsgRNA are included. In a particular example, the first sgRNA/hsgRNA pair includes spacers as described in SEQ ID NO:4 and 11 (or 12), and the second sgRNA/hsgRNA pair includes spacers as described in SEQ ID NO:30 and 33 (or 34).
The term “nucleobase deaminase” as used herein, refers to a group of enzymes that catalyze the hydrolytic deamination of nucleobases such as cytidine, deoxycytidine, adenosine and deoxyadenosine. Non-limiting examples of nucleobase deaminases include cytidine deaminases and adenosine deaminases.
“Cytidine deaminase” refers to enzymes that catalyze the irreversible hydrolytic deamination of cytidine and deoxycytidine to uridine and deoxyuridine, respectively. Cytidine deaminases maintain the cellular pyrimidine pool. A family of cytidine deaminases is APOBEC (“apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like”). Members of this family are C-to-U editing enzymes. Some APOBEC family members have two domains, one domain of APOBEC like proteins is the catalytic domain, while the other domain is a pseudocatalytic domain. More specifically, the catalytic domain is a zinc dependent cytidine deaminase domain and is important for cytidine deamination.
Non-limiting examples of APOBEC proteins include APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, and activation-induced (cytidine) deaminase (AID).
Various mutants of the APOBEC proteins are also known that have bring about different editing characteristics for base editors. For instance, for human APOBEC3A, certain mutants (e.g., W98Y, Y130F, Y132D, W104A, D131Y and P134Y) even outperform the wildtype human APOBEC3A in terms of editing efficiency or editing window. Accordingly, the term APOBEC and each of its family member also encompasses variants and mutants that have certain level (e.g., 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%) of sequence identity to the corresponding wildtype APOBEC protein or the catalytic domain and retain the cytidine deaminating activity. The variants and mutants can be derived with amino acid additions, deletions and/or substitutions. Such substitutions, in some embodiments, are conservative substitutions.
“Adenosine deaminase”, also known as adenosine aminohydrolase, or ADA, is an enzyme (EC 3.5.4.4) involved in purine metabolism. It is needed for the breakdown of adenosine from food and for the turnover of nucleic acids in tissues.
Non-limiting examples of adenosine deaminases include tRNA-specific adenosine deaminase (TadA), adenosine deaminase tRNA specific 1 (ADAT1), adenosine deaminase tRNA specific 2 (ADAT2), adenosine deaminase tRNA specific 3 (ADAT3), adenosine deaminase RNA specific B1 (ADARB1), adenosine deaminase RNA specific B2 (ADARB2), adenosine monophosphate deaminase 1 (AMPD1), adenosine monophosphate deaminase 2 (AMPD2), adenosine monophosphate deaminase 3 (AMPD3), adenosine deaminase (ADA), adenosine deaminase 2 (ADA2), adenosine deaminase like (ADAL), adenosine deaminase domain containing 1 (ADAD1), adenosine deaminase domain containing 2 (ADAD2), adenosine deaminase RNA specific (ADAR) and adenosine deaminase RNA specific B1 (ADARB1).
Some of the nucleobase deaminases have a single, catalytic domain, while others also have other domains, such as an inhibitory domain as currently discovered by the instant inventors. In some embodiments, therefore, the first fragment only includes the catalytic domain, such as mA3-CDA1, hA3F-CDA2 and hA3B-CDA2. In some embodiments, the first fragment includes at least a catalytic core of the catalytic domain.
The term “Cas protein” or “clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) protein” refers to RNA-guided DNA endonuclease enzymes associated with the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) adaptive immunity system in Streptococcus pyogenes, as well as other bacteria. Cas proteins include Cas9 proteins, Cas12a (Cpf1) proteins, Cas12b (formerly known as C2c1) proteins, Cas13 proteins and various engineered counterparts. Example Cas proteins include SpCas9, FnCas9, St1Cas9, St3Cas9, NmCas9, SaCas9, AsCpf1, LbCpf1, FnCpf1, VQR SpCas9, EQR SpCas9, VRER SpCas9, SpCas9-NG, xSpCas9, RHA FnCas9, KKH SaCas9, NmeCas9, StCas9, CjCas9, AsCpf1, FnCpf1, SsCpf1, PcCpf1, BpCpf1, CmtCpf1, LiCpf1, PmCpf1, Pb3310Cpf1, Pb4417Cpf1, BsCpf1, EeCpf1, BhCas12b, AkCas12b, EbCas12b, LsCas12b, RfCas13d, LwaCas13a, PspCas13b, PguCas13b, RanCas13b and those provided in Table A below.
In some embodiments, the base editing system further includes a nucleobase deaminase inhibitor fused to the nucleobase deaminase. A “nucleobase deaminase inhibitor,” accordingly, refers to a protein or a protein domain that inhibits the deaminase activity of a nucleobase deaminase. In some embodiments, the second fragment includes at least an inhibitory core of the inhibitory protein/domain.
Two example nucleobase deaminase inhibitors are mA3-CDA2, hA3F-CDA1 and hA31B-CDA1 (sequences provided in Table B), which are the inhibitory domains of the corresponding nucleobase deaminases. Additional nucleobase deaminase inhibitors have been identified in the protein databases as homologues of mA3-CDA2, hA3F-CDA1 and hA3B-CDA1 (see Tables B1, B2 and B3). Their biological equivalents (e.g., having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5% sequence identity, or having one, two, or three amino acid addition/deletion/substitution, and having nucleobase deaminase inhibitor activity) can also be prepared with known methods in the art, such as conservative amino acid substitutions.
When the nucleobase deaminase inhibitor is included, it is fused to the nucleobase deaminase but is separated by a protease cleavage site. In some embodiments, the base editing system further includes the protease that is capable of cleaving the protease cleavage site.
The protease cleavage site can be any known protease cleavage site (peptide) for any proteases. Non-limiting examples of proteases include TEV protease, TuMV protease, PPV protease, PVY protease, ZIKV protease and WNV protease. The protein sequences of example proteases and their corresponding cleavage sites are provided in Table B.
ACCCAUGUCUGCAGGGCCAAGUGGCACCGAGUCGGUGC
Mus spicilegus A3
Cricetulus
longicaudatus A3
Mus terricolor A3
Mus caroli A3
Mus pahari A3
Mus shortridgei A3
Mus setulosus A3
Grammomys
Rattus norvegicus A3
Mastomys coucha A3
Cricetulus griseus
Peromyscus leucopus
Mesocricetus auratus
Microtus ochrogaster
Nannospalax galili
Meriones
unguiculatus A3
Dipodomys ordii A3
Jaculus jaculus A3
Chinchilla lanigera
Heterocephalus
glaber A3 (AA277-
Octodon degus A3
Urocitellus parryii
Aotus nancymaae
Cebus capucinus
Saimiri boliviensis
boliviensis A3H
Homo sapiens A3H
Homo sapiens
Pan paniscus A3H
Symphalangus
syndactylus A3H
Macaca mulatta A3H
Theropithecus gelada
Mandrillus
leucophaeus A3H
Bos grunniens A3
Bubalus bubalis A3
Odocoileus
virginianus texanus
Sus scrofa A3
Ceratotherium simum
simum A3B
Equus caballus A3H
Enhydra lutris
kenyoni A3B
Leptonychotes
weddellii A3H
Ursus arctos
horribilis A3F
Panthera leo
bleyenberghi A3H
Panthera tigris
sumatrae A3H
Tupaia belangeri A3
Pan troglodytes A3F
Pan paniscus A3F
Colobus angolensis
palliatus A3F
Macaca mulatta A3F
Macaca fascicularis
Rhinopithecus
roxellana A3F
Rhinopithecus bieti
Rhinopithecus
roxellana A3F
Macaca mulatta A3F
Trachypithecus
francoisi A3F
Gorilla gorilla A3F
Papio anubis A3F
Pongo abelii A3F
Macaca leonina A3F
Macaca nemestrina
Homo sapiens A3B
Gorilla gorilla
gorill aA3B
Pan troglodytes A3B
Theropithecus
gelada A3F
Mandrillus
leucophaeus A3F
Gorilla gorilla
gorilla A3B
Pan paniscus A3B
Hylobates moloch
Symphalangus
syndactylus A3G
Macaca mulatta A3B
Chlorocebus sabaeus
Nomascus
leucogenys A3B
Trachypithecus
francoisi A3B
Trachypithecus
francoisi A3F
Rhinopithecus bieti
Rhinopithecus
roxellana A3B
Pongo abelii A3F
Macaca mulatta A3B
Macaca leonina A3B
Macaca nemestrina
Macaca mulatta A3D
Pongo abelii A3F
Erythrocebus patas
Pan troglodytes A3B
Macaca mulatta
Piliocolobus
tephrosceles A3F
Macaca leonina A3D
Macaca nemestrina
Chlorocebus
aethiops A3DE
Macaca mulatta
Gorilla A3B (AA29-
Pan paniscus A3B
Pan troglodytes A3B
Gorilla A3F (AA30-
Pan troglodytes A3F
Human sapiens A3F
Macaca leonine
Macaca nemestrina
Rhinopithecus
roxellana A3F
Mandrillus
leucophaeus A3F
Macaca mulatta A3F
Theropithecus
gelada A3F
Cercocebus atys A3B
Macaca fascicularis
Macaca mulatta A3B
Macaca leonina A3B
Mandrillus
leucophaeus A3B
Macaca nemestrina
Rhinopithecus bieti
Rhinopithecus
roxellana A3B
Chlorocebus sabaeus
Nomascus
leucogenys A3B
Cercocebus atys A3F
Papio anubis A3F
Chlorocebus
aethiops A3D
Chlorocebus sabaeus
Chlorocebus sabaeus
Erythrocebus patas
Macaca fascicularis
Macaca fascicularis
Macaca nemestrina
Macaca leonina A3D
Macaca mulatta A3D
Gorilla A3D (AA29-
Pan paniscus A3D
Pan troglodytes A3D
Homo sapiens A3D
Nomascus
leucogenys A3D
Saimiri boliviensis
Saimiri boliviensis
Piliocolobus
tephrosceles A3F
Colobus angolensis
palliatus A3F
Pongo abelii A3F
In some embodiments, the protease cleavage site is a self-cleaving peptide, such as the 2A peptides. “2A peptides” are 18-22 amino-acid-long viral oligopeptides that mediate “cleavage” of polypeptides during translation in eukaryotic cells. The designation “2A” refers to a specific region of the viral genome and different viral 2As have generally been named after the virus they were derived from. The first discovered 2A was F2A (foot-and-mouth disease virus), after which E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2A), and T2A (thosea asigna virus 2A) were also identified. A few non-limiting examples of 2A peptides are provided in SEQ ID NO:217-219.
In some embodiments, the protease cleavage site is a cleavage site (e.g., SEQ ID NO:196) for the TEV protease. In some embodiments, the TEV protease provided in the base editing system includes two separate fragments, each of which on its own is not active. However, in the presence of the remaining fragment of the TEV protease, they will be able to execute the cleavage. Such an arrangement provides additional control and flexible of the base editing capabilities. The TEV fragments may be the TEV N-terminal domain (e.g., SEQ ID NO:194) or the TEV C-terminal domain (e.g., SEQ ID NO:195).
Various arrangement of the proteins/fragments can be made for a fusion protein in the disclosed base editing systems. Non-limiting examples include, from N-terminal side to C-terminal side:
Such fusion proteins may include other fragments, such as uracil DNA glycosylase inhibitor (UGI) and nuclear localization sequences (NLS).
The “Uracil Glycosylase Inhibitor” (UGI), which can be prepared from Bacillus subtilis bacteriophage PBS1, is a small protein (9.5 kDa) which inhibits E. coli uracil-DNA glycosylase (UDG) as well as UDG from other species. Inhibition of UDG occurs by reversible protein binding with a 1:1 UDG:UGI stoichiometry. UGI is capable of dissociating UDG-DNA complexes. A non-limiting example of UGI is found in Bacillus phage AR9 (YP_009283008.1). In some embodiments, the UGI comprises the amino acid sequence of SEQ ID NO:216 or has at least at least 70%, 75%, 80%, 85%, 90% or 95% sequence identity to SEQ ID NO:216 and retains the uracil glycosylase inhibition activity.
The fusion protein, in some embodiments, may include one or more nuclear localization sequences (NLS).
A “nuclear localization signal or sequence” (NLS) is an amino acid sequence that tags a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins may share the same NLS. An NLS has the opposite function of a nuclear export signal (NES), which targets proteins out of the nucleus. A non-limiting example of NLS is the internal SV40 nuclear localization sequence (iNLS).
In some embodiments, a peptide linker is optionally provided between each of the fragments in the fusion protein. In some embodiments, the peptide linker has from 1 to 100 amino acid residues (or 3-20, 4-15, without limitation). In some embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the amino acid residues of peptide linker are amino acid residues selected from the group consisting of alanine, glycine, cysteine, and serine.
Nucleobase Deaminase Inhibitors Fusion Proteins, tBEs
As demonstrated in the experimental examples, hA3F-CDA1 has been identified as an excellent cytidine deaminase inhibitor. Analogs of hA3F-CDA1 are shown in Table B2, as well as those having at least 70%, 75%, 80%, 85% 90%, 95%, 97%, 98%, or 99% sequence identity to hA3F-CDA1 or any of those in Table B2.
Accordingly, a fusion protein is designed that can be used to generate a base editor with improved base editing specificity and efficiency. In one embodiment, the present disclosure provides a fusion protein that includes a first fragment comprising a nucleobase deaminase (e.g., a cytidine deaminase) or a catalytic domain thereof, a second fragment comprising a nucleobase deaminase inhibitor, and a protease cleavage site between the first fragment and the second fragment. In some embodiments, the nucleobase deaminase inhibitor is hA3F-CDA1 (SEQ ID NO:192), or any of its analogs, such as those shown in Table B2, as well as those having at least 70%, 75%, 80%, 85% 90%, 95%, 97%, 98%, or 99% sequence identity to hA3F-CDA1 or any of those in Table B2.
A base editor that incorporates such a fusion protein has reduced or even no editing capability and accordingly will generate reduced or no off-target mutations. Upon cleavage of the protease cleavage site and release of the nucleobase deaminase inhibitor from the fusion protein at a target site, the base editor that is at the target site will then be able to edit the target site efficiently.
In some embodiments, the fusion protein further includes a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) protein, optionally in the first fragment, next to the nucleobase deaminase or the catalytic domain thereof.
When the fusion protein is used, in vitro, ex vivo, or in vivo, to conduct gene/base editing in a cell, two additional molecules can be introduced. In one example, one molecule (B) is a single guide RNA (sgRNA) that further incorporates a tag sequence that can be recognized by an RNA recognition peptide. The sgRNA, alternatively, can be replaced by a crRNA that targets the target site and a CRISPR RNA (crRNA) alone, or in combination with a trans-activating CRISPR RNA (tracrRNA). Examples of tag sequences and corresponding RNA recognition peptides include MS2/MS2 coat protein (MCP), PP7/PP7 coat protein (PCP), and boxB/boxB coat protein (N22p), the sequences of which are provided herein. The molecule (B) may be provided as a DNA sequence encoding the RNA molecule.
The other additional molecule (C), in some embodiments, includes a second TEV protease fragment coupled to the RNA recognition peptide (e.g., MCP, PCP, N22p). The first TEV fragment and the second TEV fragment, in some embodiments, when present together, are able to cleave a TEV protease site.
Such co-presence can be triggered by the molecule (C) binding to the molecule (B) by virtue of the tag sequence-RNA recognition protein interaction. Meanwhile, the fusion protein (A) and the molecule (B) will be both present at the target genome locus for gene editing. Therefore, the molecule (B) brings both of the TEV protease fragments from the fusion protein (A) and molecule (C) together, which will activate the TEV protease, leading to removal of the nucleobase deaminase inhibitor from the fusion protein and activation of the base editor. It can be readily appreciated that such activation only occurs at the target genome site, not at off-target single-stranded DNA regions. As such, base editing does not occur at the single-stranded DNA regions that sgRNA does not bind to.
The disclosed base editing system can be used to engineer a target cell. If used in vitro or ex vivo, the gene therapy approach can increase the expression of γ-globin in the target cell. If used in vivo, the gene therapy approach can treat diseases associated with insufficient production or dysfunction of hemoglobins. Example diseases include β-thalassemia, sickle cell anemia, Haemoglobin C, and Haemoglobin E.
In some embodiments, each component of the base editing system can be introduced to the target cell individually, or in combination. For instance, a fusion protein may be packaged into nanoparticle such as liposome. In another example, a guide RNA and a protein may be combined into a complex for introduction.
In some embodiments, some or all of the components of the base editing system can be introduced as one or more polynucleotides encoding them. These polynucleotides may be constructed as plasmids or viral vectors, without limitation.
In an example ex vivo approach, CD34+ hematopoietic stem and progenitor cells (HSPCs) can be collected from a patient by apheresis after mobilization with either filgrastim and plerixafor (in a patient with 0-thalassemia) or plerixafor alone (in a patient with SCD) after a minimum of 8 weeks of transfusions of packed red cells targeting a level of sickle hemoglobin of less than 30%. The HSPCs can then be edited with the disclosed gene editing technology, along with the designed sgRNA, to produce edited cells. DNA sequencing can be used to evaluate the percentage of allelic editing at the on-target site.
Prior to infusion of the edited cells, the patient can be given a pharmacokinetically adjusted busulfan myeloablation. The edited cells can be administered through intravenous infusion.
This example tested a newly designed base editor, referred to as transformer Base Editor (tBE), which can specifically edit cytosines in target regions with no observable off-target mutations, to edit the BCL11A gene which is useful for treating 0-hemoglobinopathies.
The tBE fuses a base editor with a cytidine deaminase inhibitor to inhibit the activity of the cytidine deaminase until the tBE complex is assembled at the target genomic site. The tBE employs a sgRNA (about 20 nt) to bind at the target genomic site and a helper sgRNA (hsgRNA, 10-20 nt) to bind at a nearby region upstream to the target genomic site. The binding of two sgRNAs can guide the components of tBE to correctly assemble at the target genomic site for efficient base editing.
To test whether the tBE can perform high-specificity and high-efficiency base editing in BCL11A erythroid enhancer region, we designed 45 pairs (5 sgRNA×9 hsgRNA, as listed in Tables 1 and 2) of sgRNA/hsgRNAs to target the BCL11A erythroid enhancer region (the core BCL11A erythroid enhancer). For comparison, we co-transfected the sgRNAs in sgRNA/hsgRNA pairs with a previously reported BE, YE1-BE4max and a single sgRNA targeting the same genomic site with tBE (
We extracted genomic DNA 72 hours after transfecting the plasmids into cells, and compared the C-to-T editing efficiencies of these BEs at target sites. From Sanger sequencing results, we found both tBE and YE1-BE4max induced gene editing in BCL11A erythroid enhancer region. It's worth noting that tBE induced similar or higher base editing efficiencies than YE1-BE4max at some target sites, such as the target sites for sgRNA-BCL11A-3/hsgRNA-BCL11A-2 (
Next, we tested whether the tBE can perform high-specificity and high-efficiency base editing at the BCL11A binding motif in HBG1/2 promoters. We designed 3 pairs (1 sgRNA×3 hsgRNA, as listed in Tables 3 and 4) of sgRNA/hsgRNA to target the BCL11A binding motif in HBG1/2 promoters (
We then tested whether the tBE can perform high-specificity and high-efficiency at the BCL11A erythroid enhancer and HBG1/2 promoter regions simultaneously by modifying the plasmids of tBE system (
This example used a highly precise and efficient base editing system (tBE) to perform base editing at the therapeutic genomic sites of the β-hemoglobinopathies. Furthermore, the tBE system, which contains Cas9 nickase (D10A), is less toxic than Cas9 nuclease as Cas9 nickase activates a lower level of p53 pathway than Cas9 nuclease. In addition, this example achieved high specificity and efficiency base editing individually or simultaneously at two therapeutic target sites, which can reactive a high expression level of γ-globin. This example therefore demonstrates a clinical use of tBE, especially in the gene therapies of the (3-hemoglobinopathies.
The expression of BCL11A may be impacted by other cis elements or protein factors. There are three DNase I hypersensitive sites (DHSs), referred to as DHSs +62, +58, and +55 based on distance in kilobases from the transcription start site (TSS) of BCL11A. KLF1 is a key erythroid transcription factor that activates BCL11A directly by binding BCL11A's promoter. Furthermore, there is a GATA1-binding motif located in intron 4 of the NFIX gene, which could regulate the expression of BCL11A indirectly by influencing the expression of KLF1. In addition, ZBTB7A (zinc finger and BTB domain containing 7A), a repressor protein, could bind the HBG1/2 enhancer/promoter by identifying a conserved motif and repress the expression of HBG.
To test whether the tBE can perform high-specificity and high-efficiency base editing at the three KLF1 binding motifs of BCL11A (two core KLF1 binding motifs locate in +55 kb DHS of BCL11A erythroid enhancer region, the other one locates in 1 Mb upstream of BCL11A). We designed 50 pairs of sgRNA/hsgRNAs (Tables 5-7) to target the three KLF1 binding motifs (
caaugcuugg
caggaugaugcaaugcuugg
augcaaugcu
uaccaggaugaugcaaugcu
caaugcuugg
caggaugaugcaaugcuugg
augcaaugcu
uaccaggaugaugcaaugcu
ggcuggacag
acccaggcugggcuggacag
caggcugggc
gaugcacacccaggcugggc
acacccaggc
cacaagaugcacacccaggc
augcacaccc
agcacacaagaugcacaccc
gaccgcucac
cagccuuggggaccgcucac
cucccuaccg
gugccgacaacucccuaccg
ccuaccgcgaccccuaucag
gaccgcucac
cagccuuggggaccgcucac
cucccuaccg
gugccgacaacucccuaccg
ccccuaucag
ccuaccgcgaccccuaucag
cucccuaccg
gugccgacaacucccuaccg
gugaucuugu
ggcacacccugugaucuugu
ugugaucuug
gggcacacccugugaucuug
caccuucuca
gugagcuccccaccuucuca
caaugcuugg
caggaugaugcaaugcuugg
cgcagcaaga
caugugaaaacgcagcaaga
aaacgcagca
ugccaugugaaaacgcagca
gugaaaacgc
ucucugccaugugaaaacgc
cagccaggac
ggccaucugccagccaggac
ucugccagcc
aagguggccaucugccagcc
agcaagaagg
gugaaaacgcagcaagaagg
cgcagcaaga
caugugaaaacgcagcaaga
aaacgcagca
ugccaugugaaaacgcagca
gugaaaacgc
ucucugccaugugaaaacgc
We also tested whether the tBE can perform base editing at the GATA1-binding motif located in intron 4 of the NFIX gene. We designed more than 20 pairs of sgRNA/hsgRNAs to target the GATA1-binding motif (
ugcggccaug
ggaggcacugugcggccaug
ugugcggcca
ggggaggcacugugcggcca
cacagcuggu
gacagcugugcacagcuggu
ugcggccaug
ggaggcacugugcggccaug
ugugcggcca
ggggaggcacugugcggcca
In addition, we tested whether the tBE can perform base editing at the two ZBTB7A-binding motifs located in the HBG1/2 promoter/enhancer. We designed 41 pairs of sgRNA/hsgRNAs to target the ZBTB7A-binding motifs (
uuuccuuauc
auaaaauuauuuuccuuauc
ucauaagagc
uuagaugagcucauaagagc
aaaaguaauu
gaggcuuuugaaaaguaauu
ucuguggggg
acugaccuuaucuguggggg
accuuaucug
cucccaacugaccuuaucug
ucuguggggg
acugaccuuaucuguggggg
uuaucugugg
ccaacugaccuuaucugugg
accuuaucug
cucccaacugaccuuaucug
uuuccuuauc
auaaaauuauuuuccuuauc
uuaucugugg
ccaacugaccuuaucugugg
accuuaucug
cucccaacugaccuuaucug
uugcagaugg
ucuuccuggauugcagaugg
guucucuucc
cguggucaggguucucuucc
cucgugguca
ugaaggcugacucgugguca
acucgugguc
cugaaggcugacucgugguc
ggcugacucg
cauuucugaaggcugacucg
acauuucuga
guuuuuucucacauuucuga
aacaaggcaa
acugaaucggaacaaggcaa
aaucggaaca
ggaaugacugaaucggaaca
augacugaau
aaaaacuggaaugacugaau
gggcccgggc
uuagugguccgggcccgggc
auuagugguc
cacgccccauauuagugguc
gggcccgggc
uuagugguccgggcccgggc
auuagugguc
cacgccccauauuagugguc
cuucuccugu
gcccguguggcuucuccugu
gccuuucgcc
cauuuauaaggccuuucgcc
ugaguacugu
gcgacacuugugaguacugu
gacacuugug
cagacgcagcgacacuugug
acugugggaa
acuugugaguacugugggaa
cgcauuuaua
uugcacagcucgcauuuaua
gugaguacug
agcgacacuugugaguacug
auaguugcac
gggcacaggcauaguugcac
uugcacagcu
acaggcauaguugcacagcu
auaguugcac
gggcacaggcauaguugcac
auaguugcac
gggcacaggcauaguugcac
ugaguacugu
gcgacacuugugaguacugu
uugcuacucu
ccuggugagcuugcuacucu
gcacaggcau
gcuacucugggcacaggcau
uugcuacucu
ccuggugagcuugcuacucu
gcaaucucac
aagaacuguagcaaucucac
uucaugugcc
gccaugcguuuucaugugcc
cacgggcgaa
ggagaagccacacgggcgaa
gccacacggg
cacaggagaagccacacggg
ugcguuuuca
caccuggccaugcguuuuca
cacgggcgaa
ggagaagccacacgggcgaa
uucaugugcc
gccaugcguuuucaugugcc
gaagccacac
guccacaggagaagccacac
caccuggcca
cguccuuccccaccuggcca
cuuauaaaug
ggcgaaaggccuuauaaaug
aaaugcgagc
aaggccuuauaaaugcgagc
cugugcccag
gcaacuaugccugugcccag
gccugugccc
gugcaacuaugccugugccc
gccugugccc
gugcaacuaugccugugccc
gccugugccc
gugcaacuaugccugugccc
cugugcccag
gcaacuaugccugugcccag
cacgcuaaaa
ggguacuguacacgcuaaaa
cacgcuaaaa
ggguacuguacacgcuaaaa
acacgcuaaa
aggguacuguacacgcuaaa
uggggaagga
cauggccagguggggaagga
agguggggaa
acgcauggccagguggggaa
ggccaggugg
gaaaacgcauggccaggugg
acucgaucac
auuauucaacacucgaucac
acucgaucac
auuauucaacacucgaucac
acaguacccu
uuuagcguguacaguacccu
A tBE includes, along with a base editor, a cytidine deaminase inhibitor to inhibit the activity of the cytidine deaminase. The inhibitor can be cleaved once the tBE complex is assembled at the target genomic site. This example tested a newly identified cytidine deaminase inhibitor, hA3F-CDA1.
As illustrated in
The editing frequencies of these base editors were measured at a representative genomic locus, and the results are charted in
Each of mA3-CDA2, hA3F-CDA1 and hA3B-CDA1 was fused to mA3-CDA1 (mA3CDA1-nSpCas9-BE) to prepare three tBE (
Similar constructs were prepared and tested for their inhibitory effects on C-to-T editing frequencies at six genomic loci (
This example, therefore, identifies hA3F-CDA1 as an excellent cytidine deaminase inhibitor, suitable for preparing transformer Base Editors (tBE).
The present disclosure is not to be limited in scope by the specific embodiments described which are intended as single illustrations of individual aspects of the disclosure, and any compositions or methods which are functionally equivalent are within the scope of this disclosure. It will be apparent to those skilled in the art that various modifications and variations can be made in the methods and compositions of the present disclosure without departing from the spirit or scope of the disclosure. Thus, it is intended that the present disclosure cover the modifications and variations of this disclosure provided they come within the scope of the appended claims and their equivalents.
All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
| Number | Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/085285 | Apr 2021 | WO | international |
| PCT/CN2021/115140 | Aug 2021 | WO | international |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2022/084982 | 4/2/2022 | WO |
