IKK-.beta. proteins, nucleic acids and methods

FIELD OF THE INVENTION
The field of this invention is proteins involved in transcription factor activation.
BACKGROUND
Cytokines trigger changes in gene expression by modifying the activity of otherwise latent transcription factors (Hill and Treisman, 1995). Nuclear factor .kappa.B (NF-.kappa.B) is a prominent example of how such an external stimulus is converted into an active transcription factor (Verma et al., 1995). The NF-.kappa.B system is composed of homo- and heterodimers of members of the Rel family of related transcription factors that control the expression of numerous immune and inflammatory response genes as well as important viral genes (Lenardo and Baltimore, 1989; Baeuerle and Henkel, 1994). The activity of NF-.kappa.B transcription factors is regulated by their subcellular localization (Verma et al., 1995). In most cell types, NF-.kappa.B is present as a heterodimer comprising of a 50 kDa and a 65 kDa subunit. This heterodimer is sequestered in the cytoplasm in association with I.kappa.B.alpha. a member of the I.kappa.B family of inhibitory proteins (Finco and Baldwin, 1995; Thanos and Maniatis, 1995; Verma et al., 1995). I.kappa.B.alpha. masks the nuclear localization signal of NF-.kappa.B and thereby prevents NF-.kappa.B nuclear translocation. Conversion of NF-.kappa.B into an active transcription factor that translocates into the nucleus and binds to cognate DNA sequences requires the phosphorylation and subsequent ubiquitin-dependent degradation of I.kappa.B.alpha. in the 26s proteasome. Signal-induced phosphorylation of I.kappa.B.alpha. occurs at serines 32 and 36. Mutation of one or both of these serines renders I.kappa.B.alpha. resistant to ubiquitination and proteolytic degradation (Chen et al., 1995).
The pleiotropic cytokines tumor necrosis factor (TNF) and interleukin-1 (IL-1) are among the physiological inducers of I.kappa.B phosphorylation and subsequent NF-.kappa.B activation (Osborn et al., 1989; Beg et al., 1993). Although TNF and IL-1 initiate signaling cascades leading to NF-.kappa.B activation via distinct families of cell-surface receptors (Smith et al., 1994; Dinarello, 1996), both pathways utilize members of the TNF receptor-associated factor (TRAF) family of adaptor proteins as signal transducers (Rothe et al., 1995; Hsu et al., 1996; Cao et al., 1996b). TRAF proteins were originally found to associate directly with the cytoplasmic domains of several members of the TNF receptor family including the 75 kDa TNF receptor (TNFR2), CD40, CD30, and the lymphotoxin-.beta. receptor (Rothe et al., 1994; Hu et al., 1994; Cheng et al., 1995; Mosialos et al., 1995; Song and Donner, 1995; Sato et al., 1995; Lee et al., 1996; Gedrich et al., 1996; Ansieau et al., 1996). In addition, TRAP proteins are recruited indirectly to the 55 kDa TNF receptor (TNFR1) by the adaptor protein TRADD (Hsu et al., 1996). Activation of NF-.kappa.B by TNF requires TRAF2 (Rothe et al., 1995; Hsu et al., 1996). TRAF5 has also been implicated in NF-.kappa.B activation by members of the TNF receptor family (Nakano et al., 1996). In contrast, TRAF6 participates in NF-.kappa.B activation by IL-1 (Cao et al., 1996b). Upon IL-1 treatment, TRAF6 associates with IRAK, a serine-threonine kinase that binds to the IL-1 receptor complex (Cao et al., 1996a).
The NF-.kappa.B-inducing kinase (NIK) is a member of the MAP kinase kinase kinase (MAP3K) family that was identified as a TRAF2-interacting protein (Malinin et al., 1997). NIK activates NF-.kappa.B when overexpressed, and kinase-inactive mutants of NIK comprising its TRAF2-interacting C-terminal domain (NIK.sub.(624-947)) or lacking two crucial lysine residues in its kinase domain (NIK.sub.KK429-430AA)) behave as dominant-negative inhibitors that suppress TNF-, IL-1-, and TRAF2-induced NF-.kappa.B activation (Malinin et al., 1997). Recently, NIK was found to associate with additional members of the TRAP family, including TRAF5 and TRAF6. Catalytically inactive mutants of NIK also inhibited TRAF5- and TRAF6-induced NF-.kappa.B activation, thus providing a unifying concept for NIK as a common mediator in the NF-.kappa.B signaling cascades triggered by TNF and IL-1 downstream of TRAFs.
Here, we disclose a novel kinase I.kappa.B Kinase, IKK-.beta., as a NIK-interacting protein. IKK-.beta. has sequence similarity to the conceptual translate of a previously identified open reading frame postulated to encode a serine-threonine kinase of unknown function (`Conserved Helix-loop-helix Ubiquitous Kinase` or CHUK, Connelly and Marcu, 1995; Mock et al., 1995). Catalytically inactive mutants of IKK-.beta. are shown to suppress NF-.kappa.B activation induced by TNF and IL-1 stimulation as well as by TRAF and NIK overexpression; transiently expressed IKK-.beta. is shown to associate with the endogenous I.kappa.B.alpha. complex; and IKK-.beta. is shown to phosphorylate I.kappa.B.alpha. on serines 32 and 36. As used herein, Ser32 and Ser36 of I.kappa.B refers collectively to the two serine residues which are part of the consensus sequence DSGL/IXSM/L (e.g. ser 32 and 36 in I.kappa.B.alpha., ser 19 and 23 in I.kappa.B.beta., and ser 157 and 161, or 18 and 22, depending on the usage of methionines, in I.kappa.B.epsilon., respectively.
SUMMARY OF THE INVENTION
The invention provides methods and compositions relating to isolated IKK-.beta. polypeptides, related nucleic acids, polypeptide domains thereof having IKK-.beta.-specific structure and activity and modulators of IKK-.beta. function, particularly I.kappa.B kinase activity. IKK-.beta. polypeptides can regulate NF.kappa.B activation and hence provide important regulators of cell function. The polypeptides may be produced recombinantly from transformed host cells from the subject IKK-.beta. polypeptide encoding nucleic acids or purified from mammalian cells. The invention provides isolated IKK-.beta. hybridization probes and primers capable of specifically hybridizing with the disclosed IKK-.beta. gene, IKK-.beta.-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis (e.g. genetic hybridization screens for IKK-.beta. transcripts), therapy (e.g. IKK-.beta. kinase inhibitors to inhibit TNF signal transduction) and in the biopharmaceutical industry (e.g. as immunogens, reagents for isolating other transcriptional regulators, reagents for screening chemical libraries for lead pharmacological agents, etc.).
DETAILED DESCRIPTION OF THE INVENTION
The nucleotide sequence of a natural cDNA encoding a human IKK-.beta. polypeptide is shown as SEQ ID NO: 1, and the full conceptual translate is shown as SEQ ID NO: 2. The IKK-.beta. polypeptides of the invention include incomplete translates of SEQ ID NO: 1 and deletion mutants of SEQ ID NO: 2, which translates and deletion mutants have IKK-.beta.-specific amino acid sequence and binding specificity or function.
The IKK-.beta. polypeptide domains of the invention have amino acid sequences distinguishable from IKK-.alpha., generally at least 11, preferably at least 21, more preferably at least 31 consecutive residues of SEQ ID NO: 2 and provide IKK-.beta. domain specific activity or function, such as IKK-.beta.-specific kinase or kinase inhibitory activity, NIK-binding or binding inhibitory activity, I.kappa.B-binding or binding inhibitory activity, NF.kappa.B activating or inhibitory activity or antibody binding. Preferred domains phosphorylate at least one and preferably both the serine 32 and 36 of I.kappa.B (Verma, I. M., et al. (1995)).
IKK-.beta.-specific activity or function may be determined by convenient in vitro, cell-based, or in vivo assays: e.g. in vitro binding assays, cell culture assays, in animals (e.g. gene therapy, transgenics, etc.), etc. Binding assays encompass any assay where the molecular interaction of an IKK-.beta. polypeptide with a binding target is evaluated. The binding target may be a natural intracellular binding target such as an IKK-.beta. substrate, a IKK-.beta. regulating protein or other regulator that directly modulates IKK-.beta. activity or its localization; or non-natural binding target such a specific immune protein such as an antibody, or an IKK-.beta. specific agent such as those identified in screening assays such as described below. IKK-.beta.-binding specificity may assayed by kinase activity or binding equilibrium constants (usually at least about 10.sup.7 M.sup.-1, preferably at least about 10.sup.8 M.sup.-1, more preferably at least about 10.sup.9 M.sup.-1), by the ability of the subject polypeptide to function as negative mutants in IKK-.beta.-expressing cells, to elicit IKK-.beta. specific antibody in a heterologous host (e.g a rodent or rabbit), etc. In any event, the IKK-.beta. binding specificity of the subject IKK-.beta. polypeptides necessarily distinguishes IKK-.alpha. (SEQ ID NO: 4).
The claimed IKK-.beta. polypeptides are isolated or pure: an "isolated" polypeptide is unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, and more preferably at least about 5% by weight of the total polypeptide in a given sample and a pure polypeptide constitutes at least about 90%, and preferably at least about 99% by weight of the total polypeptide in a given sample. The IKK-.beta. polypeptides and polypeptide domains may be synthesized, produced by recombinant technology, or purified from mammalian, preferably human cells. A wide variety of molecular and biochemical methods are available for biochemical synthesis, molecular expression and purification of the subject compositions, see e.g. Molecular Cloning, A Laboratory Manual (Sambrook, et al. Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY) or that are otherwise known in the art.
The invention provides binding agents specific to the subject kinase proteins including substrates, agonists, antagonists, natural intracellular binding targets, etc., methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development. For example, specific binding agents are useful in a variety of diagnostic and therapeutic applications, especially where disease or disease prognosis is associated with improper utilization of a pathway involving the subject proteins, e.g. NF-.kappa.B activation. Novel IKK-.beta.-specific binding agents include IKK-.beta.-specific receptors, such as somatically recombined polypeptide receptors like specific antibodies or T-cell antigen receptors (see, e.g Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory) and other natural intracellular binding agents identified with assays such as one-, two- and three-hybrid screens, non-natural intracellular binding agents identified in screens of chemical libraries such as described below, etc. Agents of particular interest modulate IKK-.beta. function, e.g. IKK-.beta.-dependent transcriptional activation. For example, a wide variety of inhibitors of IKK-.beta. I.kappa.B kinase activity may be used to regulate signal transduction involving I.kappa.B. Exemplary IKK-.beta. I.kappa.B kinase inhibitors include known classes of serine/threonine kinase (e.g. PKC) inhibitors such as competitive inhibitors of ATP and substrate binding, antibiotics, IKK-.beta.-derived peptide inhibitors, etc., see Tables 1 and 2. IKK-.beta. specificity and activity are readily quantified in high throughput kinase assays using panels of protein kinases (see cited references and Examples).
Preferred inhibitors include natural compounds such as staurosporine (Omura S, et al. J Antibiot (Tokyo) 1995 July;48(7):535-48), produced by a marine organism, and synthetic compounds such as PD 153035, which also potently inhibits the EGF receptor protein kinase (Fry D W et al. Science 1994 Aug. 19;265(5175):1093-5). Members of the tyrphostin family of synthetic protein kinase inhibitors are also useful; these include compounds which are pure ATP competitors, compounds which are pure substrate competitors, and compounds which are mixed competitors: compete with both ATP and substrate (Levitzki A and Gazit A, Science 1995 Mar 24;267(5205):1782-8). Additional IKK-.beta. inhibitors include peptide-based substrate competitors endogenously made by the mammalian cell, e.g. PKI (protein kinase inhibitor, Seasholtz A F et al., Proc Natl Acad Sci USA 1995 Feb. 28;92(5):1734-8), or proteins inhibiting cdc kinases (Correa-Bordes J and Nurse P, Cell 1995 Dec. 15;83(6):1001-9). Additional small peptide based substrate competitive kinase inhibitors and allosteric inhibitors (inhibitory mechanisms independent of ATP or substrate competition) are readily generated by established methods (Hvalby O, et al. Proc Natl Acad Sci USA 1994 May 24;91(11):4761-5; Barja P, et al., Cell Immunol 1994 January;153(1):28-38; Villar-Palasi C, Biochim Biophys Acta 1994 Dec. 30;1224(3):384-8; Liu W Z, et al., Biochemistry 1994 Aug. 23;33(33):10120-6).
TABLE I______________________________________Selected Small Molecule IKK-.beta. Kinase InhibitorsInhibitors Citations______________________________________HA-100.sup.1 1. Hagiwara, M,. et al. Mol. Pharmacol. 32:7 (1987)Chelerythrine.sup.2 2. Herbert, J. M., et al. Biochem Biophys Res Com 172:993 (1990)Staurosporine.sup.3,4,5 3. Schachtele, C., et al. Biochem Biophys Res Com 151:542 (1988)Calphostin C.sup.6,7,8,9 4. Tamaoki, T., et al. Biochem Biophys Res Com 135:397 (1986)K-252b.sup.10 5. Tischler, A. S., et al. J. Neurochemistry 55:1159 (1990)PKC 19-36.sup.11 6. Bruns, R. F., et al. Biochem Biophys Res Com 176:288 (1991)Iso-H7.sup.12 7. Kobayashi, E., et al. Biochem Biophys Res Com 159:548 (1989)PKC 19-31 8. Tamaoki, T., et al Adv 2nd Mass Phospho- protein Res 24:497 (1990)H-7.sup.13,3,14 9. Tamaoki, T., et al. Biotechnology 8:732 (1990)H-89.sup.15 10. Yasuzawa, T. J. Antibiotics 39:1972 (1986)KT5720.sup.16 11. House, C., et al. Science 238:1726 (1987)cAMP-depPKinhib.sup.17 12. Quick, J., et al. Biochem. Biophys. Res. Com. 167:657 (1992)A-3.sup.18 13. Bouli, N. M. and Davis, M. Brain Res. 525:198 (1990)HA1004.sup.19,20 14. Takahashi, I., et al. J. Pharmacol. Exp. Ther. 255:1218 (1990)K-252a.sup.16,5 15. Chijiwa, T., et al. J. Biol. Chem. 265:5267 (1990)KT5823.sup.16 16. Kase, H., et al. Biochem. Biophys. Res. Com. 142:436 (1987)ML-9.sup.21 17. Cheng, H. C., et al. J. Biol. Chem. 261:989 (1986)KT5926.sup.22 18. Inagaki, M., et al. Mol. Pharmacol. 29:577 (1986) 19. Asano, T. and Hidaka, H. J Pharmaco. Exp Ther 231:141 (1984) 20. Hidaka, H., et al. Biochemistry 23:5036 (1984) 21. Nagatsu, T., et al. Biochem Biophys Res Com 143:1045 (1987) 22. Nakanishi, S., et al. Mol. Pharmacol. 37:482 (1990)______________________________________
TABLE II______________________________________Selected Peptidyl IKK-.beta. Kinase Inhibitors______________________________________hI.kappa.B.alpha., residues 24-39, 32Ala hIKK-.beta., .DELTA.5-203hI.kappa.B.alpha., residues 29-47, 36Ala hIKK-.beta., .DELTA.1-178hI.kappa.B.alpha., residues 26-46, 32/36Ala hIKK-.beta., .DELTA.368-756hI.kappa.B.beta., residues 25-38, 32Ala hIKK-.beta., .DELTA.460-748hI.kappa.B.beta., residues 30-41, 36Ala hIKK-.alpha., .DELTA.1-289hI.kappa.B.beta., residues 26-46, 32/36Ala hIKK-.alpha., .DELTA.12-219hI.kappa.B.epsilon., residues 24-40, 32Ala hIKK-.alpha., .DELTA.307-745hI.kappa.B.epsilon., residues 31-50, 36Ala hIKK-.alpha., .DELTA.319-644hI.kappa.B.epsilon., residues 27-44, 32/36Ala______________________________________
Accordingly, the invention provides methods for modulating signal transduction involving I.kappa.B in a cell comprising the step of modulating IKK-.beta. kinase activity, e.g. by contacting the cell with a serine/threonine kinase inhibitor. The cell may reside in culture or in situ, i.e. within the natural host. Preferred inhibitors are orally active in mammalian hosts. For diagnostic uses, the inhibitors or other IKK-.beta. binding agents are frequently labeled, such as with fluorescent, radioactive, chemiluminescent, or other easily detectable molecules, either conjugated directly to the binding agent or conjugated to a probe specific for the binding agent.
The amino acid sequences of the disclosed IKK-.beta. polypeptides are used to back-translate IKK-.beta. polypeptide-encoding nucleic acids optimized for selected expression systems (Holler et al. (1993) Gene 136, 323-328; Martin et al. (1995) Gene 154, 150-166) or used to generate degenerate oligonucleotide primers and probes for use in the isolation of natural IKK-.beta.-encoding nucleic acid sequences ("GCG" software, Genetics Computer Group, Inc, Madison Wis.). IKK-.beta.-encoding nucleic acids used in IKK-.beta.-expression vectors and incorporated into recombinant host cells, e.g. for expression and screening, transgenic animals, e.g. for functional studies such as the efficacy of candidate drugs for disease associated with IKK-.beta.-modulated cell function, etc.
The invention also provides nucleic acid hybridization probes and replication/amplification primers having a IKK-.beta. cDNA specific sequence contained in SEQ ID NO: 1 and sufficient to effect specific hybridization thereto (i.e. specifically hybridize with SEQ ID NO: 1 in the presence of IKK-.alpha. cDNA, SEQ ID NO: 3). Such primers or probes are at least 12, preferably at least 24, more preferably at least 36 and most preferably at least 96 bases in length. Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formamide in 5.times.SSPE (0.18M NaCl, 0.01M NaPO.sub.4, pH7.7, 0.001M EDTA) buffer at a temperature of 42.degree. C. and remaining bound when subject to washing at 42.degree. C. with 0.2.times.SSPE; preferably hybridizing in a buffer comprising 50% formamide in 5.times.SSPE buffer at a temperature of 42.degree. C. and remaining bound when subject to washing at 42.degree. C. with 0.2.times.SSPE buffer at 42.degree. C. IKK-.beta. nucleic acids can also be distinguished using alignment algorithms, such as BLASTX (Altschul et al. (1990) Basic Local Alignment Search Tool, J Mol Biol 215, 403-410).
The subject nucleic acids are of synthetic/non-natural sequences and/or are isolated, i.e. unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, preferably at least about 5% by weight of total nucleic acid present in a given fraction, and usually recombinant, meaning they comprise a non-natural sequence or a natural sequence joined to nucleotide(s) other than that which it is joined to on a natural chromosome. Recombinant nucleic acids comprising the nucleotide sequence of SEQ ID NO: 1 or fragments thereof, contain such sequence or fragment at a terminus, immediately flanked by a sequence other than that which it is joined to on a natural chromosome, or flanked by a native flanking region fewer than 10 kb, preferably fewer than 2 kb, which is at a terminus or is immediately flanked by a sequence other than that which it is joined to on a natural chromosome. While the nucleic acids are usually RNA or DNA, it is often advantageous to use nucleic acids comprising other bases or nucleotide analogs to provide modified stability, etc.
The subject nucleic acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, etc.; use in detecting the presence of IKK-.beta. genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional IKK-.beta. homologs and structural analogs. In diagnosis, IKK-.beta. hybridization probes find use in identifying wild-type and mutant IKK-.beta. alleles in clinical and laboratory samples. Mutant alleles are used to generate allele-specific oligonucleotide (ASO) probes for high-throughput clinical diagnoses. In therapy, therapeutic IKK-.beta. nucleic acids are used to modulate cellular expression or intracellular concentration or availability of active IKK-.beta..
The invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of a IKK-.beta. modulatable cellular function. Generally, these screening methods involve assaying for compounds which modulate IKK-.beta. interaction with a natural IKK-.beta. binding target, in particular, IKK-.beta. phosphorylation of I.kappa.B-derived substrates, particularly I.kappa.B and NIK substrates. A wide variety of assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc. The methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. Identified reagents find use in the pharmaceutical industries for animal and human trials; for example, the reagents may be derivatized and rescreened in in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.
In vitro binding assays employ a mixture of components including an IKK-.beta. polypeptide, which may be part of a fusion product with another peptide or polypeptide, e.g. a tag for detection or anchoring, etc. The assay mixtures comprise a natural intracellular IKK-.beta. binding target. In a particular embodiment, the binding target is a substrate comprising I.kappa.B serines 32 and/or 36. Such substrates comprise a I.kappa.B.alpha., .beta. or .epsilon. peptide including the serine 32 and/or 36 residue and at least 5, preferably at least 10, and more preferably at least 20 naturally occurring immediately flanking residues on each side (e.g. for serine 36 peptides, residues 26-46, 22-42, or 12-32 or 151-171 for I.kappa.B.alpha., .beta. or .epsilon. -derived substrates, respectively). While native full-length binding targets may be used, it is frequently preferred to use portions (e.g. peptides) thereof so long as the portion provides binding affinity and avidity to the subject IKK-.beta. polypeptide conveniently measurable in the assay. The assay mixture also comprises a candidate pharmacological agent. Candidate agents encompass numerous chemical classes, though typically they are organic compounds; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds. A variety of other reagents may also be included in the mixture. These include reagents like ATP or ATP analogs (for kinase assays), salts, buffers, neutral proteins, e.g. albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used.
The resultant mixture is incubated under conditions whereby, but for the presence of the candidate pharmacological agent, the IKK-.beta. polypeptide specifically binds the cellular binding target, portion or analog with a reference binding affinity. The mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding. Incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid, high-throughput screening.
After incubation, the agent-biased binding between the IKK-.beta. polypeptide and one or more binding targets is detected by any convenient way. For IKK-.beta. kinase assays, `binding` is generally detected by a change in the phosphorylation of a IKK-.beta. substrate. In this embodiment, kinase activity may quantified by the transfer to the substrate of a labeled phosphate, where the label may provide for direct detection as radioactivity, luminescence, optical or electron density, etc. or indirect detection such as an epitope tag, etc. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiative emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, etc.
A difference in the binding affinity of the IKK-.beta. polypeptide to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the IKK-.beta. polypeptide to the IKK-.beta. binding target. Analogously, in the cell-based assay also described below, a difference in IKK-.beta.-dependent transcriptional activation in the presence and absence of an agent indicates the agent modulates IKK-.beta. function. A difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.
The following experimental section and examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
Identification of IKK-.beta.
To investigate the mechanism of NIK-mediated NF-.kappa.B activation, we initially identified proteins that associate directly with NIK by yeast two-hybrid protein interaction cloning (Fields and Song, 1989). An expression vector was generated that encodes NIK fused to the DNA-binding domain of the yeast transcription factor GAL4. This vector was used as bait in a two-hybrid screen of a human B cell cDNA library. From approximately six million transformants, eight positive clones were obtained, as determined by activation of his and lacZ reporter genes. Of these clones, three encoded a member of the TRAF family, TRAF3 (Hu et al., 1994; Cheng et al., 1995; Mosialos et al., 1995; Sato et al., 1995) and one encoded a novel protein we call IKK-.alpha.. Retransformation into yeast cells verified the interaction between NIK and IKK-.alpha.. A full-length human IKK-.alpha. clone was isolated by screening a Jurkat cDNA library with a probe generated from the 5'-end of the IKK-.alpha. two-hybrid clone. IKK-.alpha. comprises an N-terminal serine-threonine kinase catalytic domain, a C-terminal helix-loop-helix domain and a leucine zipper-like amphipathic .alpha.-helix juxtaposed in between the helix-loop-helix and kinase domain.
To identify potential IKK-.alpha.-related genes, we searched a public database of human expressed sequence tags (ESTs). We identified two ESTs (W68756 and AA128064), which we determined were capable of encoding distinct peptides with sequence similarity with IKK-.alpha.. IKK-.alpha.-related cDNA was cloned by probing a Jurkat cDNA library (human T cell) with an oligonucleotide probe corresponding to sequence from one of the ESTs. Sequence analysis demonstrated that the two ESTs included different fragments of the same gene. The longest cDNA clones obtained had a .about.3.2 kb insert (SEQ ID NO: 1) and an open reading frame of 756 amino acids (SEQ ID NO: 2). We have designed the protein encoded by this cDNA as IKK-.beta..
Interaction of IKK-.beta. and NIK in Human Cells
The interaction of IKK-.beta. with NIK was confirmed in mammalian cell coimmunoprecipitation assays. Human IKK-.beta. containing an C-terminal Flag epitope tag was transiently coexpressed in 293 human embryonic kidney cells with Myc epitope-tagged NIK. Cell lysates were immunoprecipitated using a monoclonal antibody against the Flag epitope, and coprecipitating NIK was detected by immunoblot analysis with an anti-Myc monoclonal antibody. In this assay, IKK-.beta. was able to coprecipitate NIK confirming the interaction between both proteins as detected for IKK-.alpha. by yeast two-hybrid analysis. Also, a deletion mutant IKK-.beta. protein lacking most of the N-terminal kinase domain (IKK-.beta..sub.(.DELTA.5-203, i.e. 1-4 & 204-756)) was able to associate with NIK, indicating that the .alpha.-helical C-terminal half of IKK-.beta. mediates the interaction with NIK.
Effect of IKK-.beta. and IKK-.beta. Mutants on NF-.kappa.B Activation
To investigate a possible role for IKK-.beta. in NF-.kappa.B activation, we examined if transient overexpression of IKK-.beta. might activate an NF-.kappa.B-dependent reporter gene. An E-selectin-luciferase reporter construct (Schindler and Baichwal, 1994) and a IKK-.beta. expression vector were cotransfected into HeLa cells. IKK-.beta. expression activated the reporter gene in a dose-dependent manner, with a maximal induction of luciferase activity of about 20-fold compared to vector control. Similar results were obtained in 293 cells, where IKK-.beta. overexpression induced reporter gene activity approximately 20-fold. Thus, IKK-.beta. induces NF-.kappa.B activation when overexpressed.
We next determined the effect of overexpression of kinase-inactive IKK-.beta..sub.(.DELTA.5-203) that still associates with NIK on signal-induced NF-.kappa.B activation in reporter gene assays in 293 cells. Overexpression of IKK-.beta..sub.(.DELTA.5-203) blocked TNF- and IL-1-induced reporter gene activation similar to overexpression of NIK.sub.(624-947). IKK-.beta..sub.(.DELTA.5-203) was also found to inhibited NF-.kappa.B-dependent reporter gene activity elicited by overexpression of TRAF2, TRAF6 and NIK. Taken together these results demonstrate that a catalytically inactive IKK-.beta. mutant is a dominant-negative inhibitor of TNF-, IL-1, TRAF- and NIK-induced NF-.kappa.B activation. This indicates that IKK-.beta. functions as a common mediator of NF-.kappa.B activation by TNF and IL-1 downstream of NIK.
Parenthetical References
Ansieau, S., et al. (1996). Proc. Natl. Acad. Sci. USA 93, 14053-14058.
Baeuerle, P. A., and Henkel, T. (1994). Annu. Rev. Immunol. 12, 141-179.
Beg, A. A., et al. (1993). Mol. Cell. Biol. 13, 3301-3310.
Cao, Z., Henzel, W. J., and Gao, X. (1996a). Science 271, 1128-1131.
Cao, Z., et al. (1996b).. Nature 383, 443-446.
Chen, Z., et al.. (1995). Genes Dev. 9, 1586-1597.
Cheng, G., et al. (1995). Science 267, 1494-1498.
Connelly, M. A., and Marcu, K. B. (1995). Cell. Mol. Biol. Res. 41, 537-549.
Dinarello, C. A. (1996). Biologic basis for interleukin-1 in disease. Blood 87, 2095-2147.
Fields, S., and Song, O.-k. (1989). Nature 340, 245-246.
Finco, T. S., and Baldwin, A. S. (1995). Immunity 3, 263-272.
Gedrich, R. W., et al. (1996). J. Biol. Chem. 271, 12852-12858.
Hill, C. S., and Treisman, R. (1995). Cell 80, 199-211.
Hsu, H., Shu, H.-B., Pan, M.-P., and Goeddel, D. V. (1996). Cell 84, 299-308.
Hu, H. M., et al. (1994). J. Biol. Chem. 269, 30069-30072.
Lee, S. Y., et al. (1996). Proc. Natl. Acad. Sci. USA 93, 9699-9703.
Lenardo, M., and Baltimore, D. (1989). Cell 58, 227-229.
Malinin, N. L., et al.. (1997). Nature 385, 540-544.
Mock et al. (1995). Genomics 27, 348-351.
Mosialos, G., et al. (1995). Cell 80, 389-399.
Nakano, H., et al. (1996). J. Biol. Chem. 271, 14661-14664.
Osborn, L., Kunkel, S., and Nabel, G. J. (1989). Proc. Natl. Acad. Sci. USA 86, 2336-2340.
Rothe, M., Sarma, V., Dixit, V. M., and Goeddel, D. V. (1995). Science 269, 1424-1427.
Rothe, M., Wong, S. C., Henzel, W. J., and Goeddel, D. V. (1994). Cell 78, 681-692.
Sato, T., Irie, S., and Reed, J. C. (1995). FEBS Lett. 358, 113-118.
Schindler, U., and Baichwal, V. R. (1994). Mol. Cell. Biol. 14,5820-5831.
Smith, C. A., Farrah, T., and Goodwin, R. G. (1994). Cell 76, 959-962.
Song, H. Y., and Donner, D. B. (1995). Biochem. J. 809, 825-829.
Thanos, D., and Maniatis, T. (1995). Cell 80, 529-532.
Verma, I. M., et al. (1995). Genes Dev. 9, 2723-2735.

EXAMPLES
1. Protocol for at IKK-.beta.-I.kappa.B.alpha. phosphorylation assay.
A. Reagents:
Neutralite Avidin: 20 .mu.g/ml in PBS.
kinase: 10.sup.-8 -10.sup.-5 M IKK-.beta. (SEQ ID NO: 2) at 20 .mu.g/ml in PBS.
substrate: 10.sup.-7 -10.sup.-4 M biotinylated substrate (21 residue peptide consisting of residues 26-46 of human I.kappa.B.alpha.) at 40 .mu.g/ml in PBS.
Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
Assay Buffer: 100 mM KCl, 10 mM MgCl.sub.2, 1 mM MnCl.sub.2, 20 mM HEPES pH 7.4, 0.25 mM EDTA, 1% glycerol, 0.5% NP-40, 50 mM BME, 1 mg/ml BSA, cocktail of protease inhibitors.
�.sup.32 P!.gamma.-ATP 10x stock: 2.times.10.sup.-5 M cold ATP with 100 .mu.Ci �.sup.32 P!.gamma.-ATP. Place in the 4.degree. C. microfridge during screening.
Protease inhibitor cocktail (1000.times.): 10 mg Trypsin Inhibitor (BMB # 109894), 10 mg Aprotinin (BMB # 236624), 25 mg Benzamidine (Sigma # B-6506), 25 mg Leupeptin (BMB # 1017128), 10 mg APMSF (BMB # 917575), and 2 mM NaVo.sub.3 (Sigma # S-6508) in 10 ml of PBS.
B. Preparation of assay plates:
Coat with 120 .mu.l of stock N Avidin per well overnight at 4.degree. C.
Wash 2 times with 200 .mu.l PBS.
Block with 150 .mu.l of blocking buffer.
Wash 2 times with 200 .mu.l PBS.
C. Assay:
Add 40 .mu.l assay buffer/well.
Add 40 .mu.l biotinylated substrate (2-200 pmoles/40 ul in assay buffer)
Add 40 .mu.l kinase (0.1-10 pmoles/40 ul in assay buffer)
Add 10 .mu.l compound or extract.
Add 10 .mu.l �.sup.32 P!.gamma.-ATP 10x stock.
Shake at 25.degree. C. for 15 minutes.
Incubate additional 45 minutes at 25.degree. C.
Stop the reaction by washing 4 times with 200 .mu.l PBS.
Add 150 .mu.l scintillation cocktail.
Count in Topcount.
D. Controls for all assays (located on each plate):
a. Non-specific binding
b. cold ATP at 80% inhibition.
2. Protocol for high throughput IKK-.beta.-NIK binding assay.
A. Reagents:
Neutralite Avidin: 20 .mu.g/ml in PBS.
Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.
Assay Buffer: 100 mM KCl, 20 mM HEPES pH 7.6, 1 mM MgCl.sub.2, 1% glycerol, 0.5% NP-40, 50 mM .beta.-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors.
.sup.33 P IKK-.beta. polypeptide 10x stock: 10.sup.-8 -10.sup.-6 M "cold" IKK-.beta. supplemented with 200,000-250,000 cpm of labeled IKK-.beta. (Beckman counter). Place in the 4.degree. C. microfridge during screening.
Protease inhibitor cocktail (1000X): 10 mg Trypsin Inhibitor (BMB # 109894), 10 mg Aprotinin (BMB # 236624), 25 mg Benzamidine (Sigma # B-6506), 25 mg Leupeptin (BMB # 1017128), 10 mg APMSF (BMB # 917575), and 2 mM NaVO.sub.3 (Sigma # S-6508) in 10 ml of PBS.
NIK: 10.sup.-7 -10.sup.-5 M biotinylated NIK in PBS.
B. Preparation of assay plates:
Coat with 120 .mu.l of stock N-Avidin per well overnight at 4.degree. C.
Wash 2 times with 200 .mu.l PBS.
Block with 150 .mu.l of blocking buffer.
Wash 2 times with 200 .mu.l PBS.
C. Assay:
Add 40 .mu.l assay buffer/well.
Add 10 .mu.l compound or extract.
Add 10 .mu.l .sup.33 P-IKK-.beta. (20-25,000 cpm/0.1-10 pmoles/well=10.sup.-9 -10.sup.-7 M final conc).
Shake at 25.degree. C. for 15 minutes.
Incubate additional 45 minutes at 25.degree. C.
Add 40 .mu.M biotinylated NIK (0.1-10 pmoles/40 ul in assay buffer)
Incubate 1 hour at room temperature.
Stop the reaction by washing 4 times with 200 .mu.M PBS.
Add 150 .mu.M scintillation cocktail.
Count in Topcount.
D. Controls for all assays (located on each plate):
a. Non-specific binding
b. Soluble (non-biotinylated NIK) at 80% inhibition.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 4(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2268 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:ATGAGCTGGTCACCTTCCCTGACAACGCAGACATGTGGGGCCTGGGAAATGAAAGAGCGC60CTTGGGACAGGGGGATTTGGAAATGTCATCCGATGGCACAATCAGGAAACAGGTGAGCAG120ATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGCCCCCGGAACCGAGAGCGGTGGTGCCTG180GAGATCCAGATCATGAGAAGGCTGACCCACCCCAATGTGGTGGCTGCCCGAGATGTCCCT240GAGGGGATGCAGAACTTGGCGCCCAATGACCTGCCCCTGCTGGCCATGGAGTACTGCCAA300GGAGGAGATCTCCGGAAGTACCTGAACCAGTTTGAGAACTGCTGTGGTCTGCGGGAAGGT360GCCATCCTCACCTTGCTGAGTGACATTGCCTCTGCGCTTAGATACCTTCATGAAAACAGA420ATCATCCATCGGGATCTAAAGCCAGAAAACATCGTCCTGCAGCAAGGAGAACAGAGGTTA480ATACACAAAATTATTGACCTAGGATATGCCAAGGAGCTGGATCAGGGCAGTCTTTGCACA540TCATTCGTGGGGACCCTGCAGTACCTGGCCCCAGAGCTACTGGAGCAGCAGAAGTACACA600GTGACCGTCGACTACTGGAGCTTCGGCACCCTGGCCTTTGAGTGCATCACGGGCTTCCGG660CCCTTCCTCCCCAACTGGCAGCCCGTGCAGTGGCATTCAAAAGTGCGGCAGAAGAGTGAG720GTGGACATTGTTGTTAGCGAAGACTTGAATGGAACGGTGAAGTTTTCAAGCTCTTTACCC780TACCCCAATAATCTTAACAGTGTCCTGGCTGAGCGACTGGAGAAGTGGCTGCAACTGATG840CTGATGTGGCACCCCCGACAGAGGGGCACGGATCCCACGTATGGGCCCAATGGCTGCTTC900AAGGCCCTGGATGACATCTTAAACTTAAAGCTGGTTCATATCTTGAACATGGTCACGGGC960ACCATCCACACCTACCCTGTGACAGAGGATGAGAGTCTGCAGAGCTTGAAGGCCAGAATC1020CAACAGGACACGGGCATCCCAGAGGAGGACCAGGAGCTGCTGCAGGAAGCGGGCCTGGCG1080TTGATCCCCGATAAGCCTGCCACTCAGTGTATTTCAGACGGCAAGTTAAATGAGGGCCAC1140ACATTGGACATGGATCTTGTTTTTCTCTTTGACAACAGTAAAATCACCTATGAGACTCAG1200ATCTCCCCACGGCCCCAACCTGAAAGTGTCAGCTGTATCCTTCAAGAGCCCAAGAGGAAT1260CTCGCCTTCTTCCAGCTGAGGAAGGTGTGGGGCCAGGTCTGGCACAGCATCCAGACCCTG1320AAGGAAGATTGCAACCGGCTGCAGCAGGGACAGCGAGCCGCCATGATGAATCTCCTCCGA1380AACAACAGCTGCCTCTCCAAAATGAAGAATTCCATGGCTTCCATGTCTCAGCAGCTCAAG1440GCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATTGACCTGGAGAAGTACAGCGAGCAA1500ACCGAGTTTGGGATCACATCAGATAAACTGCTGCTGGCCTGGAGGGAAATGGAGCAGGCT1560GTGGAGCTCTGTGGGCGGGAGAACGAAGTGAAACTCCTGGTAGAACGGATGATGGCTCTG1620CAGACCGACATTGTGGACTTACAGAGGAGCCCCATGGGCCGGAAGCAGGGGGGAACGCTG1680GACGACCTAGAGGAGCAAGCAAGGGAGCTGTACAGGAGACTAAGGGAAAAACCTCGAGAC1740CAGCGAACTGAGGGTGACAGTCAGGAAATGGTACGGCTGCTGCTTCAGGCAATTCAGAGC1800TTCGAGAAGAAAGTGCGAGTGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAG1860AAGGCGCTGGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGATGAG1920AAGACTGTTGTCCGGCTGCAGGAGAAGCGGCAGAAGGAGCTCTGGAATCTCCTGAAGATT1980GCTTGTAGCAAGGTCCGTGGTCCTGTCAGTGGAAGCCCGGATAGCATGAATGCCTCTCGA2040CTTAGCCAGCCTGGGCAGCTGATGTCTCAGCCCTCCACGGCCTCCAACAGCTTACCTGAG2100CCAGCCAAGAAGAGTGAAGAACTGGTGGCTGAAGCACATAACCTCTGCACCCTGCTAGAA2160AATGCCATACAGGACACTGTGAGGGAACAAGACCAGAGTTTCACGGCCCTAGACTGGAGC2220TGGTTACAGACGGAAGAAGAAGAGCACAGCTGCCTGGAGCAGGCCTCA2268(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 756 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetSerTrpSerProSerLeuThrThrGlnThrCysGlyAlaTrpGlu151015MetLysGluArgLeuGlyThrGlyGlyPheGlyAsnValIleArgTrp202530HisAsnGlnGluThrGlyGluGlnIleAlaIleLysGlnCysArgGln354045GluLeuSerProArgAsnArgGluArgTrpCysLeuGluIleGlnIle505560MetArgArgLeuThrHisProAsnValValAlaAlaArgAspValPro65707580GluGlyMetGlnAsnLeuAlaProAsnAspLeuProLeuLeuAlaMet859095GluTyrCysGlnGlyGlyAspLeuArgLysTyrLeuAsnGlnPheGlu100105110AsnCysCysGlyLeuArgGluGlyAlaIleLeuThrLeuLeuSerAsp115120125IleAlaSerAlaLeuArgTyrLeuHisGluAsnArgIleIleHisArg130135140AspLeuLysProGluAsnIleValLeuGlnGlnGlyGluGlnArgLeu145150155160IleHisLysIleIleAspLeuGlyTyrAlaLysGluLeuAspGlnGly165170175SerLeuCysThrSerPheValGlyThrLeuGlnTyrLeuAlaProGlu180185190LeuLeuGluGlnGlnLysTyrThrValThrValAspTyrTrpSerPhe195200205GlyThrLeuAlaPheGluCysIleThrGlyPheArgProPheLeuPro210215220AsnTrpGlnProValGlnTrpHisSerLysValArgGlnLysSerGlu225230235240ValAspIleValValSerGluAspLeuAsnGlyThrValLysPheSer245250255SerSerLeuProTyrProAsnAsnLeuAsnSerValLeuAlaGluArg260265270LeuGluLysTrpLeuGlnLeuMetLeuMetTrpHisProArgGlnArg275280285GlyThrAspProThrTyrGlyProAsnGlyCysPheLysAlaLeuAsp290295300AspIleLeuAsnLeuLysLeuValHisIleLeuAsnMetValThrGly305310315320ThrIleHisThrTyrProValThrGluAspGluSerLeuGlnSerLeu325330335LysAlaArgIleGlnGlnAspThrGlyIleProGluGluAspGlnGlu340345350LeuLeuGlnGluAlaGlyLeuAlaLeuIleProAspLysProAlaThr355360365GlnCysIleSerAspGlyLysLeuAsnGluGlyHisThrLeuAspMet370375380AspLeuValPheLeuPheAspAsnSerLysIleThrTyrGluThrGln385390395400IleSerProArgProGlnProGluSerValSerCysIleLeuGlnGlu405410415ProLysArgAsnLeuAlaPhePheGlnLeuArgLysValTrpGlyGln420425430ValTrpHisSerIleGlnThrLeuLysGluAspCysAsnArgLeuGln435440445GlnGlyGlnArgAlaAlaMetMetAsnLeuLeuArgAsnAsnSerCys450455460LeuSerLysMetLysAsnSerMetAlaSerMetSerGlnGlnLeuLys465470475480AlaLysLeuAspPhePheLysThrSerIleGlnIleAspLeuGluLys485490495TyrSerGluGlnThrGluPheGlyIleThrSerAspLysLeuLeuLeu500505510AlaTrpArgGluMetGluGlnAlaValGluLeuCysGlyArgGluAsn515520525GluValLysLeuLeuValGluArgMetMetAlaLeuGlnThrAspIle530535540ValAspLeuGlnArgSerProMetGlyArgLysGlnGlyGlyThrLeu545550555560AspAspLeuGluGluGlnAlaArgGluLeuTyrArgArgLeuArgGlu565570575LysProArgAspGlnArgThrGluGlyAspSerGlnGluMetValArg580585590LeuLeuLeuGlnAlaIleGlnSerPheGluLysLysValArgValIle595600605TyrThrGlnLeuSerLysThrValValCysLysGlnLysAlaLeuGlu610615620LeuLeuProLysValGluGluValValSerLeuMetAsnGluAspGlu625630635640LysThrValValArgLeuGlnGluLysArgGlnLysGluLeuTrpAsn645650655LeuLeuLysIleAlaCysSerLysValArgGlyProValSerGlySer660665670ProAspSerMetAsnAlaSerArgLeuSerGlnProGlyGlnLeuMet675680685SerGlnProSerThrAlaSerAsnSerLeuProGluProAlaLysLys690695700SerGluGluLeuValAlaGluAlaHisAsnLeuCysThrLeuLeuGlu705710715720AsnAlaIleGlnAspThrValArgGluGlnAspGlnSerPheThrAla725730735LeuAspTrpSerTrpLeuGlnThrGluGluGluGluHisSerCysLeu740745750GluGlnAlaSer755(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2238 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:ATGGAGCGGCCCCCGGGGCTGCGGCCGGGCGCGGGCGGGCCCTGGGAGATGCGGGAGCGG60CTGGGCACCGGCGGCTTCGGGAACGTCTGTCTGTACCAGCATCGGGAACTTGATCTCAAA120ATAGCAATTAAGTCTTGTCGCCTAGAGCTAAGTACCAAAAACAGAGAACGATGGTGCCAT180GAAATCCAGATTATGAAGAAGTTGAACCATGCCAATGTTGTAAAGGCCTGTGATGTTCCT240GAAGAATTGAATATTTTGATTCATGATGTGCCTCTTCTAGCAATGGAATACTGTTCTGGA300GGAGATCTCCGAAAGCTGCTCAACAAACCAGAAAATTGTTGTGGACTTAAAGAAAGCCAG360ATACTTTCTTTACTAAGTGATATAGGGTCTGGGATTCGATATTTGCATGAAAACAAAATT420ATACATCGAGATCTAAAACCTGAAAACATAGTTCTTCAGGATGTTGGTGGAAAGATAATA480CATAAAATAATTGATCTGGGATATGCCAAAGATGTTGATCAAGGAAGTCTGTGTACATCT540TTTGTGGGAACACTGCAGTATCTGGCCCCAGAGCTCTTTGAGAATAAGCCTTACACAGCC600ACTGTTGATTATTGGAGCTTTGGGACCATGGTATTTGAATGTATTGCTGGATATAGGCCT660TTTTTGCATCATCTGCAGCCATTTACCTGGCATGAGAAGATTAAGAAGAAGGATCCAAAG720TGTATATTTGCATGTGAAGAGATGTCAGGAGAAGTTCGGTTTAGTAGCCATTTACCTCAA780CCAAATAGCCTTTGTAGTTTAATAGTAGAACCCATGGAAAACTGGCTACAGTTGATGTTG840AATTGGGACCCTCAGCAGAGAGGAGGACCTGTTGACCTTACTTTGAAGCAGCCAAGATGT900TTTGTATTAATGGATCACATTTTGAATTTGAAGATAGTACACATCCTAAATATGACTTCT960GCAAAGATAATTTCTTTTCTGTTACCACCTGATGAAAGTCTTCATTCACTACAGTCTCGT1020ATTGAGCGTGAAACTGGAATAAATACTGGTTCTCAAGAACTTCTTTCAGAGACAGGAATT1080TCTCTGGATCCTCGGAAACCAGCCTCTCAATGTGTTCTAGATGGAGTTAGAGGCTGTGAT1140AGCTATATGGTTTATTTGTTTGATAAAAGTAAAACTGTATATGAAGGGCCATTTGCTTCC1200AGAAGTTTATCTGATTGTGTAAATTATATTGTACAGGACAGCAAAATACAGCTTCCAATT1260ATACAGCTGCGTAAAGTGTGGGCTGAAGCAGTGCACTATGTGTCTGGACTAAAAGAAGAC1320TATAGCAGGCTCTTTCAGGGACAAAGGGCAGCAATGTTAAGTCTTCTTAGATATAATGCT1380AACTTAACAAAAATGAAGAACACTTTGATCTCAGCATCACAACAACTGAAAGCTAAATTG1440GAGTTTTTTCACAAAAGCATTCAGCTTGACTTGGAGAGATACAGCGAGCAGATGACGTAT1500GGGATATCTTCAGAAAAAATGCTAAAAGCATGGAAAGAAATGGAAGAAAAGGCCATCCAC1560TATGCTGAGGTTGGTGTCATTGGATACCTGGAGGATCAGATTATGTCTTTGCATGCTGAA1620ATCATGGAGCTACAGAAGAGCCCCTATGGAAGACGTCAGGGAGACTTGATGGAATCTCTG1680GAACAGCGTGCCATTGATCTATATAAGCAGTTAAAACACAGACCTTCAGATCACTCCTAC1740AGTGACAGCACAGAGATGGTGAAAATCATTGTGCACACTGTGCAGAGTCAGGACCGTGTG1800CTCAAGGAGCTGTTTGGTCATTTGAGCAAGTTGTTGGGCTGTAAGCAGAAGATTATTGAT1860CTACTCCCTAAGGTGGAAGTGGCCCTCAGTAATATCAAAGAAGCTGACAATACTGTCATG1920TTCATGCAGGGAAAAAGGCAGAAAGAAATATGGCATCTCCTTAAAATTGCCTGTACACAG1980AGTTCTGCCCGGTCCCTTGTAGGATCCAGTCTAGAAGGTGCAGTAACCCCTCAGACATCA2040GCATGGCTGCCCCCGACTTCAGCAGAACATGATCATTCTCTGTCATGTGTGGTAACTCCT2100CAAGATGGGGAGACTTCAGCACAAATGATAGAAGAAAATTTGAACTGCCTTGGCCATTTA2160AGCACTATTATTCATGAGGCAAATGAGGAACAGGGCAATAGTATGATGAATCTTGATTGG2220AGTTGGTTAACAGAATGA2238(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 745 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetGluArgProProGlyLeuArgProGlyAlaGlyGlyProTrpGlu151015MetArgGluArgLeuGlyThrGlyGlyPheGlyAsnValCysLeuTyr202530GlnHisArgGluLeuAspLeuLysIleAlaIleLysSerCysArgLeu354045GluLeuSerThrLysAsnArgGluArgTrpCysHisGluIleGlnIle505560MetLysLysLeuAsnHisAlaAsnValValLysAlaCysAspValPro65707580GluGluLeuAsnIleLeuIleHisAspValProLeuLeuAlaMetGlu859095TyrCysSerGlyGlyAspLeuArgLysLeuLeuAsnLysProGluAsn100105110CysCysGlyLeuLysGluSerGlnIleLeuSerLeuLeuSerAspIle115120125GlySerGlyIleArgTyrLeuHisGluAsnLysIleIleHisArgAsp130135140LeuLysProGluAsnIleValLeuGlnAspValGlyGlyLysIleIle145150155160HisLysIleIleAspLeuGlyTyrAlaLysAspValAspGlnGlySer165170175LeuCysThrSerPheValGlyThrLeuGlnTyrLeuAlaProGluLeu180185190PheGluAsnLysProTyrThrAlaThrValAspTyrTrpSerPheGly195200205ThrMetValPheGluCysIleAlaGlyTyrArgProPheLeuHisHis210215220LeuGlnProPheThrTrpHisGluLysIleLysLysLysAspProLys225230235240CysIlePheAlaCysGluGluMetSerGlyGluValArgPheSerSer245250255HisLeuProGlnProAsnSerLeuCysSerLeuIleValGluProMet260265270GluAsnTrpLeuGlnLeuMetLeuAsnTrpAspProGlnGlnArgGly275280285GlyProValAspLeuThrLeuLysGlnProArgCysPheValLeuMet290295300AspHisIleLeuAsnLeuLysIleValHisIleLeuAsnMetThrSer305310315320AlaLysIleIleSerPheLeuLeuProProAspGluSerLeuHisSer325330335LeuGlnSerArgIleGluArgGluThrGlyIleAsnThrGlySerGln340345350GluLeuLeuSerGluThrGlyIleSerLeuAspProArgLysProAla355360365SerGlnCysValLeuAspGlyValArgGlyCysAspSerTyrMetVal370375380TyrLeuPheAspLysSerLysThrValTyrGluGlyProPheAlaSer385390395400ArgSerLeuSerAspCysValAsnTyrIleValGlnAspSerLysIle405410415GlnLeuProIleIleGlnLeuArgLysValTrpAlaGluAlaValHis420425430TyrValSerGlyLeuLysGluAspTyrSerArgLeuPheGlnGlyGln435440445ArgAlaAlaMetLeuSerLeuLeuArgTyrAsnAlaAsnLeuThrLys450455460MetLysAsnThrLeuIleSerAlaSerGlnGlnLeuLysAlaLysLeu465470475480GluPhePheHisLysSerIleGlnLeuAspLeuGluArgTyrSerGlu485490495GlnMetThrTyrGlyIleSerSerGluLysMetLeuLysAlaTrpLys500505510GluMetGluGluLysAlaIleHisTyrAlaGluValGlyValIleGly515520525TyrLeuGluAspGlnIleMetSerLeuHisAlaGluIleMetGluLeu530535540GlnLysSerProTyrGlyArgArgGlnGlyAspLeuMetGluSerLeu545550555560GluGlnArgAlaIleAspLeuTyrLysGlnLeuLysHisArgProSer565570575AspHisSerTyrSerAspSerThrGluMetValLysIleIleValHis580585590ThrValGlnSerGlnAspArgValLeuLysGluLeuPheGlyHisLeu595600605SerLysLeuLeuGlyCysLysGlnLysIleIleAspLeuLeuProLys610615620ValGluValAlaLeuSerAsnIleLysGluAlaAspAsnThrValMet625630635640PheMetGlnGlyLysArgGlnLysGluIleTrpHisLeuLeuLysIle645650655AlaCysThrGlnSerSerAlaArgSerLeuValGlySerSerLeuGlu660665670GlyAlaValThrProGlnThrSerAlaTrpLeuProProThrSerAla675680685GluHisAspHisSerLeuSerCysValValThrProGlnAspGlyGlu690695700ThrSerAlaGlnMetIleGluGluAsnLeuAsnCysLeuGlyHisLeu705710715720SerThrIleIleHisGluAlaAsnGluGluGlnGlyAsnSerMetMet725730735AsnLeuAspTrpSerTrpLeuThrGlu740745__________________________________________________________________________

IKK-.beta. proteins, nucleic acids and methods

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Parent Case Info

Non-Patent Literature Citations (5)

Continuations (1)

Entry
Koyama et al., Genomics 26:245-253, 1995.
Jung et al., Cancer Res. 57:24-27, 1997.
Kumar et al., Proc. Natl. Acad. Sci. USA 91:6288-6292, 1994.
Schouten et al., EMBO J. 16:3133-3144, 1997.
McElhinny et al., Mol. Cell. Biol. 16:899-906, 1996.