Patent Application
20100267012
The present application is being filed along with duplicate copies of a CD-ROM marked “Copy 1” and “Copy 2” containing a Sequence Listing in electronic format. The duplicate copies of the CD-ROM each contain a file entitled GENOM.048NPCCP1.TXT created on Sep. 14, 2006 and is 1,929,380 bytes in size. The information on these duplicate CD-ROMs is incorporated herein by reference in its entirety.
Microorganisms are classically identified by their ability to utilize different substrates as a source of carbon and nitrogen through the use of biochemical tests such as the API20E™ system (bioMérieux). For susceptibility testing, clinical microbiology laboratories use methods including disk diffusion, agar dilution and broth microdilution. Although identifications based on biochemical tests and antibacterial susceptibility tests are cost-effective, generally two days are required to obtain preliminary results due to the necessity of two successive overnight incubations to identify the bacteria from clinical specimens as well as to determine their susceptibility to antimicrobial agents. There are some commercially available automated systems (i.e. the MicroScan™ system from Dade Behring and the Vitek™ system from bioMérieux) which use sophisticated and expensive apparatus for faster microbial identification and susceptibility testing (Stager and Davis, 1992, Clin. Microbiol. Rev. 5:302-327). These systems require shorter incubation periods, thereby allowing most bacterial identifications and susceptibility testing to be performed in less than 6 hours. Nevertheless, these faster systems always require the primary isolation of the bacteria or fungi as a pure culture, a process which takes at least 18 hours for a pure culture or 2 days for a mixed culture. So, the shortest time from sample reception to identification of the pathogen is around 24 hours. Moreover, fungi other than yeasts are often difficult or very slow to grow from clinical specimens. Identification must rely on labor-intensive techniques such as direct microscopic examination of the specimens and by direct and/or indirect immunological assays. Cultivation of most parasites is impractical in the clinical laboratory. Hence, microscopic examination of the specimen, a few immunological tests and clinical symptoms are often the only methods used for an identification that frequently remains presumptive.
The fastest bacterial identification system, the autoSCAN-Walk-Away™ system (Dade Behring) identifies both gram-negative and gram-positive bacterial species from standardized inoculum in as little as 2 hours and gives susceptibility patterns to most antibiotics in 5 to 6 hours. However, this system has a particularly high percentage (i.e. 3.3 to 40.5%) of non-conclusive identifications with bacterial species other than Enterobacteriaceae (Croizé J., 1995, Lett. Infectiol. 10:109-113; York et al., 1992, J. Clin. Microbiol. 30:2903-2910). For Enterobacteriaceae, the percentage of non-conclusive identifications was 2.7 to 11.4%. The list of microorganisms identified by commercial systems based on classical identification methods is given in Table 15.
A wide variety of bacteria and fungi are routinely isolated and identified from clinical specimens in microbiology laboratories. Tables 1 and 2 give the incidence for the most commonly isolated bacterial and fungal pathogens from various types of clinical specimens. These pathogens are the main organisms associated with nosocomial and community-acquired human infections and are therefore considered the most clinically important.
Most clinical specimens received in clinical microbiology laboratories are urine and blood samples. At the microbiology laboratory of the Centre Hospitalier de l'Université Laval (CHUL), urine and blood account for approximately 55% and 30% of the specimens received, respectively (Table 3). The remaining 15% of clinical specimens comprise various biological fluids including sputum, pus, cerebrospinal fluid, synovial fluid, and others (Table 3). Infections of the urinary tract, the respiratory tract and the bloodstream are usually of bacterial etiology and require antimicrobial therapy. In fact, all clinical samples received in the clinical microbiology laboratory are tested routinely for the identification of bacteria and antibiotic susceptibility.
Conventional Pathogen Identification from Clinical Specimens
The search for pathogens in urine specimens is so preponderant in the routine microbiology laboratory that a myriad of tests have been developed. However, the gold standard remains the classical semi-quantitative plate culture method in which 1 μL of urine is streaked on agar plates and incubated for 18-24 hours. Colonies are then counted to determine the total number of colony forming units (CFU) per liter of urine. A bacterial urinary tract infection (UTI) is normally associated with a bacterial count of 107 CFU/L or more in urine. However, infections with less than 107 CFU/L in urine are possible, particularly in patients with a high incidence of diseases or those catheterized (Stark and Maki, 1984, N. Engl. J. Med. 311:560-564). Importantly, approximately 80% of urine specimens tested in clinical microbiology laboratories are considered negative (i.e. bacterial count of less than 107 CFU/L; Table 3). Urine specimens found positive by culture are further characterized using standard biochemical tests to identify the bacterial pathogen and are also tested for susceptibility to antibiotics. The biochemical and susceptibility testing normally require 18-24 hours of incubation.
Accurate and rapid urine screening methods for bacterial pathogens would allow a faster identification of negative specimens and a more efficient treatment and care management of patients. Several rapid identification methods (Uriscreen™, UTIscreen™, Flash Track™ DNA probes and others) have been compared to slower standard biochemical methods, which are based on culture of the bacterial pathogens. Although much faster, these rapid tests showed low sensitivities and poor specificities as well as a high number of false negative and false positive results (Koening et al., 1992, J. Clin. Microbiol. 30:342-345; Pezzlo et al., 1992, J. Clin. Microbiol. 30:640-684).
The Blood Specimens Received In The Microbiology Laboratory Are Always Submitted For Culture. Blood Culture Systems May Be Manual, Semi-Automated Or Completely Automated. The BACTEC™ System (From Becton Dickinson) And The Bactalert™ System (From Organon Teknika Corporation) Are The Two Most Widely Used Automated Blood Culture Systems. These Systems Incubate Blood Culture Bottles Under Optimal Conditions For Growth Of Most Bacteria. Bacterial Growth Is Monitored Continuously To Detect Early Positives By Using Highly Sensitive Bacterial Growth Detectors. Once Growth Is Detected, A Gram Stain Is Performed Directly From The Blood Culture And Then Used To Inoculate Nutrient Agar Plates. Subsequently, Bacterial Identification And Susceptibility Testing Are Carried Out From Isolated Bacterial Colonies With Automated Systems As Described Previously. Blood Culture Bottles Are Normally Reported As Negative If No Growth Is Detected After An Incubation Of 6 To 7 Days. Normally, The Vast Majority Of Blood Cultures Are Reported Negative. For Example, The Percentage Of Negative Blood Cultures At The Microbiology Laboratory Of The CHUL For The Period February 1994-January 1995 Was 93.1% (Table 3).
Upon receipt by the clinical microbiology laboratory, all body fluids other than blood and urine that are from normally sterile sites (i.e. cerebrospinal, synovial, pleural, pericardial and others) are processed for direct microscopic examination and subsequent culture. Again, most clinical samples are negative for culture (Table 3). In all these normally sterile sites, tests for the universal detection of algae, archaea, bacteria, fungi and parasites would be very useful.
Regarding clinical specimens which are not from sterile sites such as sputum or stool specimens, the laboratory diagnosis by culture is more problematic because of the contamination by the normal flora. The bacterial or fungal pathogens potentially associated with the infection are grown and separated from the colonizing microbes using selective methods and then identified as described previously. Of course, the DNA-based universal detection of bacteria would not be useful for the diagnosis of bacterial infections at these non-sterile sites. On the other hand, DNA-based assays for species or genus or family or group detection and identification as well as for the detection of antimicrobial agents resistance genes from these specimens would be very useful and would offer several advantages over classical identification and susceptibility testing methods.
DNA-Based Assays with any Specimen
There is an obvious need for rapid and accurate diagnostic tests for the detection and identification of algae, archaea, bacteria, fungi and parasites directly from clinical specimens. DNA-based technologies are rapid and accurate and offer a great potential to improve the diagnosis of infectious diseases (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Bergeron and Ouellette, 1995, Infection 23:69-72; Bergeron and Ouellette, 1998, J Clin Microbiol. 36:2169-72). The DNA probes and amplification primers which are objects of the present invention are applicable for the detection and identification of algae, archaea, bacteria, fungi, and parasites directly from any clinical specimen such as blood, urine, sputum, cerebrospinal fluid, pus, genital and gastro-intestinal tracts, skin or any other type of specimens (Table 3). These assays are also applicable to detection from microbial cultures (e.g. blood cultures, bacterial or fungal colonies on nutrient agar, or liquid cell cultures in nutrient broth). The DNA-based tests proposed in this invention are superior in terms of both rapidity and accuracy to standard biochemical methods currently used for routine diagnosis from any clinical specimens in microbiology laboratories. Since these tests can be performed in one hour or less, they provide the clinician with new diagnostic tools which should contribute to a better management of patients with infectious diseases. Specimens from sources other than humans (e.g. other primates, birds, plants, mammals, farm animals, livestock, food products, environment such as water or soil, and others) may also be tested with these assays.
Among all the clinical specimens received for routine diagnosis, approximately 80% of urine specimens and even more (around 95%) for other types of normally sterile clinical specimens are negative for the presence of bacterial pathogens (Table 3). It would also be desirable, in addition to identify bacteria at the species or genus or family or group level in a given specimen, to screen out the high proportion of negative clinical specimens with a DNA-based test detecting the presence of any bacterium (i.e. universal bacterial detection). As disclosed in the present invention, such a screening test may be based on DNA amplification by PCR of a highly conserved genetic target found in all bacteria. Specimens negative for bacteria would not be amplified by this assay. On the other hand, those that are positive for any bacterium would give a positive amplification signal. Similarly, highly conserved genes of fungi and parasites could serve not only to identify particular species or genus or family or group but also to detect the presence of any fungi or parasite in the specimen.
A rapid diagnostic test should have a significant impact on the management of infections. DNA probe and DNA amplification technologies offer several advantages over conventional methods for the identification of pathogens and antimicrobial agents resistance genes from clinical samples (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich and Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). There is no need for culture of the pathogens, hence the organisms can be detected directly from clinical samples, thereby reducing the time associated with the isolation and identification of pathogens. Furthermore, DNA-based assays are more accurate for microbial identification than currently used phenotypic identification systems which are based on biochemical tests and/or microscopic examination. Commercially available DNA-based technologies are currently used in clinical microbiology laboratories, mainly for the detection and identification of fastidious bacterial pathogens such as Mycobacterium tuberculosis, Chlamydia trachomatis, Neisseria gonorrhoeae as well as for the detection of a variety of viruses (Tang Y. and Persing D. H., Molecular detection and identification of microorganisms, In: P. Murray et al., 1999, Manual of Clinical Microbiology, ASM press, 7th edition, Washington D.C.). There are also other commercially available DNA-based assays which are used for culture confirmation assays.
Others have developed DNA-based tests for the detection and identification of bacterial pathogens which are objects of the present invention, for example: Staphylococcus sp. (U.S. Pat. No. 5,437,978), Neisseria sp. (U.S. Pat. No. 5,162,199 and European patent serial no. 0,337,896,131) and Listeria monocytogenes (U.S. Pat. Nos. 5,389,513 and 5,089,386). However, the diagnostic tests described in these patents are based either on rRNA genes or on genetic targets different from those described in the present invention. To our knowledge there are only four patents published by others mentioning the use of any of the four highly conserved gene targets described in the present invention for diagnostic purposes (PCT international publication number WO92/03455 and WO00/14274, European patent publication number 0 133 671 B1, and European patent publication number 0 133 288 A2). WO92/03455 is focused on the inhibition of Candida species for therapeutic purposes. It describes antisense oligonucleotide probes hybridizing to Candida messenger RNA. Two of the numerous mRNA proposed as targets are coding for translation elongation factor 1 (tef1) and the beta subunit of ATPase. DNA amplification or hybridization are not under the scope of their invention and although diagnostic use is briefly mentioned in the body of the application, no specific claim is made regarding diagnostics. WO00/14274 describes the use of bacterial recA gene for identification and speciation of bacteria of the Burkholderia cepacia complex. Specific claims are made on a method for obtaining nucleotide sequence information for the recA gene from the target bacteria and a following comparison with a standard library of nucleotide sequence information (claim 1), and on the use of PCR for amplification of the recA gene in a sample of interest (claims 4 to 7, and 13). However, the use of a discriminatory restriction enzyme in a RFLP procedure is essential to fulfill the speciation and WO00/14274 did not mention that multiple recA probes could be used simultaneously. Patent EP 0 133 288 A2 describes and claims the use of bacterial tuf (and fus) sequence for diagnostics based on hybridization of a tuf (or fus) probe with bacterial DNA. DNA amplification is not under the scope of EP 0 133 288 A2. Nowhere it is mentioned that multiple tuf (or fus) probes could be used simultaneously. No mention is made regarding speciation using tuf (or fus) DNA nucleic acids and/or sequences. The sensitivities of the tuf hybridizations reported are 1×106 bacteria or 1-100 ng of DNA. This is much less sensitive than what is achieved by our assays using nucleic acid amplification technologies.
Although there are phenotypic identification methods which have been used for more than 125 years in clinical microbiology laboratories, these methods do not provide information fast enough to be useful in the initial management of patients. There is a need to increase the speed of the diagnosis of commonly encountered bacterial, fungal and parasitical infections. Besides being much faster, DNA-based diagnostic tests are more accurate than standard biochemical tests presently used for diagnosis because the microbial genotype (e.g. DNA level) is more stable than the phenotype (e.g. physiologic level).
Bacteria, fungi and parasites encompass numerous well-known microbial pathogens. Other microorganisms could also be pathogens or associated with human diseases. For example, achlorophylious algae of the Prototheca genus can infect humans. Archae, especially methanogens, are present in the gut flora of humans (Reeve, J. H., 1999, J. Bacteriol. 181:3613-3617). However, methanogens have been associated to pathologic manifestations in the colon, vagina, and mouth (Belay et al., 1988, Appl. Enviro. Microbiol. 54:600-603; Belay et al., 1990, J. Clin. Microbiol. 28:1666-1668; Weaver et al., 1986, Gut 27:698-704).
In addition to the identification of the infectious agent, it is often desirable to identify harmful toxins and/or to monitor the sensitivity of the microorganism to antimicrobial agents. As revealed in this invention, genetic identification of the microorganism could be performed simultaneously with toxin and antimicrobial agents resistance genes. Alternatively, assays to identify toxin and/or antimicrobial resistance genes can be performed separately and independently from assays for identification of infectious agents.
Knowledge of the genomic sequences of algal, archaeal, bacterial, fungal and parasitical species continuously increases as testified by the number of sequences available from public databases such as GenBank. From the sequences readily available from those public databases, there is no indication therefrom as to their potential for diagnostic purposes. For determining good candidates for diagnostic purposes, one could select sequences for DNA-based assays for (i) the species-specific detection and identification of commonly encountered bacterial, fungal and parasitical pathogens, (ii) the genus-specific detection and identification of commonly encountered bacterial, fungal or parasitical pathogens, (iii) the family-specific detection and identification of commonly encountered bacterial, fungal or parasitical pathogens; (iv) the group-specific detection and identification of commonly encountered bacterial, fungal or parasitical pathogens, (v) the universal detection of algal, archaeal, bacterial, fungal or parasitical pathogens, and/or (vi) the specific detection and identification of antimicrobial agents resistance genes, and/or (vii) the specific detection and identification of bacterial toxin genes. All of the above types of DNA-based assays may be performed directly from any type of clinical specimens or from a microbial culture.
In our assigned U.S. Pat. No. 6,001,564 and our WO98/20157 patent publication, we described DNA sequences suitable for (i) the species-specific detection and identification of clinically important bacterial pathogens, (ii) the universal detection of bacteria, and (iii) the detection of antimicrobial agents resistance genes.
The WO98/20157 patent publication describes proprietary tuf DNA sequences as well as tuf sequences selected from public databases (in both cases, fragments of at least 100 base pairs), as well as oligonucleotide probes and amplification primers derived from these sequences. All the nucleic acid sequences described in that patent publication can enter in the composition of diagnostic kits or products and methods capable of a) detecting the presence of bacteria and fungi b) detecting specifically at the species, genus, family or group levels, the presence of bacteria and fungi and antimicrobial agents resistance genes associated with these pathogens. However, these methods and kits need to be improved, since the ideal kit and method should be capable of diagnosing close to 100% of microbial pathogens and associated antimicrobial agents resistance genes and toxins genes. For example, infections caused by Enterococcus faecium have become a clinical problem because of its resistance to many antibiotics. Both the detection of these bacteria and the evaluation of their resistance profiles are desirable. Besides that, novel DNA sequences (probes and primers) capable of recognizing the same and other microbial pathogens or the same and additional antimicrobial agents resistance genes are also desirable to aim at detecting more target genes and complement our earlier patent applications.
The present invention improves the assigned application by disclosing new proprietary tuf nucleic acids and/or sequences as well as describing new ways to obtain tuf nucleic acids and/or sequences. In addition we disclose new proprietary atpD and recA nucleic acids and/or sequences. In addition, new uses of tuf, atpD and recA DNA nucleic acids and/or sequences selected from public databases (Table 11) are disclosed.
Highly conserved genes are useful for identification of microorganisms. For bacteria, the most studied genes for identification of microorganisms are the universally conserved ribosomal RNA genes (rRNA). Among those, the principal targets used for identification purposes are the small subunit (SSU) ribosomal 16S rRNA genes (in prokaryotes) and 18S rRNA genes (in eukaryotes) (Relman and Persing, Genotyping Methods for Microbial Identification, In: D. H. Persing, 1996, PCR Protocols for Emerging Infectious Diseases, ASM Press, Washington D.C.). The rRNA genes are also the most commonly used targets for universal detection of bacteria (Chen et al., 1988, FEMS Microbiol. Lett. 57:19-24; McCabe et al., 1999, Mol. Genet. Metabol. 66:205-211) and fungi (Van Burik et al., 1998, J. Clin. Microbiol. 36:1169-1175).
However, it may be difficult to discriminate between closely related species when using primers derived from the 16S rRNA. In some instances, 16S rRNA sequence identity may not be sufficient to guarantee species identity (Fox et al., 1992, Int. J. Syst. Bacteriol. 42:166-170) and it has been shown that inter-operon sequence variation as well as strain to strain variation could undermine the application of 16S rRNA for identification purposes (Clayton et al., 1995, Int. J. Syst. Bacteriol. 45:595-599). The heat shock proteins (HSP) are another family of very conserved proteins. These ubiquitous proteins in bacteria and eukaryotes are expressed in answer to external stress agents. One of the most described of these HSP is HSP 60. This protein is very conserved at the amino acid level, hence it has been useful for phylogenetic studies. Similar to 16S rRNA, it would be difficult to discriminate between species using the HSP 60 nucleotide sequences as a diagnostic tool. However, Goh et al. identified a highly conserved region flanking a variable region in HSP 60, which led to the design of universal primers amplifying this variable region (Goh et al., U.S. Pat. No. 5,708,160). The sequence variations in the resulting amplicons were found useful for the design of species-specific assays.
Disclosed herein are compositions and methods for the detection and quantitation of antibiotic resistant organisms from a sample.
Some embodiments relate to compositions for the detection of a vancomycin resistant pathogen in a sample using a nucleic acid amplification assay. The composition can include at least one primer pair, comprising a forward and a reverse oligonucleotide, wherein the forward and reverse oligonucleotides each includes a binding region that is complementary to primer binding sites present on opposite strands of the pathogen's DNA, wherein the primer pair is adapted to amplify a vanA or vanB gene of the pathogen's DNA between and including said primer binding sites to produce a detectable amplification product. The binding regions of the oligonucleotides can correspond to, or be fully complementary to, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of at least two of the following sequences: SEQ ID NO: 1090, SEQ ID NO: 1091, SEQ ID NO: 1095, SEQ ID NO: 2298 and SEQ ID NO: 1096.
In some embodiments, the composition includes a primer pair wherein the primers comprise, consist essentially of, or consist of at least 10 consecutive nucleotides of SEQ ID NO: 1095 and SEQ ID NO: 1096. Preferred compositions include a primer pair wherein the primers comprises, consists essentially of, or consist of the sequences of SEQ ID NO: 1095 and SEQ ID NO: 1096.
Preferably, the composition comprises at least four primers, wherein the each of the four primers comprises, consists essentially of, or consists of at least 10 consecutive nucleotides of SEQ ID NOs: 1090, 1091, 1096 and 2298, or the complements thereof. In other preferred embodiments, the four primers comprise, consist essentially of, or consist of the SEQ ID NO: 1090, 1091, 1096, and 2298.
In some embodiments, the composition can also include at least one internal hybridization probe, wherein the internal hybridization probe can hybridize under stringent condition to the vanA or vanB amplification products produced by the compositions described above. Preferably, the internal hybridization probe is a molecular beacon. In more preferred embodiments, the molecular beacon can include the sequence of SEQ ID NO: 2299 or SEQ ID NO: 2300.
In further embodiments, the compositions can also include at least one internal control DNA, which can be amplified to produce an internal control amplicon under the same conditions and using the same oligonucleotides of the compositions described above. In further embodiments, the compositions can include an internal control probe that can hybridize under stringent conditions to the internal control amplicon. In some embodiments, the internal control DNA comprises the sequence of SEQ ID NO: 2302. Preferably, the internal control probe is a molecular beacon. In some embodiments, the internal control probe includes at least 10 consecutive nucleotides of the sequence of SEQ ID NO: 2301.
Also provided herein are kits that include the compositions described herein.
Methods to detect the presence of vancomycin-resistant organisms in a sample are also provided. In some embodiments, the method can include the step of annealing the nucleic acids of the sample with at least one probe and/or primer, wherein each of the primers and/or probes include nucleic acid sequences that correspond to, or are fully complementary to, at least 10 consecutive nucleotides of at least two of the following sequences: SEQ ID NO: 1090, SEQ ID NO: 1091, SEQ ID NO: 1095 and SEQ ID NO: 1096. The presence and/or amount of primer or probe that is annealed to said sample nucleic acid can be detected. In some embodiments, the primers and/or probes can include the nucleic acid sequences of SEQ ID NO's 1090, 1091, 1096 and 2297, or the complements thereof.
Preferably, the primers and/or probes are placed in the same physical enclosure.
In some embodiments, wherein at least one pair of primers is annealed to the sample DNA, and wherein said primer pair include nucleic acid sequences that correspond to, or are fully complementary to, at least 10 consecutive nucleotides of SEQ ID NO: 1090 and 1091 or SEQ ID NO: 1095 and 1096, the methods also include a step of amplifying the sample DNA with the annealed primer pair(s). For example, in some embodiments, the amplification step can include a method selected from the group consisting of:
(a) polymerase chain reaction (PCR),
(b) ligase chain reaction,
(c) nucleic acid sequence-based amplification,
(d) self-sustained sequence replication,
(e) strand displacement amplification,
(f) branched DNA signal amplification,
(g) nested PCR, and
(h) multiplex PCR.
Preferably, the amplification step includes a PCR amplification step.
In some embodiments that include an amplification step, the sample can also be contacted with at least one probe that hybridizes to an amplification product produced from at least one of the primer pairs. In preferred embodiments, the probe includes at least 10 consecutive nucleotides of the sequence of SEQ ID NO: 2299 or 2300. For example, in some embodiments, the at least one probe includes the sequence of SEQ ID NO: 2299 or 2300.
It is an object of the present invention to provide a specific, ubiquitous and sensitive method using probes and/or amplification primers for determining the presence and/or amount of nucleic acids:
In a specific embodiment, a similar method directed to each specific microbial species or genus or family or group detection and identification, antimicrobial agents resistance genes detection, toxin genes detection, and universal bacterial detection, separately, is provided.
In a more specific embodiment, the method makes use of DNA fragments from conserved genes (proprietary sequences and sequences obtained from public databases), selected for their capacity to sensitively, specifically and ubiquitously detect the targeted algal, archaeal, bacterial, fungal or parasitical nucleic acids.
In a particularly preferred embodiment, oligonucleotides of at least 12 nucleotides in length have been derived from the longer DNA fragments, and are used in the present method as probes or amplification primers. To be a good diagnostic candidate, an oligonucleotide of at least 12 nucleotides should be capable of hybridizing with nucleic acids from given microorganism(s), and with substantially all strains and representatives of said microorganism(s); said oligonucleotide being species-, or genus-, or family-, or group-specific or universal.
In another particularly preferred embodiment, oligonucleotides primers and probes of at least 12 nucleotides in length are designed for their specificity and ubiquity based upon analysis of our databases of tuf, atpD and recA sequences. These databases are generated using both proprietary and public sequence information. Altogether, these databases form a sequence repertory useful for the design of primers and probes for the detection and identification of algal, archaeal, bacterial, fungal and parasitical microorganisms. The repertory can also be subdivided into subrepertories for sequence analysis leading to the design of various primers and probes.
The tuf, atpD and recA sequences databases as a product to assist the design of oligonucleotides primers and probes for the detection and identification of algal, archaeal, bacterial, fungal and parasitical microorganisms are also covered.
The proprietary oligonucleotides (probes and primers) are also another object of this invention.
Diagnostic kits comprising probes or amplification primers such as those for the detection of a microbial species or genus or family or phylum or group selected from the following list consisting of Abiotrophia adiacens, Acinetobacter baumanii, Actinomycetae, Bacteroides, Cytophaga and Flexibacter phylum, Bacteroides fragilis, Bordetella pertussis, Bordetella sp., Campylobacter jejuni and C. coli, Candida albicans, Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida tropicalis, Candida zeylanoides, Candida sp., Chlamydia pneumoniae, Chlamydia trachomatis, Clostridium sp., Corynebacterium sp., Crypococcus neoformans, Cryptococcus sp., Cryptosporidium parvum, Entamoeba sp., Enterobacteriaceae group, Enterococcus casseliflavus-flavescens-gallinarum group, Enterococcus faecalis, Enterococcus faecium, Enterococcus gallinarum, Enterococcus sp., Escherichia coli and Shigella sp. group, Gemella sp., Giardia sp., Haemophilus influenzae, Klebsiella pneumoniae, Legionella pneumophila, Legionella sp., Leishmania sp., Mycobacteriaceae family, Mycoplasma pneumoniae, Neisseria gonorrhoeae, platelets contaminants group (see Table 14), Pseudomonas aeruginosa, Pseudomonads group, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Staphylococcus sp., Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus sp., Trypanosoma brucei, Trypanosoma cruzi, Trypanosoma sp., Trypanosomatidae family, are also objects of the present invention.
Diagnostic kits further comprising probes or amplification primers for the detection of an antimicrobial agents resistance gene selected from the group listed in Table 5 are also objects of this invention.
Diagnostic kits further comprising probes or amplification primers for the detection of a toxin gene selected from the group listed in Table 6 are also objects of this invention.
Diagnostic kits further comprising probes or amplification primers for the detection of any other algal, archaeal, bacterial, fungal or parasitical species than those specifically listed herein, comprising or not comprising those for the detection of the specific microbial species or genus or family or group listed above, and further comprising or not comprising probes and primers for the antimicrobial agents resistance genes listed in Table 5, and further comprising or not comprising probes and primers for the toxin genes listed in Table 6 are also objects of this invention.
In a preferred embodiment, such a kit allows for the separate or the simultaneous detection and identification of the above-listed microbial species or genus or family or group; or universal detection of algae, archaea, bacteria, fungi or parasites; or antimicrobial agents resistance genes; or toxin genes; or for the detection of any microorganism (algae, archaea, bacteria, fungi or parasites).
In the above methods and kits, probes and primers are not limited to nucleic acids and may include, but are not restricted to analogs of nucleotides such as: inosine, 3-nitropyrrole nucleosides (Nichols et al., 1994, Nature 369:492-493), Linked Nucleic Acids (LNA) (Koskin et al., 1998, Tetrahedron 54:3607-3630), and Peptide Nucleic Acids (PNA) (Egholm et al., 1993, Nature 365:566-568).
In the above methods and kits, amplification reactions may include but are not restricted to: a) polymerase chain reaction (PCR), b) ligase chain reaction (LCR), c) nucleic acid sequence-based amplification (NASBA), d) self-sustained sequence replication (3SR), e) strand displacement amplification (SDA), f) branched DNA signal amplification (bDNA), g) transcription-mediated amplification (TMA), h) cycling probe technology (CPT), i) nested PCR, j) multiplex PCR, k) solid phase amplification (SPA), 1) nuclease dependent signal amplification (NDSA), m) rolling circle amplification technology (RCA), n) Anchored strand displacement amplification, o) Solid-phase (immobilized) rolling circle amplification.
In the above methods and kits, detection of the nucleic acids of target genes may include real-time or post-amplification technologies. These detection technologies can include, but are not limited to, fluorescence resonance energy transfer (FRET)-based methods such as adjacent hybridization to FRET probes (including probe-probe and probe-primer methods), TaqMan, Molecular Beacons, scorpions, nanoparticle probes and Sunrise (Amplifluor). Other detection methods include target genes nucleic acids detection via immunological methods, solid phase hybridization methods on filters, chips or any other solid support, whether the hybridization is monitored by fluorescence, chemiluminescence, potentiometry, mass spectrometry, plasmon resonance, polarimetry, colorimetry, or scanometry. Sequencing, including sequencing by dideoxy termination or sequencing by hybridization, e.g. sequencing using a DNA chip, is another possible method to detect and identify the nucleic acids of target genes.
In a preferred embodiment, a PCR protocol is used for nucleic acid amplification, in diagnostic method as well as in method of construction of a repertory of nucleic acids and deduced sequences.
In a particularly preferred embodiment, a PCR protocol is provided, comprising, an initial denaturation step of 1-3 minutes at 95° C., followed by an amplification cycle including a denaturation step of one second at 95° C. and an annealing step of 30 seconds at 45-65° C., without any time allowed specifically for the elongation step. This PCR protocol has been standardized to be suitable for PCR reactions with most selected primer pairs, which greatly facilitates the testing because each clinical sample can be tested with universal, species-specific, genus-specific, antimicrobial agents resistance gene and toxin gene PCR primers under uniform cycling conditions. Furthermore, various combinations of primer pairs may be used in multiplex PCR assays.
It is also an object of the present invention that tuf, atpD and recA sequences could serve as drug targets and these sequences and means to obtain them revealed in the present invention can assist the screening, design and modeling of these drugs.
It is also an object of the present invention that tuf, atpD and recA sequences could serve for vaccine purposes and these sequences and means to obtain them revealed in the present invention can assist the screening, design and modeling of these vaccines.
We aim at developing a universal DNA-based test or kit to screen out rapidly samples which are free of algal, archaeal, bacterial, fungal or parasitical cells. This test could be used alone or combined with more specific identification tests to detect and identify the above algal and/or archaeal and/or bacterial and/or fungal and/or parasitical species and/or genera and/or family and/or group and to determine rapidly the bacterial resistance to antibiotics and/or presence of bacterial toxins. Although the sequences from the selected antimicrobial agents resistance genes are available from public databases and have been used to develop DNA-based tests for their detection, our approach is unique because it represents a major improvement over current diagnostic methods based on bacterial cultures. Using an amplification method for the simultaneous or independent or sequential microbial detection-identification and antimicrobial resistance genes detection, there is no need for culturing the clinical sample prior to testing. Moreover, a modified PCR protocol has been developed to detect all target DNA sequences in approximately one hour under uniform amplification conditions. This procedure should save lives by optimizing treatment, should diminish antimicrobial agents resistance because less antibiotics will be prescribed, should reduce the use of broad spectrum antibiotics which are expensive, decrease overall health care costs by preventing or shortening hospitalizations, and side effects of drugs, and decrease the time and costs associated with clinical laboratory testing.
In another embodiment, sequence repertories and ways to obtain them for other gene targets are also an object of this invention, such is the case for the hexA nucleic acids and/or sequences of Streptococci.
In yet another embodiment, for the detection of mutations associated with antibiotic resistance genes, we built repertories to distinguish between point mutations reflecting only gene diversity and point mutations involved in resistance. Such repertories and ways to obtain them for pbp1a, pbp2b and pbp2x genes of sensitive and penicillin-resistant Streptococcus pneumoniae and also for gyrA and parC gene fragments from various bacterial species are also an object of the present invention.
The diagnostic kits, primers and probes mentioned above can be used to identify algae, archaea, bacteria, fungi, parasites, antimicrobial agents resistance genes and toxin genes on any type of sample, whether said diagnostic kits, primers and probes are used for in vitro or in situ applications. The said samples may include but are not limited to: any clinical sample, any environment sample, any microbial culture, any microbial colony, any tissue, and any cell line.
It is also an object of the present invention that said diagnostic kits, primers and probes can be used alone or in conjunction with any other assay suitable to identify microorganisms, including but not limited to: any immunoassay, any enzymatic assay, any biochemical assay, any lysotypic assay, any serological assay, any differential culture medium, any enrichment culture medium, any selective culture medium, any specific assay medium, any identification culture medium, any enumeration culture medium, any cellular stain, any culture on specific cell lines, and any infectivity assay on animals.
In the methods and kits described herein below, the oligonucleotide probes and amplification primers have been derived from larger sequences (i.e. DNA fragments of at least 100 base pairs). All DNA fragments have been obtained either from proprietary fragments or from public databases. DNA fragments selected from public databases are newly used in a method of detection according to the present invention, since they have been selected for their diagnostic potential.
In another embodiment, the amino acid sequences translated from the repertory of tuf, atpD and recA nucleic acids and/or sequences are also an object of the present invention.
It is clear to the individual skilled in the art that other oligonucleotide sequences appropriate for (i) the universal detection of algae, archaea, bacteria, fungi or parasites, (ii) the detection and identification of the above microbial species or genus or family or group, and (iii) the detection of antimicrobial agents resistance genes, and (iv) the detection of toxin genes, other than those listed in Annexes I to III, XXI to XXII, XXXII to XXXVII, XXXIX to XLI, and XLIII to LIV may also be derived from the proprietary fragments or selected public database sequences. For example, the oligonucleotide primers or probes may be shorter or longer than the ones chosen; they may also be selected anywhere else in the proprietary DNA fragments or in the sequences selected from public databases; they may be also variants of the same oligonucleotide. If the target DNA or a variant thereof hybridizes to a given oligonucleotide, or if the target DNA or a variant thereof can be amplified by a given oligonucleotide PCR primer pair, the converse is also true; a given target DNA may hybridize to a variant oligonucleotide probe or be amplified by a variant oligonucleotide PCR primer. Alternatively, the oligonucleotides may be designed from any DNA fragment sequences for use in amplification methods other than PCR. Consequently, the core of this invention is the identification of universal, species-specific, genus-specific, family-specific, group-specific, resistance gene-specific, toxin gene-specific genomic or non-genomic DNA fragments which are used as a source of specific and ubiquitous oligonucleotide probes and/or amplification primers. Although the selection and evaluation of oligonucleotides suitable for diagnostic purposes requires much effort, it is quite possible for the individual skilled in the art to derive, from the selected DNA fragments, oligonucleotides other than the ones listed in Annexes I to III, XXI to XXII, XXXII to XXXVII, XXXIX to XLI, and XLIII to LIV which are suitable for diagnostic purposes. When a proprietary fragment or a public databases sequence is selected for its specificity and ubiquity, it increases the probability that subsets thereof will also be specific and ubiquitous.
Since a high percentage of clinical specimens are negative for bacteria (Table 3), DNA fragments having a high potential for the selection of universal oligonucleotide probes or primers were selected from proprietary and public database sequences. The amplification primers were selected from genes highly conserved in algae, archaea, bacteria, fungi and parasites, and are used to detect the presence of any algal, archaeal, bacterial, fungal or parasitical pathogen in clinical specimens in order to determine rapidly whether it is positive or negative for algae, archaea, bacteria, fungi or parasites. The selected genes, designated tuf, fus, atpD and recA, encode respectively 2 proteins (elongation factors Tu and G) involved in the translational process during protein synthesis, a protein (beta subunit) responsible for the catalytic activity of proton pump ATPase and a protein responsible for the homologous recombination of genetic material. The alignments of tuf, atpD and recA sequences used to derive the universal primers include both proprietary and public database sequences. The universal primer strategy allows the rapid screening of the numerous negative clinical specimens (around 80% of the specimens received, see Table 3) submitted for microbiological testing.
Table 4 provides a list of the archaeal, bacterial, fungal and parasitical species for which tuf and/or atpD and/or recA nucleic acids and/or sequences are revealed in the present invention. Tables 5 and 6 provide a list of antimicrobial agents resistance genes and toxin genes selected for diagnostic purposes. Table 7 provides the origin of tuf, atpD and recA nucleic acids and/or sequences listed in the sequence listing. Tables 8-10 and 12-14 provide lists of species used to test the specificity, ubiquity and sensitivity of some assays described in the examples. Table 11 provides a list of microbial species for which tuf and/or atpD and/or recA sequences are available in public databases. Table 15 lists the microorganisms identified by commercial systems. Tables 16-18 are part of Example 42, whereas Tables 19-20 are part of Example 43. Tables 21-22 illustrate Example 44, whereas Tables 23-25 illustrate Example 45.
The present inventors reasoned that comparing the published Haemophilus influenzae and Mycoplasma genitalium genomes and searching for conserved genes could provide targets to develop useful diagnostic primers and probes. This sequence comparison is highly informative as these two bacteria are distantly related and most genes present in the minimal genome of M. genitalium are likely to be present in every bacterium. Therefore genes conserved between these two bacteria are likely to be conserved in all other bacteria.
Following the genomic comparison, it was found that several protein-coding genes were conserved in evolution. Highly conserved proteins included the translation elongation factors G (EF-G) and Tu (EF-Tu) and the β subunit of F0F1 type ATP-synthase, and to a lesser extent, the RecA recombinase. These four proteins coding genes were selected amongst the 20 most conserved genes on the basis that they all possess at least two highly conserved regions suitable for the design of universal amplification and sequencing primers. Moreover, within the fragment amplified by these primers, highly conserved and more variable regions are also present hence suggesting it might be possible to rapidly obtain sequence information from various microbial species to design universal as well as species-, genus-, family-, or group-specific primers and probes of potential use for the detection and identification and/or quantification of microorganisms.
Translation elongation factors are members of a family of GTP-binding proteins which intervene in the interactions of tRNA molecules with the ribosome machinery during essential steps of protein synthesis. The role of elongation factor Tu is to facilitate the binding of aminoacylated tRNA molecules to the A site of the ribosome. The eukaryotic, archaeal (archaebacterial) and algal homolog of EF-Tu is called elongation factor 1 alpha (EF-1α). All protein synthesis factors originated from a common ancestor via gene duplications and fusions (Cousineau et al., 1997, J. Mol. Evol. 45:661-670). In particular, elongation factor G (EF-G), although having a functional role in promoting the translocation of aminoacyl-tRNA molecules from the A site to the P site of the ribosome, shares sequence homologies with EF-Tu and is thought to have arisen from the duplication and fusion of an ancestor of the EF-Tu gene.
In addition, EF-Tu is known to be the target for antibiotics belonging to the elfamycin's group as well as to other structural classes (Anborgh and Parmeggiani, 1991, EMBO J. 10:779-784; Luiten et al., 1992, European patent application serial No. EP 0 466 251 A1). EF-G for its part, is the target of the antibiotic fusidic acid. In addition to its crucial activities in translation, EF-Tu has chaperone-like functions in protein folding, protection against heat denaturation of proteins and interactions with unfolded proteins (Caldas et al., 1998, J. Biol. Chem 273:11478-11482). Interestingly, a form of the EF-Tu protein has been identified as a dominant component of the periplasm of Neisseria gonorrhoeae (Porcella et al., 1996, Microbiology 142:2481-2489), hence suggesting that at least in some bacterial species, EF-Tu might be an antigen with vaccine potential.
F0F1 type ATP-synthase belongs to a superfamily of proton-translocating ATPases divided in three major families: P, V and F (Nelson and Taiz, 1989, TIBS 14:113-116). P-ATPases (or E1-E2 type) operate via a phosphorylated intermediate and are not evolutionarily related to the other two families. V-ATPases (or V0V1 type) are present on the vacuolar and other endomembranes of eukaryotes, on the plasma membrane of archaea (archaebacteria) and algae, and also on the plasma membrane of some eubacteria especially species belonging to the order Spirochaetales as well as to the Chlamydiaceae and Deinococcaceae families. F-ATPases (or F0F1 type) are found on the plasma membrane of most eubacteria, on the inner membrane of mitochondria and on the thylakoid membrane of chloroplasts. They function mainly in ATP synthesis. They are large multimeric enzymes sharing numerous structural and functional features with the V-ATPases. F and V-type ATPases have diverged from a common ancestor in an event preceding the appearance of eukaryotes. The β subunit of the F-ATPases is the catalytic subunit and it possesses low but significant sequence homologies with the catalytic A subunit of V-ATPases.
The translation elongation factors EF-Tu, EF-G and EF-1α and the catalytic subunit of F or V-types ATP-synthase, are highly conserved proteins sometimes used for phylogenetic analysis and their genes are also known to be highly conserved (Iwabe et al., 1989, Proc. Natl. Acad. Sci. USA 86:9355-9359, Gogarten et al., 1989, Proc. Natl. Acad. Sci. USA 86:6661-6665, Ludwig et al., 1993, Antonie van Leeuwenhoek 64:285-305).
A recent BLAST (Altschul et al., 1997, J. Mol. Biol. 215:403-410) search performed by the present inventors on the GenBank, European Molecular Biology Laboratory (EMBL), DNA Database of Japan (DDBJ) and specific genome project databases indicated that throughout bacteria, the EF-Tu and the β subunit of F0F1 type ATP-synthase genes may be more conserved than other genes that are well conserved between H. influenzae and M. genitalium.
The RecA recombinase is a multifunctional protein encoded by the recA gene. It plays a central role in homologous recombination, it is critical for the repair of DNA damage and it is involved in the regulation of the SOS system by promoting the proteolytic digestion of the LexA repressor. It is highly conserved in bacteria and could serve as a useful genetic marker to reconstruct bacterial phylogeny (Miller and Kokjohn, 1990, Annu. Rev. Microbiol. 44:365-394). Although RecA possesses some highly conserved sequence segments that we used to design universal primers aimed at sequencing the recA fragments, it is clearly not as well conserved EF-G, EF-Tu and (3 subunit of F0F1 type ATP-synthase. Hence, RecA may not be optimal for universal detection of bacteria with high sensitivity but it was chosen because preliminary data indicated that EF-G, EF-Tu and 1 subunit of F0F1 type ATP-synthase may sometimes be too closely related to find specific primer pairs that could discriminate between certain very closely related species and genera. While RecA, EF-G, EF-Tu and β subunit of F0F1 type ATP-synthase genes, possesses highly conserved regions suitable for the design of universal sequencing primers, the less conserved region between primers should be divergent enough to allow species-specific and genus-specific primers in those cases.
Thus, as targets to design primers and probes for the genetic detection of microorganisms, the present inventors have focused on the genes encoding these four proteins: tuf, the gene for elongation factor Tu (EF-Tu); fus, the gene for the elongation factor G (EF-G); atpD, the gene for β subunit of F0F1 type ATP-synthase; and recA, the gene encoding the RecA recombinase. In several bacterial genomes tuf is often found in two highly similar duplicated copies named tufA and tufB (Filer and Furano, 1981, J. Bacteriol. 148:1006-1011, Sela et al., 1989, J. Bacteriol. 171:581-584). In some particular cases, more divergent copies of the tuf genes can exist in some bacterial species such as some actinomycetes (Luiten et al. European patent application publication No. EP 0 446 251 A 1; Vijgenboom et al., 1994, Microbiology 140:983-998) and, as revealed as part of this invention, in several enterococcal species. In several bacterial species, tuf is organized in an operon with its homolog gene for the elongation factor G (EF-G) encoded by the fusA gene (
In the description of this invention, the terms <<nucleic acids>> and <<sequences>> might be used interchangeably. However, <<nucleic acids>> are chemical entities while <<sequences>> are the pieces of information derived from (inherent to) these <<nucleic acids>>. Both nucleic acids and sequences are equivalently valuable sources of information for the matter pertaining to this invention.
Analysis of multiple sequence alignments of tuf and atpD sequences permitted the design of oligonucleotide primers (and probes) capable of amplifying (or hybridizing to) segments of tuf (and/or fus) and atpD genes from a wide variety of bacterial species (see Examples 1 to 4, 24 and 26, and Table 7). Sequencing and amplification primer pairs for tuf nucleic acids and/or sequences are listed in Annex I and hybridization probes are listed in Annexes III and XLVII. Sequencing and amplification primer pairs for atpD nucleic acids and/or sequences are listed in Annex II. Analysis of the main subdivisions of tuf and atpD sequences (see
Similarly, analysis of multiple sequence alignments of recA sequences present in the public databases permitted the design of oligonucleotide primers capable of amplifying segments of recA genes from a wide variety of bacterial species. Sequencing and amplification primer pairs for recA sequences are listed in Annex XXI. The main subdivisions of recA nucleic acids and/or sequences comprise recA, radA, rad51 and dmc1. Further subdivisions could be done on the basis of the various phyla where these genes are encountered.
The present inventor's strategy is to get as much sequence data information from the four conserved genes (tuf, fus, atpD and recA). This ensemble of sequence data forming a repertory (with subrepertories corresponding to each target gene and their main sequence subdivisions) and then using the sequence information of the sequence repertory (or subrepertories) to design primer pairs that could permit either universal detection of algae or archaea or bacteria or fungi or parasites, detection of a family or group of microorganism (e.g. Enterobacteriaceae), detection of a genus (e.g. Streptococcus) or finally a specific species (e.g. Staphylococcus aureus). It should be noted that for the purpose of the present invention a group of microorganisms is defined depending on the needs of the particular diagnostic test. It does not need to respect a particular taxonomical grouping or phylum. See Example 12 where primers were designed to amplify a group a bacteria consisting of the 17 major bacterial species encountered as contaminants of platelet concentrates. Also remark that in that Example, the primers are not only able to sensitively and rapidly detect at least the 17 important bacterial species, but could also detect other species as well, as shown in Table 14. In these circumstances the primers shown in Example 12 are considered universal for platelet-contaminating bacteria. To develop an assay specific for the latter, one or more primers or probes specific to each species could be designed. Another example of primers and/or probes for group detection is given by the Pseudomonad group primers. These primers were designed based upon alignment of tuf sequences from real Pseudomonas species as well as from former Pseudomonas species such as Stenotrophomonas maltophilia. The resulting primers are able to amplify all Pseudomonas species tested as well as several species belonging to different genera, hence as being specific for a group including Pseudomonas and other species, we defined that group as Pseudomonads, as several members were former Pseudomonas.
For certain applications, it may be possible to develop a universal, group, family or genus-specific reaction and to proceed to species identification using sequence information within the amplicon to design species-specific internal probes or primers, or alternatively, to proceed directly by sequencing the amplicon. The various strategies will be discussed further below.
The ensembles formed by public and proprietary tuf, atpD and recA nucleic acids and/or sequences are used in a novel fashion so they constitute three databases containing useful information for the identification of microorganisms.
Sequence repertories of other gene targets were also built to solve some specific identification problems especially for microbial species genetically very similar to each other such as E. coli and Shigella (see Example 23). Based on tuf, atpD and recA sequences, Streptococcus pneumoniae is very difficult to differentiate from the closely related species S. oralis and S. mitis. Therefore, we elected to built a sequence repertory from hexA sequences (Example 19), a gene much more variable than our highly conserved tuf, atpD and recA nucleic acids and/or sequences.
For the detection of mutations associated with antibiotic resistance genes, we also built repertories to distinguish between point mutations reflecting only gene diversity and point mutations involved in resistance. This was done for pbp1a, pbp2b and pbp2x genes of penicillin-resistant and sensitive Streptococcus pneumoniae (Example 18) and also for gyrA and parC gene fragments of various bacterial species for which quinolone resistance is important to monitor.
The tuf, fus, atpD and recA DNA fragments sequenced by us and/or selected from public databases (GenBank and EMBL) were used to design oligonucleotides primers and probes for diagnostic purposes. Multiple sequence alignments were made using subsets of the tuf or atpD or recA sequences repertory. Subsets were chosen to encompass as much as possible of the targeted microorganism(s) DNA sequence data and also include sequence data from phylogenetically related microorganisms from which the targeted microorganism(s) should be distinguished. Regions suitable for primers and probes should be conserved for the targeted microorganism(s) and divergent for the microorganisms from which the targeted microorganism(s) should be distinguished. The large amount of tuf or atpD or recA sequences data in our repertory permits to reduce trial and errors in obtaining specific and ubiquitous primers and probes. We also relied on the corresponding peptide sequences of tuf, fus, atpD and recA nucleic acids and/or sequences to facilitate the identification of regions suitable for primers and probes design. As part of the design rules, all oligonucleotides (probes for hybridization and primers for DNA amplification by PCR) were evaluated for their suitability for hybridization or PCR amplification by computer analysis using standard programs (i.e. the Genetics Computer Group (GCG) programs and the primer analysis software Oligo™ 5.0). The potential suitability of the PCR primer pairs was also evaluated prior to the synthesis by verifying the absence of unwanted features such as long stretches of one nucleotide and a high proportion of G or C residues at the 3′ end (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.). Oligonucleotide probes and amplification primers were synthesized using an automated DNA synthesizer (Perkin-Elmer Corp., Applied Biosystems Division).
The oligonucleotide sequence of primers or probes may be derived from either strand of the duplex DNA. The primers or probes may consist of the bases A, G, C, or T or analogs and they may be degenerated at one or more chosen nucleotide position(s). The primers or probes may be of any suitable length and may be selected anywhere within the DNA sequences from proprietary fragments or from selected database sequences which are suitable for (i) the universal detection of algae or archaea or bacteria or fungi or parasites, (ii) the species-specific detection and identification of any microorganism, including but not limited to: Abiotrophia adiacens, Bacteroides fragilis, Bordetella pertussis, Candida albicans, Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida krusei, Candida lusitaniae, Candida parapsilosis, Candida tropicalis, Candida zeylanoides, Campylobacter jejuni and C. coli, Chlamydia pneumoniae, Chlamydia trachomatis, Cryptococcus neoformans, Cryptosporidium parvum, Enterococcus faecalis, Enterococcus faecium, Enterococcus gallinarum, Escherichia coli, Haemophilus influenzae, Legionella pneumophila, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Trypanosoma brucei, Trypanosoma cruzi, (iii) the genus-specific detection of Bordetella species, Candida species, Clostridium species, Corynebacterium species, Cryptococcus species, Entamoeba species, Enterococcus species, Gemella species, Giardia species, Legionella species, Leishmania species, Staphylococcus species, Streptococcus species, Trypanosoma species, (iv) the family-specific detection of Enterobacteriaceae family members, Mycobacteriaceae family members, Trypanosomatidae family members, (v) the detection of Enterococcus casseliflavus-flavescens-gallinarum group, Enterococcus, Gemella and Abiotrophia adiacens group, Pseudomonads extended group, Platelet-contaminating bacteria group, (vi) the detection of clinically important antimicrobial agents resistance genes listed in Table 5, (vii) the detection of clinically important toxin genes listed in Table 6.
Variants for a given target microbial gene are naturally occurring and are attributable to sequence variation within that gene during evolution (Watson et al., 1987, Molecular Biology of the Gene, 4th ed., The Benjamin/Cummings Publishing Company, Menlo Park, Calif.; Lewin, 1989, Genes IV, John Wiley & Sons, New York, N.Y.). For example, different strains of the same microbial species may have a single or more nucleotide variation(s) at the oligonucleotide hybridization site. The person skilled in the art is well aware of the existence of variant algal, archaeal, bacterial, fungal or parasitical DNA nucleic acids and/or sequences for a specific gene and that the frequency of sequence variations depends on the selective pressure during evolution on a given gene product. The detection of a variant sequence for a region between two PCR primers may be demonstrated by sequencing the amplification product. In order to show the presence of sequence variants at the primer hybridization site, one has to amplify a larger DNA target with PCR primers outside that hybridization site. Sequencing of this larger fragment will allow the detection of sequence variation at this site. A similar strategy may be applied to show variants at the hybridization site of a probe. Insofar as the divergence of the target nucleic acids and/or sequences or a part thereof does not affect the specificity and ubiquity of the amplification primers or probes, variant microbial DNA is under the scope of this invention. Variants of the selected primers or probes may also be used to amplify or hybridize to a variant DNA.
Sequencing of tuf Nucleic Acids and/or Sequences from a Variety of Archaeal, Bacterial, Fungal and Parasitical Species
The nucleotide sequence of a portion of tuf nucleic acids and/or sequences was determined for a variety of archaeal, bacterial, fungal and parasitical species. The amplification primers (SEQ ID NOs. 664 and 697), which amplify a tuf gene portion of approximately 890 bp, were used along with newly designed sequencing primer pairs (See Annex I for the sequencing primers for tuf nucleic acids and/or sequences). Most primer pairs can amplify different copies of tuf genes (tufA and tufB). This is not surprising since it is known that for several bacterial species these two genes are nearly identical. For example, the entire tufA and tufB genes from E. coli differ at only 13 nucleotide positions (Neidhardt et al., 1996, Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd ed., American Society for Microbiology Press, Washington, D.C.). Similarly, some fungi are known to have two nearly identical copies of tuf nucleic acids and/or sequences (EF-1□). These amplification primers are degenerated at several nucleotide positions and contain inosines in order to allow the amplification of a wide range of tuf nucleic acids and/or sequences. The strategy used to select these amplification primers is similar to that illustrated in Annex I for the selection of universal primers. The tuf sequencing primers even sometimes amplified highly divergent copies of tuf genes (tufC) as illustrated in the case of some enterococcal species (SEQ ID NOs.: 73, 75, 76, 614 to 618, 621 and 987 to 989). To prove this, we have determined the enterococcal tuf nucleic acids and/or sequences from PCR amplicons cloned into a plasmid vector. Using the sequence data from the cloned amplicons, we designed new sequencing primers specific to the divergent (tufC) copy of enterococci (SEQ ID NOs.: 658-659 and 661) and then sequenced directly the tufC amplicons. The amplification primers (SEQ ID NOs.: 543, 556, 557, 643-645, 660, 664, 694, 696 and 697) could be used to amplify the tuf nucleic acids and/or sequences from any bacterial species. The amplification primers (SEQ ID NOs.: 558, 559, 560, 653, 654, 655, 813, 815, 1974-1984, 1999-2003) could be used to amplify the tuf (EF-1 □ genes from any fungal and/or parasitical species. The amplification primers SEQ ID NOs. 1221-1228 could be used to amplify bacterial tuf nucleic acids and/or sequences of the EF-G subdivision (fusA) (
Most tuf fragments to be sequenced were amplified using the following amplification protocol: One μl of cell suspension (or of purified genomic DNA 0.1-100 ng/μl) was transferred directly to 19 μl of a PCR reaction mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 1 μM of each of the 2 primers, 200 μM of each of the four dNTPs, 0.5 unit of Taq DNA polymerase (Promega Corp., Madison, Wis.). PCR reactions were subjected to cycling using a PTC-200 thermal cycler (MJ Research Inc., Watertown, Mass.) as follows: 3 min at 94-96° C. followed by 30-45 cycles of 1 min at 95° C. for the denaturation step, 1 min at 50-55° C. for the annealing step and 1 min at 72° C. for the extension step. Subsequently, twenty microliters of the PCR-amplified mixture were resolved by electrophoresis in a 1.5% agarose gel. The amplicons were then visualized by staining with methylene blue (Flores et al., 1992, Biotechniques, 13:203-205). The size of the amplification products was estimated by comparison with a 100-bp molecular weight ladder. The band corresponding to the specific amplification product was excised from the agarose gel and purified using the QIAquick™ gel extraction kit (QIAGEN Inc., Chatsworth, Calif.). The gel-purified DNA fragment was then used directly in the sequencing protocol. Both strands of the tuf genes amplification product were sequenced by the dideoxynucleotide chain termination sequencing method by using an Applied Biosystems automated DNA sequencer (model 377) with their Big Dye™ Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, Calif.). The sequencing reactions were performed by using the same amplification primers and 10 ng/100 by of the gel-purified amplicon per reaction. For the sequencing of long amplicons such as those of eukaryotic tuf (EF-1 □ nucleic acids and/or sequences, we designed internal sequencing primers (SEQ ID NOs.: 654, 655 and 813) to be able to obtain sequence data on both strands for most of the fragment length. In order to ensure that the determined sequence did not contain errors attributable to the sequencing of PCR artefacts, we have sequenced two preparations of the gel-purified tuf amplification product originating from two independent PCR amplifications. For most target microbial species, the sequences determined for both amplicon preparations were identical. In case of discrepancies, amplicons from a third independent PCR amplification were sequenced. Furthermore, the sequences of both strands were 100% complementary thereby confirming the high accuracy of the determined sequence. The tuf nucleic acids and/or sequences determined using the above strategy are described in the Sequence Listing. Table 7 gives the originating microbial species and the source for each tuf sequence in the Sequence Listing.
The alignment of the tuf sequences determined by us or selected from databases revealed clearly that the length of the sequenced portion of the tuf genes is variable. There may be insertions or deletions of several amino acids. In addition, in several fungi introns were observed. Intron nucleic acids and/or sequences are part of tuf nucleic acids and/or sequences and could be useful in the design of species-specific primers and probes. This explains why the size of the sequenced tuf amplification products was variable from one fungal species to another. Consequently, the nucleotide positions indicated on top of each of Annexes IV to XX, XXIII to XXXI, XXXVIII and XLII do not correspond for sequences having insertions or deletions.
It should also be noted that the various tuf nucleic acids and/or sequences determined by us occasionally contain base ambiguities. These degenerated nucleotides correspond to sequence variations between tufA and tufB genes (or copies of the EF-G subdivision of tuf nucleic acids and/or sequences, or copies of EF-1 □ subdivision of tuf nucleic acids and/or sequences for fungi and parasites) because the amplification primers amplify both tuf genes. These nucleotide variations were not attributable to nucleotide misincorporations by the Taq DNA polymerase because the sequence of both strands was identical and also because the sequences determined with both preparations of the gel-purified tuf amplicons obtained from two independent PCR amplifications were identical.
The Selection of Amplification Primers from Tuf Nucleic Acids and/or Sequences
The tuf sequences determined by us or selected from public databases were used to select PCR primers for universal detection of bacteria, as well as for genus-specific, species-specific family-specific or group-specific detection and identification. The strategy used to select these PCR primers was based on the analysis of multiple sequence alignments of various tuf sequences. For more details about the selection of PCR primers from tuf sequences please refer to Examples 5, 7-14, 17, 22, 24, 28, 30-31, 33, 36, and 38-40, and to Annexes VI-IX, XI-XIX and XXV.
Sequencing of atpD and recA Nucleic Acids and/or Sequences from a Variety of Archaeal, Bacterial, Fungal and Parasitical Species
The method used to obtain atpD and recA nucleic acids and/or sequences is similar to that described above for tuf nucleic acids and/or sequences.
The Selection of Amplification Primers from atpD or recA Nucleic Acids and/or Sequences
The comparison of the nucleotide sequence for the atpD or recA genes from various archaeal, bacterial, fungal and parasitical species allowed the selection of PCR primers (refer to Examples 6, 13, 29, 34 and 37, and to Annexes IV, V, X, and XX).
For DNA amplification by the widely used PCR (polymerase chain reaction) method, primer pairs were derived from proprietary DNA fragments or from database sequences. Prior to synthesis, the potential primer pairs were analyzed by using the Oligo™ 5.0 software to verify that they were good candidates for PCR amplification.
During DNA amplification by PCR, two oligonucleotide primers binding respectively to each strand of the heat-denatured target DNA from the microbial genome are used to amplify exponentially in vitro the target DNA by successive thermal cycles allowing denaturation of the DNA, annealing of the primers and synthesis of new targets at each cycle (Persing et al, 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.).
Briefly, the PCR protocols were as follows: Treated clinical specimens or standardized bacterial or fungal or parasitical suspensions (see below) or purified genomic DNA from bacteria, fungi or parasites were amplified in a 20 μl PCR reaction mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 2.5 mM MgCl2, 0.4 μM of each primer, 200 μM of each of the four dNTPs and 0.5 unit of Taq DNA polymerase (Promega) combined with the TaqStart™ antibody (Clontech Laboratories Inc., Palo Alto, Calif.). The TaqStart™ antibody, which is a neutralizing monoclonal antibody to Taq DNA polymerase, was added to all PCR reactions to enhance the specificity and the sensitivity of the amplifications (Kellogg et al., 1994, Biotechniques 16:1134-1137). The treatment of the clinical specimens varies with the type of specimen tested, since the composition and the sensitivity level required are different for each specimen type. It consists in a rapid protocol to lyse the microbial cells and eliminate or neutralize PCR inhibitors. For amplification from bacterial or fungal or parasitical cultures or from purified genomic DNA, the samples were added directly to the PCR amplification mixture without any pre-treatment step. An internal control was derived from sequences not found in the target microorganisms or in the human genome. The internal control was integrated into all amplification reactions to verify the efficiency of the PCR assays and to ensure that significant PCR inhibition was absent. Alternatively, an internal control derived from rRNA was also useful to monitor the efficiency of microbial lysis protocols.
PCR reactions were then subjected to thermal cycling (3 min at 94-96° C. followed by 30 cycles of 1 second at 95° C. for the denaturation step and 30 seconds at 50-65° C. for the annealing-extension step) using a PTC-200 thermal cycler (MJ Research Inc.). The number of cycles performed for the PCR assays varies according to the sensitivity level required. For example, the sensitivity level required for microbial detection directly from clinical specimens is higher for blood specimens than for urine specimens because the concentration of microorganisms associated with a septicemia can be much lower than that associated with a urinary tract infection. Consequently, more sensitive PCR assays having more thermal cycles are probably required for direct detection from blood specimens. Similarly, PCR assays performed directly from bacterial or fungal or parasitical cultures may be less sensitive than PCR assays performed directly from clinical specimens because the number of target organisms is normally much lower in clinical specimens than in microbial cultures.
The person skilled in the art of DNA amplification knows the existence of other rapid amplification procedures such as ligase chain reaction (LCR), transcription-mediated amplification (TMA), self-sustained sequence replication (3SR), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), branched DNA (bDNA), cycling probe technology (CPT), solid phase amplification (SPA), rolling circle amplification technology (RCA), solid phase RCA, anchored SDA and nuclease dependent signal amplification (NDSA) (Lee et al., 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Eaton Publishing, Boston, Mass.; Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Westin et al., 2000, Nat. Biotechnol. 18:199-204). The scope of this invention is not limited to the use of amplification by PCR, but rather includes the use of any rapid nucleic acid amplification method or any other procedure which may be used to increase the sensitivity and/or the rapidity of nucleic acid-based diagnostic tests. The scope of the present invention also covers the use of any nucleic acids amplification and detection technology including real-time or post-amplification detection technologies, any amplification technology combined with detection, any hybridization nucleic acid chips or arrays technologies, any amplification chips or combination of amplification and hybridization chips technologies. Detection and identification by any sequencing method is also under the scope of the present invention.
Any oligonucleotide suitable for the amplification of nucleic acids by approaches other than PCR or for DNA hybridization which are derived from the species-specific, genus-specific and universal DNA fragments as well as from selected antimicrobial agents resistance or toxin gene sequences included in this document are also under the scope of this invention.
Classically, detection of amplification is performed by standard ethidium bromide-stained agarose gel electrophoresis. It is clear that other methods for the detection of specific amplification products, which may be faster and more practical for routine diagnosis, may be used. Such methods may be based on the detection of fluorescence after or during amplification. One simple method for monitoring amplified DNA is to measure its rate of formation by measuring the increase in fluorescence of intercalating agents such as ethidium bromide or SYBR® Green I (Molecular Probes). If more specific detection is required, fluorescence-based technologies can monitor the appearance of a specific product during the reaction. The use of dual-labeled fluorogenic probes such as in the TaqMan™ system (Applied Biosystems) which utilizes the 5′-3′ exonuclease activity of the Taq polymerase is a good example (Livak K. J. et al. 1995, PCR Methods Appl. 4:357-362). TaqMan™ can be performed during amplification and this “real-time” detection can be done in a single closed tube hence eliminating post-PCR sample handling and consequently preventing the risk of amplicon carryover. Several other fluorescence-based detection methods can be performed in real-time. Fluorescence resonance energy transfer (FRET) is the principle behind the use of adjacent hybridization probes (Wittwer, C. T. et al. 1997. BioTechniques 22:130-138), molecular beacons (Tyagi S. and Kramer F. R. 1996. Nature Biotechnology 14:303-308) and scorpions (Whitcomb et al. 1999. Nature Biotechnology 17:804-807). Adjacent hybridization probes are designed to be internal to the amplification primers. The 3′ end of one probe is labelled with a donor fluorophore while the 5′ end of an adjacent probe is labelled with an acceptor fluorophore. When the two probes are specifically hybridized in closed proximity (spaced by 1 to 5 nucleotides) the donor fluorophore which has been excited by an external light source emits light that is absorbed by a second acceptor that emit more fluorescence and yields a FRET signal. Molecular beacons possess a stem-and-loop structure where the loop is the probe and at the bottom of the stem a fluorescent moiety is at one end while a quenching moiety is at the other end. The beacons undergo a fluorogenic conformational change when they hybridize to their targets hence separating the fluorochrome from its quencher. The FRET principle is also used in an air thermal cycler with a built-in fluorometer (Wittwer, C. T. et al. 1997. BioTechniques 22:130-138). The amplification and detection are extremely rapid as reactions are performed in capillaries: it takes only 18 min to complete 45 cycles. Those techniques are suitable especially in the case where few pathogens are searched for. Boehringer-Roche Inc. sells the LightCycler™, and Cepheid makes the SmartCycler. These two apparatus are capable of rapid cycle PCR combined with fluorescent SYBR® Green I or FRET detection. We recently demonstrated in our laboratory, real-time detection of 10 CFU in less than 40 minutes using adjacent hybridization probes on the LightCycler™. Methods based on the detection of fluorescence are particularly promising for utilization in routine diagnosis as they are very rapid, quantitative and can be automated.
Microbial pathogens detection and identification may also be performed by solid support or liquid hybridization using species-specific internal DNA probes hybridizing to an amplification product. Such probes may be generated from any sequence from our repertory and designed to specifically hybridize to DNA amplification products which are objects of the present invention. Alternatively, the internal probes for species or genus or family or group detection and identification may be derived from the amplicons produced by a universal, family-, group-, genus- or species-specific amplification assay(s). The oligonucleotide probes may be labeled with biotin or with digoxigenin or with any other reporter molecule (for more details see below the section on hybrid capture). Hybridization on a solid support is amendable to miniaturization.
At present the oligonucleotide nucleic acid microarray technology is appealing. Currently, available low to medium density arrays (Heller et al., An integrated microelectronics hybridization system for genomic research and diagnostic applications. In: Harrison, D. J., and van den Berg, A., 1998, Micro total analysis systems '98, Kluwer Academic Publisher, Dordrecht.) could specifically capture fluorescent-labelled amplicons. Detection methods for hybridization are not limited to fluorescence; potentiometry, colorimetry and plasmon resonance are some examples of alternative detection methods. In addition to detection by hybridization, nucleic acid microarrays could be used to perform rapid sequencing by hybridization. Mass spectrometry could also be applicable for rapid identification of the amplicon or even for sequencing of the amplification products (Chiu and Cantor, 1999, Clinical Chemistry 45:1578; Berkenkamp et al., 1998, Science 281:260).
For the future of our assay format, we also consider the major challenge of molecular diagnostics tools, i.e.: integration of the major steps including sample preparation, genetic amplification, detection, data analysis and presentation (Anderson et al., Advances in integrated genetic analysis. In: Harrison, D. J., and van den Berg, A., 1998, Micro total analysis systems '98, Kluwer Academic Publisher, Dordrecht.).
To ensure PCR efficiency, glycerol, dimethyl sulfoxide (DMSO) or other related solvents can be used to increase the sensitivity of the PCR and to overcome problems associated with the amplification of a target DNA having a high GC content or forming strong secondary structures (Dieffenbach and Dveksler, 1995, PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Plainview, N.Y.). The concentration ranges for glycerol and DMSO are 5-15% (v/v) and 3-10% (v/v), respectively. For the PCR reaction mixture, the concentration ranges for the amplification primers and MgCl2 are 0.1-1.5 μM and 1.0-10.0 mM, respectively. Modifications of the standard PCR protocol using external and nested primers (i.e. nested PCR) or using more than one primer pair (i.e. multiplex PCR) may also be used (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.). For more details about the PCR protocols and amplicon detection methods, see Examples.
Hybridization and detection of amplicons by chemiluminescence were adapted from Nikiforov et al. (1994, PCR Methods and Applications 3:285-291 and 1995, Anal. Biochem. 227:201-209) and from the DIG™ system protocol of Boehringer Mannheim. Briefly, 0.50 μl of a 25 picomoles solution of capture probe diluted in EDC {1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) are immobilized in each well of 96-wells plates (Microlite™ 2, Dynex) by incubation overnight at room temperature. The next day, the plates are incubated with a solution of 1% BSA diluted into TNTw (10 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.05% Tween™. 20) for 1 hour at 37° C. The plates are then washed on a Wellwash Ascent™ (Labsystems) with TNTw followed by Washing Buffer (100 mM maleic acid pH7.5; 150 mM NaCl; 0.3% Tween™ 20).
The amplicons were labelled with DIG-11-dUTP during PCR using the PCR DIG Labelling Mix from Boehringer Mannheim according to the manufacturer's instructions. Hybridization of the amplicons to the capture probes is performed in triplicate at stringent temperature (generally, probes are designed to allow hybridization at 55° C., the stringent temperature) for 30 minutes in 1.5 M NaCl; 10 mM EDTA. It is followed by two washes in 2×SSC; 0.1% SDS, then by four washes in 0.1×SSC; 0.1% SDS at the stringent temperature (55° C.). Detection with 1,2 dioxetane chemiluminescent alkaline phosphatase substrates like CSPD® (Tropix Inc.) is performed according to the manufacturer's instructions but with shorter incubations times and a different antibody concentration. The plates are agitated at each step, the blocking incubation is performed for only 5 minutes, the anti-DIG-AP1 is used at a 1:1000 dilution, the incubation with antibody lasts 15 minutes, the plates are washed twice for only 5 minutes. Finally, after a 2 minutes incubation into the detection buffer, the plates are incubated 5 minutes with CSPD® at room temperature followed by a 10 minutes incubation at 37° C. without agitation. Luminous signal detection is performed on a Dynex Microtiter Plate Luminometer using RLU (Relative Light Units).
The specificity of oligonucleotide primers and probes was tested by amplification of DNA or by hybridization with bacterial or fungal or parasitical species selected from a panel comprising closely related species and species sharing the same anatomo-pathological site (see Annexes and Examples). All of the bacterial, fungal and parasitical species tested were likely to be pathogens associated with infections or potential contaminants which can be isolated from clinical specimens. Each target DNA could be released from microbial cells using standard chemical and/or physical treatments to lyse the cells (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) or alternatively, genomic DNA purified with the GNOME™ DNA kit (Bio101, Vista, Calif.) was used. Subsequently, the DNA was subjected to amplification with the primer pairs. Specific primers or probes amplified only the target microbial species, genus, family or group.
Oligonucleotides primers found to amplify specifically the target species, genus, family or group were subsequently tested for their ubiquity by amplification (i.e. ubiquitous primers amplified efficiently most or all isolates of the target species or genus or family or group). Finally, the sensitivity of the primers or probes was determined by using 10-fold or 2-fold dilutions of purified genomic DNA from the targeted microorganism. For most assays, sensitivity levels in the range of 1-100 copies were obtained. The specificity, ubiquity and sensitivity of the PCR assays using the selected amplification primer pairs were tested either directly from cultures of microbial species or from purified microbial genomic DNA.
Probes were tested in hybrid capture assays as described above. An oligonucleotide probe was considered specific only when it hybridized solely to DNA from the species or genus or family or group from which it was selected. Oligonucleotide probes found to be specific were subsequently tested for their ubiquity (i.e. ubiquitous probes detected efficiently most or all isolates of the target species or genus or family or group) by hybridization to microbial DNAs from different clinical isolates of the species or genus or family or group of interest including ATCC reference strains. Similarly, oligonucleotide primers and probes could be derived from antimicrobial agents resistance or toxin genes which are objects of the present invention.
The reference strains used to build proprietary tuf, atpD and recA sequence data subrepertories, as well as to test the amplification and hybridization assays were obtained from (i) the American Type Culture Collection (ATCC), (ii) the Laboratoire de santé publique du Québec (LSPQ), (iii) the Centers for Disease Control and Prevention (CDC), (iv) the National Culture Type Collection (NCTC) and (v) several other reference laboratories throughout the world. The identity of our reference strains was confirmed by phenotypic testing and reconfirmed by analysis of tuf, atpD and recA sequences (see Example 13).
Antimicrobial resistance complicates treatment and often leads to therapeutic failures. Furthermore, overuse of antibiotics inevitably leads to the emergence of microbial resistance. Our goal is to provide clinicians, in approximately one hour, the needed information to prescribe optimal treatments. Besides the rapid identification of negative clinical specimens with DNA-based tests for universal algal, archaeal, bacterial, fungal or parasitical detection and the identification of the presence of a specific pathogen in the positive specimens with species- and/or genus- and/or family- and/or group-specific DNA-based tests, clinicians also need timely information about the ability of the microbial pathogen to resist antibiotic treatments. We feel that the most efficient strategy to evaluate rapidly microbial resistance to antimicrobials is to detect directly from the clinical specimens the most common and clinically important antimicrobial agents resistance genes (i.e. DNA-based tests for the specific detection of antimicrobial agents resistance genes). Since the sequence from the most important and common antimicrobial agents resistance genes are available from public databases, our strategy is to use the sequence from a portion or from the entire resistance gene to design specific oligonucleotide primers or probes which will be used as a basis for the development of sensitive and rapid DNA-based tests. The list of each of the antimicrobial agents resistance genes selected on the basis of their clinical relevance (i.e. high incidence and importance) is given in Table 5; descriptions of the designed amplification primers and internal probes are given in Annexes XXXIV-XXXVII, XXXIX, XLV, and L-LI. Our approach is unique because the antimicrobial agents resistance genes detection and the microbial detection and identification can be performed simultaneously, or independently, or sequentially in multiplex or parallel or sequential assays under uniform PCR amplification conditions. These amplifications can also be done separately.
Toxin identification is often very important to prescribe optimal treatments. Besides the rapid identification of negative clinical specimens with DNA-based tests for universal bacterial detection and the identification of the presence of a specific pathogen in the positive specimens with species- and/or genus- and/or family- and/or group-specific DNA-based tests, clinicians sometimes need timely information about the ability of certain bacterial pathogens to produce toxins. Since the sequence from the most important and common bacterial toxin genes are available from public databases, our strategy is to use the sequence from a portion or from the entire toxin gene to design specific oligonucleotide primers or probes which will be used as a basis for the development of sensitive and rapid DNA-based tests. The list of each of the bacterial toxin genes selected on the basis of their clinical relevance (i.e. high incidence and importance) is given in Table 6; descriptions of the designed amplification primers and internal probes are given in Annexes XXII, XXXII and XXXIII. Our approach is unique because the toxin genes detection and the bacterial detection and identification can be performed simultaneously, or independently, or sequentially, in multiplex or parallel or sequential assays under uniform PCR amplification conditions. These amplifications can also be done separately.
In the routine microbiology laboratory, a high percentage of clinical specimens sent for bacterial identification are negative by culture. Testing clinical samples with universal amplification primers or universal probes to detect the presence of bacteria prior to specific identification and screening out the numerous negative specimens is thus useful as it reduces costs and may rapidly orient the clinical management of the patients. Several amplification primers and probes were therefore synthesized from highly conserved portions of bacterial sequences from the tuf, atpD and recA nucleic acids and/or sequences. The universal primers selection was based on a multiple sequence alignment constructed with sequences from our repertory.
All computer analysis of amino acid and nucleotide sequences were performed by using the GCG programs. Subsequently, optimal PCR primers for the universal amplification of bacteria were selected with the help of the Oligo™ program. The selected primers are degenerated at several nucleotide positions and contain several inosines in order to allow the amplification of all clinically relevant bacterial species. Inosine is a nucleotide analog able to specifically bind to any of the four nucleotides A, C, G or T. Degenerated oligonucleotides consist of an oligonucleotide mix having two or more of the four nucleotides A, C, G or T at the site of mismatches. The inclusion of inosine and/or of base ambiguities in the amplification primers allow mismatch tolerance thereby permitting the amplification of a wider array of target nucleotide sequences (Dieffenbach and Dveksler, 1995 PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
The amplification conditions with the universal primers are very similar to those used for the species- and genus-specific amplification assays except that the annealing temperature is slightly lower. The original universal PCR assay described in our assigned WO98/20157 (SEQ ID NOs. 23-24 of the latter application) was specific and nearly ubiquitous for the detection of bacteria. The specificity for bacteria was verified by amplifying genomic DNA isolated from the 12 fungal species as well as genomic DNA from Leishmania donovani, Saccharomyces cerevisiae and human lymphocytes. None of the above eukaryotic DNA preparations could be amplified by the universal assay, thereby suggesting that this test is specific for bacteria. The ubiquity of the universal assay was verified by amplifying genomic DNAs from 116 reference strains which represent 95 of the most clinically relevant bacterial species. These species have been selected from the bacterial species listed in Table 4. We found that at least 104 of these strains could be amplified. However, the assay could be improved since bacterial species which could not be amplified with the original tuf nucleic acids and/or sequences-based assay included species belonging to the following genera: Corynebacterium (11 species) and Stenotrophomonas (1 species). Sequencing of the tuf genes from these bacterial species and others has been performed in the scope of the present invention in order to improve the universal assay. This sequencing data has been used to select new universal primers which may be more ubiquitous and more sensitive. Also, we improved our primer and probes design strategy by taking into consideration the phylogeny observed in analysing our repertory of tuf, atpD and recA sequences. Data from each of the 3 main subrepertories (tuf, atpD and recA) was subjected to a basic phylogenic analysis using the Pileup command from version 10 of the GCG package (Genetics Computer Group, inc.). This analysis indicated the main branches or phyla reflecting the relationships between sequences. Instead of trying to design primers or probes able to hybridize to all phyla, we designed primers or probes able to hybridize to the main phyla while trying to use the largest phylum possible. This strategy should allow less degenerated primers hence improving sensitivity and by combining primers in a multiplex assay, improve ubiquity. Universal primers SEQ ID NOs. 643-645 based on tuf sequences have been designed to amplify most pathogenic bacteria except Actinomyceteae, Clostridiaceae and the Cytophaga, Flexibacter and Bacteroides phylum (pathogenic bacteria of this phylum include mostly Bacteroides, Porphyromonas and Prevotella species). Primers to fill these gaps have been designed for Actinomyceteae (SEQ ID NOs. 646-648), Clostridiaceae (SEQ ID NOs. 796-797, 808-811), and the Cytophaga, Flexibacter and Bacteroides phylum (SEQ ID NOs. 649-651), also derived from tuf nucleic acids and/or sequences. These primers sets could be used alone or in conjunction to render the universal assay more ubiquitous.
Universal primers derived from atpD sequences include SEQ ID NOs. 562-565. Combination of these primers does not amplify human DNA but should amplify almost all pathogenic bacterial species except proteobacteria belonging to the epsilon subdivision (Campylobacter and Helicobacter), the bacteria from the Cytophaga, Flexibacter and Bacteroides group and some actinomycetes and corynebacteria. By analysing atpD sequences from the latter species, primers and probes to specifically fill these gaps could be designed and used in conjunction with primers SEQ ID NOs. 562-565, also derived from atpD nucleic acids and/or sequences.
In addition, universality of the assay could be expanded by mixing atpD sequences-derived primers with tuf sequences-derived primers. Ultimately, even recA sequences-derived primers could be added to fill some gaps in the universal assay.
It is important to note that the 95 bacterial species selected to test the ubiquity of the universal assay include all of the most clinically relevant bacterial species associated with a variety of human infections acquired in the community or in hospitals (nosocomial infections). The most clinically important bacterial and fungal pathogens are listed in Tables 1 and 2.
Amino Acid Sequences Derived from tuf, atpD and recA Nucleic Acids and/or Sequences
The amino acid sequences translated from the repertory of tuf, atpD and recA nucleic acids and/or sequences are also an object of the present invention. The amino acid sequence data will be particularly useful for homology modeling of three-dimensional (3D) structure of the elongation factor Tu, elongation factor G, elongation factor 1α, ATPase subunit beta and RecA recombinase. For all these proteins, at least one structure model has been published using X-ray diffraction data from crystals. Based on those structural informations it is possible to use computer software to build 3D model structures for any other protein having peptide sequence homologies with the known structure (Greer, 1991, Methods in Enzymology, 202:239-252; Taylor, 1994, Trends Biotechnol., 12(5):154-158; Sali, 1995, Curr. Opin. Biotechnol. 6:437-451; Sanchez and Sali, 1997, Curr. Opin. Struct. Biol. 7:206-214; Fischer and Eisenberg, 1999, Curr. Opin. Struct. Biol. 9:208-211; Guex et al., 1999, Trends Biochem. Sci. 24: 364-367). Model structures of target proteins are used for the design or to predict the behavior of ligands and inhibitors such as antibiotics. Since EF-Tu and EF-G are already known as antibiotic targets (see above) and since the beta subunit of ATPase and RecA recombinase are essential to the survival of the microbial cells in natural conditions of infection, all four proteins could be considered antibiotic targets. Sequence data, especially the new data generated by us could be very useful to assist the creation of new antibiotic molecules with desired spectrum of activity. In addition, model structures could be used to improve protein function for commercial purposes such as improving antibiotic production by microbial strains or increasing biomass.
The following detailed embodiments and appended drawings are provided as illustrative examples of his invention, with no intention to limit the scope thereof.
For sake of clarity, here is a list of Examples and Annexes:
Example 1: Sequencing of bacterial atpD (F-type and V-type) gene fragments.
Example 2: Sequencing of eukaryotic atpD (F-type and V-type) gene fragments.
Example 3: Sequencing of eukaryotic tuf (EF-1) gene fragments.
Example 4: Sequencing of eukaryotic tuf (organelle origin, M) gene fragments.
Example 5: Specific detection and identification of Streptococcus agalactiae using tuf sequences.
Example 6: Specific detection and identification of Streptococcus agalactiae using atpD sequences.
Example 7: Development of a PCR assay for detection and identification of staphylococci at genus and species levels.
Example 8: Differentiating between the two closely related yeast species Candida albicans and Candida dubliniensis.
Example 9: Specific detection and identification of Entamoeba histolytica.
Example 10: Sensitive detection and identification of Chlamydia trachomatis.
Example 11: Genus-specific detection and identification of enterococci.
Example 12: Detection and identification of the major bacterial platelets contaminants using tuf sequences with a multiplex PCR test.
Example 13: The resolving power of the tuf and atpD sequences databases is comparable to the biochemical methods for bacterial identification.
Example 14: Detection of group B streptococci from clinical specimens.
Example 15: Simultaneous detection and identification of Streptococcus pyogenes and its pyrogenic exotoxin A.
Example 16: Real-time detection and identification of Shiga toxin-producing bacteria.
Example 17: Development of a PCR assay for the detection and identification of staphylococci at genus and species levels and its associated mecA gene.
Example 18: Sequencing of pbp1a, pbp2b and pbp2x genes of Streptococcus pneumoniae.
Example 19: Sequencing of hexA genes of Streptococcus species.
Example 20: Development of a multiplex PCR assay for the detection of Streptococcus pneumoniae and its penicillin resistance genes.
Example 21: Sequencing of the vancomycin resistance vanA, vanC1, vanC2 and vanC3 genes.
Example 22: Development of a PCR assay for the detection and identification of enterococci at genus and species levels and its associated resistance genes vanA and vanB.
Example 23: Development of a multiplex PCR assay for detection and identification of vancomycin-resistant Enterococcus faecalis, Enterococcus faecium, Enterococcus gallinarum, Enterococcus casseliflavus, and Enterococcus flavescens.
Example 24: Universal amplification involving the EF-G (fusA) subdivision of tuf sequences.
Example 25: DNA fragment isolation from Staphylococcus saprophyticus by arbitrarily primed PCR.
Example 26: Sequencing of prokaryotic tuf gene fragments.
Example 27: Sequencing of procaryotic recA gene fragments.
Example 28: Specific detection and identification of Escherichia coli/Shigella sp. using tuf sequences.
Example 29: Specific detection and identification of Klebsiella pneumoniae using atpD sequences.
Example 30: Specific detection and identification of Acinetobacter baumanii using tuf sequences.
Example 31: Specific detection and identification of Neisseria gonorrhoeae using tuf sequences.
Example 32: Sequencing of bacterial gyrA and parC gene fragments.
Example 33: Development of a PCR assay for the specific detection and identification of Staphylococcus aureus and its quinolone resistance genes gyrA and parC.
Example 34: Development of a PCR assay for the detection and identification of Klebsiella pneumoniae and its quinolone resistance genes gyrA and parC.
Example 35: Development of a PCR assay for the detection and identification of Streptococcus pneumoniae and its quinolone resistance genes gyrA and parC.
Example 36: Detection of extended-spectrum TEM-type β-lactamases in Escherichia coli.
Example 37: Detection of extended-spectrum SHV-type β-lactamases in Klebsiella pneumoniae.
Example 38: Development of a PCR assay for the detection and identification of Neisseria gonorrhoeae and its associated tetracycline resistance gene tetM.
Example 39: Development of a PCR assay for the detection and identification of Shigella sp. and their associated trimethoprim resistance gene dhfrIa.
Example 40: Development of a PCR assay for the detection and identification of Acinetobacter baumanii and its associated aminoglycoside resistance gene aph(3′)-VIa.
Example 41: Specific detection and identification of Bacteroides fragilis using atpD (V-type) sequences.
Example 42: Evidence for horizontal gene transfer in the evolution of the elongation factor Tu in Enterococci.
Example 43: Elongation factor Tu (tuf) and the F-ATPase beta-subunit (atpD) as phylogenetic tools for species of the family Enterobacteriaceae.
Example 44: Testing new pairs of PCR primers selected from two species-specific genomic DNA fragments which are objects of U.S. Pat. No. 6,001,564.
Example 45: Testing modified versions of PCR primers derived from the sequence of several primers which are objects of U.S. Pat. No. 6,001,564.
The various Annexes show the strategies used for the selection of a variety of DNA amplification primers, nucleic acid hybridization probes and molecular beacon internal probes:
As shown in these Annexes, the selected amplification primers may contain inosines and/or base ambiguities. Inosine is a nucleotide analog able to specifically bind to any of the four nucleotides A, C, G or T. Alternatively, degenerated oligonucleotides which consist of an oligonucleotide mix having two or more of the four nucleotides A, C, G or T at the site of mismatches were used. The inclusion of inosine and/or of degeneracies in the amplification primers allows mismatch tolerance thereby permitting the amplification of a wider array of target nucleotide sequences (Dieffenbach and Dveksler, 1995 PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
As shown in Annex IV, the comparison of publicly available atpD (F-type) sequences from a variety of bacterial species revealed conserved regions allowing the design of PCR primers able to amplify atpD sequences (F-type) from a wide range of bacterial species. Using primers pairs SEQ ID NOs. 566 and 567, 566 and 814, 568 and 567, 570 and 567, 572 and 567, 569 and 567, 571 and 567, 700 and 567, it was possible to amplify and sequence atpD sequences SEQ ID NOs. 242-270, 272-398, 673-674, 737-767, 866-867, 942-955, 1245-1254, 1256-1265, 1527, 1576, 1577, 1600-1604, 1640-1646, 1649, 1652, 1655, 1657, 1659-1660, 1671, 1844-1845, and 1849-1865.
Similarly, Annex V shows the strategy to design the PCR primers able to amplify atpD sequences of the V-type from a wide range of archaeal and bacterial species. Using primers SEQ ID NOs. 681-683, it was possible to amplify and sequence atpD sequences SEQ ID NOs. 827-832, 929-931, 958 and 966. As the gene was difficult to amplify for several species, additional amplification primers were designed inside the original amplicon (SEQ ID NOs. 1203-1207) in order to obtain sequence information for these species. Other primers (SEQ ID NO. 1212, 1213, 2282-2285) were also designed to amplify regions of the atpD gene (V-type) in archaebacteria.
The comparison of publicly available atpD (F-type) sequences from a variety of fungal and parasitical species revealed conserved regions allowing the design of PCR primers able to amplify atpD sequences from a wide range of fungal and parasitical species. Using primers pairs SEQ ID NOs. 568 and 573, 574 and 573, 574 and 708, and 566 and 567, it was possible to amplify and sequence atpD sequences SEQ ID NOs. 458-497, 530-538, 663, 667, 676, 678-680, 768-778, 856-862, 889-896, 941, 1638-1639, 1647, 1650-1651, 1653-1654, 1656, 1658, 1684, 1846-1848, and 2189-2192.
In the same manner, the primers described in Annex V (SEQ ID NOs. 681-683) could amplify the atpD (V-type) gene from various fungal and parasitical species. This strategy allowed to obtain SEQ ID NOs. 834-839, 956-957, and 959-965.
As shown in Annex VII, the comparison of publicly available tuf (EF-1) sequences from a variety of fungal and parasitical species revealed conserved regions allowing the design of PCR primers able to amplify tuf sequences from a wide range of fungal and parasitical species. Using primers pairs SEQ ID NOs. 558 and 559, 813 and 559, 558 and 815, 560 and 559, 653 and 559, 558 and 655, and 654 and 559, 1999 and 2000, 2001 and 2003, 2002 and 2003, it was possible to amplify and sequence tuf sequences SEQ ID NOs. 399-457, 509-529, 622-624, 677, 779-790, 840-842, 865, 897-903, 1266-1287, 1561-1571 and 1685.
As shown in Annex VI, the comparison of publicly available tuf (organelle origin, M) sequences from a variety of fungal and parasitical organelles revealed conserved regions allowing the design of PCR primers able to amplify tuf sequences of several organelles belonging to a wide range fungal and parasitical species. Using primers pairs SEQ ID NOs. 664 and 652, 664 and 561, 911 and 914, 912 and 914, 913 and 915, 916 and 561, 664 and 917, it was possible to amplify and sequence tuf sequences SEQ ID NOs. 498-508, 791-792, 843-855, 904-910, 1664, 1666-1667, 1669-1670, 1673-1683, 1686-1689, 1874-1876, 1879, 1956-1960, and 2193-2199.
As shown in Annex VIII, the comparison of tuf sequences from a variety of bacterial species allowed the selection of PCR primers specific for S. agalactiae. The strategy used to design the PCR primers was based on the analysis of a multiple sequence alignment of various tuf sequences. The multiple sequence alignment includes the tuf sequences of four bacterial strains from the target species as well as tuf sequences from other species and bacterial genera, especially representatives of closely related species. A careful analysis of this alignment allowed the selection of oligonucleotide sequences which are conserved within the target species but which discriminate sequences from other species and genera, especially from the closely related species, thereby permitting the species-specific, ubiquitous and sensitive detection and identification of the target bacterial species.
The chosen primer pair, oligos SEQ ID NO. 549 and SEQ ID NO. 550, gives an amplification product of 252 bp. Standard PCR was carried out using 0.4 μM of each primer, 2.5 mM MgCl2, BSA 0.05 mM, 1× Taq Buffer (Promega), dNTP 0.2 mM (Pharmacia), 0.5 U Taq DNA polymerase (Promega) coupled with TaqStart™ antibody (Clontech Laboratories Inc., Palo Alto), 1 μl of genomic DNA sample in a final volume of 20 μl using a PTC-200 thermocycler (MJ Research Inc.). The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 62° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide.
Specificity of the assay was tested by adding into the PCR reactions, 0.1 ng of genomic DNA from each of the bacterial species listed in Table 8. Efficient amplification was observed only for the 5 S. agalactiae strains listed. Of the other bacterial species, including 32 species representative of the vaginal flora and 27 other streptococcal species, only S. acidominimus yielded amplification. The signal with 0.1 ng of S. acidominimus genomic DNA was weak and the detection limit for this species was 10 pg (corresponding to more than 4000 genome copies) while the detection limit for S. agalactiae was 2.5 fg (corresponding to one genome copy) of genomic DNA.
To increase the specificity of the assay, internal probes were designed for FRET (Fluorescence Resonance Energy Transfer) detection using the LightCycler™ (Idaho Technology). As illustrated in Annex IX, a multiple sequence alignment of streptococcal tuf sequence fragments corresponding to the 252 by region amplified by primers SEQ ID NO. 549 and SEQ ID NO. 550, was used for the design of internal probes TSagHF436 (SEQ ID NO. 582) and TSagHF465 (SEQ ID NO. 583). The region of the amplicon selected for internal probes contained sequences unique and specific to S. agalactiae. SEQ ID NO. 583, the more specific probe, is labelled with fluorescein in 3′, while SEQ ID NO. 582, the less discriminant probe, is labelled with CY5 in 5′ and blocked in 3′ with a phosphate group. However, since the FRET signal is only emitted if both probes are adjacently hybridized on the same target amplicon, detection is highly specific.
Real-time detection of PCR products using the LightCycler™ was carried out using 0.4 μM of each primer (SEQ ID NO. 549-550), 0.2 μM of each probe (SEQ ID NO. 582-583), 2.5 mM MgCl2, BSA 450 μg/ml, 1×PC2 Buffer (AB Peptides, St-Louis, dNTP 0.2 mM (Pharmacia), 0.5 U KlenTaq1™ DNA polymerase (AB Peptides) coupled with TaqStart™ antibody (Clontech Laboratories Inc., Palo Alto), 0.7 μl of genomic DNA sample in a final volume of 7 μl using a LightCycler thermocycler (Idaho Technology). The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 94° C. for initial denaturation, then forty cycles of three steps consisting of 0 second (this setting meaning the LightCycler will reach the target temperature and stay at it for its minimal amount of time) at 94° C., 10 seconds at 64° C., 20 seconds at 72° C. Amplification was monitored during each annealing steps using the fluorescence ratio. The streptococcal species having close sequence homologies with the tuf sequence of S. agalactiae (S. acidominimus, S. anginosus, S. bovis, S. dysgalactiae, S. equi, S. ferus, S. gordonii, S. intermedius, S. parasanguis, S. parauberis, S. salivarius, S. sanguis, S. suis) as well as S. agalactiae were tested in the LightCycler with 0.07 ng of genomic DNA per reaction. Only S. agalactiae yielded an amplification signal, hence demonstrating that the assay is species-specific. With the LightCycler™ assay using the internal FRET probes, the detection limit for S. agalactiae was 1-2 genome copies of genomic DNA.
As shown in Annex X, the comparison of atpD sequences from a variety of bacterial species allowed the selection of PCR primers specific for S. agalactiae. The primer design strategy is similar to the strategy described in the preceding Example except that atpD sequences were used in the alignment.
Four primers were selected, ASag42 (SEQ ID NO. 627), ASag52 (SEQ ID NO. 628), ASag206 (SEQ ID NO. 625) and ASag371 (SEQ ID NO. 626). The following combinations of these four primers give four amplicons; SEQ ID NO. 627+SEQ ID NO. 625=190 bp, SEQ ID NO. 628+SEQ ID NO. 625=180 bp, SEQ ID NO. 627+SEQ ID NO. 626=355 bp, and SEQ ID NO. 628+SEQ ID NO. 626=345 bp.
Standard PCR was carried out on PTC-200 thermocyclers (MJ Research Inc) using 0.4 μM of each primers pair, 2.5 mM MgCl2, BSA 0.05 mM, 1× taq Buffer (Promega), dNTP 0.2 mM (Pharmacia), 0.5 U Taq DNA polymerase (Promega) coupled with TaqStart™ antibody (Clontech Laboratories Inc., Palo Alto), 1 μl of genomic DNA sample in a final volume of 20 μL. The optimal cycling conditions for maximum sensitivity and specificity were adjusted for each primer pair. Three minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at the optimal annealing temperature specified below were followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. Since atpD sequences are relatively more specific than tuf sequences, only the most closely related species namely, the streptococcal species listed in Table 9, were tested.
All four primer pairs only amplified the six S. agalactiae strains. With an annealing temperature of 63° C., the primer pair SEQ ID NO. 627+SEQ ID NO. 625 had a sensitivity of 1-5 fg (equivalent to 1-2 genome copies). At 55° C., the primer pair SEQ ID NO. 628+SEQ ID NO. 625 had a sensitivity of 2.5 fg (equivalent to 1 genome copy). At 60° C., the primer pair SEQ ID NO. 627+SEQ ID NO. 626 had a sensitivity of 10 fg (equivalent to 4 genome copies). At 58° C., the primer pair SEQ ID NO. 628+SEQ ID NO. 626 had a sensitivity of 2.5-5 fg (equivalent to 1-2 genome copies). This proves that all four primer pairs can detect S. agalactiae with high specificity and sensitivity. Together with Example 5, this example demonstrates that both tuf and atpD sequences are suitable and flexible targets for the identification of microorganisms at the species level. The fact that 4 different primer pairs based on atpD sequences led to efficient and specific amplification of S. agalactiae demonstrates that the challenge is to find target genes suitable for diagnostic purposes, rather than finding primer pairs from these target sequences.
Bacterial strains. The specificity of the PCR assay was verified by using a panel of ATCC (America Type Culture Collection) and DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH; German Collection of Microorganisms and Cell Cultures) reference strains consisting of 33 gram-negative and 47 gram-positive bacterial species (Table 12). In addition, 295 clinical isolates representing 11 different species of staphylococci from the microbiology laboratory of the Centre Hospitalier Universitaire de Québec, Pavillon Centre Hospitalier de l'Université Laval (CHUL) (Step-Foy, Québec, Canada) were also tested to further validate the Staphylococcus-specific PCR assay. These strains were all identified by using (i) conventional methods or (ii) the automated MicroScan Autoscan-4 system equipped with the Positive BP Combo Panel Type 6 (Dade Diagnostics, Mississauga, Ontario, Canada). Bacterial strains from frozen stocks kept at −80° C. in brain heart infusion (BHI) broth containing 10% glycerol were cultured on sheep blood agar or in BHI broth (Quelab Laboratories Inc, Montréal, Québec, Canada).
PCR primers and internal probes. Based on multiple sequence alignments, regions of the tuf gene unique to staphylococci were identified. Staphylococcus-specific PCR primers TStaG422 (SEQ ID NO. 553) and TStaG765 (SEQ ID NO. 575) were derived from these regions (Annex XII). These PCR primers are displaced by two nucleotide positions compared to original Staphylococcus-specific PCR primers described in our patent publication WO98/20157 (SEQ ID NOs. 17 and 20 in the said patent publication). These modifications were done to ensure specificity and ubiquity of the primer pair, in the light of new tuf sequence data revealed in the present patent application for several additional staphylococcal species and strains.
Similarly, sequence alignment analysis were performed to design genus and species-specific internal probes (see Annexes XIII to XVI). Two internal probes specific for Staphylococcus (SEQ ID NOs. 605-606), five specific for S. aureus (SEQ ID NOs. 584-588), five specific for S. epidermidis (SEQ ID NO. 589-593), two specific for S. haemolyticus (SEQ ID NOs. 594-595), three specific for S. hominis (SEQ ID NOs. 596-598), four specific for S. saprophyticus (SEQ ID NOs. 599-601 and 695), and two specific for coagulase-negative Staphylococcus species including S. epidermidis, S. hominis, S. saprophyticus, S. auricularis, S. capitis, S. haemolyticus, S. lugdunensis, S. simulans, S. cohnii and S. warneri (SEQ ID NOs. 1175-1176) were designed. The range of mismatches between the Staphylococcus-specific 371-bp amplicon and each of the 20-mer species-specific internal probes was from 1 to 5, in the middle of the probe when possible. No mismatches were present in the two Staphylococcus-specific probes for the 11 species analyzed: S. aureus, S. auricularis, S. capitis, S. cohnii, S. epidermidis, S. haemolyticus, S. hominis, S. lugdunensis, S. saprophyticus, S. simulans and S. warneri. In order to verify the intra-specific sequence conservation of the nucleotide sequence, sequences were obtained for the 371-bp amplicon from five unrelated ATCC and clinical strains for each of the species S. aureus, S. epidermidis, S. haemolyticus, S. hominis and S. saprophyticus. The Oligo™ (version 5.0) primer analysis software (National Biosciences, Plymouth, Minn.) was used to confirm the absence of self-complementary regions within and between the primers or probes. When required, the primers contained inosines or degenerated nucleotides at one or more variable positions. Oligonucleotide primers and probes were synthesized on a model 394 DNA synthesizer (Applied Biosystems, Mississauga, Ontario, Canada). Detection of the hybridization was performed with the DIG-labeled dUTP incorporated during amplification with the Staphylococcus-specific PCR assay, and the hybridization signal was detected with a luminometer (Dynex Technologies) as described above in the section on luminescent detection of amplification products. Annexes XIII to XVI illustrate the strategy for the selection of several internal probes.
PCR amplification. For all bacterial species, amplification was performed from purified genomic DNA or from a bacterial suspension whose turbidity was adjusted to that of a 0.5 McFarland standard, which corresponds to approximately 1.5×108 bacteria per ml. One nanogram of genomic DNA or 1 □l of the standardized bacterial suspension was transferred directly to a 19 □l PCR mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.2 □M (each) of the two Staphylococcus genus-specific primers (SEQ ID NOs. 553 and 575), 200 □M (each) of the four deoxynucleoside triphosphates (Pharmacia Biotech), 3.3 □g/□l bovine serum albumin (BSA) (Sigma-Aldrich Canada Ltd, Oakville, Ontario, Canada), and 0.5 U Taq polymerase (Promega) coupled with TaqStart™ Antibody (Clontech). The PCR amplification was performed as follows: 3 min. at 94° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 55° C., plus a terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. Visualization of the PCR products was made under UV at 254 nm.
For determination of the sensitivities of the PCR assays, two-fold dilutions of purified genomic DNA were used to determine the minimal number of genome copies which can be detected.
Amplifications with the Staphylococcus genus-specific PCR assay. The specificity of the assay was assessed by performing 30-cycle and 40-cycle PCR amplifications with the panel of gram-positive (47 species from 8 genera) and gram-negative (33 species from 22 genera) bacterial species listed in Table 12. The PCR assay was able to detect efficiently 27 of 27 staphylococcal species tested in both 30-cycle and 40-cycle regimens. For 30-cycle PCR, all bacterial species tested other than staphylococci were negative. For 40-cycle PCR, Enterococcus faecalis and Macrococcus caseolyticus were slightly positive for the Staphylococcus-specific PCR assay. The other species tested remained negative. Ubiquity tests performed on a collection of 295 clinical isolates provided by the microbiology laboratory of the Centre Hospitalier Universitaire de Québec, Pavillon Centre Hospitalier de l'Université Laval (CHUL), including Staphylococcus aureus (n=34), S. auricularis (n=2), S. capitis (n=19), S. cohnii (n=5), S. epidermidis (n=18), S. haemolyticus (n=21), S. hominis (n=73), S. lugdunensis (n=17), S. saprophyticus (n=6), S. simulans (n=3), S. warneri (n=32) and Staphylococcus sp. (n=65), showed a uniform amplification signal with the 30-cycle PCR assays and a perfect relation between the genotype and classical identification schemes.
The sensitivity of the Staphylococcus-specific assay with 30-cycle and 40-cycle PCR protocols was determined by using purified genomic DNA from the 11 staphylococcal species previously mentioned. For PCR with 30 cycles, a detection limit of 50 copies of genomic DNA was consistently obtained. In order to enhance the sensitivity of the assay, the number of cycles was increased. For 40-cycle PCR assays, the detection limit was lowered to a range of 5-10 genome copies, depending on the staphylococcal species tested.
Hybridization between the Staphylococcus-specific 371-bp amplicon and species-specific or genus-specific internal probes. Inter-species polymorphism was sufficient to generate species-specific internal probes for each of the principal species involved in human diseases (S. aureus, S. epidermidis, S. haemolyticus, S. hominis and S. saprophyticus). In order to verify the intra-species sequence conservation of the nucleotide sequence, sequence comparisons were performed on the 371-bp amplicon from five unrelated ATCC and clinical strains for each of the 5 principal staphylococcal species: S. aureus, S. epidermidis, S. haemolyticus, S. hominis and S. saprophyticus. Results showed a high level of conservation of nucleotide sequence between different unrelated strains from the same species. This sequence information allowed the development of staphylococcal species identification assays using species-specific internal probes hybridizing to the 371-bp amplicon. These assays are specific and ubiquitous for those five staphylococcal species. In addition to the species-specific internal probes, the genus-specific internals probes were able to recognize all or most Staphylococcus species tested.
It is often useful for the clinician to be able to differentiate between two very closely related species of microorganisms. Candida albicans is the most important cause of invasive human mycose. In recent years, a very closely related species, Candida dubliniensis, was isolated in immunosuppressed patients. These two species are difficult to distinguish by classic biochemical methods. This example demonstrates the use of tuf sequences to differentiate Candida albicans and Candida dubliniensis. PCR primers SEQ ID NOs. 11-12, from previous patent publication WO98/20157, were selected for their ability to specifically amplify a tuf (elongation factor 1 alpha type) fragment from both species (see Annex XI for primer positions). Within this tuf fragment, a region differentiating C. albicans and C. dubliniensis by two nucleotides was selected and used to design two internal probes (see Annex XI for probe design, SEQ ID NOs. 577 and 578) specific for each species. Amplification of genomic DNA from C. albicans and C. dubliniensis was carried out using DIG-11-dUTP as described above in the section on chemiluminescent detection of amplification products. Internal probes SEQ ID NOs. 577 and 578 were immobilized on the bottom of individual microtiter plates and hybridization was carried out as described above in the above section on chemiluminescent detection of amplification products. Luminometer data showed that the amplicon from C. albicans hybridized only to probe SEQ ID NO. 577 while the amplicon from C. dubliniensis hybridized only to probe SEQ ID NO. 578, thereby demonstrating that each probe was species-specific.
Upon analysis of tuf (elongation factor 1 alpha) sequence data, it was possible to find four regions where Entamoeba histolytica sequences remained conserved while other parasitical and eukaryotic species have diverged. Primers TEntG38 (SEQ ID NO. 703), TEntG442 (SEQ ID NO. 704), TEntG534 (SEQ ID NO. 705), and TEntG768 (SEQ ID NO. 706) were designed so that SEQ ID NO. 703 could be paired with the three other primers. On PTC-200 thermocyclers (MJ Research), the cycling conditions for initial sensitivity and specificity testing were 3 min. at 94° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 55° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. The three primer pairs could detect the equivalent of less than 200 E. histolytica genome copies. Specificity was tested using 0.5 ng of purified genomic DNA from a panel of microorganisms including Babesia bovis, Babesia microtti, Candida albicans, Crithidia fasciculata, Leishmania major, Leishmania hertigi and Neospora caninum. Only E. histolytica DNA could be amplified, thereby suggesting that the assay was species-specific.
Upon analysis of tuf sequence data, it was possible to find two regions where Chlamydia trachomatis sequences remained conserved while other species have diverged. Primers Ctr82 (SEQ ID NO. 554) and Ctr249 (SEQ ID NO. 555) were designed. With the PTC-200 thermocyclers (MJ Research), the optimal cycling conditions for maximum sensitivity and specificity were determined to be 3 min. at 94° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 60° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. The assay could detect the equivalent of 8 C. trachomatis genome copies. Specificity was tested with 0.1 ng of purified genomic DNA from a panel of microorganisms including 22 species commonly encountered in the vaginal flora (Bacillus subtilis, Bacteroides fragilis, Candida albicans, Clostridium difficile, Corynebacterium cervicis, Corynebacterium urealyticum, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Fusobacterium nucleatum, Gardnerella vaginalis, Haemophilus influenzae, Klebsiella oxytoca, Lactobacillus acidophilus, Peptococcus niger, Peptostreptococcus prevotii, Porphyromonas asaccharolytica, Prevotella melaminogenica, Propionibacterium acnes, Staphylococcus aureus, Streptococcus acidominimus, and Streptococcus agalactiae). Only C. trachomatis DNA could be amplified, thereby suggesting that the assay was species-specific.
Upon analysis of tuf sequence data and comparison with the repertory of tuf sequences, it was possible to find two regions where Enterococcus sequences remained conserved while other genera have diverged (Annex XVII). Primer pair Encg313dF and Encg599c (SEQ ID NOs. 1137 and 1136) was tested for its specificity by using purified genomic DNA from a panel of bacteria listed in Table 10. Using the PTC-200 thermocycler (MJ Research), the optimal cycling conditions for maximum sensitivity and specificity were determined to be 3 min. at 94° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 55° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. Visualization of the PCR products was made under UV at 254 nm. The 18 enterococcal species listed in Table 10 were all amplified efficiently. The only other species amplified were Abiotrophia adiacens, Gemella haemolysans and Gemella morbillorum, three gram-positive species. Sensitivity tested with several strains of E. casseliflavus, E. faecium, E. faecalis, E. flavescens and E. gallinarum and with one strain of each other Enterococcus species listed in Table 10 ranged from 1 to 10 copies of genomic DNA. The sequence variation within the 308-bp amplicon was sufficient so that internal probes could be used to speciate the amplicon and differentiate enterococci from Abiotrophia adiacens, Gemella haemolysans and Gemella morbillorum, thereby allowing to achieve excellent specificity. Species-specific internal probes were generated for each of the clinically important species, E. faecalis (SEQ ID NO. 1174), E. faecium (SEQ ID NO. 602), and the group including E. casseliflavus, E. flavescens and E. gallinarum (SEQ ID NO. 1122) (Annex XVIII). The species-specific internal probes were able to differentiate their respective Enterococcus species from all other Enterococcus species. These assays are sensitive, specific and ubiquitous for those five Enterococcus species.
Blood platelets preparations need to be monitored for bacterial contaminations. The tuf sequences of 17 important bacterial contaminants of platelets were aligned. As shown in Annex XIX, analysis of these sequences allowed the design of PCR primers. Since in the case of contamination of platelet concentrates, detecting all species (not just the more frequently encountered ones) is desirable, perfect specificity of primers was not an issue in the design. However, sensitivity is important. That is why, to avoid having to put too much degeneracy, only the most frequent contaminants were included in primer design, knowing that the selected primers would anyway be able to amplify more species than the 17 used in the design because they target highly conserved regions of tuf sequences. Oligonucleotide sequences which are conserved in these 17 major bacterial contaminants of platelet concentrates were chosen (oligos Tplaq 769 and Tplaq 991, respectively SEQ ID NOs. 636 and 637) thereby permitting the detection of these bacterial species. However, sensitivity was slightly deficient with staphylococci. To ensure maximal sensitivity in the detection of all the more frequent bacterial contaminants, a multiplex assay also including oligonucleotide primers targeting the Staphylococcus genera (oligos Stag 422, SEQ ID NO. 553; and Stag 765, SEQ ID NO. 575) was developed. The bacterial species detected with the assay are listed in Table 14.
The primer pairs, oligos SEQ ID NO. 636 and SEQ ID NO. 637 that give an amplification product of 245 pb, and oligos SEQ ID NO. 553 and SEQ ID NO. 575 that give an amplification product of 368 pb, were used simultaneously in the multiplex PCR assay. Detection of these PCR products was made on the LightCycler thermocycler (Idaho Technology) using SYBR® Green I (Molecular Probe Inc.). SYBR® Green I is a fluorescent dye that binds specifically to double-stranded DNA.
Fluorogenic detection of PCR products with the LightCycler was carried out using 1.0 μM of both Tplaq primers (SEQ ID NOs. 636-637) and 0.4 μM of both TStaG primers (SEQ ID NOs. 553 and 575), 2.5 mM MgCl2, BSA 7.5 μM, dNTP 0.2 mM (Pharmacia), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.5 U Taq DNA polymerase (Boerhinger Mannheim) coupled with TaqStart™ antibody (Clontech), and 0.07 ng of genomic DNA sample in a final volume of 7 μl. The optimal cycling conditions for maximum sensitivity and specificity were 1 minute at 94° C. for initial denaturation, then forty-five cycles of three steps consisting of 0 second at 95° C., 5 seconds at 60° C. and 9 seconds at 72° C. Amplification was monitored during each elongation cycle by measuring the level of SYBR® Green I. However, real analysis takes place after PCR. Melting curves are done for each sample and transformation of the melting peak allows determination of Tm. Thus primer-dimer and specific PCR product are discriminated. With this assay, all prominent bacterial contaminants of platelet concentrates listed in Annex XIX and Table 14 were detected. Sensitivity tests were performed on the 9 most frequent bacterial contaminants of platelets. The detection limit was less than 20 genome copies for E. cloacae, B. cereus, S. choleraesuis and S. marcescens; less than 15 genome copies for P. aeruginosa; and 2 to 3 copies were detected for S. aureus, S. epidermidis, E. coli and K. pneumoniae. Further refinements of assay conditions should increase sensitivity levels.
The present gold standard for bacterial identification is mainly based on key morphological traits and batteries of biochemical tests. Here we demonstrate that the use of tuf and atpD sequences combined with simple phylogenetic analysis of databases formed by these sequences is comparable to the gold standard. In the process of acquiring data for the tuf sequences, we sequenced the tuf gene of a strain that was given to us labelled as Staphylococcus hominis ATCC 35982. That tuf sequence (SEQ ID NO. 192) was incorporated into the tuf sequences database and subjected to a basic phylogenic analysis using the Pileup command from version 10 of the GCG package (Genetics Computer Group). This analysis indicated that SEQ ID NO. 192 is not associated with other S. hominis strains but rather with the S. warneri strains. The ATCC 35982 strain was sent to the reference laboratory of the Laboratoire de santé publique du Québec (LSPQ). They used the classic identification scheme for staphylococci (Kloos and Schleifer, 1975., J. Clin. Microbiol. 1:82-88). Their results shown that although the colonial morphology could correspond to S. hominis, the more precise biochemical assays did not. These assays included discriminant mannitol, mannose and ribose acidification tests as well as rapid and dense growth in deep thioglycolate agar. The LSPQ report identified strain ATCC 35982 as S. warneri which confirms our database analysis. The same thing happened for S. warneri (SEQ ID NO. 187) which had initially been identified as S. haemolyticus by a routine clinical laboratory using a low resolving power automated system (MicroScan, AutoScan-4™). Again, the tuf and LSPQ analysis agreed on its identification as S. warneri. In numerous other instances, in the course of acquiring tuf and atpD sequence data from various species and genera, analysis of our tuf and/or atpD sequence databases permitted the exact identification of mislabeled or erroneously identified strains. These results clearly demonstrate the usefulness and the high resolving power of our sequence-based identification assays using the tuf and atpD sequences databases.
Streptococcus agalactiae, the group B streptococcus (GBS), is responsible for a severe illness affecting neonate infants. The bacterium is passed from the healthy carrier mother to the baby during delivery. To prevent this infection, it is recommended to treat expectant mothers susceptible of carrying GBS in their vaginal/anal flora. Carrier status is often a transient condition and rigorous monitoring requires cultures and classic bacterial identification weeks before delivery. To improve the detection and identification of GBS we developed a rapid, specific and sensitive PCR test fast enough to be performed right at delivery.
GBS clinical specimens. A total of 66 duplicate vaginal/anal swabs were collected from 41 consenting pregnant women admitted for delivery at the Centre Hospitalier Universitaire de Québec, Pavillon Saint-Francois d'Assise following the CDC recommendations. The samples were obtained either before or after rupture of membranes. The swab samples were tested at the Centre de Recherche en Infectiologie de l'Université Laval within 24 hours of collection. Upon receipt, one swab was cut and then the tip of the swab was added to GNS selective broth for identification of group B streptococci (GBS) by the standard culture methods recommended by the CDC. The other swab was processed following the instruction of the IDI DNA extraction kit (Infectio Diagnotics (IDI) Inc.) prior to PCR amplification.
Oligonucleotides. PCR primers, Tsag340 (SEQ ID NO. 549) and Tsag552 (SEQ ID NO. 550) complementary to the regions of the tuf gene unique for GBS were designed based upon a multiple sequence alignment using our repertory of tuf sequences. Oligo primer analysis software (version 5.0) (National Biosciences) was used to analyse primers annealing temperature, secondary structure potential as well as mispriming and dimerization potential. The primers were synthesized using a model 391 DNA synthesizer (Applied Biosystems).
A pair of fluorescently labeled adjacent hybridization probes Sag465-F (SEQ ID NO. 583) and Sag436-C (SEQ ID NO. 582) were synthesized and purified by Operon Technologies. They were designed to meet the recommendations of the manufacturer (Idaho Technology) and based upon multiple sequence alignment analysis using our repertory of tuf sequences to be specific and ubiquitous for GBS. These adjacent probes, which are separated by one nucleotide, allow fluorescence resonance energy transfer (FRET), generating an increased fluorescence signal when both hybridized simultaneously to their target sequences. The probe SEQ ID NO. 583 was labeled with FITC in 3 prime while SEQ ID NO. 582 was labeled with Cy5 in 5 prime. The Cy5-labeled probes contained a 3′-blocking phosphate group to prevent extension of the probes during the PCR reactions.
PCR amplification. Conventional amplifications were performed either from 2 μl of a purified genomic DNA preparation or cell lysates of vaginal/anal specimens. The 20 μl PCR mixture contained 0.4 μM of each GBS-specific primer (SEQ ID NOs. 549-550), 200 μM of each deoxyribonucleotide (Pharmacia Biotech), 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100, 2.5 mM MgCl2, 3.3 mg/ml bovine serum albumin (BSA) (Sigma), and 0.5 U of Taq polymerase (Promega) combined with the TaqStart™ antibody (Clontech). The TaqStart™ antibody, which is a neutralizing monoclonal antibody of Taq DNA polymerase, was added to all PCR reactions to enhance the efficiency of the amplification. The PCR mixtures were subjected to thermal cycling (3 min at 95° C. and then 40 cycles of 1 s at 95° C., and 30 s at 62° C. with a 2-min final extension at 72° C.) with a PTC-200 DNA Engine thermocycler (MJ research). The PCR-amplified reaction mixture was resolved by agarose gel electrophoresis.
The LightCycler™ PCR amplifications were performed with 1 μl of a purified genomic DNA preparation or cell lysates of vaginal/anal specimens. The 10 μl amplification mixture consisted of 0.4 μM each GBS-specific primer (SEQ ID NOs. 549-550), 200 μM each dNTP, 0.2 μM each fluorescently labeled probe (SEQ ID NOs. 582-583), 300 μg/ml BSA (Sigma), and 1 μl of 10×PC2 buffer (containing 50 mM Tris-HCl (pH 9.1), 16 mM ammonium sulfate, 3.5 mM Mg2+, and 150 μg/ml BSA) and 0.5 U KlenTaq1™ (AB Peptides) coupled with TaqStart™ antibody (Clontech). KlenTaq1™ is a highly active and more heat-stable DNA polymerase without 5′-exonuclease activity. This prevents hydrolysis of hybridized probes by the 5′ to 3′ exonuclease activity. A volume of 7 μl of the PCR mixture was transferred into a composite capillary tube (Idaho Technology). The tubes were then centrifuged to move the reaction mixture to the tips of the capillaries and then cleaned with optical-grade methanol. Subsequently the capillaries were loaded into the carousel of a LC32 LightCycler™ (Idaho Technology), an instrument that combines rapid-cycle PCR with fluorescence analysis for continuous monitoring during amplification. The PCR reaction mixtures were subjected to a denaturation step at 94° C. for 3 min followed by 45 cycles of 0 s at 94° C., 20 s at 64° C. and 10 s at 72° C. with a temperature transition rate of 20° C./s. Fluorescence signals were obtained at each cycle by sequentially positioning each capillary on the carousel at the focus of optical elements affiliated to the built-in fluorimeter for 100 milliseconds. Complete amplification and analysis required about 35 min.
Specificity and sensitivity tests. The specificity of the conventional and LightCycler™ PCR assays was verified by using purified genomic DNA (0.1 ng/reaction) from a battery of ATCC reference strains representing 35 clinically relevant gram-positive species (Abiotrophia defectiva ATCC 49176, Bifidobacterium breve ATCC 15700, Clostridium difficile ATCC 9689, Corynebacterium urealyticum ATCC 43042, Enterococcus casseliflavus ATCC 25788, Enterococcus durans ATCC 19432, Enterococcus faecalis ATCC 29212, Enterococcus faecium ATCC 19434, Enterococcus gallinarum ATCC 49573, Enterococcus raffinosus ATCC 49427, Lactobacillus reuteri ATCC 23273, Lactococcus lactis ATCC 19435, Listeria monocytogenes ATCC 15313, Peptococcus niger ATCC 27731, Peptostreptococcus anaerobius ATCC 27337, Peptostreptococcus prevotii ATCC 9321, Staphylococcus aureus ATCC 25923, Staphylococcus epidermidis ATCC 14990, Staphylococcus haemolyticus ATCC 29970, Staphylococcus saprophyticus ATCC 15305, Streptococcus agalactiae ATCC 27591, Streptococcus anginosus ATCC 33397, Streptococcus bovis ATCC 33317, Streptococcus constellatus ATCC 27823, Streptococcus dysgalactiae ATCC 43078, Streptococcus gordonii ATCC 10558, Streptococcus mitis ATCC 33399, Streptococcus mutans ATCC 25175, Streptococcus oralis ATCC 35037, Streptococcus parauberis ATCC 6631, Streptococcus pneumoniae ATCC 6303, Streptococcus pyogenes ATCC 19615, Streptococcus salivarius ATCC 7073, Streptococcus sanguinis ATCC 10556, Streptococcus uberis ATCC 19436). These microbial species included 15 species of streptococci and many members of the normal vaginal and anal floras. In addition, 40 GBS isolates of human origin, whose identification was confirmed by a latex agglutination test (Streptex, Murex), were also used to evaluate the ubiquity of the assay.
For determination of the sensitivities (i.e., the minimal number of genome copies that could be detected) for conventional and LightCycler™ PCR assays, serial 10-fold or 2-fold dilutions of purified genomic DNA from 5 GBS ATCC strains were used. Results
Evaluation of the GBS-specific conventional and LightCycler™ PCR assays. The specificity of the two assays demonstrated that only DNAs from GBS strains could be amplified. Both PCR assays did not amplify DNAs from any other bacterial species tested including 14 streptococcal species other than GBS as well as phylogenetically related species belonging to the genera Enterococcus, Peptostreptococcus and Lactococcus. Important members of the vaginal or anal flora, including coagulase-negative staphylococci, Lactobacillus sp., and Bacteriodes sp. were also negative with the GBS-specific PCR assay. The LightCycler™ PCR assays detected only GBS DNA by producing an increased fluorescence signal which was interpreted as a positive PCR result. Both PCR methods were able to amplify all of 40 GBS clinical isolates, showing a perfect correlation with the phenotypic identification methods.
The sensitivity of the assay was determined by using purified genomic DNA from the 5 ATCC strains of GBS. The detection limit for all of these 5 strains was one genome copy of GBS. The detection limit of the assay with the LightCycler™ was 3.5 fg of genomic DNA (corresponding to 1-2 genome copies of GBS). These results confirmed the high sensitivity of our GBS-specific PCR assay.
Direct Detection of GBS from vaginal/anal specimens. Among 66 vaginal/anal specimens tested, 11 were positive for GBS by both culture and PCR. There was one sample positive by culture only. The sensitivity of both PCR methods with vaginal/anal specimens for identifying colonization status in pregnant women at delivery was 91.7% when compared to culture results. The specificity and positive predictive values were both 100% and the negative predictive value was 97.8%. The time for obtaining results was approximately 45 min for LightCycler™ PCR, approximately 100 min for conventional PCR and 48 hours for culture.
We have developed two PCR assays (conventional and LightCycler™) for the detection of GBS, which are specific (i.e., no amplification of DNA from a variety of bacterial species other than GBS) and sensitive (i.e., able to detect around 1 genome copy for several reference ATCC strains of GBS). Both PCR assays are able to detect GBS directly from vaginal/anal specimens in a very short turnaround time. Using the real-time PCR assay on LightCycler™, we can detect GBS carriage in pregnant women at delivery within 45 minutes.
The rapid detection of Streptococcus pyogenes and of its pyrogenic exotoxin A is of clinical importance. We developed a multiplex assay which permits the detection of strains of S. pyogenes carrying the pyrogenic toxin A gene, which is associated with scarlet fever and other pathologies. In order to specifically detect S. pyogenes, nucleotide sequences of the pyrrolidone carboxylyl peptidase (pcp) gene were aligned to design PCR primers Spy291 (SEQ ID NO. 1211) and Spy473 (SEQ ID NO. 1210). Next, we designed primers for the specific detection of the pyrogenic exotoxin A. Nucleotide sequences of the speA gene, carried on the bacteriophage T12, were aligned as shown in Annex XXIII to design PCR primers Spytx814 (SEQ ID NO. 994) and Spytx 927 (SEQ ID NO. 995).
The primer pairs: oligos SEQ ID NOs. 1210-1211, yielding an amplification product of 207 bp, and oligos SEQ ID NOs. 994-995, yielding an amplification product of 135 bp, were used in a multiplex PCR assay.
PCR amplification was carried out using 0.4 μM of both pairs of primers, 2.5 mM MgCl2, BSA 0.05 μM, dNTP 0.2 μM (Pharmacia), 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.5 U Taq DNA polymerase (Promega) coupled with TaqStart™ antibody (Clontech Laboratories Inc.), and 1 μl of genomic DNA sample in a final volume of 20 PCR amplification was performed using a PTC-200 thermal cycler (MJ Research). The optimal cycling conditions for maximum specificity and sensitivity were 3 minutes at 94° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 63° C., followed by a final step of 2 minutes at 72° C. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. Visualization of the PCR products was made under UV at 254 nm.
The detection limit was less than 5 genome copies for both S. pyogenes and its pyrogenic exotoxin A. The assay was specific for pyrogenic exotoxin A-producing S. pyogenes: strains of the 27 other species of Streptococcus tested, as well as 20 strains of various gram-positive and gram-negative bacterial species were all negative.
A similar approach was used to design an alternative set of speA-specific primers (SEQ ID NOs. 996 to 998, see Annex XXIV). In addition, another set of primers based on the tuf gene (SEQ ID NOs. 999 to 1001, see Annex XXV) could be used to specifically detect Streptococcus pyogenes.
Shiga toxin-producing Escherichia coli and Shigella dysenteriae cause bloody diarrhea. Currently, identification relies mainly on the phenotypic identification of S. dysenteriae and E. coli serotype O157:H7. However, other serotypes of E. coli are increasingly found to be producers of type 1 and/or type 2 Shiga toxins. Two pairs of PCR primers targeting highly conserved regions present in each of the Shiga toxin genes stx1 and stx2 were designed to amplify all variants of those genes (see Annexes XXVI and XXVII). The first primer pair, oligonucleotides 1SLT224 (SEQ ID NO. 1081) and 1SLT385 (SEQ ID NO. 1080), yields an amplification product of 186 by from the six, gene. For this amplicon, the 1SLTB1-Fam (SEQ ID NO. 1084) molecular beacon was designed for the specific detection of six, using the fluorescent label 6-carboxy-fluorescein. The 1 SltS1-FAM (SEQ ID NO. 2012) molecular scorpion was also designed as an alternate way for the specific detection of stx1. A second pair of PCR primers, oligonucleotides 2SLT537 (SEQ ID NO. 1078) and 2SLT678b (SEQ ID NO. 1079), yields an amplification product of 160 by from the stx2 gene. Molecular beacon 2SLTB1-Tet (SEQ ID NO. 1085) was designed for the specific detection of stx2 using the fluorescent label 5-tetrachloro-fluorescein. Both primer pairs were combined in a multiplex PCR assay.
PCR amplification was carried out using 0.8 μM of primer pair SEQ ID NOs. 1080-1081, 0.5 μM of primer pair SEQ ID NOs. 1078-1079, 0.3 μM of each molecular beacon, 8 mM MgCl2, 490 μg/mL BSA, 0.2 mM dNTPs (Pharmacia), 50 mM Tris-HCl, 16 mM NH4SO4, 1× TaqMaster (Eppendorf), 2.5 U KlenTaq1 DNA polymerase (AB Peptides) coupled with TaqStart™ antibody (Clontech Laboratories Inc.), and 1 μl of genomic DNA sample in a final volume of 25 PCR amplification was performed using a SmartCycler thermal cycler (Cepheid). The optimal cycling conditions for maximum sensitivity and specificity were 60 seconds at 95° C. for initial denaturation, then 45 cycles of three steps consisting of 10 seconds at 95° C., 15 seconds at 56° C. and 5 seconds at 72° C. Detection of the PCR products was made in real-time by measuring the fluorescent signal emitted by the molecular beacon when it hybridizes to its target at the end of the annealing step at 56° C.
The detection limit was the equivalent of less than 5 genome copies. The assay was specific for the detection of both toxins, as demonstrated by the perfect correlation between PCR results and the phenotypic characterization performed using antibodies specific for each Shiga toxin type. The assay was successfully performed on several Shiga toxin-producing strains isolated from various geographic areas of the world, including 10 O157:H7 E. coli, 5 non-O157:H7 E. coli and 4 S. dysenteriae.
The Staphylococcus-specific PCR primers described in Example 7 (SEQ ID NOs. 553 and 575) were used in multiplex with the mecA-specific PCR primers and the S. aureus-specific primers described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 261 and 262 for mecA and SEQ ID NOs. 152 and 153 for S. aureus in the said patent). Sequence alignment analysis of 10 publicly available mecA gene sequences allowed to design an internal probe specific to mecA (SEQ ID NO. 1177). An internal probe was also designed for the S. aureus-specific amplicon (SEQ ID NO 1234). PCR amplification and agarose gel electrophoresis of the amplified products were performed as described in Example 7, with the exception that 0.4 μM (each) of the two Staphylococcus-specific primers (SEQ ID NOs. 553 and 575) and 0.4 μM (each) of the mecA-specific primers and 0.4 μM (each) of the S. aureus-specific primers were used in the PCR mixture. The specificity of the multiplex assay with 40-cycle PCR protocols was verified by using purified genomic DNA from five methicillin-resistant and fifteen methicillin-sensitive staphylococcal strains. The sensitivity of the multiplex assay with 40-cycle PCR protocols was determined by using purified genomic DNA from twenty-three methicillin-resistant and twenty-eight methicillin-sensitive staphylococcal strains. The detection limit was 2 to 10 genome copies of genomic DNA, depending on the staphylococcal species tested. Furthermore, the mecA-specific internal probe, the S. aureus-specific internal probe and the coagulase-negative staphylococci-specific internal probe (described in Example 7) were able to recognize twenty-three methicillin-resistant staphylococcal strains and twenty-eight methicillin-sensitive staphylococcal strains with high sensitivity and specificity.
The format of the assay is not limited to the one described above. A person skilled in the art could adapt the assay for different formats such as PCR with real-time detection using molecular beacon probes. Molecular beacon probes designed to be used in this assay include, but are not limited to, SEQ ID NO. 1232 for detection of the S. aureus-specific amplicon, SEQ ID NO. 1233 for detection of coagulase-negative staphylococci and SEQ ID NO. 1231 for detection of mecA.
Alternatively, a multiplex PCR assay containing the Staphylococcus-specific PCR primers described in Example 7 (SEQ ID NOs. 553 and 575) and the mecA-specific PCR primers described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 261 and 262 in the said patent) were developed. PCR amplification and agarose gel electrophoresis of the amplified products were performed as described in Example 7, with the exception that 0.4 μM (each) of the Staphylococcus-specific primers (SEQ ID NOs. 553 and 575) and 0.4 μM (each) of the mecA-specific primers described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 261 and 262 in the said patent) were used in the PCR mixture. The sensitivity of the multiplex assay with 40-cycle PCR protocols was determined by using purified genomic DNA from two methicillin-resistant and five methicillin-sensitive staphylococcal strains. The detection limit was 2 to 5 copies of genomic DNA, depending on the staphylococcal species tested. The specificity of the multiplex PCR assay coupled with capture-probe hybridization was tested with two strains of methicillin-resistant S. aureus, two strains of methicillin-sensitive S. aureus and seven strains of methicillin-sensitive coagulase-negative staphylococci. The mecA-specific internal probe (SEQ ID NO. 1177) and the S. aureus-specific internal probe (SEQ ID NO. 587) described in Example 7 were able to recognize all the strains with high specificity showing a perfect correlation with susceptibility to methicillin. The sensitivity of the PCR assay coupled with capture-probe hybridization was tested with one strain of methicillin-resistant S. aureus. The detection limit was around 10 copies of genomic DNA.
Penicillin resistance in Streptococcus pneumoniae involves the sequential alteration of up to five penicillin-binding proteins (PBPs) 1A, 1B, 2A, 2X and 2B in such a way that their affinity is greatly reduce toward the antibiotic molecule. The altered PBP genes have arisen as the result of interspecies recombination events from related streptococcal species. Among the PBPs usually found in S. pneumoniae, PBPs 1A, 2B, and 2X play the most important role in the development of penicillin resistance. Alterations in PBP 2B and 2X mediate low-level resistance to penicillin while additional alterations in PBP 1A plays a significant role in full penicillin resistance.
In order to generate a database for pbp sequences that can be used for design of primers and/or probes for the specific and ubiquitous detection of β-lactam resistance in S. pneumoniae, pbp1a, pbp2b and pbp2x DNA fragments sequenced by us or selected from public databases (GenBank and EMBL) from a variety of S. pneumoniae strains were used to design oligonucleotide primers. This database is essential for the design of specific and ubiquitous primers and/or probes for detection of β-lactam resistance in S. pneumoniae since the altered PBP 1A, PBP 2B and PBP 2X of β-lactam resistant S. pneumoniae are encoded by mosaic genes with numerous sequence variations among resistant isolates. The PCR primers were located in conserved regions of pbp genes and were able to amplify pbp1a, pbp2b, and pbp2x sequences of several strains of S. pneumoniae having various levels of resistance to penicillin and third-generation cephalosporins. Using primer pairs SEQ ID NOs. 1125 and 1126, SEQ ID NOs. 1142 and 1143, SEQ ID NOs. 1146 and 1147, it was possible to amplify and determine pbp1a sequences SEQ ID NOs. 1004-1018, 1648, 2056-2060 and 2062-2064, pbp2b sequences SEQ ID NOs. 1019-1033, and pbp2x sequences SEQ ID NOs. 1034-1048. Six other PCR primers (SEQ ID NOs. 1127-1128, 1144-1145, 1148-1149) were also designed and used to complete the sequencing of pbp1a, pbp2b and pbp2x amplification products. The described primers (SEQ ID NOs. 1125 and 1126, SEQ ID NOs. 1142 and 1143, SEQ ID NOs. 1146 and 1147, SEQ ID NOs. 1127-1128, 1144-1145, 1148-1149) represent a powerful tool for generating new pbp sequences for design of primers and/or probes for detection of β-lactam resistance in S. pneumoniae.
The hexA sequence of S. pneumoniae described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NO. 31 in the said patent, SEQ ID NO. 1183 in the present application) allowed the design of a PCR primer (SEQ ID NO. 1182) which was used with primer Spn1401 described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NO. 156 in the said patent, SEQ ID NO. 1179 in the present application) to generate a database for hexA sequences that can be used to design primers and/or probes for the specific identification and detection of S. pneumoniae (Annex XLII). Using primers SEQ ID NO. 1179 and SEQ ID NO. 1182 (Annex XLII), it was possible to amplify and determine the hexA sequence from S. pneumoniae (4 strains) (SEQ ID NOs. 1184-1187), S. mitis (three strains) (SEQ ID NOs. 1189-1191) and S. oralis (SEQ ID NO. 1188).
Two different assays were developed to identify S. pneumoniae and its susceptibility to penicillin.
Bacterial strains. The specificity of the multiplex PCR assay was verified by using a panel of ATCC (American Type Culture Collection) reference strains consisting of 33 gram-negative and 67 gram-positive bacterial species (Table 13). In addition, a total of 98 strains of S. pneumoniae, 16 strains of S. mitis and 3 strains of S. oralis from the American Type Culture Collection, the microbiology laboratory of the Centre Hospitalier Universitaire de Québec, Pavillon Centre Hospitalier de l'Université Laval (CHUL), (Step-Foy, Québec, Canada), the Laboratoire de santé publique du Québec, (Sainte-Anne-de-Bellevue, Québec, Canada), the Sunnybrook and Women's College Health Sciences Centre (Toronto, Canada), the Infectious Diseases Section, Department of Veterans Affairs Medical Center, (Houston, USA) were also tested to further validate the Streptococcus pneumoniae-specific PCR assay. The penicillin MICs (minimal inhibitory concentrations) were measured by the broth dilution method according to the recommended protocol of NCCLS.
PCR primers and internal probes. The analysis of hexA sequences from a variety of streptococcal species from the publicly available hexA sequence and from the database described in Example 19 (SEQ ID NOs. 1184-1191) allowed the selection of a PCR primer specific to S. pneumoniae, SEQ ID NO. 1181. This primer was used with the S. pneumoniae-specific primer SEQ ID NO. 1179 to generate an amplification product of 241 by (Annex XLII). The PCR primer SEQ ID NO. 1181 is located 127 nucleotides downstream on the hexA sequence compared to the original S. pneumoniae-specific PCR primer Spn1515 described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NO. 157 in the said patent). These modifications were done to ensure the design of the S. pneumoniae-specific internal probe according to the new hexA sequences of several streptococcal species from the database described in Example 19 (SEQ ID NOs. 1184-1191).
The analysis of pbp1a sequences from S. pneumoniae strains with various levels of penicillin resistance from public databases and from the database described in Example 18 allowed the identification of amino acid substitutions Ile-459 to Met and Ser-462 to Ala that occur in isolates with high-level penicillin resistance (MICs≧1 μg/ml), and amino acid substitutions Ser-575 to Thr, Gln-576 to Gly and Phe-577 to Tyr that are common to all penicillin-resistant isolates with MICs≧0.25 μg/ml. As shown in Annex XXXI, PCR primer pair SEQ ID NOs. 1130 and 1131 were designed to detect high-level penicillin resistance (MICs≧1 μg/ml), whereas PCR primer pair SEQ ID NOs. 1129 and 1131 were designed to detect intermediate- and high-level penicillin resistance (MICs≧0.25 μg/ml).
The analysis of hexA sequences from the publicly available hexA sequence and from the database described in Example 19 allowed the design of an internal probe specific to S. pneumoniae (SEQ ID NO. 1180) (Annex XLII). The range of mismatches between the S. pneumoniae-specific 241-bp amplicon was from 2 to 5, in the middle of the 19-bp probe. The analysis of pbp1a sequences from public databases and from the database described in Example 18 allowed the design of five internal probes containing all possible mutations to detect the high-level penicillin resistance 383-bp amplicon (SEQ ID NOs. 1197, 1217-1220). Alternatively, two other internal probes (SEQ ID NOs. 2024-2025) can also be used to detect the high-level penicillin resistance 383-bp amplicon. Five internal probes containing all possible mutations to detect the 157-bp amplicon which includes intermediate- and high-level penicillin resistance were also designed (SEQ ID NOs. 1094, 1192-1193, 1214 and 1216). Design and synthesis of primers and probes, and detection of the probe hybridization were performed as described in Example 7. Annex XXXI illustrates one of the internal probe for detection of the high-level penicillin resistance 383-bp amplicon (SEQ ID NO. 1197) and one of the internal probe for detection of the intermediate- and high-level penicillin resistance 157-bp amplicon (SEQ ID NO. 1193).
PCR amplification. For all bacterial species, amplification was performed from purified genomic DNA using a PTC-200 thermocycler (MJ Research). 1 μl of genomic DNA at 0.1 ng/μl, or 1 μl of a bacterial lysate, was transferred to a 19 μl PCR mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (H 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.1 μM (each) of the S. pneumoniae-specific primers SEQ ID NO. 1179 and SEQ ID NO. 1181, 0.2 μM of primer SEQ ID NO. 1129, 0.7 μM of primer SEQ ID NO. 1131, and 0.6 μM of primer SEQ ID NO. 1130, 0.05 mM bovine serum albumin (BSA), and 0.5 U Taq polymerase (Promega) coupled with TaqStart™ antibody. In order to generate Digoxigenin (DIG)-labeled amplicons for capture probe hybridization, 0.1×PCR DIG labeling four deoxynucleoside triphosphates mix (Boehringer Mannheim GmbH) was used for amplification.
For determination of the sensitivity of the PCR assays, 10-fold dilutions of purified genomic DNA were used to determine the minimal number of genome copies which can be detected.
Capture probe hybridization. The DIG-labeled amplicons were hybridized to the capture probes bound to 96-well plates. The plates were incubated with anti-DIG-alkaline phosphatase and the chemiluminescence was measured by using a luminometer (MLX, Dynex Technologies Inc.) after incubation with CSPD and recorded as Relative Light Unit (RLU). The RLU ratio of tested sample with and without captures probes was then calculated. A ratio 2.0 was defined as a positive hybridization signal. All reactions were performed in duplicate.
Amplifications with the multiplex PCR assay. The specificity of the assay was assessed by performing 40-cycle PCR amplifications with the panel of gram-positive (67 species from 12 genera) and gram-negative (33 species from 17 genera) bacterial species listed in Table 13. All bacterial species tested other than S. pneumoniae were negative except S. mitis and S. oralis. Ubiquity tests were performed using a collection of 98 S. pneumoniae strains including high-level penicillin resistance (n=53), intermediate resistance (n=12) and sensitive (n=33) strains. There was a perfect correlation between PCR and standard susceptibility testing for 33 penicillin-sensitive isolates. Among 12 S. pneumoniae isolates with intermediate penicillin resistance based on susceptibility testing, 11 had intermediate resistance based on PCR, but one S. pneumoniae isolate with penicillin MIC of 0.25 μg/ml showed a high-level penicillin resistance based on genotyping. Among 53 isolates with high-level penicillin resistance based on susceptibility testing, 51 had high-level penicillin resistance based on PCR but two isolates with penicillin MIC>1 μg/ml showed an intermediate penicillin resistance based on genotyping. In general, there was a good correlation between the genotype and classical culture method for bacterial identification and susceptibility testing.
The sensitivity of the S. pneumoniae-specific assay with 40-cycle PCR protocols was determined by using purified genomic DNA from 9 isolates of S. pneumoniae. The detection limit was around 10 copies of genomic DNA for all of them.
Post-PCR hybridization with internal probes. The specificity of the multiplex PCR assay coupled with capture-probe hybridization was tested with 98 strains of S. pneumoniae, 16 strains of S. mitis and 3 strains of S. oralis. The internal probe specific to S. pneumoniae (SEQ ID NO. 1180) detected all 98 S. pneumoniae strains but did not hybridize to the S. mitis and S. oralis amplicons. The five internal probes specific to the high-level resistance amplicon (SEQ ID NOs. 1197, 1217-1220) detected all amplification patterns corresponding to high-level resistance. The two S. pneumoniae strains with penicillin MIC>1 μg/ml that showed an intermediate penicillin resistance based on PCR amplification were also intermediate resistance based on probe hybridization. Similarly, among 12 strains with intermediate-penicillin resistance based on susceptibility testing, 11 showed intermediate-penicillin resistance based on hybridization with the five internal probes specific to the intermediate and high-level resistance amplicon (SEQ ID NOs. 1094, 1192-1193, 1214 and 1216). The strain described above having a penicillin MIC of 0.25 μg/ml which was high-level penicillin resistance based on PCR amplification was also high-level resistance based on probe hybridization. In summary, the combination of the multiplex PCR and hybridization assays results in a highly specific test for the detection of penicillin-resistant Streptococcus pneumoniae.
Bacterial strains. The specificity of the multiplex PCR assay was verified by using the same strains as those used for the development of Assay I. The penicillin MICs (minimal inhibitory concentrations) were measured by the broth dilution method according to the recommended protocol of NCCLS.
PCR primers and internal probes. The analysis of pbp1a sequences from S. pneumoniae strains with various levels of penicillin resistance from public databases and from the database described in Example 18 allowed the design of two primers located in the constant region of pbp1a. PCR primer pair (SEQ ID NOs. 2015 and 2016) was designed to amplify a 888-bp variable region of pbp1a from all S. pneumoniae strains. A series of internal probes were designed for identification of the pbp1a mutations associated with penicillin resistance in S. pneumoniae. For detection of high-level penicillin resistance (MICs≧1 μg/ml), three internal probes were designed (SEQ ID NOs. 2017-2019). Alternatively, ten other internal probes were designed that can also be used for detection of high-level resistance within the 888-bp pbp1a amplicon: (1) three internal probes for identification of the amino acid substitutions Thr-371 to Ser or Ala within the motif S370TMK (SEQ ID NOs. 2031-2033); (2) two internal probes for detection of the amino acid substitutions Ile-459 to Met and Ser-462 to Ala near the motif S428RN (SEQ ID NOs. 1135 and 2026); (3) two internal probes for identification of the amino acid substitutions Asn-443 to Asp (SEQ ID NOs. 1134 and 2027); and (4) three internal probes for detection of all sequence variations within another region (SEQ ID NOs. 2028-2030). For detection of high-level and intermediate penicillin resistance (MICs 0.25 μg/ml), four internal probes were designed (SEQ ID NOs. 2020-2023). Alternatively, six other internal probes were designed for detection of the four consecutive amino acid substitutions T574SQF to A574TGY near the motif K557TG (SEQ ID NOs. 2034-2039) that can also be used for detection of intermediate- and high-level resistance within the 888-bp pbp1a amplicon.
PCR amplification. For all bacterial species, amplification was performed from purified genomic DNA using a PTC-200 thermocycler (MJ Research). 1 μl of genomic DNA at 0.1 ng/μl, or 1 μl of a bacterial lysate, was transferred to a 19 μl PCR mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.08 μM (each) of the S. pneumoniae-specific primers SEQ ID NO. 1179 and SEQ ID NO. 1181, 0.4 μM of the pbp1a-specific primer SEQ ID NO. 2015, 1.2 μM of pbp1a-specific primer SEQ ID NO. 2016, 0.05 mM bovine serum albumin (BSA), and 0.5 U Taq polymerase (Promega) coupled with TaqStart™ antibody. In order to generate Digoxigenin (DIG)-labeled amplicons for capture probe hybridization, 0.1×PCR DIG labeling four deoxynucleoside triphosphates mix (Boehringer Mannheim GmbH) was used for amplification.
For determination of the sensitivities of the PCR assays, 10-fold dilutions of purified genomic DNA were used to determine the minimal number of genome copies which can be detected.
Capture probe hybridization. The DIG-labeled amplicons were hybridized to the capture probes bound to 96-well plates as described for Assay I.
Amplifications with the multiplex PCR assay. The specificity of the assay was assessed by performing 40-cycle PCR amplifications with the panel of gram-positive (67 species from 12 genera) and gram-negative (33 species from 17 genera) bacterial species listed in Table 13. All bacterial species tested other than S. pneumoniae were negative except S. mitis and S. oralis. Ubiquity tests were performed using a collection of 98 S. pneumoniae strains including high-level penicillin resistance (n=53), intermediate resistance (n=12) and sensitive (n=33) strains. All the above S. pneumoniae strains produced the 888-bp amplicon corresponding to pbp1a and the 241-bp fragment corresponding to hexA.
The sensitivity of the S. pneumoniae-specific assay with 40-cycle PCR protocols was determined by using purified genomic DNA from 9 isolates of S. pneumoniae. The detection limit was around 10 copies of genomic DNA for all of them.
Post-PCR hybridization with internal probes. The specificity of the multiplex PCR assay coupled with capture-probe hybridization was tested with 98 strains of S. pneumoniae, 16 strains of S. mitis and 3 strains of S. oralis. The internal probe specific to S. pneumoniae (SEQ ID NO. 1180) detected all 98 S. pneumoniae strains but did not hybridize to the S. mills and S. oralis amplicons. The three internal probes (SEQ ID NOs 2017-2019) specific to high-level resistance detected all the 43 strains with high-level penicillin resistance based on susceptibility testing. Among 12 isolates with intermediate-penicillin resistance based on susceptibility testing, 11 showed intermediate-penicillin resistance based on hybridization with 4 internal probes (SEQ ID NOs. 2020-2023) and one strain having penicillin MIC of 0.25 μg/ml was misclassified as high-level penicillin resistance. In summary, the combination of the multiplex PCR and hybridization assays results in a highly specific test for the detection of penicillin-resistant Streptococcus pneumoniae.
The publicly available sequences of the vanH-vanA-vanX-vanY locus of transposon Tnl546 from E. faecalis, vanC1 sequence from one strain of E. gallinarum, vanC2 and vanC3 sequences from a variety of E. casseliflavus and E. flavescens strains, respectively, allowed the design of PCR primers able to amplify the vanA, vanC1, vanC2 and vanC3 sequences of several Enterococcus species. Using primer pairs van6877 and van9106 (SEQ ID NOs. 1150 and 1155), vanC1-122 and vanC1-1315 (SEQ ID NOs. 1110 and 1109), and vanC2C3-1 and vanC2C3-1064 (SEQ ID NOs. 1108 and 1107), it was possible to amplify and determine vanA sequences SEQ ID NOs. 1049-1057, vanC1 sequences SEQ ID NOs. 1058-1059, vanC2 sequences SEQ ID NOs. 1060-1063 and vanC3 sequences SEQ ID NOs. 1064-1066, respectively. Four other PCR primers (SEQ ID NOs. 1151-1154) were also designed and used to complete the sequencing of vanA amplification products.
The comparison of vanA and vanB sequences revealed conserved regions allowing the design of PCR primers specific to both vanA and vanB sequences (Annex XXXVIII). The PCR primer pair vanAB459 and vanAB830R (SEQ ID NOs. 1112 and 1111) was used in multiplex with the Enterococcus-specific primers Encg313dF and Encg599c (SEQ ID NOs. 1137 and 1136) described in Example 11. Sequence alignment analysis of vanA and vanB sequences revealed regions suitable for the design of internal probes specific to vanA (SEQ ID NO. 1170) and vanB (SEQ ID NO. 1171). PCR amplification and agarose gel electrophoresis of the amplified products were performed as described in Example 11. The optimal cycling conditions for maximum sensitivity and specificity were found to be 3 min. at 94° C., followed by forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 62° C., plus a terminal extension at 72° C. for 2 minutes. The specificity of the multiplex assay with 40-cycle PCR was verified by using 0.1 nanogram of purified genomic DNA from a panel of bacteria listed in Table 10. The sensitivity of the multiplex assay with 40-cycle PCR was verified with three strains of E. casseliflavus, eight strains of E. gallinarum, two strains of E. flavescens, two vancomycin-resistant strains of E. faecalis and one vancomycin-sensitive strain of E. faecalis, three vancomycin-resistant strains of E. faecium, one vancomycin-sensitive strain of E. faecium and one strain of each of the other enterococcal species listed in Table 10. The detection limit was 1 to 10 copies of genomic DNA, depending on the enterococcal species tested. The vanA- and vanB-specific internal probes (SEQ ID NOs. 1170 and 1171), as well as the E. faecalis- and E. faecium-specific internal probes (SEQ ID NOs. 1174 and 602) and the internal probe specific to the group including E. casseliflavus, E. gallinarum and E. flavescens (SEQ ID NO. 1122) described in Example 11, were able to recognize vancomycin-resistant enterococcal species with high sensitivity, specificity and ubiquity showing a perfect correlation between the genotypic and phenotypic analysis.
The format of the assay is not limited to the one described above. A person skilled in the art could adapt the assay for different formats such as PCR with real-time detection using molecular beacon probes. Molecular beacon probes designed to be used in this assay include, but are not limited to, SEQ ID NO. 1236 for the detection of E. faecalis, SEQ ID NO. 1235 for the detection of E. faecium, SEQ ID NO. 1240 for the detection of vanA, and SEQ ID NO. 1241 for the detection of vanB.
The vanA and vanB genes encode the major glycopeptide resistance phenotypes in vancomycin resistant microorganisms. To design an assay to detect vancomycin resistant microorganisms, the nucleotide sequence of the vanA and vanB genes were analyzed.
An internal control DNA, pERVd (SEQ ID NO: 2302) was designed for the vanR assay. The primers of SEQ ID NO: 1090 and SEQ ID NO: 1096 can hybridize to produce and amplification product from the internal control DNA. A molecular beacon probe (SEQ ID NO: 2301) was designed to detect the amplification product of the internal control DNA. SEQ ID NO: 2301 contains a 5′ tetrachlorofluorescein (TET) fluorophore and the DABCYL quencher moiety at its 3′ end.
In a first experiment, the vanA-specific PCR primer pair (SEQ ID. NOs. 1089 and 1090) was used in multiplex with the vanB-specific PCR primer pair described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 1095 and 1096 in the present patent and SEQ ID NOs. 231 and 232 in the said patent). The comparison of vanC1, vanC2 and vanC3 sequences revealed conserved regions allowing design of PCR primers (SEQ ID NOs. 1101 and 1102) able to generate a 158-bp amplicon specific to the group including E. gallinarum, E. casseliflavus and E. flavescens (Annex XXX). The vanC-specific PCR primer pair (SEQ ID NOs. 1101 and 1102) was used in multiplex with the E. faecalis-specific PCR primer pair described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 40 and 41 in the said patent) and with the E. faecium-specific PCR primer pair described in our patent publication WO98/20157 (SEQ ID NOs. 1 and 2 in the said publication). For both multiplexes, the optimal cycling conditions for maximum sensitivity and specificity were found to be 3 min. at 94° C., followed by forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 58° C., plus a terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. The vanA-specific PCR primer pair (SEQ ID NOs. 1089 and 1090), the vanB-specific primer pair (SEQ ID NOs. 1095 and 1096) and the vanC-specific primer pair (SEQ ID NOs. 1101 and 1102) were tested for their specificity by using 0.1 nanogram of purified genomic DNA from a panel of 5 vancomycin-sensitive Enterococcus species, 3 vancomycin-resistant Enterococcus species, 13 other gram-positive bacteria and one gram-negative bacterium. Specificity tests were performed with the E. faecium-specific PCR primer pair described in our patent publication WO98/20157 (SEQ ID NOs. 1 and 2 in the said publication) and with the E. faecalis-specific PCR primer pair described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 40 and 41 in the said patent) on a panel of 37 gram-positive bacterial species. All Enterococcus strains were amplified with high specificity showing a perfect correlation between the genotypic and phenotypic analysis. The sensitivity of the assays was determined for several strains of E. gallinarum, E. casseliflavus, E. flavescens and vancomycin-resistant E. faecalis and E. faecium. Using each of the E. faecalis- and E. faecium-specific PCR primer pairs as well as vanA-, vanB- and vanC-specific PCR primers used alone or in multiplex as described above, the sensitivity ranged from 1 to 10 copies of genomic DNA.
The format of the assay is not limited to the one described above. A person skilled in the art could adapt the assay for different formats such as PCR with real-time detection using molecular beacon probes. Molecular beacon probes designed to be used in this assay include, but are not limited to, SEQ ID NO. 1238 for the detection of E. faecalis, SEQ ID NO. 1237 for the detection of E. faecium, SEQ ID NO. 1239 for the detection of vanA, and SEQ ID NO. 1241 for the detection of vanB.
Another PCR assay was developed for the detection of vancomycin-resistant E. faecium and vancomycin-resistant E. faecalis. This assay included two multiplex: (1) the first multiplex contained the vanA-specific primer pair (SEQ ID NOs. 1090-1091) and the vanB-specific PCR primer pair described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 1095 and 1096 in the present patent and SEQ ID NOs. 231 and 232 in the said patent), and (2) the second multiplex contained the E. faecalis-specific PCR primer pair described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID NOs. 40 and 41 in the said patent) and the E. faecium-specific PCR primer pair described in our patent publication WO98/20157 (SEQ ID NOs. 1 and 2 in the said publication). For both multiplexes, the optimal cycling conditions for maximum sensitivity and specificity were found to be 3 min. at 94° C., followed by forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 58° C., plus a terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. The two multiplexes were tested for their specificity by using 0.1 nanogram of purified genomic DNA from a panel of two vancomycin-sensitive E. faecalis strains, two vancomycin-resistant E. faecalis strains, two vancomycin-sensitive E. faecium strains, two vancomycin-resistant E. faecium strains, 16 other enterococcal species and 31 other gram-positive bacterial species. All the E. faecium and E. faecalis strains were amplified with high specificity showing a perfect correlation between the genotypic analysis and the susceptibility to glycopeptide antibiotics (vancomycin and teicoplanin). The sensitivity of the assay was determined for two vancomycin-resistant E. faecalis strains and two vancomycin-resistant E. faecium strains. The detection limit was 5 copies of genomic DNA for all the strains.
This multiplex PCR assay was coupled with capture-probe hybridization. Four internal probes were designed: one specific to the vanA amplicon (SEQ ID NO. 2292), one specific to the vanB amplicon (SEQ ID NO. 2294), one specific to the E. faecalis amplicon (SEQ ID NO. 2291) and one specific to the E. faecium amplicon (SEQ ID NO. 2287). Each of the internal probes detected their specific amplicons with high specificity and sensitivity.
In a next set of experiments, a multiplex real-time PCR reaction (the VanR assay) using the vanA primer pair SEQ ID NO: 1090 and 1091, the vanB primer pair SEQ ID NO: 1096 and 2298, the internal control DNA SEQ ID NO: 2302, and the molecular beacon probes SEQ ID NOs: 2299, 2300, and 2301 was performed.
For the template DNA, purified genomic DNA from vanA resistant Enterococcus faecium or vanB resistant Enterococcus faecalis was obtained from strains grown on blood agar plates under standard conditions. Genomic DNA was extracted from the cultures using the GNOME kit (QBIOgene, Carlsbad, Calif.) according to the manufacturer's instructions. Template DNA samples were treated with RNase prior to quantitation. Genomic DNA concentration was determined and the quality of the genomic DNA preparations was confirmed using conventional methods.
Lyophilized reagents listed in Table 24 were used for the VanR assay. The lyophilized reagents were reconstituted with 225 μl diluent (116 mM Tris-HCl, pH 8.3, 11.6 mM KCl, 3.48 mM MgCl2, 5.8 mM NH2SO4) and subsequently divided into 25 μl aliquots. 0.5, 2.5, 5, 10 or 20 copies of template DNA was added to each of 5 replicate reactions.
The VanR assay PCR was run in a SMART CYCLER™ PCR machine under the following conditions: 60° C. for 6 sec, followed by 95° C. for 900 sec, followed by 45 cycles of 95° C. for 5 seconds, 63° C. for 10 sec and 72° C. for 20 sec. The fluorescent readout from the FAM channel (vanA) and the Texas Red channel (vanB) of the reactions is shown in
To demonstrate the specificity of the VanR assay, vanC, vanD, vanE, and vanG resistant enterococci, other closely related bacteria, normal and pathogenic anal or fecal flora, or human DNA as listed in Tables 16-18 were assayed as follows: VanR assay lyophilized reagents (Table 38) were reconstituted with 225 μl diluent and aliquoted as described above. Template DNA was prepared using conventional methods and diluted in sample preparation buffer to a final concentration of 0.33 ng/μl. 3 μl template DNA was added to each master mix, and the reaction was carried out as described above in the SMART CYCLER™ PCR machine. 41 electrophoresis loading buffer was added to the reactions upon completion, and 15 μl of each reaction was run on an agarose gel to view the PCR amplification products, as shown in
To assess the specificity of the molecular beacons in the VanR assay, PCR assays were preformed to test cross-reactivity with amplified vanA and vanB target DNA and internal control DNA. The reaction components listed in Table 34 were each added to premix in Table 33. For each reaction, 25.8 μl of the final mix was combined with 3 μl template DNA (either 25 copies vanA DNA or 50 copies vanB DNA) or TE buffer (1×), as indicated. The reactions were performed in the SMART CYCLER™ PCR machine using the VanR assay conditions as described above. Table 35 shows the results of the experiment. Positive results were obtained in the FAM channel in every reaction that contained vanA template DNA and the vanA primers. Positive results were obtained in the Texas Red channel in every reaction that contained vanB template DNA and vanB primers. Positive results obtained in the TET channel in every reaction that contained internal control template DNA and internal control primers.
Negative results were obtained in each channel for every reaction that did not contain a target DNA that could be amplified and detected using the indicated molecular beacon probe. In other words, the molecular beacon probes did not cross-react with non-specific DNAs.
Validation with Clinical Samples
To validate the VanR assay, the sensitivity of the VanR assay was performed on clinical samples. Briefly, the VanR assay lyophilized reagents listed in Table 38 were reconstituted in 225 μl diluent and aliquoted as described above. DNA isolation and quantitation was performed using conventional techniques. The samples were processed in a SMART CYCLER' PCR machine using the VanR reaction conditions described above.
To assess the sensitivity of the VanR assay, template DNA isolated from enterococci from various geographic regions, and on template DNA from vanB resistant bacterial species other than enterococci was isolated and tested in the VanR assay as described above. Table 36 lists the enterococcal strains from various regions in the world tested in the assay. The table identifies the vanA and vanB phenotype of each strain. PCR amplification products were detected by running a sample of each reaction on an agarose gel, shown in
These results demonstrate that the VanR assay is sensitive and specific.
As shown in
In addition to other possible primer combinations to amplify the region covering fusA and tuf,
Moreover, different combinations of primers SEQ ID NOs. 1221-1229, sometimes in combination with tuf sequencing primer SEQ ID NO. 697, were used to sequence portions of the str operon, including the intergenic region. In this manner, the following sequences were generated: SEQ ID NOs. 1518-1526, 1578-1580, 1786-1821, 1822-1834, 1838-1843, 2184, 2187, 2188, 2214-2249, and 2255-2269.
DNA sequences of unknown coding potential for the species-specific detection and identification of Staphylococcus saprophyticus were obtained by the method of arbitrarily primed PCR (AP-PCR).
AP-PCR is a method which can be used to generate specific DNA probes for microorganisms (Fani et al., 1993, Molecular Ecology 2:243-250). A description of the AP-PCR protocol used to isolate a species-specific genomic DNA fragment from Staphylococcus saprophyticus follows. Twenty different oligonucleotide primers of 10 nucleotides in length (all included in the AP-PCR kit OPAD (Operon Technologies, Inc., Alameda, Calif.)) were tested systematically with DNAs from 5 bacterial strains of Staphylococcus saprophyticus as well as with bacterial strains of 27 other staphylococcal (non-S. saprophyticus) species. For all bacterial species, amplification was performed directly from one μL (0.1 ng/μL) of purified genomic DNA. The 25 μL PCR reaction mixture contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 1.2 μM of only one of the 20 different AP-PCR primers OPAD, 200 μM of each of the four dNTPs, 0.5 U of Taq DNA polymerase (Promega Corp., Madison, Wis.) coupled with TaqStart™ antibody (Clontech Laboratories Inc., Palo Alto, Calif.). PCR reactions were subjected to cycling using a MJ Research PTC-200 thermal cycler as follows: 3 min at 96° C. followed by 42 cycles of 1 min at 94° C. for the denaturation step, 1 min at 31° C. for the annealing step and 2 min at 72° C. for the extension step. A final extension step of 7 min at 72° C. followed the 42 cycles to ensure complete extension of PCR products. Subsequently, twenty microliters of the PCR-amplified mixture were resolved by electrophoresis on a 1.5% agarose gel containing 0.25 μg/ml of ethidium bromide. The size of the amplification products was estimated by comparison with a 50-bp molecular weight ladder.
Amplification patterns specific for Staphylococcus saprophyticus were observed with the AP-PCR primer OPAD-16 (sequence: 5′-AACGGGCGTC-3′). Amplification with this primer consistently showed a band corresponding to a DNA fragment of approximately 380 by for all Staphylococcus saprophyticus strains tested but not for any of the other staphylococcal species tested.
The band corresponding to the 380 by amplicon, specific and ubiquitous for S. saprophyticus based on AP-PCR, was excised from the agarose gel and purified using the QIAquick™ gel extraction kit (QIAGEN Inc.). The gel-purified DNA fragment was cloned into the T/A cloning site of the pCR 2.1™ plasmid vector (Invitrogen Inc.) using T4 DNA ligase (New England BioLabs). Recombinant plasmids were transformed into E. coli DH5α competent cells using standard procedures. All reactions were performed according to the manufacturer's instructions. Plasmid DNA isolation was done by the method of Birnboim and Doly (Nucleic Acid Res., 1979, 7:1513-1523) for small-scale preparations. All plasmid DNA preparations were digested with the EcoRI restriction endonuclease to ensure the presence of the approximately 380 by AP-PCR insert into the plasmid. Subsequently, a large-scale and highly purified plasmid DNA preparation was performed from two selected clones shown to carry the AP-PCR insert by using the QIAGEN plasmid purification kit (midi format). These large-scale plasmid preparations were used for automated DNA sequencing.
The 380 by nucleotide sequence was determined for three strains of S. saprophyticus (SEQ ID NOs. 74, 1093, and 1198). Both strands of the AP-PCR insert from the two selected clones were sequenced by the dideoxynucleotide chain termination sequencing method with SP6 and T7 sequencing primers by using the Applied Biosystems automated DNA sequencer (model 373A) with their PRISM™ Sequenase® Terminator Double-stranded DNA Sequencing Kit (Applied Biosystems, Foster City, Calif.).
Optimal species-specific amplification primers (SEQ ID NOs. 1208 and 1209) have been selected from the sequenced AP-PCR Staphylococcus saprophyticus DNA fragments with the help of the primer analysis software Oligo™ 5.0 (National BioSciences Inc). The selected primers were tested in PCR assays to verify their specificity and ubiquity. Data obtained with DNA preparations from reference ATCC strains of 49 gram-positive and 31 gram-negative bacterial species, including 28 different staphylococcal species, indicate that the selected primer pairs are specific for Staphylococcus saprophyticus since no amplification signal has been observed with DNAs from the other staphylococcal or bacterial species tested. This assay was able to amplify efficiently DNA from all 60 strains of S. saprophyticus from various origins tested. The sensitivity level achieved for three S. saprophyticus reference ATCC strains was around 6 genome copies.
The comparison of publicly available tuf sequences from a variety of bacterial species revealed conserved regions, allowing the design of PCR primers able to amplify tuf sequences from a wide range of bacterial species. Using primer pair SEQ ID NOs. 664 and 697, it was possible to amplify and determine tuf sequences SEQ ID NOs.: 1-73, 75-241, 607-618, 621, 662, 675, 717-736, 868-888, 932, 967-989, 992, 1002, 1572-1575, 1662-1663, 1715-1733, 1835-1837, 1877-1878, 1880-1881, 2183, 2185, 2200, 2201, and 2270-2272.
The comparison of publicly available recA sequences from a variety of bacterial species revealed conserved regions, allowing the design of PCR primers able to amplify recA sequences from a wide range of bacterial species. Using primer pairs SEQ ID NOs. 921-922 and 1605-1606, it was possible to amplify and determine recA sequences SEQ ID NOs.: 990-991, 1003, 1288-1289, 1714, 1756-1763, 1866-1873 and 2202-2212.
The analysis of tuf sequences from a variety of bacterial species allowed the selection of PCR primers (SEQ ID NOs. 1661 and 1665) and of an internal probe (SEQ ID NO. 2168) specific to Escherichia coli/Shigella sp. The strategy used to design the PCR primers was based on the analysis of a multiple sequence alignment of various tuf sequences. The multiple sequence alignment included the tuf sequences of Escherichia coli/Shigella sp. as well as tuf sequences from other species and bacterial genera, especially representatives of closely related species. A careful analysis of this alignment allowed the selection of oligonucleotide sequences which are conserved within the target species but which discriminate sequences from other species, especially from the closely related species, thereby permitting the species-specific and ubiquitous detection and identification of the target bacterial species.
The chosen primer pair, oligos SEQ ID NOs. 1661 and 1665, gives an amplification product of 219 bp. Standard PCR was carried out using 0.4 μM of each primer, 2.5 mM MgCl2, BSA 0.05 mM, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, dNTPs 0.2 mM (Pharmacia), 0.5 U Taq DNA polymerase (Promega) coupled with TaqStart™ antibody (Clontech Laboratories Inc.), 1 μl of genomic DNA sample in a final volume of 20 μl using a PTC-200 thermocycler (MJ Research). The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 60° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. Visualization of the PCR products was made under UV at 254 nm.
Specificity of the assay was tested by adding to the PCR reactions 0.1 ng of genomic DNA from each of the following bacterial species: Escherichia coli (7 strains), Shigella sonnei, Shigella flexneri, Shigella dysenteriae, Salmonella typhimyurium, Salmonella typhi, Salmonella enteritidis, Tatumella ptyseos, Klebsiella pneumoniae (2 strains), Enterobacter aerogenes, Citrobacter farmeri, Campylobacter jejuni, Serratia marcescens. Amplification was observed only for the Escherichia coli and Shigella sp. strains listed and Escherichia fergusonii. The sensitivity of the assay with 40-cycle PCR was verified with one strain of E. coli and three strains of Shigella sp. The detection limit for E. coli and Shigella sp. was 1 to 10 copies of genomic DNA, depending on the strains tested.
The analysis of atpD sequences from a variety of bacterial species allowed the selection of PCR primers specific to K. pneumoniae. The primer design strategy is similar to the strategy described in Example 28 except that atpD sequences were used in the alignment.
Two K. pneumoniae-specific primers were selected, (SEQ ID NOs. 1331 and 1332) which give an amplification product of 115 bp. Standard PCR was carried out on PTC-200 thermocyclers (MJ Research) using 0.4 μM of each primer as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were as follow: three minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 55° C., followed by terminal extension at 72° C. for 2 minutes.
Specificity of the assay was tested by adding to the PCR reactions 0.1 ng of genomic DNA from each of the following bacterial species: Klebsiella pneumoniae (2 strains), Klebsiella ornitholytica, Klebsiella oxytoca (2 strains), Klebsiella planticola, Klebsiella terrigena, Citrobacter freundii, Escherichia coli, Salmonella cholerasuis typhi, Serratia marcescens, Enterobacter aerogenes, Proteus vulgaris, Kluyvera ascorbata, Kluyvera georgiana, Kluyvera cryocrescens and Yersinia enterolitica. Amplification was detected for the two K. pneumoniae strains, K. planticola, K. terrigena and the three Kluyvera species tested. Analysis of the multiple alignment sequence of the atpD gene allowed the design of an internal probe SEQ ID NO. 2167 which can discriminate Klebsiella pneumoniae from other Klebsiella sp. and Kluyvera sp. The sensitivity of the assay with 40-cycle PCR was verified with one strain of K. pneumoniae. The detection limit for K. pneumoniae was around 10 copies of genomic DNA.
The analysis of atpD sequences from a variety of bacterial species allowed the selection of PCR primers specific to Acinetobacter baumannii. The primer design strategy is similar to the strategy described in Example 28.
Two A. baumannii-specific primers were selected, SEQ ID NOs. 1690 and 1691, which give an amplification product of 233 bp. Standard PCR was carried out on PTC-200 thermocyclers (MJ Research) using 0.4 μM of each primer as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were as follow: three minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 60° C., followed by terminal extension at 72° C. for 2 minutes.
Specificity of the assay was tested by adding to the PCR reactions 0.1 ng of genomic DNA from each of the following bacterial species: Acinetobacter baumannii (3 strains), Acinetobacter anitratus, Acinetobacter lwoffi, Serratia marcescens, Enterobacter cloacae, Enterococcus faecalis, Pseudomonas aeruginosa, Psychrobacter phenylpyruvicus, Neisseria gonorrheoae, Haemophilus haemoliticus, Yersinia enterolitica, Proteus vulgaris, Eikenella corrodens, Escherichia coli. Amplification was detected only for A. baumannii, A. anitratus and A. lwoffi. The sensitivity of the assay with 40-cycle PCR was verified with two strains of A. baumannii. The detection limit for the two A. baumannii strains tested was 5 copies of genomic DNA. Analysis of the multiple alignment sequence of the atpD gene allowed the design of a A. baumannii-specific internal probe (SEQ ID NO. 2169).
The analysis of tuf sequences from a variety of bacterial species allowed the selection of PCR primers specific to Neisseria gonorrhoeae. The primer design strategy is similar to the strategy described in Example 28.
Two N. gonorrhoeae-specific primers were selected, SEQ ID NOs. 551 and 552, which give an amplification product of 139 bp. PCR amplification was carried out on PTC-200 thermocyclers (MJ Research) using 0.4 μM of each primer as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were as follow: three minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 65° C., followed by terminal extension at 72° C. for 2 minutes.
Specificity of the assay was tested by adding into the PCR reactions, 0.1 ng of genomic DNA from each of the following bacterial species: Neisseria gonorrhoeae (19 strains), Neisseria meningitidis (2 strains), Neisseria lactamica, Neisseria flavescens, Neisseria animalis, Neisseria canis, Neisseria cuniculi, Neisseria elongata, Neisseria mucosa, Neisseria polysaccharea, Neisseria sicca, Neisseria subflava, Neisseria weaveri. Amplification was detected only for N. gonorrhoeae, N. sicca and N. polysaccharea. The sensitivity of the assay with 40-cycle PCR was verified with two strains of N. gonorrhoeae. The detection limit for the N. gonorrhoeae strains tested was 5 copies of genomic DNA. Analysis of the multiple alignment sequence of the tuf gene allowed the design of an internal probe, SEQ ID NO. 2166, which can discriminate N. gonorrhoeae from N. sicca and N. polysaccharea.
One of the major mechanism of resistance to quinolone in various bacterial species is mediated by target changes (DNA gyrase and/or topoisomerase IV). These enzymes control DNA topology and are vital for chromosome function and replication. Each of these enzymes is a tetramer composed of two subunits: GyrA and GyrB forming A2B2 complex in DNA gyrase; and ParC and ParE forming and C2E2 complex in DNA topoisomerase IV. It has been shown that they are hotspots, called the quinolone-resistance-determining region (QRDR) for mutations within gyrA that encodes for the GyrA subunit of DNA gyrase and within parC that encodes the parC subunit of topoisomerase IV.
In order to generate a database for gyrA and parC sequences that can be used for design of primers and/or probes for the specific detection of quinolone resistance in various bacterial species, gyrA and parC DNA fragments selected from public database (GenBanK and EMBL) from a variety of bacterial species were used to design oligonucleotide primers.
Using primer pair SEQ ID NOs. 1297 and 1298, it was possible to amplify and determine gyrA sequences from Klebsiella oxytoca (SEQ ID NO. 1764), Klebsiella pneumoniae subsp. ozaneae (SEQ ID NO. 1765), Klebsiella planticola (SEQ ID NO. 1766), Klebsiella pneumoniae (SEQ ID NO. 1767), Klebsiella pneumoniae subsp. pneumoniae (two strains) (SEQ ID NOs. 1768-1769), Klebsiella pneumoniae subsp. rhinoscleromatis (SEQ ID NO. 1770), Klebsiella terrigena (SEQ ID NO. 1771), Kluyvera ascorbata (SEQ ID NO. 2013), Kluyvera georgiana (SEQ ID NO. 2014) and Escherichia coli (4 strains) (SEQ ID NOs. 2277-2280). Using primer pair SEQ ID NOs. 1291 and 1292, it was possible to amplify and determine gyrA sequences from Legionella pneumophila subsp. pneumophila (SEQ ID NO. 1772), Proteus mirabilis (SEQ ID NO. 1773), Providencia rettgeri (SEQ ID NO. 1774), Proteus vulgaris (SEQ ID NO. 1775) and Yersinia enterolitica (SEQ ID NO. 1776). Using primer pair SEQ ID NOs. 1340 and 1341, it was possible to amplify and determine gyrA sequence from Staphylococcus aureus (SEQ ID NO. 1255).
Using primers SEQ ID NOs. 1318 and 1319, it was possible to amplify and determine parC sequences from K oxytoca (two strains) (SEQ ID NOs. 1777-1778), Klebsiella pneumoniae subsp. ozaenae (SEQ ID NO. 1779), Klebsiella planticola (SEQ ID NO. 1780), Klebsiella pneumoniae (SEQ ID NO. 1781), Klebsiella pneumoniae subsp. pneumoniae (two strains) (SEQ ID NOs. 1782-1783), Klebsiella pneumoniae subsp. rhinoscleromatis (SEQ ID NO. 1784) and Klebsiella terrigena (SEQ ID NO. 1785).
The analysis of gyrA and parC sequences from a variety of bacterial species revealed conserved regions allowing the design of PCR primers specific to the quinolone-resistance-determining region (QRDR) of gyrA and parC from Staphylococcus aureus. PCR primer pair SEQ ID NOs. 1340 and 1341 was designed to amplify the gyrA sequence of S. aureus, whereas PCR primer pair SEQ ID NOs. 1342 and 1343 was designed to amplify S. aureus parC. The comparison of gyrA and parC sequences from S. aureus strains with various levels of quinolone resistance allowed the identification of amino acid substitutions Ser-84 to Leu, Glu-88 to Gly or Lys in the GyrA subunit of DNA gyrase encoded by gyrA and amino acid changes Ser-80 to Phe or Tyr and Ala-116 to Glu in the ParC subunit of topoisomerase IV encoded by parC. These amino acid substitutions in GyrA and ParC subunits occur in isolates with intermediate- or high-level quinolone resistance. Internal probes for the specific detection of wild-type S. aureus gyrA (SEQ ID NO. 1940) and wild-type S. aureus parC (SEQ ID NO. 1941) as well as internal probes for the specific detection of each of the gyrA (SEQ ID NOs. 1333-1335) and parC mutations identified in quinolone-resistant S. aureus (SEQ ID NOs. 1336-1339) were designed.
The gyrA- and parC-specific primer pairs (SEQ ID NOs. 1340-1341 and SEQ ID NOs. 1342-1343) were used in multiplex. PCR amplification was carried out on PTC-200 thermocyclers (MJ Research) using 0.3, 0.3, 0.6 and 0.6 μM of each primers, respectively, as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 62° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by electrophoresis in agarose gels (2%) containing 0.25 μg/ml of ethidium bromide. The specificity of the multiplex assay with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from a panel of gram-positive bacteria. The list included the following: Abiotrophia adiacens, Abiotrophia defectiva, Bacillus cereus, Bacillus mycoides, Enterococcus faecalis (2 strains), Enterococcus flavescens, Gemella morbillorum, Lactococcus lactis, Listeria innocua, Listeria monocytogenes, Staphylococcus aureus (5 strains), Staphylococcus auricalis, Staphylococcus capitis subsp. urealyticus, Staphylococcus carnosus, Staphylococcus chromogenes, Staphylococcus epidermidis (3 strains), Staphylococcus gallinarum, Staphylococcus haemolyticus (2 strains), Staphylococcus hominis, Staphylococcus hominis subsp hominis, Staphylococcuslentus, Staphylococcus lugdunensis, Staphylococcus saccharolyticus, Staphylococcus saprophyticus (3 strains), Staphylococcus simulans, Staphylococcus warneri, Staphylococcus xylosus, Streptococcus agalactiae, Streptococcus pneumoniae. Strong amplification of both gyrA and parC genes was only detected for the S. aureus strains tested. The sensitivity of the multiplex assay with 40-cycle PCR was verified with one quinolone-sensitive and four quinolone-resistant strains of S. aureus. The detection limit was 2 to 10 copies of genomic DNA, depending on the strains tested.
Detection of the hybridization with the internal probes was performed as described in Example 7. The internal probes specific to wild-type gyrA and parC of S. aureus and to the gyrA and parC variants of S. aureus were able to recognize two quinolone-resistant and one quinolone-sensitive S. aureus strains showing a perfect correlation with the susceptibility to quinolones.
The complete assay for the specific detection of S. aureus and its susceptibility to quinolone contains the Staphylococcus-specific primers (SEQ ID NOs. 553 and 575) described in Example 7 and the multiplex containing the S. aureus gyrA- and parC-specific primer pairs (SEQ ID NOs. 1340-1341 and SEQ ID NOs. 1342-1343). Amplification is coupled with post-PCR hybridization with the internal probe specific to S. aureus (SEQ ID NO. 587) described in Example 7 and the internal probes specific to wild-type S. aureus gyrA and parC (SEQ ID NOs. 1940-1941) and to the S. aureus gyrA and parC variants (SEQ ID NOs. 1333-1338).
An assay was also developed for the detection of quinolone-resistant S. aureus using the SmartCycler (Cepheid). Real-time detection is based on the use of S. aureus parC-specific primers (SEQ ID NOs. 1342 and 1343) and the Staphylococcus-specific primers (SEQ ID NOs. 553 and 575) described in Example 7. Internal probes were designed for molecular beacon detection of the wild-type S. aureus parC (SEQ ID NO. 1939), for detection of the Ser-80 to Tyr or Phe amino acid substitutions in the ParC subunit encoded by S. aureus parC (SEQ ID NOs. 1938 and 1955) and for detection of S. aureus (SEQ ID NO. 2282).
The analysis of gyrA and parC sequences from a variety of bacterial species from the public databases and from the database described in Example 32 revealed conserved regions allowing the design of PCR primers specific to the quinolone-resistance-determining region (QRDR) of gyrA and parC from K. pneumoniae. PCR primer pair SEQ ID NOs. 1936 and 1937, or pair SEQ ID NOs. 1937 and 1942, were designed to amplify the gyrA sequence of K. pneumoniae, whereas PCR primer pair SEQ ID NOs. 1934 and 1935 was designed to amplify K. pneumoniae parC sequence. An alternative pair, SEQ ID NOs. 1935 and 1936, can also amplify K. pneumoniae parC. The comparison of gyrA and parC sequences from K. pneumoniae strains with various levels of quinolone resistance allowed the identification of amino acid substitutions Ser-83 to Tyr or Phe and Asp-87 to Gly or Ala and Asp-87 to Asn in the GyrA subunit of DNA gyrase encoded by gyrA and amino acid changes Ser-80 to Ile or Arg and Glu-84 to Gly or Lys in the ParC subunit of topoisomerase IV encoded by parC. These amino acid substitutions in the GyrA and ParC subunits occur in isolates with intermediate- or high-level quinolone resistance. Internal probes for the specific detection of wild-type K. pneumoniae gyrA (SEQ ID NO. 1943) and wild-type K. pneumoniae parC (SEQ ID NO. 1944) as well as internal probes for the specific detection of each of the gyrA (SEQ ID NOs. 1945-1949) and parC mutations identified in quinolone-resistant K. pneumoniae (SEQ ID NOs. 1950-1953) were designed.
Two multiplex using the K. pneumoniae gyrA- and parC-specific primer pairs were used: the first multiplex contained K. pneumoniae gyrA-specific primers (SEQ ID NOs. 1937 and 1942) and K. pneumoniae parC-specific primers (SEQ ID NOs. 1934 and 1935) and the second multiplex contained K. pneumoniae gyrA/parC-specific primer (SEQ ID NOs. 1936), K. pneumoniae gyrA-specific primer (SEQ ID NO. 1937) and K. pneumoniae parC-specific primer (SEQ ID NO. 1935). Standard PCR was carried out on PTC-200 thermocyclers (MJ Research) using for the first multiplex 0.6, 0.6, 0.4, 0.4 μM of each primer, respectively, and for the second multiplex 0.8, 0.4, 0.4 μM of each primer, respectively. PCR amplification and agarose gel electrophoresis of the amplified products were performed as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 62° C., followed by terminal extension at 72° C. for 2 minutes. The specificity of the two multiplex assays with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from a panel of gram-negative bacteria. The list included: Acinetobacter baumannii, Citrobacter freundii, Eikenella corrodens, Enterobacter aerogenes, Enterobacter cancerogenes, Enterobacter cloacae, Escherichia coli (10 strains), Haemophilus influenzae, Klebsiella pneumoniae, Klebsiella ornitholytica, Klebsiella oxytoca (2 strains), Klebsiella planticola, Klebsiella terrigena, Kluyvera ascorbata, Kluyvera cryocrescens, Kluyvera georgiana, Neisseria gonorrhoeae, Proteus mirabilis, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella choleraesuis subsp. typhimurium, Salmonella enteritidis, Serratia liquefaciens, Serratia marcescens and Yersinia enterocolytica. For both multiplex, strong amplification of both gyrA and parC was observed only for the K. pneumoniae strain tested. The sensitivity of the two multiplex assays with 40-cycle PCR was verified with one quinolone-sensitive strain of K. pneumoniae. The detection limit was around 10 copies of genomic DNA.
The complete assay for the specific detection of K. pneumoniae and its susceptibility to quinolone contains the Klebsiella-specific primers (SEQ ID NOs. 1331 and 1332) described in Example 29 and either the multiplex containing the K. pneumoniae gyrA- and parC-specific primers (SEQ ID NOs. 1935, 1936, 1937) or the multiplex containing the K. pneumoniae gyrA- and parC-specific primers (SEQ ID NOs. 1934, 1937, 1939, 1942). Amplification is coupled with post-PCR hybridization with the internal probe specific to K. pneumoniae (SEQ ID NO. 2167) described in Example 29 and the internal probes specific to wild-type K. pneumoniae gyrA and parC (SEQ ID NOs. 1943, 1944) and to the K. pneumoniae gyrA and parC variants (SEQ ID NOs. 1945-1949 and 1950-1953).
An assay was also developed for the detection of quinolone-resistant K. pneumoniae using the SmartCycler (Cepheid). Real-time detection is based on the use of resistant K. pneumoniae gyrA-specific primers (SEQ ID NOs. 1936 and 1937) and the K. pneumoniae-specific primers (SEQ ID NOs. 1331 and 1332) described in Example 29. Internal probes were designed for molecular beacon detection of the wild-type K. pneumoniae gyrA (SEQ ID NO. 2251), for detection of the Ser-83 to Tyr or Phe and/or Asp-87 to Gly or Asn in the GyrA subunit of DNA gyrase encoded by gyrA (SEQ ID NOs. 2250) and for detection of K. pneumoniae (SEQ ID NO. 2281).
The analysis of gyrA and parC sequences from a variety of bacterial species revealed conserved regions allowing the design of PCR primers able to amplify the quinolone-resistance-determining region (QRDR) of gyrA and parC from all S. pneumoniae strains. PCR primer pair SEQ ID NOs. 2040 and 2041 was designed to amplify the QRDR of S. pneumoniae gyrA, whereas PCR primer pair SEQ ID NOs. 2044 and 2045 was designed to amplify the QRDR of S. pneumoniae parC. The comparison of gyrA and parC sequences from S. pneumoniae strains with various levels of quinolone resistance allowed the identification of amino acid substitutions Ser-81 to Phe or Tyr in the GyrA subunit of DNA gyrase encoded by gyrA and amino acid changes Ser-79 to Phe in the ParC subunit of topoisomerase IV encoded by parC. These amino acid substitutions in the GyrA and ParC subunits occur in isolates with intermediate- or high-level quinolone resistance. Internal probes for the specific detection of each of the gyrA (SEQ ID NOs. 2042 and 2043) and parC (SEQ ID NO. 2046) mutations identified in quinolone-resistant S. pneumoniae were designed.
For all bacterial species, amplification was performed from purified genomic DNA. 1 μl of genomic DNA at 0.1 ng/μL was transferred directly to a 19 μl PCR mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.4 μM (each) of the above primers SEQ ID NOs. 2040, 2041, 2044 and 2045, 0.05 mM bovine serum albumin (BSA) and 0.5 U Taq polymerase coupled with TaqStart™ antibody. The optimal cycling conditions for maximum sensitivity' and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 58° C., followed by terminal extension at 72° C. for 2 minutes. In order to generate Digoxigenin (DIG)-labeled amplicons for capture probe hybridization, 0.1×PCR DIG labeling four deoxynucleoside triphosphates mix (Boehringer Mannheim GmbH) was used for amplification.
The DIG-labeled amplicons were hybridized to the capture probes bound to 96-well plates. The plates were incubated with anti-DIG-alkaline phosphatase and the chemiluminescence was measured by using a luminometer (MLX, Dynex Technologies Inc.) after incubation with CSPD and recorded as Relative Light Unit (RLU). The RLU ratio of tested sample with and without captures probes was then calculated. A ratio 2.0 was defined as a positive hybridization signal. All reactions were performed in duplicate.
The specificity of the multiplex assay with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from a panel of bacteria listed in Table 13. Strong amplification of both gyrA and parC was detected only for the S. pneumoniae strains tested. Weak amplification of both gyrA and parC genes was detected for Staphylococcus simulans. The detection limit tested with purified genomic DNA from 5 strains of S. pneumoniae was 1 to 10 genome copies. In addition, 5 quinolone-resistant and 2 quinolone-sensitive clinical isolates of S. pneumoniae were tested to further validate the developed multiplex PCR coupled with capture probe hybridization assays. There was a perfect correlation between detection of S. pneumoniae gyrA and parC mutations and the susceptibility to quinolone.
The complete assay for the specific detection of S. pneumoniae and its susceptibility to quinolone contains the S. pneumoniae-specific primers (SEQ ID NOs. 1179 and 1181) described in Example 20 and the multiplex containing the S. pneumoniae gyrA-specific and parC-specific primer pairs (SEQ ID NOS. 2040 and 2041 and SEQ ID NOs. 2044 and 2045). Amplification is coupled with post-PCR hybridization with the internal probe specific to S. pneumoniae (SEQ ID NO. 1180) described in Example and the internal probes specific to each of the S. pneumoniae gyrA and parC variants (SEQ ID NOs. 2042, 2043 and 2046).
The analysis of TEM sequences which confer resistance to third-generation cephalosporins and to β-lactamase inhibitors allowed the identification of amino acid substitutions Met-69 to Ile or Leu or Val, Ser-130 to Gly, Arg-164 to Ser or His, Gly-238 to Ser, Glu-240 to Lys and Arg-244 to Ser or Cys or Thr or His or Leu. PCR primers SEQ ID NOs. 1907 and 1908 were designed to amplify TEM sequences. Internal probes for the specific detection of wild-type TEM (SEQ ID NO. 2141) and for each of the amino acid substitutions (SEQ ID NOs. 1909-1926) identified in TEM variants were designed to detect resistance to third-generation cephalosporins and to β-lactamase inhibitors. Design and synthesis of primers and probes, and detection of the hybridization were performed as described in Example 7.
For all bacterial species, amplification was performed from purified genomic DNA. One μl of genomic DNA at 0.1 ng/μl was transferred directly to a 19 μl PCR mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0); 0.1% Triton X-100, 2.5 mM MgCl2, 0.4 μM of the TEM-specific primers SEQ ID NOs. 1907 and 1908, 200 μM (each) of the four deoxynucleoside triphosphates, 0.05 mM bovine serum albumin (BSA) and 0.5 U Taq polymerase (Promega) coupled with TaqStart™ antibody. PCR amplification and agarose gel analysis of the amplified products were performed as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of three steps consisting of 5 seconds at 95° C., 30 seconds at 55° C. and 30 seconds at 72° C., followed by terminal extension at 72° C. for 2 minutes.
The specificity of the TEM-specific primers with 40-cycle PCR was verified by using 0.1 ng of purified genomic from the following bacteria: three third-generation cephalosporin-resistant Escherichia coli strains (one with TEM-10, one with TEM-28 and the other with TEM-49), two third-generation cephalosporin-sensitive Escherichia coli strain (one with TEM-1 and the other without TEM), one third-generation cephalosporin-resistant Klebsiella pneumoniae strain (with TEM-47), and one β-lactamase-inhibitor-resistant Proteus mirabilis strain (with TEM-39). Amplification with the TEM-specific primers was detected only for strains containing TEM.
The sensitivity of the assay with 40-cycle PCR was verified with three E. coli strains containing TEM-1 or TEM-10 or TEM-49, one K. pneumoniae strain containing TEM-47 and one P. mirabilis strain containing TEM-39. The detection limit was 5 to 100 copies of genomic DNA, depending on the TEM-containing strains tested.
The TEM-specific primers SEQ ID NOs. 1907 and 1908 were used in multiplex with the Escherichia coli/Shigella sp.-specific primers SEQ ID NOs. 1661 and 1665 described in Example 28 to allow the complete identification of Escherichia coli/Shigella sp. and the susceptibility to β-lactams. PCR amplification with 0.4 μM of each of the primers and agarose gel analysis of the amplified products was performed as described above.
The specificity of the multiplex with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from the following bacteria: three third-generation cephalosporin-resistant Escherichia coli strains (one with TEM-10, one with TEM-28 and the other with TEM-49), two third-generation cephalosporin-sensitive Escherichia coli strain (one with TEM-1 and the other without TEM), one third-generation cephalosporin-resistant Klebsiella pneumoniae strain (with TEM-47), and one β-lactamase-inhibitor-resistant Proteus mirabilis strain (with TEM-39). The multiplex was highly specific to Escherichia coli strains containing TEM.
The complete assay for detection of TEM-type β-lactamases in E. coli includes PCR amplification using the multiplex containing the TEM-specific primers (SEQ ID NOs. 1907 and 1908) and the Escherichia coli/Shigella sp.-specific primers (SEQ ID NOs. 1661 and 1665) coupled with post PCR-hybridization with the internal probes specific to wild-type TEM (SEQ ID NO. 2141) and to the TEM variants (SEQ ID NOs. 1909-1926).
The comparison of SHV sequences, which confer resistance to third-generation cephalosporins and to β-lactamase inhibitors, allowed the identification of amino acid substitutions Ser-130 to Gly, Asp-179 to Ala or Asn, Gly-238 to Ser, and Glu-240 to Lys. PCR primer pair SEQ ID NOs. 1884 and 1885 was designed to amplify SHV sequences. Internal probes for the specific identification of wild-type SHV (SEQ ID NO. 1896) and for each of the amino acid substitutions (SEQ ID NOs. 1886-1895 and 1897-1898) identified in SHV variants were designed to detect resistance to third-generation cephalosporins and to β-lactamase inhibitors. Design and synthesis of primers and probes, and detection of the hybridization were performed as described in Example 7.
For all bacterial species, amplification was performed from purified genomic DNA. One μl of genomic DNA at 0.1 ng/μl was transferred directly to a 19 μl PCR mixture. Each PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.4 μM of the SHV-specific primers SEQ ID NO. 1884 and 1885, 200 μM (each) of the four deoxynucleoside triphosphates, 0.05 mM bovine serum albumin (BSA) and 0.5 U Taq polymerase (Promega) coupled with TaqStart™ antibody. PCR amplification and agarose gel analysis of the amplified products were performed as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were 3 minutes at 95° C. for initial denaturation, then forty cycles of three steps consisting of 5 seconds at 95° C., 30 seconds at 55° C. and 30 seconds at 72° C., followed by terminal extension at 72° C. for 2 minutes.
The specificity of the SHV-specific primers with 40-cycle PCR was verified by using 0.1 ng of purified genomic from the following bacteria: two third-generation cephalosporin-resistant Klebsiella pneumoniae strains (one with SHV-2a and the other with SHV-12), one third-generation cephalosporin-sensitive Klebsiella pneumoniae strain (with SHV-1), two third-generation cephalosporin-resistant Escherichia coli strains (one with SHV-8 and the other with SHV-7), and two third-generation cephalosporin-sensitive Escherichia coli strains (one with SHV-1 and the other without any SHV). Amplification with the SHV-specific primers was detected only for strains containing SHV.
The sensitivity of the assay with 40-cycle PCR was verified with four strains containing SHV. The detection limit was 10 to 100 copies of genomic DNA, depending on the SHV-containing strains tested.
The amplification was coupled with post-PCR hybridization with the internal probes specific for identification of wild-type SHV (SEQ ID NO. 1896) and for each of the amino acid substitutions (SEQ ID NOs. 1886-1895 and 1897-1898) identified in SHV variants. The specificity of the probes was verified with six strains containing various SHV enzymes, one Klebsiella pneumoniae strain containing SHV-1, one Klebsiella pneumoniae strain containing SHV-2a, one Klebsiella pneumoniae strain containing SHV-12, one Escherichia coli strain containing SHV-1, one Escherichia coli strain containing SHV-7 and one Escherichia coli strain containing SHV-8. The probes correctly detected each of the SHV genes and their specific mutations. There was a perfect correlation between the SHV genotype of the strains and the susceptibility to β-lactam antibiotics.
The SHV-specific primers SEQ ID NOs. 1884 and 1885 were used in multiplex with the K. pneumoniae-specific primers SEQ ID NOs. 1331 and 1332 described in Example 29 to allow the complete identification of K. pneumoniae and the susceptibility to β-lactams. PCR amplification with 0.4 μM of each of the primers and agarose gel analysis of the amplified products were performed as described above.
The specificity of the multiplex with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from the following bacteria: three K. pneumoniae strains containing SHV-1, one Klebsiella pneumoniae strain containing SHV-2a, one Klebsiella pneumoniae strain containing SHV-12, one K. rhinoscleromatis strain containing SHV-1, one Escherichia coli strain without SHV. The multiplex was highly specific to Klebsiella pneumoniae strain containing SHV.
The analysis of publicly available tetM sequences revealed conserved regions allowing the design of PCR primers specific to tetM sequences. The PCR primer pair SEQ ID NOs. 1588 and 1589 was used in multiplex with the Neisseria gonorrhoeae-specific primers SEQ ID NOs. 551 and 552 described in Example 31. Sequence alignment analysis of tetM sequences revealed regions suitable for the design of an internal probe specific to tetM (SEQ ID NO. 2254). PCR amplification was carried out on PTC-200 thermocyclers (MJ Research) using 0.4 μM of each primer pair as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were as follow: three minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 60° C., followed by terminal extension at 72° C. for 2 minutes.
The specificity of the multiplex PCR assay with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from the following bacteria: two tetracycline-resistant Escherichia coli strains (one containing the tetracycline-resistant gene tetB and the other containing the tetracycline-resistant gene tetC), one tetracycline-resistant Pseudomonas aeruginosa strain (containing the tetracycline-resistant gene tetA), nine tetracycline-resistant Neisseria gonorrhoeae strains, two tetracycline-sensitive Neisseria meningitidis strains, one tetracycline-sensitive Neisseria polysaccharea strain, one tetracycline-sensitive Neisseria sicca strain and one tetracycline-sensitive Neisseria subflava strain. Amplification with both the tetM-specific and Neisseria gonorrhoeae-specific primers was detected only for N. gonorrhoeae strains containing tetM. There was a weak amplification signal using Neisseria gonorrhoeae-specific primers for the following species: Neisseria sicca, Neisseria polysaccharea and Neisseria meningitidis. There was a perfect correlation between the tetM genotype and the tetracycline susceptibility pattern of the Neisseria gonorrhoeae strains tested. The internal probe specific to N. gonorrhoeae SEQ ID NO. 2166 described in Example 31 can discriminate Neisseria gonorrhoeae from the other Neisseria sp.
The sensitivity of the assay with 40-cycle PCR was verified with two tetracycline resistant strains of N. gonorrhoeae. The detection limit was 5 copies of genomic DNA for both strains.
The analysis of publicly available dhfrIa and other dhfr sequences revealed regions allowing the design of PCR primers specific to dhfrIa sequences. The PCR primer pair (SEQ ID NOs. 1459 and 1460) was used in multiplex with the Escherichia coli/Shigella sp.-specific primers SEQ ID NOs. 1661 and 1665 described in Example 28. Sequence alignment analysis of dhfrIa sequences revealed regions suitable for the design of an internal probe specific to dhfrIa (SEQ ID NO. 2253). PCR amplification and agarose gel analysis of the amplified products were performed as described in Example 28 with an annealing temperature of 60° C. The specificity of the multiplex assay with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from a panel of bacteria. The list included the following trimethoprim-sensitive strains, Salmonella typhimyurium, Salmonella typhi, Salmonella enteritidis, Tatumella ptyseos, Klebsiella pneumoniae, Enterobacter aerogenes, Citrobacter farmeri, Campylobacter jejuni, Serratia marcescens, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, six trimethoprim-resistant Escherichia coli strains (containing dhfrIa or dhfrV or dhfrVII or dhfrXII or dhfrXIII or dhfrXV), four trimethoprim-resistant strains containing dhfrIa (Shigella sonnei, Shigella flexneri, Shigella dysenteriae and Escherichia coli). There was a perfect correlation between the dhfrIa genotype and the trimethoprim susceptibility pattern of the Escherichia coli and Shigella sp. strains tested. The dhfrIa primers were specific to the dhfrIa gene and did not amplify any of the other trimethoprim-resistant dhfr genes tested. The sensitivity of the multiplex assay with 40-cycle PCR was verified with three strains of trimethoprim-resistant strains of Shigella sp. The detection limit was 5 to 10 genome copies of DNA, depending on the Shigella sp. strains tested.
The comparison of publicly available aph(3′)-VIa sequence revealed regions allowing the design of PCR primers specific to aph(3)-VIa. The PCR primer pair (SEQ ID NOs. 1404 and 1405) was used in multiplex with the Acinetobacter baumannii-specific primers SEQ ID NOs. 1692 and 1693 described in Example 30. Analysis of the aph(3)-VIa sequence revealed region suitable for the design of an internal probe specific to aph(3′)-VIa (SEQ ID NO. 2252). PCR amplification and agarose gel analysis of the amplified products were performed as described in Example 28. The specificity of the multiplex assay with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA from a panel of bacteria including: two aminoglycoside-resistant A. baumanni strains (containing aph(3)-VIa), one aminoglycoside-sensitive A. baumani strain, one of each of the following aminoglycoside-resistant bacteria, one Serratia marcescens strain containing the aminoglycoside-resistant gene aacC1, one Serratia marcescens strain containing the aminoglycoside-resistant gene aacC4, one Enterobacter cloacae strain containing the aminoglycoside-resistant gene aacC2, one Enterococcus faecalis containing the aminoglycoside-resistant gene aacA-aphD, one Pseudomonas aeruginosa strain containing the aminoglycoside-resistant gene aac6IIa and one of each of the following aminoglycoside-sensitive bacterial species, Acinetobacter anitratus, Acinetobacter lwoffi, Psychobbacter phenylpyruvian, Neisseria gonorrhoeae, Haemophilus haemolyticus, Haemophilus influenzae, Yersinia enterolitica, Proteus vulgaris, Eikenella corrodens, Escherichia coli. There was a perfect correlation between the aph(3′)-VIa genotype and the aminoglycoside susceptibility pattern of the A. baumannii strains tested. The aph(3)-VIa-specific primers were specific to the aph(3)-VIa gene and did not amplify any of the other aminoglycoside-resistant genes tested. The sensitivity of the multiplex assay with 40-cycle PCR was verified with two strains of aminoglycoside-resistant strains of A. baumannii. The detection limit was 5 genome copies of DNA for both A. baumannii strains tested.
The comparison of atpD (V-type) sequences from a variety of bacterial species allowed the selection of PCR primers for Bacteroides fragilis. The strategy used to design the PCR primers was based on the analysis of a multiple sequence alignment of various atpD sequences from B. fragilis, as well as atpD sequences from the related species B. dispar, bacterial genera and archaea, especially representatives with phylogenetically related atpD sequences. A careful analysis of this alignment allowed the selection of oligonucleotide sequences which are conserved within the target species but which discriminate sequences from other species, especially from closely related species B. dispar, thereby permitting the species-specific and ubiquitous detection and identification of the target bacterial species.
The chosen primer pair, SEQ ID NOs. 2134-2135, produces an amplification product of 231 bp. Standard PCR was carried out on PTC-200 thermocyclers (MJ Research Inc.) using 0.4 μM of each primers pair as described in Example 28. The optimal cycling conditions for maximum sensitivity and specificity were as follows: three minutes at 95° C. for initial denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 60° C., followed by terminal extension at 72° C. for 2 minutes.
The format of this assay is not limited to the one described above. A person skilled in the art could adapt the assay for different formats such as PCR with real-time detection using molecular beacon probes. Molecular beacon probes designed to be used in this assay include, but are not limited to, SEQ ID NO. 2136 for the detection of the B. fragilis amplicon.
The elongation factor Tu, encoded by tuf genes, is a GTP binding protein that plays a central role in protein synthesis. One to three tuf genes per genome are present depending on the bacterial species. Most low G+C gram-positive bacteria carry only one tuf gene. We have designed degenerate PCR primers derived from consensus sequences of the tuf gene to amplify partial tuf sequences from 17 enterococcal species and other phylogenetically related species. The amplified DNA fragments were sequenced either by direct sequencing or by sequencing cloned inserts containing putative amplicons. Two different tuf genes (tufA and tufB) were found in 11 enterococcal species, including Enterococcus avium, E. casseliflavus, E. dispar, E. durans, E. faecium, E. gallinarum, E. hirae, E. malodoratus, E. mundtii, E. pseudoavium, and E. raffinosus. For the other six enterococcal species (E. cecorum, E. columbae, E. faecalis, E. sulfureus, E. saccharolyticus, and E. solitarius), only the tufA gene was present. Based on 16S rRNA gene sequence analysis, the 11 species having two tuf genes all share a common ancestor, while the six species having only one copy diverged from the enterococcal lineage before that common ancestor. The presence of one or two copies of the tuf gene in enterococci was confirmed by Southern hybridization. Phylogenetic analysis of tuf sequences demonstrated that the enterococcal tufA gene branches with the Bacillus, Listeria and Staphylococcus genera, while the enterococcal tufB gene clusters with the genera Streptococcus and Lactococcus. Primary structure, analysis showed that four amino acid residues within the sequenced regions are conserved and unique to the enterococcal tufB genes and the tuf genes of streptococci and L. lactis. The data suggest that an ancestral streptococcus or a streptococcus-related species may have horizontally transferred a tuf gene to the common ancestor of the 11 enterococcal species which now carry two tuf genes.
The elongation factor Tu (EF-Tu) is a GTP binding protein playing a central role in protein synthesis. It mediates the recognition and transport of aminoacyl-tRNAs and their positioning to the A-site of the ribosome. The highly conserved function and ubiquitous distribution render the elongation factor a valuable phylogenetic marker among eubacteria and even throughout the archaebacterial and eukaryotic kingdoms. The tuf genes encoding elongation factor Tu are present in various copy numbers per bacterial genome. Most gram-negative bacteria contain two tuf genes. As found in Escherichia coli, the two genes, while being almost identical in sequence, are located in different parts of the bacterial chromosome. However, recently completed microbial genomes revealed that only one tuf gene is found in Helicobacter pylori as well as in some obligate parasitic bacteria, such as Borrelia burgdorferi, Rickettsia prowazekii, and Treponema pallidum, and in some cyanobacteria. In most gram-positive bacteria studied so far, only one tuf gene was found. However, Southern hybridization showed that there are two tuf genes in some clostridia as well as in Streptomyces coelicolor and S. lividans. Up to three tuf-like genes have been identified in S. ramocissimus.
Although massive prokaryotic gene transfer is suggested to be one of the factors responsible for the evolution of bacterial genomes, the genes encoding components of the translation machinery are thought to be highly conserved and difficult to be transferred horizontally due to the complexity of their interactions. However, a few recent studies demonstrated evidence that horizontal gene transfer has also occurred in the evolution of some genes coding for the translation apparatus, namely, 16S rRNA and some aminoacyl-tRNA synthetases. No further data suggest that such a mechanism is involved in the evolution of the elongation factors. Previous studies concluded that the two copies of tuf genes in the genomes of some bacteria resulted from an ancient event of gene duplication. Moreover, a study of the tuf gene in R. prowazekii suggested that intrachromosomal recombination has taken place in the evolution of the genome of this organism.
To date, little is known about the tuf genes of enterococcal species. In this study, we analyzed partial sequences of tuf genes in 17 enterococcal species, namely, E. avium, E. casseliflavus, E. cecorum, E. columbae, E. dispar, E. durans, E. faecalis, E. faecium, E. gallinarum, E. hirae, E. malodoratus, E. mundtii, E. pseudoavium, E. raffinosus, E. saccharolyticus, E. solitarius, and E. sulfureus. We report here the presence of two divergent copies of tuf genes in 11 of these enterococcal species. The 6 other species carried a single tuf gene. The evolutionary implications are discussed.
Bacterial strains. Seventeen enterococcal strains and other gram-positive bacterial strains obtained from the American Type Culture Collection (ATCC, Manassas, Va.) were used in this study (Table 16). All strains were grown on sheep blood agar or in brain-heart infusion broth prior to DNA isolation.
DNA isolation. Bacterial DNAs were prepared using the G NOME DNA extraction kit (Bio101, Vista, Calif.) as previously described.
Sequencing of putative tuf genes. In order to obtain the tuf gene sequences of enterococci and other gram-positive bacteria, two sequencing approaches were used: 1) sequencing of cloned PCR products and 2) direct sequencing of PCR products. A pair of degenerate primers (SEQ ID NOs. 664 and 697) were used to amplify an 886-bp portion of the tuf genes from enterococcal species and other gram-positive bacteria as previously described. For E. avium, E. casseliflavus, E. dispar, E. durans, E. faecium, E. gallinarum, E. hirae, E. mundtii, E. pseudoavium, and E. raffinosus, the amplicons were cloned using the Original TA cloning kit (Invitrogen, Carlsbad, Calif.) as previously described. Five clones for each species were selected for sequencing. For E. cecorum, E. faecalis, E. saccharolyticus, and E. solitarius as well as the other gram-positive bacteria, the sequences of the 886-bp amplicons were obtained by direct sequencing. Based on the results obtained from the earlier rounds of sequencing, two pairs of primers were designed for obtaining the partial tuf sequences from the other enterococcal species by direct sequencing. One pair of primers (SEQ ID NOs. 543 and 660) were used to amplify the enterococcal tuf gene fragments from E. columbae, E. malodoratus, and E. sulfureus. Another pair of primers (SEQ ID NOs. 664 and 661) were used to amplify the second tuf gene fragments from E. avium, E. malodoratus, and E. pseudoavium.
Prior to direct sequencing, PCR products were electrophoresed on 1% agarose gel at 120V for 2 hours. The gel was then stained with 0.02% methylene blue for 30 minutes and washed twice with autoclaved distilled water for 15 minutes. The gel slices containing PCR products of the expected sizes were cut out and purified with the QIAquick gel extraction kit (QIAgen Inc., Mississauga, Ontario, Canada) according to the manufacturer's instructions. PCR mixtures for sequencing were prepared as described previously. DNA sequencing was carried out with the Big Dye™ Terminator Ready Reaction cycle sequencing kit using a 377 DNA sequencer (PE Applied Biosystems, Foster City, Calif.). Both strands of the amplified DNA were sequenced. The sequence data were verified using the Sequencer™ 3.0 software (Gene Codes Corp., Ann Arbor, Mich.).
Sequence analysis and phylogenetic study. Nucleotide sequences of the tuf genes and their respective flanking regions for E. faecalis, Staphylococcus aureus, and Streptococcus pneumoniae, were retrieved from the TIGR microbial genome database and S. pyogenes from the University of Oklahoma database. DNA sequences and deduced protein sequences obtained in this study were compared with those in all publicly available databases using the BLAST and FASTA programs. Unless specified, sequence analysis was conducted with the programs from GCG package (Version 10; Genetics Computer Group, Madison, Wis.). Sequence alignment of the tuf genes from 74 species representing all three kingdoms of life (Tables 16 and 17) were carried out by use of Pileup and corrected upon visual analysis. The N- and C-termini extremities of the sequences were trimmed to yield a common block of 201 amino acids sequences and equivocal residues were removed. Phylogenetic analysis was performed with the aid of PAUP 4.0b4 written by Dr. David L. Swofford (Sinauer Associates, Inc., Publishers, Sunderland, Mass.). The distance matrix and maximum parsimony were used to generate phylogenetic trees and bootstrap resampling procedures were performed using 500 and 100 replications in each analysis, respectively.
Protein structure analysis. The crystal structures of (i)Thermus aquaticus EF-Tu in complex with Phe-tRNAPhe and a GTP analog and (ii) E. coli EF-Tu in complex with GDP served as templates for constructing the equivalent models for enterococcal EF-Tu. Homology modeling of protein structure was performed using the SWISS-MODEL server and inspected using the SWISS-PDB viewer version 3.1.
Southern hybridization. In a previous study, we amplified and cloned an 803-bp PCR product of the tuf gene fragment from E. faecium. Two divergent sequences of the inserts, which we assumed to be tufA and tufB genes, were obtained. The recombinant plasmid carrying either tufA or tufB sequence was used to generate two probes labeled with Digoxigenin (DIG)-11-dUTP by PCR incorporation following the instructions of the manufacturer (Boehringer Mannheim, Laval, Québec, Canada). Enterococcal genomic DNA samples (1-2 μg) were digested to completion with restriction endonucleases BglII and XbaI as recommended by the supplier (Amersham Pharmacia Biotech, Mississauga, Ontario, Canada). These restriction enzymes were chosen because no restriction sites were observed within the amplified tuf gene fragments of most enterococci. Southern blotting and filter hybridization were performed using positively charged nylon membranes (Boehringer Mannheim) and QuikHyb hybridization solution (Stratagene Cloning Systems, La Jolla, Calif.) according to the manufacturers' instructions with modifications. Twenty μl of each digestion were electrophoresed for 2 h at 120V on a 0.8% agarose gel. The DNA fragments were denatured with 0.5 M NaOH and transferred by Southern blotting onto a positively charged nylon membrane (Boehringer Mannheim). The filters were pre-hybridized for 15 min and then hybridized for 2 h in the QuikHyb solution at 68° C. with either DIG-labeled probe. Posthybridization washings were performed twice with 0.5×SSC, 1% SDS at room temperature for 15 min and twice in the same solution at 60° C. for 15 min. Detection of bound probes was achieved using disodium 3-(4-methoxyspiro(1,2-dioxetane-3,2′-(5′-chloro) tricyclo(3,3.1.13.7) decan)-4-yl) phenyl phosphate (CSPD) (Boehringer Mannheim) as specified by the manufacturer.
GenBank submission. The GenBank accession numbers for partial tuf gene sequences generated in this study are given in Table 16.
Sequencing and nucleotide sequence analysis. In this study, all gram-positive bacteria other than enterococci yielded a single tuf sequence of 886 by using primers SEQ ID NOs. 664 and 697 (Table 16). Each of four enterococcal species including E. cecorum, E. faecalis, E. saccharolyticus, and E. solitarius also yielded one 886-bp tuf sequence. On the other hand, for E. avium, E. casseliflavus, E. dispar, E. durans, E. faecium, E. gallinarum, E. hirae, E. mundtii, E. pseudoavium, and E. raffinosus, direct sequencing of the 886-bp fragments revealed overlapping peaks according to their sequence chromatograms, suggesting the presence of additional copies of the tuf gene. Therefore, the tuf gene fragments of these 10 species were cloned first and then sequenced. Sequencing data revealed that two different types of tuf sequences (tufA and tufB) are found in eight of these species including E. casseliflavus, E. dispar, E. durans, E. faecium, E. gallinarum, E. hirae, E. mundtii, and E. raffinosus. Five clones from E. avium and E. pseudoavium yielded only a single tuf sequence. These new sequence data allowed the design of new primers specific for the enterococcal tufA or tufB sequences. Primers SEQ ID NOs. 543 and 660 were designed to amplify only enterococcal tufA sequences and a 694-bp fragment was amplified from all 17 enterococcal species. The 694-bp sequences of tufA genes from E. columbae, E. malodoratus, and E. sulfureus were obtained by direct sequencing using these primers. Primers SEQ ID NOs. 664 and 661 were designed for the amplification of 730-bp portion of tufB genes and yielded the expected fragments from 11 enterococcal species, including E. malodoratus and the 10 enterococcal species in which heterogeneous tuf sequences were initially found. The sequences of the tufB fragments for E. avium, E. malodoratus and E. pseudoavium were determined by direct sequencing using the primers SEQ ID NOs. 664 and 661. Overall, tufA gene fragments were obtained from all 17 enterococcal species but tufB gene fragments were obtained with only 11 enterococcal species (Table 16).
The identities between tufA and tufB for each enterococcal species were 68-79% at the nucleotide level and 81 to 89% at the amino acid level. The tufA gene is highly conserved among all enterococcal species with identities varying from 87% to 99% for DNA and 93% to 99% for amino acid sequences, while the identities among tufB genes of enterococci varies from 77% to 92% for DNA and 91% to 99% for amino acid sequences, indicating their different origins and evolution (Table 18). Since E. solitarius has been transferred to the genus Tetragenococcus, which is also a low G+C gram-positive bacterium, our sequence comparison did not include this species as an enterococcus. G+C content of enterococcal tufA sequences ranged from 40.8% to 43.1%, while that of enterococcal tufB sequences varied from 37.8% to 46.3%. Based on amino acid sequence comparison, the enterococcal tufA gene products share higher identities with those of Abiotrophia adiacens, Bacillus subtilis, Listeria monocytogenes, S. aureus, and S. epidermidis. On the other hand, the enterococcal tufB gene products share higher percentages of amino acid identity with the tuf genes of S. pneumoniae, S. pyogenes and Lactococcus lactis (Table 18).
In order to elucidate whether the two enterococcal tuf sequences encode genuine EF-Tu, the deduced amino acid sequences of both genes were aligned with other EF-Tu sequences available in SWISSPROT (Release 38). Sequence alignment demonstrated that both gene products are highly conserved and carry all conserved residues present in this portion of prokaryotic EF-Tu (
Based on the deduced amino acid sequences, the enterococcal tufB genes have unique conserved residues Lys129, Leu140, Ser230, and Asp234 (E. coli numbering) that are also conserved in streptococci and L. lactis, but not in the other bacteria (
The tuf gene sequences obtained for E. faecalis, S. aureus, S. pneumoniae and S. pyogenes were compared with their respective incomplete genome sequence. Contigs with more than 99% identity were identified. Analysis of the E. faecalis genome data revealed that the single E. faecalis tuf gene is located within an str operon where tuf is preceded by fus that encodes the elongation factor G. This str operon is present in S. aureus and B. subtilis but not in the two streptococcal genomes examined. The 700-bp or so sequence upstream the S. pneumoniae tuf gene has no homology with any known gene sequences. In S. pyogenes, the gene upstream of tuf is similar to a cell division gene, ftsW, suggesting that the tuf genes in streptococci are not arranged in a str operon.
Phylogenetic analysis. Phylogenetic analysis of the tuf amino acid sequences with representatives of eubacteria, archeabacteria, and eukaryotes using neighbor-joining and maximum parsimony methods showed three major clusters representing the three kingdoms of life. Both methods gave similar topologies consistent with the rRNA gene data (data not shown). Within the bacterial clade, the tree is polyphyletic but tufA genes from all enterococcal species always clustered with those from other low G+C gram-positive bacteria (except for streptococci and lactococci), while the tufB genes of the 11 enterococcal species form a distinct cluster with streptococci and L. lactis (
Southern hybridization. Southern hybridization of BglII/XbaI digested genomic DNA from 12 enterococcal species tested with the tufA probe (DIG-labeled tufA fragment from E. faecium) yielded two bands of different sizes in 9 species, which also carried two divergent tuf sequences according to their sequencing data. For E. faecalis and E. solitarius, a single band was observed indicating that one tuf gene is present (
In this study, we have shown that two divergent copies of genes encoding the elongation factor Tu are present in some enterococcal species. Sequence data revealed that both genes are highly conserved at the amino acid level. One copy (tufA) is present in all enterococcal species, while the other (tufB) is present only in 11 of the 17 enterococcal species studied. Based on 16S rRNA sequence analysis, these 11 species are members of three different enterococcal subgroups (E. avium, E. faecium, and E. gallinarum species groups) and a distinct species (E. dispar). Moreover, 16S rDNA phylogeny suggests that these 11 species possessing 2 tuf genes all share a common ancestor before they further evolved to become the modern species. Since the six other species having only one copy diverged from the enterococcal lineage before that common ancestor, it appears that the presence of one tuf gene in these six species is not attributable to gene loss.
Two clusters of low G+C gram-positive bacteria were observed in the phylogenetic tree of the tuf genes: one contains a majority of low G+C gram-positive bacteria and the other contains lactococci and streptococci. This is similar to the finding on the basis of phylogenetic analysis of the 16S rRNA gene and the hrcA gene coding for a unique heat-shock regulatory protein. The enterococcal tufA genes branched with most of the low G+C gram-positive bacteria, suggesting that they originated from a common ancestor. On the other hand, the enterococcal tufB genes branched with the genera Streptococcus and Lactococcus that form a distinct lineage separated from other low G+C gram-positive bacteria (
The tuf genes are present in various copy numbers in different bacteria. Furthermore, the two tuf genes are normally associated with characteristic flanking genes. The two tuf gene copies commonly encountered within gram-negative bacteria are part of the bacterial str operon and tRNA-tufB operon, respectively. The arrangement of tufA in the str operon was also found in a variety of bacteria, including Thermotoga maritima, the most ancient bacteria sequenced so far, Aquifex aeolicus, cyanobacteria, Bacillus sp., Micrococcus luteus, Mycobacterium tuberculosis, and Streptomyces sp. Furthermore, the tRNA-tufB operon has also been identified in Aquifex aeolicus, Thermus thermophilus, and Chlamydia trachomatis. The two widespread tuf gene arrangements argue in favor of their ancient origins. It is noteworthy that most obligate intracellular parasites, such as Mycoplasma sp., R. prowazekii, B. burgdorferi, and T. pallidum, contain only one tuf gene. Their flanking sequences are distinct from the two conserved patterns as a result of selection for effective propagation by an extensive reduction in genome size by intragenomic recombination and rearrangement.
Most gram-positive bacteria with low G+C content sequenced to date contain only a single copy of the tuf gene as a part of the str operon. This is the case for B. subtilis, S. aureus and E. faecalis. PCR amplification using a primer targeting a conserved region of the fus gene and the tufA-specific primer SEQ ID NO. 660, but not the tufB-specific primer SEQ ID NO. 661, yielded the expected amplicons for all 17 enterococcal species tested, indicating the presence of the fus-tuf organization in all enterococci (data not shown). However, in the genomes of S. pneumoniae and S. pyogenes, the sequences flanking the tuf genes varies although the tuf gene itself remains highly conserved. The enterococcal tufB genes are clustered with streptococci, but at present we do not have enough data to identify the genes flanking the enterococcal tufB genes. Furthermore, the functional role of the enterococcal tufB genes remains unknown. One can only postulate that the two divergent gene copies are expressed under different conditions.
The amino acid sequence identities between the enterococcal tufA and tufB genes are lower than either i) those between the enterococcal tufA and the tuf genes from other low G+C gram-positive bacteria (streptococci and lactococci excluded) or ii) those between the enterococcal tufB and streptococcal and lactococcal tuf genes. These findings suggest that the enterococcal tufA genes share a common ancestor with other low G+C gram-positive bacteria via the simple scheme of vertical evolution, while the enterococcal tufB genes are more closely related to those of streptococci and lactococci. The facts that some enterococci possess an additional tuf gene and that the single streptococcal tuf gene is nut clustered with other low G+C gram-positive bacteria cannot be explained by the mechanism of gene duplication or intrachromosomal recombination. According to sequence and phylogenetic analysis, we propose that the presence of the additional copy of the tuf genes in 11 enterococcal species is due to horizontal gene transfer. The common ancestor of the 11 enterococcal species now carrying tufB genes acquired a tuf gene from an ancestral streptococcus or a streptococcus-related species during enterococcal evolution through gene transfer before the diversification of modern enterococci. Further study of the flanking regions of the gene may provide more clues for the origin and function of this gene in enterococci.
Recent studies of genes and genomes have demonstrated that considerable horizontal transfer occurred in the evolution of aminoacyl-tRNA synthetases in all three kingdoms of life. The heterogeneity of 16S rRNA is also attributable to horizontal gene transfer in some bacteria, such as Streptomyces, Thermomonospora chromogena and Mycobacterium celatum. In this study, we provide the first example in support of a likely horizontal transfer of the tuf gene encoding the elongation factor Tu. This may be an exception since stringent functional constraints do not allow for frequent horizontal transfer of the tuf gene as with other genes. However, enterococcal tuf genes should not be the only such exception as we have noticed that the phylogeny of Streptomyces tuf genes is equally or more complex than that of enterococci. For example, the three tuf-like genes in a high G+C gram-positive bacterium, S. ramocissimus, branched with the tuf genes of phylogenetically divergent groups of bacteria (
The phylogeny of enterobacterial species commonly found in clinical samples was analyzed by comparing partial sequences of their elongation factor Tu (tuf) genes and their F-ATPase beta-subunit (atpD) genes. A 884-bp fragment for tuf and a 884- or 871-bp fragment for atpD were sequenced for 88 strains of 72 species from 25 enterobacterial genera. The atpD sequence analysis revealed a specific indel to Pantoea and Tatumella species showing for the first time a tight phylogenetic affiliation between these two genera. Comprehensive tuf and atpD phylogenetic trees were constructed and are in agreement with each other. Monophyletic genera are Yersinia, Pantoea, Edwardsiella, Cedecea, Salmonella, Serratia, Proteus, and Providencia. Analogous trees were obtained based on available 16S rDNA sequences from databases. tuf and atpD phylogenies are in agreement with the 16S rDNA analysis despite the smaller resolution power for the latter. In fact, distance comparisons revealed that tuf and atpD genes provide a better resolution for pairs of species belonging to the family Enterobacteriaceae. However, 16S rDNA distances are better resolved for pairs of species belonging to different families. In conclusion, tuf and atpD conserved genes are sufficiently divergent to discriminate different species inside the family Enterobacteriaceae and offer potential for the development of diagnostic tests based on DNA to identify enterobacterial species.
Members of the family Enterobacteriaceae are facultatively anaerobic gram-negative rods, catalase-positive and oxidase-positive (Brenner, 1984). They are found in soil, water, plants, and in animals from insects to man. Many enterobacteria are opportunistic pathogens. In fact, members of this family are responsible for about 50% of nosocomial infections in the United States (Brenner, 1984). Therefore, this family is of considerable clinical importance.
Major classification studies on the family Enterobacteriaceae are based on phenotypic traits (Brenner et al., 1999; Brenner et al., 1980; Dickey & Zumoff, 1988; Farmer III et al., 1980; Farmer III et al., 1985b; Farmer III et al., 1985a) such as biochemical reactions and physiological characteristics. However, phenotypically distinct strains may be closely related by genotypic criteria and may belong to the same genospecies (Bercovier et al., 1980; Hartl & Dykhuizen, 1984). Also, phenotypically close strains (biogroups) may belong to different genospecies, like Klebsiella pneumoniae and Enterobacter aerogenes (Brenner, 1984) for example. Consequently, identification and classification of certain species may be ambiguous with techniques based on phenotypic tests (Janda et al., 1999; Kitch et al., 1994; Sharma et al., 1990).
More advances in the classification of members of the family Enterobacteriaceae have come from DNA-DNA hybridization studies (Brenner et al., 1993; Brenner et al., 1986; Brenner, et al., 1980; Farmer III, et al., 1980; Farmer III, et al., 1985b; Izard et al., 1981; Steigerwalt et al., 1976). Furthermore, the phylogenetic significance of bacterial classification based on 16S rDNA sequences has been recognized by many workers (Stackebrandt & Goebel, 1994; Wayne et al., 1987). However, members of the family Enterobacteriaceae have not been subjected to extensive phylogenetic analysis of 16S rDNA (Sproer et al., 1999). In fact, this molecule was not thought to solve taxonomic problems concerning closely related species because of its very high degree of conservation (Brenner, 1992; Sproer, et al., 1999). Another drawback of the 16S rDNA gene is that it is found in several copies within the genome (seven in Escherichia coli and Salmonella typhimurium) (Hill & Harnish, 1981). Due to sequence divergence between the gene copies, direct sequencing of PCR products is often not suitable to achieve a representative sequence (Cilia et al., 1996; Hill & Harnish, 1981). Other genes such as gap and ompA (Lawrence et al., 1991), rpoB (Mollet et al., 1997), and infB (Hedegaard et al., 1999) were used to resolve the phylogeny of enterobacteria. However, none of these studies covered an extensive number of species.
tuf and atpD are the genes encoding the elongation factor Tu (EF-Tu) and the F-ATPase beta-subunit, respectively. EF-Tu is involved in peptide chain formation (Ludwig et al., 1990). The two copies of the tuf gene (tufA and tufB) found in enterobacteria (Sela et al., 1989) share high identity level (99%) in Salmonella typhimurium and in E. coli. The recombination phenomenon could explain sequence homogenization between the two copies (Abdulkarim & Hughes, 1996; Grunberg-Manago, 1996). F-ATPase is present on the plasma membranes of eubacteria (Nelson & Taiz, 1989). It functions mainly in ATP synthesis (Nelson & Taiz, 1989) and the beta-subunit contains the catalytic site of the enzyme. EF-Tu and F-ATPase are highly conserved throughout evolution and shows functional constancy (Amann et al., 1988; Ludwig, et al., 1990). Recently, phylogenies based on protein sequences from EF-Tu and F-ATPase beta-subunit showed good agreement with each other and with the rDNA data (Ludwig et al., 1993).
We elected to sequence 884-bp fragments of tuf and atpD from 88 clinically relevant enterobacterial strains representing 72 species from 25 genera. These sequences were used to create phylogenetic trees that were compared with 16S rDNA trees. These trees revealed good agreement with each others and demonstrated the high resolution of tuf and atpD phylogenies at the species level.
Bacterial strains and genomic material. All bacterial strains used in this study were obtained from the American Type Culture Collection (ATCC) or the Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ). These enterobacteria can all be recovered from clinical specimens, but not all are pathogens. Whenever possible, we choose type strains. Identification of all strains was confirmed by classical biochemical tests using the automated system MicroScan WalkAway-96 system equipped with a Negative BP Combo Panel Type 15 (Dade Behring Canada). Genomic DNA was purified using the G NOME DNA kit (Bio 101). Genomic DNA from Yersinia pestis was kindly provided by Dr. Robert R. Brubaker. Strains used in this study and their descriptions are shown in Table 19.
PCR primers. The eubacterial tuf and atpD gene sequences available from public databases were analyzed using the GCG package (version 8.0) (Genetics Computer Group). Based on multiple sequence alignments, two highly conserved regions were chosen for each genes, and PCR primers were derived from these regions with the help of Oligo primer analysis software (version 5.0) (National Biosciences). A second 5′ primer was design to amplify the gene atpD for few enterobacteria difficult to amplify with the first primer set. When required, the primers contained inosines or degeneracies to account for variable positions. Oligonucleotide primers were synthesized with a model 394 DNA/RNA synthesizer (PE Applied Biosystems). PCR primers used in this study are listed in Table 20.
DNA sequencing. An 884-bp portion of the tuf gene and an 884-bp portion (or alternatively an 871-bp portion for a few enterobacterial strains) of the atpD gene were sequenced for all enterobacteria listed in the first strain column of Table 19. Amplification was performed with 4 ng of genomic DNA. The 40-μl PCR mixtures used to generate PCR products for sequencing contained 1.0 μM each primer, 200 μM each deoxyribonucleoside triphosphate (Pharmacia Biotech), 10 mM Tris-HCl (pH 9.0 at 25° C.), 50 mM KCl, 0.1% (w/v) Triton X-100, 2.5 mM MgCl2, 0.05 mM BSA, 0.3 U of Taq DNA polymerase (Promega) coupled with TaqStart™ antibody (Clontech Laboratories). The TaqStart™ neutralizing monoclonal antibody for Taq DNA polymerase was added to all PCR mixtures to enhance efficiency of amplification (Kellogg et al., 1994). The PCR mixtures were subjected to thermal cycling (3 min at 95° C. and then 35 cycles of 1 min at 95° C., 1 min at 55° C. for tuf or 50° C. for atpD, and 1 min at 72° C., with a 7-min final extension at 72° C.) using a PTC-200 DNA Engine thermocycler (MJ Research). PCR products having the predicted sizes were recovered from an agarose gel stained for 15 min with 0.02% of methylene blue followed by washing in sterile distilled water for 15 min twice (Flores et al., 1992). Subsequently, PCR products having the predicted sizes were recovered from gels using the QIAquick gel extraction kit (QIAGEN).
Both strands of the purified amplicons were sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems) on an automated DNA sequencer (Model 377). Amplicons from two independent PCR amplifications sequenced for each strain to ensure the absence of sequencing errors attributable to nucleotide miscorporations by the Taq DNA polymerase. Sequence assembly was performed with the aid of Sequencher 3.0 software (Gene Codes).
Phylogenetic analysis. Multiple sequence alignments were performed using PileUp from the GCG package (Version 10.0) (Genetics Computer Group) and checked by eye with the editor SeqLab to edit sequences if necessary and to note which regions were to be excluded for phylogenetic analysis. Vibrio cholerae and Shewanella putrefaciens were used as outgroups. Bootstrap subsets (750 sets) and phylogenetic trees were generated with the Neighbor Joining algorithm from Dr. David Swofford's PAUP (Phylogenetic Analysis Using Parsimony) Software version 4.0b4 (Sinauer Associates) and with tree-bisection branch-swapping. The distance model used was Kimura (1980) two-parameter. Relative rate test was performed with the aid of Phyltest program version 2.0 (c).
A PCR product of the expected size of 884 by was obtained for tuf and of 884 or 871 by for atpD from all bacterial strains tested. After subtracting for biased primer regions and ambiguous single strand data, sequences of at least 721 by for tuf and 713 by for atpD were submitted to phylogenetic analyses. These sequences were aligned with tuf and atpD sequences available in databases to verify that the nucleotide sequences indeed encoded a part of tested genes. Gaps were excluded to perform phylogenetic analysis.
From the sequence alignments obtained from both tested genes, only one insertion was observed. This five amino acids insertion is located between the positions 325 and 326 of atpD gene of E. coli strain K-12 (Saraste et al., 1981) and can be considered a signature sequence of Tatumella ptyseos and Pantoea species (
Enterobacter agglomerans ATCC 27989 sequence does not possess the five amino acid indel (
Representative trees constructed from tuf and atpD sequences with the neighbor-joining method are shown in
Even though Pantoea agglomerans and Pantoea dispersa indels were excluded for phylogenetic analysis, these two species grouped together and were distant from Enterobacter agglomerans ATCC 27989, adding another evidence that the latter species is heterogenous and that not all members of this species belong to the genus Pantoea. In fact, the E. agglomerans strain ATCC 27989 exhibits branch lengths similar to others Enterobacter species with both genes. Therefore, we suggest that this strain belong to the genus Enterobacter until further reclassification of that genus.
tuf and atpD trees exhibit very short genetic distances between taxa belonging to the same genetic species including species segregated for clinical considerations. This first concern E. coli and Shigella species that were confirmed to be the same genetic species by hybridization studies (Brenner et al., 1972; Brenner et al., 1972; Brenner et al., 1982) and phylogenies based on 16S rDNA (Wang et al., 1997) and rpoB genes (Mollet, et al., 1997). Hybridization studies (Bercovier, et al., 1980) and phylogeny based on 16S rDNA genes (Ibrahim et al., 1994) demonstrated also that Yersinia pestis and Y. pseudotuberculosis are the same genetic species. Among Yersinia pestis and Y. pseudotuberculosis, the three Klebsiella pneumoniae subspecies, E. coli-Shigella species, and Salmonella choleraesuis subspecies, Salmonella is a less tightly knit species than the other genetic species. The same is true for E. coli and Shigella species.
Escherichia fergusonii is very close to E. coli-Shigella genetic species. This observation is corroborated by 16S rDNA phylogeny (McLaughlin et al., 2000) but not by DNA hybridization values. In fact, E. fergusonii is only 49% to 63% related to E. coli-Shigella (Farmer III, et al., 1985b). It was previously observed that very recently diverged species may not be recognizable based on 16S rDNA sequences although DNA hybridization established them as different species (Fox et al., 1992). Therefore, E. fergusonii could be a new “quasi-species”.
atpD phylogeny revealed Salmonella subspecies divisions consistent with the actual taxonomy. This result was already observed by Christensen et al. (Christensen & Olsen, 1998). Nevertheless, tuf partial sequences discriminate less than atpD between Salmonella subspecies.
Overall, tuf and atpD phylogenies exhibit enough divergence between species to ensure efficient discrimination. Therefore, it could be easy to distinguish phenotypically close enterobacteria belonging to different genetic species such as Klebsiella pneumoniae and Enterobacter aerogenes.
Phylogenetic relationships between Salmonella, E. coli and C. freundii are not well defined. 16S rDNA and 23S rDNA sequence data reveals a closer relationship between Salmonella and E. coli than between Salmonella and C. freundii (Christensen et al., 1998), while DNA homology studies (Selander et al., 1996) and infB phylogeny (Hedegaard, et al., 1999) showed that Salmonella is more closely related to C. freundii than to E. coli. In that regard, tuf and atpD phylogenies are coherent with 16S rDNA and 23S rDNA sequence analysis.
Phylogenetic analyses were also performed using amino acids sequences. tuf tree based on amino acids is characterized by a better resolution between taxa outgroup and taxa ingroup (enterobacteria) than tree based on nucleic acids whereas atpD trees based on amino acids and nucleic acids give almost the same resolution between taxa outgroup and ingroup (data not shown).
Relative rate test (or two cluster test (Takezaki et al., 1995)) evaluates if evolution is constant between two taxa. Before to apply the test, the topology of a tree is determined by tree-building method without the assumption of rate constancy. Therefore, two taxa (or two groups of taxa) are compared with a third taxon that is an outgroup of the first two taxa (Takezaki, et al., 1995). Few pairs of taxa that exhibited a great difference between their branch lengths at particular nodes were chosen to perform the test. This test reveals that tuf and atpD are not constant in their evolution within the family Enterobacteriaceae. For tuf, for example, the hypothesis of rate constancy is rejected (Z value higher than 1.96) between Yersinia species. The same is true for Proteus species. For atpD, for example, evolution is not constant between Proteus species, between Proteus species and Providencia species, and between Yersinia species and Escherichia coli. For 16S rDNA, for example, evolution is not constant between two E. coli, between E. coli and Enterobacter aerogenes, and between E. coli and Proteus vulgaris. These results suggest that tuf, atpD and 16S rDNA could not serve as a molecular clock for the entire family Enterobacteriaceae.
Since the number and the nature of taxa can influence topology of trees, phylogenetic trees from tuf and atpD were reconstructed using sequences corresponding to strains for which 16S rDNA genes were published in GenEMBL. These trees were similar to those generated using 16S rDNA (
Comparison of Distances Based on tuf, atpD, and 16S rDNA data.
tuf, atpD, and 16S rDNA distances (i.e. the number of differences per nucleotide site) were compared with each other for each pair of strains. We found that the tuf and atpD distances were respectively 2.268±0.965 and 2.927±0.896 times larger than 16S rDNA distances (
Observing the distance distributions, 16S rDNA distances reveal a clear separation between the families Enterobacteriaceae and Vibrionaceae despite the fact that the family Vibrionaceae is genetically very close to the Enterobacteriaceae (
There were some discrepancies in the relative distances for the same pairs of taxa between the two genes studied. First, distances between Yersinia species are at least two times lower for atpD than for tuf (
In conclusion, tuf and atpD genes exhibit phylogenies consistent with 16S rDNA genes phylogeny. For example, they reveal that the family Enterobacteriaceae is monophyletic. Moreover, tuf and atpD distances provide a higher discriminating power than 16S rDNA distances. In fact, tuf and atpD genes discriminate well between different genospecies and are conserved between strains of the same genetic species in such a way that primers and molecular probes for diagnostic purposes could be designed. Preliminary studies support these observations and diagnostic tests based on tuf and atpD sequence data to identify enterobacteria are currently under development.
Objective. The goal of these experiments is to demonstrate that it is relatively easy for a person skilled in the art to find other PCR primer pairs from the species-specific fragments used as targets for detection and identification of a variety of microorganisms. In fact, we wish to prove that the PCR primers previously tested by our group and which are objects of the present patent application are not the only possible good choices for diagnostic purposes. For this example, we used diagnostic targets described in our assigned U.S. Pat. No. 6,001,564.
Experimental strategy. We have selected randomly two species-specific genomic DNA fragments for this experiment. The first one is the 705-bp fragment specific to Staphylococcus epidermidis (SEQ ID NO: 36 from U.S. Pat. No. 6,001,564) while the second one is the 466-bp fragment specific to Moraxella catarrhalis (SEQ ID NO: 29 from U.S. Pat. No. 6,001,564). Subsequently, we have selected from these two fragments a number of PCR primer pairs other than those previously tested. We have chosen 5 new primer pairs from each of these two sequences which are well dispersed along the DNA fragment (
Bacterial strains. All bacterial strains used for these experiments were obtained from the American Type Culture Collection (ATCC, Rockville, Md.).
Genomic DNA isolation. Genomic DNA was purified from the ATCC reference strains by using the G-nome DNA kit (Bio 101 Inc., Vista, Calif.).
Oligonucleotide design and synthesis. PCR primers were designed with the help of the Oligo™ primer analysis software Version 4.0 (National Biosciences Inc., Plymouth, Minn.) and synthesized using a model 391 DNA synthesizer (Applied Biosystems, Foster City, Calif.).
PCR assays. All PCR assays were performed by using genomic DNA purified from reference strains obtained from the ATCC. One μl of purified DNA preparation (containing 0.01 to 1 ng of DNA per μl) was added directly into the PCR reaction mixture. The 20 μL PCR reactions contained final concentrations of 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl2, 0.4 μM of each primer, 200 μM of each of the four dNTPs and 0.5 unit of Taq DNA polymerase (Promega, Madison, Wis.) combined with the TaqStart™ antibody (Clontech Laboratories Inc., Palo Alto, Calif.). An internal control was integrated into all amplification reactions to verify the efficiency of the amplification reaction as well as to ensure that significant PCR inhibition was absent. Primers amplifying a region of 252 by from a control plasmid added to each amplification reaction were used to provide the internal control. PCR reactions were then subjected to thermal cycling (3 min at 95° C. followed by 30 cycles of 1 second at 95° C. for the denaturation step and 30 seconds at 50 to 65° C. for the annealing-extension step) using a PTC-200 thermal cycler (MJ Research Inc., Watertown, Mass.). PCR amplification products were then analyzed by standard agarose gel (2%) electrophoresis. Amplification products were visualized in agarose gels containing 0.25 μg/mL of ethidium bromide under UV at 254 nm.
Tables 21 and 22 show the results of specificity tests with the 5 new primer pairs selected from SEQ ID NO: 29 (specific to M. catarrhalis from U.S. Pat. No. 6,001,564) and SEQ ID NO: 36 (specific to S. epidermidis from U.S. Pat. No. 6,001,564), respectively. In order to evaluate the performance of these new primers pairs, we compared them in parallel with the original primer pairs previously tested.
For M. catarrhalis, all of the 5 selected PCR primer pairs were specific for the target species because none of the closely related species could be amplified (Table 21). In fact, the comparison with the original primer pair SEQ ID NO: 118+SEQ ID NO: 119 (from U.S. Pat. No. 6,001,564) revealed that all new pairs showed identical results in terms of specificity and sensitivity thereby suggesting their suitability for diagnostic purposes.
For S. epidermidis, 4 of the 5 selected PCR primer pairs were specific for the target species (Table 22). It should be noted that for 3 of these four primer pairs the annealing temperature had to be increased from 55° C. to 60 or 65° C. to attain specificity for S. epidermidis. Again the comparison with the original primer pair SEQ ID NO: 145+SEQ ID NO: 146 (from U.S. Pat. No. 6,001,564) revealed that these four primer pairs were as good as the original pair. Increasing the annealing temperature for the PCR amplification is well known by persons skilled in the art to be a very effective way to improve the specificity of a PCR assay (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich and Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). In fact, those skilled in the art are well aware of the fact that the annealing temperature is critical for the optimization of PCR assays. Only the primer pair VBsep3+VBsep4 amplified bacterial species other than S. epidermidis including the staphylococcal species S. capitis, S. cohnii, S. aureus, S. haemolyticus and S. hominis (Table 22). For this non-specific primer pair, increasing the annealing temperature from 55 to 65° C. was not sufficient to attain the desired specificity. One possible explanation for the fact that it appears slightly easier to select species-specific primers for M catarrhalis than for S. epidermidis is that M catarrhalis is more isolated in phylogenetic trees than S. epidermidis. The large number of coagulase negative staphylococcal species such as S. epidermidis is largely responsible for this phylogenetic clustering.
These experiment clearly show that it is relatively easy for a person skilled in the art to select, from the species-specific DNA fragments selected as target for identification, PCR primer pairs suitable for diagnostic purposes other than those previously tested. The amplification conditions can be optimize by modifying critical variables such as the annealing temperature to attain the desired specificity and sensitivity. Consequently, we consider that it is legitimate to claim any possible primer sequences selected from the species-specific fragment and that it would be unfair to grant only the claims dealing with the primer pairs previously tested. By extrapolation, these results strongly suggest that it is also relatively easy for a person skilled in the art to select, from the species-specific DNA fragments, DNA probes suitable for diagnostic purposes other than those previously tested.
Objective. The purpose of this project is to verify the efficiency of amplification by modified PCR primers derived from primers previously tested. The types of primer modifications to be tested include (i) variation of the sequence at one or more nucleotide positions and (ii) increasing or reducing the length of the primers. For this example, we used diagnostic targets described in U.S. Pat. No. 6,001,564.
Testing Primers with Nucleotide Changes
We have designed 13 new primers which are derived from the S. epidermidis-specific SEQ ID NO: 146 from U.S. Pat. No. 6,001,564 (Table 23). These primers have been modified at one or more nucleotide positions. As shown in Table 23, the nucleotide changes were introduced all along the primer sequence. Furthermore, instead of modifying the primer at any nucleotide position, the nucleotide changes were introduced at the third position of each codon to better reflect potential genetic variations in vivo. It should be noted that no nucleotide changes were introduced at the 3′ end of the oligonucleotide primers because those skilled in the art are well aware of the fact that mismatches at the 3′ end should be avoided (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.). All of these modified primers were tested in PCR assays in combination with SEQ ID NO: 145 from U.S. Pat. No. 6,001,564 and the efficiency of the amplification was compared with the original primer pair SEQ ID NO: 145+SEQ ID NO: 146 previously tested in U.S. Pat. No. 6,001,564.
We have designed shorter and longer versions of the original S. epidermidis-specific PCR primer pair SEQ ID NO: 145+146 from U.S. Pat. No. 6,001,564 (Table 24) as well as shorter versions of the original P. aeruginosa-specific primer pair SEQ ID NO: 83+84 from U.S. Pat. No. 6,001,564 (Table 25). As shown in Tables 24 and 25, both primers of each pair were shortened or lengthen to the same length. Again, those skilled in the art know that the melting temperature of both primers from a pair should be similar to avoid preferential binding at one primer binding site which is detrimental in PCR (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich and Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). All of these shorter or longer primer versions were tested in PCR assays and the efficiency of the amplification was compared with the original primer pair SEQ ID NOs 145 and 146.
See the Materials and methods section of Example 44.
Testing Primers with Nucleotide Changes
The results of the PCR assays with the 13 modified versions of SEQ ID NO: 146 from U.S. Pat. No. 6,001,564 are shown in Table 23. The 8 modified primers having a single nucleotide variation showed an efficiency of amplification identical to the original primer pair based on testing with 3 different dilutions of genomic DNA. The four primers having two nucleotide variations and primer VBmut12 having 3 nucleotide changes also showed PCR results identical to those obtained with the original pair. Finally, primer VBmut13 with four nucleotide changes showed a reduction in sensitivity by approximately one log as compared with the original primer pair. However, reducing the annealing temperature from 55 to 50° C. gave an efficiency of amplification very similar to that observed with the original primer pair (Table 23). In fact, reducing the annealing temperature of PCR cycles represents an effective way to reduce the stringency of hybridization for the primers and consequently allows the binding of probes with mismatches (Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.). Subsequently, we have confirmed the specificity of the PCR assays with each of these 13 modified versions of SEQ ID NO: 146 from U.S. Pat. No. 6,001,564 by performing amplifications from all bacterial species closely related to S. epidermidis which are listed in Table 22.
For these experiments, two primer pairs were selected: i) SEQ ID NO: 145+146 from U.S. Pat. No. 6,001,564 (specific to S. epidermidis) which are AT rich and ii) SEQ ID NO: 83+84 (specific to P. aeruginosa) which are GC rich. For the AT rich sequence, primers of 15 to 30 nucleotide in length were designed (Table 24) while for the GC rich sequences, primers of 13 to 19 nucleotide in length were designed (Table 25).
Table 24 shows that, for an annealing temperature of 55° C., the 30-25-, 20- and 17-nucleotide versions of SEQ ID NO: 145 and 146 from U.S. Pat. No. 6,001,564 all showed identical results as compared with the original primer pair except that the 17-nucleotide version amplified slightly less efficiently the S. epidermidis DNA. Reducing the annealing temperature from 55 to 45° C. for the 17-nucleotide version allowed to increase the amplification efficiency to a level very similar to that with the original primer pair (SEQ ID NO: 145+146 from U.S. Pat. No. 6,001,564). Regarding the 15-nucleotide version, there was amplification of S. epidermidis DNA only when the annealing temperature was reduced to 45° C. Under those PCR conditions the assay remained S. epidermidis-specific but the amplification signal with S. epidermidis DNA was slightly lower as compared with the original primer pair. Subsequently, we have further confirmed the specificity of the shorter or longer versions by amplifying DNA from all bacterial species closely related to S. epidermidis which are listed in Table 22.
Table 25 shows that, for an annealing temperature of 55° C., all shorter versions of SEQ ID NO: 83 and 84 from U.S. Pat. No. 6,001,564 showed identical PCR results as compared with the original primer pair. As expected, these results show that it is simpler to reduce the length of GC rich as compared with AT rich. This is attributable to the fact that GC binding is more stable than AT binding.
Testing Primers with Nucleotide Changes
The above experiments clearly show that PCR primers may be modified at one or more nucleotide positions without affecting the specificity and the sensitivity of the PCR assay. These results strongly suggest that a given oligonucleotide can detect variant genomic sequences from the target species. In fact, the nucleotide changes in the selected primers were purposely introduced at the third position of each codon to mimic nucleotide variation in genomic DNA. Thus we conclude that it is justified to claim “a variant thereof” for i) the SEQ IDs of the fragments and oligonucleotides which are object of the present patent application and ii) genomic variants of the target species.
The above experiments clearly show that PCR primers may be shorter or longer without affecting the specificity and the sensitivity of the PCR assay. We have showed that oligonucleotides ranging in sizes from 13 to 30 nucleotides may be as specific and sensitive as the original primer pair from which they were derived. Consequently, these results suggest that it is not exaggerated to claim sequences having at least 12 nucleotide in length.
This invention has been described herein above, and it is readily apparent that modifications can be made thereto without departing from the spirit of this invention. These modifications are under the scope of this invention, as defined in the appended claims.
Escherichia coli
Staphylococcus aureus
Staphylococcus epidermidis
Enterococcus faecalis
Enterococcus faecium
Pseudomonas aeruginosa
Klebsiella pneumoniae
Proteus mirabilis
Streptococcus pneumoniae
Haemophilus influenzae
Neisseria meningitidis
Listeria monocytogenes
Candida albicans
Enterobacter sp.
Acinetobacter sp.
Citrobacter sp.
Serratia marcescens
1Data recorded by the National Nosocomial Infections Surveillance (NNIS) from 80 hospitals (Emori and Gaynes, 1993, Clin. Microbiol. Rev., 6: 428-442).
2Urinary tract infection.
3Surgical site infection.
4Bloodstream infection.
5Cerebrospinal fluid.
E. coli
S. epidermidis and
S. aureus
S. pneumoniae
E. faecalis
E. faecium
Enterococcus sp.
H. influenzae
P. aeruginosa
K. pneumoniae
P. mirabilis
S. pyogenes
Enterobacter sp.
Candida sp.
1Data obtained for 270 isolates collected at the Centre Hospitalier del'Université Laval (CHUL) during a 5 month period (May to October 1995).
2Data from 10 hospitals throughout Canada representing 941 gram-negative isolates. (Chamberland et al., 1992, Clin. Infect. Dis., 15: 615-628).
3Data from a 20-year study (1969-1988) for nearly 4000 isolates. (Eykyn et al., 1990, J. Antimicrob. Chemother., Suppl. C, 25: 41-58).
4Data recorded by the National Nosocomial Infections Surveillance (NNIS) from 80 hospitals (Emori and Gaynes, 1993, Clin. Microbiol. Rev., 6: 428-442).
5Coagulase-negative staphylococci.
Abiotrophia adiacens
Abiotrophia defectiva
Achromobacter xylosoxidans subsp. denitrificans
Acetobacterium woodi
Acetobacter aceti
Acetobacter altoacetigenes
Acetobacter polyoxogenes
Acholeplasma laidlawii
Acidothermus cellulolyticus
Acidiphilum facilis
Acinetobacter baumannii
Acinetobacter calcoaceticus
Acinetobacter lwoffii
Actinomyces meyeri
Aerococcus viridans
Aeromonas hydrophila
Aeromonas salmonicida
Agrobacterium radiobacter
Agrobacterium tumefaciens
Alcaligenes faecalis subsp. faecalis
Allochromatium vinosum
Anabaena variabilis
Anacystis nidulans
Anaerorhabdus furcosus
Aquifex aeolicus
Aquifex pyrophilus
Arcanobacterium haemolyticum
Archaeoglobus fulgidus
Azotobacter vinelandii
Bacillus anthracis
Bacillus cereus
Bacillus firmus
Bacillus halodurans
Bacillus megaterium
Bacillus mycoides
Bacillus pseudomycoides
Bacillus stearothermophilus
Bacillus subtilis
Bacillus thuringiensis
Bacillus weihenstephanensis
Bacteroides distasonis
Bacteroides fragilis
Bacteroides forsythus
Bacteroides ovatus
Bacteroides vulgatus
Bartonella henselae
Bifidobacterium adolescentis
Bifidobacterium breve
Bifidobacterium dentium
Bifidobacterium longum
Blastochloris viridis
Borrelia burgdorferi
Bordetella pertussis
Bordetella bronchiseptica
Brucella abortus
Brevibacterium linens
Brevibacterium flavum
Brevundimonas diminuta
Buchnera aphidicola
Budvicia aquatica
Burkholderia cepacia
Burkholderia mallei
Burkholderia pseudomallei
Buttiauxella agrestis
Butyrivibrio fibrisolvens
Campylobacter coli
Campylobacter curvus
Campylobacter fetus subsp. fetus
Campylobacter fetus subsp. venerealis
Campylobacter gracilis
Campylobacter jejuni
Campylobacter jejuni subsp. doylei
Campylobacter jejuni subsp. jejuni
Campylobacter lari
Campylobacter rectus
Campylobacter sputorum subsp. sputorum
Campylobacter upsaliensis
Cedecea davisae
Cedecea lapagei
Cedecea neteri
Chlamydia pneumoniae
Chlamydia psittaci
Chlamydia trachomatis
Chlorobium vibrioforme
Chloroflexus aurantiacus
Chryseobacterium meningosepticum
Citrobacter amalonaticus
Citrobacter braakii
Citrobacter farmeri
Citrobacter freundii
Citrobacter koseri
Citrobacter sedlakii
Citrobacter werkmanii
Citrobacter youngae
Clostridium acetobutylicum
Clostridium beijerinckii
Clostridium bifermentans
Clostridium botulinum
Clostridium difficile
Clostridium innocuum
Clostridium histolyticum
Clostridium novyi
Clostridium septicum
Clostridium perfringens
Clostridium ramosum
Clostridium tertium
Clostridium tetani
Comamonas acidovorans
Corynebacterium accolens
Corynebacterium bovis
Corynebacterium cervicis
Corynebacterium diphtheriae
Corynebacterium flavescens
Corynebacterium genitalium
Corynebacterium glutamicum
Corynebacterium jeikeium
Corynebacterium kutscheri
Corynebacterium minutissimum
Corynebacterium mycetoides
Corynebacterium pseudodiphtheriticum
Corynebacterium pseudogenitalium
Corynebacterium pseudotuberculosis
Corynebacterium renale
Corynebacterium striatum
Corynebacterium ulcerans
Corynebacterium urealyticum
Corynebacterium xerosis
Coxiella burnetii
Cytophaga lytica
Deinococcus radiodurans
Deinonema sp.
Edwardsiella hoshinae
Edwardsiella tarda
Ehrlichia canis
Ehrlichia risticii
Eikenella corrodens
Enterobacter aerogenes
Enterobacter agglomerans
Enterobacter amnigenus
Enterobacter asburiae
Enterobacter cancerogenus
Enterobacter cloacae
Enterobacter gergoviae
Enterobacter hormaechei
Enterobacter sakazakii
Enterococcus avium
Enterococcus casseliflavus
Enterococcus cecorum
Enterococcus columbae
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus hirae
Enterococcus malodoratus
Enterococcus mundtii
Enterococcus pseudoavium
Enterococcus raffinosus
Enterococcus saccharolyticus
Enterococcus solitarius
Enterococcus sulfureus
Clostridium sordellii
Erwinia amylovora
Erwinia carotovora
Escherichia coli
Escherichia fergusonii
Escherichia hermannii
Escherichia vulneris
Eubacterium lentum
Eubacterium nodatum
Ewingella americana
Francisella tularensis
Frankia alni
Fervidobacterium islandicum
Fibrobacter succinogenes
Flavobacterium ferrigeneum
Flexistipes sinusarabici
Fusobacterium gonidiaformans
Fusobacterium necrophorum subsp. necrophorum
Fusobacterium nucleatum subsp. polymorphum
Gardnerella vaginalis
Gemella haemolysans
Gemella morbillorum
Globicatella sanguis
Gloeobacter violaceus
Gloeothece sp.
Gluconobacter oxydans
Haemophilus actinomycetemcomitans
Haemophilus aphrophilus
Haemophilus ducreyi
Haemophilus haemolyticus
Haemophilus influenzae
Haemophilus parahaemolyticus
Haemophilus parainfluenzae
Haemophilus paraphrophilus
Haemophilus segnis
Hafnia alvei
Halobacterium marismortui
Halobacterium salinarum
Haloferax volcanii
Helicobacter pylori
Herpetoshiphon aurantiacus
Kingella kingae
Klebsiella ornithinolytica
Klebsiella oxytoca
Klebsiella planticola
Klebsiella pneumoniae subsp. ozaenae
Klebsiella pneumoniae subsp. pneumoniae
Klebsiella pneumoniae subsp. rhinoscleromatis
Klebsiella terrigena
Kluyvera ascorbata
Kluyvera cryocrescens
Kluyvera georgiana
Kocuria kristinae
Lactobacillus acidophilus
Lactobacillus garvieae
Lactobacillus paracasei
Lactobacillus casei subsp. casei
Lactococcus garvieae
Lactococcus lactis
Lactococcus lactis subsp. lactis
Legionella micdadei
Legionella pneumophila subsp. pneumophila
Leminorella grimontii
Leminorella richardii
Leptospira biflexa
Leptospira interrogans
Leuconostoc mesenteroides subsp. dextranicum
Listeria innocua
Listeria ivanovii
Listeria monocytogenes
Listeria seeligeri
Macrococcus caseolyticus
Magnetospirillum magnetotacticum
Megamonas hypermegale
Methanobacterium thermoautotrophicum
Methanococcus jannaschii
Methanococcus vannielii
Methanosarcina barkeri
Methanosarcina jannaschii
Methylobacillus flagellatum
Methylomonas clara
Micrococcus luteus
Micrococcus lylae
Mitsuokella multacidus
Mobiluncus curtisii subsp. holmesii
Moellerella thermoacetica
Moellerella wisconsensis
Moorella thermoacetica
Moraxella catarrhalis
Moraxella osloensis
Morganella morganii subsp. morganii
Mycobacterium avium
Mycobacterium bovis
Mycobacterium gordonae
Mycobacterium kansasii
Mycobacterium leprae
Mycobacterium terrae
Mycobacterium tuberculosis
Mycoplasma capricolum
Mycoplasma gallisepticum
Mycoplasma genitalium
Mycoplasma hominis
Mycoplasma pirum
Mycoplasma mycoides
Mycoplasma pneumoniae
Mycoplasma pulmonis
Mycoplasma salivarium
Myxococcus xanthus
Neisseria animalis
Neisseria canis
Neisseria cinerea
Neisseria cuniculi
Neisseria elongata subsp. elongata
Neisseria elongata subsp. intermedia
Neisseria flava
Neisseria flavescens
Neisseria gonorrhoeae
Neisseria lactamica
Leclercia adecarboxylata
Neisseria meningitidis
Neisseria mucosa
Neisseria perflava
Neisseria pharyngis var. flava
Neisseria polysaccharea
Neisseria sicca
Neisseria subflava
Neisseria weaveri
Obesumbacterium proteus
Ochrobactrum anthropi
Pantoea agglomerans
Pantoea dispersa
Paracoccus denitrificans
Pasteurella multocida
Pectinatus frisingensis
Peptococcus niger
Peptostreptococcus anaerobius
Peptostreptococcus asaccharolyticus
Peptostreptococcus prevotii
Phormidium ectocarpi
Pirellula marina
Planobispora rosea
Plesiomonas shigelloides
Plectonema boryanum
Porphyromonas asaccharolytica
Porphyromonas gingivalis
Pragia fontium
Prevotella buccalis
Prevotella melaninogenica
Prevotella oralis
Prevotella ruminocola
Prochlorothrix hollandica
Propionibacterium acnes
Propionigenium modestum
Proteus mirabilis
Proteus penneri
Proteus vulgaris
Providencia alcalifaciens
Providencia rettgeri
Providencia rustigianii
Providencia stuartii
Pseudomonas aeruginosa
Pseudomonas fluorescens
Pseudomonas putida
Pseudomonas stutzeri
Psychrobacter phenylpyruvicum
Pyrococcus abyssi
Rahnella aquatilis
Rickettsia prowazekii
Rhizobium leguminosarum
Rhizobium phaseoli
Rhodobacter capsulatus
Rhodobacter sphaeroides Rhodopseudomonas
palustris
Rhodospirillum rubrum
Ruminococcus albus
Ruminococcus bromii
Salmonella bongori
Salmonella choleraesuis subsp. arizonae
Salmonella choleraesuis subsp choleraesuis
Salmonella choleraesuis subsp. diarizonae
Salmonella choleraesuis subsp. houtenae
Salmonella choleraesuis subsp. indica
Salmonella choleraesuis subsp. salamae
Serpulina hyodysenteriae
Serratia ficaria
Serratia fonticola
Serratia grimesii
Serratia liquefaciens
Serratia marcescens
Serratia odorifera
Serratia plymuthica
Serratia rubidaea
Shewanella putrefaciens
Shigella boydii
Shigella dysenteriae
Shigella flexneri
Shigella sonnei
Sinorhizobium meliloti
Spirochaeta aurantia
Staphylococcus aureus
Staphylococcus aureus subsp. aureus
Staphylococcus auricularis
Staphylococcus capitis subsp. capitis
Staphylococcus cohnii subsp. cohnii
Staphylococcus epidermidis
Staphylococcus haemolyticus
Staphylococcus hominis
Staphylococcus hominis subsp. hominis
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus sciuri subsp. sciuri
Staphylococcus simulans
Staphylococcus warneri
Stigmatella aurantiaca
Stenotrophomonas maltophilia
Streptococcus acidominimus
Streptococcus agalactiae
Streptococcus anginosus
Streptococcus bovis
Streptococcus cricetus
Streptococcus cristatus
Streptococcus downei
Streptococcus dysgalactiae
Streptococcus equi subsp. equi
Streptococcus ferus
Streptococcus gordonii
Streptococcus macacae
Streptococcus mitis
Streptococcus mutans
Streptococcus oralis
Streptococcus parasanguinis
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus ratti
Streptococcus salivarius
Streptococcus salivarius subsp. thermophilus
Streptococcus sanguinis
Streptococcus sobrinus
Streptococcus suis
Streptococcus uberis
Streptococcus vestibularis
Streptomyces anbofaciens
Streptomyces aureofaciens
Streptomyces cinnamoneus
Streptomyces coelicolor
Streptomyces collinus
Streptomyces lividans
Streptomyces netropsis
Streptomyces ramocissimus
Streptomyces rimosus
Streptomyces venezuelae
Succinivibrio dextrinosolvens
Synechococcus sp.
Synechocystis sp.
Tatumella ptyseos
Taxeobacter occealus
Tetragenococcus halophilus
Thermoplasma acidophilum
Thermotoga maritima
Thermus aquaticus
Thermus thermophilus
Thiobacillus ferrooxidans
Thiomonas cuprina
Trabulsiella guamensis
Treponema pallidum
Ureaplasma urealyticum
Veillonella parvula
Vibrio alginolyticus
Vibrio anguillarum
Vibrio cholerae
Vibrio mimicus
Wolinella succinogenes
Xanthomonas citri
Xanthomonas oryzae
Xenorhabdus bovieni
Xenorhabdus nematophilus
Yersinia bercovieri
Yersinia enterocolitica
Yersinia frederiksensii
Yersinia intermedia
Yersinia pestis
Yersinia pseudotuberculosis
Yersinia rohdei
Yokenella regensburgei
Zoogloea ramigera
Absidia corymbifera
Absidia glauca
Alternaria alternate
Arxula adeninivorans
Aspergillus flavus
Aspergillus fumigatus
Aspergillus nidulans
Aspergillus niger
Aspergillus oryzae
Aspergillus terreus
Aspergillus versicolor
Aureobasidium pullulans
Basidiobolus ranarum
Bipolaris hawaiiensis
Bilophila wadsworthia
Blastoschizomyces capitatus
Blastomyces dermatitidis
Candida albicans
Candida catenulata
Candida dubliniensis
Candida famata
Candida glabrata
Candida guilliermondii
Candida haemulonii
Candida inconspicua
Candida kefyr
Candida krusei
Candida lambica
Candida lusitaniae
Candida norvegica
Candida norvegensis
Candida parapsilosis
Candida rugosa
Candida sphaerica
Candida tropicalis
Candida utilis
Candida viswanathii
Candida zeylanoides
Cladophialophora carrionii
Coccidioides immitis
Coprinus cinereus
Cryptococcus albidus
Cryptococcus humicolus
Cryptococcus laurentii
Cryptococcus neoformans
Cunninghamella bertholletiae
Curvularia lunata
Emericella nidulans
Emmonsia parva
Eremothecium gossypii
Exophiala dermatitidis
Exophiala jeanselmei
Exophiala moniliae
Exserohilum rostratum
Eremothecium gossypii
Fonsecaea pedrosoi
Fusarium moniliforme
Fusarium oxysporum
Fusarium solani
Geotrichum sp.
Histoplasma capsulatum
Hortaea werneckii
Issatchenkia orientalis Kudrjanzev
Kluyveromyces lactis
Malassezia furfur
Malassezia pachydermatis
Malbranchea filamentosa
Metschnikowia pulcherrima
Microsporum audouinii
Microsporum canis
Mucor circinelloides
Neurospora crassa
Paecilomyces lilacinus
Paracoccidioides brasiliensis
Penicillium marneffei
Phialaphora verrucosa
Pichia anomala
Piedraia hortai
Podospora anserina
Podospora curvicolla
Puccinia graminis
Pseudallescheria boydii
Reclinomonas americana
Rhizomucor racemosus
Rhizopus oryzae
Rhodotorula minuta
Rhodotorula mucilaginosa
Saccharomyces cerevisiae
Saksenaea vasiformis
Schizosaccharomyces pombe
Scopulariopsis koningii
Sordaria macrospora
Sporobolomyces salmonicolor
Sporothrix schenckii
Stephanoascus ciferrii
Syncephalastrum racemosum
Trichoderma reesei
Trichophyton mentagrophytes
Trichophyton rubrum
Trichophyton tonsurans
Trichosporon cutaneum
Ustilago maydis
Wangiella dermatitidis
Yarrowia lipolytica
Babesia bigemina
Babesia bovis
Babesia microti
Blastocystis hominis
Crithidia fasciculata
Cryptosporidium parvum
Entamoeba histolytica
Giardia lamblia
Kentrophoros sp.
Leishmania aethiopica
Leishmania amazonensis
Leishmania braziliensis
Leishmania donovani
Leishmania infantum
Leishmania enriettii
Leishmania gerbilli
Leishmania guyanensis
Leishmania hertigi
Leishmania major
Leishmania mexicana
Leishmania panamensis
Leishmania tarentolae
Leishmania tropica
Neospora caninum
Onchocerca volvulus
Plasmodium berghei
Plasmodium falciparum
Plasmodium knowlesi
Porphyra purpurea
Toxoplasma gondii
Treponema pallidum
Trichomonas tenax
Trichomonas vaginalis
Trypanosoma brucei
Trypanosoma brucei subsp. brucei
Trypanosoma congolense
Trypanosoma cruzi
Enterobacteriaceae
Enterobacteriaceae,
Enterobacteriaceae
Enterobacteriaceae,
Enterobacteriaceae,
Enterococcus sp.,
Staphylococcus sp.
Enterobacteriaceae,
Enterobacteriaceae,
Enterobacteriaceae
Enterobacteriaceae,
Enterococcus sp.,
Staphylococcus sp.
Staphylococcus sp.
Enterobacteriaceae,
Enterobacteriaceae,
Enterococcus sp.,
Staphylococcus sp.
Enterobacteriaceae,
M. tuberculosis,
M. avium complex
Enterobacteriaceae,
Haemophilus sp.
Enterobacteriacea,
Pseudomonas aeruginosa
Enterobacteriaceae,
Neisseria sp.,
Haemophilus sp.
Enterobacteriacea,
Pseudomonas aeruginosa
Enterobacteriaceae,
Neisseria sp.,
Haemophilus sp.
Pseudomonas sp.,
Enterobacteriaceae
Enterobacteriaceae
Enterobacteriaceae
Enterobacteriaceae
Enterobacteriaceae,
Pseudomonas aeruginosa
Enterobacteriaceae,
Pseudomodanaceae
Enterobacteriaceae
Enterococcus sp.,
Staphylococcus sp.
Staphylococcus sp.
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Enterobacteriaceae,
Staphylococcus sp.
Enterobacteriaceae,
Staphylococcus sp.
Enterococcus sp.
Streptococcus sp.
Enterobacteriaceae,
Staphylococcus sp.
Enterobacteriaceae,
Staphylococcus sp.
Enterobacteriaceae
Staphylococcus sp.
Staphylococcus sp.
Streptococcus sp.
Enterobacteriaceae,
Staphylococcus sp.
Staphylococcus sp.
Enterococcus faecium
Staphylococcus sp.
Staphylococcus sp.
Staphylococcus sp.
Staphylococcus sp.
Enterococcus faecium
Staphylococcus aureus
Staphylococcus sp.
Pseudomonas aeruginosa
Pseudomonas aeruginosa
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Enterococcus sp.
Enterococcus sp.
Enterococcus gallinarum
Enterococcus casseliflavus
Enterococcus flavescens
Enterococcus faecium
Enterococcus faecium
Staphylococcus sp.
1Bacteria having high incidence for the specified antibiotic resistance gene. The presence of the antibiotic resistance genes in other bacteria is not excluded.
2Shaw, K. J., P. N. Rather, R. S. Hare, and G. H. Miller. 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbial. Rev. 57: 138-163.
3Antibiotic resistance genes from our assigned U.S. Pat. No. 6,001,564 for which we have selected PCR primer pairs.
4These SEQ ID NOs. refer to a previous patent (publication WO98/20157).
5Bush, K., G. A. Jacoby and A. Medeiros. 1995. A functional classification scheme for β-lactamase and its correlation with molecular structure. Antimicrob. Agents. Chemother. 39: 1211-1233.
6Nucleotide mutations in blaSHV, blaTEM, and blaOXA, are associated with extended-spectrum β-lactamase or inhibitor-resistant β-lactamase.
7Bauerfeind, A., Y. Chong, and K. Lee. 1998. Plasmid-encoded AmpC beta-lactamases: how far have we gone 10 ears after discovery? Yonsei Med. J. 39: 520-525.
8Sutcliffe. J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agent Chemother. 40: 2562-2566.
9Leclerc, R., A., Brisson-Noël, J. Duval, and P. Courvalin. 1991. Phenotypic expression and genetic heterogeneity of lincosamide inactivation in Staphylococcus sp. Antimicrob. Agents. Chemother. 31: 1887-1891.
10Bozdogan, B., L. Berrezouga, M.-S. Kuo, D. A. Yurek, K. A. Farley, B. J. Stockman, and R. Leclercq. 1999. A new gene, linB, conferring resistance to lincosamides by nucleotidylation in Enterococcus faecium HM1025. Antimicrob. Agents. Chemother. 43: 925-929.
11Cockerill III, F. R. 1999. Genetic methods for assessing antimicrobial resistance. Antimicrob. Agents. Chemother. 43: 199-212.
12Tenover, F. C., T. Popovic, and O Olsvik. 1996. Genetic methods for detecting antibacterial resistance genes. pp. 1368-1378. In Murray, P. R., E. J. Baron, M. A. Pfaller, F. C. Tenover, R. H. Yolken (eds). Manual of clinical microbiology. 6th ed., ASM Press, Washington, D. C. USA
13Dowson, C. G., T. J. Tracey, and B. G. Spratt. 1994. Origin and molecular epidemiology of penicillin-binding-protein-mediated resistance to β-lactam antibiotics. Trends Molec. Microbiol. 2: 361-366.
14Jensen, L. B., N. Frimodt-Moller, F. M. Aarestrup. 1999. Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark. FEMS Microbiol. 170: 151-158:
15Thal, L. A., and M. J. Zervos. 1999. Occurrence and epidemiology of resistance to virginimycin and streptrogramins. J. Antimicrob. Chemother. 43: 171-176.
16Martinez J. L., A. Alonso, J. M. Gomez-Gomez, and F. Baquero. 1998. Quinolone resistance by mutations in chromosomal gyrase genes. Just the tip of the iceberg? J. Antimicrob. Chemother. 42: 683-688
17Cockerill III, F. R. 1999. Genetic methods for assessing antimicrobial resistance. Antimicrob. Agents. Chemother. 43: 199-212.
18Casadewall, B. and P. Courvalin. 1999 Characterization of the vanD glycopeptide resistance gene cluster from Enterococcus faecium BM 4339. J. Bacteriol. 181: 3644-3648.
19Roberts, M. C. 1999. Genetic mobility and distribution of tetracycline resistance determinants. Ciba Found. Symp. 207: 206-222.
20Huovinen, P., L. Sundström, G. Swedberg, and O. Sköld. 1995. Trimethoprim and sulfonamide resistance.Antimicrob. Agent Chemother. 39: 279-289.
Actinobacillus actinomycetemcomitans
Actinomyces pyogenes
Aeromonas hydrophila
Bacillus anthracis
Bacillus cereus
Bacillus mycoides
Bacillus pseudomycoides
Bacteroides fragilis
Bordetella bronchiseptica
Bordetella pertussis
Campylobacter jejuni
Citrobacter freundii
Clostridium botulinum
Clostridium difficile
Clostridium perfringens
Clostridium sordellii
Clostridium tetani
Corynebacterium diphtheriae
Corynebacterium pseudotuberculosis
Eikenella corrodens
Enterobacter cloacae
Enterococcus faecalis
Escherichia coli (EHEC)
Acinetobacter baumannii
Actinomyces meyeri
Aerococcus viridans
Achromobacter xylosoxidans subsp. denitrificans
Anaerorhabdus furcosus
Bacillus anthracis
Bacillus cereus
Bacteroides distasonis
Enterococcus casseliflavus
Staphylococcus saprophyticus
Bacteroides ovatus
Bartonella henselae
Bifidobacterium adolescentis
Bifidobacterium dentium
Brucella abortus
Burkholderia cepacia
Cedecea davisae
Cedecea neteri
Cedecea lapagei
Chlamydia pneumoniae
Chlamydia psittaci
Chlamydia trachomatis
Chryseobacterium meningosepticum
Citrobacter amalonaticus
Citrobacter braakii
Citrobacter koseri
Citrobacter farmeri
Citrobacter freundii
Citrobacter sedlakii
Citrobacter werkmanii
Citrobacter youngae
Clostridium perfringens
Comamonas acidovorans
Corynebacterium bovis
Corynebacterium cervicis
Corynebacterium flavescens
Corynebacterium kutscheri
Corynebacterium minutissimum
Corynebacterium mycetoides
Corynebacterium pseudogenitalium
Corynebacterium renale
Corynebacterium ulcerans
Corynebacterium urealyticum
Corynebacterium xerosis
Coxiella burnetii
Edwardsiella hoshinae
Edwardsiella tarda
Eikenella corrodens
Enterobacter aerogenes
Enterobacter agglomerans
Enterobacter amnigenus
Enterobacter asburiae
Enterobacter cancerogenus
Enterobacter cloacae
Enterobacter gergoviae
Enterobacter hormaechei
Enterobacter sakazakii
Enterococcus casseliflavus
Enterococcus cecorum
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus hirae
Enterococcus mundtii
Enterococcus pseudoavium
Enterococcus raffinosus
Enterococcus saccharolyticus
Enterococcus solitarius
Enterococcus casseliflavus
Staphylococcus saprophyticus
Enterococcus flavescens
Enterococcus gallinarum
Ehrlichia canis
Escherichia coli
Escherichia fergusonii
Escherichia hermannii
Escherichia vulneris
Eubacterium lentum
Eubacterium nodatum
Ewingella americana
Francisella tularensis
Fusobacterium nucleatum subsp. polymorphum
Gemella haemolysans
Gemella morbillorum
Haemophilus actinomycetemcomitans
Haemophilus aphrophilus
Haemophilus ducreyi
Haemophilus haemolyticus
Haemophilus parahaemolyticus
Haemophilus parainfluenzae
Haemophilus paraphrophilus
Haemophilus segnis
Hafnia alvei
Kingella kingae
Klebsiella omithinolytica
Klebsiella oxytoca
Klebsiella planticola
Klebsiella pneumoniae subsp. ozaenae
Klebsiella pneumoniae pneumoniae
Klebsiella pneumoniae subsp. rhinoscleromatis
Kluyvera ascorbata
Kluyvera cryocrescens
Kluyvera georgiana
Lactobacillus casei subsp. casei
Lactococcus lactis subsp. lactis
Leclercia adecarboxylata
Legionella micdadei
Legionella pneumophila subsp. pneumophila
Leminorella grimontii
Leminorella richardii
Leptospira interrogans
Megamonas hypermegale
Mitsuokella multacidus
Mobiluncus curtisii subsp. holmesii
Moellerella wisconsensis
Moraxella catarrhalis
Morganella morganii subsp. morganii
Mycobacterium tuberculosis
Neisseria cinerea
Neisseria elongata subsp. elongata
Neisseria flavescens
Neisseria gonorrhoeae
Neisseria lactamica
Neisseria meningitidis
Neisseria mucosa
Neisseria sicca
Neisseria subflava
Neisseria weaveri
Ochrobactrum anthropi
Pantoea agglomerans
Pantoea dispersa
Pasteurella multocida
Peptostreptococcus anaerobius
Peptostreptococcus asaccharolyticus
Peptostreptococcus prevotii
Porphyromonas asaccharolytica
Porphyromonas gingivalis
Pragia fontium
Prevotella melaninogenica
Prevotella oralis
Propionibacterium acnes
Proteus mirabilis
Proteus penneri
Proteus vulgaris
Providencia alcalifaciens
Providencia rettgeri
Providencia rustigianii
Providencia stuartii
Pseudomonas aeruginosa
Pseudomonas fluorescens
Pseudomonas stutzeri
Psychrobacter phenylpyruvicum
Rahnella aquatilis
Salmonella choleraesuis subsp. arizonae
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. diarizonae
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. houtenae
Salmonella choleraesuis subsp. indica
Salmonella choleraesuis subsp. salamae
Salmonella choleraesuis subsp. choleraesuis serotype Typhi
Serratia fonticola
Serratia liquefaciens
Serratia marcescens
Serratia odorifera
Serratia plymuthica
Serratia rubidaea
Shigella boydii
Shigella dysenteriae
Shigella flexneri
Shigella sonnei
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus subsp. aureus
Staphylococcus auricularis
Staphylococcus capitis subsp. capitis
Macrococcus caseolyticus
Staphylococcus cohnii subsp. cohnii
Staphylococcus epidermidis
Staphylococcus haemolyticus
Staphylococcus warneri
Staphylococcus haemolyticus
Staphylococcus haemolyticus
Staphylococcus haemolyticus
Staphylococcus hominis subsp. hominis
Staphylococcus warneri
Staphylococcus hominis
Staphylococcus hominis
Staphylococcus hominis
Staphylococcus hominis
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus saprophyticus
Staphylococcus saprophyticus
Staphylococcus sciuri subsp. sciuri
Staphylococcus warneri
Staphylococcus warneri
Bifidobacterium longum
Stenotrophomonas maltophilia
Streptococcus acidominimus
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus anginosus
Streptococcus bovis
Streptococcus anginosus
Streptococcus cricetus
Streptococcus cristatus
Streptococcus downei
Streptococcus dysgalactiae
Streptococcus equi subsp. equi
Streptococcus ferus
Streptococcus gordonii
Streptococcus anginosus
Streptococcus macacae
Streptococcus gordonii
Streptococcus mutans
Streptococcus parasanguinis
Streptococcus ratti
Streptococcus sanguinis
Streptococcus sobrinus
Streptococcus suis
Streptococcus uberis
Streptococcus vestibularis
Tatumella ptyseos
Trabulsiella guamensis
Veillonella parvula
Yersinia enterocolitica
Yersinia frederiksenii
Yersinia intermedia
Yersinia pestis
Yersinia pseudotuberculosis
Yersinia rohdei
Yokenella regensburgei
Achromobacter xylosoxidans subsp. denitrificans
Acinetobacter baumannii
Acinetobacter lwoffii
Staphylococcus saprophyticus
Alcaligenes faecalis subsp. faecalis
Bacillus anthracis
Bacillus cereus
Bacteroides distasonis
Bacteroides ovatus
Leclercia adecarboxylata
Stenotrophomonas maltophilia
Bartonella henselae
Bifidobacterium adolescentis
Brucella abortus
Cedecea davisae
Cedecea lapagei
Cedecea neteri
Chryseobacterium meningosepticum
Citrobacter amalonaticus
Citrobacter braakii
Citrobacter koseri
Citrobacter farmeri
Citrobacter freundii
Citrobacter koseri
Citrobacter sedlakii
Citrobacter werkmanii
Citrobacter youngae
Clostridium innocuum
Clostridium perfringens
Corynebacterium diphtheriae
Corynebacterium pseudodiphtheriticum
Corynebacterium ulcerans
Corynebacterium urealyticum
Coxiella burnetii
Edwardsiella hoshinae
Edwardsiella tarda
Eikenella corrodens
Enterobacter agglomerans
Enterobacter arnnigenus
Enterobacter asburiae
Enterobacter cancerogenus
Enterobacter cloacae
Enterobacter gergoviae
Enterobacter hormaechei
Enterobacter sakazakii
Enterococcus avium
Enterococcus casseliflavus
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus gallinarum
Enterococcus saccharolyticus
Escherichia fergusonii
Escherichia hermannii
Escherichia vulneris
Eubacterium lentum
Ewingella americana
Francisella tularensis
Fusobacterium gonidiaformans
Fusobacterium necrophorum subsp. necrophorum
Fusobacterium nucleatum subsp. polymorphum
Gardnerella vaginalis
Gemella haemolysans
Gemella morbillorum
Haemophilus ducreyi
Haemophilus haemolyticus
Haemophilus parahaemolyticus
Haemophilus parainfluenzae
Hafnia alvei
Kingella kingae
Klebsiella pneumoniae subsp. ozaenae
Klebsiella omithinolytica
Klebsiella oxytoca
Klebsiella planticola
Klebsiella pneumoniae subsp. pneumoniae
Kluyvera ascorbata
Kluyvera cryocrescens
Kluyvera georgiana
Lactobacillus acidophilus
Legionella pneumophila subsp. pneumophila
Leminorella grimontii
Listeria monocytogenes
Micrococcus lylae
Moellerella wisconsensis
Moraxella catarrhalis
Moraxella osloensis
Morganella morganii subsp. morganii
Pantoea agglomerans
Pantoea dispersa
Pasteurella multocida
Pragia fontium
Proteus mirabilis
Proteus vulgaris
Providencia alcalifaciens
Providencia rettgeri
Providencia rustigianii
Providencia stuartii
Psychrobacter phenylpyruvicum
Rahnella aquatilis
Salmonella choleraesuis subsp. arizonae
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. diarizonae
Salmonella choleraesuis subsp. houtenae
Salmonella choleraesuis subsp. indica
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. salamae
Salmonella choleraesuis subsp. choleraesuis serotype Typhi
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. choleraesuis
Serratia ficaria
Serratia fonticola
Serratia grimesii
Serratia liquefaciens
Serratia marcescens
Serratia odorifera
Serratia plymuthica
Serratia rubidaea
Pseudomonas putida
Shigella boydii
Shigella dysenteriae
Shigella flexneri
Shigella sonnei
Staphylococcus aureus
Staphylococcus auricularis
Staphylococcus capitis subsp. capitis
Staphylococcus cohnii subsp. cohnii
Staphylococcus epidermidis
Staphylococcus haemolyticus
Staphylococcus hominis subsp. hominis
Staphylococcus hominis
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus simulans
Staphylococcus wameri
Streptococcus acidominimus
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus dysgalactiae
Streptococcus equi subsp. equi
Streptococcus anginosus
Streptococcus salivarius
Streptococcus suis
Streptococcus uberis
Tatumella ptyseos
Trabulsiella guamensis
Yersinia bercovieri
Yersinia enterocolitica
Yersinia frederiksenii
Yersinia intermedia
Yersinia pseudotuberculosis
Yersinia rohdei
Yokenella regensburgei
Yarrowia lipolytica
Absidia corymbifera
Alternaria alternata
Aspergillus flavus
Aspergillus fumigatus
Aspergillus fumigatus
Aspergillus niger
Blastoschizomyces capitatus
Candida albicans
Candida albicans
Candida albicans
Candida albicans
Candida albicans
Candida dubliniensis
Candida catenulata
Candida dubliniensis
Candida dubliniensis
Candida famata
Candida glabrata
Candida guilliermondii
Candida haemulonii
Candida inconspicua
Candida kefyr
Candida krusei
Candida lambica
Candida lusitaniae
Candida norvegensis
Candida parapsilosis
Candida rugosa
Candida sphaerica
Candida tropicalis
Candida utilis
Candida viswanathii
Candida zeylanoides
Coccidioides immitis
Cryptococcus albidus
Exophiala jeanselmei
Fusarium oxysporum
Geotrichum sp.
Histoplasma capsulatum
Issatchenkia orientalis Kudrjanzev
Malassezia furfur
Malassezia pachydermatis
Malbranchea filamentosa
Metschnikowia pulcherrima
Paecilomyces lilacinus
Paracoccidioides brasiliensis
Penicillium marneffei
Pichia anomala
Pichia anomala
Pseudallescheria boydii
Rhizopus oryzae
Rhodotorula minuta
Sporobolomyces salmonicolor
Sporothrix schenckii
Stephanoascus ciferrii
Trichophyton mentagrophytes
Trichosporon cutaneum
Wangiella dermatitidis
Aspergillus fumigatus
Blastoschizomyces capitatus
Candida albicans
Candida dubliniensis
Candida famata
Candida glabrata
Candida guilliermondii
Candida haemulonii
Candida inconspicua
Candida kefyr
Candida krusei
Candida lambica
Candida lusitaniae
Candida norvegensis
Candida parapsilosis
Candida rugosa
Candida sphaerica
Candida tropicalis
Candida utilis
Candida viswanathii
Candida zeylanoides
Coccidioides immitis
Cryptococcus albidus
Fusarium oxysporum
Geotrichum sp.
Histoplasma capsulatum
Malassezia furfur
Malassezia pachydermatis
Metschnikowia pulcherrima
Penicillium mameffei
Pichia anomala
Pichia anomala
Rhodotorula minuta
Rhodotorula mucilaginosa
Sporobolomyces salmonicolor
Sporothrix schenckii
Stephanoascus ciferrii
Trichophyton mentagrophytes
Wangiella dermatitidis
Yarrowia lipolytica
Aspergillus fumigatus
Blastoschizomyces capitatus
Candida rugosa
Coccidioides immitis
Fusarium oxysporum
Histoplasma capsulatum
Paracoccidioides brasiliensis
Penicillium marneffei
Pichia anomala
Trichophyton mentagrophytes
Yarrowia lipolytica
Babesia bigemina
Babesia bovis
Crithidia fasciculata
Entamoeba histolytica
Giardia lamblia
Leishmania tropica
Leishmania aethiopica
Leishmania tropica
Leishmania donovani
Leishmania infantum
Leishmania enriettii
Leishmania gerbilli
Leishmania hertigi
Leishmania major
Leishmania amazonensis
Leishmania mexicana
Leishmania tarentolae
Leishmania tropica
Neospora caninum
Trichomonas vaginalis
Trypanosoma brucei subsp. brucei
Crithidia fasciculata
Leishmania tropica
Leishmania aethiopica
Leishmania donovani
Leishmania infantum
Leishmania gerbilli
Leishmania hertigi
Leishmania major
Leishmania amazonensis
Enterococcus faecalis
Enterococcus faecium
Enterococcus gallinarum
Haemophilus influenzae
Staphylococcus epidermidis
Salmonella choleraesuis subsp. choleraesuis
Serratia ficaria
Enterococcus malodoratus
Enterococcus durans
Enterococcus pseudoavium
Enterococcus dispar
Enterococcus avium
Saccharomyces cerevisiae
Enterococcus faecium
Saccharomyces cerevisiae
Cryptococcus neoformans
Candida albicans
Corynebacterium diphtheriae
Candida catenulata
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Trypanosoma cruzi
Corynebacterium glutamicum
Escherichia coli
Helicobacter pylori
Clostridium acetobutylicum
Cytophaga lytica
Ehrlichia risticii
Vibrio cholerae
Vibrio cholerae
Leishmania enriettii
Babesia microti
Cryptococcus neoformans
Cryptococcus neoformans
Cunninghamella bertholletiae
Candida tropicalis
Enterococcus hirae
Chlamydia pneumoniae
Halobacterium salinarum
Homo sapiens
Plasmodium falciparum
Saccharomyces cerevisiae
Schizosaccharomyces pombe
Trypanosoma congolense
Thermus thermophilus
Escherichia coli
Borrelia burgdorferi
Treponema pallidum
Chlamydia trachomatis
Enterococcus faecalis
Methanosarcina barkeri
Methanococcus jannaschii
Porphyromonas gingivalis
Streptococcus pneumoniae
Burkholderia mallei
Burkholderia pseudomallei
Clostridium beijerinckii
Clostridium innocuum
Clostridium novyi
Clostridium septicum
Clostridium tertium
Clostridium tetani
Enterococcus malodoratus
Enterococcus sulfureus
Lactococcus garvieae
Mycoplasma pirum
Mycoplasma salivarium
Neisseria polysaccharea
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. choleraesuis
Serratia grimesii
Clostridium difficile
Burkholderia pseudomallei
Clostridium bifermentans
Clostridium beijerinckii
Clostridium difficile
Clostridium ramosum
Clostridium septicum
Clostridium tertium
Comamonas acidovorans
Klebsiella pneumoniae subsp. rhinoscleromatis
Neisseria canis
Neisseria cinerea
Neisseria cuniculi
Neisseria elongata subsp. elongata
Neisseria flavescens
Neisseria gonorrhoeae
Neisseria gonorrhoeae
Neisseria lactamica
Neisseria meningitidis
Neisseria mucosa
Neisseria subflava
Neisseria weaveri
Neisseria animalis
Proteus penneri
Salmonella choleraesuis subsp. choleraesuis
Yersinia pestis
Burkholderia mallei
Clostridium sordellii
Clostridium novyi
Clostridium botulinum
Clostridium histolyticum
Peptostreptococcus prevotii
Absidia corymbifera
Alternaria alternata
Aspergillus flavus
Mucor circinelloides
Piedraia hortai
Pseudallescheria boydii
Rhizopus oryzae
Scopulariopsis koningii
Trichophyton mentagrophytes
Trichophyton tonsurans
Trichosporon cutaneum
Cladophialophora carrionii
Cunninghamella bertholletiae
Curvularia lunata
Fonsecaea pedrosoi
Microsporum audouinii
Mucor circinelloides
Phialophora verrucosa
Saksenaea vasiformis
Syncephalastrum racemosum
Trichophyton tonsurans
Trichophyton mentagrophytes
Bipolaris hawaiiensis
Aspergillus fumigatus
Trichophyton mentagrophytes
Clostridium novyi
Clostridium difficile
Clostridium septicum
Clostridium botulinum
Clostridium perfringens
Clostridium tetani
Streptococcus pyogenes
Babesia bovis
Cryptosporidium parvum
Leishmania infantum
Leishmania major
Leishmania tarentolae
Trypanosoma brucei
Trypanosoma cruzi
Trypanosoma cruzi
Trypanosoma cruzi
Babesia bovis
Leishmania aethiopica
Leishmania amazonensis
Leishmania donovani
Leishmania infantum
Leishmania enriettii
Leishmania gerbilli
Leishmania major
Leishmania mexicana
Leishmania tarentolae
Trypanosoma cruzi
Trypanosoma cruzi
Trypanosoma cruzi
Babesia bigemina
Babesia bovis
Babesia microti
Leishmania guyanensis
Leishmania mexicana
Leishmania tropica
Leishmania tropica
Bordetella pertussis
Trypanosoma brucei brucei
Cryptosporidium parvum
Staphylococcus saprophyticus
Zoogloea ramigera
Staphylococcus saprophyticus
Enterococcus casseliflavus
Enterococcus casseliflavus
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus gallinarum
Staphylococcus haemolyticus
Staphylococcus epidermidis
Staphylococcus epidermidis
Staphylococcus epidermidis
Staphylococcus epidermidis
Enterococcus gallinarum
Pseudomonas aeruginosa
Enterococcus casseliflavus
Enterococcus casseliflavus
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecium
Enterococcus faecium
Zoogloea ramigera
Enterococcus faecalis
Aspergillus fumigatus
Penicillium mameffei
Paecilomyces lilacinus
Penicillium mameffei
Sporothrix schenckii
Malbranchea filamentosa
Paecilomyces lilacinus
Aspergillus niger
Aspergillus fumigatus
Penicillium mameffei
Piedraia hortai
Paecilomyces lilacinus
Paracoccidioides brasiliensis
Sporothrix schenckii
Penicillium mameffei
Curvularia lunata
Aspergillus niger
Bipolaris hawaiiensis
Aspergillus flavus
Alternaria alternata
Penicillium mameffei
Penicillium mameffei
Escherichia coli
Bacteroides fragilis
Bacteroides distasonis
Porphyromonas asaccharolytica
Listeria monocytogenes
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Cryptococcus humicolus
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Neisseria polysaccharea
Neisseria sicca
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus oralis
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Babesia microti
Entamoeba histolytica
Fusobacterium nucleatum subsp. polymorphum
Leishmania aethiopica
Leishmania tropica
Leishmania guyanensis
Leishmania donovani
Leishmania hertigi
Leishmania mexicana
Leishmania tropica
Peptostreptococcus anaerobius
Bordetella pertussis
Bordetella pertussis
Enterococcus columbae
Enterococcus flavescens
Streptococcus pneumoniae
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Mycobacterium avium
Streptococcus pneumoniae
Mycobacterium gordonae
Streptococcus pneumoniae
Mycobacterium tuberculosis
Staphylococcus warneri
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus oralis
Streptococcus pneumoniae
Enterococcus hirae
Enterococcus mundtii
Enterococcus raffinosus
Bacillus anthracis
Prevotella melaninogenica
Enterococcus casseliflavus
Streptococcus pyogenes
Streptococcus pyogenes
Bacillus cereus
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Enterococcus faecium
Enterococcus gallinarum
Enterococcus faecium
Enterococcus faecium
Enterococcus faecium
Enterococcus faecalis
Enterococcus gallinarum
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus gallinarum
Enterococcus casseliflavus
Enterococcus casseliflavus
Enterococcus casseliflavus
Enterococcus casseliflavus
Enterococcus flavescens
Enterococcus flavescens
Enterococcus flavescens
Enterococcus faecium
Enterococcus faecium
Enterococcus faecium
Enterococcus faecalis
Enterococcus gallinarum
Enterococcus faecium
Enterococcus flavescens
Enterococcus faecium
Enterococcus gallinarum
Escherichia coli
Escherichia coli
Staphylococcus saprophyticus
Enterococcus faecium
Enterococcus gallinarum
Enterococcus faecium
Enterococcus casseliflavus
Enterococcus faecium
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Staphylococcus aureus
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus oralis
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Staphylococcus saprophyticus
Streptococcus pyogenes
Escherichia coli
Enterococcus faecium
Enterococcus faecalis
Staphylococcus aureus subsp. aureus
Bacillus anthracis
Bacillus mycoides
Bacillus thuringiensis
Bacillus thuringiensis
Bacillus thuringiensis
Bacillus weihenstephanensis
Bacillus thuringiensis
Bacillus thuringiensis
Bacillus cereus
Bacillus cereus
Staphylococcus aureus
Bacillus weihenstephanensis
Bacillus anthracis
Bacillus thuringiensis
Bacillus cereus
Bacillus cereus
Bacillus thuringiensis
Bacillus thuringiensis
Bacillus thuringiensis
Bacillus thuringiensis
Bacillus anthracis
Paracoccidioides brasiliensis
Blastomyces dermatitidis
Histoplasma capsulatum
Trichophyton rubrum
Microsporum canis
Aspergillus versicolor
Exophiala moniliae
Hortaea wemeckii
Fusarium solani
Aureobasidium pullulans
Blastomyces dermatitidis
Exophiala dermatitidis
Fusarium moniliforme
Aspergillus terreus
Aspergillus fumigatus
Cryptococcus laurentii
Emmonsia parva
Fusarium solani
Sporothrix schenckii
Aspergillus nidulans
Cladophialophora carrionii
Exserohilum rostratum
Bacillus thuringiensis
Bacillus thuringiensis
Staphylococcus aureus
Escherichia coli
Staphylococcus aureus
Escherichia coli
Staphylococcus aureus
Staphylococcus aureus
Pseudomonas aeruginosa
Serratia marcescens
Escherichia coli
Enterobacter cloacae
Citrobacter koseri
Serratia marcescens
Escherichia coli
Staphylococcus aureus
Escherichia coli
Escherichia coli
Enterococcus faecalis
Acinetobacter baumannii
Pseudomonas aeruginosa
Klebsiella pneumoniae
Escherichia coli
Salmonella choleraesuis subsp. choleraesuis serotype
Pseudomonas aeruginosa
Escherichia coli
Pseudomonas aeruginosa
Pseudomonas aeruginosa
Salmonella choleraesuis subsp. choleraesuis serotype
Staphylococcus epidermidis
Escherichia coli
Escherichia coli
Escherichia coli
Proteus mirabilis
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Acinetobacter lwoffii
Acinetobacter lwoffii
Acinetobacter lwoffii
Haemophilus influenzae
Haemophilus influenzae
Haemophilus influenzae
Proteus mirabilis
Proteus mirabilis
Proteus mirabilis
Campylobacter curvus
Escherichia coli
Escherichia coli
Staphylococcus haemolyticus
Enterococcus faecium
Streptococcus pyogenes
Streptococcus pneumoniae
Escherichia coli
Candida albicans
Candida dubliniensis
Candida famata
Candida glabrata
Candida guilliermondii
Candida haemulonii
Candida kefyr
Candida lusitaniae
Candida sphaerica
Candida tropicalis
Candida viswanathii
Alcaligenes faecalis subsp. faecalis
Prevotella buccalis
Succinivibrio dextrinosolvens
Tetragenococcus halophilus
Campylobacter jejuni subsp. jejuni
Campylobacter rectus
Enterococcus casseliflavus
Enterococcus gallinarum
Streptococcus mitis
Enterococcus faecium
Enterococcus faecium
Enterococcus faecalis
Campylobacter jejuni subsp. doylei
Enterococcus sulfurous
Enterococcus solitarius
Campylobacter sputorum subsp. sputorum
Enterococcus pseudoavium
Klebsiella omithinolytica
Klebsiella oxytoca
Staphylococcus aureus
Staphylococcus cohnii
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus
Aspergillus fumigatus
Aspergillus fumigatus
Bacillus mycoides
Bacillus mycoides
Bacillus mycoides
Bacillus pseudomycoides
Bacillus pseudomycoides
Budvicia aquatica
Buttiauxella agrestis
Candida norvegica
Streptococcus pneumoniae
Campylobacter lari
Coccidioides immitis
Emmonsia parva
Erwinia amylovora
Fonsecaea pedrosoi
Fusarium moniliforme
Klebsiella oxytoca
Microsporum audouinii
Obesumbacterium proteus
Paracoccidioides brasiliensis
Plesiomonas shigelloides
Shewanella putrefaciens
Campylobacter curvus
Campylobacter rectus
Fonsecaea pedrosoi
Microsporum audouinii
Piedraia hortai
Escherichia coli
Saksenaea vasiformis
Trichophyton tonsurans
Enterobacter aerogenes
Bordetella pertussis
Arcanobacterium haemolyticum
Butyrivibrio fibrisolvens
Campylobacter jejuni subsp. doylei
Campylobacter lari
Campylobacter sputorum subsp. sputorum
Campylobacter upsaliensis
Globicatella sanguis
Lactobacillus acidophilus
Leuconostoc mesenteroides subsp. dextranicum
Prevotella buccalis
Ruminococcus bromii
Paracoccidioides brasiliensis
Candida norvegica
Aspergillus nidulans
Aspergillus terreus
Candida norvegica
Candida parapsilosis
Streptococcus gordonii
Streptococcus mutans
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus salivarius subsp. thermophilus
Escherichia coli
Enterococcus faecalis
Pseudomonas aeruginosa
Staphylococcus aureus
Escherichia coli
Staphylococcus aureus
Enterococcus faecalis
Campylobacter jejuni subsp. jejuni
Abiotrophia adiacens
Abiotrophia defectiva
Corynebacterium accolens
Corynebacterium genitalium
Corynebacterium jeikeium
Corynebacterium pseudodiphtheriticum
Corynebacterium striatum
Enterococcus avium
Gardnerella vaginalis
Listeria innocua
Listeria ivanovii
Listeria monocytogenes
Listeria seeligeri
Staphylococcus aureus
Staphylococcus saprophyticus
Staphylococcus simulans
Streptococcus agalactiae
Streptococcus pneumoniae
Streptococcus salivarius
Agrobacterium radiobacter
Bacillus subtilis
Bacteroides fragilis
Borrelia burgdorferi
Brevibacterium linens
Chlamydia trachomatis
Fibrobacter succinogenes
Flavobacterium ferrugineum
Helicobacter pylori
Micrococcus luteus
Mycobacterium tuberculosis
Mycoplasma genitalium
Neisseria gonorrhoeae
Rickettsia prowazekii
Salmonella choleraesuis subsp. choleraesuis
Shewanella putrefaciens
Stigmatella aurantiaca
Thiomonas cuprina
Treponema pallidum
Ureaplasma urealyticum
Wolinella succinogenes
Burkholderia cepacia
Bacillus anthracis
Bacillus anthracis
Bacillus cereus
Bacillus cereus
Bacillus mycoides
Bacillus pseudomycoides
Bacillus thuringiensis
Bacillus thuringiensis
Klebsiella oxytoca
Klebsiella pneumoniae subsp. ozaenae
Klebsiella planticola
Klebsiella pneumoniae
Klebsiella pneumoniae subsp. pneumoniae
Klebsiella pneumoniae subsp. pneumoniae
Klebsiella pneumoniae subsp. rhinoscleromatis
Klebsiella terrigena
Legionella pneumophila subsp. pneumophila
Proteus mirabilis
Providencia rettgeri
Proteus vulgaris
Yersinia enterocolitica
Klebsiella oxytoca
Klebsiella oxytoca
Klebsiella pneumoniae subsp. ozaenae
Klebsiella planticola
Klebsiella pneumoniae
Klebsiella pneumoniae subsp. pneumoniae
Klebsiella pneumoniae subsp. pneumoniae
Klebsiella pneumoniae subsp. rhinoscleromatis
Klebsiella terrigena
Bacillus cereus
Bacillus cereus
Bacillus anthracis
Bacillus cereus
Bacillus anthracis
Bacillus pseudomycoides
Bacillus cereus
Bacillus anthracis
Bacillus cereus
Bacillus weihenstephanensis
Bacillus mycoides
Bacillus thuringiensis
Bacillus weihenstephanensis
Bacillus thuringiensis
Bacillus anthracis
Bacillus pseudomycoides
Bacillus anthracis
Bacillus cereus
Bacillus cereus
Bacillus mycoides
Bacillus cereus
Bacillus cereus
Bacillus cereus
Bacillus anthracis
Bacillus mycoides
Bacillus thuringiensis
Bacillus cereus
Bacillus weihenstephanensis
Bacillus anthracis
Bacillus cereus
Bacillus cereus
Bacillus anthracis
Bacillus cereus
Bacillus anthracis
Bacillus pseudomycoides
Bacillus cereus
Streptococcus oralis
Budvicia aquatica
Buttiauxella agrestis
Klebsiella oxytoca
Plesiomonas shigelloides
Shewanella putrefaciens
Obesumbacterium proteus
Klebsiella oxytoca
Budvicia aquatica
Plesiomonas shigelloides
Obesumbacterium proteus
Shewanella putrefaciens
Buttiauxella agrestis
Campylobacter coli
Campylobacter fetus subsp. fetus
Campylobacter fetus subsp. venerealis
Buttiauxella agrestis
Klebsiella oxytoca
Plesiomonas shigelloides
Shewanella putrefaciens
Obesumbacterium proteus
Budvicia aquatica
Abiotrophia adiacens
Arcanobacterium haemolyticum
Basidiobolus ranarum
Blastomyces dermatitidis
Blastomyces dermatitidis
Campylobacter coli
Campylobacter fetus subsp. fetus
Campylobacter fetus subsp. venerealis
Campylobacter gracilis
Campylobacter jejuni subsp. jejuni
Enterococcus cecorum
Enterococcus columbae
Enterococcus dispar
Enterococcus malodoratus
Enterococcus mundtii
Enterococcus raffinosus
Globicatella sanguis
Lactococcus garvieae
Lactococcus lactis
Listeria ivanovii
Succinivibrio dextrinosolvens
Tetragenococcus halophilus
Campylobacter fetus subsp. fetus
Campylobacter fetus subsp. venerealis
Campylobacter jejuni subsp. jejuni
Enterococcus avium
Enterococcus faecium
Listeria monocytogenes
Streptococcus mitis
Streptococcus oralis
Aspergillus fumigatus
Aspergillus versicolor
Basidiobolus ranarum
Campylobacter gracilis
Campylobacter jejuni subsp. jejuni
Coccidioides immitis
Erwinia amylovora
Salmonella choleraesuis subsp. choleraesuis serotype
Klebsiella pneumoniae
Klebsiella pneumoniae
Escherichia coli
Klebsiella pneumoniae
Klebsiella pneumoniae
Escherichia coli
Pseudomonas aeruginosa
Neisseria meningitidis
Escherichia coli
Klebsiella oxytoca
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Klebsiella pneumoniae subsp. pneumoniae
Candida inconspicua
Candida utilis
Candida zeylanoides
Candida catenulata
Candida krusei
Cryptococcus neoformans
Cryptococcus neoformans
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Eremothecium gossypii
Eremothecium gossypii
Aspergillus oryzae
Aureobasidium pullulans
Histoplasma capsulatum
Neurospora crassa
Podospora anserina
Podospora curvicolla
Sordaria macrospora
Trichoderma reesei
Candida albicans
Schizosaccharomyces pombe
Klebsiella pneumoniae
Klebsiella pneumoniae
Kluyvera ascorbata
Kluyvera georgiana
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pneumoniae
Mycobacterium tuberculosis
Mycoplasma pneumoniae
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Clostridium difficile
Clostridium difficile
Pseudomonas putida
Pseudomonas aeruginosa
Campylobacter jejuni
Streptococcus pneumoniae
Staphylococcus aureus
Escherichia coli
Escherichia coli
Shigella flexneri
Clostridium perfringens
Staphylococcus aureus
Staphylococcus aureus
Salmonella typhimurium
Alcaligenes faecalis subsp. faecalis
Campylobacter coli
Succinivibrio dextrinosolvens
Tetragenococcus halophilus
Campylobacter jejuni subsp. jejuni
Campylobacter jejuni subsp. jejuni
Leishmania guyanensis
Trypanosoma brucei brucei
Aspergillus nidulans
Leishmania panamensis
Aspergillus nidulans
Aureobasidium pullulans
Emmonsia parva
Exserohilum rostratum
Fusarium moniliforme
Fusarium solani
Histoplasma capsulatum
Kocuria kristinae
Vibrio mimicus
Citrobacter freundii
Clostridium botulinum
Francisella tularensis
Peptostreptococcus anaerobius
Peptostreptococcus asaccharolyticus
Providencia stuartii
Salmonella choleraesuis subsp. choleraesuis
Salmonella choleraesuis subsp. choleraesuis
Staphylococcus saprophyticus
Yersinia pseudotuberculosis
Zoogloea ramigera
Abiotrophia adiacens
Acinetobacter baumannii
Actinomyces meyeri
Clostridium difficile
Corynebacterium diphtheriae
Enterobacter cloacae
Klebsiella pneumoniae subsp. pneumoniae
Listeria monocytogenes
Mycobacterium avium
Mycobacterium gordonae
Mycobacterium kansasii
Mycobacterium terrae
Neisseria polysaccharea
Staphylococcus epidermidis
Staphylococcus haemolyticus
Succinivibrio dextrinosolvens
Tetragenococcus halophilus
Veillonella parvula
Yersinia pseudotuberculosis
Zoogloea ramigera
Aeromonas hydrophila
Abiotrophia adiacens
Acinetobacter baumannii
Actinomyces meyeri
Clostridium difficile
Corynebacterium diphtheriae
Enterobacter cloacae
Klebsiella pneumoniae subsp. pneumoniae
Listeria monocytogenes
Mycobacterium avium
Mycobacterium gordonae
Mycobacterium kansasii
Mycobacterium terrae
Neisseria polysaccharea
Staphylococcus epidermidis
Staphylococcus haemolyticus
Abiotrophia adiacens
Acinetobacter baumannii
Actinomyces meyeri
Clostridium difficile
Corynebacterium diphtheriae
Enterobacter cloacae
Klebsiella pneumoniae subsp. pneumoniae
Listeria monocytogenes
Mycobacterium avium
Mycobacterium gordonae
Mycobacterium kansasii
Mycobacterium terrae
Neisseria polysaccharea
Staphylococcus epidermidis
Staphylococcus haemolyticus
Aeromonas hydrophila
Bilophila wadsworthia
Brevundimonas diminuta
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus oralis
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Enterococcus faecium
Enterococcus faecium
Enterococcus faecalis
Streptococcus acidominimus
Bacteroides caccae
Streptococcus agalactiae
Bacteroides vulgatus
Streptococcus agalactiae
Bacteroides fragilis
Streptococcus agalactiae
Candida albicans
Streptococcus agalactiae
Clostridium innoculum
Streptococcus agalactiae
Clostridium ramosum
Streptococcus anginosus
Lactobacillus casei subsp. casei
Streptococcus anginosus
Clostridium septicum
Streptococcus bovis
Corynebacterium cervicis
Streptococcus anginosus
Corynebacterium genitalium
Streptococcus cricetus
Corynebacterium urealyticum
Streptococcus cristatus
Enterococcus faecalis
Streptococcus downei
Enterococcus faecium
Streptococcus dysgalactiae
Eubacterium lentum
Streptococcus equi subsp. equi
Eubacterium nodutum
Streptococcus ferus
Gardnerella vaginalis
Streptococcus gordonii
Lactobacillus acidophilus
Streptococcus macacae
Lactobacillus crispatus
Streptococcus mitis
Lactobacillus gasseri
Streptococcus mutans
Lactobacillus johnsonii
Streptococcus oralis
Lactococcus lactis subsp. lactis
Streptococcus parasanguinis
Lactococcus lactis subsp. lactis
Streptococcus parauberis
Listeria innocua
Streptococcus pneumoniae
Micrococcus luteus
Streptococcus pyogenes
Escherichia coli
Streptococcus ratti
Micrococcus lylae
Streptococcus salivarius
Porphyromonas asaccharolytica
Streptococcus sanguinis
Prevotella corporis
Streptococcus sobrinus
Prevotella melanogenica
Streptococcus suis
Staphylococcus aureus
Streptococcus uberis
Staphylococcus epidermidis
Streptococcus vestubularis
Staphylococcus saprophyticus
Streptococcus agalactiae-specific
Streptococcus acidominimus
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus agalactiae
Streptococcus anginosus
Streptococcus anginosus
Streptococcus bovis
Streptococcus cricetus
Streptococcus cristatus
Streptococcus downei
Streptococcus dysgalactiae
Streptococcus equi subsp. equi
Streptococcus ferus
Streptococcus gordonii
Streptococcus macacae
Streptococcus mitis
Streptococcus mutans
Streptococcus oralis
Streptococcus parasanguinis
Streptococcus parauberis
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus ratti
Streptococcus salivarius
Streptococcus sanguinis
Streptococcus sobrinus
Streptococcus suis
Streptococcus uberis
Streptococcus vestibularis
Abiotrophia adiacens
Abiotrophia defectiva
Bacillus cereus
Bacillus subtilis
Bifidobacterium adolescentis
Bifidobacterium breve
Bifidobacterium dentium
Bifidobacterium longum
Clostridium perfringens
Clostridium septicum
Corynebacterium aquaticus
Corynebacterium
pseudodiphtheriticum
Enterococcus avium
Enterococcus casseliflavus
Enterococcus cecorum
Enterococcus columbae
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus hirae
Enterococcus malodoratus
Enterococcus mundtii
Enterococcus pseudoavium
Enterococcus raffinosus
Enterococcus saccharolyticus
Enterococcus solitarius
Enterococcus sulfureus
Eubacterium lentum
Gemella haemolysans
Gemella morbillorum
Lactobacillus acidophilus
Leuconostoc mesenteroides
Listeria grayi
Listeria grayi
Listeria innocua
Listeria ivanovii
Listeria monocytogenes
Listeria seeligeri
Micrococcus luteus
Pediococcus acidilacti
Pediococcus pentosaceus
Peptococcus niger
Peptostreptococcus anaerobius
Peptostreptococcus indolicus
Peptostreptococcus micros
Propionibacterium acnes
Staphylococcus aureus
Staphylococcus capitis
Staphylococcus epidermidis
Staphylococcus haemolyticus
Staphylococcus hominis
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus simulans
Staphylococcus warneri
Streptococcus agalactiae
Streptococcus anginosus
Streptococcus bovis
Streptococcus constellatus
Streptococcus cristatus
Streptococcus intermedius
Streptococcus mitis
Streptococcus mitis
Streptococcus mutans
Streptococcus parasanguinis
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus salivarius
Streptococcus sanguinis
Streptococcus suis
Acidominococcus fermentans
Acinetobacter baumannii
Alcaligenes faecalis
Anaerobiospirillum
succiniproducens
Anaerorhabdus furcosus
Bacteroides distasonis
Bacteroides thetaiotaomicron
Bacteroides vulgatus
Bordetella pertussis
Bulkholderia cepacia
Butyvibrio fibrinosolvens
Cardiobacterium hominis
Citrobacter freundii
Desulfovibrio vulgaris
Edwardsiellae tarda
Enterobacter cloacae
Escherichia coli
Fusobacterium russii
Haemophilus influenzae
Hafnia alvei
Klebsiella oxytoca
Meganomonas hypermegas
Mitsukoella multiacidus
Moraxella catarrhalis
Morganella morganii
Neisseria meningitidis
Pasteurella aerogenes
Proteus vulgaris
Providencia alcalifaciens
Providencia rettgeri
Pseudomonas aeruginosa
Salmonella typhimurium
Serratia marcescens
Shigella flexneri
Shigella sonnei
Succinivibrio dextrinosolvens
Tissierella praeacuta
Veillonella parvuala
Yersinia enterocolitica
Actinobacillus actinomycetemcomitans
Actinobacillus actinomycetemcomitans
Agrobacterium tumefaciens
Agrobacterium tumefaciens
Agrobacterium tumefaciens
Anacystis nidulans
Aquifex aeolicus
Aquifex aeolicus
Aquifex pyrophilus
Aquifex pyrophilus
Bacillus anthracis
Bacillus anthracis
Bacillus halodurans
Bacillus halodurans
Bacillus stearothermophilus
Bacillus subtilis
Bacillus subtilis
Bacillus subtilis
Bacillus subtilis
Bacteroides forsythus
Bacteroides fragilis
Bordetella bronchiseptica
Bordetella pertussis
Bordetella pertussis
Borrelia burdorgferi
Borrelia burgdorferi
Brevibacterium linens
Buchnera aphidicola
Burkholderia pseudomallei
Campylobacter jejuni
Campylobacter jejuni
Chlamydia pneumoniae
Chlamydia pneumoniae
Chlamydia trachomatis
Chlamydia trachomatis
Chlamydia trachomatis
Chlamydia trachomatis
Chlorobium vibrioforme
Chloroflexus aurantiacus
Clostridium acetobutylicum
Clostridium difficile
Clostridium difficile
Corynebacterium diphtheriae
Corynebacterium diphtheriae
Corynebacterium glutamicum
Corynebacterium glutamicum
Coxiella burnetii
Cytophaga lytica
Deinococcus radiodurans
Deinococcus radiodurans
Deinococcus radiodurans
Deinonema sp.
Eikenella corrodens
Eikenella corrodens
Enterococcus faecalis
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Fervidobacterium islandicum
Fibrobacter succinogenes
Flavobacterium ferrigeneum
Flexistipes sinusarabici
Gloeobacter violaceus
Gloeothece sp.
Haemophilus actinomycetemcomitans
Haemophilus ducreyi
Haemophilus influenzae
Haemophilus influenzae
Haemophilus influenzae
Helicobacter pylori
Helicobacter pylori
Helicobacter pylori
Herpetosiphon aurantiacus
Klebsiella pneumoniae
Klebsiella pneumoniae
Lactobacillus paracasei
Legionella pneumophila
Leptospira interrogans
Leptospira interrogans
Micrococcus luteus
Micrococcus luteus
Moraxella sp.
Mycobacterium avium
Mycobacterium avium
Mycobacterium bovis
Mycobacterium bovis
Mycobacterium leprae
Mycobacterium leprae
Mycobacterium leprae
Mycobacterium leprae
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycoplasma capricolum
Mycoplasma genitalium
Mycoplasma genitalium
Mycoplasma hominis
Mycoplasma hominis
Mycoplasma pneumoniae
Mycoplasma pneumoniae
Neisseria gonorrhoeae
Neisseria gonorrhoeae
Neisseria meningitidis
Neisseria meningitidis
Pasteurella multocida
Peptococcus niger
Phormidium ectocarpi
Planobispora rosea
Planobispora rosea
Planobispora rosea
Plectonema boryanum
Porphyromonas gingivalis
Porphyromonas gingivalis
Porphyromonas gingivalis
Porphyromonas gingivalis
Porphyromonas gingivalis
Porphyromonas gingivalis
Porphyromonas gingivalis
Porphyromonas gingivalis
Prochlorothrix hollandica
Pseudomonas aeruginosa
Pseudomonas putida
Rickettsia prowazekii
Rickettsia prowazekii
Rickettsia prowazekii
Salmonella choleraesuis subsp.
choleraesuis serotype Typhimurium
Salmonella choleraesuis subsp.
choleraesuis serotype Typhimurium
Salmonella choleraesuis subsp.
choleraesuis serotype Typhimurium
Serpulina hyodysenteriae
Serratia marcescens
Shewanella putrefaciens
Shewanella putrefaciens
Spirochaeta aurantia
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus aureus
Stigmatella aurantiaca
Stigmatella aurantiaca
Streptococcus mutans
Streptococcus mutans
Streptococcus oralis
Streptococcus pyogenes
Streptococcus pyogenes
Streptomyces aureofaciens
Streptomyces cinnamoneus
Streptomyces coelicolor
Streptomyces coelicolor
Streptomyces coelicolor
Streptomyces collinus
Streptomyces netropsis
Streptomyces ramocissimus
Streptomyces ramocissimus
Streptomyces ramocissimus
Synechococcus sp.
Synechococcus sp.
Synechocystis sp.
Synechocystis sp.
Synechocystis sp.
Taxeobacter occealus
Thermotoga maritima
Thermotoga maritima
Thermus aquaticus
Thermus thermophilus
Thermus thermophilus
Thermus thermophilus
Thiomonas cuprina
Thiomonas cuprina
Thiomonas cuprina
Treponema denticola
Treponema denticola
Treponema pallidum
Treponema pallidum
Treponema pallidum
Ureaplasma urealyticum
Ureaplasma urealyticum
Ureaplasma urealyticum
Vibrio cholerae
Wolinella succinogenes
Yersinia pestis
Yersinia pestis
Archaeoglobus fulgidus
Halobacterium marismortui
Methanobacterium thermoautrophicum
Methanococcus jannaschii
Methanococcus vannielii
Pyrococcus abyssi
Thermoplasma acidophilum
Absidia glauca
Arxula adeninivorans
Aspergillus oryzae
Aureobasidium pullulans
Candida albicans
Candida albicans
Candida albicans
Cryptococcus neoformans
Cryptococcus neoformans
Eremothecium gossypii
Eremothecium gossypii
Fusarium oxysporum
Histoplasma capsulatum
Podospora anserina
Podospora curvicolla
Prototheca wickerhamii
Puccinia graminis
Reclinomonas americana
Rhizomucor racemosus
Rhizomucor racemosus
Rhizomucor racemosus
Rhodotorula mucilaginosa
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Schizophyllum commune
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Sordaria macrospora
Trichoderma reesei
Yarrowia lipolytica
Blastocystis hominis
Cryptosporidium parvum
Eimeria tenella
Entamoeba histolytica
Entamoeba histolytica
Giardia lamblia
Kentrophoros sp.
Leishmania amazonensis
Leishmania braziliensis
Onchocerca volvulus
Porphyra purpurea
Plasmodium berghei
Plasmodium falciparum
Plasmodium knowlesi
Toxoplasma gondii
Trichomonas tenax
Trypanosoma brucei
Trypanosoma cruzi
Arabidopsis thaliana
Glycine max
Glycine max
Glycine max
Glycine max
Homo sapiens
Pyramimonas disomata
Acetobacterium woodi
Actinobacillus actinomycetemcomitans
Bacillus anthracis
Bacillus firmus
Bacillus megaterium
Bacillus stearothermophilus
Bacillus stearothermophilus
Bacillus subtilis
Bacteroides fragilis
Bordetella bronchiseptica
Bordetella pertussis
Borrelia burgdorferi
Burkholderia cepacia
Burkholderia pseudomallei
Campylobacter jejuni
Chlamydia pneumoniae
Chlamydia trachomatis
Chlorobium vibrioforme
Citrobacter freundii
Clostridium acetobutylicum
Clostridium acetobutylicum
Clostridium difficile
Corynebacterium diphtheriae
Corynebacterium glutamicum
Corynebacterium glutamicum
Cytophaga lytica
Enterobacter aerogenes
Enterococcus faecalis
Enterococcus hirae
Enterococcus hirae
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Escherichia coli
Flavobacterium ferrugineum
Haemophilus actinomycetemcomitans
Haemophilus influenzae
Helicobacter pylori
Helicobacter pylori
Helicobacter pylori
Klebsiella pneumoniae
Lactobacillus casei
Legionella pneumophila
Moorella thermoacetica
Mycobacterium avium
Mycobacterium bovis
Mycobacterium leprae
Mycobacterium leprae
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycoplasma gallisepticum
Mycoplasma genitalium
Mycoplasma pneumoniae
Neisseria gonorrhoeae
Neisseria meningitidis
Pasteurella multocida
Pectinatus frisingensis
Peptococcus niger
Pirellula marina
Porphyromonas gingivalis
Propionigenium modestum
Pseudomonas aeruginosa
Pseudomonas putida
Rhodobacter capsulatus
Rhodospirillum rubrum
Rickettsia prowazekii
Rickettsia prowazekii
Ruminococcus albus
Salmonella bongori
Salmonella bongori
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis subsp.
choleraesuis serotype Dublin
Salmonella choleraesuis subsp.
choleraesuis serotype Dublin
Salmonella choleraesuis subsp.
choleraesuis serotype Infantis
Salmonella choleraesuis subsp.
choleraesuis serotype Tennessee
Salmonella choleraesuis subsp.
choleraesuis serotype Typhimurium
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis
Salmonella choleraesuis
Shewanella putrefaciens
Staphylococcus aureus
Stigmatella aurantiaca
Streptococcus bovis
Streptococcus mutans
Streptococcus mutans
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus pyogenes
Streptococcus sanguinis
Streptomyces lividans
Thermus thermophilus
Thiobacillus ferrooxidans
Treponema pallidum
Vibrio alginolyticus
Vibrio cholerae
Wolinella succinogenes
Yersinia enterocolitica
Yersinia pestis
Archaeoglobus fulgidus
Halobacterium salinarum
Haloferax volcanii
Methanococcus jannaschii
Methanosarcina barkeri
Candida albicans
Candida tropicalis
Kluyveromyces lactis
Neurospora crassa
Saccharomyces cerevisiae
Saccharomyces cerevisiae
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Giardia lamblia
Plasmodium falciparum
Trypanosoma congolense
Homo sapiens
Homo sapiens
Acetobacter aceti
Acetobacter altoacetigenes
Acetobacter polyoxogenes
Acholeplasma laidlawii
Acidiphilium facilis
Acidothermus cellulolyticus
Acinetobacter calcoaceticus
Actinobacillus actinomycetemcomitans
Aeromonas salmonicida
Agrobacterium tumefaciens
Allochromatium vinosum
Aquifex aeolicus
Aquifex pyrophilus
Azotobacter vinelandii
Bacillus stearothermophilus
Bacillus subtilis
Bacillus subtilis
Bacteroides fragilis
Bifidobacterium breve
Blastochloris viridis
Bordetella pertussis
Bordetella pertussis
Borrelia burgdorferi
Borrelia burgdorferi
Brevibacterium flavum
Brucella abortus
Burkholderia cepacia
Burkholderia cepacia
Burkholderia pseudomallei
Campylobacter fetus subsp. fetus
Campylobacter jejuni
Campylobacter jejuni
Chlamydia trachomatis
Chlamydia trachomatis
Chlamydophila pneumoniae
Chloroflexus aurantiacus
Clostridium acetobutylicum
Clostridium perfringens
Corynebacterium diphtheriae
Corynebacterium glutamicum
Corynebacterium pseudotuberculosis
Deinococcus radiodurans
Deinococcus radiodurans
Enterobacter agglomerans
Enterococcus faecalis
Erwinia carotovora
Escherichia coli
Escherichia coli
Escherichia coli
Frankia alni
Gluconobacter oxydans
Haemophilus influenzae
Haemophilus influenzae
Haemophilus influenzae
Helicobacter pylori
Helicobacter pylori
Helicobacter pylori
Klebsiella pneumoniae
Lactococcus lactis
Legionella pneumophila
Leptospira biflexa
Leptospira interrogans
Magnetospirillum magnetotacticum
Methylobacillus flagellatus
Methylomonas clara
Mycobacterium avium
Mycobacterium bovis
Mycobacterium leprae
Mycobacterium tuberculosis
Mycobacterium tuberculosis
Mycoplasma genitalium
Mycoplasma mycoides
Mycoplasma pneumoniae
Mycoplasma pulmonis
Myxococcus xanthus
Myxococcus xanthus
Neisseria animalis
Neisseria cinerea
Neisseria cinerea
Neisseria cinerea
Neisseria cinerea
Neisseria elongata
Neisseria elongata
Neisseria elongata
Neisseria elongata
Neisseria elongata
Neisseria elongata
Neisseria flava
Neisseria flavescens
Neisseria gonorrhoeae
Neisseria gonorrhoeae
Neisseria gonorrhoeae
Neisseria gonorrhoeae
Neisseria lactamica
Neisseria lactamica
Neisseria lactamica
Neisseria lactamica
Neisseria lactamica
Neisseria lactamica
Neisseria lactamica
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria meningitidis
Neisseria mucosa
Neisseria mucosa
Neisseria perflava
Neisseria perflava
Neisseria pharyngis var. flava
Neisseria polysaccharea
Neisseria polysaccharea
Neisseria polysaccharea
Neisseria polysaccharea
Neisseria polysaccharea
Neisseria sicca
Neisseria subflava
Paracoccus denitrificans
Pasteurella multocida
Porphyromonas gingivalis
Prevotella ruminicola
Proteus mirabilis
Proteus vulgaris
Pseudomonas aeruginosa
Pseudomonas aeruginosa
Pseudomonas aeruginosa
Pseudomonas fluorescens
Pseudomonas putida
Pseudomonas putida
Rhizobium leguminosarum
Rhizobium phaseoli
Rhodobacter capsulatus
Rhodobacter sphaeroides
Rhodopseudomonas palustris
Rickettsia prowazekii
Rickettsia prowazekii
Serratia marcescens
Shigella flexneri
Shigella sonnei
Sinorhizobium meliloti
Staphylococcus aureus
Streptococcus gordonii
Streptococcus mutans
Streptococcus mutans
Streptococcus pneumoniae
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus pyogenes
Streptococcus salivarius
Streptomyces ambofaciens
Streptomyces coelicolor
Streptomyces lividans
Streptomyces rimosus
Streptomyces venezuelae
Synechococcus sp.
Synechocystis sp.
Thermotoga maritima
Thermotoga maritima
Thermus aquaticus
Thermus thermophilus
Thiobacillus ferrooxidans
Treponema denticola
Treponema pallidum
Vibrio anguillarum
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Vibrio cholerae
Xanthomonas citri
Xanthomonas oryzae
Xenorhabdus bovienii
Xenorhabdus nematophilus
Yersinia pestis
Yersinia pestis
Anabaena variabilis
Arabidopsis thaliana
Candida albicans
Coprinus cinereus
Emericella nidulans
Gallus gallus
Homo sapiens
Homo sapiens
Leishmania major
Leishmania major
Mus musculus
Neurospora crassa
Saccharomyces cerevisiae
Schizosaccharomyces pombe
Schizosaccharomyces pombe
Tetrahymena thermophila
Trypanosoma brucei
Ustilago maydis
Xenopus laevis
Xenopus laevis
1Nucleotides sequences published in Arch. Microbiol. 1990 153: 241-247
2These sequences are from theTIGR database (http://www.tigr.org/tdb/tdb.html)
3Nucleotides sequences published in FEMS Microbiology Letters 1988 50: 101-106
Strain
Staphylococcal species (n = 27)
Staphylococcus arlettae
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus auricularis
Staphylococcus capitis
Staphylococcus caprae
Staphylococcus carnosus
Staphylococcus chromogenes
Staphylococcus cohnii
Staphylococcus delphini
Staphylococcus epidermidis
Staphylococcus equorum
Staphylococcus felis
Staphylococcus gallinarum
Staphylococcus haemolyticus
Staphylococcus hominis
Staphylococcus hyicus
Staphylococcus intermedius
Staphylococcus kloosis
Staphylococcus lentus
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus schleiferi
Staphylococcus sciuri
Staphylococcus simulans
Staphylococcus warneri
Staphylococcus xylosus
Acinetobacter baumannii
Bacteroides distasonis
Bacteroides fragilis
Bulkholderia cepacia
Bordetella pertussis
Citrobacter freundii
Enterobacter aerogenes
Enterobacter cloacae
Escherichia coli
Haemophilus influenzae
Haemophilus parahaemolyticus
Haemophilus parainfluenzae
Hafnia alvei
Kingella indologenes
Klebsiella oxytoca
Klebsiella pneumoniae
Moraxella catarrhalis
Morganella morganii
Neisseria gonorrhoeae
Neisseria meningitidis
Proteus mirabilis
Proteus vulgaris
Providencia rettgeri
Providencia stuartii
Pseudomonas aeruginosa
Pseudomonas fluorencens
Salmonella choleraesuis
Salmonella typhimurium
Serratia marcescens
Shigella flexneri
Shigella sonnei
Stenotrophomonas maltophilia
Yersinia enterocolitica
Bacillus subtilis
Enterococcus avium
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Lactobacillus acidophilus
Lactococcus lactis
Listeria innocua
Listeria ivanovii
Listeria monocytogenes
Macrococcus caseolyticus
Streptococcus agalactiae
Streptococcus anginosus
Streptococcus bovis
Streptococcus mutans
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus salivarius
Streptococcus pneumoniae assay.
Abiotrophia adiacens
Abiotrophia defectiva
Actinomyces pyogenes
Bacillus anthracis
Bacillus cereus
Bifidobacterium breve
Clostridium difficile
Enterococcus avium
Enterococcus casseliflavus
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus hirae
Enterococcus mundtii
Enterococcus raffinosus
Lactobacillus lactis
Lactobacillus monocytogenes
Mobiluncus curtisii
Peptococcus niger
Peptostreptococcus acones
Peptostreptococcus anaerobius
Peptostreptococcus
asaccharolyticus
Peptostreptococcus lactolyticus
Peptostreptococcus magnus
Peptostreptococcus prevotii
Peptostreptococcus tetradius
Staphylococcus aureus
Staphylococcus capitis
Staphylococcus epidermidis
Staphylococcus haemolyticus
Staphylococcus hominis
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus simulans
Staphylococcus. warneri
Streptococcus acidominimus
Streptococcus agalactiae
Streptococcus anginosus
Streptococcus bovis
Streptococcus constellatus
Streptococcus cricetus
Streptococcus cristatus
Streptococcus downei
Streptococcus dysgalactiae
Streptococcus equi
Streptococcus ferus
Streptococcus gordonii
Streptococcus intermedius
Streptococcus mitis
Streptococcus mitis
Streptococcus mitis
Streptococcus mutans
Streptococcus oralis
Streptococcus oralis
Streptococcus oralis
Streptococcus parasanguinis
Streptococcus parauberis
Streptococcus rattus
Streptococcus salivarius
Streptococcus sanguinis
Streptococcus suis
Streptococcus uberis
Streptococcus vestibularis
Actinetobacter baumannii
Bordetella pertussis
Citrobacter diversus
Citrobacter freundii
Enterobacter aerogenes
Enterobacter agglomerans
Enterobacter cloacae
Escherichia coli
Haemophilus ducreyi
Haemophilus haemolyticus
Haemophilus influenzae
Haemophilus parainfluenzae
Hafnia alvei
Klebsiella oxytoca
Klebsiella pneumoniae
Moraxella atlantae
Moraxella catarrhalis
Moraxella morganii
Neisseria gonorrhoeae
Neisseria meningitidis
Proteus mirabilis
Proteus vulgaris
Providencia alcalifaciens
Providencia rettgeri
Providencia rustigianii
Providencia stuartii
Pseudomonas aeruginosa
Pseudomonas fluorescens
Pseudomonas stutzeri
Salmonella typhimurium
Serratia marcescens
Shigella flexneri
Yersina enterocolitica
Abiotrophia adiacens
Abiotrophia defective
Acinetobacter baumannii
Acinetobacter lwoffi
Aerococcus viridans
Bacillus anthracis
Brucella abortus
Burkholderia cepacia
Citrobacter diversus
Citrobacter freundii
Enterobacter aerogenes
Enterobacter agglomerans
Enterococcus avium
Enterococcus casseliflavus
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus mundtii
Enterococcus raffinosus
Enterococcus solitarius
Gemella morbillorum
Haemophilus ducreyi
Haemophilus haemolyticus
Haemophilus influenzae
Haemophilus parahaemolyticus
Haemophilus parainfluenzae
Hafnia alvei
Kingella kingae
Legionella pneumophila
Megamonas hypermegale
Moraxella atlantae
Moraxella catarrhalis
Morganella morganii
Neisseria gonorrheae
Neisseria meningitidis
Pasteurella aerogenes
Pasteurella multocida
Peptostreptococcus magnus
Proteus mirabilis
Providencia alcalifaciens
Providencia rettgeri
Providencia rustigianii
Providencia stuartii
Pseudomonas fluorescens
Pseudomonas stutzeri
Salmonella bangori
Salmonella enteritidis
Salmonella gallinarum
Salmonella typhimurium
Serratia liquefaciens
Shigella flexneri
Shigella sonnei
Staphylococcus capitis
Staphylococcus haemolyticus
Staphylococcus hominis
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus simulans
Staphylococcus warneri
Stenotrophomonas maltophilia
Streptococcus acidominimus
Streptococcus anginosus
Streptococcus bovis
Streptococcus constellatus
Streptococcus cricetus
Streptococcus cristatus
Streptococcus dysgalactiae
Streptococcus equi
Streptococcus ferus
Streptococcus gordonii
Streptococcus intermedius
Streptococcus macacae
Streptococcus mitis
Streptococcus oralis
Streptococcus parasanguinis
Streptococcus parauberis
Streptococcus pneumoniae
Streptococcus ratti
Streptococcus sobrinus
Streptococcus uberis
Streptococcus vestibularis
Vibrio cholerae
Yersinia enterocolitica
Yersinia pestis
Abiotrophia adiacens (Streptococcus
adjacens)
Abiotrophia defectiva (Streptococcus
defectivus)
Achromobacter species
Acidaminococcus fermentans
Acinetobacter alcaligenes
Acinetobacter anitratus
Acinetobacter baumannii
Acinetobacter calcoaceticus
Acinetobacter calcoaceticus biovar
anitratus
Acinetobacter calcoaceticus biovar
lwoffi
Acinetobacter genomospecies
Acinetobacter haemolyticus
Acinetobacter johnsonii
Acinetobacter junii
Acinetobacter lwoffii
Acinetobacter radioresistens
Acinetobacter species
Actinobacillus
actinomycetemcomitans
Actinobacillus capsulatus
Actinobacillus equuli
Actinobacillus hominis
Actinobacillus lignieresii
Actinobacillus pleuropneumoniae
Actinobacillus species
Actinobacillus suis
Actinobacillus ureae
Actinomyces bovis
Actinomyces israelii
Actinomyces meyeri
Actinomyces naeslundii
Actinomyces neuii subsp. anitratus
Actinomyces neuii subsp. neuii
Actinomyces odontolyticus
Actinomyces pyogenes
Actinomyces radingae
Actinomyces species
Actinomyces turicensis
Actinomyces viscosus
Aerococcus species
Aerococcus viridans
Aeromonas caviae
Aeromonas hydrophila
Aeromonas hydrophila group
Aeromonas jandaei
Aeromonas salmonicida
Aeromonas salmonicida subsp.
achromogenes
Aeromonas salmonicida subsp.
masoucida
Aeromonas salmonicida subsp.
salmonicida
Aeromonas schubertii
Aeromonas sobria
Aeromonas species
Aeromonas trota
Aeromonas veronii
Aeromonas veronii biovar sobria
Aeromonas veronii biovar veronii
Agrobacterium radiobacter
Agrobacterium species
Agrobacterium tumefaciens
Alcaligenes denitrificans
Alcaligenes faecalis
Alcaligenes odorans
Alcaligenes odorans (Alcaligenes
faecalis)
Alcaligenes species
Alcaligenes xylosoxidans
Alcaligenes xylosoxidans subsp.
denitrificans
Alcaligenes xylosoxidans subsp.
xylosoxidans
Alloiococcus otitis
Anaerobiospirillum succiniciproducens
Anaerovibrio lipolytica
Arachnia propionica
Arcanobacterium (Actinomyces)
bemardiae
Arcanobacterium (Actinomyces)
pyogenes
Arcanobacterium haemolyticum
Arcobacter cryaerophilus
Arthrobacter globiformis
Arthrobacter species
Arxiozyma telluris (Torulopsis
pintolopesii)
Atopobium minutum (Lactobacillus
minutus)
Aureobacterium species
Bacillus amyloliquefaciens
Bacillus anthracis
Bacillus badius
Bacillus cereus
Bacillus circulans
Bacillus coagulans
Bacillus firmus
Bacillus lentus
Bacillus licheniformis
Bacillus megaterium
Bacillus mycoides
Bacillus pantothenticus
Bacillus pumilus
Bacillus species
Bacillus sphaericus
Bacillus stearothermophilus
Bacillus subtilis
Bacillus thuringiensis
Bacteroides caccae
Bacteroides capillosus
Bacteroides distasonis
Bacteroides eggerthii
Bacteroides fragilis
Bacteroides merdae
Bacteroides ovatus
Bacteroides species
Bacteroides splanchnicus
Bacteroides stercoris
Bacteroides thetaiotaomicron
Bacteroides uniformis
Bacteroides ureolyticus (B. corrodens)
Bacteroides vulgatus
Bergeyella (Weeksella) zoohelcum
Bifidobacterium adolescentis
Bifidobacterium bifidum
Bifidobacterium breve
Bifidobacterium dentium
Bifidobacterium infantis
Bifidobacterium species
Blastoschizomyces (Dipodascus)
capitatus
Bordetella avium
Bordetella bronchiseptica
Bordetella parapertussis
Bordetella pertussis
Bordetella species
Borrelia species
Branhamella (Moraxella) catarrhalis
Branhamella species
Brevibacillus brevis
Brevibacillus laterosporus
Brevibacterium casei
Brevibacterium epidermidis
Brevibacterium linens
Brevibacterium species
Brevundimonas (Pseudomonas)
diminuta
Brevundimonas (Pseudomonas)
vesicularis
Brevundimonas species
Brochothrix thermosphacta
Brucella abortus
Brucella canis
Brucella melitensis
Brucella ovis
Brucella species
Brucella suis
Budvicia aquatica
Burkholderia (Pseudomonas) cepacia
Burkholderia (Pseudomonas) gladioli
Burkholderia (Pseudomonas) mallei
Burkholderia (Pseudomonas)
pseudomallei
Burkholderia species
Buttiauxella agrestis
Campylobacter coli
Campylobacter concisus
Campylobacter fetus
Campylobacter fetus subsp. fetus
Campylobacter fetus subsp.
venerealis
Campylobacter hyointestinalis
Campylobacter jejuni subsp. doylei
Campylobacter jejuni subsp. jejuni
Campylobacter lari
Campylobacter lari subsp. UPTC
Campylobacter mucosalis
Campylobacter species
Campylobacter sputorum
Campylobacter sputorum subsp.
bubulus
Campylobacter sputorum subsp.
fecalis
Campylobacter sputorum subsp.
sputorum
Campylobacter upsaliensis
Candida (Clavispora) lusitaniae
Candida (Pichia) guilliermondii
Candida (Torulopsis) glabrata
Candida albicans
Candida boidinii
Candida catenulata
Candida ciferrii
Candida colliculosa
Candida conglobata
Candida curvata (Cryptococcus
curvatus)
Candida dattila
Candida dubliniensis
Candida famata
Candida globosa
Candida hellenica
Candida holmii
Candida humicola
Candida inconspicua
Candida intermedia
Candida kefyr
Candida krusei
Candida lambica
Candida magnoliae
Candida maris
Candida melibiosica
Candida membranaefaciens
Candida norvegensis
Candida norvegica
Candida parapsilosis
Candida paratropicalis
Candida pelliculosa
Candida pseudotropicalis
Candida pulcherrima
Candida ravautii
Candida rugosa
Candida sake
Candida silvicola
Candida species
Candida sphaerica
Candida stellatoidea
Candida tenuis
Candida tropicalis
Candida utilis
Candida valida
Candida vini
Candida viswanathii
Candida zeylanoides
Capnocytophaga gingivalis
Capnocytophaga ochracea
Capnocytophaga species
Capnocytophaga sputigena
Cardiobacterium hominis
Camobacterium divergens
Camobacterium piscicola
Cedecea davisae
Cedecea lapagei
Cedecea neteri
Cedecea species
Cellulomonas (Oerskovia) turbata
Cellulomonas species
Chlamydia species
Chromobacterium violaceum
Chryseobacterium (Flavobacterium)
indologenes
Chryseobacterium (Flavobacterium)
meningosepticum
Chryseobacterium gleum
Chryseobacterium species
Chryseomonas indologenes
Citeromyces matritensis
Citrobacter amalonaticus
Citrobacter braakii
Citrobacter diversus
Citrobacter farmeri
Citrobacter freundii
Citrobacter freundii complex
Citrobacter koseri
Citrobacter sedlakii
Citrobacter species
Citrobacter werkmanii
Citrobacter youngae
Clostridium acetobutylicum
Clostridium barati
Clostridium beijerinckii
Clostridium bifermentans
Clostridium botulinum
Clostridium botulinum (NP) B&F
Clostridium botulinum (NP) E
Clostridium botulinum (P) A&H
Clostridium botulinum (P) F
Clostridium botulinum G1
Clostridium botulinum G2
Clostridium butyricum
Clostridium cadaveris
Clostridium chauvoei
Clostridium clostridiiforme
Clostridium difficile
Clostridium fallax
Clostridium glycolicum
Clostridium hastiforme
Clostridium histolyticum
Clostridium innocuum
Clostridium limosum
Clostridium novyi
Clostridium novyi A
Clostridium paraputrificum
Clostridium perfringens
Clostridium putrificum
Clostridium ramosum
Clostridium septicum
Clostridium sordellii
Clostridium species
Clostridium sphenoides
Clostridium sporogenes
Clostridium subterminale
Clostridium tertium
Clostridium tetani
Clostridium tyrobutyricum
Comamonas (Pseudomonas)
acidovorans
Comamonas (Pseudomonas)
testosteroni
Comamonas species
Corynebacterium accolens
Corynebacterium afermentans
Corynebacterium amycolatum
Corynebacterium aquaticum
Corynebacterium argentoratense
Corynebacterium auris
Corynebacterium bovis
Corynebacterium coyleae
Corynebacterium cystitidis
Corynebacterium diphtheriae
Corynebacterium diphtheriae biotype
belfanti
Corynebacterium diphtheriae biotype
gravis
Corynebacterium diphtheriae biotype
intermedius
Corynebacterium diphtheriae biotype
mitis
Corynebacterium flavescens
Corynebacterium glucuronolyticum
Corynebacterium glucuronolyticum-
seminale
Corynebacterium group A
Corynebacterium group A-4
Corynebacterium group A-5
Corynebacterium group ANF
Corynebacterium group B
Corynebacterium group B-3
Corynebacterium group F
Corynebacterium group F-1
Corynebacterium group F-2
Corynebacterium group G
Corynebacterium group G-1
Corynebacterium group G-2
Corynebacterium group I
Corynebacterium group I-2
Corynebacterium jeikeium (group JK)
Corynebacterium kutscheri (C. murium)
Corynebacterium macginleyi
Corynebacterium minutissimum
Corynebacterium pilosum
Corynebacterium propinquum
Corynebacterium
pseudodiphtheriticum
Corynebacterium pseudotuberculosis
Corynebacterium pyogenes
Corynebacterium renale
Corynebacterium renale group
Corynebacterium seminale
Corynebacterium species
Corynebacterium striatum (C. flavidum)
Corynebacterium ulcerans
Corynebacterium urealyticum (group
Corynebacterium xerosis
Cryptococcus albidus
Cryptococcus ater
Cryptococcus cereanus
Cryptococcus gastricus
Cryptococcus humicolus
Cryptococcus lactativorus
Cryptococcus laurentii
Cryptococcus luteolus
Cryptococcus melibiosum
Cryptococcus neoformans
Cryptococcus species
Cryptococcus terreus
Cryptococcus uniguttulatus
Debaryomyces hansenii
Debaryomyces marama
Debaryomyces polymorphus
Debaryomyces species
Dermabacter hominis
Dermacoccus (Micrococcus)
nishinomiyaensis
Dietzia species
Edwardsiella hoshinae
Edwardsiella ictaluri
Edwardsiella species
Edwardsiella tarda
Eikenella corrodens
Empedobacter brevis (Flavobacterium
breve)
Enterobacter aerogenes
Enterobacter agglomerans
Enterobacter amnigenus
Enterobacter amnigenus asburiae
Enterobacter amnigenus biogroup 1
Enterobacter amnigenus biogroup 2
Enterobacter asburiae
Enterobacter cancerogenus
Enterobacter cloacae
Enterobacter gergoviae
Enterobacter hormaechei
Enterobacter intermedius
Enterobacter sakazakii
Enterobacter species
Enterobacter taylorae
Enterobacter taylorae (CDC enteric
Enterococcus (Streptococcus)
cecorum
Enterococcus (Streptococcus)
faecalis (Group D)
Enterococcus (Streptococcus)
faecium(Group D)
Enterococcus (Streptococcus)
saccharolyticus
Enterococcus avium (Group D)
Enterococcus casseliflavus
casseliflavus)
Enterococcus durans (Streptococcus
faecium subsp. durans) (Group D)
Enterococcus gallinarum
Enterococcus hirae
Enterococcus malodoratus
Enterococcus mundtii
Enterococcus raffinosus
Enterococcus species
Erwinia amylovora
Erwinia carotovora
Erwinia carotovora subsp. atroseptica
Erwinia carotovora subsp.
betavasculorum
Erwinia carotovora subsp. carotovora
Erwinia chrysanthemi
Erwinia cypripedii
Erwinia mallotivora
Erwinia nigrifluens
Erwinia quercina
Erwinia rhapontici
Erwinia rubrifaciens
Erwinia salicis
Erwinia species
Erysipelothrix rhusiopathiae
Erysipelothrix species
Escherichia blattae
Escherichia coli
Escherichia coli A-D
Escherichia coli O157:H7
Escherichia fergusonii
Escherichia hermannii
Escherichia species
Escherichia vulneris
Eubacterium aerofaciens
Eubacterium alactolyticum
Eubacterium lentum
Eubacterium limosum
Eubacterium species
Ewingella americana
Filobasidiella neoformans
Filobasidium floriforme
Filobasidium uniguttulatum
Flavimonas oryzihabitans
Flavobacterium gleum
Flavobacterium indologenes
Flavobacterium odoratum
Flavobacterium species
Francisella novicida
Francisella philomiragia
Francisella species
Francisella tularensis
Fusobacterium mortiferum
Fusobacterium necrogenes
Fusobacterium necrophorum
Fusobacterium nucleatum
Fusobacterium species
Fusobacterium varium
Gaffkya species
Gardnerella vaginalis
Gemella haemolysans
Gemella morbillorum
Gemella species
Geotrichum candidum
Geotrichum fermentans
Geotrichum penicillarum
Geotrichum penicillatum
Geotrichum species
Gordona species
Haemophilus aegyptius
Haemophilus aphrophilus
Haemophilus ducreyi
Haemophilus haemoglobinophilus
Haemophilus haemolyticus
Haemophilus influenzae
Haemophilus influenzae biotype I
Haemophilus influenzae biotype II
Haemophilus influenzae biotype III
Haemophilus influenzae biotype IV
Haemophilus influenzae biotype V
Haemophilus influenzae biotype VI
Haemophilus influenzae biotype VII
Haemophilus influenzae biotype VIII
Haemophilus paragallinarum
Haemophilus parahaemolyticus
Haemophilus parainfluenzae
Haemophilus parainfluenzae biotype I
Haemophilus parainfluenzae biotype II
Haemophilus parainfluenzae biotype
Haemophilus parainfluenzae biotype
Haemophilus parainfluenzae biotype V
Haemophilus parainfluenzae biotype
Haemophilus parainfluenzae biotype
Haemophilus parainfluenzae biotype
Haemophilus paraphrohaemolyticus
Haemophilus paraphrophilus
Haemophilus segnis
Haemophilus somnus
Haemophilus species
Hafnia alvei
Hanseniaspora guilliermondii
Hanseniaspora uvarum
Hanseniaspora valbyensis
Hansenula anomala
Hansenula holstii
Hansenula polymorpha
Helicobacter (Campylobacter) cinaedi
Helicobacter (Campylobacter)
fennelliae
Helicobacter (Campylobacter) pylori
Issatchenkia orientalis
Kingella denitrificans
Kingella indologenes
Kingella kingae
Kingella species
Klebsiella ornithinolytica
Klebsiella oxytoca
Klebsiella planticola
Klebsiella pneumoniae subsp.
ozaenae
Klebsiella pneumoniae subsp.
pneumoniae
Klebsiella pneumoniae subsp.
rhinoscleromatis
Klebsiella species
Klebsiella terrigena
Kloeckera apiculata
Kloeckera apis
Kloeckera japonica
Kloeckera species
Kluyvera ascorbata
Kluyvera cryocrescens
Kluyvera species
Kluyveromyces lactis
Kluyveromyces marxianus
Kluyveromyces thermotolerans
Kocuria (Micrococcus) kristinae
Kocuria (Micrococcus) rosea
Kocuria(Micrococcus) varians
Koserella trabulsii
Kytococcus (Micrococcus)
sedentarius
Lactobacillus (Weissella) viridescens
Lactobacillus A
Lactobacillus acidophilus
Lactobacillus B
Lactobacillus brevis
Lactobacillus buchneri
Lactobacillus casei
Lactobacillus casei subsp. casei
Lactobacillus casei subsp. lactosus
Lactobacillus casei subsp. rhamnosus
Lactobacillus catenaformis
Lactobacillus cellobiosus
Lactobacillus collinoides
Lactobacillus coprophilus
Lactobacillus crispatus
Lactobacillus curvatus
Lactobacillus delbrueckii subsp.
bulgaricus
Lactobacillus delbrueckii subsp.
delbrueckii
Lactobacillus delbrueckii subsp. lactis
Lactobacillus fermentum
Lactobacillus fructivorans
Lactobacillus helveticus
Lactobacillus helveticus subsp. jugurti
Lactobacillus jensenii
Lactobacillus lindneri
Lactobacillus minutus
Lactobacillus paracasei subsp.
paracasei
Lactobacillus pentosus
Lactobacillus plantarum
Lactobacillus salivarius
Lactobacillus salivarius var. salicinius
Lactobacillus species
Lactococcus diacitilactis
Lactococcus garvieae
Lactococcus lactis subsp. cremoris
Lactococcus lactis subsp. diacitilactis
Lactococcus lactis subsp. hordniae
Lactococcus lactis subsp. lactis
Lactococcus plantarum
Lactococcus raffinolactis
Leclercia adecarboxylata
Legionella species
Leminorella species
Leptospira species
Leptotrichia buccalis
Leuconostoc (Weissella)
paramesenteroides
Leuconostoc carnosum
Leuconostoc citreum
Leuconostoc gelidum
Leuconostoc lactis
Leuconostoc mesenteroides
Leuconostoc mesenteroides subsp.
cremoris
Leuconostoc mesenteroides subsp.
dextranicum
Leuconostoc mesenteroides subsp.
mesenteroides
Leuconostoc species
Listeria grayi
Listeria innocua
Listeria ivanovii
Listeria monocytogenes
Listeria murrayi
Listeria seeligeri
Listeria species
Listeria welshimeri
Megasphaera elsdenii
Methylobacterium mesophilicum
Metschnikowia pulcherrima
Microbacterium species
Micrococcus luteus
Micrococcus lylae
Micrococcus species
Mobiluncus curtisii
Mobiluncus mulieris
Mobiluncus species
Moellerella wisconsensis
Moraxella (Branhamella) catarrhalis
Moraxella atlantae
Moraxella bovis
Moraxella lacunata
Moraxella nonliquefaciens
Moraxella osloensis
Moraxella phenylpyruvica
Moraxella species
Morganella morganii
Morganella morganii subsp. morganii
Morganella morganii subsp. sibonii
Mycobacterium africanum
Mycobacterium asiaticum
Mycobacterium avium
Mycobacterium bovis
Mycobacterium chelonae
Mycobacterium fortuitum
Mycobacterium gordonae
Mycobacterium kansasii
Mycobacterium malmoense
Mycobacterium marinum
Mycobacterium phlei
Mycobacterium scrofulaceum
Mycobacterium smegmatis
Mycobacterium species
Mycobacterium tuberculosis
Mycobacterium ulcerans
Mycobacterium xenopi
Mycoplasma fermentans
Mycoplasma hominis
Mycoplasma orale
Mycoplasma pneumoniae
Mycoplasma species
Myroides species
Neisseria cinerea
Neisseria elongata subsp. elongata
Neisseria flava
Neisseria flavescens
Neisseria gonorrhoeae
Neisseria lactamica
Neisseria meningitidis
Neisseria mucosa
Neisseria perflava
Neisseria polysaccharea
Neisseria saprophytes
Neisseria sicca
Neisseria subflava
Neisseria weaveri
Neisseria weaveri (CDC group M5)
Nocardia species
Ochrobactrum anthropi
Oerskovia species
Oerskovia xanthineolytica
Oligella (Moraxella) urethralis
Oligella species
Oligella ureolytica
Paenibacillus alvei
Paenibacillus macerans
Paenibacillus polymyxa
Pantoea agglomerans
Pantoea ananas (Erwinia uredovora)
Pantoea dispersa
Pantoea species
Pantoea stewartii
Pasteurella (Haemophilus) avium
Pasteurella aerogenes
Pasteurella gallinarum
Pasteurella haemolytica
Pasteurella haemolyticus
Pasteurella multocida
Pasteurella multocida SF
Pasteurella multocida subsp.
multocida
Pasteurella multocida subsp. septica
Pasteurella pneumotropica
Pasteurella species
Pasteurella ureae
Pediococcus acidilactici
Pediococcus damnosus
Pediococcus pentosaceus
Pediococcus species
Peptococcus niger
Peptococcus species
Peptostreptococcus anaerobius
Peptostreptococcus asaccharolyticus
Peptostreptococcus indolicus
Peptostreptococcus magnus
Peptostreptococcus micros
Peptostreptococcus parvulus
Peptostreptococcus prevotii
Peptostreptococcus productus
Peptostreptococcus species
Peptostreptococcus tetradius
Phaecoccomyces exophialiae
Photobacterium damselae
Pichia (Hansenula) anomala
Pichia (Hansenula) jadinii
Pichia (Hansenula) petersonii
Pichia angusta (Hansenula
polymorpha)
Pichia carsonii (P. vini)
Pichia etchellsii
Pichia farinosa
Pichia fermentans
Pichia membranaefaciens
Pichia norvegensis
Pichia ohmeri
Pichia spartinae
Pichia species
Plesiomonas shigelloides
Porphyromonas asaccharolytica
Porphyromonas endodontalis
Porphyromonas gingivalis
Porphyromonas levii
Prevotella (Bacteroides) buccae
Prevotella (Bacteroides) buccalis
Prevotella (Bacteroides) corporis
Prevotella (Bacteroides) denticola
Prevotella (Bacteroides) loescheii
Prevotella (Bacteroides) oralis
Prevotella (Bacteroides) disiens
Prevotella (Bacteroides) oris
Prevotella bivia (Bacteroides bivius)
Prevotella intermedia (Bacteroides
intermedius)
Prevotella melaninogenica
Prevotella ruminicola
Propionibacterium acnes
Propionibacterium avidum
Propionibacterium granulosum
Propionibacterium propionicum
Propionibacterium species
Proteus mirabilis
Proteus penneri
Proteus species
Proteus vulgaris
Prototheca species
Prototheca wickerhamii
Prototheca zopfii
Providencia alcalifaciens
Providencia heimbachae
Providencia rettgeri
Providencia rustigianii
Providencia species
Providencia stuartii
Providencia stuartii urea +
Pseudomonas (Chryseomonas)
luteola
Pseudomonas acidovorans
Pseudomonas aeruginosa
Pseudomonas alcaligenes
Pseudomonas cepacia
Pseudomonas chlororaphis (P. aureofaciens)
Pseudomonas fluorescens
Pseudomonas fluorescens group
Pseudomonas mendocina
Pseudomonas pseudoalcaligenes
Pseudomonas putida
Pseudomonas species
Pseudomonas stutzeri
Pseudomonas testosteroni
Pseudomonas vesicularis
Pseudoramibacter (Eubacterium)
alactolyticus
Psychrobacter (Moraxella)
phenylpyruvicus
Rahnella aquatilis
Ralstonia (Pseudomonas,
Burkholderia) pickettii
Rhodococcus (Corynebacterium) equi
Rhodococcus species
Rhodosporidium toruloides
Rhodotorula glutinis
Rhodotorula minuta
Rhodotorula mucilaginosa (R. rubra)
Rhodotorula species
Rickettsia species
Rothia dentocariosa
Saccharomyces cerevisiae
Saccharomyces exiguus
Saccharomyces kluyverii
Saccharomyces species
Sakaguchia dacryoides
Salmonella arizonae
Salmonella choleraesuis
Salmonella enteritidis
Salmonella gallinarum
Salmonella paratyphi A
Salmonella paratyphi B
Salmonella pullorum
Salmonella species
Salmonella typhi
Salmonella typhimurium
Salmonella typhisuis
Salmonella/Arizona
Serratia ficaria
Serratia fonticola
Serratia grimesii
Serratia liquefaciens
Serratia marcescens
Serratia odorifera
Serratia odorifera type 1
Serratia odorifera type 2
Serratia plymuthica
Serratia proteamaculans
Serratia proteamaculans subsp.
proteamaculans
Serratia proteamaculans subsp.
quinovora
Serratia rubidaea
Serratia species
Shewanella (Pseudomonas,
Alteromonas) putrefaciens
Shigella boydii
Shigella dysenteriae
Shigella flexneri
Shigella sonneri
Shigella species
Sphingobacterium multivorum
Sphingobacterium species
Sphingobacterium spiritivorum
Sphingobacterium thalpophilum
Sphingomonas (Pseudomonas)
paucimobilis
Sporidiobolus salmonicolor
Sporobolomyces roseus
Sporobolomyces salmonicolor
Sporobolomyces species
Staphylococcus (Peptococcus)
saccharolyticus
Staphylococcus arlettae
Staphylococcus aureus
Staphylococcus aureus (Coagulase-
negative)
Staphylococcus auricularis
Staphylococcus capitis
Staphylococcus capitis subsp. capitis
Staphylococcus capitis subsp.
ureolyticus
Staphylococcus caprae
Staphylococcus carnosus
Staphylococcus caseolyticus
Staphylococcus chromogenes
Staphylococcus cohnii
Staphylococcus cohnii subsp. cohnii
Staphylococcus cohnii subsp.
urealyticum
Staphylococcus epidermidis
Staphylococcus equorum
Staphylococcus gallinarum
Staphylococcus haemolyticus
Staphylococcus hominis
Staphylococcus hominis subsp.
hominis
Staphylococcus hominis subsp.
novobiosepticus
Staphylococcus hyicus
Staphylococcus intermedius
Staphylococcus kloosii
Staphylococcus lentus
Staphylococcus lugdunensis
Staphylococcus saprophyticus
Staphylococcus schleiferi
Staphylococcus sciuri
Staphylococcus simulans
Staphylococcus species
Staphylococcus warneri
Staphylococcus xylosus
Stenotrophomonas (Xanthomonas)
maltophilia
Stephanoascus ciferrii
Stomatococcus mucilaginosus
Streptococcus acidominimus
Streptococcus agalactiae
Streptococcus agalactiae (Group B)
Streptococcus agalactiae hemolytic
Streptococcus agalactiae non-
Streptococcus alactolyticus
Streptococcus anginosus
Streptococcus anginosus (Group D,
Streptococcus beta-hemolytic group A
Streptococcus beta-hemolytic non-
Streptococcus beta-hemolytic non-
Streptococcus beta-hemolytic
Streptococcus bovis (Group D,
Streptococcus bovis I
Streptococcus bovis II
Streptococcus canis
Streptococcus constellatus
Streptococcus constellatus
Streptococcus constellatus (viridans
Streptococcus)
Streptococcus downei
Streptococcus dysgalactiae subsp.
dysgalactiae
Streptococcus dysgalactiae subsp.
equisimilis
Streptococcus equi (Group C/Group G
Streptococcus)
Streptococcus equi subsp. equi
Streptococcus equi subsp.
zooepidemicus
Streptococcus equinus
Streptococcus equinus (Group D,
Streptococcus equisimilis
Streptococcus equisimulis (Group
Streptococcus Gamma (non)-
Streptococcus gordonii
Streptococcus Group B
Streptococcus Group C
Streptococcus Group D
Streptococcus Group E
Streptococcus Group F
Streptococcus Group G
Streptococcus Group L
Streptococcus Group P
Streptococcus Group U
Streptococcus intermedius
Streptococcus intermedius
Streptococcus intermedius (viridans
Streptococcus)
Streptococcus milleri group
Streptococcus mitis
Streptococcus mitis (viridans
Streptococcus)
Streptococcus mitis group
Streptococcus mutans
Streptococcus mutans (viridans
Streptococcus)
Streptococcus oralis
Streptococcus parasanguis
Streptococcus pneumoniae
Streptococcus porcinus
Streptococcus pyogenes
Streptococcus pyogenes (Group A)
Streptococcus salivarius
Streptococcus salivarius (viridans
Streptococcus)
Streptococcus salivarius subsp.
salivarius
Streptococcus salivarius subsp.
thermophilus
Streptococcus sanguis
Streptococcus sanguis I (viridans
Streptococcus)
Streptococcus sanguis II
Streptococcus sanguis II (viridans
Streptococcus)
Streptococcus sobrinus
Streptococcus species
Streptococcus suis I
Streptococcus suis II
Streptococcus uberis
Streptococcus uberis (viridans
Streptococcus)
Streptococcus vestibularis
Streptococcus zooepidemicus
Streptococcus zooepidemicus (Group
Streptomyces somaliensis
Streptomyces species
Suttonella (Kingella) indologenes
Tatumella ptyseos
Tetragenococcus (Pediococcus)
halophilus
Torulaspora delbrueckii
Torulopsis candida
Torulopsis haemulonii
Torulopsis inconspicua
Treponema species
Trichosporon asahii
Trichosporon asteroides
Trichosporon beigelii
Trichosporon cutaneum
Trichosporon inkin
Trichosporon mucoides
Trichosporon ovoides
Trichosporon pullulans
Trichosporon species
Turicella otitidis
Ureaplasma species
Ureaplasma urealyticum
Veillonella parvula (V. alcalescens)
Veillonella species
Vibrio alginolyticus
Vibrio cholerae
Vibrio damsela
Vibrio fluvialis
Vibrio furnissii
Vibrio harveyi
Vibrio hollisae
Vibrio metschnikovii
Vibrio mimicus
Vibrio parahaemolyticus
Vibrio species
Vibrio species SF
Vibrio vulnificus
Weeksella (Bergeylla) virosa
Weeksella species
Weeksella virosa
Williopsis (Hansenula) satumus
Xanthomonas campestris
Xanthomonas species
Yarrowia (Candida) lipolytica
Yersinia aldovae
Yersinia enterocolitica
Yersinia enterocolitica group
Yersinia frederiksenii
Yersinia intermedia
Yersinia intermedius
Yersinia kristensenii
Yersinia pestis
Yersinia pseudotuberculosis
Yersinia pseudotuberculosis SF
Yersinia ruckeri
Yersinia species
Yokenella regensburgei
Yokenella regensburgei (Koserella
trabulsii)
Zygoascus hellenicus
Zygosaccharomyces species
1The list includes microorganisms that may be identified by API identification test systems and VITEK ® automated identification system from bioMerieux Inc., or by the MicroScan ®-WalkAway ® automated systems from Dade Behring. Identification relies on classical identification methods using batteries of biochemical and other phenotypical tests.
Abiotrophia adiacens
Enterococcus avium
Enterococcus casseliflavus
Enterococcus cecorum
Enterococcus columbae
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecium
Enterococcus gallinarum
Enterococcus hirae
Enterococcus malodoratus
Enterococcus mundtii
Enterococcus pseudoavium
Enterococcus raffinosus
Enterococcus saccharolyticus
Enterococcus solitarius
Enterococcus sulfureus
Lactococcus lactis
Listeria monocytogenes
Listeria seeligeri
Staphylococcus aureus
Staphylococcus epidermidis
Streptococcus mutans
Streptococcus pneumoniae
Streptococcus pyogenes
Streptococcus suis
Agrobacterium tumefaciens
Anacystis nidulans
Aquifex aeolicus
Bacillus stearothermophilus
Bacillus subtilis
Bacteroides fragilis
Borrelia burgdorferi
Brevibacterium linens
Bulkholderia cepacia
Campylobacter jejuni
Chlamydia pneumoniae
Chlamydia trachomatis
Corynebacterium glutamicum
Cytophaga lytica
Deinococcus radiodurans
Escherichia coli
Fervidobacterium islandicum
Haemophilus influenzae
Helicobacter pylori
Homo sapiens (Human)
Methanococcus jannaschii
Mycobacterium leprae
Mycobacterium tuberculosis
Mycoplasma genitalium
Mycoplasma pneumoniae
Neisseria gonorrhoeae
Nicotiana tabacum (Tobacco)
Peptococcus niger
Planobispora rosea
Saccharomyces cerevisiae (Yeast)
Salmonella typhimurium
Shewanella putrefaciens
Spirochaeta aurantia
Spirulina platensis
Streptomyces aureofaciens
Streptomyces cinnamoneus
Streptomyces coelicolor
Streptomyces collinus
Streptomyces ramocissimus
Synechocystis sp.
Taxeobacter ocellatus
Thermotoga maritima
Thermus aquaticus
Thermus thermophilus
Thiobacillus cuprinus
Treponema pallidum
Wolinella succinogenes
Cedecea davisae
Cedecea lapagei
Cedecea neteri
Citrobacter amalonaticus
Citrobacter braakii
Citrobacter farmeri
Citrobacter freundii
Citrobacter koseri
Citrobacter sedlakii
Citrobacter werkmanii
Citrobacter youngae
Edwardsiella hoshinae
Edwardsiella tarda
Enterobacter aerogenes
Enterobacter agglomerans
Enterobacter amnigenus
Enterobacter asburiae
Enterobacter cancerogenus
Enterobacter cloacae
Enterobacter gergoviae
Enterobacter hormaechei
Enterobacter sakazakii
Escherichia coli
Escherichia coli
Escherichia coli (ETEC)
Escherichia coli (O157:H7)
Escherichia fergusonii
Escherichia hermanii
Escherichia vulneris
Ewingella americana
Hafnia alvei
Klebsiella ornithinolytica
Klebsiella oxytoca
Klebsiella planticola
Klebsiella pneumoniae
Kluyvera ascorbata
Kluyvera cryocrescens
Kluyvera georgiana
Leclercia adecarboxylata
Leminorella grimontii
Moellerella wisconsensis
Morganella morganii
Pantoea agglomerans
Pantoea dispersa
Plesiomonas shigelloides
Pragia fontium
Proteus mirabilis
Proteus penneri
Proteus vulgaris
Providencia alcalifaciens
Providencia rettgeri
Providencia rustigianii
Providencia stuartii
Rahnella aquatilis
Salmonella choleraesuis
Serratia fonticola
Serratia grimesii
Serratia liquefaciens
Serratia marcescens
Serratia odorifera
Serratia plymuthica
Serratia rubidaea
Shigella boydii
Shigella dysenteriae
Shigella flexneri
Shigella sonnei
Tatumella ptyseos
Trabulsiella guamensis
Yersinia enterocolitica
Yersinia frederiksenii
Yersinia intermedia
Yersinia pestis
Yersinia pseudotuberculosis
Yersinia rohdei
Shewanella putrefaciens
Vibrio cholerae
Moraxella
Moraxella
catarrhalis
catarrhalis
Moraxella
nonliquefaciens
Moraxella
Moraxella
Moraxella
Moraxella
Kingella
Kingella
lacunata
osloensis
atlantae
phenylpyruvica
indologenes
kingea
Neisseria
Neisseria
Escherichia
Staphylococcus
meningitidis
gonorrhoeae
coli
aureus
1SEQ ID NO. from U.S. Pat. No. 6,001,564.
2All PCR assays were performed with 1 ng of purified genomic DNA by using an annealing temperature of 55° C. and 30 cycles of amplification. The genomic DNA from the various bacterial species above was always isolated from reference strains obtained from ATCC.
3All position results showed a strong amplification signal with genomic DNA from the target species M. catarrhalis.
Staphylococcus
Staphylococcus
Staphylo-
Staphylo-
epidermidis,
epidermidis,
coccus
coccus
capitis
cohnii
Staphylo-
Staphylo-
Staphylo-
Staphylo-
Staphylo-
Entero-
coccus
coccus
Staphylo-
coccus
Staphylo-
Staphylo-
coccus
coccus
Bacillus
coccus
aureus
auricularis
coccus
hominis
coccus
coccus
simulans
warneri
subtilis
faecalis
Entero-
Entero-
Strepto-
Strepto-
Strepto-
coccus
coccus
Listeria
coccus
coccus
coccus
faecium
gallinarum
monocytogenes
agalactiae
pneumoniae
pyogenes
1SEQ ID NO. from U.S. Pat. No. 6,001,564.
2All PCR assays were performed with 1 ng of purified genomic DNA by using an annealing temperature of 55 to 65° C. and 30 cycles of amplification. The genomic DNA from the various bacterial species above was always isolated from reference strains obtained from ATCC.
3All positive results showed a strong amplification signal with genomic DNA from the target species S. epidermidis. The instensity of the positive amplification signal with species other than S. epidermidis was variable.
Staphyloccus
epidermidis
2
Staphylococcus
aureus
3
CA
TATCA
AAGTATCA
GAAAAGTATCA
GGAGAAAAGTATCA
CGTGGAGAAAAGTATCA
GAGCGTGGAGAAAAGTATCA
AAAGAGCGTGGAGAAAAGTATCA
AAGTA
CA
GGAGA
AAGTATCA
GAGCG
GGAGAAAAGTATCA
GAGCGTGG
GAAAAGTA
CA
GAGCG
GGAGA
AAGTA
CA
1All PCR tests were performed with SEQ ID NO: 145 without modification combined with SEQ ID NO: 146 or 13 modified versions of SEQ ID NO: 146. Boxed nucleotides indicate changes in SEQ ID NO: 146. All SEQ ID NOs. are from U.S. Pat No. 6,001,564.
2The tests with S. epidermidis were performed by using an annealing temperature of 55° C. with 1, 0.1 and 0.01 ng of purified genomic DNA or at 50° C. with 1 ng of purified genomic DNA.
3The tests with S. aureus were performed only at 50° C. with 1 ng of genomic DNA.
4The intensity of the positive amplification signal was quantified as follows: 3+ = strong signal, 2+ = intermediate signal and + = weak signal.
Staphylococcus
Staphylo-
epidermidis
3
Staphylo-
coccus
Staphylo-
Staphylo-
coccus
haemo-
coccus
coccus
aureus
4
lyticus
capitis
warneri
4+5
1All PCR tests were performed using an annealing temperature of 45 or 55° C. and 30 cycles of amplification.
2All SEQ ID NOs. in this Table are from U.S. pat. No. 6,001,546.
3The tests with S. epidermidis were made with 1, 0.1 and 0.01 ng of purified genomic DNA.
4The tests with all other bacterial species were made only with 1 ng of purified genomic DNA.
5The intensity of the positive amplification signal was quantified as follows: 4+ = very strong signal, 3+ = strong signal, 2+ = intermediate signal and + = weak signal.
Pseudomonas
aeruginosa
3
Pseudomonas
Burkholderia
fluorescens
4
cepacia
2+5
Shewanella
Stenotrophomonas
Neisseria
Haemophilus
putida
maltophilia
meningitidis
parahaemolyticus
1All PCR tests were performed using an annealing temperature of 55° C. and 30 cycles of amplification.
2All SEQ ID NOs. in this Table are from U.S. Pat. No. 6,001,546.
3The tests with P. aeruginosa were made with 1, 0.1 and 0.01 ng of purified genomic DNA.
4The tests with all other bacterial species were made only with 1 ng of purified genomic DNA.
5The intensity of the positive amplification signal was quantified as follows: 2+ = strong signal and + = moderately strong signal.
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecalis
E. gallinarum
E. gallinarum
E. flavescens
S. aureus
E. faecium SLH475
E. faecium UI709
E. faecium VRE-1
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium
E. faecium CG4248
E. faecalis
E. faecalis
E. faecalis
E. faecalis
E. faecalis
E. faecalis T4059
E. faecalis
E. faecalis T4059
E. faecalis
S. bovis biotype II
S. lutetiensis strain 5-F9
E. faecium
E. faecalis
Enterococcus casseliflavus
Enterococcus cecorum
Enterococcus columbae
Enterococcus malodoratus
Enterococcus mundtii
Enterococcus pseudoavium
Enterococcus raffinosus
Enterococcus dispar
Enterococcus durans
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecium
Enterococcus faecium
Enterococcus flavescens
Enterococcus gallinarum
Enterococcus saccharolyticus
Enterococcus sulfureus
Enterococcus faecium (vanD)
Enterococcus faecium (vanD)
Enterococcus faecalis (vanE)
Enterococcus faecalis (vanE)
Enterococcus faecalis (vanG)
Enterococcus faecalis (vanG)
Acinetobacter twoffii
Aeromonas hydrophila
Bacteroides fragilis
Bacillus cereus
Bifidobacterium breve
Candida albicans
Clostridium difficile
Clostridium perfringens
Corynebacterium bovis
Escherichia coli
Escherichia coli
Fusobacterium nucleatum
Gardnerella vaginalis
Klebsiella oxytoca
Klebsiella pneumoniae
Listeria monocytogenes
Morganella morganii subsp. morganii
Peptostreptococcus anaerobius
Peptostreptococcus asaccharolyticus
Porphyromonas asaccharolytica
Prevotella melaninogenica
Propionibacterium acnes
Staphylococcus epidermidis
Stenotrophomonas maltophilia
Abiotrophia defectiva
Acinetobacter baumannii
Actinomyces pyogenes
Citrobacter braakii
Citrobacter koseri
Corynebacterium genitalium
Enterobacter cloacae
Hafnia alvei
Homo sapiens
Lactobacillus acidophilus
Lactobacillus gasseri
Mobiluncus curtisii subsp. holmesii
Neisseria gonorrhoeae
Pantoea agglomerans
Pseudomonas aeruginosa
Salmonella enterica subsp. Arizonae
Salmonella enterica subsp. Enterica
Salmonella typhimurium
Shigella flexneri
Shigella sonnei
Staphylococcus aureus
Streptococcus anginosus
Streptococcus bovis
Vibrio cholerae
Yersinia enterocolitica subs. enterolitica
Enterococcus casseliflavus
Enterococcus casseliflavus
Enterococcus faecalis
Enterococcus faecium
Enterococcus faecium
Enterococcus faecium
Enterococcus faecium
Enterococcus gallinarum
Enterococcus gallinarum
Enterococcus gallinarum
S. epidermidis DNA
1At 100 times the usual concentration
2At usual concentration
3At 25/50 VanA/VanB DNA copies
4At 1 ng/rx VanA/VanB DNA copies
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecalis
Enterococcus gallinarum
Enterococcus faecium
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecium
Enterococcus gallinarum
Enterococcus faecalis
Enterococcus faecium
Enterococcus faecalis
Enterococcus faecalis
Enterococcus faecium
Enterococcus faecium
Enterococcus faecium
Enterococcus faecalis
Enterococcus faecium
Clostridium innocuum
Clostridium sp.
Clostridium sp.
Clostridium symbosium
Eggerthella lenta
S. epidermidis DNA
aThese sequences are from the complementary DNA strand of the sequence of the
aSequence from databases.
bThese sequences are from the complementary DNA strand of the sequence of the
cThese sequences were aligned to derive the corresponding primer.
dThe nucleotide positions refer to the S. agalactiae tuf sequence fragment
aThese sequences were aligned to derive the corresponding primer.
bThese sequences are from the complementary DNA strand of the sequence of the
c The nucleotide positions refer to the T. cruzi tuf sequence fragment (SEQ ID
d The nucleotide positions refer to the C. perfringens tuf sequence fragment
e The nucleotide positions refer to the C. diphtheriae tuf sequence fragment
f The nucleotide positions refer to the E. durans tuf sequence fragment (SEQ ID
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the L. pneumophila tuf sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the S. aureus tuf sequence fragment (SEQ ID
eThe nucleotide positions refer to the S. agalactiae tuf sequence fragment
fThe nucleotide positions refer to the C. albicans tuf(EF-1) sequence fragment
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the C. neoformans tuf (EF-1) sequence
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the L. tropica tuf(EF-1) sequence fragment
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the T. brucei tuf (EF-1) sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the E. coli tuf sequence fragment (SEQ ID
eSequence from databases.
fThe nucleotide positions refer to the P. aeruginosa tuf sequence fragment
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the L. tropica tuf (EF-1) sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the E. coli tuf sequence fragment (SEQ ID
eThe nucleotide positions refer to the B. cereus tuf sequence fragment (SEQ ID
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the E. coli tuf sequence fragment (SEQ ID
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the A. meyeri tuf sequence fragment (SEQ ID
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the B. distasonis tuf sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the A. fumigatus tuf (EF-1) sequence
eThe nucleotide positions refer to the C. albicans tuf (EF-1) sequence fragment
aThe nucleotide positions refer to the A. fumigatus tuf (EF-1) sequence
bThese sequences are from the complementary DNA strand of the sequence of the
cSequences from databases.
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of the
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence
cThese sequences were aligned to derive the corresponding primer.
dThe nucleotide positions refer to the C. albicans tuf sequence fragment (SEQ
aThese sequences were aligned to derive the corresponding primer.
bThese sequences are from the complementary DNA strand of the sequence of the
cSequence from databases.
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the S. agalactiae atpD sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
dSequence from databases.
eThe nucleotide positions refer to the C. jejuni atpD sequence fragment (SEQ
fThe nucleotide positions refer to the C. albicans atpD sequence fragment (SEQ
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the K. pneumoniae atpD sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
a These sequences were aligned to derive the corresponding primer.
b The nucleotide positions refer to the K. pneumoniae atpD sequence fragment
c These sequences are from the complementary DNA strand of the sequence of the
d Sequences from databases.
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of the
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the E. faecalis tuf sequence fragment (SEQ
cThe nucleotide positions refer to the E. faecium tuf sequence fragment (SEQ
dThe nucleotide positions refer to the E. gallinarum tuf sequence fragment
eThe nucleotide positions refer to the N. gonorrhoeae tuf sequence fragment
fThe nucleotide positions refer to the C. albicans tuf(EF-1) sequence fragment
gThe nucleotide positions refer to the C. dubliniensis tuf(EF-1) sequence
aSequences from databases.
bThese sequences were aligned to derive the corresponding probe.
cThe nucleotide positions refer to the S. aureus tuf sequence fragment (SEQ ID
dThe nucleotide positions refer to the S. epidermidis tuf sequence fragment
eThe nucleotide positions refer to the S. haemolyticus tuf sequence fragment
fThe nucleotide positions refer to the S. hominis tuf sequence fragment (SEQ
gallinarum group
aThese sequences were aligned to derive the corresponding primer.
b The nucleotide positions refer to the S. saprophyticus tuf sequence fragment
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the S. agalactiae tuf sequence fragment
eThe nucleotide positions refer to the S. pneumoniae tuf sequence fragment
fThe nucleotide positions refer to the E. flavescens tuf sequence fragment
gThe nucleotide positions refer to the E. faecium tuf sequence fragment (SEQ
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the G. haemolysans tuf sequence fragment
cThe nucleotide positions refer to the S. aureus tuf sequence fragment (SEQ ID
dThe nucleotide positions refer to the S. pneumoniae tuf sequence fragment
eThe nucleotide positions refer to the C. albicans tuf(EF-1) sequence fragment
fThe nucleotide positions refer to the C. dubliniensis tuf(EF-1) sequence
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the C. lusitaniae tuf(EF-1) sequence
cThe nucleotide positions refer to the C. albicans tuf(EF-1) sequence fragment
B. cepacia
B. pertussis
P. aeruginosa
E. coli
N. gonorrhoeae
M. thermoacetica
S. aurantiaca
M. tuberculosis
B. fragilis
C. lytica
A. woodii
C. acetobutylicum
M. pneumoniae
H. pylori
aThis sequence is the reverse-complement of the selected primer.
E. hirae
H. salinarum
T. thermophilus
T. congolense
P. falciparum
C. pneumoniae
aThese sequences are the reverse-complement of the selected primers.
C. neoformans
a
S. cerevisiae
a
O. volvulus
a
G. maxB1b
G. maxB2b
E. coli
c
S. aureofaciens
c
E. tenella
b
T. gondii
b
S. cerevisiae
b
A. thaliana
b
C. neoformans
a
S. cerevisiae
a
O. volvulus
a
G. maxB1b
G. maxB2b
E. coli
c
S. aureofaciens
c
E. tenella
b
T. gondii
b
S. cerevisiae
b
A. thaliana
b
aThis sequence refers to tuf(EF-1) gene.
bThis sequence refers to tuf (M) or organelle gene.
cThis sequence refers to tuf gene from bacteria.
dThese sequences are the reverse-complement of the selected primers.
S. cerevisiae
B. hominis
C. albicans
C. neoformans
E. histolytica
G. lamblia
H. capsulatum
L. braziliensis
O. volvulus
P. berghei
P. knowlesi
S. pombe
T. cruzi
Y. lipolytica
Mismatches for SEQ ID NO. 653 are indicated by underlined nucleotides.
S. cerevisiae
B. hominis
C. albicans
C. neoformans
E. histolytica
G. lamblia
H. capsulatum
L. braziliensis
O. volvulus
P. berghei
P. knowlesi
S. pombe
T. cruzi
Y. lipolytica
aThis sequences are the reverse-complement of the selected primers.
S. agalactiae
S. agalactiae
S. agalactiae
S. agalactiae
S. anginosus
S. anginosus
S. bovis
S. gordonii
S. mutans
S. pneumoniae
S. sanguinis
S. sobrinus
B. cepacia
B. fragilis
B. subtilis
C. diphtheriae
C. trachomatis
E. coli
G. vaginalis
S. aureus
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
bThis sequence is the reverse-complement of the selected primer.
S.
acidominimus
S. agalactiae
S. agalactiae
S. agalactiae
S. agalactiae
S. agalactiae
S. anginosus
S. anginosus
S. bovis
S. anginosus
S. cricetus
S. cristatus
S. downei
S.
dysgalactiae
S. equi equi
S. ferus
S. gordonii
S. macacae
S. gordonii
S. mutans
S. oralis
S.
parasanguinis
S. pneumoniae
S. pyogenes
S. ratti
S. salivarius
S. sanguinis
S. sobrinus
S. suis
S. uberis
S.
vestibularis
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
bThese sequences are the reverse-complement of the selected probes.
S. agalactiae
S. agalactiae
S. agalactiae
S. agalactiae
S. agalactiae
S. bovis
S. salivarius
S. pneumoniae
S. pyogenes
S. anginosus
S. sanguinis
S. mutans
B. anthracis
B. cereus
E. faecium
E. gallinarum
E. faecalis
E. coli
L. monocytogenes
S. aureus
S. epidermidis
a,d,e,fThese sequences were obtained from Genbank and have accession #: a = AB009314, d = AF001955, e = U31170, and f = V00311.
b,cThese sequences were obtained from genome sequencing projects,
gThese sequences are the reverse-complement of the selected primers.
C. albicans
C. albicans
C. albicans
C. albicans
C. albicans
C. dubliniensis
C. dubliniensis
C. dubliniensis
C. glabrata
C. guilliermondii
C. kefyr
C. krusei
C. lusitaniae
C. neoformans
C. parapsilosis
C. tropicalis
A. fumigatus
P. anomala
S. cerevisiae
S. pombe
a
C. albicans primers have been described in a previous patent (publication WO98/20157, SEQ ID NOs. 11-12)
bThis sequence is the reverse-complement of the selected primer.
S. aureus
S. aureus
S. aureus
S. aureus aureus
S. auricularis
S. capitis
capitis
M. caseolyticus
S. cohnii
S. epidermidis
S. epidermidis
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. hominis
hominis
S. hominis
S. hominis
S. hominis
S. hominis
S. lugdunensis
S. saprophyticus
S. saprophyticus
S. saprophyticus
S. sciuri sciuri
S. warneri
S. warneri
S. warneri
B. subtilis
E. coli
L. monocytogenes
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
bThese sequences are the reverse-complement of the selected primers.
Staphylococcus-specific hybridization
S. aureus
S. aureus
S. aureus
S. aureus
S. aureus aureus
S. auricularis
S. capitis capitis
M. caseolyticus
S. cohnii
S. epidermidis
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. hominis
S. hominis
S. hominis hominis
S. hominis
S. hominis
S. lugdunensis
S. saprophyticus
S. saprophyticus
S. saprophyticus
S. sciuri sciuri
S. warneri
S. warneri
S. warneri
S. warneri
B. subtilis
E. coli
L. monocytogenes
138a
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
Staphylococcus saprophyticus-specific and
S. aureus
S. aureus
S. aureus
S. aureus
S. aureus aureus
S. auricularis
S. capitis capitis
M. caseolyticus
S. cohnii
S. epidermidis
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. hominis
S. hominis hominis
S. hominis
S. hominis
S. hominis
S. lugdunensis
S. saprophyticus
S. saprophyticus
S. saprophyticus
S. sciuri sciuri
S. warneri
S. warneri
S. warneri
S. warneri
B. subtilis
E. coli
L. monocytogenes
aThis sequence was obtained from Genbank accession #Z99104.
bThe SEQ ID NO. refers to previous patent publication WO98/20157.
Staphylococcus aureus-specific and of
Staphylococcus epidermidis-specific
S. aureus
S. aureus
S. aureus
S. aureus
S. aureus aureus
S. auricularis
S. capitis capitis
M. caseolyticus
S. cohnii
S. epidermidis
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. hominis
S. hominis
S. hominis hominis
S. hominis
S. hominis
S. lugdunensis
S. saprophyticus
S. saprophyticus
S. saprophyticus
S. sciuri sciuri
S. warneri
S. warneri
S. warneri
S. warneri
B. subtilis
E. coli
L. monocytogenes
aThis sequence was obtained from Genbank accession #Z99104.
bThe SEQ ID NO. refers to previous patent publication WO98/20157.
Staphylococcus hominis-specific
S. aureus
S. aureus
S. aureus
S. aureus
S. aureus aureus
S. auricularis
S. capitis capitis
M. caseolyticus
S. cohnii
S. epidermidis
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. haemolyticus
S. hominis
S. hominis
S. hominis hominis
S. hominis
S. hominis
S. lugdunensis
S. saprophyticus
S. saprophyticus
S. saprophyticus
S. sciuri sciuri
S. warneri
S. warneri
S. warneri
S. warneri
B. subtilis
E. coli
L. monocytogenes
aThis sequence was obtained from Genbank accession #Z99104.
bThe SEQ ID NO. refers to previous patent publication WO98/20157.
E. avium
E. casseliflavus
E. cecorum
E. dispar
E. durans
E. flavescens
E. faecium
E. faecalis
E. gallinarum
E. hirae
E. mundtii
E. pseudoavium
E. raffinosus
E. saccharolyticus
E. solitarius
E. coli
B. cepacia
B. fragilis
B. subtilis
C. diphtheriae
C. trachomatis
G. vaginalis
S. aureus
S. pneumoniae
A. adiacens
G. haemolysans
G. morbillorum
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
bThis sequence is the reverse-complement of the selected primer.
E. avium
E. casseliflavus
E. cecorum
E. dispar
E. durans
E. faecalis
E. faecium
E. flavescens
E. gallinarum
E. hirae
E. mundtii
E. pseudoavium
E. raffinosus
E. saccharolyticus
E. solitarius
C. diphtheriae
G. vaginalis
B. cepacia
S. aureus
B. subtilis
S. pneumoniae
E. coli
B. fragilis
C. trachomatis
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
B. cereus
B. subtilis
E. cloacae
E. coli
K. oxytoca
K. pneumoniae
P. aeruginosa
S. agalactiae
S. aureus
S. choleraesuis
S. epidermidis
S. marcescens
S. mutans
S. pyogenes
S. salivarius
S. sanguinis
Y. enterocolitica
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
bThis sequence is the reverse-complement of the selected primer.
C. glutamicum
M. tuberculosis
E. faecalis
S. agalactiae
B. subtilis
L. monocytogenes
S. aureus
A. baumannii
N. gonorrhoeae
C. freundii
E. cloacae
E. coli
S. typhimurium
K. pneumoniae
S. marcescens
Y. enterocolitica
B. cepacia
H. influenzae
M. pneumoniae
H. pylori
B. fragilis
aThese sequences are the reverse-complement of the selected primers.
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
aSequence from databases.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
aThe extra G nucleotide introducing a gap in the sequence is probably a sequencing error.
bThis sequence is the reverse-complement of the selected primer.
aThis sequence is the reverse-complement of the selected primer.
S. anginosus
S. bovis
S. dysgalactiae
S. pyogenes
S. agalactiae
S. oralis
S. pneumoniae
S. cristatus
S. mitis
S. gordonii
S. sanguinis
S. parasanguinis
S. salivarius
S. vestibularis
S. suis
S. mutans
S. ratti
S. macacae
S. cricetus
E. faecalis
S. aureus
B. cereus
E. coli
b
aThe SEQ ID NO. refers to previous patent publication WO98/20157.
bThis sequence is the reverse-complement of the selected primer.
aThis sequence is the reverse-complement of the selected primer.
aThis sequence is the reverse-complement of the selected primer.
aThis sequence is the reverse-complement of the above selected primer.
aThis sequence is the reverse-complement of the above vanB sequence.
aThis sequence is the reverse-complement of the selected sequence.
aThis sequence is the reverse-complement of the selected primer.
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
GG-MR-HEG-ATG TCA GAG GGA TAG ATC CA
aUnderlined nucleotides indicate the molecular beacon's stem.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
cSequences from databases.
dScorpion primer.
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the vanA sequence fragment (SEQ ID NO. 1051).
cThese sequences are from the complementary DNA strand of the sequence of the
dSequences from databases.
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the vanA sequence fragment (SEQ ID NO. 1051).
cThese sequences are from the complementary DNA strand of the sequence of the
dThe nucleotide positions refer to the vanC1 sequence fragment (SEQ ID NO. 1058).
eThe nucleotide positions refer to the vanC2 sequence fragment (SEQ ID NO. 1140).
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the vanA sequence fragment (SEQ ID NO. 1051).
cSequences from databases.
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the pbp1a sequence fragment (SEQ ID NO. 1004).
cThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
dSequences from databases.
aThese sequences were aligned to derive the corresponding primer.
bThe nucleotide positions refer to the pbp1a sequence fragment (SEQ ID NO. 1004).
cSequence from databases.
aThis sequence is the reverse-complement of the above selected primer.
aSequence from databases.
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
cThese sequences were aligned to derive the corresponding primer.
dThe nucleotide positions refer to the hexA sequence fragment (SEQ ID NO. 1183).
aThis sequences is from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
bThese sequences were aligned to derive the corresponding primer.
cThe nucleotide positions refer to the hexA sequence fragment (SEQ ID NO. 1183).
S. pneumoniae
S. pneumoniae
S. pneumoniae
S. pneumoniae
S. pneumoniae
S. oralis
S. mitis
S. mitis
S. mitis
S. pneumoniae
S. pneumoniae
S. pneumoniae
S. pneumoniae
S. pneumoniae
S. oralis
S. mitis
S. mitis
S. mitis
aThis sequence is the reverse-complement of the selected primer.
aSequences from databases.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
aThis sequence is from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
bThese sequences were aligned to derive the corresponding primer.
cThe nucleotide positions refer to the S. saprophyticus unknown gene sequence fragment (SEQ ID NO. 1198).
CGC
CTC GC
CTC GG
aUnderlined nucleotides indicate the molecular beacon's stem.
bThis sequence is from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
cSequence from databases.
TCC
aUnderlined nucleotides indicate the molecular beacon's stem.
aUnderlined nucleotides indicate the molecular beacon's stem.
bSequence from databases.
cThis sequence is from the complementary DNA
aUnderlined nucleotides indicate the molecular beacon's stem.
bSequence from databases.
cThese sequences were aligned to derive the corresponding primer.
dThe nucleotide positions refer to the P. aeruginosa tuf
TCG C
CTC GC
aUnderlined nucleotides indicate the molecular beacon's stem.
bThis sequence is from the complementary DNA strand of the
cThese sequences were aligned to derive the corresponding primer.
dThe nucleotide positions refer to the C. neoformans tuf (EF-1)
eThe nucleotide positions refer to the L. pneumophila tuf (EF-1)
GTC G
aUnderlined nucleotides indicate the molecular beacon's stem.
bThese sequences were aligned to derive the corresponding primer.
cThe nucleotide positions refer to the C. albicans tuf (EF-1)
dSequence from databases.
eThe nucleotide positions refer to the P. aeruginosa tuf sequence fragment (SEQ ID NO. 153).
aUnderlined nucleotides indicate the molecular beacon's stem.
bSequence from databases.
aSequence from databases.
bThese sequences are from the complementary DNA strand of the sequence of the originating fragment given in the Sequence Listing.
aSequence from databases.
TCG G
GCT CGG
CGG
aUnderlined nucleotides indicate the molecular beacon's stem.
bSequence from databases.
cThese sequences were aligned to derive the corresponding primer.
dThe nucleotide positions refer to the C. jejuni atpD sequence
aUnderlined nucleotides indicate the molecular beacon's stem.
bThese sequences were aligned to derive the corresponding primer.
cThe nucleotide positions refer to the C. albicans atpD sequence
aSequence from databases.
| Number | Date | Country | Kind |
|---|---|---|---|
| 2283458 | Sep 1999 | CA | national |
| 2037010 | May 2000 | CA | national |
This application is a continuation-in-part of application Ser. No. 11/236,785, filed Sep. 27, 2005, which is a continuation of Ser. No. 10/089,177, filed Mar. 27, 2002, which is the U.S. national phase under 35 U.S.C. §371 of prior PCT International Application No. PCT/CA00/01150, filed Sep. 28, 2000, which claims the benefit of Canada Application No. 2037010 filed May 19, 2000, and Canada Application No. 2283458, filed Sep. 28, 1999, the disclosures of which are hereby expressly incorporated by reference in their entireties. This application is also a continuation-in-part of application Ser. No. 10/753,169, filed Jan. 7, 2004, which is a continuation of application Ser. No. 09/989,643, filed Nov. 20, 2001 which is a continuation of application Ser. No. 09/297,539 filed May 3, 1999 which is a national phase of PCT/CA97/00829 filed Nov. 4, 1997, which claims priority to application Ser. No. 08/743,637, filed Nov. 4, 1996, the disclosures of which are hereby expressly incorporated by reference in their entireties.
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10089177 | Mar 2002 | US |
| Child | 11236785 | US | |
| Parent | 09989643 | Nov 2001 | US |
| Child | 10753169 | US | |
| Parent | 09297539 | May 1999 | US |
| Child | 09989643 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 11236785 | Sep 2005 | US |
| Child | 11522253 | US | |
| Parent | 10753169 | Jan 2004 | US |
| Child | 10089177 | US |
