HNF3.delta. compositions

The present invention relates to a novel family of purified proteins designated Hepatocyte Nuclear Factors-3 (HNF3), DNA encoding them, and processes for obtaining them. These proteins may be used to induce changes in the transcription and expression of factors in tissue, organs, and particularly, in pancreatic tissue. Thus, these proteins may be useful in the treatment of pancreatic disorder, and in the enhancement and/or inhibition of cellular formation, growth, differentiation, proliferation and/or maintenance, for example formation of pancreatic tissue. These proteins may also be used for augmenting the activity of other tissue regenerating factors. In particular, the present invention relates to the isolation of a new protein in the HNF3 family of proteins. This novel protein, and the gene encoding it are designated as HNF3.delta..
BACKGROUND OF THE INVENTION
The search for the molecule or molecules responsible for the formation, proliferation, differentiation and maintenance of tissue and organs, such as the pancreas, has been extensive. The structures of several proteins in the family designated as Hepatocyte Nuclear Factors-3/Forkhead or HFH, have previously been elucidated. Weigel et al., Cell, 57: 645-658 (1989); Weigel and Jackle, Cell, 63: 455-456 (1990). The HNF3 branch of the HFH family, HNF3.alpha., -3.alpha., and -3.gamma., were originally identified in hepatocytes, and were hypothesized to be liver transcription factors which bind to recognition sites in DNA regulatory regions. Costa, in Liver Gene Expression, (Tronche and Yaniv, eds.) at pp. 183-204 (R. G. Landes Company)(1994). It was further observed that binding of different combinations of liver factors provided varied promoter control while minimizing the requisite number of regulatory proteins. Thus, the HNF3 family may be capable of regulating the transcription of multiple proteins. During gastrulation of mouse embryos, murine HNF3.beta. and -3.alpha. were observed to be expressed during early and late primitive streak stages of gastrulation, respectively. Later in development, all three known HNF3 genes (HNF3.alpha., -3.beta., and -3.gamma.) were expressed in the gut, pancreas and liver primordium, while only HNF3.alpha., and -3.beta. were expressed in lung. All three HNF3 genes were co-expressed in parenchymal hepatocyte cells, and in HepG2, H4IIE and FTO-2B hepatoma cell lines. HNF3.alpha. and -3.beta. were found to be expressed in the lung and in lower amounts in the intestine, whereas HNF3.gamma. MRNA is transcribed in the testis but not in sertoli cells. HNF3.beta. protein is also expressed in the pancreas, where it recognizes a HNF3 binding site required for transcriptional activation by the .alpha.-amylase enhancer region. The HNF3.alpha. gene is abundantly transcribed within a thin epithelial cell layer lining the pulmonary bronchioles, suggesting that it may regulate the transcription of genes whose protein products are secreted into the lung airway. HNF3.beta. is absent from the bronchiolar epithelium, but expressed at high levels in the smooth muscle surrounding bronchioles and arterioles, suggesting that the HNF3 genes may regulate different target genes. The HNF3 proteins have been shown to collaborate with other liver transcription factors to regulate the expression of over a dozen liver genes, including serum carrier proteins, pharmacologically active polypeptides and genes encoding enzymes involved in glucose metabolism. Thus, the HNF3 proteins are capable of regulating a large number of genes with differing effects. Lai et al., PNAS USA 90: 10421-10423 (1993) found that HNF3.alpha. and HNF3.beta. showed an inhibitory effect in cells of pancreatic origin on the promoter of the glucagon gene. Thus, the HNF3 proteins are capable of regulating genes present in pancreatic cells.
SUMMARY OF THE INVENTION
The present invention provides additional novel members of the HNF3 family of proteins, which the present inventors have named HNF3.delta.. The HNF3.delta. proteins of the present invention show similarities in structure and function to known member of the HNF3 family. However, they are also potentially distinct in their localization and binding recognition sites. For this reason, the HNF3.delta. proteins, DNA sequences encoding them and methods of using the protein and DNA sequences represent an important new invention.
In certain embodiments, the present invention provides for an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:
(a) the nucleotide sequence of SEQ ID NO: 1 from nucleotide 1 or 88 to nucleotide 2400 or 3441; or SEQ ID NO: 3 from nucleotide 1 or 70 to 2358 or 3342;
(b) a nucleotide sequence capable of hybridizing to a nucleic acid sequence specified in (a);
(c) a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:2 or SEQ ID NO: 4 and varying from the sequence of the nucleotide sequence specified in (a) as a result of degeneracy of the genetic code;
(d) a nucleotide sequence comprising a fragment of (a) which encodes an amino acid sequence comprising nucleotides 88 to 2400 or 3441 of SEQ ID NO: 1 or a DNA sequence comprising nucleotides 70 to 2358 or 3342 of SEQ ID NO: 3;
(e) a nucleotide sequence comprising a fragment of (a) which encodes an amino acid sequence comprising amino acids 1 to 771 of SEQ ID NO: 2; or amino acid sequence comprising amino acids 1 to 763 of SEQ ID NO: 4; and
(f) an allelic variant of the nucleotide sequence specified in (a). In preferred embodiments, the nucleotide sequence encodes for a protein having HNF3.delta. activity. In other embodiments, the nucleotide sequence is operably linked to an expression control sequence.
The invention also provides for a host cell transformed with such polynucleotides, including mammalian cells. A process is also provided for producing an HNF3.delta. protein, said process comprising: (a) growing a culture of the host cell of the invention in a suitable culture medium; and (b) purifying the HNF3.delta. protein from the culture. Proteins produced according to such processes are also provided.
Pharmaceutical compositions are also provided comprising such polynucleotides and a pharmaceutically acceptable carrier. In preferred embodiments, the polynucleotide is contained in a vector suitable for gene therapy and/or the composition further comprises agents capable of increasing the uptake of said polynucleotide by cells.
The invention further provides an isolated HNF3.delta. protein comprising an amino acid sequence selected from the group consisting of:
(a) the amino acid sequence of SEQ ID NO: 2; or SEQ ID NO: 4
(b) fragments of (a) having HNF3.delta. activity.
Preferred embodiments include proteins comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, proteins comprising amino acids 1 to 771 of SEQ ID NO: 2; and proteins comprising amino acids 1 to 763 of SEQ ID NO: 4. Pharmaceutical compositions comprising such proteins and a pharmaceutically acceptable carrier are also provided.
The present invention also provides compositions comprising an antibody which specifically reacts with an HNF3.delta. protein of the invention.
The invention also provides for methods of treating conditions associated with excessive or insufficient HNF3.delta. activity, including the ability to regulate the transcription of one or more genes which are implicated in the formation, differentiation, proliferation and/or maintenance of cells and/or tissue, such as organ tissue including liver, lungs and pancreas, by administering to a mammalian subject a therapeutically effective amount of a pharmaceutical composition comprising an HNF3.delta. protein (as protein or in the form of a polynucleotide, for example, through gene therapy). The protein compositions may be stabilized through association with other factors and/or alterations to the amino acid sequence. In particular, the invention provides methods of treating conditions associated with the transcription, either positively or negatively, of one or more genes which are involved in the production of insulin-producing beta cells, or other cell types typically found in the islets of Langerhans or other pancreatic cells, as well as other organ tissues such as liver, lung, cardiac, and kidney tissue, and including the formation, growth, proliferation, differentiation and/or maintenance of such cells, tissue or organs.
As used herein, the term "HNF3.delta. protein" refers to the human HNF3.delta. protein, having the amino acid sequence specified in SEQUENCE ID NO: 4, respectively, as well as homologues of this protein found in other species; and other proteins which are closely related structurally and/or functionally to HNF3.delta.. Examples of "HNF3.delta. proteins" include rat HNF3.delta. protein, having the amino acid sequence of SEQUENCE ID NO: 2, as well as homologues in other species, preferably human and other mammals. It is also known that HNF related proteins also exist in other species, including family members in Drosophila, Xenopus, C. elegans as well as in rats, mice and humans.
As used herein, the term "HNF3.delta. activity" refers to one or more of the activities which are exhibited by the HNF3.delta. proteins of the present invention. In particular, "HNF3.delta. activity" includes the ability to bind HNF3.delta. DNA recognition sites, such as the SAAB5.1 recognition site described further below. "HNF3.delta. activity" further includes the ability to regulate the transcription of one or more genes which are implicated in the formation, differentiation, proliferation and/or maintenance of cells and/or tissue, such as organ tissue including liver, lungs and pancreas. HNF3.delta. activity may also include the ability to demonstrate effects upon the growth and/or differentiation of embryonic cells and/or stem cells. Thus, the proteins or compositions of the present invention may also be useful for treating cell populations, such as embryonic cells or stem cell populations, to enhance or enrich the growth and/or differentiation of the cells. HNF3.delta. may be capable of inducing the formation of pancreatic tissue by regulating the expression of the pancreas-specific gene IDX1. This is based upon the inventors' findings that HNF3.delta. could activate transcription of a reporter gene in cultured cells by binding to upstream HNF3.delta. recognition sequences �multiple copies of 5'-agattgagta-3' (SAAB5. 1), HNF3.delta. recognition sequences selected in vitro!, and that similar HNF3.delta. recognition sequences were identified within the promoter sequence of IDX1. In particular then, "HNF3.delta. activity" may include the ability to regulate the transcription, either positively or negatively, of one or more genes which are involved in the production of insulin-producing beta cells, or other cell types typically found in the islets of Langerhans or other pancreatic cells, as well as other organ tissues such as liver, lung, cardiac, and kidney tissue, and may therefore be utilized to enhance and/or inhibit the formation, growth, proliferation, differentiation and/or maintenance of such cells, tissue or organs. "HNF3.delta. activity" also includes the activities of HNF3.delta. protein in the assays described in the examples herein.
Rat and Human HNF3.delta.
The rat HNF3.delta. DNA sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence Listings. HNF3.delta. proteins produced from the DNA sequence demonstrate the HNF3.delta. activity described herein, and may be capable of inducing the formation of pancreatic tissue. HNF3.delta. proteins may be further characterized by the ability to demonstrate activity in the assays described below.
It is expected that other species, particularly human, have DNA sequences homologous to rat HNF3.delta.. The invention, therefore, includes methods for obtaining the DNA sequences encoding human HNF3.delta., the DNA sequences obtained by those methods, and the human protein encoded by those DNA sequences. This method entails utilizing the rat HNF3.delta. nucleotide sequence or portions thereof to design probes to screen libraries for the human gene or coding sequences or fragments thereof using standard techniques. Thus, the present invention includes DNA sequences from other species, particularly, human, which are homologous to rat HNF3.delta. can be obtained using the rat HNF3.delta. sequence. A DNA sequence encoding the complete human HNF3.delta. protein (SEQ ID NO: 3) and the corresponding amino acid sequence (SEQ ID NO: 4) are set forth herein. As described herein, these sequences were isolated using a portion of the rat HNF3.delta. sequence as a probe. The human HNF3.delta. sequence of SEQ ID NO: 3 may also be used in order to design probes to obtain further human HNF3.delta. gene or coding sequences through standard techniques. The rat and human HNF3.delta. sequences, or portions thereof, may also be used as probes, or to design probes, in order to obtain other related DNA sequences, as well as finding homologues to the HNF3.delta. protein in other species. The HNF3.delta. proteins of the present invention, such as human HNF3.delta., may be produced by culturing a cell transformed with the correlating DNA sequence, and recovering the nuclear extract. The purified expressed protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other contaminants. The recovered purified protein is contemplated to exhibit HNF3.delta. activity, including DNA binding activity. The purified protein of the invention may be further characterized by the ability to demonstrate activity in one or more of the assays described below.
Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of a HNF3.delta. protein, such as rat or human HNF3.delta. protein, in a pharmaceutically acceptable vehicle or carrier. These compositions of the invention may be used in the formation of hormone-secreting cells of a pancreatic phenotype. These compositions may further be utilized in order to enhance and/or inhibit the formation, growth, proliferation, differentiation and/or maintenance of beta cells, and other cell types typically found in the islets of Langerhans or other pancreatic cells, as well as other organ tissues such as liver, lung, cardiac, and kidney tissue. The compositions comprising HNF3.delta. may be used to treat precursor or stem cells, such as pancreatic stem cells, which are able to differentiate into cells which comprise differentiated tissue or organs, such as pancreatic cells, in order to enhance the formation, differentiation, proliferation and/or maintenance of such cells, tissue or organs. Methods for forming and maintaining such cells are described, for example, in W093/00441, the disclosure of which is hereby incorporated herein by reference.
The compositions of the invention may comprise, in addition to a HNF3.delta. protein, other therapeutically useful agents including growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factor (TGF-.alpha. and TGF-.beta.), activins, inhibins, bone morphogenetic proteins (BMP), and insulin-like growth factor (IGF). The compositions may also include an appropriate matrix for instance, for supporting the composition and providing a surface for pancreatic tissue growth. The matrix may provide slow release of the HNF3.delta. protein and/or the appropriate environment for presentation thereof.
The HNF3.delta. containing compositions may be employed in methods for treating a number of tissue defects, and healing and maintenance of various types of tissues and wounds. The tissues and wounds which may be treated include pancreas, but may also include epidermis, nerve, muscle, including cardiac muscle, and other tissues and wounds, and other organs such as liver, lung, cardiac, and kidney tissue. These methods, according to the invention, entail administering to a patient needing such tissue formation, wound healing or tissue repair, an effective amount of a HNF3.delta. protein. The HNF3.delta. containing compositions may also be used to treat or prevent such conditions as pancreatic cancer, and other abnormalities of organ tissue, such as pancreas, liver, lung, cardiac, and kidney tissue, and other tissues and organs. These methods may also entail the administration of a protein of the invention in conjunction with administration of at least one other protein, for example growth factors including EGF, FGF, TGF-.alpha., TGF-.beta., BMP, activin, inhibin and IGF.
Still a further aspect of the invention are DNA sequences coding for expression of a HNF3.delta. protein. Such sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in SEQ ID NO: 1 or SEQ ID NO: 3, DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence SEQ ID NO: 1 or SEQ ID NO: 3, and DNA sequences which encode the protein of SEQ ID NO: 2 or SEQ ID NO: 4. Further included in the present invention are DNA sequences which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 3 and encode a protein having the ability to enhance and/or inhibit the formation, growth, proliferation, differentiation, maintenance of pancreatic cells, such as insulin-producing beta cells, or other organ tissues such as liver, lung, cardiac, and kidney tissue. Preferred DNA sequences include those which hybridize under stringent conditions �see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389!. It is generally preferred that such DNA sequences encode a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature human HNF3.delta. amino acid sequence shown in SEQ ID NO: 4. Finally, allelic or other variations of the sequences of SEQ ID NO: 3, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has HNF3.delta. activity, are also included in the present invention. The present invention also includes fragments of the DNA sequence of HNF3.delta. shown in SEQ ID NO: 1 or SEQ ID NO: 3 which encode a polypeptide which retains the activity of HNF3.delta. protein. The determination whether a particular variant or fragment of the HNF3.delta. proteins of the present invention, such as those shown in SEQ ID NO: 2 and SEQ ID NO: 4, maintains HNF3.delta. activity, is routinely performed using the assays described in the examples herein.
The DNA sequences of the present invention are useful, for example, as probes for the detection of MRNA encoding HNF3.delta. in a given cell population. The DNA sequences may also be useful for preparing vectors for gene therapy applications as described below.
A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence therefor. These vectors may be employed in a novel process for producing a recombinant HNF3.delta. protein of the invention in which a cell line transformed with a DNA sequence encoding a HNF3.delta. protein in operative association with an expression control sequence therefor, is cultured in a suitable culture medium and a HNF3.delta. protein is recovered and purified therefrom. This process may employ a number of known cells both prokaryotic and eukaryotic as host cells for expression of the polypeptide. The vectors may also be used in gene therapy applications. In such use, the vectors may be transfected into the cells of a patient ex vivo, and the cells may be reintroduced into a patient. Alternatively, the vectors may be introduced into a patient in vivo through targeted transfection.
In a preferred embodiment of the invention, vectors are prepared using one or more non-native regulatory elements, such as promoters and/or enhancers operatively associated with the coding sequence for HNF3.delta., in order to achieve expression of HNF3.delta. in desired cell tissue and/or at a desired time in development. For example, a vector may be constructed using the promoter element from the well-characterized IDX1 gene, which is known to be constitutively expressed in pancreatic cells, including beta cells, during development. By operatively associating the promoter from the IDX gene with the coding sequence for HNF3.delta., and transforming suitable cells, such as pancreatic stem cells as described in W093/00441, one can express HNF3.delta. in these cells, thus promoting the desired effects of formation, growth, proliferation, differentiation and/or maintenance of pancreatic beta cells which are able to secrete insulin, either in in vitro culture or in vivo.
Still a further aspect of the invention are HNF3.delta. proteins or polypeptides. Such polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO: 2 or SEQ ID NO: 4, variants of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, including naturally occurring allelic variants, and other variants in which the protein retains the ability to enhance and/or inhibit the formation, growth, proliferation, differentiation and/or maintenance of pancreatic or other organ tissue, such as liver, lung, cardiac, and kidney tissue, characteristic of HNF3.delta.. Preferred polypeptides include a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature HNF3.delta. amino acid sequences shown in SEQ ID NO: 2 or SEQ ID NO: 4. Finally, allelic or other variations of the sequences of SEQ ID NO: 2 or SEQ ID NO: 4, whether such amino acid changes are induced by mutagenesis, chemical alteration, or by alteration of DNA sequence used to produce the polypeptide, where the peptide sequence still has HNF3.delta. activity, are also included in the present invention. The present invention also includes fragments of the amino acid sequence of HNF3.delta. shown in SEQ ID NO: 2 or SEQ ID NO: 4 which retain the activity of HNF3.delta. protein. One skilled in the art can readily produce such variations and fragments of the HNF3.delta. protein using techniques known in the art, and can readily assay them for activity, as described in the examples herein.
The purified proteins of the present inventions may be used to generate antibodies, either monoclonal or polyclonal, to HNF3.delta. and/or other related HNF3.delta. proteins, using methods that are known in the art of antibody production. Thus, the present invention also includes antibodies to human HNF3.delta. and/or other HNF3.delta. proteins. The antibodies may be useful for purification of HNF3.delta. proteins, or for inhibiting or preventing the effects of HNF3.delta. proteins either in vitro or in vivo. The HNF-3.delta. protein and related proteins may be useful for inducing the growth and/or differentiation of embryonic cells and/or stem cells. Thus, proteins or compositions of the present invention may also be useful for treating cell populations, such as embryonic cells or stem cell populations, to enhance, enrich or to inhibit the growth and/or differentiation of the cells. For example, the HNF3.delta. protein may be useful for treating cell populations to enhance and/or inhibit the formation, differentiation, proliferation and/or maintenance of insulin-producing beta cells, or other cells of pancreatic phenotype. The treated cell populations may be useful for, among other things, gene therapy applications, as described below.
Description of the Sequences
SEQ ID NO: 1 is a nucleotide sequence encoding the rat HNF3.delta. polypeptide.
SEQ ID NO: 2 is the amino acid sequence containing the rat HNF3.delta. polypeptide.
SEQ ID NO: 3 is a nucleotide sequence encoding the human HNF3.delta..
SEQ ID NO: 4 is the amino acid sequence containing the human HNF3.delta. polypeptide.
DETAILED DESCRIPTION OF THE INVENTION
HNF3.delta.
The rat HNF3.delta. nucleotide sequence (SEQ ID NO: 1) and encoded amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence listings herein. The coding sequence of the mature rat HNF3.delta. protein begins at nucleotide #88 and continues through nucleotide #2400. Purified rat HNF3.delta. proteins of the present invention are produced by culturing a host cell transformed with a DNA sequence comprising the DNA coding sequence of SEQ ID NO: 1 from nucleotide #88 to #2400, or from nucleotide #1 to #3441, and recovering and purifying from the cell extract a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acids #1 to #771 of SEQ ID NO: 2.
The human HNF3.delta. sequence of the present invention is obtained using the whole or fragments of the rat HNF3.delta. DNA sequence, or a partial human HNF3.delta. sequence, as a probe. Thus, the human HNF3.delta. DNA sequence of SEQ ID NO: 3 corresponds well to the DNA sequence of the rat HNF3.delta. DNA sequence shown in SEQ ID NO: 1. The human HNF3.delta. protein comprises the sequence of amino acids #1 to #763 of SEQ ID NO: 4.
The HNF3.delta. proteins of the present invention, include polypeptides having a molecular weight of about 85.2 kd, pI 7.75 in monomeric form, said polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 and having the ability to exhibit HNF3.delta. activity, or to demonstrate activity in one or more of the assays described in the examples herein. The HNF3.delta. proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present. HNF3.delta. proteins may be characterized by the ability to exhibit HNF3.delta. activity, including the ability to bind HNF3.delta. DNA recognition sequences, or to demonstrate activity in one or more of the assays described in the examples herein.
The HNF3.delta. proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 1 or SEQ ID NO: 3, but into which modifications or deletions are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO: 2 or SEQ ID NO: 4. These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with HNF3.delta. polypeptides of SEQ ID NO: 2 or SEQ ID NO: 4 may possess biological properties in common therewith. Thus, these modifications and deletions of the native HNF3.delta. may be employed as biologically active substitutes for naturally-occurring HNF3.delta. polypeptides in therapeutic processes. It can be readily determined whether a given variant of HNF3.delta. maintains the biological activity of HNF3.delta. by subjecting both HNF3.delta. and the variant of HNF3.delta. to the assays described in the examples.
Other specific mutations of the sequences of HNF3.delta. proteins described herein involve modifications of glycosylation sites. These modifications may involve O-linked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid. A variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. Such variants of HNF3.delta. are within the present invention. Additionally, bacterial expression of HNF3.delta. protein will result in production of a non-glycosylated protein, even if the glycosylation sites are left unmodified. Such bacterially produced versions of HNF3.delta. are within the present invention.
The present invention also encompasses the novel DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and coding for expression of HNF3.delta. proteins. These DNA sequences include those depicted in SEQ ID NO: 1 and SEQ ID NO: 3 in a 5' to 3' direction and those sequences which hybridize thereto under stringent hybridization conditions �for example, 0.1X SSC, 0.1% SDS at 65.degree. C.; see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389! and encode a protein having HNF3.delta. activity. These DNA sequences also include those which comprise the DNA sequence of SEQ ID NO: 1 or SEQ ID NO: 3 and those which hybridize thereto under stringent hybridization conditions and encode a protein having HNF3.delta. activity.
Similarly, DNA sequences which code for HNF3.delta. proteins coded for by the sequences of SEQ ID NO: 1 or SEQ ID NO: 3, or HNF3.delta. proteins which comprise the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein. Variations in the DNA sequences of SEQ ID NO: 1 or SEQ ID NO: 3 which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the invention.
Another aspect of the present invention provides a novel method for producing HNF3.delta. proteins. The method of the present invention involves culturing a suitable cell line, which has been transformed with a DNA sequence encoding a HNF3.delta. protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the HNF3.delta. proteins recovered and purified from the culture medium. The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.
Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO). The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293: 620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol., 5(7): 1750-1759 (1985) or Howley et al, U.S. Pat. No. 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. The mammalian cell CV-1 may also be suitable.
Bacterial cells may also be suitable hosts. For example, the various strains of E. coli (e.g., HB101, MC1061) are well-known as host cells in the field of biotechnology. Various strains of B. subtilis, Pseudomonas, other bacilli and the like may also be employed in this method. For expression of the protein in bacterial cells, DNA encoding the propeptide of HNF3.delta. is generally not necessary.
Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Engineering, 8: 277-298 (Plenum Press 1986) and references cited therein.
Another aspect of the present invention provides vectors for use in the method of expression of these novel HNF3.delta. polypeptides. Preferably the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention. Additionally, the vectors contain appropriate expression control sequences permitting expression of the HNF3.delta. protein sequences. Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention.
The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing the replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and may be selected depending upon the host cells. Such selection is routine and does not form part of the present invention.
In order to produce rat, human or other mammalian HNF3.delta. proteins, the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. The preferred expression system for biologically active recombinant human HNF3.delta. is contemplated to be stably transformed mammalian cells.
One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or other DNA sequences encoding HNF3.delta. proteins or other modified sequences and known vectors, such as pED6. The mammalian expression vector pED6 is a derivative of pED, which is described in Kaufman et al., Nucleic Acids Research, 19: 4485-4490 (1991).
The construction of vectors may involve modification of the HNF3.delta. DNA sequences. For instance, HNF3.delta. cDNA can be modified by removing the non-coding nucleotides on the 5' and 3' ends of the coding region. The deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of HNF3.delta. proteins.
One skilled in the art can manipulate the sequences of SEQ ID NO: 1 or SEQ ID NO: 3 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences therefrom or altering nucleotides therein by other known techniques). The modified HNF3.delta. coding sequence could then be inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA, 77: 5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a HNF3.delta. protein expressed thereby.
Similar manipulations can be performed for the construction of an insect vector �See, e.g. procedures described in published European patent application 155,476! for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells. �See, e.g., procedures described in published PCT application W086/00639 and European patent application EPA 123,289!.
A method for producing high levels of a HNF3.delta. protein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous HNF3.delta. gene. The heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J. Mol. Biol., 159: 601-629 (1982). This approach can be employed with a number of different cell types.
For example, a plasmid containing a DNA sequence for a HNF3.delta. protein of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pED6 can be co-introduced into DHFR-deficient CHO cells, DUKX-BII, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol., 5: 1750 (1983). Transformants are cloned, and biologically active HNF3.delta. expression is monitored by assay in one of the assays described in the examples below, such as the DNA binding assay. HNF3.delta. protein expression should increase with increasing levels of MTX resistance. HNF3.delta. polypeptides are characterized using standard techniques known in the art such as pulse labeling with �35S! methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related HNF3.delta. proteins.
A protein of the present invention, which demonstrates HNF3.delta. activity, has application in the induction, formation, growth, differentiation, proliferation and/or maintenance and healing of tissue such as pancreatic tissue, and other organ tissue, in humans and other animals. Such a preparation employing. a HNF3.delta. protein may have prophylactic use in preventing pancreatic tumors, diabetes and other pancreatic tissue disorders. De novo formation of beta cells, islet of Langerhans cells, and other cells of pancreatic phenotype, induced by a HNF3.delta. protein contributes to the repair of congenital, trauma induced, or oncologic tissue defects or conditions. A HNF3.delta. protein may be used in the treatment of pancreatic disease, and in other tissue and organ repair processes. Such agents may provide an environment to attract suitable stem cells, stimulate growth and proliferation of pancreas-forming cells or induce differentiation of progenitors of pancreas-forming cells, and may also support the regeneration of other tissues and organs. HNF3.delta. polypeptides of the invention may also be useful in the treatment of organ disorders such as pancreitis or diabetes.
The proteins of the invention may also be used in wound healing and in related tissue repair. The types of wounds include, but are not limited to burns, incisions and ulcers. (See, e.g. PCT Publication W084/01106 for discussion of wound healing and related tissue repair). It is further contemplated that proteins of the invention may increase neuronal, astrocytic and/or glial cell survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival and repair. The proteins of the invention may further be useful for the treatment of conditions related to other types of tissue, such as nerve, epidermis, muscle, and other organs such as liver, lung, cardiac, and kidney tissue. The proteins of the present invention may also have value as a dietary supplement or as a component of cell culture media. For this use, the proteins may be used in intact form, or may be predigested to provide a more readily absorbed supplement.
The proteins of the invention may also have other useful properties characteristic of the HNF3.delta. family of proteins. Such properties include angiogenic, chemotactic and/or chemoattractant properties, and effects on cells including differentiation responses, cell proliferative responses and responses involving cell adhesion, migration and extracellular matrices. These properties make the proteins of the invention potential agents for wound healing, reduction of fibrosis and reduction of scar tissue formation. The proteins of the invention may also be useful for the induction of formation of cells capable of secreting valuable hormones, such as insulin, glucagon, or other endocrine or exocrine hormones.
A further aspect of the invention is a therapeutic method and composition for treating disorders of the pancreas, diabetes, and other conditions related to pancreatic tissue disorders or diseases. The invention further comprises therapeutic methods and compositions for wound healing and tissue repair. Such compositions comprise a therapeutically effective amount of at least one HNF3.delta. protein of the present invention in admixture with a pharmaceutically acceptable vehicle, carrier or matrix. It is further contemplated that compositions of the invention may increase neuronal survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival.
It is expected that the proteins of the invention may act in concert with or perhaps synergistically with other related proteins and growth factors. Further therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one HNF3.delta. protein of the invention with a therapeutic amount of at least one other protein, such as a member of the TGF-.beta. superfamily of proteins, which includes the BMPs, GDFs and other proteins. The composition may include other agents and growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-.alpha. and TGF-.beta.), activins, inhibins, and k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF/HILDA/DIA), insulin-like growth factors (IGF-I and IGF-II). Portions of these agents may also be used in compositions of the present invention.
The preparation and formulation of such physiologically acceptable protein compositions, having due regard to pH, isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently valuable for veterinary applications due to the lack of species specificity in HNF proteins. Particularly domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment with the HNF3.delta. proteins of the present invention.
The therapeutic method includes administering the composition topically, systemically, or locally as by injection or implantation. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of pancreatic or other tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than the HNF3.delta. proteins which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the HNF3.delta. composition in the methods of the invention.
For implantation, the composition preferably includes a matrix capable of delivering HNF3.delta. proteins to the site of pancreatic or other tissue damage, providing a structure for the developing tissue and optimally capable of being resorbed into the body. The matrix may provide slow release of HNF3.delta. and/or other protein, as well as proper presentation and appropriate environment for cellular infiltration. Such matrices may be formed of materials presently in use for other implanted medical applications. The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the HNF3.delta. compositions will define the appropriate formulation.
The dosage regimen will be determined by the attending physician considering various factors which modify the action of the HNF3.delta. protein, e.g. amount of tissue desired to be formed, the site of tissue damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue, the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the types of HNF3.delta. proteins in the composition. Generally, systemic or injectable administration will be initiated at a dose which is minimally effective, and the dose will be increased over a preselected time course until a positive effect is observed. Subsequently, incremental increases in dosage will be made limiting such incremental increases to such levels that produce a corresponding increase in effect, while taking into account any adverse affects that may appear. The addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also affect the dosage.
Progress can be monitored by periodic assessment of tissue growth and/or repair. The progress can be monitored, for example, x-rays, histomorphometric determinations and tetracycline labeling.
The following examples illustrate practice of the present invention in recovering and characterizing rat HNF3.delta. protein and employing the DNA to recover human HNF3.delta. and other HNF3.delta., obtaining the human proteins and expressing the proteins via recombinant techniques.

EXAMPLES
EXAMPLE 1
Isolation of DNA Encoding HNF3.delta.
DNA encoding HNF3.delta. was isolated by degenerate RT-PCR using INS-1 polyA+ RNA as templates and two sets of degenerate oligonucleotides, HFH-1 (5'-aarcchcchtawtcntayat-3') and HFH-2 (5'-rtgyckratngarttctgcca-3'), designed against two conserved blocks of homology within the first half of the HFH DNA binding domain. Based on the sequence information of this 153 bp HNF3.delta. PCR product, a 30-mer oligonucleotide was synthesized to screen an INS-1 cDNA library resulting in the isolation of a 3.0-kb cDNA. This 3.0-kb cDNA misses the translational start codon; therefore the 5' end of the HNF3.delta. transcript was synthesized by the PCR-based procedure, 5'-RACE. The PCR-generated 5' cDNA was assembled with the 3.0-kb cDNA at the EcoRV site to give a near full length cDNA of .about.3.4-kb.
Conceptual translation of the 3.4-kb cDNA sequence revealed a 771-amino acid ORF that can encode an 85.2-kD polypeptide. Coupled in vitro transcription-translation of the 3.4-kb cDNA led to the synthesis of a 95-kD polypeptide. Phosphorylation of the carboxyl terminal portion of the HNF3.delta. protein might explain its decreased mobility on SDS-PAGE gels.
To isolate cDNAs encoding human HNF3.delta., we screened an human pancrease adenocarcinoma library and a testis library using a 605-bp rat HNF3.delta. SacI-SacI fragment (nucleotide #556 to #1162), which spans the DNA binding domain, as probe. Using this procedure, four partial human cDNAs have been isolated. The full length cDNA, including the 5' end of the human HNF3.delta. cDNA can be cloned using 5'-RACE.
EXAMPLE 2
Expression Analysis of HNF3.delta. by Northern Blots
HNF3.delta. was cloned from INS-1 cells. To determine whether HNF3.delta. expression is limited to pancreatic .beta. cells, we studied by Northern analysis the expression of the gene in a variety of insulin-secreting (rat INS-1 and RIN1046-38; mouse bTC1 and bTC6), glucagon-secreting (rat RIN56A, mouse aTC1) and somatotstatin-secreting (rat RIN1027-B2) cells. Using the 3.4 kb HNF3.delta. cDNA as a probe, we detected a strong .about.3.4 kb doublet and a weaker .about.4.0 kb transcript in total RNAs prepared from INS-1 cells. The 3.4 kb HNF3.delta. cDNA corresponds well in size with the strong doublet although more cDNA analysis is required to confirm the identity of the multiple transcripts. Expression of these transcripts were detectable in all the insulinoma cell lines tested. HNF3.delta. expression was also detectable at a lower level in the neuronal cell line, PC12, but was undetectable in the hepatic cell line, HepG2 cells.
To understand how HNF3.delta. expression correlates with pancreas organogenesis, we analyzed by Northern blots total RNAs isolated from embryonic, neonate and adult pancreas. HNF3.delta. was highly expressed when the pancreatic bud first forms at the embryonic 12 day (e12) and remained high in e14 and e18 pancreata. Interestingly, expression did not persist through adulthood. HNF3.delta. expression was decreased in neonate pancreas and was undetectable in adult pancreas. Analysis of islet total RNA also did not show detectable expression of HNF3.delta.. This suggests that the lack of adult pancreas expression of HNF3.delta. is not due to the restriction of expression to endocrine cells, which represent less than 5% of the pancreas. Liver samples similarly analyzed indicated that the HNF3.delta. gene was expressed in e14 but not in adult liver. It is interesting to note that dramatic pancreas organogenesis occurs during the period from e12 to neonate, which corresponds to the period of high level of HNF3.delta. expression in pancreas.
To study whether HNF3.delta. is expressed in other adult tissues, total RNAs from different rat tissues were analyzed by Northern blots. HNF3.delta. expression was detectable in adult duodenum, thymus and fat, and in large intestine at a lower level. Additionally, we probed a human endocrine system multiple tissue Northern blot using the rat HNF3.delta. cDNA. A 4.0 kb transcript was detectable in both thymus and testis, but not in pancreas and other endocrine tissues. This finding is consistent with the rat tissue Northern data.
In summary, HNF3.delta. is highly expressed in insulinoma cell lines, embryonic pancreas and liver, and adult gut, thymus, fat and testis. The thymus expression can explain the cloning of human Mpp2/HNF3.delta. from the lymphoblastic cell line MOLT-4
ATCC Deposits
A plasmid containing rat HNF3.delta. DNA sequence was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. on Sep. 3, 1996 and was accorded the accession number ATCC 97704. A plasmid containing partial human HNF3.delta. DNA sequence was deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110-2209 on Sep. 3, 1996 and was accorded the accession number ATCC 97705. Using these plasmids, one can readily prepare expression vectors and other materials useful for the practice of the present invention.
EXAMPLE 3
Biological Activity of Expressed HNF3 .delta.
To test whether HNF3.delta. can function as a transcriptional activator, we co-transfected cultured cells with the HNF3.delta. cDNA and a reporter plasmid carrying 5 copies of the HNF3.delta. SAAB5. 1 binding sites. We have used both NIH3T3 and HeLa cells for transfection. Northern analysis of total RNAs prepared from both cells indicated that HNF3.delta. was expressed in NHI3T3 cells but not in HeLa cells. The HNF3.delta. binding sites were placed upstream of a TATA box secreted alkaline phosphatase (SEAP) coding sequence. With an expression plasmid/reporter plasmid ratio of 5:1, we were able to detect more than ten fold increase in transcriptional activation of the SEAP reporter gene. Since similar HNF3.delta. recognition sequences could be identified within the promoter sequence of IDX1, HNF3.delta. may also activate transcription by binding to the HNF3.delta. SAAB5.1 recognition sequences within the IDX1 promoter.
EXAMPLE4
Construction of IDX-1-HNF3.delta. Vector for Overexpression of HNF3.delta. and the Analysis of IDX-1-HNF3.delta. Mice
Northern blot analysis indicates that HNF3.delta. is highly expressed in developing pancreas from the very beginning of overt pancreas morphogenesis at e12. The interesting question to ask is whether overexpression of the HNF3.delta. gene product at this early stage of pancreas development will lead to altered fate determination. To achieve this pancreas-specific overexpression, we can subclone the HNF3.delta. cDNA into pIT2 which contains an upstream pancreas-specific IDX-1 promoter. Pioneer experiments by Dr. C. Miller (Genetics Institute, Inc, personal communication) have demonstrated that the IDX- 1 promoter within pIT2 can direct high level mis-expression of candidate genes. The IDX-1-HNF3.delta. construct can be injected into fertilized oocytes to generate Fo transgenic mice and the animals recovered at around 20 dpc for analyzing pancreas and gut development by histochemistry and immunostaining.
The fact that HNF3.delta. is also highly expressed in thymus, testis, fat (from pregnant females) and gut areas where there are high content of progenitor cells with high proliferative activity and human HNF3.delta. and MPP2 are related genes suggests that HNF3.delta. might play a role in regulating the development of progenitor cells. The prediction is that overexpression of HNF3.delta. at early pancreas development might increase the number and/or proliferative potential of early pancreatic progenitor cells leading to general hypertrophy or enhanced development of specific lineage e.g., endocrine versus exocrine IDX-1 expression becomes restricted to the .beta.-cell lineage later in pancreas development. Visual examination of the gut of 20 dpc transgenic animals followed by further innumohistochemical analysis should reveal any developmental defect due to overexpression of HNF3.delta.. Immunostaining with anti-glucagon and anti-insulin antisera should indicate whether the development of the endocrine lineages are altered.
EXAMPLE 5
Production and Analysis of Knockout Mouse for HNF3.delta.
To understand the functional role of HNF3.delta. during mouse development, a loss-of-function mutation can be generated by ES cell-based homologous recombination. A targeting construct can be made with the neomycin-resistant gene as selectable marker and >5 kb (>1 kb at either end) of flanking HNF3.delta. genomic sequences to allow for efficient homologous recombination. One copy of the thymidine kinase gene will also be introduced at one end to allow for negative selection against non-homologous recombination by culturing in the presence of gancyclovir. The bacterial .beta.-galactosidase gene can also be cloned in-frame and downstream of the 5' HNF3.delta. genomic sequence such that the majority of the HNF3.delta. coding sequences including the DNA binding domain will be replaced by the .beta.-galactosidase gene following homologous recombination. The .beta.-galactosidase reporter gene would allow the developmental expression of HNF3.delta. to be analyzed by X-gal staining in heterozygous animals.
The linearized targeting construct will be eletrophorated into ES cells followed by selection in G418 and gancyclovir-containing medium. Neo.sup.r tk-colonies will be isolated and genomic DNA prepared for PCR and Southern blot analysis for identifying clones carrying the right homologous recombination events. Positive ES lines will be injected into 3.5 dpc mouse blastocytes for generating F.sub.0 chimeric animals. If the ES cells can contribute to the germ line, backcrossing of the chimeric animals will give agouti F.sub.1 pups which will be genotyped by tail DNA analysis to identify the heterozygous animals. Further mating of the heterozygous animals will generate both heterozygous pups for analysis of expression by X-gal staining and homozygous pups for phenotypic analysis, assuming that the knockout animals are not early lethal. If a pancreatic phenotype is observed, we can also try to rescue the phenotype by crossing the knockout animals to IDX-1-HNF3.delta. mice.
EXAMPLE 6
Embryonic Stem Cell Assay
In order to assay the effects of the HNF3.delta. proteins of the present invention, it is possible to assay the growth and differentiation effects in vitro on a number of available embryonic stem cell lines. One such cell line is ES-E14TG2, which is available from the American Type Culture Collection in Rockville, Md.
In order to conduct the assay, cells may be propagated in the presence of 100 units of LIF to keep them in an undifferentiated state. Assays are setup by first removing the LIF and aggregating the cells in suspension, in what is known as embryoid bodies. After 3 days the embryoid bodies are plated on gelatin coated plates (12 well plates for PCR analysis, 24 well plates for immunocytochemistry) and treated with the proteins to be assayed. Cells are supplied with nutrients and treated with the protein factor every 2-3 days. Cells may be adapted so that assays may be conducted in media supplemented with 15% Fetal Bovine Serum (FBS) or with conditioned defined media (CDM) containing much lower amounts of FBS.
At the end of the treatment period (ranging from 7-21 days) RNA is harvested from the cells and analyzed by quantitative multiplex PCR for the following markers: Brachyury, a mesodermal marker, AP-2, an ectodermal marker, and HNF-3.alpha. an endodermal marker. Through immunocytochemistry, it is also possible to detect the differentiation of neuronal cells (glia and neurons), muscle cells (cardiomyocytes, skeletal and smooth muscle), and various other phenotype markers such as proteoglycan core protein (cartilage), and cytokeratins (epidermis). Since these cells have a tendency to differentiate autonomously when LIF is removed, the results are always quantitated by comparison to an untreated control.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 4(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3441 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 88..2400(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GCCTGGCTCGGCCCCGCGTGGAGCAGCGGTGGCCTGTGAGGGTCAAAGCTTGTGATTCTC60GATGGAGAGTGAAAGCACAGCTTCATGATGAGAACCAGCCCCCGGCGGCCA111MetArgThrSerProArgArgPro15CTGATTCTCAAGAGACGGAGGCTGCCCCTTCCTATTCAAAATGCCCCG159LeuIleLeuLysArgArgArgLeuProLeuProIleGlnAsnAlaPro101520AGTGAAACCTCAGAGGAAGAAGCAAAGAGATCCCCTGGACAGCAGGAG207SerGluThrSerGluGluGluAlaLysArgSerProGlyGlnGlnGlu25303540CCTACTCAAGCACAGGCCTCCCAAGATGTGGCAGAGTCCAGCTCTTGC255ProThrGlnAlaGlnAlaSerGlnAspValAlaGluSerSerSerCys455055AAATTTCCAGCTGGAATCAAGATTATCAACCACCCAACCGTGCCCAAC303LysPheProAlaGlyIleLysIleIleAsnHisProThrValProAsn606570ACACAAGTGGTGGCTATCCCCAACAACGCGGACATCCAGAGCATCATC351ThrGlnValValAlaIleProAsnAsnAlaAspIleGlnSerIleIle758085ACAGCGCTGACTGCCAAAGGGAAAGAGAGTGGCAGCAGTGGGCCCAAC399ThrAlaLeuThrAlaLysGlyLysGluSerGlySerSerGlyProAsn9095100AAGTTCATCCTCATCAGCTCTGGAGGGGCCTCATCTCATCCTCCTGAT447LysPheIleLeuIleSerSerGlyGlyAlaSerSerHisProProAsp105110115120CCTCAATCTCAAGCCCAAACCAGCACTGATTCCAAGAGAACAGAACTG495ProGlnSerGlnAlaGlnThrSerThrAspSerLysArgThrGluLeu125130135ATCACCGAGACGTTGGGACCAAAGCCAGGGGCTAAGGGTGTGCCTGTT543IleThrGluThrLeuGlyProLysProGlyAlaLysGlyValProVal140145150CCCAAGCCACCTGGAGCTCTTCCAAGGCAAAGACAGGAGAGCTGTGGT591ProLysProProGlyAlaLeuProArgGlnArgGlnGluSerCysGly155160165GGTGAAGCGGCCGGCTGCACACTGGACAACAGCTTAACCAATATCCAG639GlyGluAlaAlaGlyCysThrLeuAspAsnSerLeuThrAsnIleGln170175180TGGCTTGGAAAGATGAGTTCTGATGGGCTGGGCCGCTGCAGCATTAAG687TrpLeuGlyLysMetSerSerAspGlyLeuGlyArgCysSerIleLys185190195200CAGGAACTGGAAGAGAAGGAGAATTGTCACCTGGAGCAGAATCGGGTT735GlnGluLeuGluGluLysGluAsnCysHisLeuGluGlnAsnArgVal205210215AAGGTTGAGGCGCCCTCAAGAGCATCAGTGTCTTGGCAGGACTCTGTG783LysValGluAlaProSerArgAlaSerValSerTrpGlnAspSerVal220225230TCTGAGAGGCCACCCTACTCCTATATGGCCATGATACAGTTCGCGATC831SerGluArgProProTyrSerTyrMetAlaMetIleGlnPheAlaIle235240245AACAGCACTGAGAGGAAGCGTATGACCTTGAAGGATATCTACACTTGG879AsnSerThrGluArgLysArgMetThrLeuLysAspIleTyrThrTrp250255260ATCGAGGACCACTTCCCTTATTTTAAGCACATTGCCAAGCCAGGCTGG927IleGluAspHisPheProTyrPheLysHisIleAlaLysProGlyTrp265270275280AAGTGTTGGCACCAGGCCTACCACAAGCTCGGGCCACAGAACTCTATT975LysCysTrpHisGlnAlaTyrHisLysLeuGlyProGlnAsnSerIle285290295CGTCACAACCTTTCTCTCCATGACATGTTTGTTCGAGAAACATCTGCC1023ArgHisAsnLeuSerLeuHisAspMetPheValArgGluThrSerAla300305310AATGGCAAGGTCTCCTTCTGGACCATTCACCCAAGTGCTAATCGCTAC1071AsnGlyLysValSerPheTrpThrIleHisProSerAlaAsnArgTyr315320325TTGACATTGGACCAAGTGTTTAAGCCACTGGAACCAGGGTCTCCACAA1119LeuThrLeuAspGlnValPheLysProLeuGluProGlySerProGln330335340TCGCCCGAGCACTTGGAATCACAGCAGAAACGACCCAATCCTGAGCTC1167SerProGluHisLeuGluSerGlnGlnLysArgProAsnProGluLeu345350355360CGTAGAAATGTGACCATCAAAACTGAACTCCCACTAGGCGCACGGCGA1215ArgArgAsnValThrIleLysThrGluLeuProLeuGlyAlaArgArg365370375AAGATGAAGCCACTGCTCCCACGGGTTAGCTCATACCTGGTGCCCATC1263LysMetLysProLeuLeuProArgValSerSerTyrLeuValProIle380385390CAGTTCCCGGTGAACCAGTCCCTGGTGTTACAGCCCTCGGTGAAGGTT1311GlnPheProValAsnGlnSerLeuValLeuGlnProSerValLysVal395400405CCCTTGCCTCTGGCAGCATCTCTTATGAGCTCAGAGCTTGCCCGTCAT1359ProLeuProLeuAlaAlaSerLeuMetSerSerGluLeuAlaArgHis410415420AGCAAGCGAGTCCGCATTGCACCCAAGGTGCTGCTATCCAACGAAGGG1407SerLysArgValArgIleAlaProLysValLeuLeuSerAsnGluGly425430435440ATAGCCCCACTTCCTGCCACAGAACCCATGAAGGAGGAGAAACCCCTG1455IleAlaProLeuProAlaThrGluProMetLysGluGluLysProLeu445450455CTTGGAGAAGGGCTATTGCCTTTGCTTCCTATTCAGTCCATTAAGGAA1503LeuGlyGluGlyLeuLeuProLeuLeuProIleGlnSerIleLysGlu460465470GAAGTAATTCAGCCTGGGGAGGACATACCACACTTAGAGAGGCCTATC1551GluValIleGlnProGlyGluAspIleProHisLeuGluArgProIle475480485AAAGTGGAGAGCCCTCCCTTGGAAGAGTGGCCCTCTCCGTGTGCATCA1599LysValGluSerProProLeuGluGluTrpProSerProCysAlaSer490495500GTGAAAGAGGAACTGTCCAACTCCTGGGAAGATTCTTCCTGCTCTCCT1647ValLysGluGluLeuSerAsnSerTrpGluAspSerSerCysSerPro505510515520ACCCCAAAGCCCAAGAAGTCCTATTGTGGGCTTAAGTCCCCAACACGG1695ThrProLysProLysLysSerTyrCysGlyLeuLysSerProThrArg525530535TGTGTCTCAGAAATGCTGGTGACAAAGCGGAGAGAGAAGAGAGAGGTG1743CysValSerGluMetLeuValThrLysArgArgGluLysArgGluVal540545550AGCCGATCTCGGAGGAAGCAGCACCTTCAGCCACCCTGTCTAGATGAG1791SerArgSerArgArgLysGlnHisLeuGlnProProCysLeuAspGlu555560565CCTGAACTCTTCTTCTCAGAGGACTCCAGCACATTTCGGCCAGCCATG1839ProGluLeuPhePheSerGluAspSerSerThrPheArgProAlaMet570575580GAGATCCTGGCAGAGTCTTCAGAGCCTGCACCACAGCTCAGCTGCCCT1887GluIleLeuAlaGluSerSerGluProAlaProGlnLeuSerCysPro585590595600CAGGAGGAGGGAGGGCCCTTCAAGACCCCCATCAAGGAGACATTGCCT1935GlnGluGluGlyGlyProPheLysThrProIleLysGluThrLeuPro605610615GTCTCCTCCACTCCTAGCAAGTCTGTGCTCTCTAGAGACCCTGAGTCC1983ValSerSerThrProSerLysSerValLeuSerArgAspProGluSer620625630TGGAGGCTCACACCCCCAGCCAAAGTTGGGGGGTTAGATTTCAGCCCA2031TrpArgLeuThrProProAlaLysValGlyGlyLeuAspPheSerPro635640645GTACGAACCCCCCAGGGTGCCTTTGGCCCTCTGCCTGACTCGCTGGGG2079ValArgThrProGlnGlyAlaPheGlyProLeuProAspSerLeuGly650655660CTTATGGAGCTGAATACCACACCTCTGAAAAGTGTTCCCCTCTTCGAC2127LeuMetGluLeuAsnThrThrProLeuLysSerValProLeuPheAsp665670675680TCACCCCGGGAGCTCCTTAACTCAGAAGCCTTTGACCTTGCCTCTGAT2175SerProArgGluLeuLeuAsnSerGluAlaPheAspLeuAlaSerAsp685690695CCCTTTAGCAGTTCTCCACCACCACATTTGGAAGCCAAGCCAGGCTCC2223ProPheSerSerSerProProProHisLeuGluAlaLysProGlySer700705710CCCGAGCTGCAGGTCCCCAGCCTTTCAGCCAACCGTTCTCTCACAGAA2271ProGluLeuGlnValProSerLeuSerAlaAsnArgSerLeuThrGlu715720725GGCCTTGTCCTGGACACAATGAATGATAGCCTCAGCAAGATCCTTCTA2319GlyLeuValLeuAspThrMetAsnAspSerLeuSerLysIleLeuLeu730735740GACATCAGTTTCCCTGGCCTGGAGGAGGACCCTCTGGGCCCTGACAAC2367AspIleSerPheProGlyLeuGluGluAspProLeuGlyProAspAsn745750755760ATCAACTGGTCTCAGTTCATCCCTGAGCTGCGATAGAGGCAGGGTCTTACCCT2420IleAsnTrpSerGlnPheIleProGluLeuArg765770TGCCACTCAAGCCACCAGTTATCCTGGCACTTGTGTGGCTGGATAGTGCAAGGCTCAGTG2480TACCCCAAACCGTCTGAGGGAGCTAGCAGGCAAGGGCTGAGCGGTGCCCTTTGACCTAAT2540TATGCCAAGGTAAAAGCCACGTCTAAGCCACTGCTGGGACCTATGCAAGCAATAGGATCT2600CCCAGAGTCCTCCACTCCCTGCTGGCAAGTGAAGTGGGTGTGACAGAGCCGTGAGGACCA2660GGAAATGCCCACCCATTAGTCACCTGCTGCTCCTGGCAGGATAACCCTTGTAAATGGTGT2720CAGTTCCCCAAGTTGTCCTGTAATTATAAATGTAGCCATATTCCCTTAGCTCTCATTATC2780CAGAGACTGCCAGGATGGGTAGGGTGACAAGGGGTTGCATTAGCTTCTGCTTGTGGCCTT2840TGGGGGCAGGACCTGCAGTTCAGCCTCTTCACACTGTGGGTTCTGCTGTAGGCTTCTAGA2900CACACAGGTGTCCTTGCCAGGACCCCACTTACTGCCCTTTCCTCACAGCTCCCCCTGGTT2960CTAAGCCAGTGGTACTGCATGAAGAAATCCTGCGGCAAAGCCTATTGTCTCTGGGTGTGT3020GGGGACGGGTGTGCCTGAAGCAAAAGCATGGGTACTCACGTGAGTCCTTTAGGTGTTTCT3080CTGATCGTGTTCCCAATCATGCCAGGGAGTCTAGCATTGAGAACTCAGGCTGAGGCCTGA3140GGAGGAGGAGGAAGTGACCACTGACTTGCCTGGCTTCCTTAGCTTGCACCTGAGTTTTGC3200AAAAAGCCACCCTAGACCCCACTCTACAAGCTAGCACAAGAACACTACTGTAACTACCTA3260CTGAATAAAGCCCAGGTGGCCTGATCTCGGAATTGAGTGAGGGGTGATGGAGCCCGGAGA3320TGATGGGCAGGCCTGCACCTGCTGCATGGGCCTTGCACAGGTTGTCTCTCCACATCCTTC3380TTTGACTCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGA3440G3441(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 771 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetArgThrSerProArgArgProLeuIleLeuLysArgArgArgLeu151015ProLeuProIleGlnAsnAlaProSerGluThrSerGluGluGluAla202530LysArgSerProGlyGlnGlnGluProThrGlnAlaGlnAlaSerGln354045AspValAlaGluSerSerSerCysLysPheProAlaGlyIleLysIle505560IleAsnHisProThrValProAsnThrGlnValValAlaIleProAsn65707580AsnAlaAspIleGlnSerIleIleThrAlaLeuThrAlaLysGlyLys859095GluSerGlySerSerGlyProAsnLysPheIleLeuIleSerSerGly100105110GlyAlaSerSerHisProProAspProGlnSerGlnAlaGlnThrSer115120125ThrAspSerLysArgThrGluLeuIleThrGluThrLeuGlyProLys130135140ProGlyAlaLysGlyValProValProLysProProGlyAlaLeuPro145150155160ArgGlnArgGlnGluSerCysGlyGlyGluAlaAlaGlyCysThrLeu165170175AspAsnSerLeuThrAsnIleGlnTrpLeuGlyLysMetSerSerAsp180185190GlyLeuGlyArgCysSerIleLysGlnGluLeuGluGluLysGluAsn195200205CysHisLeuGluGlnAsnArgValLysValGluAlaProSerArgAla210215220SerValSerTrpGlnAspSerValSerGluArgProProTyrSerTyr225230235240MetAlaMetIleGlnPheAlaIleAsnSerThrGluArgLysArgMet245250255ThrLeuLysAspIleTyrThrTrpIleGluAspHisPheProTyrPhe260265270LysHisIleAlaLysProGlyTrpLysCysTrpHisGlnAlaTyrHis275280285LysLeuGlyProGlnAsnSerIleArgHisAsnLeuSerLeuHisAsp290295300MetPheValArgGluThrSerAlaAsnGlyLysValSerPheTrpThr305310315320IleHisProSerAlaAsnArgTyrLeuThrLeuAspGlnValPheLys325330335ProLeuGluProGlySerProGlnSerProGluHisLeuGluSerGln340345350GlnLysArgProAsnProGluLeuArgArgAsnValThrIleLysThr355360365GluLeuProLeuGlyAlaArgArgLysMetLysProLeuLeuProArg370375380ValSerSerTyrLeuValProIleGlnPheProValAsnGlnSerLeu385390395400ValLeuGlnProSerValLysValProLeuProLeuAlaAlaSerLeu405410415MetSerSerGluLeuAlaArgHisSerLysArgValArgIleAlaPro420425430LysValLeuLeuSerAsnGluGlyIleAlaProLeuProAlaThrGlu435440445ProMetLysGluGluLysProLeuLeuGlyGluGlyLeuLeuProLeu450455460LeuProIleGlnSerIleLysGluGluValIleGlnProGlyGluAsp465470475480IleProHisLeuGluArgProIleLysValGluSerProProLeuGlu485490495GluTrpProSerProCysAlaSerValLysGluGluLeuSerAsnSer500505510TrpGluAspSerSerCysSerProThrProLysProLysLysSerTyr515520525CysGlyLeuLysSerProThrArgCysValSerGluMetLeuValThr530535540LysArgArgGluLysArgGluValSerArgSerArgArgLysGlnHis545550555560LeuGlnProProCysLeuAspGluProGluLeuPhePheSerGluAsp565570575SerSerThrPheArgProAlaMetGluIleLeuAlaGluSerSerGlu580585590ProAlaProGlnLeuSerCysProGlnGluGluGlyGlyProPheLys595600605ThrProIleLysGluThrLeuProValSerSerThrProSerLysSer610615620ValLeuSerArgAspProGluSerTrpArgLeuThrProProAlaLys625630635640ValGlyGlyLeuAspPheSerProValArgThrProGlnGlyAlaPhe645650655GlyProLeuProAspSerLeuGlyLeuMetGluLeuAsnThrThrPro660665670LeuLysSerValProLeuPheAspSerProArgGluLeuLeuAsnSer675680685GluAlaPheAspLeuAlaSerAspProPheSerSerSerProProPro690695700HisLeuGluAlaLysProGlySerProGluLeuGlnValProSerLeu705710715720SerAlaAsnArgSerLeuThrGluGlyLeuValLeuAspThrMetAsn725730735AspSerLeuSerLysIleLeuLeuAspIleSerPheProGlyLeuGlu740745750GluAspProLeuGlyProAspAsnIleAsnTrpSerGlnPheIlePro755760765GluLeuArg770(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3342 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 70..2358(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:CGGCGGCGACTGCAGTCTGGAGGGTCCACACTTGTGATTCTCAATGGAGAGTGAAAACGC60AGATTCATAATGAAAGCTAGCCCCCGTCGGCCACTGATTCTCAAAAGACGGAGGCTGCCC120CTTCCTGTTCAAAATGCCCCAAGTGAAACATCAGAGGAGGAACCTAAGAGATCCCCTGCC180CAACAGGAGTCTAATCAAGCAGAGGCCTCCAAGGAAGTGGCGGAGTCCAACTCTTGCAAG240TTTCCAGCTGGGATCAAGATTATTAACCACCCCACCATGCCCAACACGCAAGTAGTGGCC300ATCCCCAACAATGCTAATATTCACAGCATCATCACAGCACTGACTGCCAAGGGAAAAGAG360AGTGGCAGTAGTGGGCCCAACAAATTCATCCTCATCAGCTGTGGGGGAGCCCCAACTCAG420CCTCCAGGACTCCGGCCTCAAACCCAAACCAGCTATGATGCCAAAAGGACAGAAGTGACC480CTGGAGACCTTGGGACCAAAACCTGCAGCTAGGGATGTGAATCTTCCTAGACCACCTGGA540GCCCTTTGCGAGCAGAAACGGGAGACCTGTGCAGATGGTGAGGCAGCAGGCTGCACTATC600AACAATAGCCTATCCAACATCCAGTGGCTTCGAAAGATGAGTTCTGATGGACTGGGCTCC660CGCAGCATCAAGCAAGAGATGGAGGAAAAGGAGAATTGTCACCTGGAGCAGCGACAGGTT720AAGGTTGAGGAGCCTTCGAGACCATCAGCGTCCTGGCAGAACTCTGTGTCTGAGCGGCCA780CCCTACTCTTACATGGCCATGATACAATTCGCCATCAACAGCACTGAGAGGAAGCGCATG840ACTTTGAAAGACATCTATACGTGGATTGAGGACCACTTTCCCTACTTTAAGCACATTGCC900AAGCCAGGCTGGAAGAACTCCATCCGCCACAACCTTTCCCTGCACGACATGTTTGTCCGG960GAGACGTCTGCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCCAGTGCCAACCGCTAC1020TTGACATTGGACCAGGTGTTTAAGCCACTGGACCCAGGGTCTCCACAATTGCCCGAGCAC1080TTGGAATCACAGCAGAAACGACCGAATCCAGAGCTCCGCCGGAACATGACCATCAAAACC1140GAACTCCCCCTGGGCGCACGGCGGAAGATGAAGCCACTGCTACCACGGGTCAGCTCATAC1200CTGGTACCTATCCAGTTCCCGGTGAACCAGTCACTGGTGTTGCAGCCCTCGGTGAAGGTG1260CCATTGCCCCTGGCGGCTTCCCTCATGAGCTCAGAGCTTGCCCGCCATAGCAAGCGAGTC1320CGCATTGCCCCCAAGGTGCTGCTAGCTGAGGAGGGGATAGCTCCTCTTTCTTCTGCAGGA1380CCAGGGAAAGAGGAGAAACTCCTGTTTGGAGAAGGGTTTTCTCCTTTGCTTCCAGTTCAG1440ACTATCAAGGAGGAAGAAATCCAGCCTGGGGAGGAAATGCCACACTTAGCGAGACCCATC1500AAAGTGGAGAGCCCTCCCTTGGAAGAGTGGCCCTCCCCGGCCCCATCTTTCAAAGAGGAA1560TCATCTCACTCCTGGGAGGATTCGTCCCAATCTCCCACCCCAAGACCCAAGAAGTCCTAC1620AGTGGGCTTAGGTCCCCAACCCGGTGTGTCTCGGAAATGCTTGTGATTCAACACAGGGAG1680AGGAGGGAGAGGAGCCGGTCTCGGAGGAAACAGCATCTACTGCCTCCCTGTGTGGATGAG1740CCGGAGCTGCTCTTCTCAGAGGGGCCCAGTACTTCCCGCTGGGCCGCAGAGCTCCCGTTC1800CCAGCAGACTCCTCTGACCCTGCCTCCCAGCTCAGCTACTCCCAGGAAGTGGGAGGACCT1860TTTAAGACACCCATTAAGGAAACGCTGCCCATCTCCTCCACCCCGAGCAAATCTGTCCTC1920CCCAGAACCCCTGAATCCTGGAGGCTCACGCCCCCAGCCAAAGTAGGGGGACTGGATTTC1980AGCCCAGTACAAACCTCCCAGGGTGCCTCTGACCCCTTGCCTGACCCCCTGGGGCTGATG2040GATCTCAGCACCACTCCCTTGCAAAGTGCTCCCCCCCTTGAATCACCGCAAAGGCTCCTC2100AGTTCAGAACCCTTAGACCTCATCTCCGTCCCCTTTGGCAACTCTTCTCCCTCAGATATA2160GACGTCCCCAAGCCAGGCTCCCCGGAGCCACAGGTTTCTGGCCTTGCAGCCAATCGTTCT2220CTGACAGAAGGCCTGGTCCTGGACACAATGAATGACAGCCTCAGCAAGATCCTGCTGGAC2280ATCAGCTTTCCTGGCCTGGACGAGGACCCACTGGGCCCTGACAACATCAACTGGTCCCAG2340TTTATTCCTGAGCTACAGTAGAGCCCTGCCCTTGCCCCTGTGCTCAAGCTGTCCACCATC2400CCGGGCACTCCAAGGCTCAGTGCACCCCAAGCCTCTGAGTGAGGACAGCAGGCAGGGACT2460GTTCTGCTCCTCATAGCTCCCTGCTGCCTGATTATGCAAAAGTAGCAGTCACACCCTAGC2520CACTGCTGGGACCTTGTGTTCCCCAAGAGTATCTGATTCCTCTGCTGTCCCTGCCAGGAG2580CTGAAGGGTGGGAACAACAAAGGCAATGGTGAAAAGAGATTAGGAACCCCCCAGCCTGTT2640TCCATTCTCTGCCCAGCAGTCTCTTACCTTCCCTGATCTTTGCAGGGTGGTCCGTGTAAA2700TAGTATAAATTCTCCAAATTATCCTCTAATTATAAATGTAAGCTTATTTCCTTAGATCAT2760TATCCAGAGACTGCCAGAAGGTGGGTAGGATGACCTGGGGTTTCAATTGACTTCTGTTCC2820TTGCTTTTAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTTCCAGGCTGAGGT2880ACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAGAGTC2940CTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAGTCAGCTTTCCTGCAAGAAGAAA3000TCCTGGTTAAAAAAGTCTTTTGTATTGGGTCAGGAGTTGAATTTGGGGTGGGAGGATGGA3060TGCAACTGAAGCAGAGTGTGGGTGCCCAGATGTGCGCTATTAGATGTTTCTCTGATAATG3120TCCCCAATCATACCAGGGAGACTGGCATTGACGAGAACTCAGGTGGAGGCTTGAGAAGGC3180CGAAAGGGCCCCTGACCTGCCTGGCTTCCTTAGCTTGCCCCTCAGCTTTGCAAAGAGCCA3240CCCTAGGCCCCAGCTGACCGCATGGGTGTGAGCCAGCTTGAGAACACTAACTACTCAATA3300AAAGCGAAGGTGGACCNAAAAAAAAAAAAAAAAAAACTCGAG3342(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 763 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 70..2358(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetLysAlaSerProArgArgProLeuIleLeuLysArgArgArgLeu151015ProLeuProValGlnAsnAlaProSerGluThrSerGluGluGluPro202530LysArgSerProAlaGlnGlnGluSerAsnGlnAlaGluAlaSerLys354045GluValAlaGluSerAsnSerCysLysPheProAlaGlyIleLysIle505560IleAsnHisProThrMetProAsnThrGlnValValAlaIleProAsn65707580AsnAlaAsnIleHisSerIleIleThrAlaLeuThrAlaLysGlyLys859095GluSerGlySerSerGlyProAsnLysPheIleLeuIleSerCysGly100105110GlyAlaProThrGlnProProGlyLeuArgProGlnThrGlnThrSer115120125TyrAspAlaLysArgThrGluValThrLeuGluThrLeuGlyProLys130135140ProAlaAlaArgAspValAsnLeuProArgProProGlyAlaLeuCys145150155160GluGlnLysArgGluThrCysAlaAspGlyGluAlaAlaGlyCysThr165170175IleAsnAsnSerLeuSerAsnIleGlnTrpLeuArgLysMetSerSer180185190AspGlyLeuGlySerArgSerIleLysGlnGluMetGluGluLysGlu195200205AsnCysHisLeuGluGlnArgGlnValLysValGluGluProSerArg210215220ProSerAlaSerTrpGlnAsnSerValSerGluArgProProTyrSer225230235240TyrMetAlaMetIleGlnPheAlaIleAsnSerThrGluArgLysArg245250255MetThrLeuLysAspIleTyrThrTrpIleGluAspHisPheProTyr260265270PheLysHisIleAlaLysProGlyTrpLysAsnSerIleArgHisAsn275280285LeuSerLeuHisAspMetPheValArgGluThrSerAlaAsnGlyLys290295300ValSerPheTrpThrIleHisProSerAlaAsnArgTyrLeuThrLeu305310315320AspGlnValPheLysProLeuAspProGlySerProGlnLeuProGlu325330335HisLeuGluSerGlnGlnLysArgProAsnProGluLeuArgArgAsn340345350MetThrIleLysThrGluLeuProLeuGlyAlaArgArgLysMetLys355360365ProLeuLeuProArgValSerSerTyrLeuValProIleGlnPhePro370375380ValAsnGlnSerLeuValLeuGlnProSerValLysValProLeuPro385390395400LeuAlaAlaSerLeuMetSerSerGluLeuAlaArgHisSerLysArg405410415ValArgIleAlaProLysValLeuLeuAlaGluGluGlyIleAlaPro420425430LeuSerSerAlaGlyProGlyLysGluGluLysLeuLeuPheGlyGlu435440445GlyPheSerProLeuLeuProValGlnThrIleLysGluGluGluIle450455460GlnProGlyGluGluMetProHisLeuAlaArgProIleLysValGlu465470475480SerProProLeuGluGluTrpProSerProAlaProSerPheLysGlu485490495GluSerSerHisSerTrpGluAspSerSerGlnSerProThrProArg500505510ProLysLysSerTyrSerGlyLeuArgSerProThrArgCysValSer515520525GluMetLeuValIleGlnHisArgGluArgArgGluArgSerArgSer530535540ArgArgLysGlnHisLeuLeuProProCysValAspGluProGluLeu545550555560LeuPheSerGluGlyProSerThrSerArgTrpAlaAlaGluLeuPro565570575PheProAlaAspSerSerAspProAlaSerGlnLeuSerTyrSerGln580585590GluValGlyGlyProPheLysThrProIleLysGluThrLeuProIle595600605SerSerThrProSerLysSerValLeuProArgThrProGluSerTrp610615620ArgLeuThrProProAlaLysValGlyGlyLeuAspPheSerProVal625630635640GlnThrSerGlnGlyAlaSerAspProLeuProAspProLeuGlyLeu645650655MetAspLeuSerThrThrProLeuGlnSerAlaProProLeuGluSer660665670ProGlnArgLeuLeuSerSerGluProLeuAspLeuIleSerValPro675680685PheGlyAsnSerSerProSerAspIleAspValProLysProGlySer690695700ProGluProGlnValSerGlyLeuAlaAlaAsnArgSerLeuThrGlu705710715720GlyLeuValLeuAspThrMetAsnAspSerLeuSerLysIleLeuLeu725730735AspIleSerPheProGlyLeuAspGluAspProLeuGlyProAspAsn740745750IleAsnTrpSerGlnPheIleProGluLeuGln755760__________________________________________________________________________

HNF3.delta. compositions

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Non-Patent Literature Citations (7)