HYPERTROPHIC CARDIOMYOPATHY

Information

  • Patent Application
  • 20070207473
  • Publication Number
    20070207473
  • Date Filed
    November 01, 2006
    19 years ago
  • Date Published
    September 06, 2007
    19 years ago
Abstract
This document provides methods and materials related to identifying, assessing, and predicting hypertrophic cardiomyopathy (HCM) in mammals. For example, methods and materials for using mutations (e.g., mutations in ZASP and MYBPC3 nucleic acids) to identify, assess, and predict HCM in mammals (e.g., humans) are provided.
Description
BACKGROUND

1. Technical Field


This document provides methods and materials related to identifying, assessing, and predicting hypertrophic cardiomyopathy (HCM) in mammals. For example, this document provides methods and materials for using mutations (e.g., mutations in ZASP and MYBPC3 nucleic acids) to identify, assess, and predict HCM in mammals (e.g., humans).


2. Background Information


Once thought to be a rare disease, HCM is now understood as a relatively common, potentially heritable disorder affecting about 1 in 500 people. Although the overall annual incidence of sudden death is around one percent, HCM represents the most common identifiable cause of sudden death in young people. HCM is characterized morphologically by thickening of the left ventricular wall, fibrosis, and myocyte disarray in the absence of extenuating extrinsic factors such as hypertension and aortic valve disease. The clinical presentation is underscored by pronounced phenotypic heterogeneity ranging from an asymptomatic course to sudden cardiac death during childhood.


SUMMARY

This document provides methods and materials related to identifying, assessing, and predicting HCM in mammals. For example, this document provides methods and materials for using mutations (e.g., mutations in ZASP and MYBPC3 nucleic acids) to identify, assess, and predict HCM in mammals (e.g., humans). Determining whether or not mammals such as humans have one or more of the mutations provided herein can allow clinicians to determine whether or not the mammal has HCM, is susceptible to develop HCM, is likely to develop HCM at an early age, or is likely to develop severe HCM. For example, the presence of multiple mutations associated with HCM can indicate that a human is susceptible to develop severe HCM. Such information can be used to guide therapeutic or preventive methods. As described herein, mammals having mutations associated with HCM can be identified by obtaining samples (e.g., blood samples) from the mammals and analyzing the samples using, for example, polymerase chain reaction, denaturing high-performance liquid chromatography, and DNA sequencing.


In general, one aspect of this document features a method for determining a human's susceptibility to develop hypertrophic cardiomyopathy. The method comprises, or consists essentially of, determining whether or not a human comprises genomic nucleic acid comprising one or more mutations listed in Table 1, where the presence of the one or more mutations indicates that the human is susceptible to develop hypertrophic cardiomyopathy. The determining step can comprise analyzing DNA, analyzing RNA, analyzing a polypeptide sample, or analyzing a blood sample from the human.


In another embodiment, this document features a method for determining whether or not a human comprises one or more mutations listed in Table 1. The method comprises, or consists essentially of, analyzing a sample from the human using polymerase chain reaction, denaturing high-performance liquid chromatography, or sequencing. The sample can be blood or genomic DNA.


In another embodiment, this document features a substantially pure amplification product comprising, or consisting essentially of, a nucleic acid molecule less than 2500 nucleotides in length, where the nucleic acid molecule comprises one or more mutations listed in Table 1.


In yet another embodiment, this document features an isolated polynucleotide having the ability to hybridize to a nucleic acid molecule comprising a mutation listed in Table 1 under hybridization conditions and not having the ability to hybridize to a second nucleic acid molecule not comprising said mutation under the same hybridization conditions. The polynucleotide, when used in an amplification reaction with a primer, can amplify the nucleic acid molecule and not the second nucleic acid molecule. The polynucleotide can be fluorescently or radioactively labeled.


Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.


The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.




DESCRIPTION OF THE DRAWINGS


FIG. 1 is a schematic diagram of the genomic structure of Z-band alternatively spliced PDZ-containing protein (ZASP). The intron-exon organization of ZASP is depicted in the top row. The middle and bottom rows depict the genomic structures of two alternatively spliced isoforms of ZASP found in heart. Solid black rectangles represent exons encoding PDZ domains. Diagonal rectangles represent ZM-motifs. Rectangles with horizontal lines represent LIM domains.



FIG. 2 is a schematic diagram of mutations found in HCM, DCM, LVNC, and MFM superimposed on the linear topology of ZASP. Open circles denote ASP mutations found in patients with HCM, and closed circles represent mutations found in patients with DCM. A target symbol indicates mutations that have been found both in DCM and HCM patients, and mutations denoted with an “X” were recently identified in myofibrillar myopathy (MFM) patients. An asterisk denotes a newly identified mutation. Black rectangles represent PDZ domains, boxes with diagonal lines represent ZM-motifs, and the box with horizontal lines represents three LIM domains.



FIG. 3A is a graph plotting the DHPLC elution profile of a heterozygous amplicon from exon 13 of ZASP. FIG. 3B contains sequence chromatograms of the wild-type and P615L alleles. FIG. 3C is an alignment of orthologous ZASP sequences from the indicated species indicating conservation of proline at position 615. FIG. 3D is a comparison of secondary structures of ZASP with leucine or proline at position 615, as predicted by PredictProtein.



FIG. 4 is a schematic diagram of mutations identified in MYBPC3. Vertical lines represent exons, and mutations identified in this cohort are indicated above their exonic location. *Newly identified mutations.



FIG. 5 is a pie chart indicating the distribution of sarcomeric mutations in patients with hypertrophic cardiomyopathy. The relative frequency of each genotype identified in the cohort of 389 unrelated patients is indicated as n (%). Each genotype is exclusive of patients with multiple mutations, who are included only in the “multiple mutations” subgroup.



FIG. 6 is a graph plotting age at diagnosis of genotyped subsets. Genotyped hypertrophic cardiomyopathy patients are grouped on the X-axis, and age at diagnosis is indicated on the Y-axis. Error bars=standard deviation. Statistically significant pairwise comparisons are indicated. Thick filament=beta-myosin heavy chain and regulatory myosin light chain; thin filament=troponin-T, troponin-I, alpha-tropomyosin, and alpha-actin. *p=0.003; ** p<0.0001; ***p<0.05 versus all other subgroups.



FIG. 7 is a graph plotting LVWT of genotyped subsets. Genotyped hypertrophic cardiomyopathy patients are grouped on the X-axis, and left ventricular wall thickness (LVWT) is indicated on the Y-axis. Error bars=standard deviation. Statistically significant pairwise comparisons are indicated. Thick filament=beta-myosin heavy chain and regulatory myosin light chain; thin filament=troponin-T, troponin-I, alpha-tropomyosin, and alpha-actin. *p=0.004; **p=0.03.



FIG. 8 is a listing of amino acid sequences of ZASP polypeptides (SEQ ID NO:2 and SEQ ID NO:4) and nucleic acid sequences encoding ZASP polypeptides (SEQ ID NO:1 and SEQ ID NO:3).



FIG. 9 is a listing of an amino acid sequence of a MYBPC3 polypeptide (SEQ ID NO:6) and a nucleic acid sequence encoding a MYBPC3 polypeptide (SEQ ID NO:5).




DETAILED DESCRIPTION

This document provides methods and materials related to detecting one or more mutations in ZASP and MYBPC3 nucleic acids. For example, this document provides methods for determining whether or not a mammal contains ZASP or MYBPC3 nucleic acid having a mutation linked to hypertrophic cardiomyopathy (HCM). The mammal can be any type of mammal including, without limitation, a mouse, rat, dog, cat, horse, sheep, goat, cow, pig, monkey, or human. The term “ZASP nucleic acid” as used herein refers to any nucleic acid that encodes a ZASP polypeptide or any fragment of such a nucleic acid. Examples of ZASP nucleic acid include, without limitation, the nucleic acid sequences set forth in FIG. 8 (SEQ ID NO:1 and SEQ ID NO:3) and the nucleic acid sequence set forth in GenBank® Accession Number NM007078. The term “MYBPC3 nucleic acid” as used herein refers to any nucleic acid that encodes a MYBPC3 polypeptide or any fragment of such a nucleic acid. Examples of MYBPC3 nucleic acid include, without limitation, the nucleic acid sequence set forth in FIG. 9 (SEQ ID NO:5) and the nucleic acid sequence set forth in GenBank® Accession Number NM000256.


The methods and materials provided herein can be used to determine whether or not ZASP or MYBPC3 nucleic acid of a mammal (e.g., human) contains a mutation or combination of mutations. Mutations in ZASP or MYBPC3 nucleic acid can include point mutations, insertions, and deletions (e.g., those mutations identified herein as being associated with HCM disease). In some embodiments, the methods and materials provided herein can be used to determine whether both alleles of ZASP or MYBPC3 of a mammal contain mutations (e.g., either the same mutation(s) on both alleles, or separate mutations on each allele), or whether only a single ZASP or MYBPC3 allele of the mammal contains a mutation. The identification of one or more mutations on an allele can be used to diagnose HCM in a mammal, typically when known clinical symptoms of HCM also are present. The identification of other mutations (e.g., sequence mutations not known to be associated with HCM) can be used to support a potential diagnosis of HCM. The identification of a mutation on only one ZASP or MYBPC3 allele can serve as an indicator that the mammal is a carrier.


Any suitable method can be used to detect a mutation within ZASP or MYBPC3 nucleic acid. For example, mutations can be detected by sequencing exons, introns, or untranslated sequences, denaturing high performance liquid chromatography (DHPLC; Underhill et al., Genome Res., 7:996-1005 (1997)), allele-specific hybridization (Stoneking et al., Am. J Hum. Genet., 48:370-382 (1991); and Prince et al., Genome Res., 11(1):152-162 (2001)), allele-specific restriction digests, mutation specific polymerase chain reactions, restriction fragment length polymorphism detection, single-stranded conformational polymorphism detection (Schafer et al., Nat. Biotechnol. 15:33-39 (1998)), infrared matrix-assisted laser desorption/ionization mass spectrometry (WO 99/57318), and combinations of such methods.


In some embodiments, genomic DNA can be used to detect one or more mutations within ZASP or MYBPC3 nucleic acid. Genomic DNA typically is extracted from a biological sample such as a peripheral blood sample, but can be extracted from other biological samples, including tissues (e.g., mucosal scrapings of the lining of the mouth or from renal or hepatic tissue). Routine methods can be used to extract genomic DNA from a blood or tissue sample, including, for example, phenol extraction. In some cases, genomic DNA can be extracted with kits such as the QIAamp® Tissue Kit (Qiagen, Chatsworth, Calif.), the Wizards® Genomic DNA purification kit (Promega, Madison, Wis.), the Puregene DNA Isolation System (Gentra Systems, Inc., Minneapolis, Minn.), and the A.S.A.P.3 Genomic DNA isolation kit (Boehringer Mannheim, Indianapolis, Ind.).


In some embodiments, RNA can be used to detect one or more mutations within ZASP or MYBPC3 nucleic acid. RNA is typically extracted from a biological sample (e.g., peripheral blood or mucosal scrapings). Methods for extracting RNA are known in the art and include phenol-chloroform and TRIzol® Reagent extraction and the use of kits such as RNeasy® (Qiagen), RNAgents® Total RNA Isolation System (Promega), and VERSAGENE™ RNA Purification Kit (Gentra).


An amplification step can be performed before proceeding with the detection method. For example, exons or introns of the ZASP or MYBPC3 nucleic acid can be amplified and then directly sequenced. In some cases, cDNA can be produced from RNA prior to amplification. Dye primer sequencing can be used to increase the accuracy of detecting heterozygous samples.


Mutations within ZASP and MYBPC3 nucleic acid can be detected by, for example, DHPLC analysis of ZASP and MYBPC3 nucleic acid, respectively. Genomic DNA can be isolated from a mammal (e.g., a human), and sequences from one or more regions of a ZASP or MYBPC3 nucleic acid can be amplified (e.g., by PCR) using pairs of oligonucleotide primers. The primer pairs listed in Tables 3 and 5, for example, can be used to amplify all 16 coding exons of human ZASP and all 34 coding exons of human MYBPC3 nucleic acid, respectively. After amplification, PCR products can be denatured and reannealed, such that an allele containing a mutation can reanneal with a wild-type allele to form a heteroduplex (i.e., a double-stranded nucleic acid with a mismatch at one or more positions). The reannealed products then can be subjected to DHPLC, which detects heteroduplexes based on their altered melting temperatures, as compared to homoduplexes that do not contain mismatches. Samples containing heteroduplexes can be sequenced by standard methods to specifically identify the mutant nucleotides. Examples of specific mutations are provided in Table 1.

TABLE 1Mutations associated with HCMMutationNucleotide ChangeNucleic AcidV125Mctg > atgZASPI158Vccc > gtcZASPD366Ngac > aacZASPY468Stat > tctZASPQ519Pcag > ccgZASPV601Igtt > attZASPP615Lccg > ctgZASPA184Vgcc > gtcZASPP419Ncct > cgtZASPG5Rggg > cggMYBPC3splicea > g int − 2MYBPC3T59 fs/49del gggcacacggcMYBPC3V219Lgtc > ctcMYBPC3V256Igtc > atcMYBPC3D389 fs/15del cMYBPC3I411 fs/0del ttMYBPC3R458Hcgc > cagMYBPC3G490Rggg > aggMYBPC3E546 fs/19del gtMYBPC3C566 fs/3del gaMYBPC3D604Vgac > gtcMYBPC3D605Ngac > aacMYBPC3P609Lcct > cttMYBPC3R733Ccgc > tgcMYBPC3D770Ngac > aacMYBPC3splicea > g int − 2MYBPC3W792Rtgg > cggMYBPC3P794 fs/26del gMYBPC3K811deldel aagMYBPC3W818 fs/11del atgcgMYBPC3S830 fs/1ins tMYBPC3E843Xgag > tagMYBPC3Y847Xtac > tagMYBPC3A851 fs/26del cMYBPC3A851 fs/31ins t, ggc > tgcMYBPC3I852 fs/25del gMYBPC3W890Xtgg > tgaMYBPC3R943Xcga > tgaMYBPC3Q998Ecag > gagMYBPC3Q998Rcag > cggMYBPC3G1041 fs/5Ins aaMYBPC3F1113Ittc > atcMYBPC3C1124Xtgc > atcMYBPC3I1131Tatt > actMYBPC3


Allele specific hybridization also can be used to detect mutations in ZASP or MYBPC3 nucleic acid, including complete haplotypes of a mammal. For example, samples of DNA or RNA from one or more mammals can be amplified using pairs of primers, and the resulting amplification products can be immobilized on a substrate (e.g., in discrete regions). Hybridization conditions can be selected such that a nucleic acid probe specifically binds to the sequence of interest, e.g., a ZASP or MYBPC3 nucleic acid containing a particular mutation. Such hybridizations can be performed under high stringency, as some nucleotide mutations include only a single nucleotide difference. High stringency conditions can include the use of low ionic strength solutions and high temperatures for washing. For example, nucleic acid molecules can be hybridized at 42° C. in 2×SSC (0.3M NaCl/0.03 M sodium citrate/0.1% sodium dodecyl sulfate (SDS)) and washed in 0.1×SSC (0.015M NaCl/0.0015 M sodium citrate), 0.1% SDS at 65° C. Hybridization conditions can be adjusted to account for unique features of the nucleic acid molecule, including length and sequence composition. Probes can be labeled (e.g., fluorescently or radioactively) to facilitate detection. In some embodiments, one of the primers used in the amplification reaction can be biotinylated (e.g., 5′ end of reverse primer), and the resulting biotinylated amplification product can be immobilized on an avidin or streptavidin coated substrate.


Allele-specific restriction digests can be performed to detect mutations in ZASP or MYBPC nucleic acid. For example, sequences from one or more regions of a ZASP or MYBPC3 nucleic acid can be amplified (e.g., by PCR) using pairs of oligonucleotide primers. The amplification products can then be digested with a restriction enzyme to detect mutations that introduce or remove a restriction site in a ZASP or MYBPC3 nucleic acid.


Real-time PCR can be used to detect mutations in ZASP or MYBPC3 nucleic acid. For example, genomic DNA or cDNA can be amplified using pairs of oligonucleotide primers (e.g., the primer pairs listed in Tables 3 and 5) in the presence of one or more nucleic acid probes or a dye that fluoresces when bound to double stranded DNA (e.g., SYBR® Green). The nucleic acid probes can be labeled (e.g., fluorescently) such that the label is detectable when hybridized to the sequence of interest (e.g., a ZASP or MYBPC3 nucleic acid). After amplification, the reaction can be subjected to a melting curve analysis. Melting curve analysis can include slowly increasing the temperature of the real-time PCR product and measuring fluorescence to determine the temperature at which the probe or dye dissociates from the amplification product (i.e., the melting temperature). If a probe is used, the melting temperature can indicate whether the sequence of interest is an exact match to the probe, or if a mismatch (e.g., a mutation) is present in the sequence of interest. If a fluorescent dye is used, the detection of more than one melting temperature can indicate the presence of at least one mutation in the sequence of interest.


In some cases, polypeptide analysis can be used to detect mutations in ZASP or MYBPC3 nucleic acid. For example, an antibody that specifically binds to a polypeptide encoded by a nucleic acid containing a mutation can be used in ELISA assays or immunoblot assays to detect the presence of such a mutation.


Other methods also can be used to detect mutations. For example, conventional and field-inversion electrophoresis can be used visualize basepair changes. In addition, Southern blotting and hybridization can be used to detect larger rearrangements such as deletions and insertions.


A mammal containing a mutation in ZASP or MYBPC3 nucleic acid or both can be classified as having an elevated risk of developing HCM. An “elevated risk” is a risk greater than that of a comparable mammal who contains wild-type ZASP and MYBPC3 nucleic acid at both alleles. A human classified as having an elevated risk of developing HCM can have one or more of the mutations listed in Table 1.


A mammal containing more than one mutation (e.g., two, three, four, five, or more mutations) in ZASP or MYBPC3 nucleic acid or both can be classified as having an elevated risk of developing a severe form of HCM compared to a mammal containing wild-type ZASP and MYBPC3 nucleic acid at both alleles. Compared to non-severe HCM, a severe form of HCM can be characterized by a younger age at onset of the disease, a greater degree of hypertrophy, and a higher surgical intervention rate. A human classified as having an elevated risk of developing severe HCM can have more than one of the mutations listed in Table 1.


A mammal containing a mutation in ZASP nucleic acid and a sarcomeric mutation (e.g., a mutation in MYBPC3, MYH7, MYL2, MYL3, TNNT2, TNNI3, TPM1 or ACTC nucleic acid) can be classified as having an elevated risk of developing HCM at a younger age than a mammal containing a mutation in ZASP nucleic acid and not containing a sarcomeric mutation. For example, a mammal having a ZASP mutation and a sarcomeric mutation can be diagnosed with HCM at an age of about 34 years (e.g., about 26, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, or 40 years), whereas a mammal having a ZASP mutation and lacking a sarcomeric mutation can be diagnosed with HCM at an age of about 51 years (e.g., about 43, 44, 45, 47, 49, 53, 55, 57, 62, 65, or 70 years). A ZASP mutation can include, without limitation, V125M, I158V, D366N, Y468S, Q519P, V601I, P615L, A184V, D117N, S196L, or P419N. Sarcomeric mutations can include previously identified mutations, such as those described elsewhere (Van Driest et al., J. Am. Coll. Cardiol., 44:602-10 (2004)).


This document also provides kits that can be used to determine whether or not mammals contain mutations described herein. Such kits can contain reagents for performing a genetic analysis, containers for reagents or samples (e.g., blood samples), and packaging materials. Reagents can include, without limitation, reagents for performing FISH, CGH, or any other technique described herein. A container can be labeled for use for the diagnosis and/or prognosis of a human relating to the development and treatment of HCM. The kit can contain separate containers, dividers, or compartments for the reagents and packaging material.


Packaging material can be descriptive, instructional, marketing or other material that relates to the methods described herein and/or the use of the reagents for the methods described herein. For example, the packaging material can describe methods for performing a genetic analysis on a human and subsequently diagnosing the human as being at risk (or not) for HCM, and/or delivering a prognosis of the human relating to survival time, likelihood of responding to therapy, etc. In addition, or in an alternative, packaging material can include contact information, e.g., a physical address, email address, website, or telephone number, where a user of the kit can obtain substantive information about performing a genetic analysis and interpreting the results, particularly as they apply to a human's likelihood of developing HCM and a subsequent prognosis.


Packaging material can be in any form. In many cases, packaging material, e.g., instructions, can be provided in printed form, e.g., a printed text, drawing, and/or photograph, e.g., a label or printed sheet.


This document also provides isolated nucleic acids that can include a fragment of at least about 15 nucleotides (e.g., at least about 16, 17, 20, 22, 25, 30, 35, 40, 50, 75, 100, 150, 300, 500, or more nucleotides) from a ZASP or MYBPC3 nucleic acid. The ZASP or MYBPC3 nucleic acid can contain one or more (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) of the mutations provided herein. For example, an isolated nucleic acid can contain 100 nucleotides from human ZASP or MYBPC3 nucleic acid with two of the mutations set forth in Table 1.


This document also provides amplification products comprising nucleic acid molecules containing, for example, one or more mutations listed in Table 1. Such products can be amplified from any nucleic acid-containing sample from a mammal, such as a blood sample. The nucleic acid can be any nucleic acid, such as genomic DNA, cDNA, or RNA. In addition, the nucleic acid can be purified from the sample prior to amplification. Any suitable method can be used to obtain the amplification products. For example, amplification products containing one or more mutations listed in Table 1 can be obtained by performing PCR or RT-PCR using, e.g., primers listed in Tables 3 and 5. The amplification product can be less than about 2500 nucleotides in length (e.g., less than 2100, 2000, 1800, 1500, 1200, 1000, 800, 750, 690, 500, 420, 300, 280, 240, 200, 150, 125, 100, 70, or 50 nucleotides in length). An amplification product can be purified by any method, such as by using a Qiagen (Valencia, Calif.) kit for purification of PCR products. In some cases, an amplification product provided herein can be a substantially pure amplification product. For example, an amplification product can contain a particular nucleic acid molecule that is greater than about 50 percent pure (e.g., greater than 55, 60, 64, 70, 75, 78, 80, 83, 87, 90, 92, 93, 95, 96, 97, 98, or 99 percent pure). A substantially pure amplification product is typically visible as a single band on an agarose gel.


The terms “polynucleotide” and “nucleic acid” are used interchangeably herein. The term “isolated nucleic acid,” as used herein, refers to a nucleic acid that is separated from other nucleic acid molecules that are present in a mammalian genome, including nucleic acids that normally flank one or both sides of the nucleic acid in a mammalian genome (e.g., nucleic acids that encode non-ZASP and non-MYBPC3 polypeptides). The term “isolated” as used herein with respect to nucleic acids also includes any non-naturally-occurring nucleic acid sequence since such non-naturally-occurring sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome.


An isolated nucleic acid can be, for example, a DNA molecule, provided one of the nucleic acid sequences normally found immediately flanking that DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a DNA molecule that exists as a separate molecule (e.g., a chemically synthesized nucleic acid, or a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid can include an engineered nucleic acid such as a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid. A nucleic acid existing among hundreds to millions of other nucleic acids within, for example, cDNA libraries or genomic libraries, or gel slices containing a genomic DNA restriction digest, is not to be considered an isolated nucleic acid.


Typically, the isolated nucleic acids provided herein are at least about 8 nucleotides in length. For example, a nucleic acid can be about 8, 9, 10-20 (e.g., 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length), 20-50, 50-100 or greater than 100 nucleotides in length (e.g., greater than 150, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, or 2000 nucleotides in length). The isolated nucleic acids provided herein can be in a sense or antisense orientation, can be complementary to a ZASP or MYBPC3 nucleic acid (e.g., SEQ ID NO:1, SEQ ID NO:3, and SEQ ID NO:5), and can be DNA, RNA, or nucleic acid analogs. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid.


This document also provides isolated polynucleotides having the ability to hybridize to nucleic acid containing one or more particular mutations listed in Table 1, while not having the ability to hybridize to nucleic acid lacking those particular one or more mutations listed in Table I under the same hybridization conditions. Such isolated polynucleotides can function as primers that can be used in PCR reactions to amplify nucleic acids containing one or more mutations described herein without amplifying the corresponding nucleic acid lacking such one or more mutations. In some cases, isolated polynucleotides can also be labeled (e.g., fluorescently or radioactively) and used as probes to detect nucleic acids containing one or more mutations listed in Table 1 without detecting nucleic acids that lack such mutations.


As used herein, “mutant” refers to any alteration in a reference ZASP or MYBPC3 sequence, and includes mutations that occur in coding and non-coding regions, including exons, introns, and untranslated sequences. Nucleotides are referred to herein by the standard one-letter designation (A, C, G, or T). Mutations include single nucleotide substitutions, deletions of one or more nucleotides, and insertions of one or more nucleotides. The reference ZASP nucleic acid sequence can be the sequence set forth in FIG. 8, SEQ ID NO:1, SEQ ID NO:3, or in GenBank® (Accession Number NM007078). The reference ZASP amino acid sequence can be the sequences set forth in FIG. 8, SEQ ID NO:2, or SEQ ID NO:4. The reference MYBPC3 nucleic acid sequence can be the sequence set forth in FIG. 9, SEQ ID NO:5, or in GenBank® (Accession Number NM000256). The reference MYBPC3 amino acid sequence can be the sequence set forth in FIG. 9 or SEQ ID NO:6.


Isolated nucleic acids can be produced by standard techniques, including, without limitation, common molecular cloning and chemical nucleic acid synthesis techniques. For example, polymerase chain reaction techniques can be used to obtain an isolated nucleic acid containing a fragment of ZASP or MYBPC3 nucleic acid with a mutation.


The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.


EXAMPLES
Example 1
Identifying ZASP Mutations in HCM Patients

Mutational analyses were performed on a cohort of 389 unrelated patients with HCM. As presented in Table 2, 215 of the HCM patients were male, with a maximum left ventricular wall thickness (LVWT) of 22±6 mm. The mean age at diagnosis was 41±19 years. Two hundred and sixteen patients (55%) had cardiac symptoms at presentation, and 60 (15%) had a cardioverter-defibrillator implanted. The mean LVWT was 21.6±6 mm. Of the 389 HCM patients, 161 (41%) were treated in part by a surgical myectomy, reflecting the surgical referral bias and subsequent over-representation of obstructive HCM in this cohort. Approximately one-third (31%) had a family history of HCM, whereas one-seventh (14%) was found to have a family history of unexplained death. An HCM-associated sarcomeric mutation was previously demonstrated in 147 of the 389 subjects (38%), with the majority of the genotype positive patients having mutations involving either MYBPC3 or MYH7 (Table 2). A total of 13 unrelated patients harbored only mutations involving the constituents of the cardiac thin filament: troponin T, troponin I, tropomyosin, and actin.

TABLE 2Demographics of an HCM cohortUnrelated Patients with HCMN = 389Male/female215/174Age at diagnosis41.2 ± 19Mean LVWT (mm)21.6 ± 6 Mean peak LVOT gradient (mmHG)46.6 ± 42No. presenting with cardiac symptoms55.5%  Positive family history of HCM31%Positive family history of SCD14%Surgical myectomy161 (41%)  Pacemaker67 (17%)  ICD60 (15%)  Number of patients with previously reported147 (38%)  sarcomeric mutationsMYBPC63 (16.2%)MYH754 (13.8%)MYL27 (1.8%)TNNT26 (1.5%)TNNI34 (1.0%)TPMI2 (0.5%)ACTC1 (0.3%)Number of patients with mutations involving ZASP20 (5.1%) 
HCM = hypertrophic cardiomyopathy;

LVOT = left ventricular outflow tract;

LVWT = left ventricular wall thickness;

SCD = sudden cardiac death;

ICD = implantable cardioverter-defibrillator


Following written informed consent for the IRB-approved research protocol, DNA was extracted from blood samples using Purgene DNA extraction kits (Gentra, Inc., Minneapolis, Minn,). Results from comprehensive open reading frame/splice site mutational analysis of eight nucleic acids encoding sarcomeric polypeptides (MYBPC3, MYH7, MYL2, MYL3, TNNT2, TNNI3, TPM1 and ACTC) were reported previously (Van Driest et al., Circulation 108:445-451 (2003); Van Driest et al., J Am Coll Cardiol. 44:1903-1910 (2004); Van Driest et al., J Am Coll Cardiol. 44:602-10 (2004)).


All 16 polypeptide-encoding exons of ZASP, along with flanking intronic regions, were amplified by polymerase chain reaction (PCR) using previously designed primers (Vatta et al., J Am Coll Cardiol. 42:2014-27 (2003); Table 3). Exon 4 was divided into two overlapping regions of interest for optimal mutational analysis. Each amplicon was assessed for heterozygosity by denaturing high performance liquid chromatography (DHPLC) performed using the Transgenomic system (Omaha, Nebr.). Each sample with an abnormal elution profile was sequenced using an ABI Prism 377 instrument (Applied Biosystems, Foster City, Calif.) to characterize the difference between the wild-type and varient alleles (Ackerman et al., Pediatr Res. 44:148-153 (1998)).

TABLE 3ZASP primersExonForward PrimerReverse Primer1GTGCCCTCTCACTCAACCCTACACATGCCCTCCTCCAAGC(SEQ ID NO:7)(SEQ ID NO:8)2TGGCCTTTCCTCAGGACCACTCCTGCACAGTTTTGTAGCC(SEQ ID NO:9)(SEQ ID NO:10)3TGACTCTGGCTCTCTCTTGCTTCCAGGAACCAGGGCTGAGT(SEQ ID NO:11)(SEQ ID NO:12)4GGCTCGCGCTAACACATCTGGCCACCTGTGGAGAGCTGTA(SEQ ID NO:13)(SEQ ID NO:14)5CACTCCTTGCTCTCCTCACCCTCTATCCACGCCAGACACA(SEQ ID NO:15)(SEQ ID NO:16)6TGTAACCGCCACCTGTTGCCTCCAGGAGGTCCAACGTGAG(SEQ ID NO:17)(SEQ ID NO:18)7CCACCAATGGGCATGGAGCAAGCAGGACTCCCTGGCTTCT(SEQ ID NO:19)(SEQ ID NO:20)8TTGCTGTGTCTCCCGTGAGTGAGGTCCCTTCCATGAGTGA(SEQ ID NO:21)(SEQ ID NO:22)9GGTGAACACATTCCCTAACCCCCAGCAGAGTTATACATTG(SEQ ID NO:23)(SEQ ID NO:24)10GCTCCCTTGACCTGTTGTCTGCCCTAACTACCTTGGACAC(SEQ ID NO:25)(SEQ ID NO:26)11GGCTGTCCTTCTGGGTGTAATCTTGGCTCTTGTGGCTCCT(SEQ ID NO:27)(SEQ ID NO:28)12ACATTTCTCTGGCTAGGAGTGCTGGGAGAAGCTATCATCTG(SEQ ID NO:29)(SEQ ID NO:30)12BTGCACCCTCGGTGGCCTACACTCCCAACCAGGGCTCAGAC(SEQ ID NO:31)(SEQ ID NO:32)13GTTCTGGGAGCTGCCTTACTGGAAGAGACATGGGTCAGAG(SED ID NO:33)(SEQ ID NO:34)14AGTCAAGCCCGCTCCCTCTCCACATGCCATCGAAGTGTTC(SEQ ID NO:35)(SEQ ID NO:36)15TGATTTGGGGTTTGTCTTGGCTAGCGTGGCAAGGTATGTA(SEQ ID NO:37)(SEQ ID NO:38)16GTCTCACGCAGGTCTGTTCTGCTTCCTCTCTCTCCCCATT(SEQ ID NO:39)(SEQ ID NO:40)


To verify with 95% confidence that the true allelic frequency of identified varients was less than 0.5%, DNA samples derived from 100 healthy African Americans and 200 healthy Caucasian Americans were screened for exons containing non-synonymous mutations (600 alleles; Coriell Laboratories, Camden, N.J.). This was based on exact binomial confidence intervals for an allele frequency, allowing exclusion of each variant from being a common polymorphism when absent in 600 reference alleles. In the case of particular mutations, additional control DNA samples were provided either by another study (Vatta et al., J Am Coll Cardiol. 42:2014-27 (2003)) or by a cohort of unrelated patients referred for long QT syndrome genetic testing who did not meet electrocardiographic voltage-criteria for cardiac hypertrophy.


The non-synonymous mutations were annotated using the single letter convention. For example, D117N indicates that the wild type aspartic acid (D) at residue 117 was replaced by asparagine (N). The amino acid position was designated according to a previously established numbering system (Vatta et al., J Am Coll Cardiol. 42:2014-27 (2003)), which varied for the two different cardiac isoforms of ZASP (FIG. 1). Exons 5, 6, and 9 were numbered based on the 283 amino acid isoforn, C/Z1 (SEQ ID NO:2), which contains exons 1-3 and 5-9. The remaining exons were numbered based on the 727 amino acid isoform, C/Z4 (SEQ ID NO:4), which contains exons 1-4, 7-8, and 10-16.


Each variant was analyzed to determine the nature of the amino acid substitution. Localization of each variant within known domains was also analyzed. In addition, the conservation of each variant was identified through homologous alignment with multiple species, and predicted effects on secondary structure were examined using the PredictProtein server (Rost et al., Nucleic Acids Res. 32:W321-6 (2004)).


Differences between continuous variables were assessed using analysis of variance (ANOVA). Pairwise differences were then determined using Fisher Protected Least Significant Difference post-hoc testing. Binomial confidence intervals excluded each variant from being a common polymorphism. Nominal variables were analyzed by contingency tables or z-tests. A probability value of less than 0.05 was considered significant.


Comprehensive mutational analyses of the 16 exons of ZASP indicated that 20 out of 389 unrelated patients (5.1%) possessed a putative HCM-associated mutation. Clinical phenotypes associated with the 20 patients who were genotype positive for perturbations in ZASP are summarized in Table 4. This subset was comprised of seven males and thirteen females diagnosed with HCM at an average age of 45.6±18 years, with a LVWT of 18±3 mm. The majority of patients were of Caucasian ethnicity (19/20). The average New York Heart Association (NYHA) classification was 2±1.1 (nine class I patients, four class II patients, five class III patients, and two class IV patients). Six patients (30%) had had a surgical myectomy. None of the 20 ZASP-positive patients with HCM displayed any overt manifestation of either proximal or distal skeletal muscle weakness. With respect to prior mutation scanning of eight sarcomeric nucleic acids in this cohort, six of the 20 ZASP genotype positive patients hosted additional sarcomeric mutations, including three with a frameshift mutation in MYBPC3 (cases 15, 16, and 17), one with a MYBPC3 missense mutation (case 19), and two with mutations in MYH7 (cases 18 and 20).

TABLE 4Clinical profiles of HCM patients with a ZASP mutationZASPAdditionalAgeSymptomsMutationSarcomericAge (y)atatSubsequentCase(exon)mutationSexRace‡DxPresentationsymptoms 1D117N (6)47/M129Angina,Angina, dyspneadyspnea 2V125M (4A)67/F161Asymptomatic(Pre)syneope 3V125M (4A)79/M173AsymptomaticDeceased 4V125M (4A)85/M158AnginaAngina, dyspnea 5V125M (4A)64/F160AsymptomaticDyspnea 6I158V (6)75/F165AnginaAngina, dyspnea 7I158V (6)47/F140Angina,Angina, dyspnea,dyspnea,presyncopepresyncope 8S196L (4B)76/F173Dyspnea,Dyspnea, anginaangina 9S196L (4B)69/F163AsymptomaticAngina, dyspnea,presyncope10D366N (10)80/M168Angina,Angina, dyspnea,dyspnea,presyncopepresyncope11Y468S (12A)53/M246Angina,Angina, dyspneadyspnea12Q519P (12B)28/F121Angina,Angina, dyspnea,dyspnea,syncopesyncope13V601I (13)40/M124AsymptomaticAsymptomatic14P615L (13)36/M128Dyspnea,Dyspnea, syneopesyncope15D117N (6)Q791 fs/4046/M132AsymptomaticDyspneaMYBPC316V125M(4A)A954 fs/9444/M136DyspneaAngina, dyspneaMYBPC317A184V (4B)A851 fs/2634/M130SyncopeSyncopeMYBPC318P419N (12A)D778V60/M143AsymptomaticAsymptomaticMYH719Q519P (12B)V219L48/F141Angina,Angina, dyspnea,MYBPC3dyspnea,presyncopepresyncope20Q519P (12B)A797T28/F120Angina,Angina, dyspnea,MYH7dyspnea,presyncopepresyncopeMax.RestingFHFH of SCDLVWTLVOTOof(Age atCaseAF(mm)(mm Hg)HCMSCD)Treatment 1No2375Yes*No 2No165NoNo 3Non/an/aNoNo 4Yes2244NoNoSeptal ablation 5No1740NoNo 6No190Yes*No 7No22n/aYes†No 8No1964NoNoMyectomy 9No130NoNo10Yes1716NoNo11No18112NoNo12No15140Yes*No13No130Yes†Yes (33, 59)†14No27120NoNoMyectomy15No39104NoNoPM,Myectomy16No2448NoNoMyectomy17No230NoYes (41)†18n/a19n/aYes*No19n/a20112Yes*NoMyectomy20No2152NoNoMyectomy
AF, atrial fibrillation;

Dx, diagnosis;

FH, family history;

LVOTO, left ventricular outflow tract obstruction;

LVWT, left ventricular wall thickness;

n/a, information not available;

PM, pacemaker;

SCD, sudden cardiac death;

*first degree relative;

†second degree relative;

‡1 = white-Caucasian; 2 = Hispanic


Patients hosting a single ZASP mutation (cases 1 through 14) or a combination of a ZASP and a sarcomeric mutation (cases 15 through 20) had a clinical phenotype resembling that of the 228 patients who were genotype negative. The average age at diagnosis of patients hosting only a ZASP variant was 51.1±19 years, whereas patients hosting an additional sarcomeric mutation were diagnosed at 34.3±8 years of age (p=0.06).


Overall, 11 distinct ZASP missense mutations, including nine newly identified mutations, were discovered (FIG. 2). These mutations were all non-conservative amino acid substitutions typically involving highly conserved residues across species. In silico analyses demonstrated significant disruption in secondary structure for each mutation. For example, a proline (P) to leucine (L) substitution at the highly conserved residue 615 (P615L-ZASP, FIG. 3A-C) was discovered in a 36-year-old male (case 14, Table 4) in whom no other mutations involving nine other HCM-associated sarcomeric nucleic acids were detected. The substitution was between the first two LIM domains and resulted in both the disruption of beta turns and the formation of alpha helices within this region (FIG. 3D). The patient had severe obstructive HCM with a maximal left ventricular wall thickness of 27 mm and a left ventricular outflow tract gradient of 120 mm Hg. A parasternal, long-axis view of an echocardiogram of a proband with P615L indicated marked hypertrophy involving the interventricular septum. Due to refractory symptoms in spite of medical therapy, the patient underwent a surgical myectomy. Microscopic evaluation of resected myocardium demonstrated myocyte hypertrophy with increased cell diameters and enlarged, hyperchromatic nuclei. A photomicrograph of a section of resected myocardium stained with hematoxylin and eosin (H & E) demonstrated myocyte hypertrophy with normal arrangement of myocytes having increased cell diameters and enlarged, hyperchromatic nuclei (Lamke et al., Cardiovasc Pathol. 12:149-58 (2003)).


Photomicrographs of immunofluorescent analyses detected strong ZASP staining at the Z-disc of control myocardium, and a dramatic overall reduction in the appearance of ZASP in myocardium obtained from the proband manifesting P615L. Phalloidin staining did not demonstrate a significant difference in Z-disk patterning or expression levels (original magnification 40×).


In addition to nine newly identified mutations, two mutations, D117N and S196L, were each found in two patients with HCM (Table 4, cases 1 and 15, and cases 8 and 9, respectively). These missense mutations were published previously as DCM/LVNC-associated mutations. In this study, however, S196L-ZASP was found in a patient (case 8) having apical variant-HCM with pronounced myocyte disarray. H & E staining of myectomy tissue from case 8 demonstrated marked myocyte disarray, showing haphazard arrangement of myocytes. S196 is conserved across species, and structural analyses predict that the introduction of S196L results in the ablation of both helices and beta turns N-terminal to the ZASP-like motif. S196L was not observed in 1020 reference alleles derived from 510 reportedly healthy subjects: 300 white, 100 black, and 110 Hispanic (Vatta et al., J Am Coll Cardiol. 42:2014-27 (2003)).


In addition to S196L, the previously published DCM/LVNC-associated variant, D117N, was also found in two patients with HCM (Table 4, cases 1 and 15). Parasternal, long-axis view of an echocardiogram of case 2 (D117N) illustrated marked septal hypertrophy. The histology was identified as a result of H & E staining illustrating myocyte disarray characterized by a “herringbone” arrangement of myocytes. This aspartate is conserved across species; however, this variant was also detected in 6% of the reference alleles from healthy blacks and 0.3% of the reference alleles from healthy whites. Secondary structure analysis for D117N indicated shortening of an alpha helix at position 228 of the C/Z1 isoform. The other reported DCM/LVNC-susceptibility variants (K136M, T213I, I352M, and D626N) were not observed in HCM cases or the additional 600 reference alleles examined (FIG. 2).


The non-synonymous variant, V125M, was identified in five of the 389 patients (i.e., >0.5% allelic frequency). Valine (V) at position 125 is invariant across species, except for the conservative substitution of alanine (A) in mouse and rat. Secondary structure analyses predicted ablation of a beta turn at position 124. Examination of over 1900 reference alleles revealed V125M in one healthy white control subject (p value<0.02; Table 4, cases 2-5 and 16).


The results established an association between ZASP mutations and HCM. More than five percent of unrelated patients with HCM hosted mutations in ZASP, making ZASP the third most common HCM-associated susceptibility nucleic acid.


Example 2
Identification of MYBPC3 Mutations in HCM Patients

A single institution cohort comprising 389 unrelated patients (215 male) was diagnosed with unequivocal and unexplained HCM at a mean age of 41.3±19 years. At presentation, 216 (55.5%) had cardiac symptoms, 120 (31%) had a family history of HCM, and 56 (14%) had a sudden cardiac death (SCD) event in a first-degree relative. The mean maximum left ventricular wall thickness (LVWT) was 21.5±7 mm, and mean peak gradient for left ventricular outflow tract obstruction (LVOTO) was 46.6±42 mm Hg. Of 389 patients, 297 (76%) had resting, labile, or mid-cavitary obstruction; 161 (41%) had undergone a surgical myectomy; and 60 (15%) had received an implantable cardioverter-defibrillator (ICD).


After providing written informed consent, the patients were enrolled in sarcomeric genetic testing. Patients were eligible for enrollment on the basis of 1) being seen and evaluated in the HCM clinic, 2) having an unequivocal diagnosis of HCM, and 3) being the first family member seen. By definition, each subject met the clinical diagnostic criteria for HCM by having a maximum LVWT greater than 13 mm in the absence of another confounding diagnosis.


Total genomic DNA was extracted from blood samples for subsequent mutational analysis using Purgene deoxyribonucleic acid (DNA) extraction kits (Gentra, Inc., Minneapolis, Minn.). This cohort was genotyped previously for mutations in nucleic acids encoding the sarcomeric polypeptides comprising the thick filament (MYH7 and the regulatory and essential light chains (MYL2 and MYL3)) and the thin filament (troponin-T (TNNT2), troponin-I (TNNI3), alpha-tropoinyosin (TPM1), and alpha-actin (ACTC); Van Driest et al., Circulation 108:445-51 (2003); Van Driest et al., J Am Coll Cardiol 44:602-10 (2004)).


PCR primers were designed to amplify all exons and flanking intronic sequences for each of the 34 polypeptide-coding exons of MYBPC3 (Table 5). Each exon of MYBPC3 was amplified in each patient's DNA sample, and amplicons were analyzed for sequence variants using denaturing high-performance liquid chromatography (DHPLC; WAVE, Transgenomic, Omaha, Nebr.; Underhill er al., Genome Res 7:996-1005 (1997)). All samples with abnormal DHPLC elution profiles were characterized by direct DNA sequencing (ABI Prism377; Applied Biosystems, Foster City, Calif.) to determine the precise sequence variation present. Nonsynonymous variants were confirmed by re-sequencing using stock DNA samples. DNA samples from 100 healthy blacks and 100 healthy whites (400 reference alleles) were obtained from Coriell Laboratories (Camden, N.J.) and tested for all candidate disease-associated mutations to confirm that none of the variants was a common polymorphism.

TABLE 5MYBPC3 primersExonForward PrimerReverse Primer1TTGGGTGACCTGTGCCTGCCCTGCTCCCACACTTAG(SEQ ID NO:41)(SEQ ID NO:42)2CGGGGTGCACGCTCCAACCAGCAGCCCAAACCTCA(SEQ ID NO:43)(SEQ ID NO:44)3GCGGGCTCATGGGTCCACCCAGCAAAGGCTTTTGA(SEQ ID NO:45)(SEQ ID NO:46)4GCCTGGGTGACAGAGCAACCTTCCCACCCCAATGCT(SEQ ID NO:47)(SEQ ID NO:48)5TGGCGAGGTGACCGTGGCCTCTGTGTGCCTTGTGC(SEQ ID NO:49)(SEQ ID NO:50)6TTGTCTCCCGCCCCCTGCCCGAGCCCAGGACAGA(SEQ ID NO:51)(SEQ ID NO:52)7-9AAGCCCCTTCCCCCATCTCTCCAGCTGCCCCAGGAAC(SEQ ID NO:53)(SEQ ID NO:54)10GGTCGGCCCAACTGACTTAGTCTCTCACCACAGCCT(SEQ ID NO:55)(SEQ ID NO:56)11ATGTGCCACCTACCCTTTCGATGAGGGTGCTGTGCTAT(SEQ ID NO:57)(SEQ ID NO:58)12CCAGGGGGCTGCAGTCTCCTCTCCTCTCCTGTGTAG(SEQ ID NO:59)(SEQ ID NO:60)13CAGCCACAGCCACAGTAGGGCAGGAGGCAAGGCTAT(SEQ ID NO:61)(SEQ ID NO:62)14TGCCGGTCCCTCTCTCTCCAGGAAAGCTGCGGACAC(SEQ ID NO:63)(SEQ ID NO:64)15TCCGCAGCTTTCCTGCCACTCCCCTGAGGCCATCTC(SEQ ID NO:65)(SEQ ID NO:66)16-17GGGGAGCCAACCCTCATGCAAGCCCTAAAGCCTCATGT(SEQ ID NO:67)(SEQ ID NO:68)18TCACGCCACACCCACACATCCATCTCAGTCTCCACCT(SEQ ID NO:69)(SEQ ID NO:70)19GGCTGGGGTATCTGGCAAGCCGACCCACCCTACCCTG(SEQ ID NO:71)(SEQ ID NO:72)20CTGTCAGCCAAGCTCCACTTCCCTTGCTCTTCCCTCTGTGAG(SEQ ID NO:73)(SEQ ID NO:74)21TCCCGTTTCTCTGAACTACACCACACACCCATCTTATAGA(SEQ ID NO:75)(SEQ ID NO:76)22AGCTCCTCTGCTCCCTACCGGCACCACGTAGGTAGA(SEQ ID NO:77)(SEQ ID NO:78)23CTCTGGGGTCTGACTTGGGCTGCCCCTCTGTGTTCT(SEQ ID NO:79)(SEQ ID NO:80)24GACGAGCAACGTTACTCAAGACCTTCCCTCGGATCTGTTT(SEQ ID NO:81)(SEQ ID NO:82)25GTTCCAGACCAGAGCTGCTTAACTGGGGAGGGGGCG(SEQ ID NO:83)(SEQ ID NO:84)26TTCCCCAGGCTTGCTCAGATGGCAAGGTGAGCATGTTC(SEQ ID NO:85)(SEQ ID NO:86)27TGGGAGTGGGGTGTCAGTACCTCCACTGGACACCAA(SEQ ID NO:87)(SEQ ID NO:88)28CGGGCCCTCACTTAGCTACCACTGGATGGGAACAAC(SEQ ID NO:89)(SEQ ID NO:90)29CATTTTCCAGTCCACTGCCCAGGTTCAGGGTTAAGC(SEQ ID NO:91)(SEQ ID NO:92)30GGAGGCGTGGTGACCCAAGTCCACGGTGAGGACAGTG(SEQ ID NO:93)(SEQ ID NO:94)31GAGGCTCTCGGCATCAGGCTGTTGGTGACAGGACTTGGT(SEQ ID NO:95)(SEQ ID NO:96)32CTGTGGGAACAGGGAGAGGGGAGAGGACTGCTCAACGTC(SEQ ID NO:97)(SEQ ID NO:98)33GTGTCTCCCTGGGTCCCTCGAGGACAACGGAGCAAAG(SEQ ID NO:99)(SEQ ID NO:100)34CTTTGCTCCGTTGTCCTCGCGCAGCACAGGAGACACACT(SEQ ID NO:101)(SEQ ID NO:102)


Analysis of variance tests were used to assess differences between continuous variables, followed by Fisher Protected Least Significant Difference post-hoc testing for pairwise differences. Contingency tables or z-tests were used as appropriate to analyze nominal variables. Probability values less than 0.05 were considered statistically significant.


In this cohort, 46 different MYBPC3 mutations were identified in 71 of 389 patients (18%). Eleven of the identified mutations were published previously, and the remaining 35 (72%) are newly identified mutations (Table 6; FIG. 4). Mutations were identified in 20 of 34 exons studied. None of the newly identified mutations were found in the 400 reference alleles. Twenty-one (46%) of the mutations identified altered single amino acids (missense mutations), 15 (33%) were insertions or deletions causing a frameshift, 6 (13%) coded for premature stop codons (nonsense mutations), 3 (7%) were putative splice donor or acceptor site mutations located in the introns, and 1 (2%) was an in-frame deletion (Table 6; FIG. 4). No statistically significant difference in clinical phenotype was attributable to the specific type of MYBPC3 mutation present (i.e., missense mutations versus premature truncations resulting from frameshift and nonsense mutations). In addition to the putative pathogenic mutations identified, 7 amino-acid altering variants in MYBPC3 were identified in patient samples as well as the 400 reference alleles (Table 6). In addition, three such variants (S236G, R326Q, and V896M) were identified in 5 patients, were not seen in the 400 reference alleles, but were previously reported as common polymorphisms with allele frequencies greater than 0.5% (Jaaskelainen et al., J Mol Med 80:412-22 (2002)). Therefore, these three variants were not considered pathogenic, and these five patients were not included in the MYBPC3-HCM subgroup.

TABLE 6Putative HCM-Causing Mutations and Nonpathogenic,Nonsynonymous Polymorphisms Identified in MYBPC3Mutation TypeMutation or(Heterozygote Frequency forSNP #ExonNucleotide ChangeVariantPolymorphisms)† 1*1ggg > cggG5RMissense mutation 2*2a > g int − 2spliceSplice mutation 3*2del gggcacacggcT59 fs/49Frameshift mutation 4*6gtc > ctcV219LMissense mutation 5*6gtc > atcV256IMissense mutation 66gag > aagE258KMissense mutation 77g > a int + 1spliceSplice mutation 8*13del cD389 fs/15Frameshift mutation 9*15del ttI411 fs/0Frameshift mutation10*16cgc > cagR458HMissense mutation11*17ggg > aggG490RMissense mutation1217cgg > cagR495QMissense mutation1317cgg > tggR502WMissense mutation1417gaa > caaE542QMissense mutation15*18del gtE546 fs/19Frameshift mutation16*18del gaC566 fs/3Frameshift mutation17*19gac > gtcD604VMissense mutation18*19gac > aacD605NMissense mutation19*19cct > cttP609LMissense mutation2022del cA698 fs/54Frameshift mutation21*23cgc > aacR733CMissense mutation22*23gac > aacD770NMissense mutation23*24a > g int − 2spliceSplice mutation2424ins gQ791 fs/40Frameshift mutation25*24tgg > cggW792RMissense mutation26*24del gP794 fs/26Frameshift mutation2725cgc > cacR810HMissense mutation28*25del aagK811delDeletion mutation29*25del atgcgWS 18 fs/11Frameshift mutation30*25ins tS830 fs/1Frameshift mutation3125gcg > acgA833TMissense mutation32*25gag > tagE843XTruncation mutation33*25tac > tagY847XTruncation mutation34*25del cA851 fs/26Frameshift mutation35*25ins t, ggc > tgcA851 fs/31Frameshift mutation36*25del gI852 fs/25Frameshift mutation37*26tgg > tgaW890XTruncation mutation38*27cga > tgaR943XTruncation mutation3927del ctA954 fs/94Frameshift mutation4027caa > taaQ969XTruncation mutation41*28cag > gagQ998EMissense mutation42*28cag > cggQ998RMissense mutation43*29ins aaG1041 fs/5Frameshift mutation44*31ttc > atcF1113IMissense mutation45*31tgc > tgaC1124XTruncation mutation46*31att > actI1131TMissense mutation 1*4gtg > atgV58MPolymorphism (11%) 26acg > ggcS236GPolymorphism (20%)‡ 312cgg > cagR326QPolymorphism (6%)‡ 4*13cgg > tggR382WPolymorphism (6%) 5*15ggt > agtG416SPolymorphism (2%) 6*17ggg > aggG507RPolymorphism (4%) 7*18ctg > atgL545MPolymorphism (1%) 826gtg > atgV896MPolymorphism (5%)‡ 933cag > tagQ1233XPolymorphism (2%)10*33dupGGIYVCPolymorphism (1%)gggggcatctatgtctgc
*Indicates a newly identified mutation or variant;

†in 100 African American and 100 Caucasian DNA samples, unless otherwise noted;

‡previously published frequency (Jaaskelainen et al., J Mol Med 80: 412-22 (2002));

HCM = hypertrophic cardiomyopathy;

SNP = single nucleotide polymorphism.


When patients with a single mutation in MYBPC3 (n=63, excluding those harboring multiple mutations in one or more nucleic acids; FIG. 5) were compared with patients with single mutations involving the thick filament (MYH7 or light chains, n=61), there were no statistically significant differences with respect to age at diagnosis (37.6±15 years versus 33.0±17 years), LVWT (22.5±5 mm versus 23.5±7 mm), frequency of myectomy (35% versus 56%), or frequency of ICD placement (29% versus 21%). These results are presented in Table 7. The phenotype ascribed to thick filament-HCM was not affected by removal of individuals with mutations in one of the two genetic components of the thick filament, namely mutations in the regulatory light chain encoded by MYL2. The same clinical parameters (age at diagnosis, LVWT, frequency of myectomy, and frequency of ICD placement) did not differ significantly between patients with thin filament mutations (alpha-actin, alphatropomyosin, troponin-T, or troponin-I; n=13) and patients with MYBPC3-HCM (Table 7; FIGS. 6 and 7). With regard to HCM morphology (resting obstruction, labile obstruction, mid-cavitary obstruction, apical, and nonobstructive HCM), again, there were no statistically significant differences between MYBPC3-HCM, thick filament-HCM, thin filament-HCM, and multiple mutation-HCM patients.

TABLE 7Clinical characteristics of patients with single, multiple, or no sarcomeric mutationsMYBPC3Thick FilamentThin FilamentMultipleNo SarcomericANOVAMutationMutationMutationMutationsMutationp ValueNumber of individuals63611310242Male/female41/2225/3610/35/5134/1080.04Age at diagnosisMean37.6 ± 1533.0 ± 1742.9 ± 1620.7 ± 1145.4 ± 19<0.0001Range3.4-75.20.1-70.622.6-72.50.2-37.40.0-89.5>25 yrs, n (%)50 (79%)41 (67%)12 (92%) 3 (30%)202 (83%) <0.0001PresentationCardiac symptoms,37 (59%)30 (49%)10 (77%) 4 (40%)134 (55%) 0.08n (%)Family history*HCM, n (%)28 (44%)27 (44%)5 (38%)5 (50%)55 (23%)0.01SCD, n (%)13 (21%)11 (18%)3 (23%)2 (20%)27 (11%)0.35EchocardiographyLVWT (mm)22.5 ± 5 23.5 ± 7 21.5 ± 4 25.2 ± 1220.8 ± 6 0.01Severe4 (6%) 9 (15%)0 (0%) 2 (20%)14 (6%) 0.07hypertrophy†,n (%)Peak LVOT41.4 ± 3852.3 ± 4634.9 ± 4246.3 ± 4447.3 ± 420.60gradient (mm Hg)>30 mm Hg at rest,31 (49%)36 (59%)5 (38%)6 (60%)128 (53%) 0.79n (%)TreatmentMyotomy/22 (35%)34 (56%)3 (23%)6 (60%)95 (39%)0.04myectomy,n (%)PM, n (%)12 (19%)13 (21%)2 (15%)0 (0%) 40 (17%)0.55Myectomy or PM,25 (40%)37 (61%)4 (31%)6 (60%)117 (48%) 0.10n (%)ICD, n (%)18 (29%)13 (21%)2 (15%)4 (40%)23 (10%)0.003
No significant differences were defined between MYBPC3-HCM and thick filament-HCM subsets.

*In a first degree relative;

†LVWT ≧30 mm;

ANOVA = analysis of variance;

HCM = hypertrophic cardiomyopathy;

ICD = implantable cardioverter-defibrillator;

LVOT = left ventricular outflow tract;

LVWT = left ventricular wall thickness;

MYBPC3 = myosin binding protein C;

PM = permanent pacemaker;

SCD = sudden cardiac death;

thick filament = β-myosin heavy chain and regulatory myosin light chain;

thin filament = troponin-T, troponin-I, α-tropomyosin, and α-actin.


Of the 389 patients, 242 (62.2%) had no mutations in MYH7, MYL2, MYL3, TNNT2, TNNI3, TPM1, ACTC, or MYBPC3. This genotype negative subset of patients was significantly older at diagnosis than genotype positive patients with an identifiable sarcomere defect (Table 7; FIG. 6). In fact, patients with genotype-negative HCM were even older at diagnosis than those with MYBPC3-HCM (45.4±19 years vs. 37.6±15 years, p<0.003). The genotype-negative patients also had significantly less hypertrophy than patients with thick filament or multiple mutations. In addition, there was a trend toward less hypertrophy in genotype-negative patients than in patients with MYBPC3-HCM (Table 7; FIG. 7).


Ten of 389 patients (2.6% of the total cohort; 7% of the genotyped subset) were identified as having multiple sarcomeric mutations, i.e., compound heterozygosity (FIG. 5). One patient had mutations in MYH7 and troponin-T (R453C and Q191del, respectively). Another patient had two MYH7 mutations (R719Q plus T1513S). Multiple MYBPC3 mutations were identified in two patients (G5R plus R502W, E258K plus A954fs/94). Two patients had mutations in MYBPC3 and MYH7 (D605N plus E894G, Q791fs/40 plus R694C). MYBPC3 and troponin-T mutations (V256I plus R92W, A833T plus R286H) also were identified in two patients. MYBPC3 and troponin-I mutations were identified in one patient (R943X plus S166F). Another patient had mutations in MYBPC3 and α-tropomyosin (F1113I plus I172T). These 10 patients were significantly younger at diagnosis than any other subgroup, had the most hypertrophy, and had the highest incidence of myectomy and ICD placement, three out of four of which were placed due to a strong family history of SCD (Table 7, FIGS. 6 and 7).


These results indicated that patients with MYBPC3 mutations did not differ significantly from patients with thick filament-HCM, thin filament-HCM, or genotype-negative HCM with respect to age at diagnosis, degree of hypertrophy, incidence of myectomy, or family history of HCM or sudden death. Patients with multiple mutations had the most severe disease presentation.


OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims
  • 1. A method for determining a human's susceptibility to develop hypertrophic cardiomyopathy, said method comprising determining whether or not a human comprises genomic MYBPC3 nucleic acid comprising one or more mutations listed in Table 1, wherein the presence of said one or more mutations indicates that said human is susceptible to develop hypertrophic cardiomyopathy.
  • 2. The method of claim 1, wherein said determining step comprises analyzing DNA.
  • 3. The method of claim 1, wherein said determining step comprises analyzing RNA.
  • 4. The method of claim 1, wherein said determining step comprises analyzing a polypeptide sample.
  • 5. The method of claim 1, wherein said determining step comprises analyzing a blood sample from said human.
  • 6. A method for determining whether or not a human comprises one or more MYBPC3 mutations listed in Table 1, said method comprising analyzing a sample from said human using polymerase chain reaction, denaturing high-performance liquid chromatography, or sequencing.
  • 7. The method of claim 6, wherein said sample is blood.
  • 8. The method of claim 6, wherein said sample is genomic DNA.
  • 9. A substantially pure amplification product comprising a nucleic acid molecule less than 2500 nucleotides in length, wherein said nucleic acid molecule comprises one or more MYBPC3 mutations listed in Table 1.
  • 10. An isolated polynucleotide having the ability to hybridize to a MYBPC3 nucleic acid molecule comprising a mutation listed in Table 1 under hybridization conditions and not having the ability to hybridize to a second nucleic acid molecule not comprising said mutation under the same hybridization conditions.
  • 11. The polynucleotide of claim 10, wherein said polynucleotide, when used in an amplification reaction with a primer, amplifies said nucleic acid molecule and not said second nucleic acid molecule.
  • 12. The polynucleotide of claim 10, wherein said polynucleotide is fluorescently or radioactively labeled.
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application Ser. No. 60/732,776, filed Nov. 1, 2005.

Provisional Applications (1)
Number Date Country
60732776 Nov 2005 US