I.kappa.B kinases

FIELD OF THE INVENTION
The field of this invention is a family of kinases which regulate signal transduction.
BACKGROUND
Inflammatory cytokines IL-1 and TNF exert diverse biological activities by altering gene expression in the cells, a function mediated mostly by transcription factor NF-.kappa.B. In unstimulated cells, NF-.kappa.B proteins form a complex with inhibitory molecules, the I.kappa.B proteins, and are rendered inactive in the cytoplasm. In response to cytokines and other stimuli, the I.kappa.B proteins are phosphorylated on specific serine residues. In particular, phosphorylation of two serine residues as part of the consensus sequence DSGL/IXSM/L (e.g. ser 32 and 36 in I.kappa.B.alpha., ser 19 and 23 in I.kappa.B.beta., and ser 157 and 161, or 18 and 22, depending on the usage of methionines, in I.kappa.BE, respectively) which mark the proteins for ubiquitination and proteosome-mediated degradation, releasing NF-.kappa.B to enter the nucleus to activate the genes that encode proteins participating in inflammatory and immune responses. Henceforth, the term I.kappa.B serine 36 is used herein to refer generically to the second serine residue of the foregoing consensus sequence, e.g. that corresponding to serine 36 in I.kappa.B.alpha., ser 23 in I.kappa.K.beta., and ser 161 or 22 in I.kappa.B.epsilon..
Delineating TNF and IL-1 signaling pathways for NF-.kappa.B activation has implicated the TRAF molecules as converging point for different cytokines, with TRAF2 being involved in TNF- and TRAF6.in IL-1-induced NF-KB activation. We disclose herein a family of I.kappa.B kinases including a TRAF2-associated kinase activity (designated T2K) and the translation product of the KIAA0151 gene product that phosphorylates the IKB molecules on the specific regulatory serine residues. We also disclose the purification of a native protein responsible for such kinase activity, the sequencing of T2K peptides derived, and the cloning of native T2K cDNA.
Nagase et al. (1995) DNA Res. 2(4),167-174 report conceptual coding sequences from a number of unidentified human genes including KIAA0151. Song et al., U.S. patent application Ser. No. 08/677,862 discloses a TRAF2-associated kinase.
SUMMARY OF THE INVENTION
The invention provides methods and compositions relating to natural isolated regulatory proteins called T2K proteins, related nucleic acids, and protein domains thereof having T2K-specific activity. The proteins may be produced recombinantly from transformed host cells from the subject T2K encoding nucleic acids or purified from mammalian cells. The invention provides isolated T2K hybridization probes and primers capable of specifically hybridizing with the disclosed T2K gene, T2K-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis (e.g. genetic hybridization screens for T2K transcripts), therapy (e.g. gene therapy to modulate T2K gene expression) and in the biopharmaceutical industry (e.g. as immunogens, reagents for isolating other transcriptional regulators, reagents for screening chemical libraries for lead pharmacological agents, etc.).

DETAILED DESCRIPTION OF THE INVENTION
The nucleotide sequences of a natural cDNA encoding a human T2K protein is shown as SEQ ID NO: 1, and the full conceptual translate is shown as SEQ ID NO:2. The T2K proteins of the invention include incomplete translates of SEQ ID NO: I and deletion mutants of SEQ ID NO:2, which translates and deletion mutants have T2K-specific amino acid sequence and assay-discernable T2K-specific binding specificity or function. Such active T2K deletion mutants, T2K peptides or protein domains comprise a sequence of at least about 6, preferably at least about 8, more preferably at least about 10 consecutive residues of SEQ ID NO:2 which distinguishes both the KIAA0151 gene product and the translation product of SEQ ID NO: 1, bases 1756-2095. For examples, T2K protein domains identified below are shown to provide protein-binding domains which are identified in and find use, inter alia, in solid-phase binding and kinase assays as described below.
T2K-specific activity or function may be determined by convenient in vitro, cell-based, or in vivo assays: e.g. in vitro binding assays, cell culture assays, in animals (e.g. gene therapy, transgenics, etc.), etc. Binding assays encompass any assay where the molecular interaction of an T2K protein with a binding target is evaluated. The binding target may be a natural intracellular binding target (including substrates, agonists and antagonists) such as an I.kappa.B or TRAF2, or other regulator that directly modulates T2K activity or its localization; or non-natural binding target such a specific immune protein such as an antibody, or an T2K specific agent such as those identified in screening assays such as described below. T2K-binding specificity may assayed by binding equilibrium constants (usually at least about 10.sup.7 M.sup.-1, preferably at least about 10.sup.8 M.sup.-1, more preferably at least about 10.sup.9 M.sup.-1), by the ability of the subject protein to function as negative mutants in T2K-expressing cells, to elicit T2K specific antibody in a heterologous host (e.g. a rodent or rabbit), etc.; or, in a preferred embodiment, by kinase activity.
The claimed T2K proteins are isolated or pure: an "isolated" protein is unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, and more preferably at least about 5% by weight of the total protein in a given sample and a pure protein constitutes at least about 90%, and preferably at least about 99% by weight of the total protein in a given sample. The T2K proteins and protein domains may be synthesized, produced by recombinant technology, or purified from mammalian, preferably human cells. A wide variety of molecular and biochemical methods are available for biochemical synthesis, molecular expression and purification of the subject compositions, see e.g. Molecular Cloning, A Laboratory Manual (Sambrook, et al. Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY) or that are otherwise known in the art.
The invention provides natural and non-natural T2K-specific binding agents, methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development. For example, T2K-specific agents are useful in a variety of diagnostic and therapeutic applications. Novel T2K-specific binding agents include T2K-specific receptors, such as somatically recombined protein receptors like specific antibodies or T-cell antigen receptors (see, e.g Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory) and other natural intracellular binding agents identified with assays such as one-, two- and three-hybrid screens, non-natural intracellular binding agents identified in screens of chemical libraries such as described below, etc. For diagnostic uses, the binding agents are frequently labeled, such as with fluorescent, radioactive, chemiluminescent, or other easily detectable molecules, either conjugated directly to the binding agent or conjugated to a probe specific for the binding agent. Agents of particular interest modulate T2K function, e.g. T2K kinase activity; for example, isolated cells, whole tissues, or individuals may be treated with a T2K binding agent to activate, inhibit, or alter T2K-kinase dependent processes such as Nf.kappa.B activation.
The amino acid sequences of the disclosed T2K proteins are used to back-translate T2K protein-encoding nucleic acids optimized for selected expression systems (Holler et al. (1993) Gene 136, 323-328; Martin et al. (1995) Gene 154, 150-166) or used to generate degenerate oligonucleotide primers and probes for use in the isolation of natural T2K-encoding nucleic acid sequences ("GCG" software, Genetics Computer Group, Inc, Madison Wis.). T2K-encoding nucleic acids used in T2K-expression vectors and incorporated into recombinant host cells, e.g. for expression and screening, transgenic animals, e.g. for functional studies such as the efficacy of candidate drugs for disease associated with T2K-modulated cell function, etc.
The invention also provides nucleic acid hybridization probes and replication/amplification primers having a hitherto novel T2K cDNA specific sequence contained in SEQ ID NO: 1 (including its complement and analogs and complements thereof having the corresponding sequence, e.g . in RNA) and sufficient to effect specific hybridization thereto (i.e. specifically hybridize with SEQ ID NO: 1 in the presence of the KIAAO 151 gene and nucleic acids consisting of SEQ ID NO: 1, bases 1756-2095). Such primers or probes are at least 12, preferably at least 24, more preferably at least 36 and most preferably at least 96 bases in length. Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formamide in 5.times.SSPE (0.18M NaCl, 0.01 M NaPO.sub.4, pH7.7, 0.001M EDTA) buffer at a temperature of 42.degree. C. and remaining bound when subject to washing at 42.degree. C. with 0.2.times.SSPE; preferably hybridizing in a buffer comprising 50% formamide in 5.times.SSPE buffer at a temperature of 42.degree. C. and remaining bound when subject to washing at 42.degree. C. with 0.2.times.SSPE buffer at 42.degree. C. T2K cDNA homologs can also be distinguished from other protein using alignment algorithms, such as BLASTX (Altschul et al. (1990) Basic Local Alignment Search Tool, J Mol Biol 215, 403-410).
The subject nucleic acids are of synthetic/non-natural sequences and/or are isolated, i.e. unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, preferably at least about 5% by weight of total nucleic acid present in a given fraction, and usually recombinant, meaning they comprise a non-natural sequence or a natural sequence joined to nucleotide(s) other than that which it is joined to on a natural chromosome. Nucleic acids comprising the nucleotide sequence of SEQ ID NO: 1 or fragments thereof, contain such sequence or fragment at a terminus, immediately flanked by a sequence other than that which it is joined to on a natural chromosome, or flanked by a native flanking region fewer than 10 kb, preferably fewer than 2 kb, which is at a terminus or is immediately flanked by a sequence other than that which it is joined to on a natural chromosome. While the nucleic acids are usually RNA or DNA, it is often advantageous to use nucleic acids comprising other bases or nucleotide analogs to provide modified stability, etc.
The subject nucleic acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, etc.; use in detecting the presence of T2K genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional T2K homologs and structural analogs. In diagnosis, T2K hybridization probes find use in identifying wild-type and mutant T2K alleles in clinical and laboratory samples. Mutant alleles are used to generate allele-specific oligonucleotide (ASO) probes for high-throughput clinical diagnoses. In therapy, therapeutic T2K nucleic acids are used to modulate cellular expression or intracellular concentration or availability of active T2K. For example, T2K nucleic acids are also used to modulate cellular expression or intracellular concentration or availability of active T2K protein. T2K inhibitory nucleic acids are typically antisense: single-stranded sequences comprising complements of the disclosed natural T2K coding sequences. Antisense modulation of the expression of a given T2K protein may employ antisense nucleic acids operably linked to gene regulatory sequences. Cell are transfected with a vector comprising a T2K sequence with a promoter sequence oriented such that transcription of the gene yields an antisense transcript capable of binding to endogenous T2K encoding mRNA. Transcription of the antisense nucleic acid may be constitutive or inducible and the vector may provide for stable extrachromosomal maintenance or integration. Alternatively, single-stranded antisense nucleic acids that bind to genomic DNA or mRNA encoding a given T2K protein may be administered to the target cell, in or temporarily isolated from a host, at a concentration that results in a substantial reduction in expression of the targeted protein. An enhancement in T2K expression is effected by introducing into the targeted cell type T2K nucleic acids which increase the functional expression of the corresponding gene products. Such nucleic acids may be T2K expression vectors, vectors which upregulate the functional expression of an endogenous allele, or replacement vectors for targeted correction of mutant alleles. Techniques for introducing the nucleic acids into viable cells are known in the art and include retroviral-based transfection, viral coat protein-liposome mediated transfection, etc.
The invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of an IKB serine 36 specific kinase protein modulatable cellular function. Generally, these screening methods involve assaying for compounds which modulate IKB serine 36 specific kinase protein interaction with a natural I.kappa.B serine 36 specific kinase protein binding target. A wide variety of assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc. The methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. Such libraries encompass candidate agents of encompass numerous chemical classes, though typically they are organic compounds; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds. Identified agents find use in the pharmaceutical industries for animal and human trials; for example, the agents may be derivatized and rescreened in in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.
In vitro binding assays employ a mixture of components including a IKB serine 36 specific kinase protein such as a T2K protein, which may be part of a fusion product with another peptide or polypeptide, e.g. a tag for detection or anchoring, etc. The assay mixtures comprise a natural intracellular binding target of the kinase protein. While native binding targets may be used, it is frequently preferred to use portions (e.g. peptides) thereof so long as the portion provides binding affinity and avidity to the subject kinase protein conveniently measurable in the assay. In a particular embodiment, the binding target is a substrate comprising I.kappa.B serine 36. Such substrates comprise a I.kappa.B.alpha., .beta. or .epsilon. peptide including the serine 36 residue and at least 5, preferably at least 10, and more preferably at least 20 naturally occuring immediately flanking residues on each side (i.e. residues 26-46, 22-42, or 12-32 or 151-171 for I.kappa.B.alpha., .beta. or .epsilon.-derived substrates, respectively).
The assay mixture also comprises a candidate pharmacological agent and typically, a variety of other reagents such as salts, buffers, neutral proteins, e.g. albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. The mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding. The mixture is then incubated under conditions whereby, but for the presence of the candidate pharmacological agent, the kinase protein specifically binds the cellular binding target, portion or analog with a reference binding affinity. Incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid, high-throughput screening.
After incubation, the agent-biased binding between the kinase protein and one or more binding targets is detected by any convenient way. First, a separation step is generally used to separate bound from unbound components. Separation may be effected by precipitation (e.g. TCA precipitation, immunoprecipitation, etc.), immobilization (e.g on a solid substrate), etc., followed by washing by, for examples, membrane filtration, gel chromatography (e.g. gel filtration, affinity, etc.). One of the components usually comprises or is coupled to a label. The label may provide for direct detection as radioactivity, luminescence, optical or electron density, etc. or indirect detection such as an epitope tag, an enzyme, etc. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiative emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, etc. A difference in the binding affinity of the kinase protein to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the kinase protein to the binding target. Analogously, in the cell-based transcription assay also described below, a difference in the kinase protein transcriptional induction in the presence and absence of an agent indicates the agent modulates kinase-modulated transcription. A difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.
The following experimental section and examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
Identification of T2K:
293 cells were stably transfected with DNA plasmids that direct the expression of the human TRAF2 protein with an N-terminal Flag-epitope tag. Cells grown in suspension culture were pelleted in 500 ml bottles in a Sorvall GS-3 rotor spun at 2000 RPM for 5 minutes and were lysed in 5 pelleted-cell-volumes of "lysis buffer" containing 50 mM Hepes, pH 7.9, 250 mM NaCl, 5 mM dithiothreitol (DTT), 1 mM EDTA, 20 mM .beta. glycerophosphate, 5 mM p-nitrophenyl phosphate, 1 mM Na orthovanadate, 1 mM benzamidine, 0.4 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM Na metabisulfite, 0.1% NP-40 and 10% (v/v) glycerol. After incubation on ice for 30 minutes with occasional rocking, cell lysate was centrifuged in a 50 ml conical tube in a Sorvall H6000A rotor at 4000 RPM for 10 minutes. Supernatants were collected and centrifuged in a Beckman 45 TI rotor at 40,000 RPM for 2 hours. The TRAF complex was immunoprecipitated using anti-flag monoclonal antibodies cross-linked to sepharose (VWR) (1.5 ml sepharose beads for 200 mls of extracts). The immunoprecipitates were washed 4 times with cell lysis buffer, twice with lysis buffer containing 1 molar NaCl, then twice with lysis buffer. At this stage, the immunocomplex can efficiently phosphorylate wild type I.kappa.B.alpha. and .beta. but not the mutants with the two serines substituted with alanines. The sepharose beads containing TRAF2 complex were then incubated at 30.degree. C. for 1 hour in 4.5 mls of kinase buffer containing 20 mM Tris-HCl pH 7.6, 20 mM MgCl.sub.2, 20 mM .beta. glycerophosphate, 20 mM p-nitrophenyl phosphate, 1 mM EDTA, 1 mM Na orthovanadate, 1 mM benzamidine, 0.4 mM PMSF, 1 mM Na metabisulfite, 1 mM ATP, and 20 mM creatinephosphate. After the in vitro kinase reaction, significant amounts of the I.kappa.B kinase activity were found in the soluble fraction which was loaded on an 1 ml heparin agarose column and eluted with a NaCl gradient. The IKB kinase activity was recovered in the flow though fraction which was concentrated with a centricon (Amicon) to 50 ul. The material was fractionated on a superdex 200 gel filtration column driven by the Smart system (Pharmacia) and the eluate was collected in 50 ul fractions. The kinase activity was recovered in the fractions that correlated with molecule size marker of 670 kD. These fractions were pooled and further separated on a Mono Q column by a NaCl linear gradient. The kinase activity was found in 0.3 to 0.4M NaCl eluate. Silver staining of the column fractions separated on SDS gels revealed an 85 to 90 kD polypeptide that correlated with the kinase activity in both superdex 200 and Mono Q fractionation. After SDS gel separation, this polypeptide was subjected to micropeptide sequencing. One peptide sequence obtained matched a partial cDNA sequence in the Merck-Washington University Est database. A cDNA clone that contains open reading frame for 729 amino acids was isolated from a lambda phage cDNA library generated from HeLa cells. Sequence analysis revealed a protein kinase domain in the N-terminal portion of the predicted protein (T2K). Searching protein sequence database with the kinase domain of T2K identified a protein (KIAAO151) highly homologous to T2K, specially in the protein kinase domain (75% identity). KIAA0151 is a kinase with undefined function and was reported by Nagase T. et al. as a novel cDNA sequence isolated from human KG-l cells (DNA Res. 2 (4), 167-174 (1995).
Substrate specificity analysis revealed that both T2K and KIAA0151 specifically phosphorylate IKB serine 36 and associate with TRAF2. Furthermore, deletion mutant analysis reveals that residues 10-250 define kinase domains and residues 251-729 and 251-716, for T2K and KIAA0151 respectively, define regulatory domains active as a negative mutants for I.kappa.B kinase activity. Recombinant T2K kinase is prepared by over-expressing GST fusion proteins in E. coli and baculavirus expression systems.
EXAMPLES
1. Protocol for at T2K-I.kappa.B.alpha. phosphorylation assay.
A. Reagents:
Neutralite Avidin: 20 .mu.g/ml in PBS.
kinase: 10.sup.-8 -10.sup.-5 M kinase (SEQ ID NO:2) at 20 .mu.g/ml in PBS.
substrate: 10.sup.-7 -10.sup.-4 M biotinylated substrate (21 residue peptide consisting of residues 26-46 of human I.kappa.B.alpha.) at 40 .mu.g/ml in PBS.
Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
Assay Buffer: 100 mM KCl, 10 mM MgCl.sub.2, 1 mM MnCl.sub.2, 20 mM HEPES pH 7.4, 0.25 mM EDTA, 1% glycerol, 0.5% NP-40, 50 mM BME, I mg/ml BSA, cocktail of protease inhibitors.
�.sup.32 P!.gamma.-ATP 10.times.stock: 2.times.10.sup.-5 M cold ATP with 100 .mu.Ci �.sup.32 P!.gamma.-ATP. Place in the 4.degree. C. microfridge during screening.
Protease inhibitor cocktail (1000.times.): 10 mg Trypsin Inhibitor (BMB # 109894), 10 mg Aprotinin (BMB # 236624), 25 mg Benzamidine (Sigma # B-6506), 25 mg Leupeptin (BMB # 1017128), 10 mg APMSF (BMB # 917575), and 2mM NaVo.sub.3 (Sigma # S-6508) in 10 ml of PBS.
B. Preparation of assay plates:
Coat with 120 .mu.l of stock N Avidin per well overnight at 4.degree. C.
Wash 2 times with 200 .mu.l PBS.
Block with 150 .mu.l of blocking buffer.
Wash 2 times with 200 .mu.l PBS.
C. Assay:
Add 40 .mu.l assay buffer/well.
Add 40 .mu.l biotinylated substrate (2-200 pmoles/40 ul in assay buffer)
Add 40 .mu.l kinase (0.1-10 pmoles/40 ul in assay buffer)
Add 10 .mu.l compound or extract.
Add 10 .mu.l �.sup.32 P!.gamma.-ATP 10.times.stock.
Shake at 25.degree. C. for 15 minutes.
Incubate additional 45 minutes at 25.degree. C.
Stop the reaction by washing 4 times with 200 .mu.l PBS.
Add 150 .mu.l scintillation cocktail.
Count in Topcount.
D. Controls for all assays (located on each plate):
a. Non-specific binding
b. cold ATP at 80% inhibition.
2. Protocol for at KIAAO151-I.kappa.B.beta. phosphorylation assay.
A. Reagents:
Neutralite Avidin: 20 .mu.g/ml in PBS.
kinase: 10.sup.-8 -10.sup.-5 M truncated KIAA0151 kinase (residues 4-714) at 20 .mu.g/ml in PBS.
substrate: 10.sup.-7 -10.sup.-4 M biotinylated substrate (21 residue peptide consisting of residues 22-42 of human I.kappa.B.beta.) at 40 .mu.g/ml in PBS.
Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
Assay Buffer: 100 mM KCl, 10 mM MgCl.sub.2, 1 mM MnCl.sub.2, 20 mM HEPES pH 7.4, 0.25 mM EDTA, 1% glycerol, 0.5% NP-40, 50 mM BME, 1 mg/ml BSA, cocktail of protease inhibitors.
-�.sup.32 P!.gamma.-ATP 10.times.stock: 2.times.10.sup.-5 M cold ATP with 100 .mu.Ci�.sup.32 P!.DELTA.-ATP. Place in the 4.degree. C. microfridge during screening.
Protease inhibitor cocktail (1000.times.): 10 mg Trypsin Inhibitor (BMB # 109894), 10 mg Aprotinin (BMB # 236624), 25 mg Benzamidine (Sigma # B-6506), 25 mg Leupeptin (BMB # 1017128), 10 mg APMSF (BMB # 917575), and 2mM NaVo.sub.3 (Sigma # S-6508) in 10 ml of PBS.
B. Preparation of assay plates:
Coat with 120 .mu.l of stock N Avidin per well overnight at 4.degree. C.
Wash 2 times with 200 .mu.l PBS.
Block with 150 .mu.l of blocking buffer.
Wash 2 times with 200 .mu.l PBS.
C. Assay:
Add 40 .mu.l assay buffer/well.
Add 40 .mu.l biotinylated substrate (2-200 pmoles/40 ul in assay buffer)
Add 40 .mu.l kinase (0.1-10 pmoles/40 ul in assay buffer)
Add 40 .mu.l compound or extract.
Add 10 .mu.l �.sup.32 P!.gamma.-ATP 10.times.stock.
Shake at 25.degree. C. for 15 minutes.
Incubate additional 45 minutes at 25.degree. C.
Stop the reaction by washing 4 times with 200 .mu.l PBS.
Add 150 .mu.l scintillation cocktail.
Count in Topcount.
D. Controls for all assays (located on each plate):
a. Non-specific binding
b. cold ATP at 80% inhibition.
3. Protocol for high throughput T2K-TRAF2 heterodimer formation assay.
A. Reagents:
Neutralite Avidin: 20 .mu.g/ml in PBS.
Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
Assay Buffer: 100 mM KCl, 20 mM HEPES pH 7.6, 1 mM MgCl.sub.2, 1% glycerol, 0.5% NP-40, 50 mM .beta.-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors.
.sup.33 P T2K protein 10.times.stock: 10.sup.-8 -10.sup.-6 M "cold" T2K supplemented with 200,000-250,000 cpm of labeled T2K (Beckman counter). Place in the 4.degree. C. microfridge during screening.
Protease inhibitor cocktail (1000.times.): 10 mg Trypsin Inhibitor (BMB # 109894), 10 mg Aprotinin (BMB # 236624), 25 mg Benzamidine (Sigma # B-6506), 25 mg Leupeptin (BMB # 1017128), 10 mg APMSF (BMB # 917575), and 2mM NaVo.sub.3 (Sigma # S-6508) in 10 ml of PBS.
TRAF2: 10.sup.-7 -10.sup.-5 M biotinylated TRAF2 in PBS.
B. Preparation of assay plates:
Coat with 120 .mu.l of stock N-Avidin per well overnight at 4.degree. C.
Wash 2 times with 200 .mu.l PBS.
Block with 150 .mu.l of blocking buffer.
Wash 2 times with 200 .mu.l PBS.
C. Assay:
Add 40 .mu.l assay buffer/well.
Add 10 .mu.l compound or extract.
Add 10 .mu.l .sup.33 P-T2K (20-25,000 cpm/0.1-10 pmoles/well=10.sup.-9 -10.sup.-7 M final conc).
Shake at 25.degree. C. for 15 minutes.
Incubate additional 45 minutes at 25.degree. C.
Add 40 .mu.l biotinylated TRAF2 (0.1-10 pmoles/40 ul in assay buffer)
Incubate 1 hour at room temperature.
Stop the reaction by washing 4 times with 200 .mu.M PBS.
Add 150 .mu.M scintillation cocktail.
Count in Topcount.
D. Controls for all assays (located on each plate):
a. Non-specific binding
b. Soluble (non-biotinylated TRAF2) at 80% inhibition.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2994 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 73..2259(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GCGGGAGCCCGCCGGCGGTGGCGCGGCGGAGACCCGGCTGGTATAACAAGAGGATTGCCT60GATCCAGCCAAGATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCT108MetGlnSerThrSerAsnHisLeuTrpLeuLeuSer1510GATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTGGAAGACAT156AspIleLeuGlyGlnGlyAlaThrAlaAsnValPheArgGlyArgHis152025AAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGC204LysLysThrGlyAspLeuPheAlaIleLysValPheAsnAsnIleSer303540TTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA252PheLeuArgProValAspValGlnMetArgGluPheGluValLeuLys45505560AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAG300LysLeuAsnHisLysAsnIleValLysLeuPheAlaIleGluGluGlu657075ACAACAACAAGACATAAAGTACTTATTATGGAATTTTGTCCATGTGGG348ThrThrThrArgHisLysValLeuIleMetGluPheCysProCysGly808590AGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATGGACTACCA396SerLeuTyrThrValLeuGluGluProSerAsnAlaTyrGlyLeuPro95100105GAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAAT444GluSerGluPheLeuIleValLeuArgAspValValGlyGlyMetAsn110115120CATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT492HisLeuArgGluAsnGlyIleValHisArgAspIleLysProGlyAsn125130135140ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACA540IleMetArgValIleGlyGluAspGlyGlnSerValTyrLysLeuThr145150155GATTTTGGTGCAGCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCT588AspPheGlyAlaAlaArgGluLeuGluAspAspGluGlnPheValSer160165170CTGTATGGCACAGAAGAATATTTGCACCCTGATATGTATGAGAGAGCA636LeuTyrGlyThrGluGluTyrLeuHisProAspMetTyrGluArgAla175180185GTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCAACAGTTGATCTT684ValLeuArgLysAspHisGlnLysLysTyrGlyAlaThrValAspLeu190195200TGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA732TrpSerIleGlyValThrPheTyrHisAlaAlaThrGlySerLeuPro205210215220TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAA780PheArgProPheGluGlyProArgArgAsnLysGluValMetTyrLys225230235ATAATTACAGGAAAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCA828IleIleThrGlyLysProSerGlyAlaIleSerGlyValGlnLysAla240245250GAAAATGGACCAATTGACTGGAGTGGAGACATGCCTGTTTCTTGCAGT876GluAsnGlyProIleAspTrpSerGlyAspMetProValSerCysSer255260265CTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTTCTTGCAAACATC924LeuSerArgGlyLeuGlnValLeuLeuThrProValLeuAlaAsnIle270275280CTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA972LeuGluAlaAspGlnGluLysCysTrpGlyPheAspGlnPhePheAla285290295300GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTA1020GluThrSerAspIleLeuHisArgMetValIleHisValPheSerLeu305310315CAACAAATGACAGCTCATAAGATTTATATACATAGCTATAATACTGCT1068GlnGlnMetThrAlaHisLysIleTyrIleHisSerTyrAsnThrAla320325330ACTATATTTCATGAACTGGTATATAAACAAACCAAAATTATTTCTTCA1116ThrIlePheHisGluLeuValTyrLysGlnThrLysIleIleSerSer335340345AATCAAGAACTTATCTACGAAGGGCGACGCTTAGTCTTAGAACCTGGA1164AsnGlnGluLeuIleTyrGluGlyArgArgLeuValLeuGluProGly350355360AGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT1212ArgLeuAlaGlnHisPheProLysThrThrGluGluAsnProIlePhe365370375380GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAA1260ValValSerArgGluProLeuAsnThrIleGlyLeuIleTyrGluLys385390395ATTTCCCTCCCTAAAGTACATCCACGTTATGATTTAGACGGGGATGCT1308IleSerLeuProLysValHisProArgTyrAspLeuAspGlyAspAla400405410AGCATGGCTAAGGCAATAACAGGGGTTGTGTGTTATGCCTGCAGAATT1356SerMetAlaLysAlaIleThrGlyValValCysTyrAlaCysArgIle415420425GCCAGTACCTTACTGCTTTATCAGGAATTAATGCGAAAGGGGATACGA1404AlaSerThrLeuLeuLeuTyrGlnGluLeuMetArgLysGlyIleArg430435440TGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA1452TrpLeuIleGluLeuIleLysAspAspTyrAsnGluThrValHisLys445450455460AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAA1500LysThrGluValValIleThrLeuAspPheCysIleArgAsnIleGlu465470475AAAACTGTGAAAGTATATGAAAAGTTGATGAAGATCAACCTGGAAGCG1548LysThrValLysValTyrGluLysLeuMetLysIleAsnLeuGluAla480485490GCAGAGTTAGGTGAAATTTCAGACATACACACCAAATTGTTGAGACTT1596AlaGluLeuGlyGluIleSerAspIleHisThrLysLeuLeuArgLeu495500505TCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAGGATATCGACAGC1644SerSerSerGlnGlyThrIleGluThrSerLeuGlnAspIleAspSer510515520AGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA1692ArgLeuSerProGlyGlySerLeuAlaAspAlaTrpAlaHisGlnGlu525530535540GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTA1740GlyThrHisProLysAspArgAsnValGluLysLeuGlnValLeuLeu545550555AATTGCATGACAGAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAA1788AsnCysMetThrGluIleTyrTyrGlnPheLysLysAspLysAlaGlu560565570CGTAGATTAGCTTATAATGAAGAACAAATCCACAAATTTGATAAGCAA1836ArgArgLeuAlaTyrAsnGluGluGlnIleHisLysPheAspLysGln575580585AAACTGTATTACCATGCCACAAAAGCTATGACGCACTTTACAGATGAA1884LysLeuTyrTyrHisAlaThrLysAlaMetThrHisPheThrAspGlu590595600TGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA1932CysValLysLysTyrGluAlaPheLeuAsnLysSerGluGluTrpIle605610615620AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAG1980ArgLysMetLeuHisLeuArgLysGlnLeuLeuSerLeuThrAsnGln625630635TGTTTTGATATTGAAGAAGAAGTATCAAAATATCAAGAATATACTAAT2028CysPheAspIleGluGluGluValSerLysTyrGlnGluTyrThrAsn640645650GAGTTACAAGAAACTCTGCCTCAGAAAATGTTTACAGCTTCCAGTGGA2076GluLeuGlnGluThrLeuProGlnLysMetPheThrAlaSerSerGly655660665ATCAAACATACCATGACCCCAATTTATCCAAGTTCTAACACATTAGTA2124IleLysHisThrMetThrProIleTyrProSerSerAsnThrLeuVal670675680GAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG2172GluMetThrLeuGlyMetLysLysLeuLysGluGluMetGluGlyVal685690695700GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCT2220ValLysGluLeuAlaGluAsnAsnHisIleLeuGluArgPheGlySer705710715TTAACCATGGATGGTGGCCTTCGCAACGTTGACTGTCTTTAGCTTTCTA2269LeuThrMetAspGlyGlyLeuArgAsnValAspCysLeu720725ATAGAAGTTTAAGAAAAGTTTCCGTTTGCACAAGAAAATAACGCTTGGGCATTAAATGAA2329TGCCTTTATAGATAGTCACTTGTTTCTACAATTCAGTATTTGATGTGGTCGTGTAAATAT2389GTACAATATTGTAAATACATAAAAAATATACAAATTTTTGGCTGCTGTGAAAATGTAATT2449TTATCTTTTAACATTTATAATTATATGAGGAAATTTGACCTCAGTGATCACGAGAAGAAA2509GCCATGACCGACCAATATGTTGACATACTGATCCTCTACTCTGAGTGGGGCTAAATAAGT2569TATTTTCTCTGACCGCCTACTGGAAATATTTTTAAGTGGAACCAAAATAGGCATCCTTAC2629AAATCAGGAAGACTGACTTGACACGTTTGTAAATGGTAGAACGGTGGCTACTGTGAGTGG2689GGAGCAGAACCGCACCACTGTTATACTGGGATAACAATTTTTTTGAGAAGGATAAAGTGG2749CATTATTTTATTTTACAAGGTGCCCAGATCCCAGTTATCCTTGTATCCATGTAATTTCAG2809ATGAATTATTAAGCAAACATTTTAAAGTGAATTCATTATTAAAAACTATTCATTTTTTTC2869CTTTGGCCATAAATGTGTAATTGTCATTAAAATTCTAAGGTCATTTCAACTGTTTTAAGC2929TGTATTTCTTTAATTCTGCTTACTATTTCATGGAAAAAAATAAATTTCTCAATTTTAAAA2989AAAAA2994(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 729 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetGlnSerThrSerAsnHisLeuTrpLeuLeuSerAspIleLeuGly151015GlnGlyAlaThrAlaAsnValPheArgGlyArgHisLysLysThrGly202530AspLeuPheAlaIleLysValPheAsnAsnIleSerPheLeuArgPro354045ValAspValGlnMetArgGluPheGluValLeuLysLysLeuAsnHis505560LysAsnIleValLysLeuPheAlaIleGluGluGluThrThrThrArg65707580HisLysValLeuIleMetGluPheCysProCysGlySerLeuTyrThr859095ValLeuGluGluProSerAsnAlaTyrGlyLeuProGluSerGluPhe100105110LeuIleValLeuArgAspValValGlyGlyMetAsnHisLeuArgGlu115120125AsnGlyIleValHisArgAspIleLysProGlyAsnIleMetArgVal130135140IleGlyGluAspGlyGlnSerValTyrLysLeuThrAspPheGlyAla145150155160AlaArgGluLeuGluAspAspGluGlnPheValSerLeuTyrGlyThr165170175GluGluTyrLeuHisProAspMetTyrGluArgAlaValLeuArgLys180185190AspHisGlnLysLysTyrGlyAlaThrValAspLeuTrpSerIleGly195200205ValThrPheTyrHisAlaAlaThrGlySerLeuProPheArgProPhe210215220GluGlyProArgArgAsnLysGluValMetTyrLysIleIleThrGly225230235240LysProSerGlyAlaIleSerGlyValGlnLysAlaGluAsnGlyPro245250255IleAspTrpSerGlyAspMetProValSerCysSerLeuSerArgGly260265270LeuGlnValLeuLeuThrProValLeuAlaAsnIleLeuGluAlaAsp275280285GlnGluLysCysTrpGlyPheAspGlnPhePheAlaGluThrSerAsp290295300IleLeuHisArgMetValIleHisValPheSerLeuGlnGlnMetThr305310315320AlaHisLysIleTyrIleHisSerTyrAsnThrAlaThrIlePheHis325330335GluLeuValTyrLysGlnThrLysIleIleSerSerAsnGlnGluLeu340345350IleTyrGluGlyArgArgLeuValLeuGluProGlyArgLeuAlaGln355360365HisPheProLysThrThrGluGluAsnProIlePheValValSerArg370375380GluProLeuAsnThrIleGlyLeuIleTyrGluLysIleSerLeuPro385390395400LysValHisProArgTyrAspLeuAspGlyAspAlaSerMetAlaLys405410415AlaIleThrGlyValValCysTyrAlaCysArgIleAlaSerThrLeu420425430LeuLeuTyrGlnGluLeuMetArgLysGlyIleArgTrpLeuIleGlu435440445LeuIleLysAspAspTyrAsnGluThrValHisLysLysThrGluVal450455460ValIleThrLeuAspPheCysIleArgAsnIleGluLysThrValLys465470475480ValTyrGluLysLeuMetLysIleAsnLeuGluAlaAlaGluLeuGly485490495GluIleSerAspIleHisThrLysLeuLeuArgLeuSerSerSerGln500505510GlyThrIleGluThrSerLeuGlnAspIleAspSerArgLeuSerPro515520525GlyGlySerLeuAlaAspAlaTrpAlaHisGlnGluGlyThrHisPro530535540LysAspArgAsnValGluLysLeuGlnValLeuLeuAsnCysMetThr545550555560GluIleTyrTyrGlnPheLysLysAspLysAlaGluArgArgLeuAla565570575TyrAsnGluGluGlnIleHisLysPheAspLysGlnLysLeuTyrTyr580585590HisAlaThrLysAlaMetThrHisPheThrAspGluCysValLysLys595600605TyrGluAlaPheLeuAsnLysSerGluGluTrpIleArgLysMetLeu610615620HisLeuArgLysGlnLeuLeuSerLeuThrAsnGlnCysPheAspIle625630635640GluGluGluValSerLysTyrGlnGluTyrThrAsnGluLeuGlnGlu645650655ThrLeuProGlnLysMetPheThrAlaSerSerGlyIleLysHisThr660665670MetThrProIleTyrProSerSerAsnThrLeuValGluMetThrLeu675680685GlyMetLysLysLeuLysGluGluMetGluGlyValValLysGluLeu690695700AlaGluAsnAsnHisIleLeuGluArgPheGlySerLeuThrMetAsp705710715720GlyGlyLeuArgAsnValAspCysLeu725__________________________________________________________________________

I.kappa.B kinases

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

Divisions (1)