Human dopamine receptor and its uses

Abstract

The present invention is directed toward the isolation, characterization and pharmacological use of the human D4 dopamine receptor. The nucleotide sequence of the gene corresponding to this receptor and alleleic variant thereof are provided by the invention. The invention also includes recombinant eukaryotic expression constructs capable of expressing the human D4 dopamine receptor in cultures of transformed eukaryotic cells. The invention provides cultures of transformed eukaryotic cells which synthesize the human D4 dopamine receptor, and methods for characterizing novel psychotropic compounds using such cultures.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The invention relates to dopamine receptors from mammalian species and the genes corresponding to such receptors. In particular, it relates to the human dopamine receptor D4. Specifically, the invention relates to the isolation, cloning and sequencing of the human D4 receptor gene. The invention also relates to the construction of eukaryotic expression vectors capable of expression of the human D4 dopamine receptor in cultures of transformed eukaryotic cells and the synthesis of the human D4 dopamine receptor in such cultures. The invention relates to the use of such cultures of transformed eukaryotic cells producing the human D4 dopamine receptor for the characterization of antipsychotic drugs.

2. Information Disclosure Statement

Dopamine is a neurotransmitter that participates in a variety of different functions mediated by the nervous system, including vision, movement, and behavior (see generally Cooper et al., 1978, The Biochemical Basis of Neuropharmacology, 3d ed., Oxford University Press, New York, pp, 161-195). The diverse physiological actions of dopamine are in turn mediated by its interaction with two of the basic types of G protein-coupled receptors, D1 and D2, which respectively stimulate and inhibit the enzyme adenylyl cyclase (Kebabian & Calne, 1979, Nature 277: 93-96). Alterations in the number or activity of these receptors may be a contributory factor in disease states such as Parkinson's disease (a movement disorder) and schizophrenia (a behavioral disorder).

A great deal of information has accumulated on the biochemistry of the D1 and D2 dopamine receptors, and methods have been developed to solubilize and purify these receptor proteins (see Senogles et al., 1986, Biochemistry 25: 749-753; Sengoles et al., 1988, J. Biol. Chem. 263: 18996-19002; Gingrich et al., 1988, Biochemistry 27: 3907-3912). The D1 dopamine receptor in several tissues appears to be a glycosylated membrane protein of about 72 kD (Amlaiky et al., 1987, Mol. Pharmacol. 31: 129-134; Ninik et al., 1988, Biochemistry 27: 7594-7599). The D2 receptor has been suggested to have a higher molecular weight of about 90-150 kD (Amlaiky & Caron, 1985, J. Biol. Chem. 260: 1983-1986; Amlaiky & Caron, 1986, J. Neurochem. 47: 196-204; Jarvie et al., 1988, Mol. Pharmacol. 34: 91-97). Much less is known about a recently discovered additional dopamine receptor, termed D3 (Sokoloff et al., 1990, Nature 347: 146-151).

Dopamine receptors are primary targets in the clinical treatment of psycho motor disorders such as Parkinson's disease and affective disorders such as schizophrenia (Seeman et al., 1987, Neuropsychopharm. 1: 5-15; Seeman, 1987, Synapse 1: 152-333). The three different dopamine receptors (D1, D2, D3) have been cloned as a result of nucleotide sequence homology which exists between these receptor genes (Bunzow et al., 1988, Nature 336: 783-787; Grandy et al., 1989, Proc. Nad. Acad. Sci. USA 86: 9762-9766; Dal Toso et al., 1989, EMBO J. 8: 4025-4034; Zhou et al., 1990, Nature 346: 76-80; Sunahara et al., 1990, Nature 346: 80-83; Sokoloff et al., 1990, Nature 347: 146-151).

The antipsychotic clozapine is useful for socially withdrawn and treatment-resistant schizophrenics (see Kane et al., 1990, Nature 347: 146-151), but unlike other antipsychotic drugs, clozapine does not cause tardive dyskinesia (see Casey, 1989, Psychopharmacology 99: 547-553). Clozapine, however, has dissociation constants for D2 and D3 which are 3 to 30-fold higher than the therapeutic free concentration of clozapine in plasma water (Ackenheil et al., 1976, Arzneim-Forsch 26: 1156-1158; Sandoz Canada, Inc., 1990, Clozaril: Summary of preclinical and clinical data). This suggests the existence of dopamine receptors more sensitive to the antipsychotic clozapine than those known in the prior art heretofore.

We have cloned and sequenced such a human dopamine receptor which we term D4. The dopamine D4 receptor gene has high homology to the human dopamine D2 and D3 receptor genes. The pharmacological profile of this receptor resembles that of the D2 and D3 receptors but it has an affinity for clozapine which is tenfold higher. The present inventors envision that the D4 dopamine receptor disclosed as this invention may prove useful in discovering new types of drugs for schizophrenia that like clozapine do not induce tardive dyskinesia and other motor side effects.

We have also discovered that the D4 gene is polymorphic in the human population, having at least 7 different alleles that can be detected by restriction fragment length polymorphism analysis (see, Botstein et al., 1980, Am. J. Hum. Genet. 32: 314-331). This is the first receptor in the catecholamine receptor family which displays polymorphic variations in the human population. The observed polymorphism in dopamine D4 receptor genes may underlie individual differences in susceptibility to neuropsychiatric disorders such as schizophrenia and manic depression, as well as responsiveness to antipsychotic medication.

DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrates the structure of a genomic clone comprising the human D4 dopamine receptor gene.

FIGS. 2A through 2D illustrates the nucleotide sequence SEQ ID No: 17 of genomic and cDNA clones of the human D4 dopamine receptor gene.

FIGS. 3A through 3F provides an amino acid sequence alignment of mammalian dopamine receptors

FIGS. 4A and 4B shows the binding of (.sup.3 H)spiperone to membranes of COS-7 cell transfected with a recombinant expression construct that expresses the human D4 receptor protein.

FIG. 5 demonstrates the pharmacological specificity of (.sup.3 H)spiperone binding to COS-7 cells transfected with a human D4 receptor expression construct.

FIGS. 6A-6C illustrates the structure of a genomic clone comprising the human D4 dopamine receptor gene and the nucleic acid and corresponding amino acid sequences of 2, 4 and 7 copies of a novel 48 bp tandem repeat.

FIG. 7 illustrates restriction fragment length polymorphic variants of the human D4 receptor gene in 9 individuals.

FIG. 8 demonstrates the transcriptional integrity of each of three cloned variant human D4 receptor gene expression constructs expressed in transfected COS-7 cells.

FIGS. 9A through 9C illustrate Scatchard analysis of each of three cloned variant human D4 dopamine receptor gene expression constructs expressed in transfected COS-7 cells.

FIGS. 9D through 9F illustrate (.sup.3 H)-spiperone competition binding experiments of each of three cloned variant human D4 dopamine receptor gene expression constructs expressed in transfected COS-7 cells.

SUMMARY OF THE INVENTION

The present invention is directed toward the isolation, characterization and pharmacological use of the human D4 dopamine receptor, the gene corresponding to this receptor, a recombinant eukaryotic expression construct capable of expressing the human D4 dopamine receptor in cultures of transformed eukaryotic cells and such cultures of transformed eukaryotic cells that synthesize the human D4 dopamine receptor.

It is an object of the invention to provide a nucleotide sequence encoding a mammalian dopamine receptor. Further, it is an object of the invention to provide a nucleotide sequence that encodes a mammalian dopamine receptor with novel and distinct pharmacological properties. It is specifically an object of the invention to provide a nucleotide sequence encoding a mammalian dopamine receptor having the particular drug dissociation properties of the human dopamine receptor D4. In particular, the mammalian dopamine receptor encoded by the nucleotide sequence of the present invention has a high affinity for the drug clozapine. The human D4 dopamine receptor embodied in the present invention shows a dissociation constant (termed K.sub.i) of 1-40 nanomolar (nM), preferably 1-20 nM, most preferably 11 nM clozapine, as detected by the (.sup.3 H)spiperone binding assay disclosed herein. The human D4 dopamine receptor embodied in the present invention displays the following pharmacological profile of inhibition of (.sup.3 H)spiperone binding in the (.sup.3 H)spiperone binding assay: spiperone>eticlopride>clozapine>(+)-butaclamol>raclopride>SCH23390. In a preferred embodiment of the invention, the nucleotide sequence encoding a dopamine receptor encodes the human dopamine receptor D4.

The present invention provides a nucleotide sequence encoding a mammalian dopamine receptor that is the human D4 receptor. In a preferred embodiment, this nucleotide sequence comprises a cDNA sequence isolated from RNA derived from the human neuroblastoma cell line SK-N-MC (SEQ ID No: 17), comprising the sequences of the D4.2 allele of the human D4 dopamine receptor gene. In another preferred embodiment, this nucleotide sequence comprises a cDNA sequence isolated from RNA derived from human pituitary gland tissue (SEQ ID No: 19). In yet another preferred embodiment, this nucleotide sequence comprises a cDNA sequence isolated from RNA derived from human substantia nigra tissue (SEQ ID No.: 19). Both of these embodiments comprise the sequences of the D4.4 allele of the human D4 dopamine receptor gene.

The invention also includes a nucleotide sequence derived from human genomic DNA (SEQ ID Nos.: 1,3,4,5,7,12,14 & 15) comprising the sequences of the D4.7 allele of the human D4 dopamine receptor gene, and a nucleotide sequence derived from human genomic DNA (SEQ ID Nos.: 1,3,4,5,7,10,14 & 15) comprising the sequences of the D4.4 allele of the human D4 dopamine receptor gene. In this embodiment of the invention, the nucleotide sequence includes 5 kilobases (kb) of human genomic DNA encoding the dopamine receptor D4. This embodiment includes the sequences present in the cDNA embodiments as well as nucleotide sequences of 5' untranslated sequence, three intervening sequences that interrupt the coding sequence of the human D4 dopamine receptor gene, and 3' untranslated sequences. Also provided is a cDNA sequence derived from the genomic DNA sequence of the D4.4. allele (SEQ ID No: 19) and the D4.7 allele (SEQ ID No: 21) of the human D4 dopamine receptor gene.

The invention includes a nucleotide sequence of a human D4 receptor molecule, and includes allelic variations of this nucleotide sequence and the corresponding D4 receptor molecule, either naturally occurring or the product of in vitro chemical or genetic modification, having essentially the same nucleotide sequence as the nucleotide sequence of the human D4 receptor disclosed herein, wherein the resulting human D4 receptor molecule has substantially the same drug dissociation properties of the human D4 receptor molecule corresponding to the nucleotide sequence described herein. Specific preferred embodiments include alleles D4.2, D4.4 and D4.7 of the human D4 dopamine receptor gene, as defined herein.

The invention provides sequences of the naturally-occurring alleles of the human D4 dopamine receptor gene. Such alleles are defined as comprising from about 2 to about 8 repeats of a nucleotide sequence that is substantially homologous to the sequence (SEQ ID Nos: 8,10,12,17,19,21): A CCC GCG CCC CGC CTC CCC CAG GAC CCC TGC GGC CCC GAC TGT GCG CC (SEQ ID No.: 23).

Allelic variations of this nucleotide sequence and the corresponding D4 receptor molecule, either naturally occurring or the product of in vitro chemical or genetic modification, having essentially the same nucleotide sequence as the nucleotide sequence of the human D4 receptor disclosed herein, wherein the resulting human D4 receptor molecule has substantially the same drug dissociation properties of the human D4 receptor molecule corresponding to the nucleotide sequence described herein are additional preferred embodiments of the invention. Specific preferred embodiments include the allele D4.2, comprising 2 copies of the repeat tandemly repeated (SEQ ID Nos: 8 & 17); the allele D4.4, comprising 4 copies of the repeat tandemly repeated (SEQ ID Nos: 10 & 19); and the allele D4.7, comprising 7 copies of the repeat tandemly repeated (SEQ ID Nos: 12 & 21).

The invention also includes a predicted amino acid sequence for the human D4 dopamine receptor deduced from the nucleotide sequence comprising the complete coding sequence of the D4 dopamine receptor gene (SEQ ID Nos: 18, 20 & 22). Specific preferred embodiments comprise the amino acid sequence of the naturally-occurring alleles of the human D4 dopamine receptor gene. Such alleles are defined as comprising from about 2 to about 8 repeats of an amino acid sequence that is substantially homologous to the sequence (SEQ ID Nos: 9,11,13,18,20,22):

(Pro/Ala)-Ala-Pro-(Arg/Gly)-Leu-Pro-(Pro/Arg/Gln)-(Asp/Gly)-Pro-Cys-Gly-(Pro/Ser)-(Asp/Asn)-Cys-Ala-Pro (SEQ ID No.: 24)

Allelic variations of this amino acid and the corresponding D4 receptor molecule, either naturally occurring or the product of in vitro chemical or genetic modification, having essentially the same amino acid sequence as the human D4 receptor disclosed herein, wherein the human D4 receptor molecule has substantially the same drug dissociation properties of the human D4 receptor molecule corresponding to the amino acid sequence described herein are additional preferred embodiments of the invention. Specific preferred embodiments include the allele D4.2, comprising 2 copies of the repeat tandemly repeated (SEQ ID Nos: 9 & 18); the allele D4.4, comprising 4 copies of the repeat tandemly repeated (SEQ ID Nos: 11 & 20); and the allele D4.7, comprising 7 copies of the repeat tandemly repeated (SEQ ID Nos: 13 & 22).

This invention provides both nucleotide and amino acid probes derived from these sequences. The invention includes probes isolated from either cDNA or genomic DNA clones, as well as probes made synthetically with the sequence information derived therefrom. The invention specifically includes but is not limited to oligonucleotide, nick-translated, random primed, or in vitro amplified probes made using cDNA or genomic clones embodying the invention, and oligonucleotide and other synthetic probes synthesized chemically using the nucleotide sequence information of cDNA or genomic clone embodiments of the invention. The sequence information provided by the present invention is also intended to provide the basis for in vitro amplification methods for detecting D4 dopamine receptor alleles comprising the genotype of somatic and germ cells, zygotes, embryoes, and tissues in humans and other mammals for diagnostic, therapeutic and other purposes.

It is a further object of this invention to provide sequences of the human D4 dopamine receptor for use as probes to determine the pattern, amount and extent of expression of this receptor in various tissues of mammals, including humans. It is also an object of the present invention to provide probes derived from the sequences of the human D4 dopamine receptor to be used for the detection and diagnosis of genetic diseases. It is an object of this invention to provide probes derived from the sequences of the human D4 dopamine receptor to be used for the detection of novel related receptor genes.

The present invention also includes synthetic peptides made using the nucleotide sequence information comprising the cDNA or genomic clone embodiments of the invention. The invention includes either naturally occurring or synthetic peptides which may be used as antigens for the production of D4 dopamine receptor-specific antibodies, or used for competitors of the D4 receptor molecule for drug binding, or to be used for the production of inhibitors (or blockers) of the binding of dopamine or dopamine analogs of the D4 dopamine receptor molecule. As used herein, the term "inhibitor of dopamine binding" is intended to encompass biochemical agonists and/or antagonists of dopamine binding to the D4 dopamine receptor.

In addition, this invention includes recombinant DNA constructs comprising the human D4 dopamine receptor and sequences that mediate the replication and selected growth of microorganisms that carry this construct.

The present invention provides recombinant expression constructs comprising the nucleotide sequence of the human D4 dopamine receptor and sequences sufficient to direct the synthesis of the human D4 dopamine receptor protein in cultures of transformed eukaryotic cells. In preferred embodiments, the recombinant expression construct is comprised of plasmid sequences derived from the plasmid pCD-PS and D4 dopamine receptor sequences corresponding to cDNA sequences for alleles D4.2, D4.4 and D4.7, as defined herein, as well as a hybrid human D4 dopamine gene, comprised of the entirety of the genomic sequences from a particular D4 dopamine genomic clone described herein, up to a PstI site located in exon III, followed by the remainder of the coding and 3' untranslated sequences found in a particular human cDNA sequence derived from a human neuroblastoma cell line. Recombinant expression constructs of the invention also encompass embodiments comprising allelic variations of the human D4 dopamine receptor genomic DNA sequences and cDNA-derived sequences. This invention includes recombinant expression constructs comprising essentially the nucleotide sequences of genomic and cDNA clones of the human D4 dopamine receptor and allelic variations thereof in embodiments that provide for the expression of human D4 dopamine receptor protein in cultures of transformed eukaryotic cells.

It is also an object of this invention to provide cultures of transformed eukayotic cells that have been transformed with such recombinant expression constructs and that synthesize human D4 dopamine receptor protein. In a preferred embodiment, the invention provides monkey COS cells that synthesize human D4 dopamine receptor protein.

The present invention also includes protein preparations of the human D4 dopamine receptor, and preparations of membranes containing the human D4 dopamine receptor, derived from cultures of eukaryotic cells transformed with the recombinant expression constructs of the invention. In a preferred embodiment, cell membranes containing human D4 dopamine receptor protein are isolated from culture of COS-7 cells transformed with a recombinant expression construct that directs the synthesis of human D4 dopamine receptor.

It also an object of this invention to provide the human D4 dopamine receptor for use in the in vitro screening of novel antipsychotic compounds. In a preferred embodiment, membrane preparations containing the human D4 dopamine receptor, derived from cultures of eukaryotic cells transformed with the recombinant expression constructs of the invention, are used to determine the drug dissociation properties of antipsychotic compounds in vitro. These properties are then used to characterize novel antipsychotic compounds by comparison to the binding properties of known antipsychotic compounds.

The present invention will also be useful for the detection of dopamine and dopamine analogues, known or unknown, either naturally occurring or as the embodiments of antipsychotic or other drugs.

It is an object of the present invention to provide a method for the quantitative detection of dopamine and dopamine analogues, either naturally occurring or as the embodiments of antipsychotic or other drugs. It is an additional object of the invention to provide a method to detect dopamine or dopamine analogues in blood, saliva, semen, cerebrospinal fluid, plasma, lymph, or any other bodily fluid.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The term "D4 dopamine receptor" as used herein refers to proteins substantially homologous to, and having substantially the same biological activity as, the protein coded for by the nucleotide sequences depicted in FIGS. 2A through 2D and FIGS. 6A through 6C (i.e., proteins which display high affinity binding to clozapine) (SEQ ID Nos: 1,3,4,5,7,8,10,12,14 & 15). This definition is intended to encompass natural allelic variations in the D4 dopamine receptor sequence, specifically including the alleles D4.2, D4.4 and D4.7, as defined herein (SEQ ID Nos.: 17,19 & 21), and all references to the D4 dopamine receptor, and nucleotide and amino acid sequences thereof are intended to encompass such allelic variations, both naturally-occurring and man-made. Cloned genes of the present invention may code for D4 dopamine receptors of any species of origin, including, mouse, rat, rabbit, cat, and human, but preferably code for receptors of mammalian, most preferably human, origin.

The production of proteins such as the D4 dopamine receptor from cloned genes by genetic engineering is well known (see, e.g., U.S. Pat. No. 4,761,371 to Bell et al. at Col. 6 line 3 to Col. 9 line 65; the disclosure of all U.S. patent references cited herein is to be incorporated herein by reference). The discussion which follows is accordingly intended as an overview of this field, and is not intended to reflect the full state of the art.

DNA which encodes the D4 dopamine receptor may be obtained, in view of the instant disclosure, by chemical synthesis, by screening reverse transcripts of mRNA from appropriate tissues, cells or cell line cultures, by screening genomic libraries from appropriate cells, or by combinations of these procedures, as illustrated below. Screening of mRNA or genomic DNA may be carried out with oligonucleotide probes generated from the D4 dopamine receptor gene sequence information provided herein. Probes may be labeled with a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group in accordance with known procedures and used in conventional hybridization assays, as described in greater detail in the Examples below. In the alternative, D4 dopamine receptor gene sequences may be obtained by use of the polymerase chain reaction (PCR) procedure, with the PCR oligonucleotide primers being produced from the D4-dopamine receptor gene sequence provided herein (see U.S. Pat. No. 4,683,195 to Mullis et al. and U.S. Pat. No. 4,683,202 to Mullis).

The D4 dopamine receptor may be synthesized in host cells transformed with constructs containing DNA encoding the D4 dopamine receptor. Such constructs are replicable and are used herein either to amplify DNA encoding the D4 dopamine receptor and/or to express DNA which encodes the D4 dopamine receptor. An expression construct is a replicable DNA construct in which a DNA sequence encoding the D4 receptor is operably linked to suitable control sequences capable of effecting the expression of the D4 receptor in a suitable host. The need for such control sequences will vary depending upon the host selected and the transfection method chosen. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation. When used for DNA amplification such constructs do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selective marker gene to facilitate recognition of transformants.

Constructs useful for practicing the present invention include plasmids, viruses (including phage), retroviruses, and integratable DNA fragments (i.e., fragments integratable into the host genome by homologous recombination). The construct may replicate and function independently of the host genome, or may, in some instances, integrate into the host genome itself. Suitable constructs will contain replicon and control sequences which are derived from species compatible with the intended expression host. Transformed host cells are cells which have been transformed, transfected or infected with the D4 receptor-containing constructs assembled using recombinant DNA techniques. Transformed host cells ordinarily express the D4 receptor, but host cells transformed for purposes of cloning or amplifying the D4 receptor DNA need not express the D4 receptor. When expressed, the D4 receptor will typically be located in the host cell membrane.

DNA regions are operably linked when they are functionally related to each other. For example: a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of leaders sequences, contiguous and in the same translational reading frame.

Cultures of cells derived from multicellular organisms are a desirable host for recombinant D4 dopamine receptor synthesis. In principal, any higher eukaryotic cell culture can be used, whether from vertebrate or invertebrate culture. However, mammalian cells are preferred, as illustrated in the Examples. Propagation of such cells in cell culture has become a routine procedure (see Tissue Culture, Academic Press: New York (Kruse & Patterson, eds.) 1973). Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI138, BHK, COS-7, CV, and MDCK cell lines. Expression constructs for such cells ordinarily include (if necessary) an origin of replication, a promoter located upstream from the gene to be expressed, along with a ribosome binding site, RNA splice site (if intron-containing genomic DNA is used), a polyadenylation site, and a transcriptional termination sequence.

The transcriptional and translational control sequences in expression constructs to be used in transforming vertebrate cells are often provided by viral sources. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and Simian Virus 40 (SV40; see, e.g., U.S. Pat. No. 4,599,308). The early and late promoters of SV40 are useful because both are obtained easily from the virus within a fragment which also contains the SV40 viral origin of replication (see Fiers et al., 1978, Nature 273: 113). Further, the human genomic D4 receptor promoter, control and/or signal sequences, may also be used, provided such control sequences are compatible with the host cell chosen.

An origin of replication may be provided either within the construct itself, such as may be derived from SV40 or other viral source (e.g., Polyoma, Adenovirus, VSV, or MPV), or may be provided by the host cell chromosomal replication mechanism. If the construct is integrated into the host cell chromosome, the latter may be sufficient.

D4 dopamine receptors made from cloned genes in accordance with the present invention may be used for screening compounds for D4 dopamine receptor activity, or for determining the amount of a dopaminergic drug in a solution (e.g., blood plasma or serum). For example, host cells may be transformed with a construct of the present invention, D4 dopamine receptors expressed in that host, the cells lysed, and the membranes from those cells used to screen compounds for D4 dopamine receptor binding activity. Competitive binding assays in which such procedures may be carried out are well known, as illustrated by the Examples below. By selection of host cells which do not ordinarily express a dopamine receptor, pure preparations of membranes containing D4 receptors can be obtained. Further, D4 dopamine receptor agonist and antagonists can be identified by transforming host cells with constructs of the present invention. Membranes obtained from such cells can be used in binding studies wherein the drug dissociation constants are measured. Such cells must contain D4 protein in the plasma and other cell membranes. Procedures for carrying out assays such as these are also described in greater detail in the Examples which follow.

Cloned genes and constructs of the present invention are useful to transform cells which do not ordinarily express the D4 dopamine receptor to thereafter express this receptor. Such cells are useful as intermediates for maldng cell membrane preparations for receptor binding assays, which are in turn useful for drug screening. Further, genes and constructs of the present invention are useful in gene therapy. For such purposes, retroviral constructs as described in U.S. Pat. No. 4,650,764 to Temin and Watanabe or U.S. Pat. No. 4,861,719 to Miller may be employed. Cloned genes of the present invention, or fragments thereof, may also be used in gene therapy carried out homologous recombination or site-directed mutagenesis (See generally Thomas & Capecchi, 1987, Cell 51: 503-512; Bertling, 1987, Bioscience Reports 7: 107112; Smithies et al., 1985, Nature 317: 230-234).

Cloned genes of the present invention, and oligonucleotides derived therefrom, are useful for screening for restriction fragment length polymorphism (RFLP) associated with genetic polymorphisms within a population. Such RFLPs may also be associated with certain genetic disorders, and the probes provided by the invention can be used for their identification and the identification of individuals susceptible to neuropsychiatric disorders such as schizophrenia and manic depression. Such RFLPs may also be useful for predicting individual responsiveness to psychotropic and antipsychotic drugs.

Oligonucleotides of the present invention are useful as diagnostic tools for probing D4 receptor gene expression in nervous tissue. For example, tissue can be probed in situ with oligonucleotide probes carrying detectable label groups by conventional autoradiography techniques, as explained in greater detail in the Examples below, to investigate native expression of this receptor or pathological conditions relating thereto. Further, chromosomes can be probed to investigate the location of the D4 dopamine receptor gene, and potential pathological conditions related thereto, as also illustrated by the Examples below.

Oligonucleotides of the present invention are also useful for in vitro amplification of D4 dopamine receptor sequences. Amplification methods include but are not intended to be limited to the polymerase chain reaction and the ligase chain reaction. Amplification of D4 dopamine receptor sequences is useful as a diagnostic tools for analyzing and quantitating D4 receptor gene expression in tissue, for example nervous tissue. Additionally, the use of oligonucleotides synthesized or isolated according to methods well known in the art that comprise D4 dopamine receptor sequences provided by the invention permit in vitro amplification methods to be used for the detection of D4 dopamine receptor alleles comprising the genotype of somatic and germ cells, zygotes, embryoes, and tissues in humans and other mammals for diagnostic, therapeutic and other purposes.

The Examples which follow are illustrative of specific embodiments of the invention, and various uses thereof. They are set forth for explanatory purposes only, and are not to be taken as limiting the invention.

EXAMPLE 1

Screening Tissue and Cell Line RNA for Dopamine Receptor Expression

RNA was prepared from different rat tissues or cell lines using the guadinium thiocyanate/CsCl procedure described in Bunzow et al., 1988, Nature 336: 783-787. Tissues tested included heart, epididymis, testis, gut, pancreas, spleen, thymus, muscle, ventricle, atria, lung, adrenal, kidney, liver, pineal gland and pituitary. Cell lines screened included SK-N-MC, SK-N-SH, COS, AKR1, Ltk, GH4C1, NG108-15, AtT20, 3T3, BSC40, C6, CV-1, Hela, IMR-32, N4TG1, NCB-20, PC-12, Rin m5f and WERI-Rb-1. 20 .mu.g of RNA was analyzed by Northern blot hybridization with a radiolabeled BstYI-BglII DNA fragment of the rat D2 receptor, which encodes the putative transmembrane domains VI and VII. Blots were hybridized under standard conditions as described in Bunzow et al., ibid.; hybridization was performed overnight at 37.degree. C. Blots were then washed at 55.degree. C. in 2.times. standard saline-citrate (SSC) and 1% sodium dodecyl sulfate (SDS). Washed blotes were exposeed to X-ray film for two days at -70.degree. C. using an intensifying screen. For comparison, the same blot was hybridized under high stringency conditions (the modifications of which include using 50% formamide and 42.degree. C. for the hybridication and 0.2.times. SSC for the wash). Under conditions of low stringency the SK-N-MC cell line showed a positive signal in these experiments.

EXAMPLE 2

Construction of a cDNA Phage Library using Neuroblastoma RNA

Double-stranded cDNA was synthesized using standard techniques (see Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press: New York) from poly(A).sup.+ mRNA isolated from the human neuroblastoma cell line SK-N-MC as described in Example 1. The cDNA was directionally cloned into the EcoRI and XhoI restriction endonuclease sites of the phage cloning vector lambda ZAPII (Stratagene, La Jolla, Calif.). The library was transferred to colony plaque screen filters (New England Nuclear, Boston, Mass.). Approximately 500,000 independent clones were screened under low-stringency hybridzation conditions as described in Example 1. Hybridization was performed for 30 hrs with .sup.32 P-labeled 1.6 kb BamHI-BglII and 300 bp BstYI-BglII fragments of a rat D2 receptor clone at a specific activity of 10.sup.6 dpm/.mu.g. Filters were washed at 55.degree. C. in 2.times. SSC and 1% SDS. The clone D210S was isolated and sequenced using the Sanger dideoxy chain termination method catalyzed by Sequenase (U.S. Biochemical Corporation, Cleveland, Ohio). The sequence of this clone is shown in FIGS. 2A through 2D (hatched area).

The putative coding sequence is shown in capitals (unsequenced intervening sequence noted by dots) and the deduced amino acid sequence is shown below the nucleotide sequence. Numbering of the putative coding sequence begins with the first methionine of the open reading frame. Single-letter abbreviations for amino acids and nucleotides used herein can be found in G. Zubay, Biochemistry (2d. ed.), 1988 (MacMillen Publishing: New York) p.33. Noteworthy is the presence of a duplicated 48 bp sequence in the putative third exon, corresponding to the third cytoplesmic loop region of the D4 receptor protein. The complete nucleotide sequence of this clone has been determined (see FIGS. 6A through 6C wherein these repeated sequences of this clone are designated D4.2 (SEQ ID No: 17)).

EXAMPLE 3

Screening a Genomic DNA Phage Library with a Human Dopamine Receptor Probe

Clone D210S was .sup.32 P-labeled by random primed synthesis and used to screen a commercially available human genomic library cloned in the phage vector EMBL3 (Clonetech, Palo Alto, Calif.). Hybridization was performed as described in Example 2 using 50% formamide. After hybridization the filters were washed at 65.degree. C. in 0.1.times. SSC and 0.1% SDS. The clone D210G was isolated and analyzed by restriction endonuclease and Southern blot analysis. The map of this genomic clone is shown in FIG. 1, wherein the structure of the D4 receptor gene is compared with the structure of the D2 gene. Relevant restriction endonuclease sites in the D4 receptor sequence are indicated. The SalI site is part of the cloning site in EMBL3. The proposed coding regions are boxed and numbered in Roman numerals. Perfect matches of proposed intron/exon junction sites are indicated by connecting stippled bars between the receptor clones.

PstI--PstI fragments of approximately 1.3 kb and 2.6 kb, and an overlapping SalI--ECoRI fragment of approximately 2.0 kb derived from the D4 receptor gene were subcloned into the plasmid pBluescript-SK (Stratagene). The subcloned fragments were characterized by sequence analysis as described above. This sequence is shown in FIGS. 2A through 2D. The complete nucleotide sequence of this clone has been determined (see FIG. 6, wherein these repeated sequences of this clone are designated D4.7 (SEQ ID No: 21)).

EXAMPLE 4

DNA Sequence Analysis of the Human D4 Dopamine Receptor

One of the cDNA clones detected by screening the SK-N-MC neuroblastoma library with a rat D2 probe at low stringency (D210S) contained a 780 bp EcoRI-XhoI insert which hybridized to the rat probe. Screening of a human genomic EMBL3 library (Clontech) under high stringency conditions with the clone D210S resulted in the isolation of the genomic clone D210G.

Southern blot and sequence analysis indicated that the clone contained a 5 kb SalI-PstI fragment which coded for the entire gene of D210S (SEQ ID No.: 21). Sequence analysis of this insert showed the presence of an open reading frame with homology to the amino acid sequence of transmembrane domains V (45%), VI (46%) and VII (78%) of the D2 receptor, shown in FIG. 3. The putative amino acid sequence of the human D4 receptor (SEQ ID No.: 22) is aligned with the human and rat D2, rat D3 and human and rat D1 receptor sequences. Amino acids conserved within the group of dopamine receptors are shaded. The putative transmembrane domains are overlined and labeled by Roman numerals.

There is a potential translation initiation codon (ATG) 590 bp downstream from the SalI site, followed by an open reading frame that showed amino acid sequence homology with transmembrane domain I (36%) and II (63%) of the D2 receptor. Almost immediately downstream from the transmembrane domain II sequence, homology to the D2 receptor disappears, indicating the presence of an intron in the genomic DNA. This intron spanned approximately 2 kb, after which sequence homology to the D2 receptor was re-established. Translation of the putative gene product showed homology to the transmembrane domains III (68%), IV (37%), V (46%) and VII (78%) of the D2 receptor (see FIGS. 3A through 3F).

Potential splice junction donor and acceptor sites (Mount, 1982, Nucl. Acids Res. 10: 461-472) were found in the transmembrane domains II, III and VI, as shown in FIG. 1. These splice sites were at an identical position as in the D2 and D3 receptor gene �see Grandy et al., 1989, Proc. Natl. Acad. Sci. USA 86: 9762-9766; Dal Toso et al., 1989, EMBO J. 8: 4025-4034; Sokoloff et al., 1990, Nature 347: 146-151! and FIG. 1. The coding sequence downstream from transmembrane domain IV is identical to the sequence of clone D210S but is interrupted by an intron of about 300 bp between transmembrane domains V and VI and an additional intron of 92 bp in transmembrane VI (FIG. 1, hatched area). The precise location of the splice site for the intron between transmembrane V and VI cannot be determined due to the fact that a sequence of 52 bp present in the coding sequence is repeated exactly on either side of the intron (FIGS. 2A through 2D).

The deduced amino acid sequence from the genomic and cDNA nucleotide sequences indicated that this gene codes for a protein of 387 amino acids with an apparent molecular weight of 41 kD. A hydrophobicity plot of the protein sequence suggests the existence of seven transmembrane domains. These regions correlate with the observed homologous regions in the human D2 receptor and other receptors belonging to the family of G-protein coupled receptors (Dohlman et al., 1987, Biochemistry 26: 2657-2664; Bunzow et al., 1988, Nature 336: 783-787; Sokoloff et al., 1990, Nature 347: 146-151; and FIGS. 2A through 2D). A potential N-linked glycosylation site (Hubbard & Ivatt, 1981, Ann. Rev. Biochem. 50: 555-583) is located two amino acids downstream from the initiation methionine. The amino acid residues Asp (80) and Asp (115) in the D4 receptor, which are conserved within the family catecholaminergic receptors, are postulated to act as "counterions" in catecholamine binding (Strader et al., 1988, J. Biol. Chem. 263: 10267-10271). Also conserved within the family of catecholaminergic receptors are Ser (197) and Ser (700) which have been suggested to interact with the catechol hydroxyl groups (Kozak, 1984, Nucleic Acids Res. 12: 857-872). Several consensus sites for potential phosphorylation by protein kinase C and protein kinase A are found in the third cytoplasmic loop (Sibley et al., 1987, Cell 48: 913-922; Bouvier et al., 1988, Nature 333: 370-373). The Cys (187), which may serve as a substrate for palmitoylation, is conserved in most of the G-protein coupled receptors (O'Dowd et al., 1989, J. Biol. Chem 264: 7564-7569). The short carboxyl tail, which terminates similar to the D2 and D3 receptor at Cys (387) (Bunzow et al., 1988, Nature 336: 783-787; Grandy et al., 1989, Proc. Natl. Acad. Sci. USA 86: 9762-9766; Dal Toso et al., 1989, EMBO J. 8: 4025-4034; Sokoloff et al., 1990, Nature 347: 146-151), and the relatively large third cytoplasmic loop, are features observed in most receptors which interact with an isoform of the G protein.

A noteworthy feature of the sequence of the third exon of the genomic D4 receptor clone is the presence of a 7-fold repeat of a GC rich, 48 bp sequence, beginning at nucleotide 447 of exon III, and encodes a proline-rich portion of the D4 dopamine receptor protein (see FIGS. 6A through 6C, wherein these sequences of this clone are designated D4.7 (SEQ ID No.:21)). This region of the protein corresponds to the putative third cytoplasmic loop of the receptor protein molecule (SEQ ID No.: 22). This sequence corresponds to the 2-fold repeat of a homologous sequence found in the SK-N-MC neuroblastoma cDNA sequence described in Example 2, suggesting that the D4 receptor gene may be polymorphic. This sequence is uniquely found in the D4 receptor and is not homologous to any other known dopamine receptor protein. Interestingly, this region of the human D4 receptor is not found in the rat homologue of the D4 receptor, making this variation specific to humans.

From these results we have concluded that the sequences we have isolated encode a polymorphic member of the dopamine receptor family.

EXAMPLE 5

Construction of an Mammalian DNA Expression Construct using Dopamine Receptor cDNA

The ApaI-PstI gene fragment (FIG. 1, the PstI site found in exon III after transmembrane domain V) was ligated to the corresponding PstI-EcoRI cDNA fragment isolated from the SK-N-MC cDNA. This construct was then cloned into the vector pCD-PS (Bonner et al., 1988, Neuron 1: 403-410). This vector allows for the expression of the human D4 receptor gene fom the SV40 promoter. Large quantities of the pCD-PS-D4 construct plasmid were prepared using standard techniques (see, Sambrook et al., ibid.). This plasmid was transfected into COS-7 cells by the calcium phosphate precipitation technique (Gorman et al., 1983, Science 221: 551-553). Two days later membranes cells were harvested and analyzed as described in Example 6.

EXAMPLE 6

Analysis of Dopamine and Dopamine-Antagonist Binding of D4 Dopamine Receptor

Cells were harvested and homogenized using a teflon pestle in 50 mM Tris-HCl (pH 7.4 at 4.degree. C.) buffer containing 5 mM EDTA, 1.5 mM CaCl.sub.2, 5 mM MgCl.sub.2, 5 mM KCl and 120 mM NaCl. Homogenates were centrifuged for 15 minutes at 39,000 g, and the resulting pellets resuspended in buffer at a concentration of 150-250 .mu.g/ml. For saturation experiments, 0.25 ml aliquots of each tissue homogenate was incubated in duplicate with increasing concentrations of (.sup.3 H)spiperone (70.3 Ci/mmol; 10-3000 pM final concentration) for 120 min at 22.degree. C. in a total volume of 1 ml. The results of these experiments are shown in FIGS. 4A and 4B. The results shown are representative of two independent experiments each conducted in duplicate (the inset show a Scatcherd plot of the same data). Estimated B.sub.max (approximately 260 fmol/mg protein) and K.sub.i (70 pM) values were obtained by LIGAND computer program.

Representative curves are shown in FIG. 5 for the concentration dependent inhibition of (.sup.3 H)spiperone binding by various dopaminergic agonist and antagonists. Estimated K.sub.i values are listed in Table I along with the K.sub.i values obtained on the human D2 receptor expressed in GH(4)ZR(7) cells. For competition binding experiments, assays were initiated by the addition of 0.25 ml of membrane preparation and incubated in duplicate with the concentrations of competing ligands indicated in FIG. 5 (10.sup.-14 to 10.sup.-3 M) and (.sup.3 H)spiperone (150-300 pM) for 120 min at 22.degree. C. Assays were terminated by rapid filtration through a Titertek cell harvester and filters subsequently monitored to quantitate radioactive tritium. For all experiments, specific (.sup.3 H)spiperone binding was defined as that binding inhibited by 10 .mu.M (+)sulpiride. Both saturation and competition binding data were analyzed by the non-linear least square curve-fitting program LIGAND run on a Digital Micro-PDP-11. The human D4 dopamine receptor displays the following pharmacological profile of inhibition of (.sup.3 H)spiperone binding in this assay: spiperone>eticlopride>clozapine>(+)-butaclamol>raclopride>SCH23390.

TABLE I______________________________________Dopamine Receptor Drug Dissociation Constants______________________________________ D.sub.2 K.sub.i D.sub.2 K.sub.i D.sub.4 K.sub.i D.sub.4 K.sub.i______________________________________Dopamine AntagonistsButaclamol-(+) 0.9 H 36 0.03Chlorpromazine 2.8 R 23 0.12Chlorpromazine 1.5 H 23 0.07Clozapine .about.130 T 11 11.8Clozapine 56 R 11 5.1Clozapine 158 H 11 15.3Eticlopride 0.09 T 0.52 0.17Fluphenazine 0.5 T 42 0.01Haloperidol 0.5 R 4.5 0.11Haloperidol 0.8 R 4.5 0.18Haloperidol 1 H 4.5 0.22Ketanserin 192 T 147 1.31Octoclothepin-S 1.5 T 0.8 1.58Octoclothepin-R 13.5 T 1.9 7.11Pimozide 2.4 R 25 0.1Raclopride 1.8 R 253 0.01Raclopride 1.6 H 253 0.01*Raclopride 3.2 H 253 0.01Remoxipride .about.300 T 2730 0.11SCH 23390 913 H 1960 0.47Spiperone 0.069 R 0.06 1.15Spiperone 0.053 H 0.06 0.88*Spiperone 0.05 H 0.06 0.83*Spiperone 0.09 H 0.06 1.5Sulpiride-S 9.2 R 63 0.02Sulpiride-S 4.8 R 63 0.08Sulpiride-S 46 H 63 0.73______________________________________ D.sub.2 K.sub.i______________________________________Sulpiride-S 15.9 H 63 0.25Thioproperazine 0.21 R 53 0.004Thioridazine 3.3 H 12 0.28Trifluoperazine 1.2 T 2.2 0.55YM-09151-2 0.06 T 0.11 0.55*YM-09151-2 0.09 H 0.11 0.82Dopamine AgonistsADTN-(.+-.) 1.7 T 33.7Apomorphine .about.2 T 3.3Apomorphine 24 RBromocriptine 5.3 R 128Bromocriptine 14 HDopamine 7.5 T 18.6Dopamine 2.8 RDopamine 474 RDopamine + Guanine nucleotide 1705 R 49Ergocriptine-S 0.4 T 55Fencidopam 2.8 T 420N-0437 0.7 T 93(-) Noradrenaline .about.6,000 T .about.6,000NPA 0.4 T 5.5PHNO-(+) 1.2 T 42Quinpirole(.+-.) 576 RQuinpirole(-) 4.8 T 17Serotonin .about.10,000 T .about.8,000SKF-38393 157 T 1600SKF-38393 9560 R______________________________________ where R = rat D2 (long); H = human D2 (long) and T = K.sub.i in pig anterior pituitary homogenates

EXAMPLE 7

Polymorphic Allelic Variants of the D4 Dopamine Receptor Isolated from Human Tissue cDNA Libraries

Human cDNA libraries were screened for expression of polymorphic variants of the human D4 receptor gene. A human substantia nigra cDNA library construced in lambda gt11 (Clontech) and a pituitary cDNA library constructed in lambda gt10 as described in Example 2 were screened for clones encoding the D4 receptor. Approximately 0.5-1.times.10.sup.6 plaque-forming units (p.f.u.) were transferred in duplicate to nylon filters (DuPont/NEN) and probed with a .sup.32 P-labeled 700 bp EcoRI-XhoI fragment encoding the cDNA isolated from the neuroepithelioma SK-N-MC under conditions as described in Example 2 above.

Screening of cDNA libraries from human pituitary and substantia nigra resulted in the isolation of variant CDNA clones of the D4 receptor. The pituitary lambda gt10 clone contained a 1.4-kb EcoRI insert, coding for intron 1 and the down-stream sequences of the D4 receptor. This pituitary D4 receptor clone also contained the second intron, but the last intron was spliced out. The isolated substantia nigra lambda gt11 clone contained a 600-bp EcoRI insert, coding for the D4 receptor, starting in the 5' site of the putative third cytoplasmic loop. Both these clones contained a four-fold repeat (see FIGS. 6A through 6C, wherein these sequences of these clones are designated D4.4 (SEQ ID No.: 19)) of the 48-bp sequence previously found as a 7-fold repeat in the D4 genomic clone D210G (Example 4) and a 2-fold repeat in the neuroblastoma SK-N-MC cDNA clone (Example 2) within the putative third cytoplasmic loop of the D4 receptor protein (compare, SEQ ID Nos.: 18, 20 & 22). A comparison of the nucleic acid sequences revealed that, due to the absence of conventional splice junction sites in the seven-fold repeat sequence of the genomic clone, a novel splicing mechanism would be required to account for the existence of the different cDNA clones.

Two different human genomic libraries from different human individuals (Clontech) were screened to detect allelic polymorphism in the human D4 receptor gene. Screening of genomic libraries resulted in the isolation of a genomic clone with a 4-fold repeat of the 48 bp sequence previously detected in pituitary and substantia nigra cDNA. This result indicated that the polymorphic cDNA molecules resulted from genetic polymorphic variation in the corresponding genomic DNA, due to the existence of polymorphic alleles in the human population for the D4 receptor.

EXAMPLE 8

Additional D4 Receptor Gene Allelic Variants Found by RFLP Analysis of Human Genomic DNA

The three different D4 receptor sequences predict a restriction fragment length polymorphism for a HincII-PstI fragment of the D4 gene (FIGS. 6A through 6C). Southern blot analysis of human genomic DNA was performed as described (see Sambrook et al., ibid. and Example 3). A RFLP was observed in humans and the different allelic fragments were sized.

Briefly, high molecular weight genomic DNA was isolated from human blood samples using proteinase K and phenol/chloroform extractions. Genomic DNA (5 .mu.g) was digested with the restriction endonucleases HincII and PstI and size separated by agarose (1%) gel electrophoresis. DNA was transferred to nylon membranes (Zeta-probe, Biorad) according to standard techniques (Sambrook et al., ibid.). Southern blots were probed with a .sup.32 P-labeled 600 bp EcoRI-HincII fragment, coding for the D4 cDNA isolated from the neuroepithelioma SK-N-MC, and washed at high stringency (65.degree. C., 0.1.times.SSC, 0.1% SDS, 40 min). The blot was exposed to X-ray film for three days. Results of these experiments are shown in FIG. 7.

The position of a 540-bp size marker is indicated on the left. D4-hybridizing polymorphic bands can be seen at approximately 520 bp, 620 bp, 710 bp, 760 bp and 800 bp. �It will be recognized to those with skill in this art that the sizes given herein for the alleles of the human D4 dopamine receptor gene are limited in their precision to the resolving power of the agarose gels used in the analyses. The sizes are approximate as given herein, and more exact sizes can be calculated from the sequences of the different alleles found in SEQ ID Nos: 17, 19 & 21.! The 520 bp, 620 bp and 760 bp fragments correlate closely with the sizes of the HincII-PstI fragments of the cloned D4 receptor variants with the two-, four- and seven-fold repeat sequences respectively. The presence of 710 bp and 800 bp fragments suggests that variants with six-fold and eight-fold repeat sequences also exist. Additional polulation screening experiments have resulted in the detection of alleles corresponding to three-fold and five-fold repeats. A total of 7 alleles of the D4 receptor gene have accordingly been found in the human population.

EXAMPLE 9

Expression of Allelic Variants of the D4 Receptor

Mammalian DNA expression constructs were made as described in Example 5 for expression of the allelic variants of the D4 receptor. Various cDNA constructs were cloned into the expression vector pCD-PS (see Example 5) which contains the SV40 origin of replication and drives expression of the cloned inserts from the SV40 late promotor. A 1.7-kb KpnI-XbaI fragment comprising a cDNA for the D4 receptor gene containing the 7-fold repeat was cloned into the pCD-PS vector of Example 5 and called hereafter pCD-D4.7. Full-length CDNA clones for the D4.2 and D4.4 forms of the receptor were made by in vitro recombination between partial cDNA clones of these forms with the full-length cDNA clone of the D4.7 receptor variant. The clone pCD-D4.4 was created by substituting the 920-bp PstI-EcoRI 3' fragment of pCD-D4.7 with the 730-bp PstI-EcoRI fragment of the D4 cDNA isolated from human pituitary. In a similar fashion the clone pCD-D4.2 was constructed by exchange of this 3' PstI-EcoRI fragment of pCD-D4.7 with a 630-bp PstI-EcoRI fragment of the D4.2 cDNA clone isolated from the neuroepithelioma SK-N-MC.

Transient expression in COS-7 cells was achieved as follows. Cells harvested and washed in phosphate buffered saline (PBS). 5.times.10.sup.7 cells were resuspended in 1 ml PBS with 100 .mu.g/ml plasmid DNA (purified by caesium chloride gradient centrifugation) and incubated for 10 min on ice. Next, 400 .mu.l aliquots of the cell suspension were subjected to an electric field of 0.65 kV/cm, 4.1 ms pulse duration using a BTX 600 Electro Cell Manipulator (Biotechnologies & Experimental Research, Inc., San Diego, Calif.). After the electric pulse, the cells were incubated for another 10 min on ice and then seeded in Modified Eagle's Medium supplemented with 10% fetal calf serum. The next day the medium was renewed. Three days after electroporation the cells were harvested and stored at -80.degree. C. until use in receptor binding studies as described herein

Expression of each of the cloned variant D4 receptor constructs was demonstrated by Northern blot analysis as described in Example 1. Blots were hybridized with the 700 bp EcoRI-XhoI fragment of the D4 cDNA isolated from the neuroepithelioma SK-N-MC (Example 2). The results of these experiments are shown in FIG. 8. Transient expression of the three forms in COS-7 cells as characterized in these experiments demonstrated the expected size and size differences between the three forms, indicating that none of the expressed D4 receptor RNAs are further processed or produced from one another by RNA splicing events. Furthermore, the two bands observed for the D4.2 and D4.4 clones represent the consequence of the use of either the endogenous D4 receptor polyadenylation signal or the SV40 (vector-derived) polyadenylation signal). These observations indicate that in the transient expression system the expression of the three different clones would result in the formation of three structurally different receptors.

EXAMPLE 10

Analysis of Dopamine and Dopamine-Antagonist Binding of Variant D4 Dopamine Receptors

Pharmacological analysis of dopamine agonist and antagonist binding was performed as described in Example 6. The results of these experiments are shown in FIGS. 9A through 9F. FIGS. 9A-9C illustrate Scatchard analysis of the saturation isotherms for (.sup.3 H)spiperone binding to membranes prepared from COS-7 cells transiently transfected with pCD-D4.2 (D4.2), pCD-D4.4 (D4.4) and pCD-D4.7 (D4.7). FIGS. 9D through 9F show clozapine competition of (.sup.3 H)spiperone binding for the three allelic forms of the D4 receptor in the presence (+Na.sup.+) and absence (-Na.sup.+) of sodium chloride.

Pharmacological analysis demonstrated that all three variants displayed saturable (.sup.3 H)spiperone binding (300-1000 fmol mg.sup.-1) with similar dissociation constants in the absence of sodium chloride (K.sub.d =40-50 pM; FIG. 4A). However, in the presence of 120 mM sodium chloride, the dissociation constants increased approximately two- to three-fold for D4.2 and D4.4 but not for D4.7.

Clozapine competition of (.sup.3 H)spiperone binding revealed that D4.2 and D4.4 had lower dissociation constants for clozapine in the absence of sodium chloride (K.sub.i =3 nM without sodiumn chloride; K.sub.i =23 nM with sodium chloride). D4.7 had a dissociation constant of approximately 15 nM for clozapine which did not exhibit sodium chloride sensitivity (K.sub.i =12 nM without sodium chloride; K.sub.i =18 nM with sodium chloride; shown in FIG. 4B). This sodium chloride-mediated effect for clozapine on the D4 variants was not modulated by guanine nucleotides.

Agonists and antagonists (dopamine, bromocriptine, raclopride and clozapine) inhibited (.sup.3 H)spiperone binding (in the presence of sodium chloride) to these different D4 receptor variants in a concentration-dependent manner with similar dissociations constants. Furthermore, all three variants exhibited a guanine nucleotide-sensitive high-affinity form of the receptor upon competition with dopamine, suggesting that all these variants can functionally couple to G-proteins. Thus, we have defined a novel, polymorphic dopamine receptor which we term D4.

It should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 24(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 388 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: 5'UTR(B) LOCATION: 1..103(ix) FEATURE:(A) NAME/KEY: exon(B) LOCATION: 104..388(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 104..388(x) PUBLICATION INFORMATION:(A) AUTHORS: Van Tol, Hubert H.M.Wu, Caren M.Guan, Hong- ChangOhara, KoichiBunzow, James R.Civelli, OlivierKennedy, JamesSeeman, PhillipNiznik, Hyman B.Jovanovic, Vera(B) TITLE: Multiple dopamine D4 receptor variants in thehuman population(C) JOURNAL: Nature(D) VOLUME: 358(F) PAGES: 149-152(G) DATE: 9 JULY-1992(x) PUBLICATION INFORMATION:(A) AUTHORS: Van Tol, Hubert H.M.Bunzow, James R.Guan, Hong- ChangSunahara, Roger K.Seeman, PhillipNiznik, Hyman B.Civelli, Olivier(B) TITLE: Cloning of the gene for a human dopamine D4receptor with high affinity for the antipsychoticclozapine(C) JOURNAL: Nature(D) VOLUME: 350(F) PAGES: 610-614(G) DATE: 18 April-1991(K) RELEVANT RESIDUES IN SEQ ID NO:1: FROM 1 TO 388(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:CGGGGGCGGGACCAGGGTCCGGCCGGGGCGTGCCCCCGGGGAGGGACTCCCCGGCTTGCC60CCCCGGCGTTGTCCGCGGTGCTCAGCGCCCGCCCGGGCGCGCCATGGGGAACCGC115MetGlyAsnArgAGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCGGGCCGCG163SerThrAlaAspAlaAspGlyLeuLeuAlaGlyArgGlyArgAlaAla5101520GGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCG211GlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGlyGlnGlyAlaAla253035GCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAAC259AlaLeuValGlyGlyValLeuLeuIleGlyAlaValLeuAlaGlyAsn404550TCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCC307SerLeuValCysValSerValAlaThrGluArgAlaLeuGlnThrPro556065ACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCT355ThrAsnSerPheIleValSerLeuAlaAlaAlaAspLeuLeuLeuAla707580CTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAG388LeuLeuValLeuProLeuPheValTyrSerGlu859095(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 95 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetGlyAsnArgSerThrAlaAspAlaAspGlyLeuLeuAlaGlyArg151015GlyArgAlaAlaGlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGly202530GlnGlyAlaAlaAlaLeuValGlyGlyValLeuLeuIleGlyAlaVal354045LeuAlaGlyAsnSerLeuValCysValSerValAlaThrGluArgAla505560LeuGlnThrProThrAsnSerPheIleValSerLeuAlaAlaAlaAsp65707580LeuLeuLeuAlaLeuLeuValLeuProLeuPheValTyrSerGlu859095(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: intron(B) LOCATION: 1..20(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /partial/cons.sub.-- splice= (5'site: YES, 3'site: NO)/evidence= EXPERIMENTAL/label= IntronI/note= "This is the 5'sequence of an intronestimated to be 2.0 kilobases in length"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GTGAGCCGCGTCCGGCCGCA20(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: intron(B) LOCATION: 1..20(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /partial/cons.sub.-- splice= (5'site: NO, 3'site: YES)/evidence= EXPERIMENTAL/label= IntronI/note= "This is the 3'sequence of a intronestimated to be 2.0 kilobases in length."(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:CCTGTGGTGTCGCCGCGCAG20(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 113 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: exon(B) LOCATION: 1..113(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..113(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GTCCAGGGTGGCGCGTGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTC48ValGlnGlyGlyAlaTrpLeuLeuSerProArgLeuCysAspAlaLeu151015ATGGCCATGGACGTCATGCTGTGCACCGCCTCCATCTTCAACCTGTGC96MetAlaMetAspValMetLeuCysThrAlaSerIlePheAsnLeuCys202530GCCATCAGCGTGGACAG113AlaIleSerValAsp35(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 37 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:ValGlnGlyGlyAlaTrpLeuLeuSerProArgLeuCysAspAlaLeu151015MetAlaMetAspValMetLeuCysThrAlaSerIlePheAsnLeuCys202530AlaIleSerValAsp35(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 102 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: intron(B) LOCATION: 1..102(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /evidence=EXPERIMENTAL/label= IntronII(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:GTGCGCCGCCCTCCCCGCCCGCGCCCCGGCGCCCCCGCGCCCCGCCCGCCGCCCTCACCG60CGGCCTGTGCGCTGTCCGGCGCCCCCTCGGCGCTCCCCGCAG102(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 563 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: exon(B) LOCATION: 1..563(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /evidence=EXPERIMENTAL/standard.sub.-- name= "Alternate Exon 3: D4.2"/note= "This sequence represent the sequence ofthe third exon of allele D4.2 of the human D4dopamine receptor gene"(ix) FEATURE:(A) NAME/KEY: misc.sub.-- feature(B) LOCATION: 257..262(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /function="Polymorphic PstI site"/evidence= EXPERIMENTAL/label= PstI/note= "This feature is the site of one of therestriction enzymes whereby digestion of genomicDNA produces a RFLP "(ix) FEATURE:(A) NAME/KEY: repeat.sub.-- region(B) LOCATION: 346..442(D) OTHER INFORMATION: /rpt.sub.-- type="tandem"/rpt.sub.-- unit= 348 .. 396/note= "This sequence represents one of 7 knownalleles of human D4 dopamine receptor geneencoding a 16 amino acid sequence repeated twice(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 2..563(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:GTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGG46PheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGly151015AGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCG94SerArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAla202530GCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGC142AlaValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArg354045GACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCG190AspProAlaValCysArgLeuGluAspArgAspTyrValValTyrSer505560TCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTGTAC238SerValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyr657075TGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCC286TrpAlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAla80859095AAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCT334LysLeuHisGlyArgAlaProArgArgProSerGlyProGlyProPro100105110TCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCC382SerProThrProProAlaProArgLeuProGlnAspProCysGlyPro115120125GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCC430AspCysAlaProProAlaProGlyLeuProProAspProCysGlySer130135140AACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAG478AsnCysAlaProProAspAlaValArgAlaAlaAlaLeuProProGln145150155ACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGG526ThrProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArg160165170175GAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCG563GluArgLysAlaMetArgValLeuProValValVal180185(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 187 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:PheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGlySer151015ArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAlaAla202530ValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArgAsp354045ProAlaValCysArgLeuGluAspArgAspTyrValValTyrSerSer505560ValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyrTrp65707580AlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAlaLys859095LeuHisGlyArgAlaProArgArgProSerGlyProGlyProProSer100105110ProThrProProAlaProArgLeuProGlnAspProCysGlyProAsp115120125CysAlaProProAlaProGlyLeuProProAspProCysGlySerAsn130135140CysAlaProProAspAlaValArgAlaAlaAlaLeuProProGlnThr145150155160ProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArgGlu165170175ArgLysAlaMetArgValLeuProValValVal180185(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 659 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: exon(B) LOCATION: 1..659(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /evidence=EXPERIMENTAL/standard.sub.-- name= "Alternate Exon 3: D4.4"/note= "This sequence represents the third exon ofallele D4.4 of the human D4 dopamine receptorgene"(ix) FEATURE:(A) NAME/KEY: misc.sub.-- feature(B) LOCATION: 257..262(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /function="PstI site"/evidence= EXPERIMENTAL/standard.sub.-- name= "PstI site"/label= PstI/note= "This sequence represents a polymorphicPstI site whereby digestion of human genomic DNAproduces a RFLP "(ix) FEATURE:(A) NAME/KEY: repeat.sub.-- region(B) LOCATION: 346..538(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /rpt.sub.-- type="tandem"/evidence= EXPERIMENTAL/rpt.sub.-- unit= 348 .. 396/note= "This repeat is present in 7 known allelesof the human D4 dopamine receptor gene and encodesa 16 amino acid sequence repeated 4 times in the(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 2..659(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:GTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGG46PheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGly151015AGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCG94SerArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAla202530GCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGC142AlaValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArg354045GACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCG190AspProAlaValCysArgLeuGluAspArgAspTyrValValTyrSer505560TCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTGTAC238SerValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyr657075TGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCC286TrpAlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAla80859095AAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCT334LysLeuHisGlyArgAlaProArgArgProSerGlyProGlyProPro100105110TCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCC382SerProThrProProAlaProArgLeuProGlnAspProCysGlyPro115120125GACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCC430AspCysAlaProProAlaProGlyLeuProArgGlyProCysGlyPro130135140GACTGTGCGCCCGCCGCGCCCAGCCTCCCCCAGGACCCCTGCGGCCCC478AspCysAlaProAlaAlaProSerLeuProGlnAspProCysGlyPro145150155GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCC526AspCysAlaProProAlaProGlyLeuProProAspProCysGlySer160165170175AACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAG574AsnCysAlaProProAspAlaValArgAlaAlaAlaLeuProProGln180185190ACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGG622ThrProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArg195200205GAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCG659GluArgLysAlaMetArgValLeuProValValVal210215(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 219 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:PheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGlySer151015ArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAlaAla202530ValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArgAsp354045ProAlaValCysArgLeuGluAspArgAspTyrValValTyrSerSer505560ValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyrTrp65707580AlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAlaLys859095LeuHisGlyArgAlaProArgArgProSerGlyProGlyProProSer100105110ProThrProProAlaProArgLeuProGlnAspProCysGlyProAsp115120125CysAlaProProAlaProGlyLeuProArgGlyProCysGlyProAsp130135140CysAlaProAlaAlaProSerLeuProGlnAspProCysGlyProAsp145150155160CysAlaProProAlaProGlyLeuProProAspProCysGlySerAsn165170175CysAlaProProAspAlaValArgAlaAlaAlaLeuProProGlnThr180185190ProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArgGlu195200205ArgLysAlaMetArgValLeuProValValVal210215(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 803 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: exon(B) LOCATION: 1..803(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /evidence=EXPERIMENTAL/standard.sub.-- name= "Alternate Exon 3: D4.7"/note= "This sequence represents the third exon ofallele D4.7 of the human D4 dopamine receptorgene"(ix) FEATURE:(A) NAME/KEY: misc.sub.-- feature(B) LOCATION: 257..262(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /function="PstI site"/evidence= EXPERIMENTAL/standard.sub.-- name= "PstI site"/label= PstI/note= "This sequence is a PstI site wherebydigestion of human genomic DNA produces a RFLP"(ix) FEATURE:(A) NAME/KEY: repeat.sub.-- region(B) LOCATION: 346..682(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /rpt.sub.-- type="tandem"/evidence= EXPERIMENTAL/rpt.sub.-- unit= 346 .. 394/note= "This sequence is a repeat found in 7 knownalleles of the human D4 dopamine receptor geneencoding a 16 amino acid sequence repeated 7 times(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 2..803(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:GTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGG46PheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGly151015AGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCG94SerArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAla202530GCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGC142AlaValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArg354045GACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCG190AspProAlaValCysArgLeuGluAspArgAspTyrValValTyrSer505560TCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTGTAC238SerValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyr657075TGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCC286TrpAlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAla80859095AAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCT334LysLeuHisGlyArgAlaProArgArgProSerGlyProGlyProPro100105110TCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCC382SerProThrProProAlaProArgLeuProGlnAspProCysGlyPro115120125GACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCC430AspCysAlaProProAlaProGlyLeuProArgGlyProCysGlyPro130135140GACTGTGCGCCCGCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCCCC478AspCysAlaProAlaAlaProGlyLeuProProAspProCysGlyPro145150155GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCAGGACCCCTGCGGCCCC526AspCysAlaProProAlaProGlyLeuProGlnAspProCysGlyPro160165170175GACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCC574AspCysAlaProProAlaProGlyLeuProArgGlyProCysGlyPro180185190GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCAGGACCCCTGCGGCCCC622AspCysAlaProProAlaProGlyLeuProGlnAspProCysGlyPro195200205GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCC670AspCysAlaProProAlaProGlyLeuProProAspProCysGlySer210215220AACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAG718AsnCysAlaProProAspAlaValArgAlaAlaAlaLeuProProGln225230235ACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGG766ThrProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArg240245250255GAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCG803GluArgLysAlaMetArgValLeuProValValVal260265(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 267 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:PheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGlySer151015ArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAlaAla202530ValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArgAsp354045ProAlaValCysArgLeuGluAspArgAspTyrValValTyrSerSer505560ValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyrTrp65707580AlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAlaLys859095LeuHisGlyArgAlaProArgArgProSerGlyProGlyProProSer100105110ProThrProProAlaProArgLeuProGlnAspProCysGlyProAsp115120125CysAlaProProAlaProGlyLeuProArgGlyProCysGlyProAsp130135140CysAlaProAlaAlaProGlyLeuProProAspProCysGlyProAsp145150155160CysAlaProProAlaProGlyLeuProGlnAspProCysGlyProAsp165170175CysAlaProProAlaProGlyLeuProArgGlyProCysGlyProAsp180185190CysAlaProProAlaProGlyLeuProGlnAspProCysGlyProAsp195200205CysAlaProProAlaProGlyLeuProProAspProCysGlySerAsn210215220CysAlaProProAspAlaValArgAlaAlaAlaLeuProProGlnThr225230235240ProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArgGlu245250255ArgLysAlaMetArgValLeuProValValVal260265(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 94 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: intron(B) LOCATION: 1..94(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:GTGGGTTCCTGTCCTGAGGGGCGGGGAGGAGAGGAGGGGGGGAGTACGAGGCCGGCTGGG60CGGGGGGCGCTAACGCGGCTCTCGGCGCCCCCAG94(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 328 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(ix) FEATURE:(A) NAME/KEY: exon(B) LOCATION: 1..328(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 3..203(ix) FEATURE:(A) NAME/KEY: 3'UTR(B) LOCATION: 204..328(ix) FEATURE:(A) NAME/KEY: polyA.sub.-- site(B) LOCATION: 304(ix) FEATURE:(A) NAME/KEY: misc.sub.-- feature(B) LOCATION: 36..41(C) IDENTIFICATION METHOD: experimental(D) OTHER INFORMATION: /function="HinCII site"/evidence= EXPERIMENTAL/standard.sub.-- name= "HinCII site"/label= HinCII/note= "This sequence is a HinCII site wherebydigestion of genomic DNA produces a RFLP"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:GGGCCTTCCTGCTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACG47AlaPheLeuLeuCysTrpThrProPhePheValValHisIleThr151015CAGGCGCTGTGTCCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCC95GlnAlaLeuCysProAlaCysSerValProProArgLeuValSerAla202530GTCACCTGGCTGGGCTACGTCAACAGCGCCCTCACCCCCGTCATCTAC143ValThrTrpLeuGlyTyrValAsnSerAlaLeuThrProValIleTyr354045ACTGTCTTCAACGCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGT191ThrValPheAsnAlaGluPheArgAsnValPheArgLysAlaLeuArg505560GCCTGCTGCTGAGCCGGGCACCCCCGGACGCCCCCCGGCCTGATGGCCA240AlaCysCys65GGCCTCAGGGACCAAGGAGATGGGGAGGGCGCTTTTGTACGTTAATTAAACAAATTCCTT300CCCAAACTCAGCTGTGAAGGCTCCTGGG328(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 66 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:AlaPheLeuLeuCysTrpThrProPhePheValValHisIleThrGln151015AlaLeuCysProAlaCysSerValProProArgLeuValSerAlaVal202530ThrTrpLeuGlyTyrValAsnSerAlaLeuThrProValIleTyrThr354045ValPheAsnAlaGluPheArgAsnValPheArgLysAlaLeuArgAla505560CysCys65(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1370 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: 5'UTR(B) LOCATION: 1..103(ix) FEATURE:(A) NAME/KEY: 3'UTR(B) LOCATION: 1268..1370(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 104..1267(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:CGGGGGCGGGACCAGGGTCCGGCCGGGGCGTGCCCCCGGGGAGGGACTCCCCGGCTTGCC60CCCCGGCGTTGTCCGCGGTGCTCAGCGCCCGCCCGGGCGCGCCATGGGGAACCGC115MetGlyAsnArg1AGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCGGGCCGCG163SerThrAlaAspAlaAspGlyLeuLeuAlaGlyArgGlyArgAlaAla5101520GGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCG211GlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGlyGlnGlyAlaAla253035GCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAAC259AlaLeuValGlyGlyValLeuLeuIleGlyAlaValLeuAlaGlyAsn404550TCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCC307SerLeuValCysValSerValAlaThrGluArgAlaLeuGlnThrPro556065ACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCT355ThrAsnSerPheIleValSerLeuAlaAlaAlaAspLeuLeuLeuAla707580CTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAGGTCCAGGGTGGCGCG403LeuLeuValLeuProLeuPheValTyrSerGluValGlnGlyGlyAla859095100TGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTCATGGCCATGGACGTC451TrpLeuLeuSerProArgLeuCysAspAlaLeuMetAlaMetAspVal105110115ATGCTGTGCACCGCCTCCATCTTCAACCTGTGCGCCATCAGCGTGGAC499MetLeuCysThrAlaSerIlePheAsnLeuCysAlaIleSerValAsp120125130AGGTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGG547ArgPheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGly135140145AGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCG595SerArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAla150155160GCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGC643AlaValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArg165170175180GACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCG691AspProAlaValCysArgLeuGluAspArgAspTyrValValTyrSer185190195TCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTGTAC739SerValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyr200205210TGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCC787TrpAlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAla215220225AAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCT835LysLeuHisGlyArgAlaProArgArgProSerGlyProGlyProPro230235240TCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCC883SerProThrProProAlaProArgLeuProGlnAspProCysGlyPro245250255260GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCC931AspCysAlaProProAlaProGlyLeuProProAspProCysGlySer265270275AACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAG979AsnCysAlaProProAspAlaValArgAlaAlaAlaLeuProProGln280285290ACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGG1027ThrProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArg295300305GAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCCTG1075GluArgLysAlaMetArgValLeuProValValValGlyAlaPheLeu310315320CTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACGCAGGCGCTGTGT1123LeuCysTrpThrProPhePheValValHisIleThrGlnAlaLeuCys325330335340CCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCCGTCACCTGGCTG1171ProAlaCysSerValProProArgLeuValSerAlaValThrTrpLeu345350355GGCTACGTCAACAGCGCCCTCACCCCCGTCATCTACACTGTCTTCAAC1219GlyTyrValAsnSerAlaLeuThrProValIleTyrThrValPheAsn360365370GCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGTGCCTGCAlaGluPheArgAsnValPheArgLysAlaLeuArgAlaCys375380385TGCTGAGCCGGGC1274CysACCCCCGGACGCCCCCCGGCCTGATGGCCAGGCCTCAGGGACCAAGGAGATGGGGAGGGC1334GCTTTTGTACGTTAATTAAACAAATTCCTTCCCAAA1370(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 387 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:MetGlyAsnArgSerThrAlaAspAlaAspGlyLeuLeuAlaGlyArg151015GlyArgAlaAlaGlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGly202530GlnGlyAlaAlaAlaLeuValGlyGlyValLeuLeuIleGlyAlaVal354045LeuAlaGlyAsnSerLeuValCysValSerValAlaThrGluArgAla505560LeuGlnThrProThrAsnSerPheIleValSerLeuAlaAlaAlaAsp65707580LeuLeuLeuAlaLeuLeuValLeuProLeuPheValTyrSerGluVal859095GlnGlyGlyAlaTrpLeuLeuSerProArgLeuCysAspAlaLeuMet100105110AlaMetAspValMetLeuCysThrAlaSerIlePheAsnLeuCysAla115120125IleSerValAspArgPheValAlaValAlaValProLeuArgTyrAsn130135140ArgGlnGlyGlySerArgArgGlnLeuLeuLeuIleGlyAlaThrTrp145150155160LeuLeuSerAlaAlaValAlaAlaProValLeuCysGlyLeuAsnAsp165170175ValArgGlyArgAspProAlaValCysArgLeuGluAspArgAspTyr180185190ValValTyrSerSerValCysSerPhePheLeuProCysProLeuMet195200205LeuLeuLeuTyrTrpAlaThrPheArgGlyLeuGlnArgTrpGluVal210215220AlaArgArgAlaLysLeuHisGlyArgAlaProArgArgProSerGly225230235240ProGlyProProSerProThrProProAlaProArgLeuProGlnAsp245250255ProCysGlyProAspCysAlaProProAlaProGlyLeuProProAsp260265270ProCysGlySerAsnCysAlaProProAspAlaValArgAlaAlaAla275280285LeuProProGlnThrProProGlnThrArgArgArgArgArgAlaLys290295300IleThrGlyArgGluArgLysAlaMetArgValLeuProValValVal305310315320GlyAlaPheLeuLeuCysTrpThrProPhePheValValHisIleThr325330335GlnAlaLeuCysProAlaCysSerValProProArgLeuValSerAla340345350ValThrTrpLeuGlyTyrValAsnSerAlaLeuThrProValIleTyr355360365ThrValPheAsnAlaGluPheArgAsnValPheArgLysAlaLeuArg370375380AlaCysCys385(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1466 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: 5'UTR(B) LOCATION: 1..103(ix) FEATURE:(A) NAME/KEY: 3'UTR(B) LOCATION: 1364..1466(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 104..1363(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:CGGGGGCGGGACCAGGGTCCGGCCGGGGCGTGCCCCCGGGGAGGGACTCCCCGGCTTGCC60CCCCGGCGTTGTCCGCGGTGCTCAGCGCCCGCCCGGGCGCGCCATGGGGAACCGC115MetGlyAsnArg1AGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCGGGCCGCG163SerThrAlaAspAlaAspGlyLeuLeuAlaGlyArgGlyArgAlaAla5101520GGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCG211GlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGlyGlnGlyAlaAla253035GCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAAC259AlaLeuValGlyGlyValLeuLeuIleGlyAlaValLeuAlaGlyAsn404550TCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCC307SerLeuValCysValSerValAlaThrGluArgAlaLeuGlnThrPro556065ACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCT355ThrAsnSerPheIleValSerLeuAlaAlaAlaAspLeuLeuLeuAla707580CTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAGGTCCAGGGTGGCGCG403LeuLeuValLeuProLeuPheValTyrSerGluValGlnGlyGlyAla859095100TGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTCATGGCCATGGACGTC451TrpLeuLeuSerProArgLeuCysAspAlaLeuMetAlaMetAspVal105110115ATGCTGTGCACCGCCTCCATCTTCAACCTGTGCGCCATCAGCGTGGAC499MetLeuCysThrAlaSerIlePheAsnLeuCysAlaIleSerValAsp120125130AGGTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGG547ArgPheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGly135140145AGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCG595SerArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAla150155160GCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGC643AlaValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArg165170175180GACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCG691AspProAlaValCysArgLeuGluAspArgAspTyrValValTyrSer185190195TCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTGTAC739SerValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyr200205210TGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCC787TrpAlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAla215220225AAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCT835LysLeuHisGlyArgAlaProArgArgProSerGlyProGlyProPro230235240TCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCC883SerProThrProProAlaProArgLeuProGlnAspProCysGlyPro245250255260GACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCC931AspCysAlaProProAlaProGlyLeuProArgGlyProCysGlyPro265270275GACTGTGCGCCCGCCGCGCCCAGCCTCCCCCAGGACCCCTGCGGCCCC979AspCysAlaProAlaAlaProSerLeuProGlnAspProCysGlyPro280285290GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCC1027AspCysAlaProProAlaProGlyLeuProProAspProCysGlySer295300305AACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAG1075AsnCysAlaProProAspAlaValArgAlaAlaAlaLeuProProGln310315320ACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGG1123ThrProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArg325330335340GAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCCTG1171GluArgLysAlaMetArgValLeuProValValValGlyAlaPheLeu345350355CTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACGCAGGCGCTGTGT1219LeuCysTrpThrProPhePheValValHisIleThrGlnAlaLeuCys360365370CCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCCGTCACCTGGCTG1267ProAlaCysSerValProProArgLeuValSerAlaValThrTrpLeu375380385GGCTACGTCAACAGCGCCCTCACCCCCGTCATCTACACTGTCTTCAAC1315GlyTyrValAsnSerAlaLeuThrProValIleTyrThrValPheAsn390395400GCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGTGCCTGCTGCAlaGluPheArgAsnValPheArgLysAlaLeuArgAlaCys405410415TGCTGAGCCGGGC1370Cys420ACCCCCGGACGCCCCCCGGCCTGATGGCCAGGCCTCAGGGACCAAGGAGATGGGGAGGGC1430GCTTTTGTACGTTAATTAAACAAATTCCTTCCCAAA1466(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 419 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:MetGlyAsnArgSerThrAlaAspAlaAspGlyLeuLeuAlaGlyArg151015GlyArgAlaAlaGlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGly202530GlnGlyAlaAlaAlaLeuValGlyGlyValLeuLeuIleGlyAlaVal354045LeuAlaGlyAsnSerLeuValCysValSerValAlaThrGluArgAla505560LeuGlnThrProThrAsnSerPheIleValSerLeuAlaAlaAlaAsp65707580LeuLeuLeuAlaLeuLeuValLeuProLeuPheValTyrSerGluVal859095GlnGlyGlyAlaTrpLeuLeuSerProArgLeuCysAspAlaLeuMet100105110AlaMetAspValMetLeuCysThrAlaSerIlePheAsnLeuCysAla115120125IleSerValAspArgPheValAlaValAlaValProLeuArgTyrAsn130135140ArgGlnGlyGlySerArgArgGlnLeuLeuLeuIleGlyAlaThrTrp145150155160LeuLeuSerAlaAlaValAlaAlaProValLeuCysGlyLeuAsnAsp165170175ValArgGlyArgAspProAlaValCysArgLeuGluAspArgAspTyr180185190ValValTyrSerSerValCysSerPhePheLeuProCysProLeuMet195200205LeuLeuLeuTyrTrpAlaThrPheArgGlyLeuGlnArgTrpGluVal210215220AlaArgArgAlaLysLeuHisGlyArgAlaProArgArgProSerGly225230235240ProGlyProProSerProThrProProAlaProArgLeuProGlnAsp245250255ProCysGlyProAspCysAlaProProAlaProGlyLeuProArgGly260265270ProCysGlyProAspCysAlaProAlaAlaProSerLeuProGlnAsp275280285ProCysGlyProAspCysAlaProProAlaProGlyLeuProProAsp290295300ProCysGlySerAsnCysAlaProProAspAlaValArgAlaAlaAla305310315320LeuProProGlnThrProProGlnThrArgArgArgArgArgAlaLys325330335IleThrGlyArgGluArgLysAlaMetArgValLeuProValValVal340345350GlyAlaPheLeuLeuCysTrpThrProPhePheValValHisIleThr355360365GlnAlaLeuCysProAlaCysSerValProProArgLeuValSerAla370375380ValThrTrpLeuGlyTyrValAsnSerAlaLeuThrProValIleTyr385390395400ThrValPheAsnAlaGluPheArgAsnValPheArgLysAlaLeuArg405410415AlaCysCys(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1610 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: 5'UTR(B) LOCATION: 1..103(ix) FEATURE:(A) NAME/KEY: 3'UTR(B) LOCATION: 1508..1610(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 104..1507(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:CGGGGGCGGGACCAGGGTCCGGCCGGGGCGTGCCCCCGGGGAGGGACTCCCCGGCTTGCC60CCCCGGCGTTGTCCGCGGTGCTCAGCGCCCGCCCGGGCGCGCCATGGGGAACCGC115MetGlyAsnArg1AGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCGGGCCGCG163SerThrAlaAspAlaAspGlyLeuLeuAlaGlyArgGlyArgAlaAla5101520GGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCG211GlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGlyGlnGlyAlaAla253035GCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAAC259AlaLeuValGlyGlyValLeuLeuIleGlyAlaValLeuAlaGlyAsn404550TCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCC307SerLeuValCysValSerValAlaThrGluArgAlaLeuGlnThrPro556065ACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCT355ThrAsnSerPheIleValSerLeuAlaAlaAlaAspLeuLeuLeuAla707580CTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAGGTCCAGGGTGGCGCG403LeuLeuValLeuProLeuPheValTyrSerGluValGlnGlyGlyAla859095100TGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTCATGGCCATGGACGTC451TrpLeuLeuSerProArgLeuCysAspAlaLeuMetAlaMetAspVal105110115ATGCTGTGCACCGCCTCCATCTTCAACCTGTGCGCCATCAGCGTGGAC499MetLeuCysThrAlaSerIlePheAsnLeuCysAlaIleSerValAsp120125130AGGTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGG547ArgPheValAlaValAlaValProLeuArgTyrAsnArgGlnGlyGly135140145AGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCG595SerArgArgGlnLeuLeuLeuIleGlyAlaThrTrpLeuLeuSerAla150155160GCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGC643AlaValAlaAlaProValLeuCysGlyLeuAsnAspValArgGlyArg165170175180GACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCG691AspProAlaValCysArgLeuGluAspArgAspTyrValValTyrSer185190195TCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTGTAC739SerValCysSerPhePheLeuProCysProLeuMetLeuLeuLeuTyr200205210TGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCC787TrpAlaThrPheArgGlyLeuGlnArgTrpGluValAlaArgArgAla215220225AAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCT835LysLeuHisGlyArgAlaProArgArgProSerGlyProGlyProPro230235240TCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCC883SerProThrProProAlaProArgLeuProGlnAspProCysGlyPro245250255260GACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCC931AspCysAlaProProAlaProGlyLeuProArgGlyProCysGlyPro265270275GACTGTGCGCCCGCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCCCC979AspCysAlaProAlaAlaProGlyLeuProProAspProCysGlyPro280285290GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCAGGACCCCTGCGGCCCC1027AspCysAlaProProAlaProGlyLeuProGlnAspProCysGlyPro295300305GACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCC1075AspCysAlaProProAlaProGlyLeuProArgGlyProCysGlyPro310315320GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCAGGACCCCTGCGGCCCC1123AspCysAlaProProAlaProGlyLeuProGlnAspProCysGlyPro325330335340GACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCC1171AspCysAlaProProAlaProGlyLeuProProAspProCysGlySer345350355AACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAG1219AsnCysAlaProProAspAlaValArgAlaAlaAlaLeuProProGln360365370ACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGG1267ThrProProGlnThrArgArgArgArgArgAlaLysIleThrGlyArg375380385GAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCCTG1315GluArgLysAlaMetArgValLeuProValValValGlyAlaPheLeu390395400CTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACGCAGGCGCTGTGT1363LeuCysTrpThrProPhePheValValHisIleThrGlnAlaLeuCys405410415420CCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCCGTCACCTGGCTG1411ProAlaCysSerValProProArgLeuValSerAlaValThrTrpLeu425430435GGCTACGTCAACAGCGCCCTCACCCCCGTCATCTACACTGTCTTCAAC1459GlyTyrValAsnSerAlaLeuThrProValIleTyrThrValPheAsn440445450GCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGTGCCTGCAlaGluPheArgAsnValPheArgLysAlaLeuArgAlaCys455460465TGCTGAGCCGGGC1514CysACCCCCGGACGCCCCCCGGCCTGATGGCCAGGCCTCAGGGACCAAGGAGATGGGGAGGGC1574GCTTTTGTACGTTAATTAAACAAATTCCTTCCCAAA1610(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 467 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:MetGlyAsnArgSerThrAlaAspAlaAspGlyLeuLeuAlaGlyArg151015GlyArgAlaAlaGlyAlaSerAlaGlyAlaSerAlaGlyLeuAlaGly202530GlnGlyAlaAlaAlaLeuValGlyGlyValLeuLeuIleGlyAlaVal354045LeuAlaGlyAsnSerLeuValCysValSerValAlaThrGluArgAla505560LeuGlnThrProThrAsnSerPheIleValSerLeuAlaAlaAlaAsp65707580LeuLeuLeuAlaLeuLeuValLeuProLeuPheValTyrSerGluVal859095GlnGlyGlyAlaTrpLeuLeuSerProArgLeuCysAspAlaLeuMet100105110AlaMetAspValMetLeuCysThrAlaSerIlePheAsnLeuCysAla115120125IleSerValAspArgPheValAlaValAlaValProLeuArgTyrAsn130135140ArgGlnGlyGlySerArgArgGlnLeuLeuLeuIleGlyAlaThrTrp145150155160LeuLeuSerAlaAlaValAlaAlaProValLeuCysGlyLeuAsnAsp165170175ValArgGlyArgAspProAlaValCysArgLeuGluAspArgAspTyr180185190ValValTyrSerSerValCysSerPhePheLeuProCysProLeuMet195200205LeuLeuLeuTyrTrpAlaThrPheArgGlyLeuGlnArgTrpGluVal210215220AlaArgArgAlaLysLeuHisGlyArgAlaProArgArgProSerGly225230235240ProGlyProProSerProThrProProAlaProArgLeuProGlnAsp245250255ProCysGlyProAspCysAlaProProAlaProGlyLeuProArgGly260265270ProCysGlyProAspCysAlaProAlaAlaProGlyLeuProProAsp275280285ProCysGlyProAspCysAlaProProAlaProGlyLeuProGlnAsp290295300ProCysGlyProAspCysAlaProProAlaProGlyLeuProArgGly305310315320ProCysGlyProAspCysAlaProProAlaProGlyLeuProGlnAsp325330335ProCysGlyProAspCysAlaProProAlaProGlyLeuProProAsp340345350ProCysGlySerAsnCysAlaProProAspAlaValArgAlaAlaAla355360365LeuProProGlnThrProProGlnThrArgArgArgArgArgAlaLys370375380IleThrGlyArgGluArgLysAlaMetArgValLeuProValValVal385390395400GlyAlaPheLeuLeuCysTrpThrProPhePheValValHisIleThr405410415GlnAlaLeuCysProAlaCysSerValProProArgLeuValSerAla420425430ValThrTrpLeuGlyTyrValAsnSerAlaLeuThrProValIleTyr435440445ThrValPheAsnAlaGluPheArgAsnValPheArgLysAlaLeuArg450455460AlaCysCys465(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 48 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:ACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCC48(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 16 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(ix) FEATURE:(A) NAME/KEY: Peptide(B) LOCATION: 1..4(D) OTHER INFORMATION: /label=Variants/note= "X residues at position 1 may be Pro or Alaand at position 5 may be Arg or Gly;"(ix) FEATURE:(A) NAME/KEY: Peptide(B) LOCATION: 7..8(D) OTHER INFORMATION: /label=Variants/note= "X residues at position 7 may be Pro or Argor Gln and at position 8 may be Asp or Gly;"(ix) FEATURE:(A) NAME/KEY: Peptide(B) LOCATION: 12..13(D) OTHER INFORMATION: /label=Variants/note= "X residues at position 12 may be Pro or Serand at position 13 may be Asp or Asn;"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:XaaAlaProXaaLeuProXaaXaaProCysGlyXaaXaaCysAlaPro151015__________________________________________________________________________

Claims

1. A homogeneous preparation of a 41 kilodalton human dopamine receptor D4, having an amino acid sequence selected from the group consisting of the human D4 dopamine receptor alleles identified by D4.4 (SEQ ID No.:20) and D4.7 (SEQ ID No.:22).

2. A homogeneous preparation of a human D4 dopamine receptor protein having an amino acid sequence that is the amino acid sequence of the human D4 dopamine receptor allele

(Pro/Ala)-Ala-Pro-(Arg/Gly)-Leu-Pro-(Pro/Arg/Gln)-(Asp/Gly)-Pro-Cys-Gly-(Pro/Ser)-(Asp/Asn)-Cys-Ala-Pro (SEQ ID No.:24)

D4.4 from amino acid 1 to amino acid 248 (SEQ ID. No.:20), covalently linked at the carboxyl terminus of amino acid 248 to the amino terminus of a repeated amino acid sequence, the carboxyl terminus of the repeated amino acid sequence being covalently linked to the amino terminus of the amino acid sequence of the human D.sub.4 dopamine receptor allele D4.4 from amino acid 312 to amino acid 419 (SEQ ID. No.:20), wherein the amino acid sequence of the repeated sequence comprises from 3 to 8 copies of the amino acid sequence:

(Pro/Ala).Ala.Pro.(Arg/Ser/Gly).Leu.Pro.(Gln/Arg/Pro).(Asp/Gly).Pro.Cys.Gly.(Pro/Ser). (Asp/Asn).Cys.Ala.Pro.

3. The homogeneous preparation of claim 2 identified as SEQ ID No.: 20.

4. The homogeneous preparation of claim 2 identified as SEQ ID No.: 22.