Patent Application
20240254465
This application is based upon and claims priority to Chinese Patent Application No. 202310086152.7, filed on Jan. 17, 2023, the entire contents of which are incorporated herein by reference.
The instant application contains a Sequence Listing which has been submitted in XML format via EFS-Web and is hereby incorporated by reference in its entirety. Said XML copy is named GBWHYC006_Sequence_Listing.xml, created on 03/12/2024, and is 112,377 bytes in size.
The present invention relates to the field of genome editing technology, specifically involving the development and application of newly identified guide RNA-mediated heat-resistant endonuclease Gs12-7 and nucleic acid detection, as well as genome targeted editing technology mediated by the newly identified guide RNA-mediated heat-resistant endonuclease Gs12-7.
The gene editing technology mediated by a clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated (Cas) system has become popular worldwide after nearly 10 years of development, becoming one of the most efficient, simple, cost-effective, and easy-to-operate technologies in existing gene editing and genome modification. This technology has shown infinite potential in basic research, clinical transformation, and agricultural production. The CRISPR/Cas system is a natural immune system in prokaryotes, which comprises two parts: CRISPR locus and Cas gene (CRISPR associated gene). At present, CRISPR/Cas systems can be divided into two categories. The first category is that their effector factors for cleaving exogenous nucleic acids are complexes formed by multiple Cas proteins, including type I, type III, and type IV Cas proteins; The second category: their action factors are relatively single Cas proteins, such as type II Cas9 protein and type V Cas12a protein.
The CRISPR/Cas9 or Cas12a system is mainly composed of Cas9 protein or Cas12a protein and guide RNA (sgRNA or crRNA). Among them, crRNA provides sequence specificity, targeting the paired DNA sequence, thereby providing precise localization for Cas9 nuclease or Cas12a nuclease and ultimately cleaving DNA, thereby achieving gene editing. In addition to crRNA, CRISPR/Cas9 or Cas12a also relies on recognizing the sequences of protospacer adjacent motifs (PAM) on the target DNA when performing editing functions. At present, the most widely used CRISPR system is type II CRISPR/Cas system. In addition to CRISPR/Cas9, there are also CRISPR/Cas12, CRISPR/Cas13, and CRISPR/Cas14. Among them, the PAM sequence recognized by SpCas9 nuclease is “NGG”, while the PAM sequence recognized by Cas12a nuclease is “TTTV or TTV”. The complexity of the PAM sequence determines the upper limit of editable sites. In practical applications, the lack of PAM sequence at the target site often leads to the inability of Cas9 or Cas12a to target, thereby hindering the effectiveness of gene editing. Secondly, gene editing requires consideration of different reaction temperatures in order to be compatible with LAMP or RPA isothermal nucleic acid amplification reactions. Therefore, exploring nucleases with less PAM restriction and high heat resistance has become a research hotspot.
For a long time, researchers have been committed to optimizing and engineering Cas9 or Cas12 proteins to expand their compatibility and heat resistance to different PAM sequences, especially allowing Cas proteins to have broader editing capabilities. Taking SpCas9 as an example, the SpCas9 VRQR mutant that can recognize NGA and the SpCas9 VRER mutant that can recognize NGCG were obtained through the error-prone PCR strategy. The xCas9 3.7 variant that can recognize NGG, NG, GAA, and GAT has been constructed by using directed evolution technology PACE; In addition, a more active SpCas9 NG variant has been developed, and its recognized PAM sequence has been extended to NG. A series of SpCas9 mutants were constructed using PACE technology, which extended the recognized PAM sequences to NRNH (R is A/G, H is A/C/T). These works have almost freed SpCas9 and its mutants from PAM troubles. The SpCas9 protein was modified to develop SpRY whose recognized PAM sequences covering NRN and NYN (Y is C/T) (NRN>NYN). The newly identified Cas12b protein is heat-resistant and only recognizes the PAM sequence of 5′-TTN. However, there is currently no Cas12a nuclease with strong heat resistance and less PAM restriction.
Compared with Cas9, Cas12a has many advantages, such as shorter crRNA, making it easier to be delivered to cells; After cleaving, cohesive ends are generated, which is more conducive to precise genome recognition and editing; The distance between the cleaving site and its recognition site is relatively far, which can achieve the purpose of continuous multiple edits. In addition, the greatest feature of the Cas12a protein lies in that it is not only used for gene editing at the cellular or individual level, but also widely used for highly sensitive and specific detection of small molecules such as nucleic acids or proteins. After binding to the target DNA, Cas12a cleaves the cis-target DNA and the trans-non-target single stranded DNA (ssDNA). If fluorescence and quenching group modified ssDNA are provided as reporter genes during nucleic acid cleavage in vitro, it can be used to indicate the presence of target nucleic acid target molecules. This strategy has been widely used for on-site visualization detection of nucleic acid. At present, there are relatively few known Cas12a proteins, such as natural AsCas12a, LbCas12a, and FnCas12a, as well as artificially modified enhanced enAsCas12a, whose recognized PAM sequences are all “TTTV or TTV”, resulting in a small target recognition range. Although studies have shown that there are differences in the PAM sequences of Cas9 or Cas12a proteins from different bacterial sources, the existence of Cas12a proteins with high heat resistance and few base restrictions in the PAM sequence has not been reported yet.
Therefore, there is still an urgent need in this field to search for CRISPR/Cas12a gene editing systems with high temperature resistance and a wider target recognition range.
The present invention has developed for the first time a CRISPR/Gs12-7 gene editing system with high activity and high heat resistance, which has the advantages of high protein temperature tolerance, recognition of PAM sequences containing BTYV, and thus has a larger gene editing space and high activity and specificity in cleaving target DNA in the genome. The present invention also establishes a nucleic acid visualization detection and genome targeted editing technology mediated by Gs12-7 protein.
In order to achieve the objectives as above, the present invention comprises the following technical solutions:
The endonucleases in the CRISPR/Cas system comprise the following proteins:
Fusion proteins, comprising the endonucleases as above and peptides connected to the N-terminus or C-terminus of the proteins.
Polynucleotides, which are polynucleotides encoding the endonucleases or fusion proteins as above. Vectors or host cells comprising the polynucleotides.
The application of the endonucleases as above in gene editing includes modifying genes, knocking out genes, altering the expression of gene products, repairing mutations, or inserting polynucleotides in prokaryotic genome, eukaryotic genome, or in vitro genes.
A CRISPR/Cas gene editing system comprising the endonucleases, fusion proteins, polynucleotides, vectors, or host cells as above. Furthermore, it also comprises direct repeat sequences that can bind to the endonucleases as above and guiding sequences that can target the target sequence.
A visual nucleic acid detection kit comprising the endonucleases as above, single stranded DNA fluorescence quenching reporter genes, and guide RNA paired with target nucleic acids.
The technical solution of the present invention has the following main beneficial effects:
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Genie scissor (Lingjian) is a family of endonucleases, where Genie means elf, representing bacterial origin, and scissor represents gene scissors, indicating their potential gene editing functions. The Chinese name corresponding to Genie scissor endonuclease is “Lingjian” endonuclease, and the Genie scissor gene editing system represents the gene editing system mediated by “Lingjian” endonuclease, abbreviated as “Lingjian gene editing”.
The protospacer adjacent motif (PAM) is a short DNA sequence (usually the length of 2-6 base pairs). The traditional view is that PAM is necessary for Cas endonuclease cleavage, typically 3-4 nucleotides downstream of the cleavage site. There are many different Cas endonucleases that can be purified from different bacteria, and each enzyme may recognize different PAM sequences.
The present invention will be further described in combination with specific embodiments. It should be understood that these embodiments are only used to illustrate the invention and not to limit the scope of the invention. The following experimental methods without specific conditions are usually in accordance with conventional conditions, such as those described in the Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer.
Based on the bioinformatics identification process of a novel guide RNA dependent endonuclease constructed by the inventor, a deep mining of bacterial encoded proteins was carried out on the massive metagenomic sequencing data from public databases such as the Non-Redundant Protein Sequence Database (NCBI nr) and the Global Microbial Gene Catalog Database (GMGC). The general analysis process was as follows: for all contig sequences in the target database, use minced software to search and locate the CRISPR array, then use prodigal software to predict CRISPR array adjacent expressed proteins, use CD-hit software to remove redundancy from all predicted proteins, use mega software for protein clustering analysis, and use hmmer software to identify and classify CRISPR-Cas similarity proteins. Finally, a new unknown bacterial protein was obtained, with an amino acid sequence as shown in SEQ ID NO: 1 and a nucleic acid sequence as shown in SEQ ID NO: 2.
Through phylogenetic tree analysis, it is found that this new bacterial protein is located on different CRISPR-Cas12a phylogenetic branches (
Next, the inventor utilized a localized blast program to perform sequence similarity alignment between this newly discovered bacterial protein and the NCBI nr database. The results show that the amino acid sequence conservation of the new Gs12-7 protein with known endonucleases LbCas12a, FnCas12a, and AsCas12a are 34.09%, 36.47%, and 39.72%, respectively (
Furthermore, the inventor analyzed the loci of this protein using CRISPRCasFinder software. It is found that Gs12-7 has a CRISPR array sequence, which comprises multiple repeat and interval sequences, as well as Cas4, Cas1, and Cas2 proteins. By using hmmer software to perform hidden Markov model alignment analysis on domain sequences in Pfam database, REC1 domain (Alpha helical recognition lobe domain), RuvC nuclease domain, and NUC domain (Nuclease domain) were obtained, and it is speculated that this new bacterial protein may have nucleic acid cleavage activity; next, the inventor predicted and aligned multiple sequences of the DR sequence secondary structure of Gs12-7 through the RNAfold web server (http://ma.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi) online website, and it is found that the newly predicted bacterial protein has a DR secondary structure similar to the known Cas12a protein, but with one base difference (
Finally, the inventor performed amino acid multiple sequence alignment of the RuvC and Nuc domains of Gs12-7 with known LbCas12a, FnCas12a, and AsCas12a proteins, respectively. As shown in
This embodiment tested the cleavage activity of the Gs12-7 protein on double stranded DNA through in vitro experiments. The guide RNA paired with the target nucleic acid was used to guide the recognition and binding of the Gs12-7 protein to the target nucleic acid, thereby stimulating the cleavage activity of the Genie scissor protein towards the target nucleic acid and cleaving the double stranded target nucleic acid in the system. Then, agarose gel electrophoresis was used to observe the size change of the target band to identify its enzyme digestion activity.
In this embodiment, the selected target double stranded DNA (dsDNA) is the African swine fever P72 gene, PAM is TTTA its sequence:
the bold marking is PAM, and the underline represents the target sequence. The guide RNA sequence is:
Using the pmd-18t-p72 plasmid as a template, p72-F: CTGTAACGCAGCACAGCTGA (SEQ ID NO: 31), and p72-R: CCATGGTTTATCCCAGGAGT (SEQ ID NO: 32) as primers, PCR amplification was performed to obtain P72 double stranded DNA. Secondly, the DNA sequence encoding Gs12-7 was synthesized by optimizing the Escherichia coli codon, and NLS nuclear localization signals were added to its C-terminus. The DNA sequence is shown in SEQ ID NO: 3. Subsequently, it was connected to the prokaryotic expression vector pET-28a and transformed into the Escherichia coli BL21 strain. After identifying the positive clone, IPTG induced expression was performed, and the target protein was purified through affinity chromatography. The following system was adopted in the in vitro cleaving reaction: 10×CutSmart Buffer 2 μL. The predicted Geniscissor-NLS-tagged protein was 500 ng, the guide RNA was 500 ng, and the P72 target amplification product was 2 μL. The system was incubated at 37° C. for 0.5 min, 2 min, 10 min, and 20 min, respectively. After the reaction was completed, 1 μL of protease K was added separately and incubated at 55° C. for 10 min to terminate the reaction. Guide RNA and target nucleic acid were added in the experimental group, while guide RNA was not added in the control group. After reaction, 1% agarose gel electrophoresis was carried out, the difference between the newly discovered target bands of Gs12-7 experimental group and control group was detected by UV transilluminator, and the cleaving efficiency was analyzed by Image J software.
As shown in
The PAM sequence recognized by the Gs12-7 protein with low homology and in vitro target nucleic acid cleavage activity was identified through bacterial PAM library subtraction experiment. Among them, the construction process of the randomly mixed PAM vector library is as follows: the DNA oligo sequence
TAAGGCCACTGTTAAAAAGCTTGGCGTAATCATGGTCATAGCTGTTT
was synthesized, where Nis a random deoxyribonucleotide. Oligo F: GGCCAGTGAATTCGAGCTCGG (SEQ ID NO: 34) and Oligo R: AAACAGCTATGACCATGATTACGCCAA (SEQ ID NO: 35) were used as upstream and downstream primers for PCR amplification. They were then connected to the pUC19 vector through homologous recombination. After transformation into Escherichia coli, the plasmid was extracted to form a random mixed PAM vector library. The guide RNA sequence used is:
Bacterial PAM library subtraction experiment: the constructed vector pACYC-Duet-1-Gs12-7-crRNA co-expressing the predicted Gs12-7 protein and crRNA was transformed into the DE3 (BL21) competent cells to prepare a stable expression bacterial strain. The stable transgenic bacterial strain constructed from the expression vector pACYC-Duet-1-Gs12-7 without crRNA was used as a negative control. 100 ng of PAM library plasmids were transferred into stable expression bacterial strains, and screened using ampicillin and chloramphenicol resistant plates. After 16 hours, the colonies on the plates were scraped off for plasmid extraction. Using 100 ng of extracted plasmids as templates, PCR amplification was performed using library sequencing primers Seq-F: GGCCAGTGAATTCGAGCTCGG (SEQ ID NO: 34) and PAM Seq-R: CAATTTCACACAGGAAACAGCTATGACC (SEQ ID NO: 37). After product recovery, the experimental and control groups were subjected to second-generation high-throughput sequencing, and the sequencing results were analyzed and displayed using Weblogo 3.0.
Identification of PAM sequence characteristics recognized by the Gs12-7 protein: 16384 different types of PAM sequences contained in the starting vector library were counted for their frequency of occurrence in high-throughput sequencing in the experimental group and control group, and standardized using the total number of PAM sequences in each group. The calculation method for each PAM consumption change is log 2 (control group standardized value/experimental group standardized value). When this value is greater than 3.5, it is considered that this PAM has been significantly consumed. Then, Weblogo 3.0 was used to visually display the frequency of occurrence of significantly consumed PAM sequences at various positions. As shown in
To demonstrate the reliability of the “BTYV” validated by the bacterial PAM library subtraction experiment, it was validated through in vitro enzyme digestion of double stranded DNA. Using the pmd-18t-p72 plasmid as a template, P72 fragment 1 was amplified using P72-F1 and P72-R1 as primers. P72 fragment 2 was amplified using different P72-F2 and P72-R2 primers, and P72 fragment 3 was amplified using P72-F3 and P72-R3 primers. Finally, using P72-F1 and P72-R3 primers, fragments 1, 3, and different fragments 2 as templates, Overlap PCR was performed to obtain different PAM target double stranded DNA (dsDNA) African swine fever P72 gene. The primer sequence is shown in the table below:
In this embodiment, the selected different PAM target double stranded DNA (dsDNA) is the African swine fever P72 gene, its sequence:
the bold marking is PAM, and the underline represents the target sequence. For the same guide RNA sequence:
Secondly, the DNA sequence encoding Gs12-7 was synthesized by optimizing the Escherichia coli codon, and NLS nuclear localization signals were added to its C-terminus. The DNA sequence is shown in SEQ ID NO: 3. Subsequently, it was connected to the prokaryotic expression vector pET-28a and transformed into the Escherichia coli BL21 strain. After identifying the positive clone, IPTG induced expression was performed, and the target protein was purified through affinity chromatography. The following system was adopted in the in vitro cleaving reaction: 10×CutSmart Buffer 2 μL. The predicted Genie scissor-NLS-tagged protein was 500 ng, the guide RNA was 500 ng, and the P72 target PCR amplification product for different PAMs was 2 μL. The system was incubated at 37° C. for 30 min, respectively. After the reaction was completed, 1 μL of protease K was added separately and incubated at 55° C. for 10 min to terminate the reaction. Guide RNA and target nucleic acid were added in the experimental group, while guide RNA was not added in the control group. After reaction, 1% agarose gel electrophoresis was carried out, the difference between the target bands of the new endonuclease Gs12-7 predicted under different PAM target sites in the experimental group and the control group was detected by imaging observation under UV transilluminator, and the cleaving efficiency was analyzed through Image J software.
As shown in
Further evaluate whether the Gs12-7 protein has trans-cleavage activity. Guide RNA that could pair with the target nucleic acid was used to guide endonuclease Gs12-7 to recognize and bind to the target nucleic acid; subsequently, its “trans-cleavage” activity towards any single stranded nucleic acid was stimulated, thereby cleaving the single stranded DNA fluorescence quenching reporter gene (ssDNA-FQ) in the reaction system; furthermore, the trans-cleavage function of the Gs12-7 protein could be determined by the excitation fluorescence intensity, background noise, and visual color changes. By screening different base combinations of intermediate single stranded DNA, the optimal fluorescence quenching reporter gene (ssDNA-FQ) for the Gs12-7 protein was identified.
The target double stranded DNA (dsDNA) used in this embodiment is the p72 conserved gene of African swine fever virus ASFV, its sequence:
the bold marking is PAM, and the underline represents the target sequence. The guide RNA sequence is:
The single stranded DNA fluorescence quenching reporter gene sequences are ROX-TATAT-BHQ 2, ROX-TTTTT-BHQ 2, ROX-GGGGG-BHQ 2, ROX-CCCCC-BHQ 2, ROX-AAAAA-BHQ 2, ROX-GCGCG-BHQ 2, or ROX-random-BHQ 2 (5′ROX/GTATCCAGTGCG/3′BHQ 2 (SEQ ID NO: 60)). Firstly, the Gs12-7 and LbCas12a proteins were obtained by prokaryotic expression purification, guide RNA was obtained by in vitro transcription, and the p72 target gene double stranded DNA was obtained by PCR amplification. Next, the following reaction system was adopted: Gs12-7/LbCas12a protein 500 ng, guide RNA 500 ng, 2 μL of 10×CutSmart Buffer, 1 μM of single stranded DNA fluorescence quenching reporter genes with different base combinations, and 2 μL of PCR amplification target product. The negative control was without a target. The reaction was carried at 37° C. for 15 min, and 98° C. for 2 min to inactivate. Then, the preference of Gs12-7 protein trans-cleavage activity for reporter gene bases was detected using a microplate reader and a blue light instrument.
As shown in
Subsequently, the optimal enzyme digestion reaction temperature for the nucleic acid detection technology mediated by the Gs12-7 protein was evaluated. Using the above targets as the nucleic acid detection sites, the following system reactions were performed: Gs12-7 protein 500 ng, guide RNA 500 ng, 2 μL of 10×CutSmart Buffer, 1 μM of single stranded DNA fluorescence quenching reporter genes (ROX-random-BHQ 2) and 2 μL of PCR amplification target product. The negative control was without a target. The reaction was carried at 37° C., 45° C., 55° C., 60° C., and 65° C. for 15 min separately, and 98° C. for 2 min to inactivate. Fluorescence intensity and background noise were observed under blue light. As shown in
Finally, to verify whether the PAM identified by the Gs12-7 protein in bacteria is suitable for nucleic acid detection, target double stranded DNA (dsDNA) was used as the p72 conserved gene of African swine fever virus ASFV, its sequence: CTGTAACGCAGCACAGCTGAACCGTTCTGAAGAAGAAGAAAGTTAATAGCAGATG CCGATACCACAAGATCAGCCGTAGTGATAGACCCCACGTAATCCGTGTCCCAACTA ATATAAAATTCTCTTGCTCTGGATACGTTAATATGACCACTGGGTTGGTATTCCTCCC GTGGCTTCAAAGCAAAGGTAATCATCATCGCACCCGGATCATCGGGGGTTTTAATC GCATTGCCTCCGTAGTGGAAGGGTATGTAAGAGCTGCAGAACTTTGATGGAAATTT ATCGATAAGATTGATACCATGAGCAGTTACGGAAATGTTTTTAATAATAGGTAATGT GATCGGATACGTAACGGGGCTAATATCAGATATAGATGAACATGCGTCTGGAAGAG CTGTATCTCTATCCTGAAAGCTTATCTCTGCGTGGTGAGTGGGCTGCATAATGGCGT TAACAACATGTCCGAACTTGTGCCAATCTCGGTGTTGATGAGGATTTTGATCGGAG ATGTTCCAGGTAGGTTTTAATCCTATAAACATATATTCAATGGGCCATTTAAGAGCA GACATTAGTTTTTCATCGTGGTGGTTATTGTTGGTGTGGGTCACCTGCGTTTTATGG ACACGTATCAGCGAAAAGCGAACGCGTTTTACAAAAAGGTTGTGTATTTCAGGGG TTACAAACAGGTTATTGATGTAAAGTTCATTATTCGTGAGCGAGATTTCATTAATGA CTCCTGGGATAAACCATGG (SEQ ID NO: 61); multiple different guide RNAs (crRNAs) targeting the PAM site of “BTYV” were designed, including crRNA-ATTV-1, crRNA-ATTV-3, crRNA-TTTV-1, crRNA-TTTV-2, crRNA-TTTV-3, crRNA-CTTV-1, crRNA-CTTV-2, crRNA-CTTV-3, crRNA-GTTV-1, crRNA-GTTV-2, crRNA-GTTV-3, and crRNA-PC, with the following sequences:
The underline represents the target sequence. Using the above P72 target as the nucleic acid detection site, the above crRNAs were obtained by in vitro transcriptional purification and subjected to the following system reactions: Gs12-7 protein 500 ng, the above different crRNAs 500 ng, 2 μL of 10×CutSmart Buffer, 1 μM of single stranded DNA fluorescence quenching reporter genes (ROX-random-BHQ 2) and 2 μL of PCR amplification product of target P72. The negative control was without a target. The reaction was carried at 37° C. for 15 min, and 98° C. for 2 min to inactivate. The fluorescence intensity of different PAM targets was verified by detecting using a blue light instrument. As shown in
Further identification of the CRISPR-Gs12-7 system's ability to recognize single base mismatches in the target region. The target double stranded DNA (dsDNA) used in this embodiment is the p72 conserved gene of African swine fever virus ASFV, its sequence:
the bold marking is PAM, and the underline represents the target sequence. Firstly, PCR amplification was performed to obtain a double stranded DNA template containing mutations from the 1-24 consecutive target sites. Target-F to Target-p72-F-20G primers were used upstream, and Target-p72-R primers were used downstream to amplify to obtain the target double stranded gene. The primer sequence table used in this embodiment is as follows:
Among them, the guide RNA sequence is:
The single stranded DNA fluorescence quenching reporter gene sequence is ROX-random-BHQ 2; firstly, the Gs12-7 protein was obtained by prokaryotic expression purification, guide RNA was obtained by in vitro transcription, and the target gene DNA with p72 single base mutation was obtained by PCR amplification. Next, the following reaction system was adopted: Gs12-7 protein 500 ng, guide RNA 500 ng, 2 μL of 10×CutSmart Buffer, 1 μM of single stranded DNA fluorescence quenching reporter genes 5′ROX/GTATCCAGTGCG/3′BHQ2 (SEQ ID NO: 60) and 2 μL of PCR amplification target products with different base mutations. The recognition ability of Gs12-7 protein for single base mismatch sites with the target was evaluated by interpreting fluorescence intensity and background signal under blue light, and its target recognition specificity was evaluated accordingly.
As shown in
The cell genome directed editing ability mediated by the Gs12-7 protein was evaluated. This embodiment first referred to the instructions of the LipofectamineTMCRISPRMAXTM reagent and incubated the new Gs12-7 and enAsCas12a proteins with guide RNA. Subsequently, ribonucleoprotein complexes (RNPs) were transfected into human HEK 293T cells, and guided by guide RNA, the Gs12-7 and enAsCas12a proteins were recognized and bound to target nucleic acids for genome cleavage. Finally, cells were collected and genomic DNA was extracted, and cleavage activity was detected through T7EN1 digestion.
In this embodiment, the selected target nucleic acid is the human FANCF gene, PAM is TTTG, its sequence:
the bold part is the PAM sequence, the underlined area is the target area. The guide RNA sequence is:
when the fusion degree of HEK 293T cells reached 70-80%, they were planked and inoculated into a 12 well plate at 8×104 cells/well. Transfection was carried out after 6-8 hours of planking, and 1.25 μg of the predicted Genie scissor or Cas12a-NLS-tagged protein was added and incubated with 625 ng of guide RNA, mixed well with 50 μL of opti-MEM and 2.6 μL of Cas9 Plus™ reagent; 50 μL of opti-MEM was mixed well with 3 μL of CRISPR™ reagent. Diluted CRISPR™ reagent was mixed well with diluted RNP and incubated at room temperature for 10 min. The incubated mixture was added to the culture medium covered with cells for transfection. After incubating at 37° C. for 72 hours, the culture medium was discarded and 100 μL of PBS was used to perform cell resuspension to extract the genome of cells. PCR amplification was performed on the target sites of transfected positive cells. T7EN1 enzyme treatment reaction and agarose gel electrophoresis were used to observe the changes of bands to judge whether the predicted protein had gene editing activity in vivo, and Image J was used to roughly calculate the editing efficiency. The template for negative control is the genome of normal cultured HEK 293T cells without RNP transfection.
As shown in
Further, in this embodiment, the eukaryotic cell codon of the newly discovered Gs12-7 protein was optimized, and SV40 NLS and NLS nuclear localization signals were added to the N and C terminals of its protein, respectively. The sequence was shown in SEQ ID NO: 4. The synthesized sequence was constructed into Lenti-puro lentivirus vector, and at the same time, it was co-transfected with the guide RNA eukaryotic expression vector to HEK293T cells through liposomes. The guide RNA paired with the target nucleic acid was used to guide the Gs12-7 protein to recognize and cleave the target nucleic acid molecule, and whether it had cell genome directed editing activity was detected through T7EN1 digestion and agarose gel electrophoresis.
In this embodiment, the selected target nucleic acid is human FANCF gene, PAM is TTTG, its sequence:
the bold part is the PAM sequence, the underlined area is the target area, and the guide RNA sequence is:
and the human RUNX1 gene, PAM is TTTC, its sequence:
GAAGGTAAAAGAAATCATTGAGTCCCCCGCCTTCAGAAGAGGGTGCATTT
the bold part is the PAM sequence, the underlined area is the target area; the human EMX1 gene, PAM is TTTG, its sequence:
the two designed guide RNA sequences are:
When the fusion degree of HEK 293T cells reached 70%-80%, they were planked and inoculated into a 12 well plate at 8×104 cells/well. Transfection was carried out after 6-8 hours of planking, and 1 μg of eukaryotic expression vector or known enhanced enAsCas12a eukaryotic expression vector, 1 μg of single or tandem guide RNA expression vectors and 10 μL of Jetprime regent were added in turn to 200 μL of Jetprime Buffer to pipette and incubate at room temperature for 10 min. The incubated mixture was added to the culture medium covered with cells for transfection. After incubating at 37° C. for 72 hours, the culture medium was discarded and 100 μL of PBS was used to perform cell resuspension to extract the genome of cells. PCR amplification was performed on the target site of transfected positive cells to edit the nearby sequences. The changes of target bands were observed by T7EN1 digestion and agarose gel electrophoresis. The negative control template was the normal culture HEK293 cell genome without transfection.
The directed editing ability of CRISPR-Gs12-7 protein towards a single target gene, multiple target genes, and multiple single gene loci was evaluated. As shown in
The above are only preferred embodiments of the present invention, and are not intended to limit the present invention in any form. Although the present invention has been disclosed in the above preferred embodiments, they are not intended to limit the present invention. Any technician who is familiar with the present invention can make a slight change or modification into the equivalent embodiments of equivalent changes by using the technical content of the above-mentioned hints without departing from the scope of the technical solution of the present invention. But as long as the technical content is not deviated from the technical solution of the present invention, any simple modifications, equivalent changes and modifications made to the above embodiments according to the technical substance of the present invention are still within the scope of the present invention.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202310086152.7 | Jan 2023 | CN | national |
