Patent Application
20200164052
The invention relates to the field of antigens and vaccines for inducing a host to initiate immune response to the growth factor receptor HER2, and particularly for breaking tolerance to self HER2. The invention related particularly to the induction of anti-HER2 immunity for the treatment and prevention of mammary carcinomas and other HER2 expressing tumors in humans and other mammalian species.
One of the foremost barriers to cancer immunotherapy and immunoprevention is the phenomenon of tolerance, the immune system's safeguard against autoimmune disease. Most tumor antigens are self antigens showing little or no difference from their normal counterparts in amino acid sequence and three dimensional structure.
The immune system generally becomes tolerant to self antigens early in life. T lymphocyte clones specifically reactive to self antigens are either deleted or anergized during thymic development, or are kept in check at the periphery, mainly by diverse populations of regulatory T cells (Treg). Especially important are natural Treg which develop in the thymus upon high affinity recognition of antigens in the thymic stroma (Colombo and Piconese, 2007). It is often impossible to predict an antigen and immunization protocol that will break tolerance to a self antigen to achieve effective vaccination. This problem has defeated the development of many vaccines intended to induce immune response against tumor antigens (Wei et al, 2004).
A most promising tumor antigen in breast and other carcinomas is HER2 (ErbB-2, neu). HER2 is amplified in ˜30% of all breast cancers and is over-expressed in several other epithelial-derived neoplasms including ovarian cancer, small cell lung cancer, and cancers of the head and neck (Slamon, et al., 1989, Yu and Hung, 2000; Tzahar and Yarden. 1998).
HER2 receptors include an extracellular domain (ECD) of about 630 amino acids, a single membrane-spanning transmembrane region (TM), and an intracellular domain (ICD) including a cytoplasmic tyrosine kinase. The ECD contains four domains arranged as a tandem repeat of a two-domain unit consisting of a ˜190-amino acid L domain (domains I and III) followed by a ˜120-amino acid cysteine-rich domain (domains II and IV) (Witton, 2003, Roskoski, 2014).
Other members of the HER family of receptors, HER1, HER3, and HER4, bind extracellular growth factor (EGF) family ligands, but HER2 itself does not. Instead, it acts as a co-receptor, the preferred binding partner of the other HER family receptors. Ligand binding brings about heterodimerization of HER family receptors with HER2, leading to tyrosine kinase activation, and the activation of downstream signaling pathways. Overexpression of HER2, commonly seen in carcinomas, promotes spontaneous receptor dimerization and the activation of signaling pathways, in the absence of a ligand (Olayioye, 2001).
The presence of HER2 specific T cells and antibodies in breast and ovarian cancer patients indicate this molecule as a target of immunoprevention and therapy (Disis, et al., 1994; Peoples, et al., 1995; Fisk, et al., 1997; Kobayashi, et al., 2000). Passive immunotherapy, by administration of the anti-HER2 moAb (monoclonal antibody), Herceptin®, is used to treat patients with advanced breast cancer (Cobleigh, et al., 1999). Unfortunately, since ErbB-2 is a self antigen, and its sequence is typically unmodified in cancer, tumor hosts show strong immune tolerance against immune tolerance to HER2.
A HER2 tolerance breaking strategy that has shown some promise is to immunize a host with xenogeneic (heterologous) HER2, that is, HER2 from a different species than that of the immunized host. The strategy depends on the development of antigens that are sufficiently foreign to the HER2 of the host species to break tolerance to HER2, but sufficiently similar to elicit T cells and antibodies that cross react with the host HER2.
Some success has been attained with this strategy. It was found, for example, that heterologous vaccination with rat HER2 (rat neu) produced a degree of T cell response in human-HER2-tolerant transgenic mice. More complete responses were produced by vaccinating the transgenic mice with a hybrid antigen combining components of rat and human HER2 (Jacob, et al, 2006; Jacob, et al., 2010).
There is a need for more effective tolerance breaking antigens, for use in therapeutic and preventative vaccination against mammary carcinoma and other HER2-expressing cancers. There is also a need for monoclonal antibodies to such antigens, because such antibodies are themselves potential cross reacting reagents that can target HER2 expressing tumor cells.
There is also a need for antigens and methods useful for breaking tolerance to self HER2 in cats, for the treatment and prevention of mammary carcinoma in domestic feline populations. Feline mammary cancer is an important veterinary problem. The domestic cat population is estimated at 1 billion worldwide (Mullikin, et al., 2010) with approximately 95 million residing in US households (www.humanesociety.org/issues/pet_overpopulation/facts/pet_ownership_statistics.html) About 15% of unsprayed domestic cats spontaneously develop mammary tumors, 90% of which are malignant. Most of the malignancies are adenocarcinomas, with progression and histopathology similar to that of human breast cancer. HER2 expression has been reported in these tumors (Hayden, et al., 1971; Munson and Moresco, 2007; Gimenez, et al., 2010; Soares, et al., 2013; DeMaria, et al., 2005). Furthermore, successful HER2-targeted immunotherapies in outbred cat populations can lead directly to improved immunotherapies for human patients, which is not the case for immunotherapies developed with inbred rodent model populations. That is because the amino acid sequences of human and feline HER2 are more similar than those of human and mouse or rat neu (see, e.g.,
Even with improved antigens and vaccines, a roadblock to breaking HER2 tolerance is the immunocompromised status of many cancer patients at the time of presentation for treatment. A competent immune system is required to meet the challenge of mounting a response to a self antigen. The induction of regulatory T cells, and the effects chemotherapy and radiation treatments can all contribute to a compromised immune system. There is a need for a diagnostic method for screening human and animal candidates for immunocompetence before the start of extended courses of tolerance-breaking immunotherapies.
The present invention provides antigenic HER2 polypeptides for breaking tolerance to self HER2 of an animal subject, the HER2 polypeptides including at least one point mutation in the extracellular domain of HER2.
The present invention also provides isolated HER2 antigenic polypeptides for inducing immune response against HER2 in a subject of a mammalian species. The HER2 polypeptides include an amino substitution of glutamine with lysine at position 141 of precursor feline HER2, or at position 119 of mature feline HER2, or at homologous positions of the HER2 of other species.
The present invention further provides HER2 gene expression constructs for the expression of these substituted antigenic HER2 polypeptides in living cells.
The present invention still further provides HER2 vaccine compositions for inducing immunity to HER2 in a mammalian subject, including an effective amount of one of the substituted HER2 gene expression constructs, and an effective amount of an adjuvant.
The present invention also provides methods for inducing an immune response to HER2 in a mammalian subject, including the steps of administering a substituted HER2 vaccine composition, and inducing an immune response to HER2.
The present invention further provides a method for inducing immune response to HER2 in a mammalian subject, using heterologous HER2 polypeptides. The method includes the steps of administering an effective amount of a gene expression construct encoding a heterologous unsubstituted (i.e. wild type) feline or bear HER2 polypeptide; administering an effective amount of an immunological adjuvant; expressing the gene construct in cells of the mammalian subject; and inducing an immune response against HER2 in the mammalian subject.
The present invention still further provides a method for inducing immune response to HER2 in a cat, including the steps of administering, to a cat, an effective amount of a gene expression construct encoding an antigenic polypeptide of human HER2, bear HER2, mouse HER2, rat neu, or human-rat chimeric HER2neu; administering an effective amount of an immunological adjuvant; expressing the gene construct in the cells of the cat, and inducing an immune response against HER2 in the cat.
The present invention also provides antigenic polypeptides for inducing immune response against HER2 in a mammalian subject, the antigenic polypeptides including either a substitution of glutamine with lysine at position 329 of precursor human HER2; a substitution of glutamine with lysine at position 307 of mature human HER2; a substitution of glutamine with arginine at position 429 of precursor human HER2; a substitution of glutamine with arginine at position 407 of mature human HER2; a substitution of asparagine with arginine at position 438 of precursor human HER2; and a substitution of asparagine with arginine at position 416 of mature human HER2. The invention provides these antigenic peptides as isolated peptides, gene expression vectors, and vaccine compositions.
The present invention further provides monoclonal antibodies selective for all of the previously mentioned substituted antigenic HER2 polypeptides.
The present invention still further provides a diagnostic test to determine whether a mammalian subject is sufficiently immunocompetent to respond to immunotherapy directed at self HER2.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Other advantages of the present invention are readily appreciated as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings wherein:
The compositions and methods according to the present invention represent solutions to the problem of immunological tolerance of tumor hosts to the HER2 antigens of their tumors. They represent the first reported examples of deliberately introduced point mutations that convert HER2 polypeptides into antigens capable of breaking tolerance to self HER2, and inducing an immune response reactive to self HER2. In an exemplary embodiment, a point mutation brings about the substitution of glutamine with lysine (Q-K) in the amino acid sequence QLRSLTEILKGGVLI (SEQ ID NO: 109) of HER2 domain I, rendering the sequence KLRSLTEILKGGVLI (SEQ ID NO: 110).
In a related embodiment, the present invention includes isolated antigenic polypeptides for breaking tolerance and inducing immune response against HER2 in a mammalian subject. The polypeptides include a substitution of glutamine with lysine with (Q-K) or a with a conservative amino acid of lysine, at position 141 (Q141K) of precursor feline HER2, or at a homologous position of the precursor HER2 of another animal species. Precursor HER2 (preHER2) is defined as HER2 including a signal peptide, an extracellular domain (ECD) and a transmembrane domain (TM). For brevity, the term Q-K substitution will refer to both a substitution of Q with K, and to a substitution of Q with a conservative amino acid, such as arginine. Also included in this embodiment are antigenic polypeptides of mature HER2 (mHER2), that is, HER2 lacking a signal peptide, and including the ECD and TM. In mHER2, the Q-K substitution is at position 119 of mfeHER2, or at a homologous position of the mature HER2 of another species.
The specification of the Q141K or Q119K substitution at a “homologous position of the HER2 of another animal species” indicates that the substitution is made to the Q that is in the lead position in a highly conserved 15 aa sequence in domain I of ErbB2, the conserved sequence being QLRSLTEILKGGVLI (see, for example, the underlined feature of SEQ ID NO: 39 as shown in
A standardized notation system will be used to denote specific forms of HER2 polypeptides. The notation will refer both to a polypeptide gene product, and to the gene construct employed to induce expression of the gene product in an organism. In the notation system, the animal species from which the HER2 is derived will be abbreviated and italicized and placed before HER2. The identity and location of an amino acid substitution if any, will be hyphenated after HER2. A wild-type HER2 will lack a designated substitution. The designation of a precursor or mature form will be abbreviated “pre” or “m”, respectively, and placed to the left of the species. If the construct is included in a vector, the vector abbreviation will appear as the left-most term. For example:
An annotated amino acid sequence of unsubstituted prefeHER2 (SEQ ID NO: 39) and prefeHER2-Q141K (SEQ ID NO: 7) is shown in
Exemplary amino acid sequences for each of the substituted antigens as follows: prefeHER2-Q141K, SEQ ID NO: 7; prebearHER2-Q141K, SEQ ID NO: 8; prehumHER2-Q141K, SEQ ID NO: 9; premouseHER2-Q142K, SEQ ID NO: 10; preratHER2-Q145K, SEQ ID NO: 11; preE2Neu-Q141K, SEQ ID NO: 12; mfeHER2-Q119K, SEQ ID NO: 1; mbearHER2-Q119K, SEQ ID NO: 2; mhumHER2-Q119K, SEQ ID NO: 3; mmouseHER2-Q120K, SEQ ID NO: 4; mratHER2-Q120K, SEQ ID NO: 5; and mE2Neu-Q119K, SEQ ID NO: 6. It will be understood that the disclosed amino acid sequences are exemplary, and that the present invention encompasses all immunologically equivalent sequences.
The development of the antigenic HER2 polypeptides of the present invention was initiated on the basis of experiments in which it was found that heterologous electrovaccination with rat neu (rat HER2) overcame T cell tolerance in human HER2 transgenic (Tg) mice. The term “heterologous”, when used to refer to HER2, or another antigen, indicates that the antigen is derived from an animal species or species hybrid that is different from the species of the animal being vaccinated. Unfortunately, heterologous vaccination of human HER2 Tg mice with rat neu did not produce an effective humoral (B cell) response. The resulting immune sera did not cross react with human HER2 (Jacob, et al., 2006).
A hybrid antigen was next developed, which included portions of human HER2 and rat HER2 (rat neu), which will be referred to as E2Neu. This hybrid antigen included human HER2 extracellular domains (ECD) 1/2, rat neu ECD 3/4 and the rat neu transmembrane domain. E2Neu was incorporated into a gene construct for expression in animals, specifically the plasmid vector pE2Neu. The vector was delivered, as a component of a vaccine, to human HER2 Tg mice. The pE2Neu vaccine was found to induce both humoral and cellular (T cell) immunity against human HER2 in human HER2 Tg mice (Jacob, et al., 2010).
Because a chimeric human/rat form of HER2 broke tolerance as well as the pure heterologous rat form, and gave a more complete immune response than the pure rat form, it was hypothesized that results can be further improved by immunization with forms of HER2 that are more minimally altered from the HER2 of a human host or experimental animal.
In one test of this hypotheses, animal hosts were immunized with self HER2 containing point mutations, to afford immunogenicity while preserving HER2 epitopes. In experiments disclosed in Examples 3 and 4, certain point mutations in HER2 were found to confer enhanced immunogenicity in vaccination experiments. Each point mutation produced a single amino acid substitution in HER2.
Vaccination experiments with wild type and substituted forms of HER2 are described in Example 3. These vaccination experiments were performed not only in mice but also in a novel and highly realistic outbred cat tumor immunity model, which was utilized in experiments disclosed in Examples 1-4. Feline HER2 is more closely related to human HER2 than are the HER2s of mice or rats (
In the experiments of Example 3, cats were immunized with a genetic vaccine including an expression vector which induced expression of the prefeHER2Q141K as well as wild type controls and heterologous HER2 forms. It was found that prefeHer2-Q141K was sufficiently foreign to break tolerance to self HER2 (i.e. feHER2) in outbred cats, inducing both antibodies and T cells reactive with feHer2. The antibodies and T cells were also reactive with Her2 molecules of humans and other species. Because these findings were obtained in the highly realistic outbred cat vaccine test system, it is reasonably predictable that they will also be applicable to other animal species. That is, it is predictable that HER2-K mutant antigens of cats and other animal species, in which Q141 or a homologous Q is substituted with K, will produce anti HER2 immunity in those animal species, when included in an appropriate vaccine composition. Indeed, it found, in experiments disclosed in Example 4, that the homologous substituted human HER2 polypeptide, prehumHER2-Q141K, broke tolerance to human HER2 in human HER2 transgenic mice.
Extrapolating from these findings, it is also predictable that the corresponding mature forms of HER2-Q141K, will also be effective in inducing immunity. The lack of a signal peptide is expected to have no effect on the reactivity of the Q-K substitution epitope, which is over a hundred residues distant, in the ECD. When expressed in a host cell, the mature forms of HER2 would not be processed into the secretory pathway and inserted into the cell membrane, but they would nonetheless be available to antigen presenting cells upon apoptosis or necrosis of the expressing cells. Thus, the previously enumerated mature forms of HER2, including a Q-K substitution at position 119 of feline HER2, or at a homologous position in other species, are also encompassed by the present invention.
In a related embodiment, the present invention includes gene expression constructs such as those utilized in Examples 2-4. The expression constructs include a nucleic acid sequence encoding an antigenic polypeptide of the HER2 of an animal species, and specifically encoding the Q141K substitution at position 141 of precursor feline HER2 (prefeHER2-Q141K), or at position 119 of mature feline HER2 (mfeHER2-Q119K), and at homologous positions of the precursor and mature forms of HER2 of other animal species. The expression construct additionally includes at least one promoter operatively linked to said nucleic acid sequence encoding a HER2 polypeptide, for expression of said antigenic peptide in a living cell.
The encoded constructs, and exemplary nucleic acid sequences encoding them, include: mfeHER2-Q119K, SEQ ID NO: 13; mbearHER2-Q119K, SEQ ID NO: 14; mhumHER2-Q119K, SEQ ID NO: 15; mmouseHER2-Q120K, SEQ ID NO: 16; mratHER2-Q120K, SEQ ID NO: 17; mE2Neu-Q119K, SEQ ID NO: 18; prefeHER2-Q141K; SEQ ID NO: 19; prebearHER2-Q141K, SEQ ID NO: 20; prehumHER2-Q141K, SEQ ID NO: 21; premouseHER2-Q142K, SEQ ID NO: 22; preratHER2-Q145K, SEQ ID NO: 23; and mE2Neu-Q141K, SEQ ID NO: 24. It will be understood that the recited nucleic acid sequences are only exemplary, and that each specified polypeptide can be encoded by one or more synonymous nucleic acid sequences without departing from the scope of the present invention. The nucleic acid sequences are preferably DNA sequences, but may alternatively comprise at least one RNA molecule.
The gene construct also includes at least one promoter operatively linked to the nucleic acid sequence encoding a HER2 Q-K substituted polypeptide, to promote expression of the gene product in a mammal or other organism. The promoter or other regulatory element is selected to ensure that the nucleic acid sequence is transcribed and translated into the antigenic polypeptide upon introduction into a living cell. An exemplary promoter is the cytomegalovirus (CMV) promoter, but any suitable promoter known in the art can be utilized, including, but not limited to, the cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) promoter; the SV40 virus promoter, and the mammalian housekeeping promoter EF1 (elongation factor 1).
A preferred expression vector is the naked DNA plasmid vector pVAX1 (Life Technologies, Grand Island, N.Y.), but any suitable vector system known in the art can be employed with routine modifications, depending on the cell type in which expression is to be obtained. In the Examples, gene constructs are expressed in mammalian hosts and in cultured mammalian cells, but with suitable expression vectors they can also be expressed in bacteria, yeasts, insect cells, and any other desired host. Appropriate techniques or references thereto can be found in Green and Sambrook (2012).
In a related embodiment, the present invention includes a vaccine composition for inducing immunity to HER2 in a mammalian subject. The vaccine composition includes an effective amount of at least one of the previously enumerated isolated HER2 polypeptide antigens or, more preferably, an effective amount of at least one of the previously mentioned gene expression constructs. The gene expression construct is expressible the living cells of the mammalian subject. The vaccine composition preferably includes an adjuvant to amplify immune response to the antigen. The present invention also includes methods for inducing immune response to HER2 in a mammalian subject, including the steps of administering an effective amount of the vaccine composition, and inducing an immune response to HER2.
An effective amount of vaccine composition is defined as one which produces an observable antigen-specific humoral and/or cellular immune response, and if administered as a therapy, a reduction in a population HER2-expressing target cells. The effective amount of a particular vaccine composition can be determined by one skilled in the art on the basis of preliminary trials in which increasing doses are given, and, as warranted, multiple courses of administration are tested. The extent of T or B cell response is measured by, for example, ELISA, cytotoxicity or growth suppression assays, and ELISPOT or other cytokine release assays. The effective amount can be adjusted to account for differences in host weight, species, or physical condition.
Exemplary gene constructs for vaccination techniques, according to the present invention, include HER2 antigens encoded into the naked DNA plasmid expression vector pVax, as described in detail in Examples 3 and 4. The preferred adjuvant is GM-CSF, administered either in soluble form or as a nucleic acid expression vector, which results in GM-CSF expression at a vaccination site. Preferably, the GM-CSF is preferably delivered as an expression plasmid.
Alternatively, the HER2 antigen gene constructs of the present invention can be cloned into any plasmid, or bacterial, or viral vector that can serve as a vaccine vector, to transfect or transduce mammalian cells. Examples include a retrovirus vector, an adenovirus vector, a lentivirus vector, a vaccinia virus vector, a pox virus vector, an adenovirus-associated vector, a virus-like particle, a Salmonella vector, a Shigella vector, a Listeria vector, a Yersinia vector, and an Escherichia vector. Techniques for expression of proteins using viral vectors can be found in Adolph, K. ed. “Viral Genome Methods” CRC Press, Florida (1996) and in Harrop, et al., 2006. Techniques for the use of attenuated bacterial vectors such as Salmonella, Shigella, Listeria, Yersinia, and Escherichia species are found for example in Vassaux et al., 2006. Vaccination is preferably accompanied by a cytokine adjuvant, such as -1, -2, -3, -6, -12, gamma-interferon, tumor necrosis factor, GM-CSF, or flt-3 ligand, delivered either as an expression construct, or as a cytokine protein.
Although electrovaccination is the preferred delivery mode, the gene expression constructs of the present invention can alternatively be packaged into liposomes or coated onto colloidal gold particles prior to administration. The gene expression constructs can then be administered intradermally, subcutaneously or intramuscularly by injection or by gas driven particle bombardment. Alternatively, the gene expression constructs can be administered to host cells ex vivo. Host cells, such as bone-marrow derived cells, can be induced to express the HER2 polypeptide antigens, and then reintroduced to the host to effect immunization. Appropriate techniques can be found in Sudowe, S. and Reske-Kunz, A. B. eds. “Biolistic DNA Delivery: Methods and Protocols”, Humana Press, New York City (2012), and Raz, E., ed. “Gene Vaccination: Theory and Practice, Springer, New York City (1998).
The antigenic HER2 polypeptides of the present invention can also be administered as isolated polypeptides, as a component of a vaccine composition that can also include at least one adjuvant, including but not limited to incomplete or complete Freund's adjuvant, alum, QS21, TITERMAX; cytokines, and cytokines such as, interleukins-1, -2, -3, -6, -12, gamma-interferon, tumor necrosis factor, GM-CSF, or flt-3 ligand. The vaccine composition, with or without adjuvant, can be administered in a pure preparation, or admixed with a pharmaceutically acceptable carrier, diluent, or excipient, as a sterile suspension, emulsion, or in a lipid carrier such as a liposome. Delivery can be by subcutaneous, intradermal, intramuscular, intranasal, or intravenous routes.
In another embodiment, the present invention includes antibodies that selectively bind each of the substituted HER2 antigenic polypeptides disclosed herein. The term “selectively binds”, when applied to an antibody of the present invention, indicates that the antibody (a) binds at a level above background to a particular substituted HER2 antigenic polypeptide, with background taken as the level of binding of a nonspecific reference agent such as a matched immunoglobulin isotype control; and (b) binds at a level at or below background to the corresponding wild type HER2 peptide.
With the amino acid sequences disclsosed herein, one skilled in the art can readily generate antibodies selective for each of the substituted HER2 polypeptides. Thus, the present invention includes monoclonal antibodies selective for substituted HER2 polypeptides, the substituted HER2 polypeptides being selected from the group consisting of: prefeHER2-Q141K mfeHER2-Q119K, prebearHER2-Q141K, mbearHER2-Q119K, prehumHER2-Q141K, mhumHER2-Q119K, premouseHER2-Q142K, mmouseHER2-Q120K, preratHER2-Q145K, mratHER2-Q120K, preE2Neu-Q141K, mE2Neu-Q119K, prehumHER2-Q329K, mhumHER2-Q307K, prehumHER2-Q429R, mhumHER2-Q407R; prehumHER2-N438D, and mhumHER2-N416D. Monoclonal antibodies according to the present invention can be obtained by using the polypeptides or their antigenic fragments as the antigens. For example, an antibody can be obtained by preparing hybridomas by fusion of myelomas, or other mammalian cells capable of infinite proliferation, with antibody-producing cells collected from mammals immunized with one of the antigens. Hybridoma clones capable of producing monoclonal antibody are cultured in vivo or in vitro. The preferred method of immunizing a mammal is by electrovaccination with expression vectors encoding mutant HER2, as described in Examples 3 and 4.
Alternatively, immunizations can be performed with purified or partially purified antigenic polypeptides. For example, the antigens can be in the form of live or killed cells expressing mutant HER2, or the partially purified culture supernatants or homogenates of such cells. In another alternative, the antigens are prepared chemically by peptide synthesis based on the amino acid sequences disclosed herein for the substituted polypeptides.
Immunization with antigenic polypeptides is performed by techniques well known in the art. For example, antigens, preferably in combination appropriate adjuvants, are injected into mammals intradermally, subcutaneously, intramuscularly, intraperitoneally, or intravenously. Rodents such as rats, mice and hamsters can be used. Depending upon species, the total dose of the antigens is generally in the range of about 5-500 μg of purified antigen or equivalent per animal.
Immunizations are performed 2-5 times at an interval of 1-2 Weeks. After the course of immunization, the animal's spleen is extracted and dispersed into a suspension of spleen cells. The antibody-producing cells and the myeloma cells obtained in the above are fused into a cell fusion mixture containing the objective hybridomas.
Suitable myeloma cells include mouse myeloma lines, such as P3-NS1-Ag4-1 cells (ATCC TIB18), P3-X63-Ag8 cells (ATCC TIB9), SP2/O—Ag14 cells (ATCC CRL1581), and other mutants which lack the HGPRT (hypoxanthine-guanine phosphoribosyltransferase) gene.
Cell fusion is carried out by techniques well known in the art, such as incubation with polyethylene glycol or Sendai virus, or by electric pulse. For example, fusion partners are suspended in fusion media containing fusion accelerators, and incubated at about 30-40° C. for about 1-5 min. Conventional serum-free media such as minimum essential medium (MEM), RPMI 1640 medium, and Iscove's Modified Dulbecco's Medium (IMDM) are preferred fusion media. To select hybridomas, the resultant cell fusion mixture is transferred to selection media such as HAT medium, and incubated at about 30-40° C. for from 3 days to 3 weeks, after which point only hybridomas are expected to survive. Detailed fusion and selection protocols are found in Harlow and Lane 1988 and Pandey, 2010.
Hybridomas are cultured as monoclonal populations, and antibodies secreted into culture are screened for reactivity with the immunizing antigen, preferably expressed on cells. Screening is preferably by immunofluorescence assays such as those described in Example 1. Alternatively, well known assays such as enzyme linked immunoassay and radioimmunoassay are used. See, for example Harlow and Lane, 1988
For selection of antibodies specifically reactive to the substituted HER2 antigens of the present invention, immunoassay screening techniques are employed to determine which of the monoclonal antibodies are reactive with the substituted antigen but not to the corresponding non-substituted antigen. Preferably, the immunoassay is an immunofluorescence assay, and the targets for immunofluorescence staining are cells transfected with either the substituted or non-substituted form of the HER2 antigen. Exemplary techniques for transfecting 3T3 cells with HER2 antigen constructs, and for assaying specific antibody binding to the transfected cells, are described in Piechocki, et al., 2001. Hybridoma clones secreting antibodies that bind specifically to the substituted form of the HER2 antigen, but not to the unsubstituted form, are producing the selective antibodies of the present invention. These clones are cultured or stored according to standard techniques. The monoclonal antibodies produced by these clones are harvested from culture in vivo, for example from animal ascites culture, or in vitro, from culture medium. The antibodies are purified by techniques such as protein A or Protein G affinity chromatography, salting out, dialysis, ultrafiltration, ion-exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC), gel electrophoresis, and isoelectrophoresis, or an appropriate combination of techniques. Once purified, the monoclonal antibodies are refrigerated, frozen, or lyophilized for storage.
Alternatively, one skilled in the art can utilize the HER2 antigens of the present invention to generate monoclonal antibodies by antibody phage display techniques. For example, cats are vaccinated with feHER2 or feHER2-Q141K, and RNA is extracted from bone marrow cells or PBLs. The RNA is used for the preparation of oligo dT-primed cDNA libraries, as described by Konthur and Walter (2002). Variable heavy (VH) and variable light (VL) chain orfs are PCR amplified based on reported sequences (www.ncbi.nlm.nih.gov/genome?term=felis%20catus), then Ig cDNA libraries are generated following the protocol described by Hammers and Stanley (2014). For screening purposes, phagemids such as pCombo3X are used to express these two chains as an scFv fused to the pill minor capsid protein of an engineered filamentous bacteriophage (originally derived from M13) (Hammers and Stanley 2014). The cognate antigen used for screening is recombinant fe HER2ecd-Fc (SEQ ID NO: 69), which is immobilized on sterile dishes via Fc binding. Screening is carried out with the pCombo3x/feHER2scFv library. A round of screening consists of binding of the feHER2scFv library to immobilized feHER2ecd-Fc to capture clones with high-affinity binding (“biopanning”), washing to remove background non-binding phage, elution of bound phage/scFv, infection of competent E. coli, expression and recovery via addition of helper phage, and preparation of recovered phage/scFv library for another round of screening. Several rounds of such screening are required to achieve sufficient purity of the aHER2 fe-scFv for functional and genetic analysis. Affinities of ˜1 nMolar are readily achievable (Hammers and Stanley 2014; Carmen and Jemutus 2002). The cloned aHER2-fe-scFv can be 1) used directly as a recombinant scFv, 2) stabilized by fusion to an Fc domain (as in SEQ ID NO: 69) for use in vivo, or 3) reconstructed into full-length IgG light and heavy chains for production of aHER2 monoclonal Ab's of interest.
Human anti-HER2 mAb's are engineered by the same protocol using human PBLs for generating the initial Ig cDNA libraries.
In another embodiment, the present invention includes methods for immunizing a mammalian subject against HER2, using heterologous, unsubstituted (“wild type”) antigenic polypeptides of bear HER2 or feline HER2. While these HER2 polypeptides are known, naturally occurring polypeptides, their inclusion in a method to induce immunity against HER2 represents a novel use. The methods include vaccination with an effective amount of expression construct, as previously described for the methods involving Q to K mutants of HER2. The unsubstituted bear and feline HER2 polypeptides were found to be effective antigens in experiments testing the hypothesis that anti-HER2 response can be achieved by immunization of a host with HER2 that is heterologous, but relatively closely matched to self HER2. Cat and bear HER2 are more closely related to human HER2 than is, for example, rodent HER2 (
Therefore, the present invention includes a method for inducing immune response to HER2 in a mammalian subject, beginning with the step of administering, to a mammalian subject, an effective amount of a gene construct comprising a nucleic acid sequence encoding a heterologous antigenic polypeptide selected from the group consisting of precursor unsubstituted bear HER2 (prebearHER2); mature unsubstituted bear HER2 (mbearHER2); precursor unsubstituted feline HER2 (prefeHER2); and mature unsubstituted feline HER2 (mfeHER2). The gene construct additionally includes at least one promoter for expression of said antigenic peptide in a living cell. The step of administering the gene construct is followed by the steps of administering an effective amount of an immunological adjuvant, expressing the gene construct in cells of the mammalian subject, and inducing an immune response against HER2 in the mammalian subject.
In another embodiment, the present invention includes methods for immunizing cats against self HER2 with vaccines including antigenic polypeptides including the ECD and TM domains of wild type human, mouse, rat, or bear, HER2, and the human-rat hybrid E2neu. Both the precursor and mature forms are included. Use of these antigens for the immunization in experimental rodent models is known, but their administration to cats as an effective anti-HER2 vaccine in cats is a novel use. These antigens are known but their use in methods of inducing immunity to self HER2 in cats is novel. Again, the methods include vaccination with an effective amount of expression construct, as previously described. Exemplary antigenic polypeptides included in the HER2 antigens include: prebearHER2, SEQ ID NO: 37; mbearHER2, SEQ ID NO: 38; prefeHER2. SEQ ID NO: 39; mfeHER2, SEQ ID NO: 40; prehumHER, SEQ ID NO: 45; mhumHER2, SEQ ID NO: 46; premouseHER2, SEQ ID NO: 47; mmouseHER2, SEQ ID NO: 48; preratHER2, SEQ ID NO: 49; mratHER2, SEQ ID NO: 50; preE2Neu, SEQ ID NO: 51; and mE2Neu, SEQ ID NO: 52. Where the antigenic polypeptides are administered in the form of expression constructs, they can be encoded in the following exemplary polynucleotide sequences, or in synonymous sequences thereof: prebearHER2, SEQ ID NO: 41; mbearHER2, SEQ ID NO: 42; prefeHER2, SEQ ID NO: 43; mfeHER2, SEQ ID NO: 44; prehumHER, SEQ ID NO: 53; mhumHER2, SEQ ID NO: 54; premouseHER2, SEQ ID NO: 55; mmouseHER2, SEQ ID NO: 56; preratHER2, SEQ ID NO: 57; mratHER2, SEQ ID NO: 58; preE2Neu, SEQ ID NO: 59; and mE2Neu, SEQ ID NO: 60.
An additional panel of substituted human HER2 polypeptides was also found to break tolerance to human HER2 in mice transgenically expressing human HER2 (human Tg mice), in experiments described in Example 4. Human HER2 is self HER2 in human HER2 Tg mice, and these mice are well known to exhibit strong tolerance to human HER2 (Piechocki, et al., 2003). The additional HER2 polypeptides found to be effective tolerance-breakers included precursor human HER2 having a Q-K substitution at amino acid 329, or a substitution of arginine for glutamine (Q-R) at amino acid 429, or a substitution of aspartic acid for asparagine (N-D) at position 438. The mature forms of these substituted HER2 antigens are reasonably predicted to be equivalently immunogenic to the precursor forms, for reasons previously stated.
Therefore, the present invention provides antigenic polypeptides for inducing immune response against HER2 in a mammalian subject, The polypeptides include at least the extracellular and transmembrane domains of human HER2, the extracellular domain including at least one of the following amino acid substitutions: glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 141 of precursor humanHER2 (prehumHER2-Q141K); glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 119 of mature humanHER2 (mhumHER2-Q119K); glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 329 of precursor humanHER2 (prehumHER2-Q329K); glutamine with lysine (Q-K) or a conservative amino acid of lysine, at position 307 of mature humanHER2 (mhumHER2-Q307K); glutamine with arginine (Q-R), or a conservative amino acid of arginine, at position 429 of precursor human HER2 (prehumHER2-Q429R); glutamine with arginine (Q-R), or a conservative amino acid of arginine, at position 407 of mature human HER2 (mhumHER2-Q407R); asparagine with aspartic acid (N-D), or a conservative amino acid of aspartic acid, at position 438 of precursor human HER2 (prehumHER2-N438D); and asparagine with aspartic acid (N-D), or a conservative amino acid of aspartic acid, at position 416 of mature human HER2 (mhumHER2-N416D).
Exemplary amino acid sequences for each of the substituted antigens as follows: prehumHER2-Q141K (SEQ ID NO: 9); mhumHER2-Q119K (SEQ ID NO: 3;); prehumHER2-Q329K (SEQ ID NO: 28); mhumHER2-Q307K (SEQ ID NO: 25); prehumHER2-Q429R (SEQ ID NO: 29); mhumHER2-Q407R (SEQ ID NO: 26); prehumHER2-N438D (SEQ ID NO: 30); and mhumHER2-N416D (SEQ ID NO: 27). It will be understood that the disclosed amino acid sequences are exemplary, and that the present invention encompasses all immunologically equivalent sequences.
The antigenic peptides are provided as isolated polypeptides, and also as polypeptides encoded as nucleic acid sequences in gene constructs. Each gene construct additionally includes at least one promoter operatively linked to the nucleic acid sequence, with the promoter inducing the expression of the encoded antigenic polypeptide in a living cell.
The encoded constructs, and exemplary nucleic acid sequences encoding them, include: prehumHER2-Q141K, SEQ ID NO: 21; mhumHER2-Q119K, SEQ ID NO: 15; prehumHER2-Q329K, SEQ ID NO: 34; mhumHER2-Q307K, SEQ ID NO: 231; prehumHER2-Q429R, SEQ ID NO: 35; mhumHER2-Q407R, SEQ ID NO: 32; prehumHER2-N438D, SEQ ID NO: 36; and mhumHER2-N416D, SEQ ID NO: 33. It will be understood that the recited nucleic acid sequences are only exemplary, and that each specified polypeptide can be encoded by one or more synonymous nucleic acid sequences without departing from the scope of the present invention. The nucleic acid sequences are preferably DNA sequences, but may alternatively comprise at least one RNA molecule.
In a related embodiment, the present invention provides the additional panel of HER2 antigen constructs in a vaccine composition for inducing immunity to HER2 in a mammalian subject, the vaccine composition including an effective amount of at least one of the gene constructs and an effective amount of an adjuvant. An exemplary use of these vaccine compositions is disclosed in Example 4.
In another related embodiment, the present invention includes monoclonal antibodies selective for each member of the additional panel of substituted human HER2 polypeptides. As previously stated, with the amino acid sequences disclosed herein, one skilled in the art can readily generate antibodies selective for each of the substituted HER2 polypeptides.
In order to respond to vaccines against self HER2, a host must possess an immune system sufficiently competent to overcome tolerance in response to vaccination. The immunodepression characteristic of mammary carcinomas and other cancers can prevent the success of even the most potent vaccine. In one embodiment, the present invention includes a diagnostic method for determining whether a host is capable of making a response to self HER2.
In the diagnostic method, a sufficient amount of vaccine known to break tolerance to the HER2 of host species is administered to a candidate host for anti-HER2 immunotherapy. A vaccine “known to induce immune response” is a vaccine which has been shown to produce a measurable benefit to at least a subset of similarly disposed mammalian hosts, for example in a clinical or preclinical trial. The vaccines include those that incorporate the substituted HER2 polypeptide antigens of the present invention, which are shown to induce immunity in Examples 3 and 4. After the vaccine has been administered, the subject is monitored for the development of cellular and/or humoral immunity to self HER2, for example by means of the immunoassays described in Example 3. If detectable immune response is detected, then the candidate host is recognized as being sufficiently immunocompetent to respond to immunotherapy directed at self HER2. Ideally, the diagnostic test represents a minimal, initial course of vaccination, with the results determining whether a more extensive course of vaccination will next be administered.
The invention is further described in detail in reference to the following examples, which are provided for the purpose of illustration only, and are not intended to be limiting. Thus, the present invention should in no way be construed as being limited to the following examples, but rather, be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Expression and Function of HER-2 in Feline Mammary Carcinoma Cell Lines and Explants.
Materials and Methods
Animals and Tissues
BALB/c mice were purchased from Charles River Laboratory. Pathogen free (SPF) purpose bred domestic shorthair cats aged 6 months-2 years were obtained from Liberty Research, Inc (Liberty, N.Y.). Animals were housed and maintained in the Department of Laboratory Animal Resource (DLAR) facility at the Wayne State University School of Medicine in accordance with Institutional Animal Care and Use Committee guidelines. The experimental cats were adopted as domestic pets by the care taker community after completion of the study. A black bear legally harvested in Ontario, Canada was the donor of the liver tissue.
Feline mammary carcinoma (FMC) samples were obtained from mastectomy tissues of two feline patients treated at Oakland Veterinary Referral Services (OVRS) in Michigan with consent from the cat owners (Table 1).
OVRS-1A and OVRS-1B are two independent primary tumors from the same cat. Three additional mammary tumor samples with paired, uninvolved stromal tissues were purchased from Colorado State University (CSU-133, 418, and 1646).
Cell Lines
K248 established from a pulmonary metastasis of a Siamese cat mammary carcinoma was provided by Dr. John Hilkens and the late Dr. Wim Misdorp at the Netherland Cancer Institute (Minke, et al., 2010). Mammary carcinoma line K12 from a 14 year old cat was established by Dr. William Hardy, Jr. and provided by Dr. Jaime Modiano of the University of Pennsylvania, PA (Modiano, et al., 1991). SKOV3 cells were purchased from the American Type Culture Collection. MCF7 cells were obtained from Lisa Polin of the Karmanos Cancer Institute. All cells were maintained in Dulbecco's Modified Eagle's Medium supplemented with fetal bovine sera, penicillin and streptomycin. The feline origin of K248 and K12 cells was authenticated by short tandem repeat (STR) analysis of four loci (
Immunohistochemical Analysis
Pathological diagnoses were performed according to the WHO classification for tumors in domestic animals. For feline HER2 detection, epitopes were retrieved with sodium citrate buffer (pH 6.0) and histological grade primary antibodies were applied according to manufacturer's recommendation (HER2, clone Z4881, Invitrogen) followed by broad-spectrum HRP polymer conjugate (SuperPicTure™ Polymer Detection Kit, Zymed) and DAB substrate (Pierce Biotech). Feline mammary tumor cells, K248, were injected subcutaneously in SCID mice. Tumor explants were used as controls.
Cell Proliferation Assay
Cells were plated at 2-5,000/well in 96-well plates and treated with gefitinib or lapatinib in quintuplicate for 48 h. Alamar Blue reagent (Life Technologies) was added and fluorescence measured after 3-4 h. The % proliferative activity was determined relative to the average of untreated samples.
Western Blot Analysis
Cells or tissues were lysed in a non-ionic detergent lysis buffer (Gibson, et al., 2013) with protease inhibitor cocktail (Roche Diagnostics) immediately after the addition of phosphatase inhibitors (NEB). Total protein was quantified by BCA assay (Pierce Biotech). Ten μg protein was boiled in Laemmli buffer, separated with 8% SDS-polyacrylamide (PAGE) gel and transferred onto PVDF membrane for overnight incubation with antibody to HER2 (42/c-erbB-2, BD Biosciences), phospho-HER2 Y1248 (polyclonal, Cell Signaling Technology), Akt (polyclonal, Cell Signaling Technology), phospho-Akt S473 (587F11, Cell Signaling Technology) or b-Actin (I-19, Santa Cruz Biotech). After washing in TBS-Tween, membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody before washing and development using enhanced chemiluminescent reagents (Thermo Scientific).
Flow Cytometric Analysis
HER2/neu epitopes were detected by moAb TA-1 (Calbiochem), Trastuzumab (Genentech), 7.16.4 (Calbiochem), N12, and N29 (hybridoma lines were generous gifts of Dr. Yosef Yarden, Weissman Institute, Isreal). moAb to human EGFR (528, Santa Cruz Biotech), HER3 (SGP1, eBioscience) and HLA-ABC (W6/32, eBioscience) were used as indicated. Phycoerythrin-conjugated goat anti-mouse or anti-human IgG was the secondary antibody (Jackson ImmunoResearch). Flow cytometric analysis was performed using FACS Canto II and data analyzed with FlowJo (Tree Star).
To measure antibody level in immune sera, mouse or feline sera were incubated with 3T3 cells transfected to express the designated antigen and detected by PE-conjugated anti-mouse or feline IgG secondary antibody (SantaCruz). Mouse antibody concentrations were extrapolated from a standard curve of HER2 moAb TA-1. Feline antibody titers were determined by serial dilution until binding was no longer detected above isotype control.
Results
In a step toward establishing an outbred cat model of HER2 immunity, the expression and signaling functions of HER2 in feline mammary carcinoma cell lines was characterized. These HER2 properties were also compared those of spontaneous feline mammary carcinomas and known HER2-expressing cell lines.
Expression of HER2 in Feline Mammary Carcinoma (FMC)
Expression of ERBB family receptor tyrosine kinase (RTK) in FMC was measured by flow cytometry. Surface expression of HER1 (EGFR), HER2, and HER3 was detected in K12 and K248 cells, using moAbs to their human homologs (
Receptor Tyrosine Kinase (RTK) Activity in FMC
Activation of RTK signaling in FMC was tested using a human RTK array (R&D Systems),
To further test if ERRB RTK signaling is required for FMC cell proliferation, FMC cell lines K12 and K248 were cultured with or without ERRB family tyrosine kinase inhibitors gefitinib or lapatinib. Both K12 and K248 exhibited dose-dependent inhibition of cell proliferation. SKOV3 and MCF7 cells were the positive and negative control, respectively (
The results show that the FMC cell lines are useful models for the induction and effects of anti-HER2 immune response.
Cloning and Characterization of Substituted Feline Her2, and Her2 of Other Species
Materials and Methods
DNA Cloning and Construction
Cloning primer sequences are shown in Table 2.
AGCCCTCCTAGGGCAGCCCCTGTAG
Feline HER2 (ERBB2) cDNA was cloned from cell line K248 (39), K12 (40), and the ovary of a domestic shorthair cat using a Protoscript kit (New England Biolabs) which showed identical sequences for all three sources. The confirmed full-length precursor feline ERBB2 (prefeHER2) cDNA sequence has been submitted to Genbank (# JN990983). For vaccination, a stop codon was introduced after codon 687 to delete the oncogenic intracellular domain, then subcloned into pVax1, giving pprefeHER2 which contains the signal peptide, extracellular and transmembrane domains of feline HER2 (
Black bear HER2 cDNA was similarly cloned from the liver tissue of a black bear. The cDNA sequence was submitted to Genbank (# JQ040508). DNA vaccine pprebearHER2 encoding the signal peptide, extracellular and transmembrane domains was constructed by PCR similar to pprefeHER2.
Results
Feline HER2 (ERBB2) cDNA cloned from K12, K248 and normal feline ovary showed identical sequences (GenBank Accession JN990983). The amino acid. translate of full-length feline HER2 shared 93% sequence identity with human HER2 (
The feline, black bear, human and rat HER2 (rat neu) extracellular and transmembrane regions (ECTM) were individually transfected into 3T3 cells. Epitope expression was compared by staining with moAbs to human HER2 (TA-1, N12, N29 and trastuzumab) or rat neu (7.16.4) (McKenzie, et al., 1989; Stancovski, et al., 1991; Hudziak, et al., 1989; Drebin, et al., 1984) (
Immunogenicity of Substituted and Heterologous her Antigenic Polypeptides
Materials and Methods
Generation of Recombinant Feline HER2 and Human Fc Fusion Protein-feHER2ecd-Fc
The secreted fusion protein feHER2ecd-hFc (SEQ ID NO: 69) was generated to serve as a stimulator for T cells in vitro. feHER2ecd-hFc was synthesized by fusing the 3′ end of the signal peptide-extracellular domain region of feHER2 (codons 1-653) to the hinge-CH2-CH3 region of human IGHG1. This codon 1-653 region of feHER2 (Genbank JN990983) was PCR amplified with forward primer 5′ CACCA AGCTT GAGAC CATGG AGCTG G (SEQ ID NO: 72) and reverse primer 5′-GATTT GGGCT CGGAC GTCAC AGGGC TGG (SEQ ID NO: 73), giving a 1986 bp product. IGHG1 cDNA (BC080557; Openbiosystems) was PCR amplified with primers 5′-CTGTG ACGTC CGAGC CCAAA TCTTG TGAC (SEQ ID NO: 74) and 5′-TCTAG ATTAT TTACC CGGAG ACAGG GAGAG GCTC (SEQ ID NO: 75), giving a 716 bp product consisting of codons 248-479. These two DNAs, which overlap by 22 bases, were fused by overlap extension-primed DNA synthesis giving 2676 bp product, which was then cloned into the HindIII and XbaI sites of the mammalian expression vector pVax1. The sequence coded by this feHER2ecd-hFc fusion cDNA, confirmed by DNA sequence analysis, is shown in
A schematic of feHER2ecd-hFc is shown in the upper panel of
Stimulation of T Cells In Vitro with Recombinant HER2ecd-Fc.
Feline PBMC were isolated by ficoll separation (GE Healthcare). Cells were plated at 2×105/well in round bottom 96-well plates and cultured with 10 μg/mL feHER2Fc (3T3 supernatant equivalent as described above), huHER2Fc, human IgG control or control 3T3 conditioned medium for 72 h. Total well contents were then transferred to feline IFNγ ELISPOT plates (R&D Systems) and incubated for an additional 48 h prior to enumeration.
Analysis of T Cell Response by ELISPOT
Mouse splenocytes or feline PBMC isolated by Ficoll separation (GE Healthcare) were maintained in Roswell Park Memorial Institute Medium supplemented with fetal bovine sera, penicillin/streptomycin. Feline PBMC were supplemented with 0.5 ng/mL feline IL-2 (R&D Systems). Cells were plated at 2×105/well in round bottom 96-well plates and cultured with 10 μg/mL feHER2Fc (3T3 supernatant equivalent as described above), huHER2Fc, human IgG control (Jackson Immunolabs) or control 3T3 conditioned medium for 48 (mouse) or 72 (feline) hours. Total well contents were then transferred to mouse or or feline (R&D Systems) IFNγ ELISPOT plates and incubated for an additional 48 hours prior to detection and enumeration as per manufacturer protocol. Visualized cytokine spots were enumerated using the ImmunoSpot analyzer (CTL, Shaker Heights, Ohio) and expressed as the number of cytokine-producing cells per 106 splenocytes or PBMC.
Feline GM-CSF
(CSF2) cDNA was amplified from a randomly-primed cDNA library (Protoscript kit from New England Biolabs) prepared from ConA-stimulated feline peripheral blood mononuclear cells (PBMC). Codons 1 through 67 were PCR amplified with forward primer 5′-ATGTG GCTGC AGAAC CTGCT TTTCC TG (SEQ ID NO: 80) and reverse primer 5′-CTCAG GGTCA AACAT TTCAG AGAC (SEQ ID NO: 81). Codons 60 through 145 were amplified with primers 5′-GTCTC TGAAA TGTTT GACCC TGAGG (SEQ ID NO: 82) and 5′-TTACT TCTGG TCTGG TCCCC AGCAG TC (SEQ ID NO: 83). These two PCR products with fused by overlap extension priming PCR, giving a 435 bp full-length CSF2 orf, which was cloned into expression vector pcDNA3.1 blunt Topo (Invitrogen). The orf sequence from a clone in the correct orientation was in accord with the consensus of feline CSF2 cDNAs in Genbank (AY878357, NM001009840, AF053007 and AF138140).
Electrovaccination of Mice and Cats
Mice were injected with an admix of 50 μg each of vaccine plasmid and plasmid encoding murine GM-CSF (pmuGM-CSF) in 50 μl PBS in the gastrocnemius muscle (Jacob, et al., 2006). Conductive gel was applied on the skin over the injection sites. Electroporation was conducted with NEPA21 electroporator (Napagene) using a tweezer electrode. Three 50 msec degenerating bipolar pulses of 100 V were administered at each site. Cats were injected with 1.5 mg each of HER2 vaccine plasmid and pfeGM-CSF in 1.5 mL PBS, divided equally over three injection sites in the biceps femoris or quadriceps. Two rounds of electroporation were applied to each site as described using a 1.5 cm2 caliper electrode (BTX).
Results
Note that in
Immunogenicity of Substituted and Heterologous Forms of HER2.
Recombinant prefeHER2-Q141K was expressed in 3T3 cells and characterized by flow cytometry (
The immunogenicity of prefeHER2 and prefeHER2-Q141K was initially characterized in BALB/c mice by electrovaccination with pprefeHER2, prefeHER2-Q141K, or control pprehuHER2 (encoding human HER2 ECTM), each of which were admixed with pmuGM-CSF encoding murine GM-CSF (Jacob, et al., 2010; Radkevich-Brown, et al., 2009; Jacob, et al., 2006; Jacob, et al., 2007) Antisera of vaccinated mice were tested for reactivity against 3T3 cells transfected with pprefeHER2 (“3T3/HER2”), pprefeHer2-Q141K (“3T3/HER2-K”), or control pprehuHER2 (“3T3/huHER2”). Expression of with pprefeHER2, pprefeHer2-Q141K, or control pprehuHER2. on individually transfected 3T3 cells was comparable, as verified with moAb TA-1 binding at 2 different concentrations (
After 2× immunization, mice produced 59±19, 49±13 and 39±20 μg/mL IgG to their cognate antigens, respectively, as measured with 3T3 cells transfected with individual test antigens (
To measure T cell response after vaccination, a feline HER2 extracellular domain (ECD) and human Ig Fc fusion protein, feHER2-Fc, was generated as the test antigen, as previously described and shown in
The results (
Anti-HER2 Vaccinations in the Feline Model System
The feasibility of DNA electrovaccination in cats was initially tested with ppreE2Neu encoding a fusion protein of human HER2 and rat neu. This construct was previously found to be effective at inducing both humoral and cellular immunity in HER2 Tg mice (Jacob, et al., 2010).
Three healthy purpose-bred, pathogen-free domestic shorthair cats 12-24 months of age (Liberty Research Inc. Liberty, N.Y.) were injected with ppreE2Neu and pfeGM-CSF in three legs in the biceps femoralis or quadriceps. Each injection site was subjected to 2 rounds of electroporation. Vaccination was administered 4× at 3 week intervals. Blood was collected through the jugular vein 2 weeks after each vaccination.
Humoral Response of Cats to ppreE2Neu
Antibodies to huHER2, rat neu, and feHER2 were quantitated by flow cytometric analysis of feline antibody binding to 3T3 cells transfected with prehuHER2, rat neu, or prefeHER2, as previously described.
Human HER2 binding IgG reached a titer of 1:400,000 in two of three cats and 1:100,000 in the third (
Vaccination with ppreE2Neu induced antibody that cross reacted with wild type feline HER2 as determined by binding to 3T3 cells expressing prefeHER2 (“3T3/feHER2” in
Humoral Responses of Cats to Vaccines Including Bear and Substituted Feline HER2
A panel of HER2 vaccines were tested in fifteen additional healthy cats between 5-8 months of age. Cats were electrovaccinated four times with pprefeHER2, pprefeHER2-K, pprebearHER2, ppreE2Neu, or an admixture of pprefeHER2-K and ppreE2Neu. Results are shown in
Consistent with the results shown previously in
Recognition of prefeHER2-Q141K by immune sera was measured by their binding to 3T3/prefeHER2-Q141K (
Antibodies binding to 3T3 cells expressing wild type prefeHER2 (“3T3/feHER2”) were detected at a dilution of between 1:1,600-1:3,200 of immune sera from pE2Neu, pfeHER2-K+pE2Neu, or pbearHER2 vaccinated cats (
Immune sera from mice immunized only with pprefeHER2 or pprefeHER2-K showed negligible antibody binding to 3T3/feHER2 (
These findings indicate that vaccines including feline HER2 with a Q to K mutation at position 141 is sufficiently foreign to break tolerance to normal self HER2 in the cat model. The findings also suggest that vaccines including feline HER2 with a Q to K mutation at position 141 induce antibodies specific for epitopes whose expression is related to some combination of HER2, HER1 and/or HER3, a combination that is exposed naturally on feline mammary carcinoma cells.
The findings also indicate that prebearHER2, when administered as a heterologous vaccination to cats, is sufficiently foreign from feline HER2 to break tolerance, but sufficiently similar to induce antibodies that cross react with feline HER2.
T Cell Responses of Cats to Substituted and Heterologous HER2 Vaccines
Cats were vaccinated with plasmids encoding prefeHER2-Q141K (“pfeHER2-K” in
IFN-γ T cell response to feHER2-Fc was measured to evaluate reactivity to self HER2. Of the 10 evaluated cats, three produced significant feHER2 specific T cell responses, with one cat each from the pfeHER2-K (˜100 SFU per million cells), pE2Neu (˜270 IFNγ spots) and pbearHER2 (˜280 IFNγ spots) groups (
Three bi-weekly booster vaccinations were given to five cats that received pfeHER2-K or pfeHER2-K+pE2Neu (
The cats tolerated the vaccination procedure without signs of pain or discomfort after they recovery from anesthesia. No adverse side effects were detected 6-12 months after the final vaccination and the cats continue to thrive.
Taken together, the experimental results disclosed in Example 3 validate a new vaccine design strategy of including a single residue substitution in a tumor self antigen. The results show that, in the feline mammary cancer test system, a feline HER2 antigenic polypeptide with a Q to K substitution at position 141 is sufficiently foreign to break tolerance, yet induces antibodies cross reactive with normal feline HER2, and with the HER2 molecules of humans and other species. Because the outbred cat system is a realistic system which reflects antigen and MHC diversity of natural human and animal populations, it is reasonably predictable that other species of HER2 including a Q to K substitution at position 141, or at an analogous position, will also be effective at immunizing against mammary carcinomas and other HER2 expressing cancers in other animal species, including humans.
The results of immunizations of cats with wild type bear HER2 validate the strategy of immunization of a host with HER2 that is heterologous, but relatively closely matched to self HER2. This indicates that bear HER2 is an effective antigen for the immunization and treatment of feline cancer hosts. Because of the similarity of bear, cat, and human HER2 (
Additional Antigenic Her2 Polypeptides Including Amino Acid Substitutions
To further test the hypothesis that minimally altered variants of self HER2 can break tolerance and induce immunity to self HER2, an additional panel of substituted HER2 was generated. All of the substituted forms were based on the precursor form of human HER2 (prehumHER2).
Materials and Methods
Generation of Substituted Variants of Human HER2.
Seven vaccine expression plasmids were constructed. Each encoded either a single point-mutated human precursor HER2 ECTM construct (pprehumHER2-Q141K, SEQ ID NO: 9; pprehumHER2-Q213K, SEQ ID NO: 84; pprehumHER2-Q239K, SEQ ID NO: 85; pprehumHER2-Q329K SEQ ID NO: 28; pprehumHER2-Q429R SEQ ID NO: 29; and pprehumHER2-N438D SEQ ID NO: 30); or a human precursor HER2 ECTM construct with 3 a.a. substitutions (pprehumHER2-NNT 124-126 DSG, SEQ ID NO: 85). The primer sequences for all constructs are listed in Table 3 below. For brevity, the constructs, and the polypeptides they encode, will be referred to in the following disclosure only by their substitutions, that is, respectively, Q141K, Q213K, Q239K, Q329K Q429R N438D, and NNT124DSG. In
TCCCGCAGGCCTCCTGGGGAGGC (SEQ ID NO: 88)
GAACTCTCTCCCCAGCAG (SEQ ID NO: 90)
CAGTCAGTGGGCAGTGGC (SEQ ID NO: 92)
tGTTGTGCAGGGGGCAGACGAG (SEQ ID NO: 94)
TCTGCTGTCACCTCTTGG (SEQ ID NO: 96)
AAGACGCTGAGGTCAGGC (SEQ ID NO: 98)
actgtcCAGCGGGTCTCCATTGTCTAGCAC (SEQ ID NO: 102)
AGCCCTCCTAGGGCAGCCCCTGTAG (SEQ ID NO: 104)
GGCTGCAGGGGGGCAGTG (SEQ ID NO: 106)
TCTGGCCACGCTGAGATG (SEQ ID NO: 108)
New England Biolab's Q5 Site-Directed Mutagenesis Kit was used with these primers to generate the variant vaccines, which were confirmed by DNA sequencing.
Stable HER2 expression of six gene constructs was confirmed in transiently transfected 3T3 cells by flow cytometry using anti-human HER2 moAbs Ab5 and N12 (
Electrovaccination of Mice and Cats
Mice were injected with an admix of 50 μg each of vaccine plasmid and plasmid encoding murine GM-CSF (pmuGM-CSF) in 50 μl PBS in the gastrocnemius muscle. Conductive gel was applied on the skin over the injection sites. Electroporation was conducted with NEPA21 electroporator (Napagene) using a tweezer electrode. Three 50 msec degenerating bipolar pulses of 100 V were administered at each site. Cats were injected with 1.5 mg each of HER2 vaccine plasmid and pfeGM-CSF in 1.5 mL PBS, divided equally over three injection sites in the biceps femoris or quadriceps. Two rounds of electroporation were applied to each site as described using a 1.5 cm2 caliper electrode (BTX).
Results
In Vivo Expression of Substituted HER2 Polypeptides and Immune Activation in Wild Type (WT) BALB/c Mice
The six verified constructs were advanced to vaccination tests as plasmid vaccines in wild type BALB/c mice. The plasmids pE2TM (prehumHER2) and pE2Neu (human HER2-rat neu hybrid ECTM) were employed as controls. There were 3 mice in each group. It was previously reported that pE2Neu induced significantly higher levels of anti-human HER2 Ab and T cell response in HER2 Tg mice than does pE2TM, showing the efficacy to overcome immune tolerance by incorporating heterologous neu sequence in ECD domains 3 and 4 (Jacob, et al., 2010). Because human HER2 with or without mutations are foreign proteins in WT mice, anti-HER2 antibody response is expected as long as the vaccine construct is expressed in vivo. Of the 6 mutants, five constructs except prehumHER2-Q239K induced anti-human HER2 Ab in at least one animal to show their successful expression in vivo and antibody induction after a single electrovaccination (
Wild type BALB/c mice were electro-vaccinated i.m. with 60 ug HER2 construct+60 ug pmGMCSF divided in two sites. Serum was collected 3 weeks after immunization and binding to Her2-expressing SKOV3 cells was assessed by flow cytometry.
Of the 6 substituted polypeptides, all induced anti-human HER2 Ab in at least one animal (
Immune Activation in Human HER2 Transgenic (Tg) Mice
The five positive mutant constructs identified in WT BALB/c mice were advanced to human HER2 transgenic (Tg) mice (in BALB/c background). Mice received electrovaccinations twice, 2 wks apart, and immune sera were collected 2 wks after the final vaccination. Binding of immune sera to 3T3 cells that express human HER2, but not other human ERBB members, showed induction of anti-human HER2 antibodies by all 5 test vaccines as well as by control pE2TM or pE2Neu (
The finer specificity of the immune sera was further tested with 5 human cancer cell lines. Breast cancer line SKBR3 and ovarian cancer line SKOV3 have amplified HER2 as shown by the binding to moAb Ab5, N12, N29 and Herceptin (
All test immune sera except those from mice immunized with prehumHER2-NNT124DSG (“124”) showed significant binding to the 5 human cancer cell lines (
It is proposed that an increased immune response to substituted HER2 vaccines is due to alteration of the amino acid charges or position of charges of HER2. The aa substitutions can be visualized by space-filling modeling (Protein Data Bank ID #2a91; www.rcsb.org/;) 3D view of “The crystal structure of a truncated ErbB2 ectodomain reveals an active conformation, poised to interact with other ErbB receptors” (Garrett, et al., 2003). Amino acid substitutions on the outer surface of HER2 3D structure would presumably be directly accessible to B-cell receptors, and predispose to anti-HER2 antibody production. In contrast, the Q329K substitution which also increases the charge is beneath the surface, but may still trigger subtle changes in antigenicity.
The results indicate that prehumHER2-Q141K prehumHER2-Q329K, prehumHER2-Q429R, and prehumHER2-N438D, are effective antigens for breaking tolerance to self human HER2, as determined in the transgenic human HER2 mouse model. The finding that prehumHER2-Q141K breaks tolerance to self human HER2 reinforces the previously disclosed finding from the cat system, that prefeHER2-Q141K breaks tolerance to self feline HER2 (Example 3). The concordance of these two findings supports the generalizability of results from the outbred cat model to human HER2 immunobiology.
In addition, as previously stated, it is predictable that the mature forms of these substituted antigenic polypeptides, mhumHER2-Q119K, mhumHER2-Q407K, mhumHER2-Q429R, and mhumHER2-N438D are also effective as tolerance-breaking antigens. The lack of a signal peptide is expected to have no effect on the reactivity of the Q-K substitution epitope, which is over a hundred residues distant, in the ECD. Even if not processed onto the surface of a host cell, the mature forms of HER2 are nonetheless be available to antigen presenting cells upon apoptosis or necrosis of the expressing cells. Exemplary amino acid sequences of these substituted HER2 antigens are: mhumHER2-Q119K, SEQ ID NO: 3; mhumHER2-Q407K, SEQ ID NO: 26; mhumHER2-Q429, SEQ ID NO: 29; and mhumHER2-N438D, SEQ ID NO: 30.
Finally, it is predictable that conservatively substituted variants of the substituted peptides of the present invention will also be effective antigens. For example, arginine can be substituted for lysine 141 in prehumHER2-Q141K and lysine 329 in prehumHER2-Q329K; lysine can be substituted for arginine 429 in prehumHER2-Q429R, and glutamic acid can be substituted for aspartic acid 438 prehumHER2-N438D.
The invention has been described in an illustrative manner, and it is to be understood that the terminology that has been used is intended to be in the nature of words of description rather than of limitation.
Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the appended claims, the invention can be practiced otherwise than as specifically described.
This invention was made with government support under grant no. CA076340 awarded by the National Institutes of Health and grant no. W81XWH-11-1-0050 awarded by the US ARMY/Medical Research and Materiel Command. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61942071 | Feb 2014 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 15120621 | Aug 2016 | US |
| Child | 16594436 | US |
