The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CFR) of the Sequence Listing file name: 47206_501C02US_Sequence_Listing_122016, date created: Dec. 30, 2016, size: 31,792 bytes).
Non-human animals comprising nucleic acid sequences encoding a dipeptidyl peptidase IV (DPP4) protein that comprise a human sequence. Transgenic non-human animals comprising a DPP4 gene that is human in whole or in part. Non-human animals that express human or humanized DPP4 proteins. Methods for making and using non-human animals comprising human or humanized DPP4 nucleic acid sequences.
Dipeptidyl peptidase IV (DPP4) is a therapeutic target for the treatment of a variety of human diseases, disorders and conditions, including, for example, hyperglycemia (see, e.g., Gerich (2013) Pathogenesis and Management of Postpandrial Hyperglycemia: Role of Incretin-Based Therapies, Intl. J. Gen. Med. 6:877-895) and Middle East respiratory syndrome coronavirus (MERS-CoV) infection (see, e.g., Raj et al. (2013) Dipeptidyl Peptidase 4 is a Functional Receptor for the Emerging Human Coronovirus-EMC, Nature 495(7440):251-254).
The evaluation of the pharmacokinetics (PK) and pharmacodynamics (PD) of therapeutic molecules that specifically target human DPP4 protein are routinely performed in non-human animals, e.g., rodents, e.g., mice or rats. However, the PD of such molecules cannot properly be determined in certain non-human animals if these therapeutic molecules also do not target the endogenous Dpp4 protein.
Moreover, the evaluation of the in vivo therapeutic efficacy of human DPP4-specific small molecule, peptide or protein (i.e., biologic) antagonists in non-human animal models of diseases is problematic in certain non-human animals in which the species-specific antagonist does not interact with the endogenous Dpp4 protein. Furthermore, the evaluation of the in vivo therapeutic efficacy of small molecule, peptide or protein (i.e., biologic) antagonists that target molecules that specifically interact with human DPP4 protein is also problematic in certain non-human animals in which the therapeutic target molecule itself does not interact with the endogenous Dpp4 protein.
Accordingly, there is a need for non-human animals, e.g., rodents, e.g., mice or rats that comprise a human or humanized DPP4 gene. For example, there is a need for non-human animals, e.g., rodents, e.g., mice or rats, in which the Dpp4 gene of the non-human animal is humanized in whole or in part or replaced (e.g., at the endogenous non-human loci) with a human DPP4 gene comprising sequences encoding human or humanized DPP4 protein.
There is also a need for non-human animals comprising a DPP4 gene (e.g., human or humanized) in which the DPP4 gene is under control of non-human regulatory elements (e.g., endogenous regulatory elements), for example, in the 5′ flanking region, e.g., promoter and enhancer(s), or in the 3′ untranslated region, of the DPP4 gene.
There is also a need for non-human animals comprising a DPP4 gene (e.g., human or humanized) in which the DPP4 gene is under control of human regulatory elements, for example, in the 5′ flanking region, e.g, promoter or enhancer(s), or in the 3′ untranslated region, of the human DPP4 gene.
There is also a need for humanized non-human animals that express human or humanized DPP4 protein on the surface of immune cells, e.g., T cells, and/or on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, at a level similar to that of Dpp4 protein on the surface of immune cells, e.g., T cells, and/or on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of an age-matched non-human animal that expresses functional Dpp4 protein, but does not comprise the human or humanized DPP4 gene
In addition, there is a need for humanized non-human animals that express human or humanized DPP4 protein on the surface of immune cells, e.g., T cells, and/or on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, at a level higher than or lower than that of Dpp4 protein on the surface of immune cells, e.g, T cells, and/or on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of an age-matched non-human animal that expresses functional Dpp4 protein, but does not comprise the human or humanized DPP4 gene.
Throughout this specification, various patents, patent applications and other types of publications (e.g., journal articles, electronic database entries, etc.) are referenced. The disclosure of all patents, patent applications, and other publications cited herein are hereby incorporated by reference in their entirety for all purposes.
Non-human animals comprising nucleic acid sequences encoding a DPP4 protein that comprises a human sequence are provided.
Transgenic non-human animals comprising a DPP4 gene that is human in whole or in part are provided.
Non-human animals that express human or humanized DPP4 protein are provided.
Non-human animals having a replacement (in whole or in part) of the endogenous non-human animal Dpp4 gene are provided.
Non-human animals comprising a DPP4 humanization (in whole or in part) at an endogenous non-human Dpp4 locus are provided.
Non-human animals are provided that have a human or humanized DPP4 gene, wherein the non-human animals do not express endogenous Dpp4 protein, and wherein the non-human animals express human or humanized DPP4 protein on the surface of immune cells, e.g., T cells, and/or on the surface of cells in one or more tissues, including placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, at a level similar to that of Dpp4 protein present on the surface of immune cells, e.g., T cells, and/or on the surface of cells in one or more tissues, including placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of an age-matched non-human animal that expresses functional endogenous Dpp4 protein, but does not comprise the replacement.
In one aspect, non-human animals comprising a human or humanized DPP4 nucleic acid sequence are provided.
In one aspect, genetically modified non-human animals are provided that comprise a replacement at an endogenous Dpp4 locus of a gene encoding an endogenous Dpp4 gene encoding a human or humanized DPP4 protein. Rodents, e.g., mice or rats, are provided that comprise a replacement of an endogenous Dpp4 gene, at an endogenous Dpp4 locus, with a human Dpp4 gene. In one embodiment, the rodent is heterozygous for a replacement at an endogenous Dpp4 locus of an endogenous Dpp4 gene encoding a human or humanized DPP4 protein. In one embodiment, the rodent is homozygous for a replacement at an endogenous Dpp4 locus of an endogenous Dpp4 gene encoding a human or humanized DPP4 protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one aspect, genetically modified rodents, e.g., mice or rats, are provided comprising a humanization of an endogenous rodent Dpp4 gene, wherein the humanization comprises a replacement at the endogenous rodent Dpp4 locus of a rodent gene encoding an exon of an Dpp4 gene with a nucleic acid sequence encoding at least one exon of a human DPP4 gene to form a modified DPP4 gene, wherein expression of the modified DPP4 gene is under control of rodent regulatory elements at the endogenous rodent Dpp4 locus.
In one embodiment, the rodent is heterozygous for the nucleic acid sequence encoding at least one exon of a human DPP4 gene to form a modified DPP4 gene. In one embodiment, the rodent is homozygous for the nucleic acid sequence encoding at least one exon of a human DPP4 gene to form a modified DPP4 gene.
In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the human DPP4 gene encoding a human or humanized DPP4 protein comprises exon 2 through exon 26 of the human DPP4 gene.
In one embodiment, the humanized DPP4 protein comprises the extracellular domain of the human DPP4 protein.
In one embodiment, the humanized DPP4 protein comprises the transmembrane domain and cytoplasmic domain of the mouse Dpp4 protein.
In one embodiment, the rodent is a mouse that is incapable of expressing a mouse Dpp4 protein.
In one embodiment, the rodent is a mouse wherein a contiguous genomic fragment of mouse Dpp4 sequence encoding exon 2 through exon 26 of mouse Dpp4 is replaced with a contiguous genomic fragment of human DPP4 sequence encoding exon 2 through exon 26 of human DPP4.
In one aspect, genetically modified rodents, e.g., a mouse or rat, are provided that express a human or humanized DPP4 protein, wherein the rodent that expresses a human or humanized DPP4 protein comprises a normal immune system, i.e., the number of immune cells, e.g., T cells, in the blood, plasma or serum of the rodent expressing human or humanized DPP4 protein are similar to the number of immune cells, e.g., T cells, in the blood, plasma or serum of a rodent that expresses functional endogenous Dpp4 protein. one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the blood of the rodent that expresses a human or humanized DPP4 protein has approximately the same number of immune cells, e.g., T as a rodent that expresses a functional, endogenous Dpp4 protein, e.g., a wild-type mouse or rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat,
In one embodiment, the mouse expressing human or humanized DPP4 on the surface of T cells has an amount of T cells present in the blood of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200% of the amount of T cells present in the blood of an age-matched mouse that expresses functional endogenous Dpp4 protein, but does not comprise a replacement of an endogenous Dpp4 gene, at an endogenous mouse Dpp4 locus, with a human DPP4 gene.
In one embodiment, the mouse expressing human or humanized DPP4 protein on the surface of T cells has an amount of T cells in the blood of between about 20% and about 200%, between about 40% and about 160%, or between about 80% and about 120% of the amount of T cells present in the blood of an age-matched mouse that expresses functional endogenous Dpp4 protein, but does not comprise a replacement of an endogenous Dpp4 gene, at an endogenous mouse Dpp4 locus, with a human DPP4 gene.
In one aspect, genetically modified rodents, e.g., a mouse or rat, are provided that express a human or humanized DPP4 protein, wherein the rodent expresses a human or humanized DPP4 protein on the surface of immune cells, e.g., T cells, and/or on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of an age-matched rodent that expresses functional endogenous Dpp4 protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the immune cells, e.g., T cells, of the rodent that expresses a human or humanized DPP4 protein have approximately the same level of DPP4 protein on its surface as the immune cells, e.g., T cells, of a rodent that expresses a functional, endogenous Dpp4 protein, e.g., a wild-type mouse or rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the mouse expresses human or humanized DPP4 protein on the surface of immune cells, e.g, T cells, at a level of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200% of the level of Dpp4 protein on the surface of immune cells, e.g, T cells, of an age-matched mouse that expresses functional endogenous Dpp4 protein, but does not comprise a replacement of an endogermus Dpp4 gene, at an endogenous mouse Dpp4 locus, with a human DPP4 gene.
In one embodiment, the mouse expresses human or humanized DPP4 protein on the surface of immune cells, e.g., T cells, at a level of between about 20% and about 200%, between about 40% and about 160%, or between about 80% and about 120% of the level of mouse Dpp4 protein present on the surface of immune cells, e.g., T cells, of an age matched mouse that expresses functional endogenous Dpp4 protein, but does not comprise a replacement of an endogenous Dpp4 gene, at an endogenous mouse Dpp4 locus, with a human DPP4 gene.
In one embodiment, the cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of the rodent that expresses a human or humanized DPP4 protein have approximately the same level of DPP4 protein on its surface as the cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of a rodent that expresses a functional, endogenous Dpp4 protein, e.g., a wild-type mouse or rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the mouse expresses human or humanized DPP4 protein on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, at a level of at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200% of the level of Dpp4 protein on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of an age-matched mouse that expresses functional endogenous Dpp4 protein, but does not comprise a replacement of an endogenous Dpp4 gene, at an endogenous mouse Dpp4 locus, with a human DPP4 gene.
In one embodiment, the mouse expresses human or humanized DPP4 protein on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, at a level of between about 20% and about 200%, between about 40% and about 160%, or between about 80% and about 120% of the level of mouse Dpp4 protein present on the surface of cells in one or more tissues, e.g., placenta, kidney, lung, liver, skeletal muscle, heart, brain and/or pancreas, of an age-matched mouse that expresses functional endogenous Dpp4 protein, but does not comprise a replacement of an endogenous Dpp4 gene, at an endogenous mouse Dpp4 locus, with a human DPP4 gene.
In one aspect, a genetically modified rodent is provided, comprising a humanized DPP4 gene comprising a replacement of rodent Dpp4 extracellular domain-encoding sequence with human DPP4 extracellular domain-coding sequence, wherein the humanized DPP4 gene comprises a rodent Dpp4 transmembrane sequence and a rodent Dpp4 cytoplasmic sequence, wherein the humanized DPP4 gene is under control of endogenous rodent Dpp4 regulatory elements at the endogenous Dpp4 locus.
In one embodiment, the rodent is heterozygous for the humanized DPP4 gene. In one embodiment, the rodent is homozygous for the humanized DPP4 gene.
In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the mouse is incapable of expressing a mouse Dpp4 protein.
In one embodiment, the rodent regulatory elements or sequences at the endogenous rodent Dpp4 locus are from a mouse or a rat
In one embodiment, the rodent regulatory elements or sequences are endogenous rodent regulatory elements or sequences at the rodent Dpp4 locus are from a mouse or a rat.
In one aspect, a non-human animal, e.g., a rodent, e.g., a mouse or rat, is provided that expresses human or humanized DPP4 protein, wherein the non-human animal expresses human or humanized DPP4 protein from an endogenous non-human Dpp4 locus. In an embodiment, the non-human animal is a rodent. In an embodiment, the rodent is a mouse. In an embodiment, the rodent is a rat. In one embodiment, the rodent is heterozygous for the endogenous non-human Dpp4 locus expressing a human or humanized DPP4 protein. In one embodiment, the rodent is homozygous for the endogenous non-human Dpp4 locus expressing a human or humanized DPP4 protein.
In one aspect, a genetically modified mouse is provided that expresses human or humanized DPP4 protein from an endogenous mouse Dpp4 locus, wherein the endogenous mouse Dpp4 gene has been replaced, in whole or in part, with a human DPP4 gene.
In one embodiment, about 78.8 kb at the endogenous mouse Dpp4 locus, including exon 2 through the stop codon in exon 26, is deleted and replaced with about 81.8 kb of human DPP4 gene sequence comprising exon 2 through exon 26 and a portion of the 3 untranslated sequence of the human DPP4 gene. In a specific embodiment, the human DPP4 gene comprises exon 2 through exon 26 and a portion of the 3′ untranslated sequence of the human DPP4 gene of human BAC RP11-68L22. In a specific embodiment, the DPP4 gene comprises mouse Dpp4 gene 5′ regulatory elements, mouse Dpp4 exon 1, including the first two amino acids, Met and Lys, of the mouse Dpp4 protein, and mouse Dpp4 3′ regulatory elements (e.g., 3′ untranslated region), and human DPP4 gene exon 2 through exon 26, i.e., the human DPP4 protein coding sequences, except for the first two amino acids, which are derived from mouse Dpp4 exon 1.
In one aspect, a genetically modified mouse is provided that comprises a nucleotide sequence encoding a human or humanized DPP4 protein, wherein the nucleotide sequence encoding the human or humanized DPP4 protein replaces, in whole or in part, an endogenous nucleotide sequence encoding an endogenous mouse Dpp4 protein.
In one embodiment, the mouse is heterozygous for the nucleotide sequence encoding a human or humanized DPP4 protein. In one embodiment, the mouse is homozygous for the nucleotide sequence encoding a human or humanized DPP4 protein.
In one aspect, a method is provided for making a humanized DPP4 rodent, comprising replacing a rodent Dpp4 gene sequence encoding rodent Dpp4 protein with a human DPP4 gene sequence comprising one or more exons of the human DPP4 gene sequence encoding human or humanized DPP4 protein, wherein the replacement is at an endogenous rodent Dpp4 locus and the human DPP4 gene sequence comprising one or more exons of the human DPP4 gene sequence encoding human or humanized DPP4 protein is operably linked to rodent regulatory elements or sequences at the endogenous rodent Dpp4 locus.
In one embodiment, the rodent is heterozygous for the nucleotide sequence encoding a human or humanized DPP4 protein. In one embodiment, the rodent is homozygous for the nucleotide sequence encoding a human or humanized DPP4 protein.
In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat
In one embodiment, the rodent regulatory elements or sequences are derived from a mouse. In one embodiment, the rodent regulatory elements or sequences are derived from a rat.
In one embodiment, the rodent regulatory elements or sequences are endogenous rodent regulatory elements or sequences at the rodent Dpp4 locus. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the human DPP4 gene sequence replacing the rodent Dpp4 gene sequence comprises at least one exon of the human DPP4 gene sequence. In other embodiments, the human DPP4 gene sequence replacing the rodent Dpp4 gene sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 exons of the human DPP4 gene sequence. In one embodiment, the human DPP4 gene sequence replacing the rodent Dpp4 gene sequence comprises all 26 exons of the human DPP4 gene sequence. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the human or humanized DPP4 gene sequence replacing the rodent Dpp4 gene sequence encodes a protein that is about 85%, 90%, 95%, 96%, 97%, 98%, or about 99% identical to a human DPP4.
In one embodiment, the human or humanized DPP4 gene sequence replacing the rodent Dpp4 gene sequence comprises at least one exon of the human DPP4 gene sequence encoding the extracellular domain of the human DPP4 protein. In other embodiments, the human DPP4 gene sequence replacing the rodent Dpp4 gene sequence comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 exons of the human DPP4 gene sequence encoding the extracellular domain of the human DPP4 protein. In one embodiment, the human DPP4 gene sequence replacing the rodent Dpp4 gene sequence comprises all 24 exons of the human DPP4 gene sequence encoding the extracellular domain of the human DPP4 protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one embodiment, the human or humanized DPP4 gene sequence replacing the rodent Dpp4 gene sequence encodes an extracellular domain of the DPP4 protein that is about 85%, 90%, 95%, 96%, 97%, 98%, or about 99% identical to the extracellular domain of a human DPP4 protein.
In one embodiment, the replacement is at an endogenous rodent Dpp4 locus and the human DPP4 gene sequence comprising one or more exons of the human DPP4 gene sequence encoding human or humanized DPP4 protein is operably linked to endogenous rodent regulatory elements or sequences at the endogenous rodent Dpp4 locus.
In one aspect, a method is provided for making a humanized DPP4 mouse, comprising replacing a mouse Dpp4 gene sequence encoding mouse Dpp4 protein with a human DPP4 gene sequence encoding human or humanized DPP4 protein.
In one embodiment, the replacement is at an endogenous mouse Dpp4 locus, and the human DPP4 gene encoding human or humanized DPP4 protein is operably linked to mouse regulatory elements or sequences at the endogenous mouse Dpp4 locus.
In one embodiment, the replacement is at an endogenous mouse Dpp4 locus, and the human DPP4 gene encoding human or humanized DPP4 protein is operably linked to endogenous mouse regulatory elements or sequences at the endogenous mouse Dpp4 locus.
In various aspects, the genetically modified non-human animals, e.g., rodents, e.g., mice or rats, described herein comprise the genetic modifications in their germ-line,
In one aspect, a non-human animal, e.g., rodent, e.g., a mouse or rat, embryo comprising a genetic modification as described herein is provided.
In one aspect, a non-human animal, e.g., rodent, e.g., a mouse or rat, host embryo is provided that comprises a donor cell that comprises a genetic modification as described herein.
In one aspect, a pluripotent or totipotent non-human animal, e.g., rodent, e.g., mouse or rat, cell comprising a genetic modification as described herein is provided. In one embodiment, the cell is a rodent cell. In one embodiment, the cell is a mouse cell. In one embodiment, the cell is a rodent embryonic stem (ES) cell. In one embodiment, the cell is a mouse ES cell.
In one aspect, a non-human animal, e.g., rodent, e.g., mouse or rat, egg is provided, wherein the non-human animal egg comprises an ectopic non-human animal chromosome, wherein the ectopic non-human animal chromosome comprises a genetic modification as described herein. In one embodiment, the non-human animal is a rodent In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
In one aspect, the mouse embryo, egg or cell that is genetically modified to comprise a human DPP4 gene is of a mouse that is of a CS7BL strain selected from C57BL/A, CS7BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/61, C5713L/61334, C57BL/61\11, C57BL/10, C57BL/10ScSn, C5713L/1.0Cr, and C57BL/Ola. In another embodiment, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIrn), 129S2, 129S4, 129S5, 129S9/SvEv1-1, 129S6 (129/SvEvTac), 12957, 129S8, 129T1, 129T2 (see, e.g., Festirig et al. (1999) Revised nomenclature for strain 129 mice, Mammalian Genome 10:836, see also, Auerbach et al (2000) Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines). In a specific embodiment, the genetically modified mouse is a mix of an aforementioned 129 strain and an aforementioned C57BL/6 strain. In another specific embodiment, the mouse is a mix of aforementioned 129 strains, or a mix of aforementioned BL/6 strains. In a specific embodiment, the 129 strain of the mix is a 129S6 (129/SvEvTac) strain. In another embodiment, the mouse is a BALB strain, e.g., BALB/c strain. In yet another embodiment, the mouse is a mix of a BALB strain and another aforementioned strain. In one embodiment, the mouse is Swiss or Swiss Webster mouse.
In various aspects, the non-human animals comprising a human or humanized DPP4 nucleic acid sequence are selected from mammals and birds. In one embodiment, the non-human animals are mammals. In one embodiment, the mammals are rodents. In one embodiment, the rodents are mice or rats.
In one aspect, a rodent is provided that comprises a nucleic acid sequence comprising a human DPP4 gene or fragment thereof, where the human DPP4 gene or fragment thereof comprises at least one exon of the human DPP4 gene, and where the human DPP4 gene or fragment thereof encodes a human or humanized DPP4 protein.
In one embodiment, the human DPP4 gene or fragment thereof comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20, 21, 22, 23, 24, or 25 exons of the human DPP4 gene.
In one embodiment, the human DPP4 gene or fragment thereof comprises all 26 exons of the human DPP4 gene.
In one embodiment, the nucleic acid sequence further comprises a 5′ flanking region of the human DPP4 gene. In one embodiment, the human DPP4 gene or fragment thereof is operably linked to the 5′ flanking region of the human DPP4 gene. In one embodiment, the 5′ flanking region of the human DPP4 gene comprises at least 1 kb in length (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30, 40, 50 kb, or greater, in length). In one embodiment, the 5′ flanking region of the human DPP4 gene comprises at least 10 kb in length. In one embodiment, the 5′ flanking region of the human DPP4 gene comprises at least 40 kb in length.
In one embodiment, expression of the human DPP4 gene or fragment thereof is under control of the 5′ flanking region of the human DPP4 gene.
In one embodiment, the human or humanized DPP4 protein comprises the amino acid sequence of SEQ ID NO: 24 or a fragment thereof.
In one embodiment, the rodent expresses the human or humanized DPP4 protein on the surface of T cells in a level that is at least about 20% (e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or greater) of the level of rodent Dpp4 protein present on the surface of T cells of an age-matched rodent that expresses functional endogenous rodent Dpp4 protein but that does not comprise the human DPP4 gene or fragment thereof.
In one embodiment, the rodent expresses the human or humanized DPP4 protein on the surface of cells in one or more tissues selected from the group consisting of placenta, kidney, lung, liver, skeletal muscle, heart, brain, and pancreas, in a level that is at least about 20% (e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or greater) of the level of rodent Dpp4 protein present on the surface of one or more tissues of an age-matched rodent that expresses functional endogenous rodent Dpp4 protein but that does not comprise the human DPP4 gene or fragment thereof.
In one embodiment, the rodent expresses functional endogenous rodent Dpp4 protein.
In one embodiment, the rodent is a mouse or a rat.
In one aspect, provided herein is a method for making a humanized transgenic rodent, comprising integrating a nucleic acid sequence comprising one or more exons of a human DPP4 gene sequence into a chromosome of a rodent, where the one or more exons of the human DPP4 gene sequence encodes a human or humanized DPP4 protein.
In one embodiment, the human DPP4 gene or fragment thereof comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20, 21, 22, 23, 24, or 25 exons of the human DPP4 gene.
In one embodiment, the human DPP4 gene or fragment thereof comprises all 26 exons of the human DPP4 gene.
In one embodiment, the nucleic acid sequence further comprises a 5′ flanking region of the human DPP4 gene.
In one embodiment, the human DPP4 gene sequence is operably linked to the 5′ flanking region of the human DPP4 gene.
In one embodiment, the human or humanized DPP4 protein comprises the amino acid sequence of SEQ ID NO 24 or a fragment thereof
In one embodiment, the rodent is a mouse or a rat. In further aspects, methods for determining the in vivo therapeutic efficacy of a human-specific DPP4 antagonist in any of the humanized DPP4 rodents described herein are provided, the method comprising administering to the rodent a DPP4 antagonist, wherein the rodent is infected with Middle East respiratory syndrome coronavirus (MERS-CoV); and determining if whether the DPP4 antagonist treats or prevents one or more symptoms of MERS-CoV infection compared to control rodents infected with MERS-CoV who have not been administered the DPP4 antagonist.
In one embodiment, the DPP4 antagonist is selected from the group consisting of small molecules, peptides and antibodies.
In one embodiment, the DPP4 antagonist is an antibody to a MERS-CoV protein.
In one embodiment, the MERS-CoV protein is MERS-CoV spike protein.
In one embodiment, the rodent is infected with one or more strains of MERS-CoV selected from the group consisting of AI-Hasa_1, Al-Hasa2, Al-Hasa_3, Al-Hasa_4, Al-Hasa_12, Al-Hasa 15, Al-Hasa 16, Al-Hasa_17, Al-Hasa 18, Al-Hasa 19, Al-Hasa _21, Al-Hasa_25, Buraida_1, EMC/2012, FRA/UAE, Hafr-Al-Batin_1, Hafr-Al-Batin_2, Hafr-Al-Batin_6, Jeddah_, Jordan-N3/2012, Munich, Riyadh_3, Riyadh_4, Riyadh_5, Riyadh_14, Taif_1, Wadi-Ad-Dawasir_1, Riyadh_9, KFU-HKU 1, KFU-HKU 13, Qatar3, Qatar4, England 1, England-Qatar/2012, BishaJ, Riyadh_1, and Riyadh_2.
In one embodiment, the antagonist is administered before MERS-CoV infection. In one embodiment, the antagonist is administered after MERS-CoV infection,
In one embodiment, the antagonist is administered simultaneously with MERS-CoV infection.
In one embodiment, the symptom of MERS-CoV infection is viral titer or RNA level.
In one embodiment, the viral titer or RNA level is assessed by one or more methods selected from the group consisting of qPCR, Northern Blot, plaque assay, and in situ hybridization,
In one embodiment, the symptom of MERS-CoV infection is lung inflammation.
In one embodiment, the lung inflammation is assessed histochemically
In one embodiment, the symptom of MERS-CoV infection is weight loss,
In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.
Each of the aspects and embodiments described herein are capable of being used together, unless excluded either explicitly or clearly from the context of the embodiment or aspect.
DPP4 Gene and Protein
The DPP4 gene encodes the type II transmembrane protein, tripeptidyl peptidase IV (DPP4) (also known as CD26, adenosine deaminase complexing protein-2 (ADCP2), adenosine deaminase binding protein (ADABP), and TP103), which has serine exopeptidase activity, and which plays an important role in the activation of T cells and in intracellular signal transduction cascades in several other cell types.
Human DPP4, NCBI Gene ID: 1803; Primary source: HGNC:3009; RefSeq transcript; NM_001935,3; UniProt ID: P27487; Genomic assembly: GRCh38; Location: chr2:162,848,755-162,931,052 strand. (See
The human DPP4 gene is located on chromosome 2, at 2q24.3. The human DPP4 gene has 26 exons and encodes a type H transmembrane polypeptide of 766 amino acids in length, including an N-terminal 6 amino acid cytoplasmic domain, a 22 amino acid transmembrane domain, and a C-terminal 738 amino acid extracellular domain. The extracellular domain (ie., ectodomain) of the human DPP4 protein is encoded by coding exons 3 through 26 of the human DPP4 gene.
Mouse Dpin44. NCI Gene ID: 13482; Primary source: MGI:94919; RefSeq transcript: NM_010074.3; tiniProt ID: P28843; Genomic assembly: GRCm38; Location: chr2:62,330,073-62,412,591-strand.
The mouse Dpp4 gene is located on chromosome 2, at 2 35.85 cM. The mouse Dpp4 gene has 26 exons and encodes a type II transmembrane polypeptide of 760 amino acids in length, including an N-terminal 6 amino acid cytoplasmic domain, a 22 amino acid transmembrane domain, and a C-terminal 732 amino acid extracellular domain. The extracellular domain (i.e., ectocloimaM) of the mouse Dpp4 protein is encoded by coding exons 3 through 26 of the mouse Dpp4 gene.
Species Specificity of DPP4 Protein
As discussed below in Example 2, the human, but not the mouse, DPP4 protein is a functional receptor for the Middle East respiratory syndrome coronavirus (MERS-CoV) infection.
Candidate therapeutic molecules that target the human DPP4 protein in a species-specific manner, or target molecules, such as MERS-CoV, which interact with the human DPP4 protein in a species-specific manner, are typically evaluated for pharmacokinetics (PK) and pharmacodynamics (PK) in non-human animals, e.g., rodents, e.g., mice or rats. Such therapeutic molecules are also tested for in vivo therapeutic efficacy in non-human animal, e.g., rodent, e.g., mouse or rat, models of human diseases, disorders and conditions in which DPP4 plays a role.
However, therapeutic molecules that are specific for the human DPP4 protein, e.g., human-specific DPP4 inhibitors, cannot be adequately evaluated for PD and/or in vivo therapeutic efficacy in rodents, in particular mice, because the targets of these therapeutic molecules are missing.
Moreover, therapeutic molecules that are specific for targets that specifically interact with human DPP4 protein, e.g., human DPP4-specific MERS-CoV, cannot be adequately evaluated for in vivo therapeutic efficacy in rodents, in particular mice, because the targets (e.g., receptor, interaction partner) of these therapeutic target molecules are missing.
Accordingly, in various embodiments, to assess the PD and/or in vivo therapeutic efficacy of a human-specific DPP4 protein antagonist or inhibitor in non-human animals, e.g., rodents, e.g., mice or rats, it is desirable to replace the endogenous Dpp4 protein with human or humanized DPP4 protein. In various embodiments, to assess the in vivo therapeutic efficacy of small molecules, peptides or biologic antagonists or inhibitors of a target molecule that specifically interacts with a human DPP4 protein in non-human animals, e.g., rodents, e.g., mice or rats, it is desirable to replace the endogenous Dpp4 protein with human or humanized DPP4 protein.
Further, in various embodiments, in order to avoid potential problems of the over- or under-expression of the human or humanized DPP4 protein, and/or the inappropriate expression of the human or humanized DPP4 protein in cells or tissues in which the endogenous Dpp4 protein is not normally expressed, it is desirable to insert the human DPP4 gene, in whole or in part, into the genoine of the non-human animals, e.g, rodents, e.g., mice or rats, at the endogenous Dpp4 gene loci, and to express the human or humanized DPP4 protein in non-human animals, e.g., rodents, e.g., mice or rats, under the control, at least in part, of the endogenous Dpp4 regulatory elements.
In some embodiments, targeted replacement of the endogenous, e.g., mouse or rat, Dpp4 gene by the human DPP4 gene or fragment thereof is desirable.
In other embodiments, the human DPP4 gene or fragment thereof is randomly inserted into the rodent, e.g., mouse or rat, genome instead of replacing the endogenous Dpp4 gene with a human DPP4 gene or fragment thereof In some embodiments, in rodents, e.g., mice or rats, in which the human DPP4 gene or fragment thereof has been randomly inserted into the genome, expression of endogenous rodent Dpp4 is retained.
Provided herein are non-human animals, e.g., rodents, e.g., mice or rats, that comprise a human DPP4 gene or fragment thereof either at (Le, replacing) the endogenous Dpp4 locus, or at one or more other loci. Also provided herein are non-human animals, e.g., rodents, e.g, mice or rats, that comprise a human DPP4 gene or fragment thereof both at (i.e., replacing) the endogenous Dpp4 locus, and at an additional locus/loci.
In some embodiments, a fragment of a human DPP4 gene contains 200 kilobases (kb) or fewer nucleotides, e.g., 180, 160, 140, 120, 100, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2.5, 1 kb or fewer nucleotides, e.g., 1000, 800, 600, 400, 200, or fewer nucleotides.
Generation of Cells and Non-Human Animals with Human DPP4
For targeted replacement of an endogenous non-human Dpp4 gene or fragment with a human DPP4 gene or fragment, a targeting construct is generated. See, e.g., Valenzuela et al. Nature Biotech, 21,6(2003):652-659; U.S. Pat. Nos. 6,586,251; and 8,759,105. For example, a targeting construct comprises homology arms flanking a replacement human DPP4 gene or fragment thereof.
In some embodiments, the replacement human DPP4 gene or fragment thereof comprises the entire human DPP4 gene. In other embodiments, the replacement human DPP4 gene or fragment thereof comprises a portion of the human DPP4 gene. For example, the replacement human DPP4 gene or fragment thereof comprises one or more exons of human DPP4 gene, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 exons of the human DPP4 gene. For example, the replacement human DPP4 gene or fragment thereof comprises the exons 1-26 of the human DPP4 gene. In other embodiments, the replacement human DPP4 gene or fragment thereof comprises exons 2-26 of the human DPP4 gene. For example, the replacement human DPP4 gene or fragment thereof comprises intron 1 upstream of exon 2 through exon 26 of the human DPP4 gene. In some embodiments, the replacement human DPP4 gene or fragment thereof further comprises a human regulatory element(s), e.g, a portion of the human 3′ untranslated region (UTR) downstream of the human DPP4 gene, for example at least 1 kb of downstream region (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30.40 Kb, or greater), and/or a human promoter or enhancer region upstream of the human DPP4 gene, for example, at least 10 kb of upstream region (e.g., at least 10, 20, 30, 40, 50 Kb, or greater).
Homology arms are sequences that are homologous to endogenous chromosomal nucleic acid sequences flanking the desired genetic modification/replacement, e.g., flanking the endogenous Dpp4 gene or fragment that is to be replaced. Homologous nucleic acid sequences can be two or more nucleic acid sequences that are either identical or similar enough that they are able to hybridize to each other or undergo intermolecular exchange. Due to the homology between the homology arms and the corresponding endogenous sequence, the homology arms direct the targeting construct to a specific chromosomal location within the genome, e.g., the endogenous Dpp4 gene locus. See, e.g., Valenzuela et al. Nature Biotech, 21,6(2003):652-659; U.S. Pat. Nos. 6,586,251; and 8,759,105,
Optionally, the targeting construct further comprises a selection marker, e.g., in between the two homology arms. Exemplary selection markers include antibiotic resistance markers (e.g.., neomycin or kanamycin) and fluorescent proteins. In some embodiments, the selection marker is foxed, i.e., flanked by two loxP sites. The foxed selection marker can be removed by the addition of Cre recombinase, which catalyzes the excision of the foxed segment, e.g., including the selection marker.
Vector/Constructs
The transgenic non-human animals (e.g., rodents, e.g., mice or rats) of the invention can be made by using various vectors and/or constructs. In some embodiments, the targeting construct is in the form of a circular piece of double-stranded DNA, e.g., a bacterial artificial chromosome (BAC), plasmid, or P1-derived artificial chromosome (PAC).
To generate a non-human cell comprising a targeted replacement of the endogenous Dpp4 locus, a targeting construct containing a human DPP4 gene or fragment described herein is introduced into a non-human (e.g., rodent, e.g mouse or rat) cell, e.g., embryonic stem (ES) cell.
To generate a non-human cell comprising a human DPP4 gene or fragment randomly inserted into the genome, a circular DNA construct, e.g., BAC, containing a human DPP4 gene or fragment thereof, is introduced into a non-human (e.g., rodent, e.g., mouse or rat) cell, e.g., ES cell. In some cases, the circular DNA construct, e.g., BAC, further contains a human DPP4 regulatory element, e.g., a human promoter or enhancer region upstream and/or downstream of human DPP4 gene. For example, the circular DNA construct contains at least 10 kb (e.g., at least 10, 20, 30, 40, 50 kb or greater) of promoter/enhancer region upstream of the ATG start codon of the human DPP4 gene. In addition or alternatively, the circular DNA construct contains at least 1 kb (e.g., at least 1, 2, 3, 4, 5, 10, 20, 30, 40 kb or greater) of untranslated region downstream of the human DPP4 gene. For example, the human DPP4 gene or fragment is operably linked to the human DPP4 regulatory element.
In some embodiments, the human DPP4 gene or fragment thereof in the circular DNA construct (e.g., BAC) comprises the entire human DPP4 gene. In other embodiments, the human DPP4 gene or fragment thereof comprises a portion of the human DPP4 gene. For example, the human DPP4 gene or fragment thereof comprises one or more exons of human DPP4 gene, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 exons of the human DPP4 gene. For example, the human DPP4 gene or fragment thereof comprises the exons 1-26 of the human DPP4 gene. In other embodiments, the human DPP4 gene or fragment thereof comprises exons 2-26 of the human DPP4 gene. For example, the human DPP4 gene or fragment thereof comprises intron 1 upstream of exon 2 through exon 26 of the human DPP4 gene.
For example, the introduction step into the cell is done by electroporation or lipid-mediated transfection.
Optionally, the circular DNA construct, e.g., BAC, is linearized before introduction into the cell. For example, linearization is performed with rare-cutting restriction enzymes, e.g., SgrDI, SfiI, NotI, PadI, or SwaI.
In cases in which the targeting construct comprises an antibiotic selection marker (e.g., neomycin), cells that have taken up the targeting construct are optionally selected in neomycin/G418-containing media. Cells that survive and/or proliferate in neomycin/G418-containing media are selected and positive for the targeting construct.
In some embodiments, the cell population is screened for those cells that have incorporated into their genome a human DPP4 gene or fragment thereof, e.g., randomly inserted into the genome or targeted (e.g., by the targeting construct) to the endogenous Dpp4 locus.
Methods for screening include quantitative FCR and fluorescence in situ hybridization. See, e.g., U.S. Pat. Nos. 6,586,251 B2 and 8,759,105 82. For example, methods of screening include detecting for the presence of a human DPP4 gene or fragment. In some embodiments, methods of screening include detecting for a loss of copy number of endogenous Dpp4 gene or fragment and/or gain of copy number of human DPP4 gene or fragment. Exemplary methods of screening are described in Examples 1 and 3.
In some embodiments in which the targeting construct comprises a foxed selection marker, correctly targeted cells are optionally further electroporated with a Cre expressing vector, e.g., transiently expressing Cre recombinase, to remove the floxed selection marker.
To generate transgenic animals, positive ES cell clones, e.g., without foxed selection marker, containing a human DPP4 gene or fragment thereof, are introduced into a rodent embryo, e.g, a mouse or rat embryo, such as an 8-cell stage mouse embryo. For example, the introduction step is done by blastocyst injection technology, aggregation techniques, nuclear transfer and cloning, and/or the VelociMouse® method. See, e.g., U.S. Pat. Nos. 8,759,105 B2, 7,294,754, 7,576,259, and 7,659,442. For example, an ES cell clone is a subpopulation of cells derived from a single cell of the ES cell population following introduction of DNA and subsequent selection.
In some cases, DNA from transgenic non-human animals are screened in similar ways as described above to confirm transmittance of the human DPP4 gene/fragment through the germline.
In some embodiments, the humanized DPP4 rodents described herein are heterozygous for the human DPP4 allele. As such, these rodents have one human DPP4 allele and one wild-type rodent DPP4 allele, in other embodiments, the humanized DPP4 rodents are homozygous for the human DPP4 allele.
Uses for Humanized DPP4 Rodents
Humanized DPP4 rodents, e.g., mice or rats, are useful to evaluate the pharmacodynamics (PD) of human-specific DPP4 antagonists, e.g., small molecule, peptide or biologic inhibitors, useful for the treatment of hyperglycemia.
Pharmacokinetics (PK) and PD assays in humanized DPP4 rodents e.g., mice or rats, are performed according to standard procedures known in the art.
Humanized DPP4 rodents, e.g., mice or rats, are useful to evaluate the in vivo therapeutic efficacy of human-specific DPP4 antagonists, e.g., small molecule, peptide or biologic inhibitors, in the treatment of hyperglycemia.
Humanized DPP4 rodents, e.g., mice or rats, are useful to test the in vivo therapeutic efficacy of antagonists, e.g., small molecule, peptide or biologic inhibitors, e.g., neutralizing antibodies, that are specific for target molecules, e.g., MERS-CoV (e.g., spike protein (S) of MERS-CoV, e.g., receptor binding domain of the spike protein of MERS-CoV), which specifically interact with human DPP4, in the treatment or prevention (or prophylaxis) of MERS-CoV infection. In some embodiments, rodents that are heterozygous for the human DPP4 allele are used to test the in vivo therapeutic efficacy of one or more antagonists in the treatment or prevention (or prophylaxis) of MERS-CoV infection. In other embodiments, DPP4 rodents that are homozygous for the human DPP4 allele are used to test the in vivo therapeutic efficacy of one or more antagonists in the treatment or prevention (or prophylaxis) of MERS-CoV infection.
Exemplary MERS-CoV strains include MERS-CoV Jordan strain (GenBank accession no. KC776174.1, MERS-CoV- Hu/Jordan-N3/2012′) and MERS-CoV EMC/2012 strain (GenBank accession no. JX869059.2). In some embodiments, a MERS-CoV virus described herein comprises a MERS-CoV clinical isolate. In other embodiments, a MERS-CoV virus described herein comprises a strain comprising the same spike protein receptor binding domain (RBD) sequence as a clinical isolate described herein. Exemplary clinical isolates are shown in the table below. The table shows the amino acid sequence variation within the receptor binding domain (RBD) of the spike protein of several MERS-CoV clinical isolates. National Center for Biotechnology Information (CBI)-deposited sequences of MERS-CoV clinical isolates were aligned at amino acids 367-606 and compared to that of the EMC/2012 strain. Clinical isolates harboring the A4318, S457G, S460F, A482V,1,5068, DSO9G, and V534A substitutions (where the amino acid (single letter designation) preceding the number is that of the EMC/2012 strain, and the amino acid (single letter designation) following the number is that of the clinical isolate) are shown in the table.
In some embodiments, an antagonist is administered before (e.g., at least 1, 2, 4, 6, 12, 24, 48 hours, 2, 3, 4, 5, 6, or 7 days, or more before) a MERS-CoV infection in the rodent. In other embodiments, the antagonist is administered after (e.g., at least 1, 2, 4, 6, 12, 24, 48 hours, 2, 3, 4, 5, 6, or 7 days, or more after) a MERS-CoV infection in the rodent.
In some embodiments, where an antagonist is administered to a rodent after MERS-CoV infection, a lower viral titer or RNA level (e.g., viral UpE or leader sequence RNA level) in the rodent after administration of the antagonist, e.g., lower by at least 5-fold (e.g., at least 5, 10, 50, 100, 500, 1000, 104, 105, 106, 107-fold or more) compared to a control level indicates that the antagonist is effective in treating a MERS-CoV infection. For example, a control level is the viral titer or RNA level in the rodent prior to administration of the antagonist. In other examples, a control level is the viral titer or RNA level in a virus-infected rodent that is untreated with the antagonist.
In some embodiments, where an antagonist is administered to a rodent prior to MERS-CoV infection, a lower viral titer or RNA level (e.g., viral UpE or leader sequence RNA level) in the rodent after administration of the antagonist, e.g., lower by at least 5-fold (e.g., at least 5, 10, 50, 100, 500, 1000, 104, 105, 106, 107-fold or more) compared to a control level indicates that the antagonist is effective in preventing a MERS-CoV infection. For example, a control level is the viral titer or RNA level of a rodent infected with MERS-CoV that was not treated with the antagonist.
In some embodiments, viral RNA levels in a rodent lung can be determined by extracting RNA from the rodent lung by homogenization in a solution containing phenol, e.g., a solution containing phenol and guanidinium isothiocyanate (e.g., Trizol® (Life Technologies, Inc)). For example, the lung can be homogenized using a Magnalyzer (Roche) according to the manufacturers' instructions. In some embodiments, levels of MERS-CoV RNA can be assessed using quantitative PCR (qPCR) using primers that target the MERS-CoV genome and/or primers that target the MERS-CoV mRNA transcript. For example, the Taqman® Fast virus one-step master mix (Applied Biosystems) can be used in qPCR according to the manufacturers' instructions using a duplex of primers obtained from Life Technologies targeting a region of the genome upstream of the envelope gene (UpE) or the leader sequence of the nucleocapsid messenger RNA (leader primer), and compared to an endogenous control, such as rodent (e.g., mouse) 18S rRNA. For example, qPCR reactions in Microampo® fast optical reaction plates (Applied Biosystems) can be read on a 7500 fast DX real-time PCR instrument (Applied Biosystems). In some examples, qPCR data can be analyzed using the delta Ct method, with an uninfected control set to 1. For example, percent MERS-CoV RNA detected can be expressed relative to levels of RNA detected in infected mice treated with control antagonist, e.g., isotype-matched control antibodies, in cases where the antagonist is an antibody against MERS-CoV.
In some embodiments, the viral titer in a rodent lung can be determined by homogenizing the rodent lung in a buffer (e.g., phosphate buffered saline (PBS)), centrifuged (e.g., at 10,000 rpm). The supernatant can be analyzed by plaque assay on mammalian cells, such as Vero cells (e.g., Vero E6 cells) to quantitate levels of virus remaining after treatment with an antagonist A standard plaque assay can be used, e.g., a plaque assay described in Page et al. (2012) Induction of alternatively activated macrophages enhances pathogenesis during severe acute respiratory syndrome coronavirus infection, J Virol 86:13334-43349. In some examples, the Page et al, plaque assay can be modified by leaving plates for 3 days for plaques to appear.
In some embodiments, less inflammation (e.g., interstitial or peri-vascular inflammation), fewer inflammatory cells, and/or less bronchiolar cuffing, e.g., determined by histological analysis, in a lung sample of a rodent treated with an antagonist prior to or after MERS-CoV infection compared to a control lung sample can indicate that the antagonist is effective in treating or preventing a MERS-CoV infection. For example, a control lung sample can be from a rodent infected with MERS-CoY that is untreated with an antagonist, e.g., untreated before and/or after infection.
The rodents described herein are useful for the efficient testing of drugs and vaccines for MERS-CoV, e.g., to demonstrate safety and efficacy prior to clinical testing in humans. They permit rapid identification and/or validation of therapeutics/prophylactics, e.g., within several weeks of testing,
Definitions
Homologous amino acid residues are residues that share similar characteristics or properties. Characteristics or properties of an amino acid residue are based on, e.g the structure of the polypeptide backbone, for example, a sheet or helical conformation, the charge or hydrophobicity of the residue, and/or the bulk of the side chain(s). For example, homologous residues are similar in side chain properties, e.g., polarity, charge, size, aromaticity, and/or hydrophobicity.
The term, “about” refers to a stated value plus or minus another amount; thereby establishing a range of values. In certain embodiments, “about” indicates a range relative to a base (or core or reference) value or amount plus or minus up to 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 015%, 0.5%, 0.25% or 0,1%. For example, about refers to a range of +/- 5% below and above the recited numbers, numbers of nucleotide bases.
The term “operably linked” as used herein refers to positions of components so described, e.g., nucleotide sequences, are in a relationship permitting them to function in their intended manner.
As used herein, the term “protein” includes polypeptides, peptides, fragments of polypeptides, and fusion polypeptides.
As used herein, a “nucleic acid” refers to two or more deoxyribonucleotides and/or ribonucleotides covalently joined together in either single or double-stranded form.
The term “replacement” in reference to gene replacement refers to placing exogenous genetic material at an endogenous genetic locus, thereby replacing all or a portion of the endogenous gene with an orthologous or homologous nucleic acid sequence. In one instance, an endogenous non-human gene or fragment thereof is replaced with a corresponding human gene or fragment thereof. A corresponding human gene or fragment thereof is a human gene or fragment that is an ortholog of, a homolog of, or is substantially identical or the same in structure and/or function, as the endogenous non-human gene or fragment thereof that is replaced.
As used herein, the term “rodent” refers to any member of the order Rodentia. Examples of rodents include, without limitation, mice, rats, squirrels, prairie dogs, porcupines, beavers, guinea pigs, and hamsters. In one embodiment, a rodent is a rat. In another embodiment, a rodent is a mouse.
Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
As used herein, the singular terms “a,” “an”, and “the” include the plural reference unless the context clearly indicates otherwise.
It is intended that every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.
The following examples are provided for illustrative purposes only and not intended to limit the invention in any manner.
Replacement of the Endogenous Mouse Dpp4 Gene With a Human DPP4 Gene
The 81.8 kb human DPP4 gene containing exon 2 through exon 26 and a portion of the 3′ untranslated region of the human DPP4 gene replaced 78.8 kb of the murine Dpp4 gene locus spanning exon 2 through the stop codon in exon 26. See
A targeting construct for replacing the mouse with the human DPP4 gene in a single targeting step was constructed using VelociGenee® genetic engineering technology (see Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech, 21(6):652-659). Mouse and human DPP4 DNA were obtained from bacterial artificial chromosome (BAC) clones RP23-362N15 and RP11-681,22, respectively. Briefly, an SgrDI linearized targeting construct generated by gap repair cloning containing mouse Dpp4 upstream and downstream homology arms flanking 82 kb of human DPP4 sequence extending from intron 1 upstream of exon 2 through exon 26, including the stop codon and a portion of the 3′ untranslated region (genomic coordinates of the entire human DPP4 gene: GRCh38: chr2:162,848,755-162,931,052 (- strand)), and a foxed neo selection cassette, was electroporated into VGB6 mouse embryonic stem (ES) cells (derived from C57BL/6N mice). Correctly targeted ES cells (MAID 7326) were further electroporated with a transient Cre-expressing vector to remove the drug selection cassette. Targeted ES cell clones without drug cassette (MAID 7327) were introduced into an 8-cell stage SW mouse embryo by the VelociMousee® method (see, U.S. Pat. Nos. 7,294,754, 7,576,259, 7,659,442, and Poueymirou et al. (2007) F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech. 25(1):91-99). VelociMice® (F0 mice fully derived from the donor ES cell) bearing the humanized DPP4 gene were identified by genotyping for loss of mouse allele and gain of human allele using a modification of allele assay (see, Valenzuela et al. (2003)).
Correctly targeted ES cell clones were identified by a loss-of-native-allele (LONA) assay (Valenzuela et al. 2003) in which the number of copies of the native, unmodified Dpp4 gene were determined by two TaqMan™ quantitative polymerase chain reactions (qPCRs) specific for sequences in the mouse Dpp4 gene that were targeted for deletion. The qPCR assays comprised the following primer-probe sets (written 5 ′to 3′): upstream forward primer, TCGCCACTGT GCCTAACATA G (SEQ ID NO:1); upstream reverse primer, GCGGGACTAA ACTGGAACAT TC (SEQ ID NO2); upstream probe, FAM-TCAGTCAACT TCTTCTGGGT TGTTTCC-BHQ (SEQ ID NO:3); downstream forward primer, CAGCTCTGGT GGAGAACTAG AC (SEQ ID NO:4); downstream reverse primer, GGAGGICCTC GGTCTTTAGA AG (SEQ ID NO:5); downstream probe, FAM-TCACACTTAG GCTTATAAAC CATTCCCGT-BHQ (SEQ ID NO:6); in which FAM refers to the 5-carboxyfluorescein fluorescent probe and BHQ refers to the fluorescence quencher of the black hole quencher type (Biosearch Technologies), DNA purified from ES cell clones that have taken up the targeting vector and incorporated in their genomes was combined with TaqMan™ Gene Expression Master Mix (Life Technologies) according to the manufacturer's suggestions in a 384-well PCR plate (MicroAmp™ Optical 384-Well Reaction Plate, Life Technologies) and cycled in an Applied Biosystems Prism 7900HT, which collects fluorescence data during the course of the PCRs and determines a threshold cycle (Ct), the fractional PCR cycle at which the accumulated fluorescence reaches a pre-set threshold. The upstream and downstream DPP4-specific qPCRs and two qPCRs for non-targeted reference genes were run for each DNA sample. The differences in the Ct values (ΔCt) between each DPP4-specific qPCR and each reference gene qPCR were calculated, and then the difference between each Ct and the median ΔCt for all samples assayed was calculated to obtain ΔΔCt values for each sample. The copy number of the DPP4 gene in each sample was calculated from the following formula: copy number=2×2−ΔΔCt. A correctly targeted clone, having lost one of its native copies, will have a Dpp4 gene copy number equal to one. Confirmation that the human DPP4 gene sequence replaced the deleted mouse Dpp4 gene sequence in the humanized allele was confirmed by a TaqMan™ qPCR assay that comprises the following primer-probe sets (written 5 ′to)3′ : human upstream forward primer, GCGGTCTCCC TCTTCTAACG (SEQ ID NO:7); human upstream reverse primer, GCAAGCCGAG CAGATCAAG (SEQ ID NO:8); human upstream probe, FAM-ACTCCCACCT GCAAATCCTG CTGC-BHQ (SEQ ID NO:9); human downstream forward primer, AACCGCACTG GCATATGGA (SEQ ID NO:10); human downstream reverse primer, TACAAGGTAG TCTGGGATTA CTAACAAAA (SEQ ID NO:11); human downstream probe, FAM-ACATTTATCT AGAAAGGCTC-BHQ (SEQ ID NO:12).
The same LONA assay is used to assay DNA purified from tail biopsies for mice derived from the targeted ES cells to determine their DPP4 genotypes and confirm that the humanized DPP4 allele is transmitted through the germline. Two pups heterozygous for the replacement are bred to generate a mouse that is homozygous for the replacement of the endogenous mouse Dpp4 gene by the human DPP4 gene. Pups that are homozygous for the replacement are used for phenotyping.
The upstream junction of the murine Dpp4 locus and the sequence containing they human DPP4 gene is designed to be within 5′-AGGAGAGAAG CCAACAAGAT CATAAGATCA TGCTCAGGGC CAAAATTCAA GGGCTTCTGC (CGTCGACG) GCCTTAGAGA ACTCCAACTG GCGCACTCCA GACGCCACCC CCACCCCCAG CCCGCGGTCT CCCTCTTCTA ACGCACTCCC ACCTGCAAAT (SEQ ID NO:13), wherein the human DPP4 sequences are italicized, and the SgrDI restriction site is bracketed. The downstream junction of the sequence containing the human DPP4 gene and the foxed neo selection cassette is designed to be within 5 ′-TTATTCCAGG GAACTATGAT GAGGCTTATA TAAGAACGAA TAAGATCAGA AATATCATTC TGCCAGTTCT TATGGCTCAG ctcgag(ataa cttcgtataa tgtatgctat acgaagttat) atgcatggcc tccgcgccgg gttttggcgc ctcccgcggg (SEQ ID NO:14), wherein the human DPP4 sequences are italicized, the neo cassette sequences are in lower case, and the loxP site is bracketed. The downstream junction of the sequence of the foxed neo selection cassette and the murine Dpp4 locus is designed to be within 5′-atgtctgga(a taacttcgta taatgtatgc tatacgaagt tat)gctagti actataacgg tcctaaggta gcgagcMgc CAGCATAGCT CTCCATAGCT TATTTAAGAC CACATTTGTT CTCATTATCT CAAAAGTGCA CfGTTAAGAT GAAGATCTTA (SEQ ID NO:15), wherein the neo cassette sequences are in lower case, and the loxP site is bracketed. After removal of the neo selection cassette, the junction of the sequence containing the human DPP4 gene, the loxP site remaining after removal of the neo selection cassette, and the murine Dpp4 locus is designed to be within 5′-TATTCCAGGG AACTATGATG AGGCTTATAT AAGAACGAAT AAGATCAGAA ATATCATTCT GGCAGTTCTT ATTGGCTCAG ctcgag(ataa cttcgtataa tgtatgctat acgaagttat) gctagtaact ataacggtcc taaggtagcg agctagcCA GCATAGCTCT CCATAGCTTA TTTAAGACCA CATTTGTTCT CATTATCTCA AAAGTGCACT GTTAAGATGA AGATCTAAT AATGTTCCAT TGAGACATTT CAGGCTGCTT TCTCCAGTTT TACACCTGCA ATCCTAACTA AGGATGCCTG TCCCCAGAAC (SEQ ID NO:16), wherein the human DPP4 sequences are italicized, the neo cassette sequences are in lower case, and the loxP site is bracketed.
Middle East Respiratory Syndrome—Coronavirus (MERS-CoV) is a newly emergent virus that causes severe acute respiratory disease. The receptor for MERS-CoV is dipeptidyl peptidase IV (DPP4) (see Raj et al. (2013) Dipeptidyl Peptidase 4 is a Functional Receptor for the Emerging human Coronavirus-EMC, Natuere 495(7440):251-254). In vivo testing of anti-viral molecules requires an animal model, e.g., a small animal model, such as a rodent (e.g., mouse or rat), that is susceptible to MERS-CoV infection. However, recent studies have shown that mouse Dpp4 cannot support MERS-CoV infection (see, e.g, Cockrell et al. (2014) Mouse Dipeptidyl Peptidase is Not a FunctionA Receptor for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Infection, J. Virol. 88(9)S195-5199; and Coleman et al. (2014) Wild-Type and Innate Immune-Deficient Mice are Not Susceptible to the Middle East Respiratory Syndrome Coronavirus, J. Gen. Virol. 95(2):408-412), at least in part because the MERS-CoV Spike protein interacts with human, but not mouse, DPP4 (see, e.g., Coleman et al. (2013); and Raj et al. (2013)). Sequence comparison of the sequences of mouse and human DPP4 revealed that the amino acids that have previously been identified as contact sites between MERS-CoV spike (S) protein and its receptor differ between the two species. In addition, expression of human DPP4 in mouse cells allows for MERS-CoV virus entry and propagation, indicating that entry of the virus is the limiting step in infection of mouse cells, and that the lack of interaction between mouse DPP4 and the MERS-CoV glycoprotein defines the species tropism in vitro. See, e.g., Lu et at (2013) Molecular basis of binding between novel human coronavirus MERS-CoV and its receptor CI)26, Nature. 500(7461):227-31; and Cockrell et al. (2014) Mouse Dipeptidyl Peptidase is Not a Functional Receptor for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Infection, J. Virol. 88(9):5195-5199
As a consequence, normal mouse strains cannot be used to measure the efficacy of therapeutics targeting MERS-CoV, Zhao et al. (2014) Rapid Generation of a Mouse Model for Middle East Respiratory Syndrome, Proc. Natl. Acad. Sci. USA 111(13):4970-4975 have expressed human DPP4 in mice by adenovirus transduction, thereby allowing for MERS-CoV infection. However, this adenovirus model has several limitations, including: (a) the virus is cleared rapidly from infected mice; (b) there is a loss of human DPP4 expression over time; (c) the tissue distribution of virally-transduced DPP4 does not reflect expression seen in mice or humans; and (d) adenovirus infection induces an interferon response.
To generate a mouse model for MERS-CoV infection, humanized DPP4 mice were generated as described above in Example 1. As shown in
Two F0 humanized DPP4 mice were infected intranasally with MERS-CoV (Jordan strain) or mock treated with PBS. Four days post-infection, MERS-CoV RNA was quantified in the lungs by real-time PCR using primers specific for the replicative form of the MERS-CoV genome. Data was normalized to the amount of PCR product obtained from the lungs of the mock-infected mice (arbitrarily set at 1).
In addition, 6 to 8 week old mice were inoculated intranasally with MERS-CoV, e.g., 2×105 pfu of MERS-CoV (Jordan). No mortality or clinical signs of disease were observed up to day 4 after inoculation. On days 2 and 4 post-inoculation, mice were euthanized and their lungs were dissected. To obtain virus RNA levels, lungs were homogenized in Trizol®, RNA extracted, and analyzed by real-time PCR using primers specific to MERS-CoV (
To obtain virus titers, lungs were homogenized in phosphate buffered saline (PBS), clarified by centrifugation, and titered on Vero E6 cells (
Robust MERS-CoV replication in the lungs was evident at 2 and 4 days post-infection. RNA quantification, using a primer set specific for MERS-CoV leader, which was designed to only amplify replicating MERS-CoV, demonstrated high levels of MERS-CoV replicating RNA in lungs collected at day 2, and these levels were maintained through day 4 post-infection (
Also, lungs from humanized DPP4 mice intranasally inoculated with either MERS-CoV (Jordan strain) or PBS (mock infected) were analyzed for pathological changes (
The above data shows that humanized DPP4 mice, such as those described herein, are susceptible to MERS-CoV infection. The data also demonstrate that the humanized DPP4 mice described herein are an in vivo model of MERS-CoV infection that recapitulates the pathology, e.g, pathological sequelae, that is seen in MERS-CoV infection of humans.
Thus, humanized DPP4 mice are a robust model of MERS-CoV that is useful to assess MERS-CoV treatment in vivo. For example, the humanized DPP4 mice are appropriate host animals to measure the pharmacokinetics, pharmacodynamics and therapeutic efficacy of therapeutic molecules that target MERS-CoV.
Next, a dose-response study of weight as a function of time post-infection of MERS-CoV was conducted in humanized DPP4 mice. Mice were infected with either MERS-CoV (Jordan strain) or PBS (mock infected) as described above and were analyzed for weight loss, which is a sign of productive infection, over a period of seven days. As shown in
The lungs of these mice were also examined histologically for inflammation according to the methods described above. As shown in
Transgenic mice were generated that contain the human DPP4 gene, for which the sequence and genomic information is shown in
To generate the BAC transgenic mice, each BAC DNA was electroporated into VGB6 mouse embryonic stem (ES) cells (derived from C57BL/6N mice). ES cells containing the coding region of the human DPP4 gene, as well as promoter regions of the gene, were introduced into an 8-cell stage SW mouse embryo by the SW mouse embryo by the VelociMouse® method (see, e.g., U.S. Pat. Nos, 7,294,754, 7,576,259, 7,659,442, and Poueymirou et al. (2007) F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses Nature Biotech. 25(1):91-99).
Human gain of allele assays were used to screen ES cell clones for ones that contained copies of the human DPP4 gene along with promoter regions of the gene. Human gain of allele assays were also used to identify VelociMice® (F0 mice fully derived from the donor ES cell) bearing the humanized DPP4 gene along with promoter regions of the gene.
Briefly, genomic DNA was extracted from ES cell clones using standard methods and tested in a TaqMan™ quantitative PCR (qPCR) assay using two sets of primer-probes to detect a human DNA sequence upstream (7333 hTU) and downstream (7333 hTD) of the human DPP4 coding sequence (
The 7333 hTU primer-probe set (written 5′ to 3′) was: human upstream forward primer, TGGCTTATTCTCTATTCCTCACCTA (SEQ ID NO: 18); human upstream probe, FAM-TGCTTTCCCTCCTCCCTTCTGA-BHQ (SEQ ID NO: 19); human upstream reverse primer, GGCCTTAGCCCAGAAACTG (SEQ ID NO: 20). The 7333 hTD primer-probe set (written 5′ to 3′) was: human downstream forward primer, TGCAGACTTGTCTTGACATTCATA (SEQ ID NO: 21); human downstream probe, CAL-AGCCTCTGCAGACACAGGAATGGC-BHQ (SEQ ID NO: 22); and human downstream reverse primer, TCTGGGCACTGGTGTACTC (SEQ ID NO: 23); in which FAM and CAL refer to the 5-carboxyfluorescein and CAL Orange fluorescent probes, respectively, and BHQ refers to the fluorescence quencher of the black hole quencher type (Biosearch Technologies).
For example, genomic DNA from ES cell clones was combined with TaqMan™ Gene Expression Master Mix (Life Technologies) according to the manufacturer's suggestions in a 384-well PCR plate (MicroAmp™ Optical 384-Well Reaction Plate, Life Technologies) and cycled in an Applied Biosystems Prism 7900HT, which collects fluorescence data during the course of the PCRs and determines a threshold cycle (Ct), the fractional PCR cycle at which the accumulated fluorescence reaches a pre-set threshold. The upstream and downstream DPP4-specific qPCRs and two qPCFts for non-DPP4 reference genes were run for each DNA sample. The differences in the Ct values Ct) between each DPP4-specific qPCR and each reference gene qPCR were calculated, and then the difference between each Ct and the median
Ct for all samples assayed was calculated to obtain
Ct values for each sample. The copy number of the DPP4 gene in each sample was calculated from the following formula: copy number=2×2−
ct. A clone containing at least one copy of the human DPP4 plus promoter regions integrated into the chromosome had a DPP4 gene copy number equal to or greater than one.
The same human gain of allele assay was used to assay DNA purified from tail biopsies for mice derived from the ES cells to confirm that the humanized DPP4 allele along with the human 5′ flanking regions were transmitted through the germline.
Using the BAC insertion and screening methods described herein, two transgenic mice with DNA encoding human DPP4 were confirmed. BAC RP11-68L22 was used to generate ES cell clones and transgenic mice referred to as MAID 7333, and BAC RP11-345J9 was used to generate ES cell clones and transgenic mice referred to as MAID 7334.
The protein encoded by the humanized DPP4 nucleic acid sequence in the MAID 7333 and 7334 mice had the amino acid sequence shown in
Transgenic mice with the humanized DPP4 gene and flanking promoter regions were tested for their ability to be infected by MERS-CoV and to serve as a model for assessing therapeutic molecules for treating or preventing MERS-CoV.
Transgenic MAID 7333 mice (e.g., generated by the methods described in Example 3) were treated with 200 μg of antibodies directed against MERS-CoV spike protein or isotype controls by intraperitoneal injection (ip). One day after antibody injection, the mice were infected intranasally with MERS-CoV. Four days after infection, lungs of the mice were harvested, and viral RNA levels were measured using real-time PCR (RT-PCR). In particular, levels of the genomic RNA (UpE) or replicating RNA (leader) (specific for the replicative form of the MERS-CoV genome) of MERS-CoV were measured.
The RT-PCR data is shown in the table below.
1Averages (% of isotype control)
Treatment of transgenic mice with the antibodies decreased viral RNA levels (both UpE and Leader) by about 50-fold to about 500-fold.
The data described herein show that transgenic mice generated by targeted integration methods (Example 1) and random BAC insertion methods (Example 3) with human DPP4 were susceptible to infection by MERS-CoV. In addition, anti-MERS-CoV antibodies blocked infection in transgenic mice in vivo. Thus, transgenic mice with human DPP4 (e.g., generated by the methods described herein) are useful for evaluating the efficacy of therapeutics (e.g., antibodies) that target the MERS-CoV virus.
The humanized DPP4 mice described herein were used to evaluate the prophylactic capability of the two monoclonal antibodies in vivo. Mice were i p injected with a dose range of anti-MERS-CoV antibodies-200 μg, 20 μg or 2 μg of anti-MERS-CoV spike protein antibody 2 (Ab 2), anti-MERS-CoV spike protein antibody 4 (Ab 4), or 200 μg of human IgG1 (hIgG1) isotype control antibody—24 hours before intranasal infection with 1×105pfu of MERS-CoV (Jordan strain). Ab 2 and Ab 4 were fully human anti-MERS-CoV spike protein antibodies, RNA was extracted from the mouse lungs and analyzed by quantitative PCR as described above. For example, qPCR data was analyzed using the delta Ct method, with an uninfected control set to 1, Percent MERS-CoV RNA detected was expressed relative to levels of RNA detected in infected mice treated with isotype-matched control antibodies (
Both antibodies significantly decreased MERS-CoV specific RNA levels in the lungs by over 2 logs at the 200 μg per mouse dose, compared to the isotype matched control antibody (
Histological analysis was also performed at 4 days post-infection on lungs from mice treated at 24 hours pre-infection with Ab 2, Ab 4, or hIgG1 isotype control antibody (
Lungs from mice pre-treated with hIgG1 isotype control mice displayed significant lung pathology with increased interstitial inflammation, perivascular cuffing, and thickening of alveolar septa. Mice treated with 200 μg of either Ab 2 or Ab 4 had reduced inflammation with minimal foci of inflammatory cells in the interstitium, minor bronchiolar cuffing, and less alveolar wall thickening. In mice pre-treated with 20 μg of Ab 2 and Ab 4, there were moderate levels of perivascular cuffing and interstitial inflammation compared to the higher dose antibody group. The 2 μg antibody pre-treated group had similar pathology to the hIgG1 isotype control, displaying significant interstitial inflammation and predominant peri-vascular inflammation. Blinded histological scoring demonstrated reduced inflammation scores for treated mice (
Thus, anti-MERS-CoV antibodies, such as Ab 2 and Ab 4, were effective in an in vivo model of MERS-CoV infection—the antibodies blocked MERS-CoV infection and disease in vivo when injected before infection, e.g., 1 day before infection.
To determine the therapeutic effect (e.g., ability to inhibit MERS-CoV replication and lung pathology after infection) of anti-MERS-CoV antibodies (e.g., Ab 2 or Ab 4), humanized DPP4 mice were infected with MERS-CoV. At 24 hours post-infection, the mice were injected i.p, with either 500 μg of hIgG1 isotype control or Ab 2 at 500 μg or 200 μg. At 4 days post-infection, mice were euthanized and mouse lungs analyzed for viral RNA, virus titer, and lung pathology. Both the 500 μg and 200 μg doses of Ab 2 reduced viral RNA levels by about 10 fold in the lungs of mice compared to control antibody treated mice (
Histological analysis was also performed on mice treated 24 hours post-infection with higG1 control antibody, 500 μg Ab 2, or 200 μg Ab 2 (
This application is a continuation of U.S. patent application Ser. No. 14/723,855, filed May 28, 2015, now U.S. Pat. No. 9,497,945, which claims priority to U.S. Provisional Patent Application No. 62/005,476, filed May 30, 2014, U.S. Provisional Patent Application No. 62/051,626, filed Sep. 17, 2014, and U.S. Provisional Patent Application No. 62/072,692, filed Oct. 30, 2014, the disclosures of each of which are incorporated by reference herein in their entireties.
Number | Name | Date | Kind |
---|---|---|---|
6586251 | Economides et al. | Jul 2003 | B2 |
7294754 | Poueymirou et al. | Nov 2007 | B2 |
7576259 | Poueymirou et al. | Aug 2009 | B2 |
7659442 | Poueymirou et al. | Feb 2010 | B2 |
8110720 | Ferrara | Feb 2012 | B2 |
8759105 | Economides et al. | Jun 2014 | B2 |
9497945 | Kyratsous et al. | Nov 2016 | B2 |
9532555 | Kyratsous | Jan 2017 | B2 |
20040120924 | Hone et al. | Jun 2004 | A1 |
20150351372 | Kyratsous et al. | Dec 2015 | A1 |
Number | Date | Country |
---|---|---|
02066630 | Aug 2002 | WO |
WO-02066630 | Aug 2002 | WO |
2004104216 | Dec 2004 | WO |
WO-2004104216 | Dec 2004 | WO |
WO-2004104216 | Dec 2004 | WO |
WO-2006128163 | Nov 2006 | WO |
WO-2006128163 | Nov 2006 | WO |
WO-2010110914 | Sep 2010 | WO |
WO-2010110914 | Sep 2010 | WO |
2012071592 | May 2012 | WO |
WO-2012071592 | May 2012 | WO |
WO-2012071592 | May 2012 | WO |
WO-2013063556 | May 2013 | WO |
WO-2014045254 | Mar 2014 | WO |
WO-2014045254 | Mar 2014 | WO |
2015088643 | Jun 2015 | WO |
WO-2015184164 | Dec 2015 | WO |
Entry |
---|
Abbott, C.A. et al. (1994). “Genomic organization, exact localization, and tissue expression of the human CD26 (dipeptidyl peptidase IV) gene,” Immunogenetics 40(5):331-338. |
Auerbach, W. et al. (Nov. 2000). “Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines,” BioTechniques 29(5): 1024-1032. |
Bernard, A.M. et al. (Dec. 20, 1994). “Structure of the mouse dipeptidyl peptidase IV (CD26) gene,” Biochemistry 33(50):15204-15214. |
Center for Disease Control and Prevention (Oct. 4, 2012). “Severe Respiratory Illness Associated with a Novel Coronavirus—Saudi Arabia and Qatar, 2012,” Morbidity and Mortality Weekly Report (MMWR), MMWR Early Release, located at <http://www.cdc.gov/mmwr/preview/mmwrhtml/mm6140a5.htm?s_cid=mm6140a5_w>, last visited on Apr. 23, 2016, 3 pages. |
Cockrell, A.S. et al. (May 2014, e-published Feb. 26, 2014). “Mouse Dipeptidyl Peptidase is Not a Functional Receptor for Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Infection,” J. Virol. 88(9):5195-5199. |
Coleman, C.M. et al. (Feb. 2014, e-published Nov. 6, 2013). “Wild-Type and Innate Immune-Deficient Mice are Not Susceptible to the Middle East Respiratory Syndrome Coronavirus,” J. Gen. Virol. 95(Pt 2):408-412. |
Festing, M.F. et al. (Aug. 1999). “Revised Nomenclature for Strain 129 Mice,” Mamm Genome 10(8):836. |
Gama Sosa, M.A. et al. (Mar. 2010, e-published Nov. 25, 2009). “Animal transgenesis: an overview,” Brain Struct Funct 214(2-3):91-109. |
GenBank Accession No. KC776174.1, located at <http:www.ncbi.nlm.nih.gov/nuccore/KC776174.1>, last visited Aug. 10, 2015, 12 pages. |
GenBank Accession No. JX869059.2 located at <http:www.ncbi.nlm.nih.gov/nuccore/JX869059.2>, last visited Aug. 10, 2015, 13 pages. |
Gerich, J. (Dec. 4, 2013). “Pathogenesis and Management of Postpandrial Hyperglycemia: Role of Incretin-Based Therapies,” Intl. J. Gen. Med. 6:877-895. |
International Search Report dated Sep. 18, 2015, for PCT Application No. PCT/US2015/033024, filed May 28, 2015, 7 pages. |
Kuroiwa, Y. et al. (Jul. 2004, e-published Jun. 6, 2004). “Sequential targeting of the genes encoding immunoglobulin-mu and prion protein in cattle,” Nat Genet 36(7):775-780. |
Lu, G. et al. (Aug. 8, 2013, e-published Jul. 7, 2013). “Molecular Basis of Binding Between Novel Human Coronavirus MERS-CoV and Its Receptor CD26,” Nature 500(7461):227-231. |
Moreadith, R.W. et al. (Mar. 1997). “Gene targeting in embryonic stem cells: the new physiology and metabolism,” J Mol Med (Berl) 75(3):208-216. |
Mullins, L.J. et al. (Apr. 1, 1996). “Transgenesis in the rat and larger mammals,” J Clin Invest 97(7):1557-1560. |
Mulvihill, E.E. et al. (Dec. 2014, e-published Sep. 12, 2014). “Pharmacology, physiology, and mechanisms of action of dipeptidyl peptidase-4 inhibitors,” Endocr Rev 35(6):992-1019. |
Page, C. et al. (Dec. 2012). “Induction of Alternatively Activated Macrophages Enhances Pathogenesis During Severe Acute Respiratory Syndrome Coronavirus Infection,” J Virol 86(24):13334-13349. |
Pascal, K.E. et al. (Jul. 14, 2015, e-published Jun. 29, 2015). “Pre- and Postexposure Efficacy of Fully Human Antibodies Against Spike Protein in a Novel Humanized Mouse Model of MERS-CoV Infection,” Proc. Natl. Acad. Sci. USA 112(28):8738-8743. |
Pascal, K.E. et al. (2015). “Supporting Information,” Proc. Natl. Acad. Sci. USA, 10 pages. |
Pera, M.F. et al. (Jan. 2000). “Human embryonic stem cells,” J Cell Sci 113(Pt1):5-10. |
Poueymirou, W.T. et al. (Jan. 2007, e-published Dec. 24, 2006). F0 Generation Mice Fully Derived From Gene-Targeted Embryonic Stem Cells Allowing Immediate Phenotypic Analyses, Nat Biotechnol 25(1):91-99. |
Raj, V.S. et al. (Mar. 14, 2013). “Dipeptidyl Peptidase 4 is a Functional Receptor for the Emerging Human Coronavirus-EMC,” Nature 495(7440):251-254. |
Reardon, S. (Jan. 30, 2014). “Biologists Make First Mouse Model for MERS,” Nature News located at http://www.nature.com/news/biologists-make-first-mouse-model-for-mers-1.14634, last visited Sep. 8, 2015. |
Ristevski, S. (Feb. 2005). “Making better transgenic models: conditional, temporal, and spatial approaches,” Mol Biotechnol 29(2):153-163. |
Sigmund, C.D. (Jun. 2000). “Viewpoint: are studies in genetically altered mice out of control?” Arteroscler Throm Vasc Biol 20(6):1425-1429. |
Simeoni, L. et al. (Sep. 2002). “Human CD26 expression in transgenic mice affects murine T-cell populations and modifies their subset distribution,” Human Immunology 63(9):719-730. |
Smith, K.R. (Oct. 9, 2002). “Gene transfer in higher animals: theoretical considerations and key concepts,” J Biotechnol 99(1):1-22. |
Tong, C. et al. (Sep. 9, 2010). “Production of p53 gene knockout rats by homologous recombination in embryonic stem cells,” Nature 467(7312):211-213. |
Valenzuela, D.M. et al. (Jun. 2003, e-published May 5, 2003). High-Throughput Engineering of the Mouse Genome Coupled with High-Resolution Expression Analysis, Nature Biotechnology 21 (6):652-659. |
Van Der Weyden L. et al. (Dec. 3, 2002, e-published Dec. 3, 2002). “Tools for targeted manipulation of the mouse genome,” Physiol Genomics 11(3):133-164. |
Written Opinion dated Sep. 18, 2015, for PCT Application No. PCT/US2015/033024, filed May 28, 2015, 7 pages. |
Zhao, J. et al. (Apr. 1, 2014). Rapid Generation of a Mouse Model for Middle East Respiratory Syndrome, Proc. Natl. Acad. Sci. USA 111(13):4970-4975. |
Raj V.S. et al., “Adenosine Deaminase Acts as a Natural Antagonist for Dipeptidyl Peptidase 4-Mediated Entry of the Middle East Respiratory Syndrome Coronavirus”, Journal of Virology 88(3):1834-1838 (Feb. 1, 2014). |
Tang X-C et al, “Identification of Human Neutralizing Antibodies Against MERS-CoV and Their Role in Virus Adaptive Evolution”, PNAS 111(19):E2018-E2026 (May 13, 2014). |
European Extended Search Report dated Jul. 3, 2018 received European Patent Application No. 18 17 3004.5. |
Abbott C.A. et al.,“Genomic Organization, Exact Localization, and Tissue Expression of the Human CD26 (Dipeptidyl Peptidase IV) Gene”, Immunogenetics 40:331-338 (1994). |
Coleman C.M. et al., “Wild-Type and Innate Immune-Deficient Mice are Not Susceptible to the Middle East Respiratory Syndrome Coronavirus”, Journal of General Virology 95:408-412 (2014). |
Dennis, Jr. M.B., “Welfare Issues of Genetically Modified Animals”, ILAR Journal 43(2)100-109 (2002). |
Reardon S., “Biologists Make First Mouse Model for MERS”, Nature NEWS, 4 pages (Jan. 30, 2014). |
Rybchin V.N., “Basics of Genetic Engineering”, Textbook for High Schools, Saint-Petersburg, Publishing House SPbSTU 522:410-417 (2002). |
Simeoni L. et al., “Human CD26 Expression in Transgenic Mice Affects Murine T-Cell Populations and Modifies Their Subset Distribution”, Human Immunology 63:719-730 (2002). |
Zhou H. et al., “Developing tTA Transgenic Rats for Inducible and Reversible Gene Expression”, International Journal of Biological Sciences 5(2):171-181 (2009). |
Canadian Examination Report dated May 4, 2017 received in Canadian Patent Application No. 2,947,899. |
Russian Search Report dated Aug. 15, 2017 received in Russian Patent Application No. 2016150679, together with an English-language translation. |
Russian Office Action dated Aug. 22, 2017 received in Russian Patent Application No. 2016150679, together with an English-language translation. |
Number | Date | Country | |
---|---|---|---|
20170112107 A1 | Apr 2017 | US |
Number | Date | Country | |
---|---|---|---|
62072692 | Oct 2014 | US | |
62051626 | Sep 2014 | US | |
62005476 | May 2014 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 14723855 | May 2015 | US |
Child | 15295955 | US |