Identification, production and use of new staphylokinase derivatives with reduced immunogenicity

BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to new staphylokinase derivatives with reduced immunogenicity, their identification, production and use in the treatment of arterial thrombosis and for the preparation of a pharmaceutical composition for treating arterial thrombosis. More in particular it relates to the use of engineered staphylokinase derivatives for the preparation of a pharmaceutical composition for treating myocardial infarction.
2. Description of the Prior Art
Staphylokinase, a protein produced by certain strains of Staphylococcus aureus, which was shown to have profibrinolytic properties more than 4 decades ago (1,2) appears to constitute a potent thrombolytic agent in patients with acute myocardial infarction (3,4). The staphylokinase gene has been cloned from the bacteriophages sak.o slashed.C (5) and sak42D (6) as well as from the genomic DNA (sakSTAR) of a lysogenic Staphylococcus aureus strain (7). The staphylokinase gene encodes a protein of 163 amino acids, with amino acid 28 corresponding to the NH.sub.2 -terminal residue of full length mature staphylokinase (6,8,9). The mature protein sequence (SEQ ID NO:3) of the wild-type variant SakSTAR (9) is represented in FIG. 1. Only four nucleotide differences were found in the coding regions of the sak.phi.C, sak42D and sakSTAR genes, one of which constituted a silent mutation (6,8,9).
In a plasma milieu, staphylokinase is able to dissolve fibrin clots without associated fibrinogen degradation (10-12). This fibrin-specificity of staphylokinase is the result of reduced inhibition by .alpha..sub.2 -antiplasmin of plasmin.staphylokinase complex bound to fibrin, recycling of staphylokinase from the plasmin.staphylokinase complex following inhibition by .alpha..sub.2 -antiplasmin, and prevention of the conversion of circulating plasminogen.staphylokinase to plasmin.staphylokinase by .alpha..sub.2 -antiplasmin (13-15). In addition staphylokinase has a weak affinity for circulating but a high affinity for fibrin-bound plasminogen (16) and staphylokinase requires NH.sub.2 -terminal processing by plasmin to display its plasminogen activating potential (17). In several experimental animal models, staphylokinase appears to be equipotent to streptokinase for the dissolution of whole blood or plasma clots, but significantly more potent for the dissolution of platelet-rich or retracted thrombi (18,19).
Staphylokinase is a heterologous protein and is immunogenic in man. The intrinsic immunogenicity of staphylokinase, like that of streptokinase, clearly hampers its unrestricted use. Not only will patients with preexisting high antibody titers be refractory to the thrombolytic effect of these agents, but allergic side effects and occasional life-threatening anaphylaxis may occur (20). Because both streptokinase and staphylokinase are heterologous proteins, it is not obvious that their immunogenicity could be reduced by protein engineering. Indeed, no successful attempts to generate active low molecular weight fragments from streptokinase have been reported. In staphylokinase, deletion of the NH2-terminal 17 amino acids or the COOH-terminal 2 amino acids inactivates the molecule, which in addition is very sensitive to inactivation by site-specific mutagenesis (21).
Nevertheless, we have, surprisingly, found that the wild-type staphylokinase variant SakSTAR (9) contains three non-overlapping immunodominant epitopes, at least two of which can be eliminated by specific site-directed mutagenesis, without inactivation of the molecule (22). These engineered staphylokinase variants are less reactive with antibodies elicited in patients treated with wild-type staphylokinase, and are significantly less immunogenic than wild-type staphylokinase, as demonstrated in rabbit and baboon models and in patients with peripheral arterial occlusion (22).
SUMMARY OF THE INVENTION
The present invention relates to general methods for the identification, production and use of staphylokinase derivatives showing a reduced antigenicity and immunogenicity as compared to wild-type staphylokinase. The derivatives have essentially the amino acid sequence of wild-type staphylokinase or modified versions thereof, but have a reduced reactivity with a panel of murine monoclonal antibodies and/or with antibodies induced in patients by treatment with wild-type SakSTAR, without destroying the biological activity of the derivatives. Preferably the amino acids are replaced by alanine but several alternative possibilities are also illustrated.
The invention also relates to a method for producing the derivatives of the invention by preparing a DNA fragment comprising at least the part of the coding sequence of staphylokinase that provides for its biological activity; performing in vitro site-directed mutagenesis on the DNA fragment to replace one or more codons for wild-type amino acids by a codon for another amino acid; cloning the mutated DNA fragment in a suitable vector; transforming or transfecting a suitable host cell with the vector; and culturing the host cell under conditions suitable for expressing the DNA fragment. Preferably the DNA fragment is a 453 bp EcoRI-HindIII fragment of the plasmid pMEX602sakB (22,23), the in vitro site-directed mutagenesis is performed by spliced overlap extension polymerase chain reaction with Vent DNA polymerase (New England Biolabs) or Taq polymerase (Boehringer Mannheim) and with available or generated SakSTAR or SAKSTAR variants as template (24).
A second DNA fragment is described in connection with the present invention. The DNA fragment is a 466 bp EcoRI-HindIII fragment of the plasmid pMEX602SAK. The expression vector pMEX602SAK was kindly provided by The Institute for Molecular Biology of Jena, Germany.
The invention also relates to pharmaceutical compositions comprising at least one of the staphylokinase derivatives according to the invention together with a suitable excipient, for treatment of arterial thrombosis. Pharmaceutical compositions, containing less immunogenic staphylokinase variants as the active ingredient, for treating arterial thrombosis in human or veterinary practice may take the form of powders or solutions and may be used for intravenous, intraarterial or parental administration. Such compositions may be prepared by combining (e.g. mixing, dissolving etc.) the active compound with pharmaceutically acceptable excipients of neutral character (such as aqueous or non-aqueous solvents, stabilizers, emulsifiers, detergents, additives), and further, if necessary with dyes. The concentration of the active ingredient in a therapeutical composition may vary widely between 0.1% and 100%, dependent on the character of the disease and the mode of administration. Further the dose of the active ingredient to be administered may vary between 0.05 mg and 1.0 mg per kg of body weight.
Furthermore the invention relates to the use of the staphylokinase derivatives for the treatment of arterial thrombosis, in particular myocardial infarction, and to the use of staphylokinase derivatives for the preparation of a pharmaceutical composition for the treatment of arterial thrombosis, in particular myocardial infarction.

BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the protein sequence of wild-type staphylokinase, SakSTAR (SEQ ID NO: 5). Numbering starts with the NH.sub.2 -terminal amino acid of mature full length staphylokinase. The "charge-cluster to alanine" variants that were studied are indicated;
FIG. 2 shows a schematic diagram of interrelationship among disclosed monoclonal antibodies;
FIG. 3 are graphs showing a time course of neutralizing activities (left panel) and specific IgG against administered agent (right panel) following intra-arterial infusion of SakSTAR (open circles, N=9), SakSTAR(K.sub.74) (closed circles, N=11) or SakSTAR(K.sub.74 ER) (open squares, n=6) in patients with peripheral arterial occlusion. The data represent median values and interquartile ranges, in .mu.g/ml.

DETAILED DESCRIPTION OF THE INVENTION
In the above and the following the terms "derivatives", "mutants" and "variants" are used interchangeably U.S. Pat. No. 5,695,754, issued Dec. 9, 1997 is hereby incorporated by reference.
The present invention will be demonstrated in more detail in the following examples, that are however not intended to be limiting to the scope of the invention. Based on the present invention several variants and improvements will be obvious for the person skilled in the art. Thus random mutagenesis is likely to generate alternative mutants with reduced immunogenicity and possibly increased functional activity, whereas mutagenesis of other amino acids may yield other variants with reduced immunogenicity.
EXAMPLE 1
Epitope mapping of wild-type staphylokinase
The epitope specificity of a panel of 15 murine MAbs (22) raised against wild-type SakSTAR was determined by real-time biospecific interaction analysis (BIA) with the BIAcore instrument (Pharmacia, Biosensor AB, Uppsala, Sweden). The MAbs were immobilized on the surface of the Sencor Chip CM5 with the Amine Coupling Kit (Pharmacia Biosensor AB) as recommended by the manufacturer (25). Immobilization was performed from protein solutions at a concentration of 20 .mu.g/mL in 10 mmol/L sodium acetate at pH 5.0 at a flow rate of 5 .mu.L/min during 6 minutes. This resulted in covalent attachment of 5,000 to 10,000 resonance unit (RU) of antibody (corresponding to 0.035 to 0.07 pmol/mm.sup.2). The SakSTAR solutions were passed by continuous flow at 20.degree. C. past the sensor surface. At least four concentrations of each analyte (range, 50 nmol/L to 50 .mu.mol/L) in 10 mmol/L HEPES, 3.4 mmol/L EDTA, 0.15 mol/L NaCl, and 0.005% Surfactant P20, pH 7.2, were injected at a flow rate of 5 .mu.L/min during 6 minutes in the association phase. Then sample was replaced by buffer, also at a flow rate of 5 .mu.L/min during 6 minutes. After each cycle, the surface of the sensor chip was regenerated by injection of 5 .mu.L of 15 mmol/L HCl. Apparant association (k.sub.ass) and apparent dissociation (k.sub.diss) rate constants were derived from the sensorgrams as described in detail elsewhere (26).
Determination of the equilibrium association constants for the binding of wild-type and variant SakSTAR to insolubilized MAbs (Table 1) yielded apparent association constants of 10.sup.7 to 10.sup.8 (mol/L).sup.-1, which are one to two orders of magnitude lower than the apparent association constants previously obtained for the binding of these MAbs to insolubilized wild-type SakSTAR (22). If the MAbs instead of the SakSTAR variants are insolubilized, avidity effects of the bivalent MAbs are indeed avoided. These present values are indeed in better agreement with known association constants of Mabs, and therefore this "reversed" procedure was used throughout the present invention.
In table 1 the column indicated with "Compound" states the various staphylokinase derivatives, the column "Substituted amino acids" identifies the modified wild-type residues, their position in the sequence and their substituted amino acid, and the column "Spec. Act." indicates the specific activity in Home Units. Indications "17G11", "26A2" etc. refer to monoclonal antibodies binding to the indicated epitopes I, II, and III (22). Epitope I is recognized by the antibody cluster 17G11, 26A2, 30A2, 2B12 and 3G10, whereas epitope II is recognized by the antibody cluster 18F12, 14H5, 28H4, 32B2 and 7F10, and epitope III by the antibody cluster 7H11, 25E1, 40C8, 24C4 and 1A10. Deposit of certain of these hybridomas have been made in the Belgian Coordinated Collections of Microorganisms (BCCM), Laboratorium voor Moleculaire Biologie-Plasmidencollectie (LMBP), Universiteit Gent. K. L. Ledeganckstraat 35, B-9000 Gent, Belgium. The accession numbers for the hybridomas are as follows: 28H4, LMBP1629CB; 18F12, LMBP1628CB; 3G10, LMBP1632CB; 30A2, LMBP1630CB; 17G11, LMBP1635CB; 1A10, LMBP1634CB; 24C4, LMBP1633CB; 7H11, LMBP1627CB AND 32B2, LMBP1631CB.
EXAMPLE 2
Construction and epitope mapping, with murine monoclonal antibodies, of "alanine-to-wild-type" reversal variants of "charged-cluster-to-alanine" mutants of staphylokinase
As stated above, wild-type staphylokinase (SakSTAR variant (9)) contains three non-overlapping immunodominant epitopes, two of which can be eliminated by specific site-directed substitution of clusters of two (K35A,E38A or E80A,D82A) or three (K74A,E75A,R77A) charged amino acids with Ala (22). The combination mutants SakSTAR(K35A,E38A,K74A,E75A,R77A) in which Lys35, Glu38, Lys74, Glu75 and Arg77, and SakSTAR(K74A,E75A,R77A,E80A,D82A) in which Lys74, Glu75, Arg77, Glu80 and Asp82 were substituted with Ala (previously identified as SakSTAR.M3.8 and SakSTAR.M8.9, respectively (22)), were found to have a reduced reactivity with murine monoclonal antibodies against two of the three immunodominant epitopes and to absorb on average only 2/3of the neutralizing antibodies elicited in 16 patients by treatment with wild-type SakSTAR (22). These mutants also induced less antibody formation than wild-type SakSTAR in rabbit and baboon models, and in patients with peripheral arterial occlusion (22). However, their specific activities were reduced to approximately 50% of that of wild-type SakSTAR, which would be of some concern with respect to the clinical use of these compounds.
In an effort to improve the activity and stability without loss of the reduced antibody recognition, the effect of a systematic reversal of one or more of these substituted amino acids to the wild-type residues was studied. Fourteen new mutants were constructed, purified and characterized in terms of specific activity, reactivity with the panel of murine monoclonal antibodies (Table 1), and absorption of antibodies from plasma of patients treated with wild-type SakSTAR (Table 2). The present example thus focusses on reversal from alanine to the wild-type residue of one or more of the seven amino acids of SakSTAR listed above i.e. K35, E38, K74, E75, R77, E80 and D82. The mutants are identified by the substituted amino acids in the order of their sequence in the molecule, with addition in subscript of those sequence numbers required to avoid ambiguity. For example, SakSTAR(K35A,E38A,K74A,E75A,R77A) is identified as SakSTAR(KEKER) and SakSTAR(K74A,E75A,R77A) as SakSTAR(K.sub.74 ER).
The source of all reagents used in the present study has previously been reported (22). Restriction enzymes were purchased from Pharmacia, Uppsala, Sweden or Boehringer Mannheim (Mannheim, Germany). T4 DNA ligase, Klenow Fragment of E. coli DNA polymerase I and alkaline phosphatase were obtained from Boehringer Mannheim. Enzyme reactions were performed using the conditions suggested by the suppliers. Plasmid DNA was isolated using a QIAGEN-purification protocol (provided by Westburg, Leusden, The Netherlands). pMEX.602sakB (i.e. pMEX.SakSTAR) was constructed as described elsewhere (23). SakSTAR, SakSTAR(KE.sub.38), SakSTAR(K.sub.74 ER), SakSTAR(E.sub.80 D), SakSTAR(KEKER) and SakSTAR(K.sub.74 ERED) were produced and purified as described elsewhere (22). Transformations of E. coli were performed utilizing the calcium phosphate procedure. DNA sequencing was performed using the dideoxy chain termination reaction method and the Automated Laser fluorescent A.L.F..TM. (Pharmacia). The chromogenic substrate (S2403) L-Pyroglutamyl-L-phenylalanyl-L-lysine-P-nitroanaline hydrochloride was purchased from Chromogenix (Belgium). .sup.125 I-labeled fibrinogen was purchased from Amersham (UK). All other methods used in the present example have been previously described (22,27).
The plasmids encoding SakSTAR(KEKE.sub.75), SakSTAR(EER), SakSTAR(EE.sub.75), SakSTAR(K.sub.35 E.sub.75 R), SakSTAR(K.sub.35 E.sub.75), SakSTAR(E.sub.80), SakSTAR(D), SakSTAR(E.sub.75 D), SakSTAR(K.sub.74) and SakSTAR(E.sub.75) were constructed by the spliced overlap extension polymerase chain reaction (SOE-PCR) (24), using Vent DNA polymerase (New England Biolabs, Leusden, The Netherlands), and available or generated SakSTAR variants as template. Two fragments were amplified by PCR, the first one starting from the 5' end of the staphylokinase gene with primer 5'-CAGGAAACAGAATTCAGGAG-3' to the region to be mutagenized (forward primer SEQ ID NO:1), the second one from the same region (backward primer SEQ ID NO:2) to the 3' end of the staphylokinase gene with primer 5'-CAAAACAGCCAAGCTTCATTCATTCAGC-3'. The forward and backward primers shared an overlap of around 24 bp (primers not shown). The two purified fragments were then assembled together in a new primeness PCR using Taq polymerase (Boehringer Mannheim). After 7 cycles (1 min at 94.degree. C., 1 min at 70.degree. C.), the extended product was reamplified by adding the 5' and 3' end primers (see above) to the PCR reaction and by cycling 25 times (1 min at 94.degree. C., 1 min 55.degree. C., 1 min at 72.degree. C.). The final product was purified, digested with EcoRI and HindIII and cloned into the corresponding sites of pMEX602sakB.
The plasmid encoding SakSTAR(EKER) was assembled by digestion of pMEX602sakB and pMEX.SakSTAR(KEKER) with Bpm I which cuts between the codons for K35 and E38 of SakSTAR, and ligation of the required fragments. The plasmid encoding SakSTAR(KKER) was constructed by digestion of pMEX.SakSTAR(KEKER) and pMEX.SakSTAR(K.sub.74 ER) with Bpm I and religation of the required fragments. The plasmids encoding SakSTAR(KEER) and SakSTAR(KEKR) were constructed by two PCR using pMEX.SakSTAR(KEKER) as template, followed by restriction ligation and recloning into pMEX602sakB.
Analytical purification of SakSTAR variants
The SakSTAR variants were expressed and purified, as described below, from transformed E coli WK6 grown either in LB medium �SakSTAR(EKER), SakSTAR(K.sub.74), SakSTAR(E.sub.75) and SakSTAR(E.sub.75 D)!, or in terrific broth (TB) (28) medium �SakSTAR(KKER), SakSTAR(KEER), SakSTAR(KEKR), SakSTAR(KEKE.sub.75), SakSTAR(EER), SakSTAR(EE.sub.75), SakSTAR(K.sub.35 E.sub.75), SakSTAR(K.sub.35 E.sub.75), SakSTAR(E.sub.80), and SakSTAR(D)!.
For derivatives produced in LB medium, a 20 ml aliquot of an overnight saturated culture was used to inoculate a 2 liter volume (in a 5 liter flask) of LB medium containing 100 .mu.g/ml ampicillin. After 3 hours incubation at 37.degree. C., IPTG (200 .mu.M) was added to induce expression from the tac promoter. The production phase was allowed to proceed for 4 hours, after which the cells were pelleted by centrifugation at 4,000 rpm for 20 min, resuspended in 1/20 volume (100 ml) of 0.01 M phosphate buffer pH 6.5 and disrupted by sonication at 0.degree. C. Cell debris were removed by centrifugation for 20 min at 20,000 rpm and the supernatant, containing the cytosolic soluble protein fraction, was stored at -20.degree. C. until purification.
For the derivatives produced in TB medium, a 4 ml aliquot of an overnight saturated culture in LB medium was used to inoculate a 2 liter culture (in a 5 liter flask) in terrific broth containing 100 .mu.g/ml ampicillin. The culture was grown with vigorous aeration for 20 hours at 30.degree. C. The cells were pelleted by centrifugation, resuspended in 1/10 volume (200 ml) of 0.01 M phosphate buffer pH 6.5 and disrupted by sonication at 0.degree. C. The suspension was then centrifuged for 20 min at 20,000 rpm and the supernatant was stored at -20.degree. C. until purification.
Cleared cell lysates containing the SakSTAR variants were subjected to chromatography on a 1.6.times.6 cm column at SP-Sephadex, followed by chromatography on a 1.6.times.5 cm column of Q-Sepharose (variants SakSTAR(EKER), SakSTAR(KKER), SakSTAR(KEER), SakSTAR(KEKR) and SakSTAR(KEKE.sub.75)) or by chromatography on a 1.6.times.6 cm column phenyl-Sepharose (variants SakSTAR(EER), SakSTAR(EE.sub.75), SakSTAR(K.sub.35 E.sub.75 R), SakSTAR(K.sub.35 E.sub.75), SakSTAR(K.sub.74), SakSTAR(E.sub.75), SakSTAR(E.sub.80), SakSTAR(D) and SakSTAR(E.sub.75 D)). The SakSTAR containing fractions, localized by SDS-gel electrophoresis, were pooled for further analysis.
Protein concentrations were determined according to Bradford (29). The fibrinolytic activities of SakSTAR solutions were determined with a chromogenic substrate assay carried out in microtiters plates using a mixture of 80 .mu.l SakSTAR solution and 100 .mu.l Glu-plasminogen solution prepared as described elsewhere (30) (final concentration 0.5 mM). After incubation for 30 min at 37.degree. C., generated plasmin was quantitated by addition of 30 .mu.l S2403 (final concentration 1 .mu.M) and measurement of the absorption at 405 nm. The activity was expressed in home units (HU) by comparison with an in-house standard (lot STAN5) which was assigned an activity of 100,000 HU per mg protein as determined by amino acid composition (7). SDS-PAGE was performed with the Phast System.TM. (Pharmacia, Uppsala, Sweden) using 10-15% gradient gels and Coomassie Brilliant blue staining. Reduction of the samples was performed by heating at 100.degree. C. for 3 min in the presence of 1% SDS and 1% dithioerythritol. The fibrinolytic activities of the different SakSTAR mutants determined with the chromogenic substrate assay are summarized in table 1. In agreement with previous observations (22), SakSTAR(K.sub.74 ER) did not react with 4 of the 5 MAbs recognizing epitope I, whereas SakSTAR(KE.sub.38) did not react with 3 of the 5 and SakSTAR(E.sub.80 D) not with the 4 of the 5 Mabs recognizing epitope III. These reduced reactivities were additive in SakSTAR(KEKER) and in SakSTAR(K.sub.74 ERED). The reduced reactivity of SakSTAR(K.sub.74 ER) was fully maintained in SakSTAR(KEKE.sub.75) and in SakSTAR(K.sub.35 E.sub.75 R), largely in SakSTAR(KEER), SakSTAR(EER), SakSTAR(EE.sub.75) and SakSTAR(E.sub.75), but much less in SakSTAR(KEKR) and SakSTAR(K.sub.74), indicating that E75 is the main contributor to the binding of the 4 Mabs recognizing epitope I to SakSTAR. However, surprisingly, binding of epitope I antibodies to SakSTAR(E.sub.75 D) was normal in two independent preparations from expression plasmids with confirmed DNA sequences. The reduced reactivity of the 3 MAbs of epitope III with SakSTAR(KE.sub.38) required both K35 and E38, as demonstrated with SakSTAR(EKER) and SakSTAR(KKER), with SakSTAR(EE.sub.75) and SakSTAR(K.sub.35 E.sub.75) and with SakSTAR(EER) and SakSTAR(K.sub.35 E.sub.75 R). The reduced reactivity of the 4 MAbs of cluster III with SakSTAR(E.sub.80 D) was maintained in SakSTAR(D) but not in SakSTAR(E.sub.80).
EXAMPLE 3
Adsorption with wild-type and with "alanine-to-wild-type" reversal variants of "charged-cluster-to-alanine" staphylokinase mutants of antibodies, elicited in patients by treatment with wild-type SakSTAR
Plasma samples from 16 patients with acute myocardial infarction, obtained several weeks after treatment with SakSTAR (4,31) were used. The staphylokinase-neutralizing activity in these samples was determined as follows. Increasing concentrations of wild-type or variant SakSTAR (50 .mu.l volumes containing 0.2 to 1000 .mu.g/ml) were added to a mixture of 300 .mu.l citrated human plasma and 50 .mu.l buffer or test plasma, immediately followed by addition of 100 .mu.l of a mixture containing thrombin (50 NIH units/ml) and CaCl.sub.2 (25 mM). The plasma clot lysis time was measured and plotted against the concentration of SakSTAR moiety. From this curve the concentration of staphylokinase moiety that produced complete clot lysis in 20 min was determined. The neutralizing activity titer was determined as the difference between the test plasma and buffer values and was expressed in .mu.g per ml test plasma. The results of the individual patients have been reported elsewhere (22). For the present invention, three plasma pools were made, one from 10 patients from whom sufficient residual plasma was available, one from three patients that absorbed less than 50% of the antibodies with SakSTAR(KEKER) (Subpool B) and one from three patients that absorbed >90% of the antibodies with SakSTAR(KEKER) (Subpool C).
These plasma pools were diluted (1/30 to 1/200) until their binding to SakSTAR substituted chips in the BIAcore instrument amounted to approximately 2000 RU. From this dilution a calibration curve for antibody binding was constructed using further serial two-fold dilutions. The plasma pools were absorbed for 10 min with 100 nM of the SakSTAR variants, and residual binding to immobilized SakSTAR was determined. Residual binding was expressed in percent of unabsorbed plasma, using the calibration curve.
The results are summarized in Table 2. Whereas wild-type SakSTAR absorbed more than 95% of the binding antibodies from pooled plasma of the 10 patients, incomplete absorption (<60%) was observed with SakSTAR(K.sub.74 ER), SakSTAR(KEKER), SakSTAR(EKER), SakSTAR(KKER), SakSTAR(KEKR), SakSTAR(KEKE.sub.75), SakSTAR(K.sub.74) and SakSTAR(K.sub.74 ERED) but absorption was nearly complete with SakSTAR(KE.sub.38), SakSTAR(KEER), SakSTAR(EER), SakSTAR(E.sub.38 E.sub.75), SakSTAR(K.sub.35 E.sub.75 R), SakSTAR(E.sub.80 D), SakSTAR(E.sub.80) and SakSTAR(D). These results, surprisingly, demonstrate that approximately 40% of the antibodies elicited in patients by treatment with wild-type SakSTAR depend on K74 for their binding (Table 2). Absorption with pooled plasma from 3 patients from which <50% of the antibodies were absorbed with SakSTAR(KEKER) (Subpool B) confirmed the predominant role of K74 for antibody recognition. As expected, absorption with pooled plasma from 3 patients from which >95% of the antibodies were absorbed with SakSTAR(KEKER) (Subpool C) was nearly complete with all variants tested.
EXAMPLE 4
Construction and epitope mapping, with murine monoclonal antibodies, of site-specific mutants of staphylokinase
Site-directed mutagenesis was applied to residues other than "charged amino acids" in order to identify i) additional residues belonging to epitopes I and III identified with the panel of murine Mabs ii) amino acids determining adsorption to antiserum from immunized patients and ii) key residues recognized by the monoclonal antibody cluster specific for epitope II (as defined in example 1 above). Since functional epitopes generally comprise more than one amino acid residue critical for antibody binding, identification of additional residues in these epitopes could fuel the construction of new combination derivatives displaying a lower antigenic profile, while keeping the specific activity and the temperature stability of wild-type staphylokinase.
In this example, the construction and characterization of SakSTAR variants in which one or at most two amino acids (adjacent or in close vicinity) were mutated to alanine is described. We show also that other types of substitution at key residues for binding to murine monoclonal antibodies and/or at critical residues for adsorption to antiserum from immunized patients can be identified, while keeping the modified antigenic profile. In addition, for some key amino acids, mutation into other residues than in alanine is preferable to maintain the specific activity of the variants.
The mutants described under this example are listed in tables 3 and 4. These variants were expressed in E. coli, purified and characterized in terms of specific activity, reactivity with the panel of murine monoclonal antibodies (Table 3), and absorption of antibodies from plasma of patients treated with wild-type SakSTAR (Table 4).
The source of all reagents used in the present study has previously been reported (22), or is specified below. The template vector for mutagenesis, pMEX602sakB (i.e. pMEX.SakSTAR), has been described elsewhere (23). The construction of the variant SakSTAR(K74) is described above (example 2). Restriction and modification enzymes were purchased from New England Biolabs (Leusden, The Netherlands), Boehringer Mannheim (Mannheim, Germany) or Pharmacia (Uppsala, Sweden). The enzymatic reactions were performed according to the supplier recommendation. The mutagenic oligonucleotides and primers were obtained from Eurogentec (Seraing, Belgium). Plasmid DNA was isolated using a purification kit from Qiagen (Hilden, Germany), as recommended. Transformation-competent E. coli cells were prepared by the well-known calcium phosphate procedure. Nucleotide sequence determination was performed on double strand plasmid DNA with the dideoxy chain termination method, using the T7 sequencing kit (Pharmacia, Uppsala, Sweden). Polymerase chain reactions (PCR) were performed using Taq polymerase from Boehringer Mannheim (Mannheim, Germany). The recombinant DNA methods required to construct the variants described in this example are well established.
The variants SakSTAR.M27, SakSTAR.M46, SakSTAR.M48, SakSTAR.M44, SakSTAR.M53, SakSTAR.M54, SakSTAR.M55, SakSTAR.M67 and SakSTAR.M56 were constructed with the Chameleon Double-Stranded Site-Directed Mutagenesis kit from Stratagene (La Jolla, USA), using the pMEX.SakSTAR vector as template, and following instructions of the supplier. The mutagenic oligonucleotides (not shown) were used in combination with the selection-primer LY34 (SEQ ID NO:3) 5' CAAAACAGCCGAGCTTCATTCATTCAGC, which destroys the unique HindIII site located 3' to the staphylokinase encoding gene into pMEX.SakSTAR and allows to counter-select the non-mutant progeny by a HindIII digestion. The deletion of the HindIII site was in most case correlated with the presence of the desired mutation introduced by the mutagenic oligonucleotide. The variants SakSTAR.M58, in which Ile133 is mutated in alanine, was constructed by performing a polymerase chain reaction on the pMEX.SakSTAR plasmid using the primer 818A (SEQ ID NO:1) located at the 5' end of the sakSTAR gene (5' CAGGAAACAGAATTCAGGAG ) and the mutagenic primer LY58 (SEQ ID NO:4) (5' TTCAGCATGCTGCAGTTATTTCTTTTCTGCAACAACCTTGG). The amplified product (30 cycles: 30 sec at 94.degree. C., 30 sec at 50.degree. C., 30 sec at 72.degree. C.) was purified, digested with EcoRI and PstI, and ligated into the corresponding sites of pMEXSakSTAR.
The variants SakSTAR.M57, SakSTAR.M127 and SakSTAR.M137 were constructed by performing a polymerase chain reaction using the primer 818A located at the 5' end of the sakSTAR gene and mutagenic primers (not shown). The amplified product (30 cycles: 1 sec at 94.degree. C., 1 sec at 50.degree. C., 10 sec at 72.degree. C.) was purified, digested with EcoRI and StyI, and ligated into the corresponding sites of pMEXSakSTAR. The variant SakSTAR.M2426 was constructed by performing two consecutive PCR reactions (30 cycles: : 30 sec at 94.degree. C., 30 sec at 50.degree. C., 30 sec at 72.degree. C.). In the first reaction, a fragment of pMEX.SaksSTAR was amplified with the primers 818A and a mutagenic primer. This amplified fragment was then used as template in a second PCR reaction with a mutagenic primer in order to further elongate the fragment downstream of the StyI site present in the sakSTAR gene (corresponding to amino acids 130-131 of SakSTAR). The resulting product was digested with EcoRI and StyI, and ligated into the corresponding sites of pMEXSakSTAR.
The plasmids encoding all the other variants listed in tables 3 and 4 were constructed by the spliced overlap extension polymerase chain reaction (SOE-PCR)(24) using pMEX.SakSTAR or available plasmids encoding SakSTAR variants as template. Two fragments were amplified by PCR (30 cycles: 1 sec at 94.degree. C., 1 sec at 50.degree. C., 10 sec at 72.degree. C.), the first one starting from the 5' end (primer 818A) of the staphylokinase gene to the region to be mutagenized (forward primer), the second one from this same region (backward primer) to the 3' end of the gene with primer 818D (SEQ ID NO:2) (5' CAAACAGCCAAGCTTCATTCATTCAGC). the forward and backward primers shared an overlap of around 24 bp (primers not shown). The two purified fragments were then assembled together in a second PCR reaction with the external primers 818A and 818D (30 cycles: 1 sec at 94.degree. C., 1 sec at 50.degree. C., 10 sec at 72.degree. C.). The amplified product from this final reaction was purified, digested with EcoRI and HindIII and ligated into the corresponding site of pMEX.SakSTAR.
For each construction, the sequence of the variant was confirmed by sequencing the entire SakSTAR coding region.
Analytical purification of SakSTAR variants
The SakSTAR variants were expressed and purified, as described below, from transformed E. coli grown in terrific broth (TB) medium. A 4 ml aliquot of an overnight saturated culture in LB medium was used to inoculate a 1 to 2 liter culture (in 5 liter flask) in terrific broth supplemented with 100 ug/ml ampicillin. The culture was incubated with vigorous aeration and at 30.degree. C. After about 16 hours incubation, IPTG (200 uM) was added to the culture to induce expression from the tac promoter. After 3 hours induction, the cells were pelleted by centrifugation at 4,000 rpm for 20 min., resuspended in 1/10 volume of 0.01 M phosphate buffer pH 6-6.5 and disrupted by sonication at 0.degree. C. The suspension was centrifuged for 20 min at 20,000 rpm and the supernatant was stored at 4.degree. C. or at -20.degree. C. until purification. The material was purified essentially as described above (Example 2): cleared cell lysates containing the SakSTAR variants were subjected to chromatography on a 1.6.times.5 cm column of SP-Sephadex, followed by chromatography on a 1.6.times.8 cm column of phenyl-Sepharose. The SakSTAR containing fractions, localized by SDS-gel electrophoresis, were pooled for further analysis.
Physiochemical and biochemical analysis
Protein concentrations were determined according to Bradford (29). SDS-PAGE was performed with the Phast System.TM. (Pharmacia, Uppsala, Sweden) using 10-15% gradient gels and Coomassie Brillant blue staining. Reduction of the samples was performed by heating at 10.degree. C. for 3 min in the presence of 1% SDS and 1% dithioerythritol. The fibrinolytic activities of SakSTAR solutions were determined with a chromogenic substrate assay carried out in microtiter plates using a mixture of 80 ul SakSTAR solution and 100 ul Glu-plasminogen solution (final concentration 0.5 mM). After incubation for 30 min at 37.degree. C., generated plasmin was quantitated by addition of 30 ul S2403 (final concentration 100 uM) and measurement of the absorption at 405 nm. The activity was expressed in home units (HU) by comparison with an in-house standard (lot STAN5) which was assigned an activity of 100,000 HU per mg protein as determined by amino acid composition (7). The specific activity of the different SakSTAR variants are summarized in tables 3 and 4.
Reactivity of SakSTAR variants with a panel of murine monoclonal antibodies
The methodology used to determine the reactivity of the SakSTAR variants with a panel of murine monoclonal antibodies was described in example 1 above.
In the present example, sixty-five mutants were evaluated in detail, together with wild-type staphylokinase. The results are summarized in table 3 (the layout of this table corresponds to the layout of table 1, as described in example 1). Apparent association constants at least 10-fold lower than those of wild-type staphylokinase were considered as significant and are indicated in bold type in the table.
Thirty-five variants displayed a modified recognition profile by the mouse monoclonal antibodies (mMAbs) compared to SakSTAR. SakSTAR.M3031 �SakSTAR(Y73A)! is not recognized by 3 mMAbs of cluster I; SakSTAR.M8586 �SakSTAR(W66A)! is not recognized by 5 mMAbs of cluster I; SakSTAR.M128129 �SakSTAR(L116A,S117A)! is not recognized by 2 mMAbs of cluster II; SakSTAR.M5960 �SakSTAR(H43A)! is not recognized by 3 mMAbs of cluster II; SakSTAR.M7576 �SakSTAR(V45A)! is not recognized by 3 mMAbs of cluster II; and SakSTAR.M9596 �SakSTAR(V32A)! is not recognized by 4 mMAbs of cluster III; in these variants, uncharged residue(s) were modified in alanine.
Alanine does not constitute the only possible substituent for a particular residue. For example, variants SakSTAR.M103104 and SakSTAR.M105106, with Gly36 modified respectively in Arg and in Lys, displayed a similarly altered antigenic profile (i.e., not recognized by 3 mMAbs of cluster III). Likewise, mutation of residue His43 in Ala (SakSTAR.M5960) or in Arg (SakSTAR.M6162) resulted in a similarly modified reactivity with the monoclonal antibody panel (not recognized by 3 mMAbs of cluster II). However, the specific activity of these variants, 69,000 and 120,000 respectively, indicated that Arg represents a prefered substitution for His43.
Another aspect of this invention is illustrated by the evaluation of six other variants, in which residue Tyr73 was mutated respectively in Ala, Phe, Trp, Ser, His and Leu (Table 3). SakSTAR.M145146a �SakSTAR(Y73F)! and SakSTAR.M171172 �SakSTAR(Y73W)! reacted as wild-type SakSTAR with the monoclonal antibody panel, while the antigenic reactivities of the four other variants were altered to different levels depending on the introduced residue: SakSTAR.M145146c �SakSTAR(Y73S)! was not recognized by 1 mMAb of cluster I; SakSTAR.M169170 �SakSTAR(Y73H)! was not recognized by 2 mMAbs of cluster l; SakSTAR.M3031 �SakSTAR(Y73A)! was not recognized by 3 mMAbs of cluster I; and SakSTAR.M145146b �SakSTAR(Y73L)! was not recognized by 4 mMAbs of cluster I.
EXAMPLE 5
Adsorption with wild-type and site-specific staphylokinase variants of antibodies, elicited in patients by treatment with SakSTAR
For the present example, the three plasma pools prepared from 10 patients, as described in example 3 were used. The methodology used to evaluate the absorption with wild-type staphylokinase and with 65 SakSTAR variants, of antibodies elicited in patients treated with SakSTAR, is described in detail in example 3. The results are summarized in Table 4. Whereas wild-type SakSTAR and most of the variants analyzed in this example absorbed more than 95% of the binding antibodies from pooled plasma of the 10 patients, incomplete absorption (<60%) was observed with SakSTAR.M3031, in which Tyr73 is substitued with Ala, and with the combined variants SakSTAR.M7980 with Y73A,K74A, SakSTAR.M8990 with Y73F,K74A and SakSTAR.M103104+ with G36R,K74A. The predominant role of Lys74 for antibody recognition has been demonstrated previously (see example 3). The present results suggest that Tyr73 participates to the same major epitope as Lys74, or, alternatively, that substitution at Tyr73 may indirectly induce a structural modification of the "K74-epitope". Absorption with pooled plasma from 3 patients from which >95% of the antibodies were absorbed with SakSTAR (KEKER) (Subpool C, see example 3) was nearly complete with most variants tested. However, incomplete absorption was observed with the variants SakSTAR.M103104 �SakSTAR(G36R)! and SakSTAR.M105106 �SakSTAR(G36K)! (<70%), and with the combination variant SakSTAR.M103104+�SakSTAR(G36R,K74A)! (<60%). This combination variant absorbed also <40% of the antibodies from Subpool B, and had a specific activity of 65,000 HU/mg (>50% of wild-type SakSTAR).
EXAMPLE 6
Identification of selected variants of staphylokinase with more than 50% residual specific activity, a more than 10-fold reduced binding to murine MAbs of one of the immunodominant epitopes and a less than 80% adsorption of pooled human antibodies elicited in patients by treatment with wild-type SakSTAR.
Five of the variants constructed and characterized in the present study combined the property of a residual specific activity of .gtoreq.50 percent of that of wild-type SakSTAR with a .gtoreq.10-fold reduced reactivity with one or more of the murine monoclonal antibodies and/or with less than 80 percent absorption with one of the subpools of antisera obtained from patients treated with wild-type SakSTAR. The results are summarized in Table 5.
In the plasma pool from 10 patients treated with SakSTAR for acute myocardial infarction, the elicited antibodies were only adsorbed for approximately 50% by SakSTAR(KEKER) and SakSTAR(K.sub.74 ERED). This reduced reactivity could be fully ascribed to the K74,E75,R77 epitope, with little contribution by the K35,E38 or E80,D82 epitopes. Furthermore, the reduced antibody recognition was largely maintained in SakSTAR(K.sub.74), which had an intact specific activity and clearly the best activity/antigenicity ratio in man of all "alanine to wild-type reversal" variants studied. In subpool B, containing plasma from 3 patients from which SakSTAR(KEKER) adsorbed less than 50% of the antibodies elicited by SakSTAR treatment, similar although more pronounced altered antibody recognition patterns were observed with the SakSTAR variants. As expected, subpool C, prepared from plasma of 3 patients from which SakSTAR(KEKER) adsorbed over 95%, similar antibody recognition patterns were observed with all SakSTAR variants studied.
The most surprising observation in man, which could not have been predicted nor extrapolated from results obtained in mice, is that only one of these 7 amino acids, namely K74, is responsible for most of the reduction in antibody recognition of the SakSTAR(KEKER) and SakSTAR(K.sub.74 ERED) variants, although a subgroup of patients (Subpool C) did not develop significant levels of antibodies against these epitopes. Alternatively, SakSTAR(G36K) and SakSTAR(G36R) combined an intact specific activity with reduced murine antibody binding to epitope III and, importantly, reduced absorption of antibodies from subpool C. The combination mutant SakSTAR(G36R,K74A) combined the reduced antibody recognition patterns of the parent variants, with maintenance of a residual specific activity of 50 percent of that of wild-type SakSTAR.
EXAMPLE 7
Comparative thrombolytic efficacy and immunogenicity of SakSTAR(K74A,E75A,R77A) and SakSTAR(K74A) versus SakSTAR in patients with peripheral arterial occlusion
A 12 to 24 liter culture (in 2 liter batches) of the variants SakSTAR(K74A,E75A,R77A) herinafter called SakSTAR(K.sub.74 ER), or of SakSTAR(K74A), hereinafter called SakSTAR(K.sub.74) was grown and IPTG-induced in LB medium supplemented with 100 .mu.g/ml ampicillin, pelleted, resuspended, disrupted by sonication and cleared as described above. The compounds were purified by chromatography on a 5.times.20 cm column of SP-Sephadex, a 5.times.10 cm column of Q-Sepharose and/or a 5.times.cm column of phenyl-Sepharose using buffer systems described elsewhere (22,23). The materials were then gel filtered on sterilized Superdex 75 to further reduce their endotoxin content. The SakSTAR variant containing fractions were pooled, the protein concentration was adjusted to 1 mg/ml and the material sterilized by filtration through a 0.22 .mu.m Millipore filter. The methodology used to determine specific activity is described above (22).
Staphylokinase-neutralizing activity in plasma was determined as described above. Quantitation of antigen-specific IgG and IgM antibodies was performed using enzyme-linked immunosorbent assays in polystyrene microtiter plates essentialy as described previously (22). In the IgG assays, dilution curves of affinospecific anti-SakSTAR IgG antibodies were included on each plate. These antibodies were isolated from plasma obtained from 3 patients, after thrombolytic therapy with wild-type SakSTAR, by chromatography on protein A-Sepharose and on insolubilized SakSTAR, and elution of bound antibodies with 0.1 M glycine-HCl, pH 2.8. The purity of the IgG preparation was confirmed by sodium dodecylsulfate polyacrylamide gel electrophoresis. In the IgM assays, titers defined as the plasma dilution giving an absorbancy at 492 nm equivalent to that of a 1/640 dilution of pooled plasma were determined and compared with the titer of baseline samples before treatment (median value 1/410, interquartile range 1/120-1/700).
Wild-type SakSTAR or the variants SakSTAR(K.sub.74) or SakSTAR(K.sub.74 ER) were administered intra-arterially at or in the proximal end of the occlusive thrombus as a bolus of 2 mg followed by an infusion of 1 mg/hr (reduced overnight in some patients to 0.5 mg/hr) in groups of 6 to 12 patients with angiographically documented occlusion of a peripheral artery or bypass graft of less than 120 days duration. Patients were studied after giving informed consent, and the protocol was approved by the Human Studies Committee of the University of Leuven. Inclusion and exclusion criteria, conjunctive antithrombotic treatment (including continuous intravenous heparin) and the study protocol were essentially as previously described (22).
Relevant baseline characteristics of the individual patients are shown in Table 6. The majority of PAO were at the femoropopliteal level. Two iliac stent and 8 graft occlusions were included. Eight patients presented with incapacitating claudication, 5 with chronic ischemic rest pain, 7 with subacute ischemia and 7 with acute ischemia. One patient (POE) who had 2 years previously been treated with SakSTAR was included in the SakSTAR(K.sub.74) group. This patient was not included in the statistical analyses of Tables 6, 7 and 8.
Table 7 summarizes the individual treatment and outcome. Intra-arterial infusion, at a dose of 6.0 to 25 mg and a duration of 4.0 to 23 hrs, induced complete recanalization in 24 patients and partial recanalization in 3. Complementary endovascular procedures (mainly PTA) were performed in 17 patients and complementary reconstructive vascular surgery following thrombolysis in 3. No patient underwent major amputation. Early recurrence of thrombosis after the end of the angiographic procedure occurred in 4 patients. Bleeding complications were absent or limited to mild to moderate hematoma formation at the angiographic puncture sites except for 5 patients who required transfusion (Table 7). Intracranial or visceral hemorrhage was not observed.
Circulating fibrinogen, plasminogen and .alpha..sub.2 -antiplasmin levels remained essentially unchanged during infusion of the SakSTAR moieties (Table 8), reflecting absolute fibrin specificity of these agents at the dosages used. Significant in vivo fibrin digestion occurred as evidenced by elevation of fibrin fragment D-dimer levels. Intra-arterial heparin therapy prolonged aPTT levels to a variable extent (Table 8).
Antibody-related SakSTAR-, SakSTAR(K.sub.74)- and SakSTAR(K.sub.74 ER)-neutralizing activity and anti-SakSTAR, anti-SakSTAR(K.sub.74) and anti-SakSTAR(K.sub.74 ER) IgG, were low at baseline and during the first week after the infusion (FIG. 3). From the second week on, neutralizing activity levels increased to reach median values at 3 to 4 weeks of 20 .mu.g SakSTAR(K.sub.74) and 2.4 .mu.g SakSTAR(K.sub.74 ER) neutralized per ml plasma in the patients treated with SakSTAR(K.sub.74) and SakSTAR(K.sub.74 ER), respectively, which is significantly lower than the median value of 93 .mu.g wild-type SakSTAR neutralized per ml in the patients treated with SakSTAR (p=0.024 for differences between the three groups by Kruskal-Wallis analysis and p=0.01 and p=0.036, respectively, for variants vs wild-type by Mann-Whitney rank sum test). The levels of anti-SakSTAR(K.sub.74) and of anti-SakSTAR(K.sub.74 ER) IgG increased to median values at 3 to 4 weeks of 270 and 82 .mu.g/ml plasma in patients treated with SakSTAR(K.sub.74) and SakSTAR(K.sub.74 ER) respectively, which is significantly lower than the median value of 1800 .mu.g anti-SakSTAR per ml plasma in the patients treated with SakSTAR ((p=0.024 for differences between the three groups by Kruskal-Wallis analysis and p=0.007 and 0.05, respectively, for variants versus wild-type by Mann-Whitney rank sum test).
The titers of anti-SakSTAR(K.sub.74) and of anti-SakSTAR(K.sub.74 ER) IgM increased from median baseline values of 1/460 and 1/410 to median values at 1 week of 1/510 and 1/450 in patients treated with SakSTAR(K.sub.74) and SakSTAR(K.sub.74 ER), respectively, which was not significantly different from the median values of 1/320 at baseline and 1/640 at week 1 in patients treated with SakSTAR. Corresponding values at 2 weeks were 1/590 and 1/550 in patients given SakSTAR(K.sub.74) and SakSTAR(K.sub.74 ER), not significantly different from 1/930 with SakSTAR (data not shown).
The antibodies induced by treatment with SakSTAR were completely absorbed by SakSTAR but incompletely by SakSTAR(K.sub.74) and by SakSTAR(K.sub.74 ER) confirming the immunogenicity of the K74,E75,R77 epitope and the dominant role of K74 in the binding of antibodies directed against this epitope. The antibodies induced by treatment with SakSTAR(K.sub.74) or SakSTAR(K.sub.74 ER) were completely absorbed by SakSTAR, by SakSTAR(K.sub.74) and by SakSTAR(K.sub.74 ER), indicating that immunization was not due to neoepitopes generated by substitution of Lys74 with Ala, but to epitopes different from the K74,E75,R77 epitope.
In summary, the present experience illustrates that staphylokinase variants with reduced antibody induction but intact thrombolytic potency can be generated. To our knowledge, the present invention constitutes the first case in which a heterologous protein, with the use of protein engineering techniques, was rendered less immunogenic without reducing its biological activity.
REFERENCES
1. Lack CH: Staphylokinase: an activator of plasma protease. Nature 161: 559, 1948.
2. Lewis JH, Ferguson JH: A proteolytic enzyme system of the blood. III. Activation of dog serum profibrinolysin by staphylokinase. Am J Physiol 166: 594, 1951.
3. U.S. Pat No. 5,336,495 (issued Sep. 8, 1994).
4. Vanderschueren S, Barrios L, Kerdsinchai P, Van den Heuvel P, Hermans L, Vrolix M, De Man F, Benit E, Muyldermans L, Collen D, Van de Werf F: A randomized trial of recombinant staphylokinase versus alteplase for coronary artery patency in acute myocardial infarction. Circulation 92: 2044-2049, 1995.
5. Sako T, Sawaki S, Sakurai T, Ito S, Yoshizawa Y, Kondo I: Cloning and expression of the staphylokinase gene of Staphylococcus aureus in Escherichia coli. Molec Gen Genet 190: 271-277, 1983.
6. Behnke D, Gerlach D: Cloning and expression in Escherichia coli, Bacillus subtilis, and Streptococcus sanguis of a gene for staphylokinase--a bacterial plasminogen activator.
Molec Gen Genet 210: 528-534, 1987.
7. Collen D, Silence K, Demarsin E, De Mol M, Lijnen HR: Isolation and characterization of natural and recombinant staphylokinase. Fibrinolysis 6: 203-213, 1992.
8. Sako T, Tsuchida N: Nucleotide sequence of the staphylokinase gene from Staphylococcus aureus. Nucleic Acids Res 11: 7679-7693, 1983.
9. Collen D, Zhao ZA, Holvoet P, Marynen P: Primary structure and gene structure of staphylokinase. Fibrinolysis 6: 226-231, 1992.
10. Sakai M, Watanuki M, Matsuo O: Mechanism of fibrin-specific fibrinolysis by staphylokinase: participation of .alpha..sub.2 -plasmin inhibitor. Biochem Biophys Res Comm 162: 830-837, 1989.
11. Matsuo O, Okada K, Fukao H, Tomioka Y, Ueshima S, Watanuki M, Sakai M: Thrombolytic properties of staphylokinase. Blood 76: 925-929, 1990.
12. Lijnen HR, Van Hoef B, De Cock F, Okada K, Ueshima S, Matsuo O, Collen D: On the mechanism of fibrin-specific plasminogen activation by staphylokinase. J Biol Chem 266: 11826-11832, 1991.
13. Lijnen HR, Van Hoef B, Matsuo O, Collen D: On the molecular interactions between plasminogen-staphylokinase, .alpha..sub.2 -antiplasmin and fibrin. Biochim Biophys Acta 1118: 144-148, 1992.
14. Silence K, Collen D, Lijnen HR: Interaction between staphylokinase, plasmin(ogen) and .alpha..sub.2 -antiplasmin. Recycling of staphylokinase after neutralization of the plasmin-staphylokinase complex by .alpha..sub.2 -antiplasmin. J Biol Chem 268: 9811-9816, 1993.
15. Silence K, Collen D, Lijnen HR: Regulation by .alpha..sub.2 -antiplasmin and fibrin of the activation of plasminogen with recombinant staphylokinase in plasma. Blood 82: 1175-1183, 1993.
16. Sakharov DV, Lijnen HR, Rijken DC. Interactions between staphylokinase, plasmin(ogen), and fibrin. J Biol Chem 271: 27912-27918, 1996.
17. Schlott B, Guhrs KH, Hartmann M, Rocker A, Collen D. Staphylokinase requires NH.sub.2 -terminal proteolysis for plasminogen activation. J Biol Chem (in press).
18. Collen D, De Cock F, Vanlinthout I, Declerck PJ, Lijnen HR, Stassen JM. Comparative thrombolytic and immunogenic properties of staphylokinase and streptokinase. Fibrinolysis 6: 232-242, 1992.
19. Collen D, De Cock F, Stassen JM. Comparative immunogenicity and thrombolytic properties toward arterial and venous thrombi of streptokinase and recombinant staphylokinase in baboons. Circulation 87: 996-1006, 1993.
20. White H: Thrombolytic treatment for recurrent myocardial infarction. Br Med J 302: 429-430, 1991.
21. Gase A, Hartmann M, Guhrs KH, Rocker A, Collen D, Behnke D, Schlott B: Functional significance of NH.sub.2 - and COOH-terminal regions of staphylokinase in plasminogen activation. Thromb Haemost 76: 755-760, 1996.
22. EP 95200023.0 (Jan. 6, 1995) and U.S. Ser. No. 08/499,092 (Jul. 6, 1995).
23. Schlott B, Hartmann M, Guhrs KH, Birch-Hirschfeid E, Pohl HD, Vanderschueren S, Van de Werf F, Michoel A, Collen D, Behnke D: High yield production and purification of recombinant staphylokinase for thrombolytic therapy. Bio/technology 12: 185-189, 1994.
24. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61-68, 1989.
25. BIAcore system manual, 5-2, Pharmacia Biosensor AB, Uppsala, Sweden.
26. Karlsson R, Michaelsson A, Mattsson L: Kinetic analysis of monoclonal antibody-antigen interactions with a new biosensor based analytical system. J Immunol Methods 145: 229-240, 1991.
27. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: a laboratory mannual. 2nd Ed. Cold Spring Harbor, N.Y. Cold Spring Harbor Laboratory Press, 1989.
28. Tartof KD, Hobbs CA: Improved media for growing plasmid and cosmid clones. Bethesda Res Lab Focus 9: 12, 1987
29. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248, 1976.
30. Deutsch DG, Mertz ET: Plasminogen: purification from human plasma by affinity chromatography. Science 170: 1095-1096, 1970.
31. Vanderschueren S, Stockx L, Wilms G, Lacroix H, Verhaeghe R, Vermylen J, Collen D:
Thrombolytic therapy of peripheral arterial occlusion with recombinant staphylokinase. Circulation 92: 2050-2057, 1995.
TABLE 1__________________________________________________________________________Apparent equilibrium association constants (K.sub.A .times. 10.sup.7M.sup.-1) for the binding of wild-type SakSTAR and of SakSTARvariants obtained by "alanine-to-wild-type" reversal of"charged-cluster-to-alanine" mutants to be insolubilizedmurine monoclonal antibodies (MAbs).__________________________________________________________________________ Spec. Act. murine MAbs (.times. 10.sup.3 Epitope I Epitope IICompound Substituted amino acid HU/mg) 17G11 26A2 30A2 2B12 3G10 18F12 14H5 28H4 32B2 7F10__________________________________________________________________________SakSTAR 130 22 13 2.9 7.8 11 38 7.4 19 7.7 2.4SakSTAR(KE.sub.38) K35A, E38A 97 15 22 4.2 11 7.9 110 10 15 12 2.2SakSTAR(K.sub.74 ER) K74A, E75A, R77A 110 11 <.01 <0.1 <0.1 <0.1 150 17 28 14 3.3SakSTAR(KEKER) K35A, E38A, K74A, E75A, R77A 50 11 <0.1 <0.1 <0.1 <0.1 110 36 26 15 2.0SakSTAR(EKER) E38A, K74A, E75A, R77A 43 11 <0.1 <0.2 <0.1 <0.1 140 39 26 15 2.1SakSTAR(KKER) K35A, K74A, E75A, R77A 56 9.2 <0.1 0.15 <0.1 <0.1 52 14 29 8.8 2.3SakSTAR(KEER) K35A, E38A, E75A, R77A 44 11 0.3 0.1 0.2 <0.1 75 9.8 12 7.3 1.6SakSTAR(KEKR) K35A, E38A, K74A, R77A 41 8.8 2.9 <0.1 2.0 0.33 110 29 31 10 2.0SakSTAR(KEKE.sub.75) K3SA, E38A, K74A, E75A 19 13 <0.1 0.1 <0.1 <0.1 180 41 37 15 1.6SakSTAR(EER) E38A, E75A, R77A 88 11 0.6 0.15 0.4 0.3 79 12 15 10 2.0SakSTAR(EE.sub.75) E38A, E75A 66 16 0.3 <0.1 <0.1 0.9 56 11 13 8.9 2.0SakSTAR(K.sub.35 E.sub.75 R) K3SA, E75A, R77A 68 9.2 <0.1 <0.1 <0.1 <0.1 60 7.0 13 11 3.3SakSTAR(K.sub.35 E.sub.75) K3SA, E75A 150 17 0.12 <0.1 0.16 0.14 40 7.2 13 9.2 4.2SakSTAR(K.sub.74) K74A 100 12 7.6 0.17 4.4 2.1 55 15 33 14 3.6SakSTAR(E.sub.75) E75A 140 13 1.2 <0.1 <0.1 <0.1 46 8.5 14 12 3.4SakSTAR(K.sub.74 ERED) K74A, E75A, R77A, E80A, D82A 50 14 <0.1 <0.1 <0.1 <0.1 180 19 33 19 3.7SakSTAR(E.sub.80 D) E80A, D82A 130 7.3 12 2.1 6.5 5.9 79 6.1 8.4 7.8 1.9SakSTAR(E.sub.80) E80A 160 13 13 3.3 7.9 10 35 7.4 17 8.6 2.1SakSTAR(D) D82A 160 17 12 4.8 7.3 11 31 7.8 17 12 2.7SakSTAR(E.sub.75 D) E75A, D82A 170 20 15 3.1 6.6 7.2 69 8.1 15 14 4.9__________________________________________________________________________ Spec. Act. murine MAbs (.times. 10.sup.3 Epitope III Compound Substituted amino acids HU/mg) 7H11 25E1 40C8 24C4 1A10__________________________________________________________________________ SakSTAR 130 4.0 14 5.4 2.9 0.6 SakSTAR(KE.sub.38) K35A, E38A 97 <0.1 <0.1 <0.1 1.0 1.0 SakSTAR(K.sub.74 ER) K74A, E75A, R77A 110 2.4 11 4.0 2.1 0.9 SakSTAR(KEKER) K35A, E38A, K74A, E75A, R77A 50 <0.1 <0.1 <0.1 1.5 1.2 SakSTAR(EKER) E38A, K74A, E75A, R77A 43 <0.1 3.2 3.7 1.6 1.1 SakSTAR(KKER) K35A, K74A, E75A, R77A 56 <0.1 1.8 <0.1 1.8 0.8 SakSTAR(KEER) K35A, E38A, E75A, R77A 44 <0.1 <0.1 <0.1 0.53 0.64 SakSTAR(KEKR) K35A, E38A, K74A, R77A 41 <0.1 <0.1 <0.1 0.63 0.74 SakSTAR(KEKE.sub.75) K3SA, E38A, K74A, E75A 19 <0.1 <0.1 <0.1 1.2 0.45 SakSTAR(EER) E38A, E75A, R77A 88 <0.1 2.6 4.7 1.1 0.81 SakSTAR(EE.sub.75) E38A, E75A 66 <0.1 20 4.8 1.3 1.6 SakSTAR(K.sub.35 E.sub.75 R) K3SA, E75A, R77A 68 <0.1 1.5 <0.1 0.8 1.1 SakSTAR(K.sub.35 E.sub.75) K3SA, E75A 150 <0.1 1.8 <0.1 1.4 1.5 SakSTAR(K.sub.74) K74A 100 2.9 14 4.9 3.4 1.2 SakSTAR(E.sub.75) E75A 140 4.5 18 5.0 1.2 2.1 SakSTAR(K.sub.74 ERED) K74A, E75A, R77A, E80A, D82A 50 <0.1 <0.1 <0.1 <0.1 1.2 SakSTAR(E.sub.80 D) E80A, D82A 130 <0.1 <0.1 <0.1 <0.1 0.44 SakSTAR(E.sub.80) E80A 160 <0.1 16 3.6 <0.1 1.7 SakSTAR(D) D82A 160 <0.1 0.18 <0.1 <0.1 2.3 SakSTAR(E.sub.75 D) E75A, D82A 170 0.17 0.7 0.5 0.1 1.4__________________________________________________________________________ Apparent association constants .gtoreq. 10fold lower than those of wildtype SakSTAR are represented in bold type; .gtoreq.65.000 HU/mg represented in bold type. M3, M8, M9, M3.8, M8.9 denotes SakSTAR variants previously stsudied (22), but in reverse order (binding of soluble Mab to insolubilized variant.
TABLE 2__________________________________________________________________________Absorption with wild-type SakSTAR variants obtained by "alanine-to-wild-type" reversal of"charged-cluster-to-alanine" mutants, elicited with wild-type SakSTAR inpatients with acute myocardialinfarction. Spec. Act. Human plasmaCompound Substituted amino acids (.times. 10.sup.3 HU/mg) Pool Subpool B Subpool C__________________________________________________________________________SakSTAR 130 95 95 95SakSTAR(KE.sub.38) K35A, E38A 97 93 91 94SakSTAR(K.sub.74 ER) K74A, E75A, R77A 110 55 43 95SakSTAR(KEKER) K35A, E38A, K74A, E75A, R77A 50 52 41 92SakSTAR(EKER) E38A, K74A, E75A, R77A 43 50 44 95SakSTAR(KKER) K35A, K74A, E75A, R77A 56 46 43 95SakSTAR(KEER) K35A, E38A, E75A, R77A 44 92 87 94SakSTAR(KEKR) K35A, E38A, K74A, R77A 41 56 50 93SakSTAR(KEKE.sub.75) K35A, E38A, K74A, E75A 19 48 41 92SakSTAR(EER) E38A, E75A, R77A 88 95 88 95SakSTAR(EE.sub.75) E38A, E7SA 66 91 90 95SakSTAR(K.sub.35 E.sub.75 R) K35A, E75A, R77A 68 88 89 95SakSTAR(K.sub.35 E.sub.75) K35A, E75A 150 94 93 95SakSTAR(K.sub.74) K74A 100 59 45 95SakSTAR(E.sub.75) E75A 140 95 93 95SakSTAR(K.sub.74 ERED) K74A, E75A, R77A, E80A, D82A 50 49 29 89SakSTAR(E.sub.80 D) E80A, D82A 130 89 83 92SakSTAR(E.sub.80) E80A 160 94 93 95SakSTAR(D) D82A 160 95 93 95SakSTAR(E.sub.75 D) E75A, D82A 170 95 95 95__________________________________________________________________________ .ltoreq.80% absorption represented in bold type; >65.000 HU/mg represente in bold type. The data represent percent ot antibodies absorbed by compound, determined from the residual binding to insolubilized SakSTAR.
TABLE 3 - Apparent equilibrium association constants (K.sub.A .times. 10.sup.7 M.sup.-) for the binding of wild-type SakSTAR and of site- specific SakSTAR variants to insolubilized murine monoclonal antibodies (Mabs) Spec. Act. Epitope I Epitope II Epitope III Compound Substituted amino acids (.times. 10.sup.3 HU/mg) 17G11 26A2 30A2 sB12 3G10 18F12 14H5 28H4 32B2 7F10 7H11 25E1 40C8 24C4 1A10 SakSTAR 130 22 13 2.9 7.8 11 38 7.4 19 7.7 2.4 4.0 14 5.4 2.9 0.6 SakSTAR.M27 Y17A, FI8A 30 13 22 3.3 10 9.5 21 4.6 6.7 12 2.5 1.2 18 6.5 3.4 <0.1 SakSTAR.M2223 F47A <5 <0.1 4 1 3.9 3.4 5.7 2.7 2.8 8.5 1.7 0.9 8.8 3 3 0.93 SakSTAR.M5051 F76A 90 20 9.6 1 2.7 3.9 13 6.2 20 15 1.7 0.32 5.9 2.1 1.2 1 SakSTAR.M46 F104A 55 5.8 19 4.8 14 27 7.3 5 14 4.8 <0.1 0.4 7.6 3.4 1.1 1.3 SakSTAR.M48 F111A 49 3.7 16 3.8 13 22 21 8.4 12 3.1 0.8 SakSTAR.M2426 F125A <10 2.8 18 4.7 11 18 17 3.2 6 1.9 <0.1 0.3 5.3 2.1 0.9 1.6 SakSTAR.M44 Y9A 78 22 49 6.6 2.3 16 44 8.4 20 14 2.6 2.4 16 9.6 1.1 0.46 SakSTAR.M3839 Y24A 40 17 33 4.3 13 11 33 4.3 7 12 4 0.36 14 6.8 4.8 <0.1 SakSTAR.M2021 H43A, Y44A <5 10 22 3.7 17 15 <0.1 <0.1 <0.1 1.4 3 2.3 11 5.2 2.1 0.13 SakSTAR.M99100 Y62V 2 3 2.2 1.8 3.5 3 21 5.7 6.6 18 3.5 1.9 8.1 4.5 5.8 0.89 SakSTAR.M8384 Y63A <5 <0.1 18 3.7 9.6 13 17 5.3 3.3 15 1.1 2.2 5.3 4.3 1 3.7 SakSTAR.M2528 Y62A, Y63A <5 <0.1 4.3 0.3 2.1 1.9 11 2.2 3.1 8.4 1.7 0.6 9.2 3.6 3.8 0.7 SakSTAR.M3031 Y73A <5 9.5 <0.1 <0.1 <0.1 4.8 33 7.3 11 8.9 2 0.5 9 2.5 1.4 0.75 SakSTAR.M145146a Y73F 31 7.9 12 1.3 2.1 8 24 15 19 15 2.6 1.6 6.2 3.5 7.2 1.4 SakSTAR.M145146b Y73L 1.8 11 <0.1 <0.1 <0.1 <0.1 84 19 26 53 3.4 4.2 7.1 4.2 3.4 0.95 SakSTAR.M169170 Y73H <2 7.3 1.5 <0.1 <0.1 1.4 20 7.5 17 42 4.3 3.5 6.8 5.9 9.7 1.3 SakSTAR.M171172 Y73W 27 4.8 9 4.6 4.6 11 8.4 4.5 11.2 8 2.7 2.9 5 3 3.8 1.3 SakSTAR.M145145c Y73S <5 7 3.6 0.59 0.6 3 21 8.3 14 21 3.2 2.2 6.7 1.3 1.3 0.67 SakSTAR.M165166 Y73F, F76Y 10 8.4 17 4.5 2.6 10 33 18 34 21 4.5 5.2 8.7 8.1 1.3 1.9 SakSTAR.M7980 Y73A, K74A <5 18 <0.1 <0.1 <0.1 <0.1 19 6.7 23 9.9 3.2 2.7 13 4 1.6 1.1 SakSTAR.M8990 Y73F, K74A 5.6 17 6.7 <0.1 2.1 <0.1 42 19 21 20 4.9 1.9 2.8 6.6 2.1 0.84 SakSTAR.M53 Y91A 53 6 16 3 7 13 28 8.2 16 0.6 2.1 1.4 3.7 1.6 1.6 0.2 SskSTAR.M54 Y92A 118 16 23 4.1 13 12 29 7.3 18 <0.1 1.7 4.4 10 3.9 5.9 1.1 SakSTAR.M5960 H43A 69 15 28 9.7 18 7.6 <0.1 <0.1 <0.1 9.1 1.5 2 23 7.8 7.2 1.6 SakSTAR.M6162 H43R 120 15 11 2.7 7.6 11 <0.1 <0.1 <0.1 13 6.4 0.7 18 6.7 57 1.4 SakSTAR.M6364 I49A 43 2.7 27 7.8 23 22 35 4.4 11 6.2 1.1 2 5.7 2 1.7 0.6 SakSTAR.M6566 I60A 96 12 20 2.9 11 13 27 6.4 25 2.7 1.5 0.7 5.8 2.9 1.7 1 SakSTAR.M55 I87A 98 6.7 23 2.8 8.6 9.1 10 3.6 11 7.4 2.7 1.1 7.8 3.4 4.5 1 SakSTAR.M67 I106A 93 2.3 13 3 7.4 6.7 5.5 5.2 17 11 1.4 1.8 3.1 1.8 1.2 0.5 SakSTAR.M56 I120A 75 23 26 5.1 17 16 30 9.8 25 9 6.9 3 15 5.1 5.2 1 SakSTAR.M57 I128A 20 16 25 48 15 14 38 2.6 4.3 8.2 2.9 2.5 2 4.2 6.7 0.9 SakSTAR.M58 1133A 99 9.4 15 1.9 7.8 7.8 24 6 9.1 8.6 1.4 0.56 6.4 1.6 1.6 0.9 SakSTAR.M130131 V29A, N28A 45 18 30 2.5 20 18 20 14 20 24 2.7 3.3 20 1.1 5 2 SakSTAR.M9596 V32A 45 10 9.6 2.4 6.2 7.8 56 17 12 14 1.4 <0.1 <0.1 <0.1 <0.1 2.2 SakSTAR.M7576 V45A <5 16 5.6 1.4 4.8 6.3 2.2 0.23 1.7 32 2.6 2.1 8.3 1.1 2.8 1.6 SakSTAR.M9798 V64A 48 14 16 2.9 6.3 7.8 15 15 21 21 2.6 1.6 7.6 5.6 2.8 0.7 SakSTAR.M120121 V78A, V79A 68 12 23 4 10 17 21 18 34 28 2.3 1.6 4.7 <0.1 0.5 1.7 SakSTAR.M140141 V112A, V113A 123 4.2 16 3.9 10 12 34 5.8 13 8 0.3 1.5 4.3 2.3 3 0.8 SakSTAR.M7374 L39A, L40A <5 14 15 3.1 5.1 8 27 16 6.3 12 2.7 1.2 5.4 3.2 2.1 0.9 SakSTAR.M9192 L68A 93 14 22 3.5 8.5 9.3 29 8.7 16 15 4 2.1 5.3 3.6 4.1 <0.1 SakSTAR.M124125 L81A 28 12 33 1.6 40 11 52 11 17 17 3.9 1.4 5.2 7.1 46 1.5 SakSTAR.M128129 L116A, 5117A 4.8 4.4 35 3.6 33 42 156 29 218 <0.1 <0.1 0.48 4.1 4.9 35 1.6 SakSTAR.M127 L127A 54 8.9 6.7 1.8 5 6.6 25 4.9 14 8.4 1.5 0.9 1.9 0.9 2.5 1.8 SakSTAR.M7172 S41A, P42A 48 10 25 4.1 13 12 1i 3 1.9 27 2.7 3.2 15 4.8 36 1.1 SakSTAR.M8182 S34A 106 17 24 46 9.5 11 28 11 22 15 2.9 3.1 8.8 3.8 2 0.17 SakSTAR.M9394 S84A 08 15 19 4.9 12 17 47 12 22 35 2 0.3 1.9 1.4 5.5 1.5 SakSTAR.M7778 N37A 110 5.6 31 3 10 11 20 4.1 14 10 2.9 1.4 5.3 3.5 3.6 0.8 SakSTAR.M133134 N95A 263/445 10 18 4 10 11 50 13 14 4.9 2.3 3.7 7.3 4.7 2.9 0.8 SakSTAR.M137 N126V 51 7.6 13 2 12 13 30 58 290 9.8 2.5 1.8 8 4.2 6.5 0.7 SakSTAR.M159160 M26L 38 5.3 14 2.2 6.6 6.5 48 3.7 2.4 3.7 2.4 2 4.1 2.2 2 0.3 SakSTAR.M161162 M26V <2 6.3 14 3.8 9.1 12 26 2 1.5 4.3 1.1 1.8 4.9 2.2 2.5 0.46 SakSTAR.M105106 G36K 88 9.9 23 3.1 8.3 9.8 21 3.9 13 15 3 <0.1 <0.1 <0.1 2.6 1.2 SakSTAR.M103104 G36R 102 11 24 3.3 10 10 27 4.6 14 20 3A <0.1 <0.1 <0.1 3.1 1.2 SakSTAR.M103104+ G36R, K74A 65 19 7 0.22 4.3 2 53 27 28 19 4.4 <0.1 <0.1 <0.1 1.2 1 SakSTAR.M3637 E19A, P20A 9 11 19 3.3 9.2 12 15 6.1 11 16 1 1.1 15 5.1 3.3 <0.1 SakSTAR.M8788 P23A 67 14 31 4.4 14 22 41 5.3 37 13 10 4 11 7.6 3.1 1.9 SakSTAR.M8586 W66A <5 <0.1 <0.1 <0.1 <0.1 <0.1 15 4.4 5.7 23 3.3 2 10 1.4 1.8 0.83 SakSTAR.M167168a A725 190 4 3.8 2.4 1.3 1.8 30 5.6 7.4 1.7 1.7 1.7 5 2.2 5.5 0.4 SakSTAR.M153154 D13A 46 2.4 6.1 2 3.7 3.4 11 1.9 4.5 4.4 8.7 1.5 2.4 1.1 3.6 <0.1 SakSTAR.M155156 D14A 30 5.1 13 4 6.6 3.1 38 7.7 12 15 2.2 2.7 6 3.2 5.6 <0.1 SakSTAR.M111112 D69E <5 14 5.7 1.2 2.6 2.2 23 4.3 15 18 4 1.5 11 6 4.1 1.1 SakSTAR.M113114 D69N 6/(43) 15 29 6.9 10 17 25 17 34 24 9.8 3.2 15 8.6 3.6 1 SakSTAR.M149150 E99A 42 7.4 15 4 8.4 8.9 22 2.7 4.7 <0.1 <0.1 2.1 6.2 7.3 14 0.77 SakSTAR.M109110a K50A 42 <0.1 13 2.9 7.8 8.7 46 8.3 12 2.2 0.5 2.8 6.4 4 2.3 0.57 SakSTAR.M151152a K102A 89 4.9 12 3.7 6.5 6.3 30 3.1 15 8.2 6.1 0.84 4.2 1.9 10 0.62 Apparent association constants .gtoreq. 10fold lower than those of wildtype SakSTAR are represented in bold type; .gtoreq.65.000 HU/mg represented in bold type.
TABLE 4__________________________________________________________________________Absorptino with wild-type SakSTAR and with site-specific SakSTAR variantsof antibodieselicited with wild-type SakSTAR in patients with acute myocardialinfarction Spec. Act. Human plasmaCompound Substituted amino acids (.times. 10.sup.3 HU/mg) Pool Subpool B Subpool C__________________________________________________________________________SakSTAR 130 95 95 95SakSTAR.M27 Y17A, F18A 30 95 95 95SakSTAR.M2223 F47A <5 90 82 97SakSTAR.M5051 FY6A 90 94 92 95SakSTAR.M46 F104A 55 95 93 95SakSTAR.M48 F111A 49 95 95 95SakSTAR.M2426 F125A <10 93 90 95SakSTAR.M44 Y9A 78 96 95 95SakSTAR.M3839 Y24A 40 95 95 95SakSTAR.M2021 H43A, Y44A <5 95 95 95SakSTAR.M99100 Y62V 2 92 86 95SakSTAR.M8384 Y63A <5 89 82 95SakSTAR.M2528 Y62A, Y63A <5 89 83 95SakSTAR.M3031 Y73A <5 63 44 93SakSTAR.M145146a Y73F 31 93 95 95SakSTAR.M145146b Y73L 1.8 81 60 94SakSTAR.M169170 Y73H <2 76 65 95SakSTAR.M171172 Y73W 27 73 53 93SakSTAR.M145145c Y735 <5 66 69 95SakSTAR.M165166 Y73F, F76Y 10 94 85 95SakSTAR.M7980 Y73A, K74A <5 47 28 87SakSTAR.M8990 Y73F, K74A 5.6 51 34 90SakSTAR.M53 Y91A 5.3 95 95 95SakSTAR.M54 Y92A 118 94 95 95SakSTAR.M5960 H43A 69 95 95 95SakSTAR.M6162 H43R 120 95 95 95SakSTAR.M6364 I49A 43 95 95 95SakSTAR.M6566 I60A 96 95 95 95SakSTAR.M55 I87A 98 95 95 95SakSTAR.M67 I106A 93 95 95 95SakSTAR.M56 I120A 75 93 95 95SakSTAR.M57 I128A 20 95 93 95SakSTAR.M58 I133A 99 95 95 95SakSTAR.M130131 V29A, N28A 45 93 95 95SakSTAR.M9596 V32A 45 90 93 95SakSTAR.M7576 V45A <5 91 92 95SakSTAR.M9798 V64A 48 94 92 95SakSTAR.M120121 V78A, V79A 68 93 93 95SakSTAR.M140141 V112A, V113A 123 95 95 95SakSTAR.M7374 L39A, L40A <5 93 93 95SakSTAR.M9192 L68A 93 92 92 95SakSTAR.M124125 L81A 28 88 95 95SakSTAR.M128129 L116A, S117A 4.8 94 95 95SakSTAR.M127 L127A 54 93 94 95SakSTAR.M7172 S41A, P42A 48 95 95 95SakSTAR.M8182 S34A 106 95 95 93SakSTAR.M9394 S84A 88 95 94 95SakSTAR.M7778 N37A 110 95 95 95SakSTAR.M133134 N95A 263/445 95 95 95SakSTAR.M137 N126V 51 95 95 95SakSTAR.M159160 M26L 38 95 95 95SakSTAR.M161162 M26V <2 95 94 95SakSTAR.M105016 G36K 88 88 80 69SakSTAR.M103014 G36R 102 89 81 70SakSTAR.M103104+ G36R, K74A 65 48 33 58SakSTAR.M3637 E19A, P20A 9 93 93 95SakSTAR.M8788 P23A 67 91 95 95SakSTAR.M8586 W66A <5 85 78 92SakSTAR.M167168a A72S 190 95 93 95SakSTAR.M153154 D13A 46 95 94 95SakSTAR.M155156 D14A 30 95 94 95SakSTAR.M111112 D69E <5 86 78 95SakSTAR.M113114 D69N 6/(43) 84 81 89SakSTAR.M149150 E99A 42 92 91 92SakSTAR.M109110a K50A 42 95 94 95SakSTAR.M151152a K102A 89 95 93 95__________________________________________________________________________ .ltoreq.80% absorption represented in bold type; >65.000 HU/mg represente in bold type. The data represent percent of antibodies absorbed by compound, determined from the residual binding to insolubilized SakSTAR.
TABLE 5__________________________________________________________________________Selected variants with .gtoreq.50% residual activity, .gtoreq.10 foldreduced binding of murine MAb, and .ltoreq.80%absorption of human antibodies eleicited by treatment with wild-typeSakSTAR.__________________________________________________________________________ murine MAbsSubstituted Spec. Act. (.times. Epitope I Epitope II Epitope IIIamino acids 10.sup.3 HU/mg) 17G11 26A2 30A2 2B12 3G10 18F12 14H5 28H4 32B2 7F10 7H11 25E1 40C8 24C4 1A10__________________________________________________________________________K74A, E75A, R77A 110 11 <.01 <0.1 <0.1 <0.1 150 17 28 14 3.3 2.4 11 4.0 2.1 0.9K74A 100 12 7.6 0.17 4.4 2.1 55 15 33 14 3.6 2.9 14 4.9 3.4 1.2G36K 88 9.9 23 3.1 8.3 9.8 21 3.9 13 15 3 <0.1 <0.1 <0.1 2.6 1.2G36R 102 11 24 3.3 10 10 27 4.6 14 20 3.4 <0.1 <0.1 <0.1 3.1 1.2G36R, K74A 65 19 7 0.22 4.3 2 53 27 28 19 4.4 <0.1 <0.1 <0.1 1.2 1__________________________________________________________________________ Substituted Spec. Act. Human plasma amino acids (.times. 10.sup.3 Poolg) Subpool Subpool__________________________________________________________________________ C K74A, E75A, R77A 110 55 43 95 K74A 100 59 45 95 G36K 88 88 80 69 G36R 102 89 81 70 G36R, K74A 48 33 58__________________________________________________________________________
TABLE 6__________________________________________________________________________Characteristics of the patients with peripheral arterial occlusiontreated withSakSTAR, SakSTAR(K.sub.74) or SakSTAR(K.sub.74 ER) Age of Length ofCompound Clinical Risk factors Current Locus of occluison occlusionPatient Id. Gender Age (yrs) presentation Relevant history Smoking occlusion (days) (cm)__________________________________________________________________________SakSTARMEE F 67 Ischemic rest Hypertension, + Left SFA 30 8 pain hyperlipidemiaFDR M 68 Claudication CAD, COPD, iliac stenting + Left IA 14 18 (stent)DAN M 73 Claudication CAD - Right SFA 30 6BER F 63 lschemic rest Hypertension, - Left FT 18 55 pain hyperlipidemia, AF and left graft FT graftDAM F 43 Acute ischemia Hypertension, claudication + Left 2 7 left arm brachial and radial arteryTCR M 68 Claudication Hyperlipidemia, CABG, - Right SFA 50 12 abdominal aortic (popliteal aneurysm repair aneurysm)CLA M 74 Acute ischemia Hyperlipidemia, CAD, + Left PA 1.5 20 acute right SFA occlusionMAN M 65 Acute ischemia Diabetes, hypertension, + Left EIA 4 20 left EIA stent (stent)MAT M 64 Subacute Hypertension, CAD, - Right FP 3 45 ischemia aortobifemoral, left FP graft and right FT graftMean .+-. SEM 65 .+-. 3.0 17 .+-. 5.6 21 .+-. 5.8SaKSTAR(K.sub.74)LI M 70 Subacute Diabetes mellitus, CABG, - Right FF 10 48 ischemia right FF graft, left FP graft graftENG M 50 Claudication Hypertension + Right SFA 28 10CDX F 48 Claudication Hypertension, - Right PA 25 7 right PA graft graftMAN F 68 Claudication Hypertension, - Right SFA .gtoreq.120 9 hyperilipidemia, CADVHE M 47 Acute ischemia Right IF graft + Right IF 10 54 graftMUL F 51 Acute ischemia Hypertension, right IF and + Right IF 1 63 FP graft and FP graftBUR F 67 Ischemic rest Diabetes mellitus, - Right TF 9.0 38 pain hypertension truncNIJ F 60 Ischemic rest Hyperlipidemia, AF graft, + Left AF 23 78 pain carotid artery surgery graftPOE* M 49 Subacute Aortic coarctation repair, - Right TF 2 30 ischemia bilateral FP bypass truncVBE M 39 Subacute Aneurysm right SC artery - Right 20 28 ischemia (thoracic outlet syndrome) brachial artery (embolism)SME F 50 Subacute Diabetes, hypertension, - TF trunc 18 32 ischemia bilateral FT graftWOL M 67 Subacute Diabetes, CAD, + Right PA 4 25 ischemia aortabilliac graftMean .+-. SEM 56 .+-. 3.0 23 .+-. 9.2 35 .+-. 6.4SakSTAR(K.sub.74 ER)JAC F 65 Acute ischemia Hypertension, - Right 0.3 5 hyperlipidemia brachial and ulnar arteryMAE M 74 Ischemic rest COPD, reimplantation + Left SFA 10 50 pain superior mesenteric arteryCRA F 52 Claudication Mitral valve disease, - Right IA 14 28 ventricular and atrial and FA fibrillation arteryVDB M 68 Claudication Hypertension, AF graft, + Left SFA 90 12 carotid artery surgeryDUN M 71 Subacute DM, CAD + Left SFA 14 6 ischemiaDEL M 59 Acute ischemia AF and right FT graft + Right FT 3 42 graftMean .+-. SEM 65 .+-. 3.3 22 .+-. 14 24__________________________________________________________________________ .+-. 7.8 AF aortofemoral; CABG: coronary artery bypass grafting; CAD, coronary artery disease; CIA: common iliac artery; COPD: chronic obstructive pulmonary disease; DM: diabetes mellitus; FF: femorofibular; FP: femoropopliteal; FT: femorotibial; IA: iliac artery; IF: iliofemoral; PA: popliteal artery; SFA: superficial femoral artery; TF: tibiofibular. *Previous treatment with SakSTAR in 1994.
TABLE 7__________________________________________________________________________Treatment and outcome in patients with peripheral arterial occlusion,treatedwith SakSTAR, SakSTAR(K74) or SakSTAR(K.sub.74 ER) Recanalization Total dose of Total durationCompound by thrombolytic of injfusion AdditionalPatient Id. thrombolysis agent (mg) (hrs) therapy Complications and remarks__________________________________________________________________________SakSTARMEE complete 7.0 5.0 PTA Puncture site bleeding, transfusion, reocclusion (day 3), femorotibial graftFRO complete 6.5 4.5 PTA + stent Pyrexia (39.degree. C.)DAN complete 7.5 5.5 PTA --EER complete 18 28 PTA Puncture site bleeding, transfusionDAM complete 19 17 PTA + stent --TOR complete 6.0 4.0 PTA + -- femoropopliteal bypass graftCLA complete 9.0 7.0 -- --MAN complete 6.5 4.5 (amputation left -- digit V)MAT complete 8.0 6.0 (-) --Mean .+-. SEM 9.7 .+-. 1.7 9.1 .+-. 2.7SakSTAR(K.sub.74)UE complete 11 9.0 PTA --ENG complete 12 10 PTA --COX partial 15 15 PTA Reocclusion after PTA resistant to rt- PA, treated by surgical graft revisionMAN complete 9.0 7.0 PTA Puncture site hematoma, transfusionVHE complete 18 16 Surgical graft -- revisionMUL complete 16 20 PTA --BUR partial 18 21 -- --NIJ complete 15 21 -- --POE* partial 6.0 4.0 rt-PA, surgical Shivering and gastrointestinal graft lengthening disturbance; presumably of allergic origin, absence of recanalization despite switch to rt-PAVBE complete 18 23 Stent right SC Retroperitoneal hematoma; artery, first rib hypovolemic shock; transfusion resectionSME complete 21 19 None NoneWOL complete 16 22 -- --Mean .+-. SEM 15 .+-. 1.2 16 .+-. 1.9SakSTAR(K.sub.74 ER)JAC complete 14 12 -- Puncture site hematoma, transfusionMAE complete 9.0 7.0 PTA --CRA complete 25 23 PTA + stentVDB complete 9.0 7.0 PTA --DUN complete 9.0 7.0 PTA Reocclusion after 1 day; conservative managementDEL complete 9.0 7.0 PTA Reocclusion after 1 week treated with rt-PAMean .+-. SEM 13 .+-. 2.6 11 .+-. 2.6__________________________________________________________________________ PTA, percutaneous transluminal angioplasty *Previous treatment with SakSTAR in 1994.
TABLE 8__________________________________________________________________________Coagulation parameters before and after administration of SakSTAR,SakSTAR(K.sub.74) or SakSTAR(K.sub.74 ER) in patientswith peripheral arterial occlusion. Fibrinogen Plasminogen D-dimer aPTTCompound (g/l) (%) .alpha..sub.2 -antiplasmin (ng/ml) (s)Patient Id. Before After Before After Before After Before Peak Before After__________________________________________________________________________SakSTARMEE 2.4 2.5 95 82 95 91 <100 6,600 34 >180FRO 6.4 6.0 80 80 99 93 580 >13,000 37 56DAN 2.3 2.8 98 93 120 110 <100 >13,000 32 72EER 4.0 3.5 95 65 110 69 890 >25,000 38 >180DAM 3.1 2.9 66 90 49 75 250 4,900 44 54TOR 3.7 4.4 73 73 90 88 2,100 >13,000 32 170CLA 3.0 3.3 85 80 89 88 350 >13,000 28 45MAN 3.3 4.1 80 82 87 84 380 4,200 59 63MAT 3.4 2.9 95 117 90 87 1,100 7,800 25 82Mean .+-. SEM 3.5 .+-. 0.4 3.6 .+-. 0.4 85 .+-. 3.8 85 .+-. 4.9 92 .+-. 6.4 87 .+-. 8.3 650 .+-. 210 11,000 .+-. 2,100 37 100 .+-. 19p* 0.6 0.9 0.4 0.004 0.004SakSTAR(K.sub.74)UE 4.6 3.9 110 76 100 61 3,300 >13,000 27 40ENG 3.0 2.9 130 130 100 120 610 4,700 27 29COX 2.9 3.8 100 110 100 120 <100 6,100 23 52MAN 3.4 3.7 67 67 93 103 <100 4,900 27 62VHE 1.8 2.2 99 74 98 69 270 >12.500 34 51MUL 2.9 2.8 100 73 120 91 2,100 5,700 33 54BUR 3.5 4.0 110 90 100 90 240 8,000 21 23NIJ 2.5 2.5 95 92 97 94 400 11,000 21 23�POE**! 2.3 2.4 98 89 100 100 <100 4,800 31 68VBE 3.6 4.5 130 110 120 100 460 4,200 22 117SME 2.8 3.4 420 1,800 30 100WOL 3.2 3.7 120 97 100 92 1,000 20,000 27 41Mean .+-. SEM 3.1 .+-. 0.2 3.4 .+-. 0.2 110 .+-. 5.1 93 .+-. 6.0 100 .+-. 2.3 94 .+-. 5.1 820 .+-. 300 8,300 .+-. 1,600 27 54 .+-. 9.1p* 0.07 0.007 0.1 0.001 0.001SakSTAR(K.sub.74 ER)JAC 2.7 3.0 110 110 97 100 <100 220 36 >180MAE 3.5 4.2 110 110 95 99 250 1,400 28 28CRA 3.4 3.8 89 91 97 95 430 1,300 35 89VDB 6.2 6.6 100 100 85 90 970 3,700 32 42DUN 4.2 3.9 100 90 93 86 200 10,000 31 45DEL 3.2 2.7 91 76 96 88 <100 4,700 37 61Mean .+-. SEM 3.9 .+-. 0.5 4.0 .+-. 0.6 100 .+-. 3.5 96 .+-. 5.2 94 .+-. 1.9 94 .+-. 2.8 340 .+-. 140 3,500 .+-. 1,500 33 74 .+-. 23p* 0.8 0.2 1.0 0.03 0.06__________________________________________________________________________ For calculations of mean .+-. SEM "<" and ">" were disregarded. * by paired Student's test or MannWithney test, as applicable. ** not included in calculations of mean .+-. SEM.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 5- (2) INFORMATION FOR SEQ ID NO: 1:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20- (B) TYPE: NUCLEIC A - #CID- (C) STRANDEDNESS: SINGLE- (D) TOPOLOGY: UNKNOWN#1: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 20 GGAG- (2) INFORMATION FOR SEQ ID NO: 2:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28- (B) TYPE: NUCLEIC A - #CID- (C) STRANDEDNESS: SING - #LE- (D) TOPOLOGY: UNKNOWN#2: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 28 CATT CATTCAGC- (2) INFORMATION FOR SEQ ID NO: 3:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28- (B) TYPE: NUCLEIC A - #CID- (C) STRANDEDNESS: SING - #LE- (D) TOPOLOGY: UNKNOWN#3: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 28 CATT CATTCAGC- (2) INFORMATION FOR SEQ ID NO: 4:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41- (B) TYPE: NUCLEIC A - #CID- (C) STRANDEDNESS: SING - #LE- (D) TOPOLOGY: UNKNOWN#4: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:# 41 TATT TCTTTTCTGC AACAACCTTG G- (2) INFORMATION FOR SEQ ID NO: 5:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 136- (B) TYPE: AMINO ACI - #D- (C) STRANDEDNESS: SING - #LE- (D) TOPOLOGY: UNKNOWN#5: (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- Ser Ser Ser Phe Asp Lys Gly Lys Tyr Lys Ly - #s Gly Asp Asp Ala# 15- Ser Tyr Phe Glu Pro Thr Gly Pro Tyr Leu Me - #t Val Asn Val Thr# 30- Gly Val Asp Ser Lys Gly Asn Glu Leu Leu Se - #r Pro His Tyr Val# 45- Glu Phe Pro Ile Lys Pro Gly Thr Thr Leu Th - #r Lys Glu Lys Ile# 60- Glu Tyr Tyr Val Glu Trp Ala Leu Asp Ala Th - #r Ala Tyr Lys Glu# 75- Phe Arg Val Val Glu Leu Asp Pro Ser Ala Ly - #s Ile Glu Val Thr# 90- Tyr Tyr Asp Lys Asn Lys Lys Lys Glu Glu Th - #r Lys Ser Phe Pro# 105- Ile Thr Glu Lys Gly Phe Val Val Pro Asp Le - #u Ser Glu His Ile# 120- Lys Asn Pro Gly Phe Asn Leu Ile Thr Lys Va - #l Val Ile Glu Lys# 135- Lys__________________________________________________________________________

Number	Name	Date
4532211	Sako et al.	Jul 1985
5336495	Collen et al.	Aug 1994
5475089	Matsuo et al.	Dec 1995

Number	Date	Country
0721982 A1	Jul 1996	EPX
9621016 A2	Jul 1996	WOX

Identification, production and use of new staphylokinase derivatives with reduced immunogenicity

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (1)

CROSS-REFERENCE TO RELATED APPLICATIONS

US Referenced Citations (3)

Foreign Referenced Citations (2)

Non-Patent Literature Citations (7)

Related Publications (1)

Continuation in Parts (1)