Patent Application
20240076666
The content of the ASCII text file of the sequence listing named “20220211 034044 224W01 ST25” which is 30.4 kb in size was created on Feb. 11, 2022, and electronically submitted via EFS-Web herewith the application is incorporated herein by reference in its entirety.
Type I interferons (IFNs) are cytokines that have potent immunomodulatory effects. For example, IFNs induce anti-viral responses, suppress autoimmune inflammation, and activate cytotoxic lymphocytes. The innate immune system detects pathogens by employing germ-line-encoded pattern-recognition-receptors (PRRs) that sense pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide and nucleic acids.
Many viruses such as Herpes Simplex Virus-1 (HSV-1) are recognized as a PAMP by the cyclic-GMP-AMP synthase (cGAS)—stimulator of interferon genes (STING) PRR-pathway. Downstream of DNA recognition, STING activates TANK Binding Kinase 1 (TBK1) and I-kappa-B kinase c (IKKc) that phosphorylate and activate interferon regulatory factors 3 and 7 (IRF3/7), leading to transcriptional induction and secretion of type I interferon (IFN) cytokines. IFNs bind to the IFN alpha and beta receptor (IFNAR) to induce transcription of anti-viral interferon-stimulated genes (ISGs).
In some embodiments, the present invention is directed to a method of increasing or decreasing the amount of endogenous interferon in a subject, which comprises administering to the subject a MORC3 therapeutic agent or modulating the activity of MRE in the subject. In some embodiments, the MORC3 therapeutic agent is an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), a MORC3 protein, or an ICP0 protein. In some embodiments, the MORC3 therapeutic agent is an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), a MORC3 protein having at least about 90% sequence identity to SEQ ID NO: 1, or an ICP0 protein having at least about 95% sequence identity to SEQ ID NO: 2. In some embodiments, the MORC3 therapeutic agent is an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), a MORC3 protein, or an ICP0 protein. In some embodiments, the MORC3 therapeutic agent is a MORC3 inhibitor. In some embodiments, the MORC3 therapeutic agent is a MORC3 activator. In some embodiments, the MORC3 therapeutic agent stabilizes expression of MORC3. In some embodiments, the MORC3 protein comprises a sequence that has at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the ICP0 protein comprises a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the sequence of the MRE in the subject at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 3. In some embodiments, the subject is in need thereof.
In some embodiments, the present invention is directed to a method of treating an IFN Excess Disorder in a subject, which comprises administering to the subject a MORC3 therapeutic agent. In some embodiments, the interferon disorder is an IFNB1 Disorder. In some embodiments, the present invention is directed to a method of treating an IFN Excess Disorder in a subject, which comprises increasing the amount of MORC3 in the subject. In some embodiments, the subject is in need thereof. In some embodiments, the IFN Excess Disorder is an autoimmune or inflammatory disease. In some embodiments, the IFN Excess Disorder is rheumatoid arthritis, psoriasis, vitiligo, hypothyroidism, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, myasthenia gravis, Addison disease, celiac disease, polymyositis, or superimposed autoimmune hepatitis. In some embodiments, the autoimmune or inflammatory disease is multiple sclerosis. In some embodiments, the multiple sclerosis is primary progressive multiple sclerosis or relapsing-remitting multiple sclerosis. In some embodiments, the IFN Excess Disorder is an IFNB1 Disorder. In some embodiments, the MORC3 therapeutic agent is a MORC3 protein. In some embodiments, the MORC3 therapeutic agent is a MORC3 activator. In some embodiments, the MORC3 therapeutic agent stabilizes expression of MORC3. In some embodiments, the MORC3 protein comprises a sequence that has at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the method further comprises inhibiting or reducing the activity of MRE in the subject. In some embodiments, the sequence of the MRE in the subject at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 3.
In some embodiments, the present invention is directed to a method of treating IFN Deficiency Disorder in a subject, which comprises administering to the subject a MORC3 therapeutic agent. In some embodiments, the present invention is directed to a method of treating IFN Deficiency Disorder in a subject, which comprises decreasing the amount of MORC3 in the subject. In some embodiments, the IFN Deficiency Disorder is a viral infection. In some embodiments, the viral infection is caused by a herpes virus, a hepatitis virus, or a coronavirus. In some embodiments, the IFN Deficiency Disorder is a cancer. In some embodiments, the cancer is a leukemia, a lymphoma, a melanoma, a sarcoma, or an adenocarcinoma. In some embodiments, the subject is in need thereof. In some embodiments, the IFN Deficiency Disorder is a viral infection such as that caused by a herpes virus, a hepatitis virus, or a coronavirus. In some embodiments, the IFN Deficiency Disorder is a cancer such as a leukemia, a lymphoma, a melanoma, a sarcoma, or an adenocarcinoma. In some embodiments, the cancer is colon cancer. In some embodiments, the IFN Deficiency Disorder is an IFNB1 Disorder. In some embodiments, the MORC3 therapeutic agent is a MORC3 inhibitor such as an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), or an ICP0 protein. In some embodiments, the MORC3 therapeutic agent is a MORC3 inhibitor such as an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), or an ICP0 protein. In some embodiments, the ICP0 protein comprises a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2.
In some embodiments, the present invention is directed to a method of treating an interferon disorder (alternatively referred to herein as a “MORC3-modulated disease” as it is modulated by MORC3) in a subject, which comprises administering to the subject a MORC3 therapeutic agent. In some embodiments, the MORC3 therapeutic agent is an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), a MORC3 protein, or an ICP0 protein. In some embodiments, the method comprises decreasing the amount of endogenous interferon in the subject by administering the MORC3 therapeutic agent, wherein the MORC3 therapeutic agent is a MORC3 activator. In some embodiments, the method comprises decreasing the amount of endogenous interferon in the subject by administering the MORC3 therapeutic agent, which is a MORC3 protein, and/or stabilizes the expression of MORC3. In some embodiments, the method comprises increasing the amount of endogenous interferon in the subject by administering the MORC3 therapeutic agent, wherein the MORC3 therapeutic agent is a MORC3 inhibitor. In some embodiments, the method comprises increasing the amount of endogenous interferon in the subject by administering the MORC3 therapeutic agent, which is an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), and/or an ICP0 protein. In some embodiments, the MORC3 protein comprises a sequence that has at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the ICP0 protein comprises a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the subject is in need thereof.
In some embodiments, the present invention is directed to a method of treating an interferon disorder (alternatively referred to herein as a “MORC3-modulated disease” as it is modulated by MORC3) in a subject, which comprises administering to the subject a MORC3 therapeutic agent. In some embodiments, the MORC3-modulated disease is an autoimmune or inflammatory disease. In some embodiments, the autoimmune or inflammatory disease is multiple sclerosis. In some embodiments, the multiple sclerosis is primary progressive multiple sclerosis or relapsing-remitting multiple sclerosis. In some embodiments, the MORC3-modulated disease is rheumatoid arthritis, psoriasis, vitiligo, hypothyroidism, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, myasthenia gravis, Addison disease, celiac disease, polymyositis, or superimposed autoimmune hepatitis. In some embodiments, the MORC3 therapeutic agent is a MORC3 protein. In some embodiments, the MORC3 protein comprises a sequence that has at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the MORC3 therapeutic agent is a MORC3 activator and/or stabilizes the expression of MORC3. In some embodiments, the subject is in need thereof.
In some embodiments, the present invention is directed to a method of treating an interferon disorder (alternatively referred to herein as a “MORC3-modulated disease” as it is modulated by MORC3) in a subject, which comprises administering to the subject a MORC3 therapeutic agent. In some embodiments, the MORC3-modulated disease is cancer. In some embodiments, the cancer is a leukemia, a lymphoma, a melanoma, a sarcoma, or an adenocarcinoma. In some embodiments, the cancer is colon cancer. In some embodiments, the MORC3-modulated disease is a viral infection. In some embodiments, the viral infection is caused by a herpes virus, a hepatitis virus, or a coronavirus. In some embodiments, the MORC3 therapeutic agent is a MORC3 inhibitor such as an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), or an ICP0 protein. In some embodiments, the ICP0 protein comprises a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the subject is in need thereof.
In some embodiments, the present invention is directed to an assay method for determining whether a candidate compound is a MORC3 inhibitor, which comprises contacting the candidate compound with a monocyte and measuring any interferon response induced thereby in the monocyte. In some embodiments, the assay method further comprises contacting the candidate compound with a genetically modified monocyte that deficient in MORC3 activity, measuring any interferon response induced thereby in the genetically modified monocyte, and comparing the interferon response in the monocyte to the interferon response in the genetically modified cell.
In some embodiments, the present invention is directed to a method of increasing interferon expression by a cell, which comprises (a) the decreasing amount of MORC3 in the cell, (b) increasing MRE activity in the cell, or both (a) and (b). In some embodiments, the MORC3 is decreased by administering an ICP0 protein to the cell or contacting the MORC3 with an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), or inactivating the MORC3 gene in the cell using recombinant techniques, or silencing the MORC3 gene with an siRNA. In some embodiments, the ICP0 protein comprises a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2.
A method of decreasing interferon expression by a cell, which comprises (a) increasing the amount of a MORC3 protein in the cell, (b) reducing MRE activity in the cell, or (c) both (a) and (b). In some embodiments, the amount of MORC3 is increased by administering a MORC3 protein to the cell and/or increasing the expression of a MORC3 protein in the cell using recombinant techniques. In some embodiments, the MORC3 protein comprises a sequence that has at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the MRE activity is reduced by recombinant techniques, e.g., modifying or deleting the MRE sequence in the cell.
In some embodiments, the present invention provides a MORC3 protein for use as a medicament. In some embodiments, the present invention provides a MORC3 protein for use in the treatment of an interferon disorder in a subject. In some embodiments, the interferon disorder is an IFN Deficiency Disorder. In some embodiments, the IFN Deficiency Disorder is a viral infection. In some embodiments, the viral infection is caused by a herpes virus, a hepatitis virus, or a coronavirus. In some embodiments, the IFN Deficiency Disorder is a cancer. In some embodiments, the cancer is a leukemia, a lymphoma, a melanoma, a sarcoma, or an adenocarcinoma. In some embodiments, the IFN Deficiency Disorder is a viral infection such as that caused by a herpes virus, a hepatitis virus, or a coronavirus. In some embodiments, the IFN Deficiency Disorder is a cancer such as a leukemia, a lymphoma, a melanoma, a sarcoma, or an adenocarcinoma. In some embodiments, the cancer is colon cancer. In some embodiments, the MORC3 protein comprises a sequence that has at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 1.
In some embodiments, the present invention provides an ICP0 protein for use as a medicament. In some embodiments, the present invention provides an ICP0 protein for use in the treatment of an interferon disorder in a subject. In some embodiments, the interferon disorder is an IFN Excess Disorder. In some embodiments, the IFN Excess Disorder is rheumatoid arthritis, psoriasis, vitiligo, hypothyroidism, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, myasthenia gravis, Addison disease, celiac disease, polymyositis, or superimposed autoimmune hepatitis. In some embodiments, the autoimmune or inflammatory disease is multiple sclerosis. In some embodiments, the multiple sclerosis is primary progressive multiple sclerosis or relapsing-remitting multiple sclerosis. In some embodiments, the ICP0 protein comprises a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2.
Both the foregoing general description and the following detailed description are exemplary and explanatory only and are intended to provide further explanation of the invention as claimed. The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute part of this specification, illustrate several embodiments of the invention, and together with the description explain the principles of the invention.
This invention is further understood by reference to the drawings wherein:
Described herein is a unique ‘self-guarded’ immune pathway in human monocytes, in which guarding and guarded function are united in one protein, MORC family CW-type zinc finger protein 3 (MORC3). Human MORC3 has Accession No. NP_056173.1 (SEQ ID NO: 1). This self-guarded immune pathway is triggered by a variety external pathogenic factors, e.g., ICP0, which is a key virulence factor of Herpes Simplex Virus-1 (HSV-1). ICP0 (Accession No. YP_009137074.1, SEQ ID NO: 2) results in robust induction of anti-viral type I interferon (IFN). Surprisingly, induction of IFN by ICP0 is independent of canonical immune pathways and the IRF3/7 transcription factors. A CRISPR-screen identified the ICP0 target MORC3 as an important negative regulator of IFN. Loss of MORC3 recapitulates the IRF3/7-independent IFN response induced by ICP0. Mechanistically, ICP0 degrades MORC3, which leads to de-repression of the IFNB1 locus in a genomic location-specific manner to drive the anti-viral IFN response. Besides repressing IFNB1, MORC3 is also a direct restriction factor of HSV-1. The results herein suggest a model in which the primary anti-viral function of MORC3 is ‘self-guarded’ by its secondary IFN-repressing function: thus, a virus that degrades MORC3 to avoid its primary anti-viral function will unleash the secondary anti-viral IFN response. Thus, a self-guarded bi-functional pathways such as the MORC3 pathway might be a central feature of animal immunity.
To study the innate immune response to herpes viruses, human BLaER1 monocytes were infected with HSV-1. Surprisingly, the induction of IFN as measured by transcription of IFNB1 and the ISGs RSAD2 and CXCL10 was not solely dependent on the STING pathway of viral DNA recognition (
These results suggest that an additional PRR-independent innate immune pathway detects HSV-1 infection in human monocytes. The possibility that the immune system is activated by a viral virulence factor was considered. A key virulence factor of HSV-1 is the SUMO-directed E3 ubiquitin ligase ICP0, which facilitates lytic replication by recognizing sumoylated ND10 nuclear body proteins, targeting them for proteasomal degradation. ICP0 was necessary for induction of PRR-independent IFN in BLaER1 monocytes (
Next, ICP0 was ectopically expressed in human monocytes utilizing a doxycycline-inducible lentiviral system. Mirroring HSV-1 infection, ICP0 expression led to an IFN response that was independent of the PRR-signaling hubs TBK1/IKKε, IRF3/7 and IKKα/β (
To evaluate the global transcriptional consequences of sensing ICP0 and E4ORF3 by the innate immune system, RNAseq was performed. Principal component analysis identified interferon-stimulated genes (ISGs) comprising PC1 (
ICP0 displays SUMO-targeted ubiquitin ligase-like activity that marks sumoylated substrates for proteasomal degradation. Thus, its primary function is to degrade or inactivate host proteins. The hypothesis that ICP0 targets a negative regulator of IFN for degradation (
MORC3 is a member of the MORC-gene family of GHKL (gyrase, Hsp90, histidine kinase, MutL)-type ATPases that are transcriptional repressors. MORC3 has been proposed to bind H3K4me3 at promoters and participate in SUMO2-mediated transcriptional repression. It co-localizes with ND10 nuclear bodies and is required for p53 activation and senescence induction in response to genotoxic stress. In mice, MORC3 is embryonically lethal and partial loss of MORC3 impairs senescence in osteoclasts and induces their longevity, driving osteoporosis and related immune pathology. Localization of MORC3 to anti-viral ND10 nuclear bodies suggests a role for MORC3 during viral infection. Whereas one report observed enhanced viral replication in MORC3 knockdown cells (implying an anti-viral function of MORC3), other studies reported diminished viral replication in MORC3 knockdown cells and increased viral replication upon MORC3 overexpression (implying a pro-viral function of MORC3). The data herein suggest that MORC3 has two functions: (1) a primary function to directly repress viral replication; and (2) a secondary function to repress IFN/ISG induction. The primary function of MORC3 is apparent in cells that do not induce IFN upon MORC3 loss, such as HCT116 cells (
To investigate how MORC3 represses IFN/ISGs RNAseq of MORC3−/− versus MORC3−/−IFNAR1−/−IFNAR2−/− monocytes was performed. It was found that the majority of transcriptional changes incurred by MORC3 deficiency were due to IFNAR signaling. ISGs that were induced in MORC3−/− cells were not upregulated upon IFNAR co-deletion (
In murine embryonic stem cells, MORC3 participates in repression of endogenous retroviruses (ERVs). However, only a minimal de-repression of ERVs in MORC3 deficient monocytes (
Finally, how the locus-specific repression mediated by MORC3 regulates expression of anti-viral ISGs was investigated. There are 17 different type I IFN genes (IFNB1, IFNE, IFNK, IFNW1, and thirteen IFNA genes) that cluster together on chromosome 9 and encode proteins that vary in cell-type expression, kinetics of induction, and receptor affinity. The most studied type I IFN gene is IFNB1 because it is dominantly induced in IFN-producing cells. However, ISG induction downstream of STING activation in BLaER1 monocytes did not rely solely on IFNB1, as revealed by IFNAR-dependent induction of ISGs, such as RSAD2, CXCL10, in an IFNB1-independent manner in response to foreign DNA (
ATAC-seq was used to identify a minisatellite-like element, which is referred to herein as the MORC3-regulated element (MRE), in an intron of FOCAD, approximately 100 kb downstream of IFNB1, that gains DNA accessibility in the absence of MORC3 (
To assess whether elimination of MORC3 can result in anti-tumor activity, mice harboring a conditional (floxed) allele of Morc3 were generated. These mice were then crossed to mice harboring an inducible CreERT2 gene. In the presence of tamoxifen, CreERT2 activity is induced, resulting in excision (deletion) of the Morc3 gene. Loss of Morc3 results in ˜100-fold Ifnb induction in the spleens of mice (
These results identify the MORC3-pathway as a novel innate immune sensing mechanism that detects the enzymatic activity of virulence factors from DNA viruses. During HSV-1 infection of monocytes, the MORC3 pathway induces a strong IFNB1 response redundantly with the cGAS-STING-pathway of cytosolic DNA sensing. As the STING-pathway is solely required for IFN induction during HSV-1 infection in other cell types, the MORC3-pathway might rely on monocyte-specific components that remain to be identified. Importantly, the MORC3-pathway does not utilize a PAMP-sensing receptor akin to a PRR; nor does it depend on canonical PRR signaling components that many viruses have evolved to disrupt or inhibit. Instead, it employs the self-guarded protein MORC3, whose bi-functionality allows detection of pathogen-encoded enzymatic activities. The primary function of MORC3 appears to be to inhibit replication of HSV-1 and likely other (DNA) viruses that replicate in the nucleus, a function that is presumably connected to its association with ND10 nuclear bodies. To escape restriction by MORC3, DNA viruses employ virulence factors, e.g. HSV-1 ICP0 and Ad5 E4ORF3, to inhibit ND10 nuclear bodies and/or degrade MORC3. In response, MORC3 may have evolved a secondary function: locus-specific repression of the IFNB1 gene. This secondary function allows activation of anti-viral IFN upon virulence factor-mediated perturbation of ND10 nuclear bodies and MORC3. De-repression of the IFNB1 locus may be less susceptible to pathogen interference or tumor cell evasion as compared to a multi-step PRR signaling pathway to activate IFNB1 transcription. The MORC3 pathway might also explain prior observations of IRF3/7-independent IFNβ during DNA virus infections and connections between perturbed sumoylation and IFN induction. The integration of two distinct functions within a single ‘dead-man's switch’ provides robust self-insurance of the anti-viral MORC3 function. Employing a single protein to repress both viral gene expression and the IFNB1 locus may provide a significant barrier against viruses that seek to selectively escape the repression of viral genes without also triggering IFNB1 expression. It is conceivable that MORC3 exerts its two different functions by executing one unifying molecular activity, namely, transcriptional repression. Various repressive activities have been proposed for the MORC gene family, including DNA methylation, H3K9-methylation, H3.3 incorporation and DNA compaction. The identification of the MRE as a key downstream component required for IFNB1 expression in MORC3-deficient cells is interesting. Loss of the MRE is the only known way to eliminate IFNB1 expression after activation of the MORC3 pathway, but importantly, loss of the MRE does not affect canonical IFNB1-inducing pathways that depend on IRF3/7. Thus, MRE mutant cells can be used to assess whether a specific intervention (e.g., MORC3 inhibitor) is affecting the MORC3 pathway.
Although the MORC3 pathway is distinct from known PRR-mediated pathways of IFN induction, the strategy of self-guarded anti-viral proteins may be more common than has been previously appreciated. The strong selective pressure applied by host-pathogen arms races may select for self-guarded pathways to force a pathogen to “pick its poison”: either the pathogen is restricted by a primary anti-viral activity, or if the pathogen interferes with this activity, a secondary restrictive anti-viral activity is unleashed. Because self-guarding fundamentally involves negative regulation, many examples of self-guarded anti-viral proteins may be hiding in plain sight as negative regulators. Indeed, it is noteworthy that many of the negative regulators of type I IFNs that have been previously described, e.g., ADAR1, SAMHD1, TREX1, RNASEH or ISG15/USP18, have known or speculated intrinsic anti-viral functions, i.e., RNA deamination, nucleotide degradation, DNA degradation, RNA-DNA hybrid degradation, or ISGylation, respectively. Negative regulation of IFN by these enzymes may have evolved to guard their intrinsic anti-viral activity. It is also noteworthy that immune pathways with a primary anti-pathogen function, such as MHC-I or TNFR complex I, have secondary roles in inhibiting other innate immune responses, i.e., NK-cell-mediated cytotoxicity and TNFR complex II, respectively. Negative regulators of NK cells and TNF signaling are also targeted by pathogen effectors. Therefore, self-guarded bi-functional pathways might be a common feature of multi-layered innate immune systems of animals.
As disclosed herein, MORC3 inhibits expression of the interferon beta gene, IFNB1, and loss of MORC3 activity activates a Type I interferon induction pathway that is independent of pattern-recognition-receptors (PRRs).
Therefore, in some embodiments, the present invention provides methods for modulating an interferon response in a subject which comprises modifying the activity of MORC3 in the subject. In some embodiments, the activity of MORC3 is inhibited or reduced. In some embodiments, the activity of MORC3 is enhanced, increased, or stabilized. In some embodiments, MORC3 activity is modified in combination with administration of one or more immunomodulators in the art.
The activity of MORC3 in a subject may be inhibited or reduced by, e.g., knock-out or knock-down of the MORC3 gene in the subject, administering the subject an siRNA that inhibits or reduces expression of MORC3, administering the subject a MORC3 inhibitor, etc. The activity of MORC3 in a subject may be enhanced or increased by, e.g., increasing the copy number of MORC3 in the subject, administering MORC3 to the subject, etc.
In some embodiments, MORC3 activity is modified in a subject in need thereof. A subject “in need of” modification of MORC3 activity is one who will likely benefit from an increase or decrease of interferon. In some embodiments, the subject is one who suffers from an abnormality in an interferon induction signaling pathway, e.g., RIG-I pathway, TRIF pathway, and IRF7 pathway. In some embodiments, the subject is in need of an increase of interferon. In some embodiments, the subject is in need of a decrease of interferon.
In some embodiments, MORC3 activity is inhibited or reduced:
In some embodiments, MORC3 activity is enhanced, increased, or stabilized to treat an inflammatory disease or disorder involving IFNB1 expression, a disease caused by hyper-IFN expression, systemic lupus erythematosus (SLE), rheumatoid arthritis, multiple sclerosis (MS), type I diabetes (T1D), and Sjögren's syndrome, myositis, etc.
In some embodiments, MORC3 activity is enhanced, increased, or stabilized to treat a bacterial or viral infection.
Methods in the art may be used to identify small molecule inhibitors of MORC3 expression and/or activity. In some embodiments, the small molecule inhibitors block the ATPase activity of MORC3.
In some embodiments, cells lacking the signaling components such as TBK1/IKKE, IKKα/b, and/or IRF3/7, as described herein, are treated with a candidate compound to determine whether the candidate compound stimulates or inhibits interferon production, and thereby indicates whether the candidate compound modulates MORC3 activity.
A compound that modulates MORC3 activity may be optimized to improve its pharmacokinetics using methods in the art and/or targeted to a tissue of interest, e.g., conjugated to a carrier molecule.
As used herein, an “interferon disorder” refers to a disease, infection, or disorder that results in and/or involves an abnormally high or an abnormally low amount of interferon production. In some embodiments, the interferon disorder is an IFNB1 Disorder. As used herein, an “IFNB1 Disorder” refers to diseases and disorders that are, directly or indirectly, caused by abnormal interferon beta (IFNB1) activity, e.g., abnormally high or abnormally low levels of interferon as compared to normal control subjects.
As used herein, a “IFN Excess Disorder” refers to diseases and disorders that, directly or indirectly, cause or result in abnormally high levels of interferon as compared to normal control subjects. IFN Excess Disorders also include abnormally high levels of interferon resulting from infections and therapeutic interventions. Examples of IFN Excess Disorders include autoimmune and inflammatory diseases such as rheumatoid arthritis, psoriasis, vitiligo, hypothyroidism, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, myasthenia gravis, Addison disease, celiac disease, polymyositis, superimposed autoimmune hepatitis, and the like. Examples of autoimmune and inflammatory diseases include multiple sclerosis, primary progressive multiple sclerosis, and relapsing-remitting multiple sclerosis.
As used herein, a “IFN Deficiency Disorder” refers to diseases and disorders that, directly or indirectly, cause or result in abnormally low levels of interferon as compared to normal control subjects; and diseases, infections, and/or symptoms that are treatable by administration of interferon. IFN Deficiency Disorders also include abnormally low levels of interferon resulting from infections and therapeutic interventions. Examples of IFN Deficiency Disorders include viral infections (e.g., as herpes, hepatitis, a coronavirus infection (e.g., COVID 19), etc.), cancers (e.g., leukemias, lymphomas, melanomas, sarcomas, adenocarcinomas, etc.), and the like.
As used herein, “MORC3 therapeutic agents” refer to compounds and biomolecules that inhibit, reduce, increase, enhance, or stabilize MORC3 expression and/or activity. MORC3 therapeutic agents include MORC3 inhibitors (e.g., siRNAs, small molecules, ATPase inhibitors (e.g., small molecule ATPase inhibitors), etc.) and MORC3 activators. In some embodiments, the MORC3 therapeutic agent is a small molecule, a protein, or a nucleic acid. In some embodiments, the MORC3 therapeutic agent is an antibody, fusion protein, degrader, shRNA, siRNA, microRNA, asymmetric interfering RNA, antisense molecule, 1hRNA, miRNA embedded shRNA, or small internally segmented RNA. In some embodiments, the MORC3 therapeutic agent is a MORC3 protein or a MORC3 fusion protein. In some embodiments, the MORC3 therapeutic agent comprises an ICP0 protein. In some embodiments, the MORC3 therapeutic agent comprises shRNA, siRNA, microRNA, asymmetric interfering RNA, antisense molecule, 1hRNA, miRNA embedded shRNA, or small internally segmented RNA. the MORC3 therapeutic agent is an siRNA, an ATPase inhibitor (e.g., a small molecule ATPase inhibitor), a MORC3 protein having at least about 90% sequence identity to SEQ ID NO: 1, or an ICP0 protein having at least about 95% sequence identity to SEQ ID NO: 2. Such MORC3 inhibitors and activators include those that bind MORC3 and thereby results in the autoinhibited conformation and the activated conformation, respectively. See, e.g., Zhang et al. (2019) PNAS USA 116(13):6111-6119. In some embodiments, the ATPase inhibitor is (−)-Blebbistatin, Bafilomycin A1 (Baf-A1), BHQ, Brefeldin A, BRITE338733, BTB06584, Bufalin, CB-5083, Dexlansoprazole, Digoxin (NSC 95100), Ilaprazole, Ilaprazole sodium, KM91104, Lansoprazole, ML241 hydrochloride, ML367, NEXIUM (esomeprazole magnesium), Oleandrin (PBI-05204), Omeprazole, Ouabain, Pantoprazole, Pantoprazole sodium, Pantoprazole sodium hydrate, Phlorizin, Revaprazan Hydrochloride, Sodium orthovanadate, Tegoprazan, Tenatoprazole, and Thapsigargin. In some embodiments, the siRNA is selected from the group consisting of hsa-miR-3148, hsa-miR-144-3p, hsa-miR-101-3p, hsa-miR-9902, hsa-miR-367-3p, hsa-miR-3059-3p, hsa-miR-92b-3p, hsa-miR-25-3p, hsa-miR-92a-3p, hsa-miR-363-3p, hsa-miR-32-5p, hsa-miR-570-5p, hsa-miR-548ai, hsa-miR-548ba, hsa-miR-548ag, hsa-miR-6124, hsa-miR-205-3p, hsa-miR-545-5p, hsa-miR-4742-5p, hsa-miR-3908, hsa-miR-153-3p, hsa-miR-3121-3p, hsa-miR-5700, hsa-miR-200b-5p, hsa-miR-7852-3p, hsa-miR-200a-5p, hsa-miR-4262, hsa-miR-6833-5p, hsa-miR-8073, hsa-miR-221-5p, hsa-miR-548m, hsa-miR-3190-3p, hsa-miR-548c-3p, hsa-miR-3145-3p, hsa-miR-12124, hsa-miR-548aj-3p, hsa-miR-548x-3p, hsa-miR-4652-3p, hsa-miR-513a-5p, hsa-miR-218-2-3p, hsa-miR-4729, hsa-miR-2054, hsa-miR-181b-5p, hsa-miR-181c-5p, hsa-miR-181d-5p, hsa-miR-181a-5p, hsa-miR-95-5p, hsa-miR-190a-3p, hsa-miR-5582-3p, hsa-miR-584-5p, hsa-miR-542-3p, hsa-miR-450a-1-3p, hsa-miR-548j-3p, hsa-miR-548 am-3p, hsa-miR-548bb-3p, hsa-miR-548ac, hsa-miR-548aq-3p, hsa-miR-548d-3p, hsa-miR-548ah-3p, hsa-miR-548ae-3p, hsa-miR-548 h-3p, hsa-miR-548z, hsa-miR-7154-5p, hsa-miR-27a-5p, hsa-miR-4275, hsa-miR-1185-2-3p, hsa-miR-1185-1-3p, hsa-miR-622, hsa-miR-4699-3p, hsa-miR-6808-3p, hsa-miR-4719, hsa-miR-3180-5p, hsa-miR-3978, hsa-miR-3163, hsa-miR-4718, hsa-miR-4748, hsa-miR-4464, hsa-miR-887-3p, hsa-let-7f-2-3p, hsa-miR-5696, hsa-miR-3657, hsa-miR-4669, hsa-miR-758-3p, hsa-miR-3649, hsa-miR-5011-5p, hsa-miR-513a-3p, hsa-miR-513c-3p, hsa-miR-3606-3p, hsa-miR-7849-3p, hsa-miR-374b-5p, hsa-miR-4703-5p, hsa-miR-374a-5p, hsa-miR-4423-5p, hsa-miR-4753-3p, hsa-miR-1284, hsa-miR-2110, hsa-miR-4422, hsa-miR-3973, hsa-miR-3942-5p, hsa-miR-367-5p, hsa-miR-183-5p, hsa-miR-8084, hsa-miR-155-5p, hsa-miR-7973, hsa-miR-30a-3p, hsa-miR-30d-3p, hsa-let-7a-3p, hsa-miR-450a-2-3p, hsa-let-7b-3p, hsa-miR-30e-3p, hsa-let-7f-1-3p, hsa-miR-98-3p, hsa-miR-152-5p, hsa-miR-6735-5p, hsa-miR-7843-5p, hsa-miR-7161-5p, hsa-miR-4′761-3p, hsa-miR-6879-5p, hsa-miR-551b-5p, hsa-miR-4632-5p, hsa-miR-944, hsa-miR-649, hsa-miR-4436b-3p, hsa-miR-5087, hsa-miR-4700-3p, hsa-miR-1323, hsa-miR-513b-5p, hsa-miR-651-3p, hsa-miR-6796-3p, hsa-miR-182-3p, hsa-miR-597-3p, hsa-miR-5000-3p, hsa-miR-548u, hsa-miR-6787-3p, hsa-miR-4752, and hsa-miR-216a-5p.
As used herein, the term “sample” is used in its broadest sense and includes specimens and cultures obtained from any source, as well as biological samples and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum, and the like. A biological sample can be obtained from a subject using methods in the art. A sample to be analyzed using one or more methods described herein can be either an initial unprocessed sample taken from a subject or a subsequently processed, e.g., partially purified, diluted, concentrated, fluidized, pretreated with a reagent (e.g., protease inhibitor, anti-coagulant, etc.), and the like. In some embodiments, the sample is a blood sample. In some embodiments, the blood sample is a whole blood sample, a serum sample, or a plasma sample. In some embodiments, the sample may be processed, e.g., condensed, diluted, partially purified, and the like. In some embodiments, the sample is pretreated with a reagent, e.g., a protease inhibitor. In some embodiments, two or more samples are collected at different time intervals to assess any difference in the amount of the analyte of interest, the progression of a disease or disorder, or the efficacy of a treatment. The test sample is then contacted with a capture reagent and, if the analyte is present, a conjugate between the analyte and the capture reagent is formed and is detected and/or measured with a detection reagent.
In some embodiments, the present invention provides kits for assaying MORC3, in a sample, e.g., a biological sample from a subject. In some embodiments, the kits comprise one or more reagents, e.g., blocking buffers, assay buffers, diluents, wash solutions, etc., for assaying the MORC3. In some embodiments, the kits comprise additional components such as interpretive information, control samples, reference levels, and standards.
In some embodiments, the present invention provides kits comprising one or more MORC3 therapeutic agents, optionally in a composition or in combination with one or more supplementary agents, packaged together with one or more reagents or drug delivery devices for preventing, inhibiting, reducing, or treating interferon disorder in a subject. In some embodiments, the kits comprise the one or more MORC3 therapeutic agents, optionally in one or more unit dosage forms, packaged together as a pack and/or in drug delivery device, e.g., a pre-filled syringe.
In some embodiments, the kits include a carrier, package, or container that may be compartmentalized to receive one or more containers, such as vials, tubes, and the like. In some embodiments, the kits optionally include an identifying description or label or instructions relating to its use. In some embodiments, the kits include information prescribed by a governmental agency that regulates the manufacture, use, or sale of compounds and compositions as contemplated herein.
The methods and kits as contemplated herein may be used in the evaluation of an interferon disorder, such as a IFN Deficiency Disorder or a IFN Excess Disorder. The methods and kits may be used to monitor the progress of such a disease, assess the efficacy of a treatment for the disease, and/or identify patients suitable for a given treatment in a subject. The methods and kits may be used to diagnose a subject as having a interferon disorder and/or provide the subject with a prognosis.
In some embodiments, the methods and kits may be used to determine whether a subject exhibits a level of MORC3 that is low or high as compared to a control. In some embodiments, the control is a sample from a normal, healthy subject. In some embodiments, the control is a pooled sample from a plurality of normal, healthy subjects. In some embodiments, the control is a given reference level. The abnormal level may then be used to diagnose the subject as suffering from an interferon disorder.
A subject identified as having a low level or a high level of MORC3 may be subjected to a suitable treatment. For example, a subject identified as having a high level of MORC3 or diagnosed as suffering from an IFN Excess Disorder may be treated with one or more MORC3 therapeutic agents. As another example, a subject identified as having a low level of MORC3 or diagnosed as suffering from a IFN Deficiency Disorder may be treated with one or more MORC3 therapeutic agents.
In some embodiments, the methods and kits may be used to monitor the efficacy of treatment with a given therapeutic, e.g., a MORC3 therapeutic agent, that modulates the level of MORC3 produced in the subject and the dosage of the given therapeutic may be adjusted accordingly.
In some embodiments, the methods and kits may be used for research purposes. For example, the methods and kits may be used to identify diseases that are caused by abnormal levels of MORC3 and/or identify diseases that result in abnormal levels of MORC3. In some embodiments, the methods and kits may be used to study mechanisms, e.g., mechanisms and pathways involving MORC3. In some embodiments, the methods and kits may be used to develop and screen for therapeutics that increase or decrease levels of MORC3 in subjects.
Compositions, including pharmaceutical compositions, comprising, consisting essentially of, or consisting of one or more MORC3 therapeutic agents are contemplated herein. The term “pharmaceutical composition” refers to a composition suitable for pharmaceutical use in a subject. A composition generally comprises an effective amount of an active agent and a diluent and/or carrier. A pharmaceutical composition generally comprises a therapeutically effective amount of an active agent and a pharmaceutically acceptable carrier. In addition to the one or more MORC3 therapeutic agents, pharmaceutical compositions may include one or more supplementary agents. Examples of suitable supplementary agents include immunomodulatory agents, interferon, and the like.
As used herein, an “effective amount” refers to a dosage or amount sufficient to produce a desired result. The desired result may comprise an objective or subjective change as compared to a control in, for example, in vitro assays, and other laboratory experiments. As used herein, a “therapeutically effective amount” refers to an amount that may be used to treat, prevent, or inhibit a given disease or condition in a subject as compared to a control, such as a placebo. Again, the skilled artisan will appreciate that certain factors may influence the amount required to effectively treat a subject, including the degree of the condition or symptom to be treated, previous treatments, the general health and age of the subject, and the like. Nevertheless, effective amounts and therapeutically effective amounts may be readily determined by methods in the art.
The one or more MORC3 therapeutic agents may be administered, preferably in the form of pharmaceutical compositions, to a subject. Preferably the subject is mammalian, more preferably, the subject is human. Preferred pharmaceutical compositions are those comprising at least one MORC3 therapeutic agent in a therapeutically effective amount and a pharmaceutically acceptable vehicle. It should be noted that treatment of a subject with a therapeutically effective amount may be administered as a single dose or as a series of several doses. The dosages used for treatment may increase or decrease over the course of a given treatment. Optimal dosages for a given set of conditions may be ascertained by those skilled in the art using dosage-determination tests and/or diagnostic assays in the art. Dosage-determination tests and/or diagnostic assays may be used to monitor and adjust dosages during the course of treatment.
Pharmaceutical compositions may be formulated for the intended route of delivery, including intravenous, intramuscular, intra peritoneal, subcutaneous, intraocular, intrathecal, intraarticular, intrasynovial, cisternal, intrahepatic, intralesional injection, intracranial injection, infusion, and/or inhaled routes of administration using methods known in the art. Pharmaceutical compositions may include one or more of the following: pH buffered solutions, adjuvants (e.g., preservatives, wetting agents, emulsifying agents, and dispersing agents), liposomal formulations, nanoparticles, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. The compositions and formulations may be optimized for increased stability and efficacy using methods in the art. See, e.g., Carra et al., (2007) Vaccine 25:4149-4158.
The compositions may be administered to a subject by any suitable route including oral, transdermal, subcutaneous, intranasal, inhalation, intramuscular, and intravascular administration. It will be appreciated that the preferred route of administration and pharmaceutical formulation will vary with the condition and age of the subject, the nature of the condition to be treated, the therapeutic effect desired, and the particular MORC3 therapeutic agent used.
As used herein, a “pharmaceutically acceptable vehicle” or “pharmaceutically acceptable carrier” are used interchangeably and refer to solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration and comply with the applicable standards and regulations, e.g., the pharmacopeial standards set forth in the United States Pharmacopeia and the National Formulary (USP-NF) book, for pharmaceutical administration. Thus, for example, unsterile water is excluded as a pharmaceutically acceptable carrier for, at least, intravenous administration. Pharmaceutically acceptable vehicles include those known in the art. See, e.g., Remington: The Science and Practice of Pharmacy 20th ed (2000) Lippincott Williams & Wilkins, Baltimore, MD.
The pharmaceutical compositions may be provided in dosage unit forms. As used herein, a “dosage unit form” refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of the one or more MORC3 therapeutic agent calculated to produce the desired therapeutic effect in association with the required pharmaceutically acceptable carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the given MORC3 therapeutic agent and desired therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
Toxicity and therapeutic efficacy of MORC3 therapeutic agents according to the instant invention and compositions thereof can be determined using cell cultures and/or experimental animals and pharmaceutical procedures in the art. For example, one may determine the lethal dose, LC50 (the dose expressed as concentration×exposure time that is lethal to 50% of the population) or the LD50 (the dose lethal to 50% of the population), and the ED50 (the dose therapeutically effective in 50% of the population) by methods in the art. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. MORC3 therapeutic agents which exhibit large therapeutic indices are preferred. While MORC3 therapeutic agents that result in toxic side-effects may be used, care should be taken to design a delivery system that targets such compounds to the site of treatment to minimize potential damage to uninfected cells and, thereby, reduce side-effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosages for use in humans. Preferred dosages provide a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary depending upon the dosage form employed and the route of administration utilized. Therapeutically effective amounts and dosages of one or more MORC3 therapeutic agents can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. Additionally, a dosage suitable for a given subject can be determined by an attending physician or qualified medical practitioner, based on various clinical factors.
The following examples are intended to illustrate but not to limit the invention.
BLaER1, U937 and THP-1 cells were cultured in RPMI Medium 1640 supplemented with L-glutamine, sodium pyruvate, 100 U/ml penicillin-streptomycin (Thermo Fisher) and 10% (v/v) FCS (Omega Scientific). HEK293T, U2OS and HCT116 cells were cultivated in DMEM Medium (Thermo Fisher) containing the same supplements. 1.4 million BLaER1 cells per well of a 6-well plate were trans-differentiated into monocytes for 5-6 days in medium containing 10 ng/ml of hrIL-3, 10 ng/ml hr-CSF-1 (M-CSF) (both PeproTech) and 100 nM β-Estradiol (Sigma-Aldrich) as previously described. 1.4 million THP-1 and U937 cells per well of a 6-well plate were differentiated overnight with 100 ng/ml PMA (Sigma-Aldrich). STING-deficient and corresponding control THP1 and U937 cells were a gift from Dan Stetson (University of Washington). BLaER1 cells were a gift from Thomas Graf (CRG, Barcelona, Spain) and Veit Hornung (LMU Munich, Germany). U2OS cells were a gift from Robert Tjian and Xavier Darzacq (UC Berkeley). THP1 cells were from ATCC. U937 cells were from the UC Berkeley Cell Culture Facility. HCT116 cells were a gift from David Raulet (UC Berkeley).
For activation of the cGAS-STING pathway, 3.2 μg of UltraPure™ Salmon Sperm DNA (Thermo Fisher) or 3.2 μg of 2′3′ cGAMP (Invivogen) was complexed with 8 11.1 Lipofectamine 2000 (Thermo Fisher) according to the manufacturer's protocol in Opti-MEM Reduced Serum Media (Thermo Fisher) and added to 1.4 million cells per well of a 6-well plate for 3 h or the indicated time. PRRs were activated with 200 ng/ml LPS-EB ultrapure from E. coli O111:B4 (Invivogen) or 500 ng/ml R848 (Invivogen). For activation of doxycycline-inducible trans-gene expression, cells were stimulated with 1 μg/ml doxycycline hyclate (Sigma-Aldrich) for 24 h.
BACs of ΔICP0 HSV-1 and corresponding WT strain were a gift from Bernard Roizman (University of Chicago). BAC DNA was prepared from a mono-clonal transformant and transfected into U2OS cells using Lipofectamine 2000 (Thermo Fisher). Virus was propagated, harvested and frozen as described. Viral progeny were titered from cell-free supernatants by TCID50 using 8 replicates per dilution. U2OS cells were used for titering if not otherwise indicated, and FFU/ml was calculated by the Spearman & Karber algorithm. Myeloid cells were infected by adsorbing virus of appropriate MOI in FCS free RPMI Medium 1640 for 1 h. Subsequently, medium was changed to complete RPMI Medium 1640. For analysis of viral progeny in the supernatant, cells were subsequently washed three times with warm PBS and resuspended in RPMI. For all other experiments, medium was directly changed to RPMI without a PBS wash.
Gene expression was quantified by quantitative PCR with reverse transcription (RT-qPCR). RNA was isolated with E.Z.N.A. Total RNA kit I (Omegabiotek) and 0.5-1 μg RNA was treated with RQ1 RNase-free DNase (Promega) in presence of RNasin plus ribonuclease inhibitor (Promega). RNA was reverse transcribed with Superscript III reverse transcriptase (Invitrogen). SYBRGreen dye (Thermo Fisher Scientific) was used for quantitative PCR assays and analyzed with a real-time PCR system (StepOnePlus; Applied Biosystems). All gene expression values were normalized to GAPDH and are depicted as 2{circumflex over ( )}-ΔCt (Cttarget−CtGAPDH). Primers used were:
Whole cell lysates were prepared by lysing cells in 50 mM Tris pH 7.4, 50 mM NaCl, 2 mM MgCl2, 0.5% NP40, 25 U/ml Benzonase® Nuclease (Millipore Sigma) and Complete Mini EDTA-free Protease Inhibitor (Roche) for 20 min on ice. Laemmli buffer was added to a final concentration of 1× and lysates were boiled at 95° C. for 10 minutes. Proteins were separated with denaturing PAGE and transferred to Immobilon-FL PVDF membranes (Millipore Sigma). Membranes were blocked with Li-Cor Odyssey blocking buffer. Primary antibodies were added and immunoblots incubated overnight. Primary antibodies used were anti-β-Actin (C4) (Santa Cruz, sc-47778), anti-HSV-1 ICP4 (H943) (Santa Cruz, sc-69809), anti-HSV-1 ICP0 (11060) (Santa Cruz, sc-53070), anti-TBK1 (D1B4) (Cell Signaling, #3504), anti-IKKε (Cell Signaling, #2690), anti-IRF-3 (D83B9) (Cell Signaling, #4302), anti-IRF-7 (Cell Signaling, #4920), anti-MORC3 (NovusBio, NBP1-83036), anti-MORC3 (Proteintech, 24994-1-AP). Appropriate secondary IRDye®-conjugated antibodies (Li-Cor) were used and immunoblots were imaged using the Li-Cor Odyssey platform.
To test whether the MRE regulates IFNB1 in cis or in trans, IFNB1 coding sequence with distinct indels were engineered. This enabled us to track which allele is being transcribed upon activation of IFNB1 by amplicon sequencing of IFNB1 cDNA (FIG. “4d). Cytosolic DNA sensing drove bi-allelic activation of IFNB1 regardless of the MRE. Activating the MORC3 pathway with a MORC3-sgRNA drove bi-allelic expression in WT cells and mono-allelic expression of IFNB1 in heterozygous MRE+/′ cells. While the long distance between IFNB1 and the MRE makes it difficult to determine which indel-marked IFNB1 allele is in cis with MRE′, these data strongly suggest that the MRE induces IFNB1 transcription in cis. Specifically, the genome of heterozygous MRE+/′ and corresponding WT (STAT1−/−STAT2−/− Cas9) BLaER1 cells was edited at the IFNB1 locus using the sgRNA GATGAACTTTGACATCCCTGAGG (SEQ ID NO: 14) (protospacer-adjacent motif (PAM) is highlighted in bold) as described in “CRISPR-Cas9-mediated gene targeting” below.
Monoclonal gene deficient BLaER1 cells were generated as follows. Briefly, sgRNAs specific for the indicated genes, were designed to target an early coding exon of the respective gene with minimal off-targets and high on-target activity using ChopChop. U6-sgRNA-CMV-mCherry-T2A-Cas9 plasmids were generated by ligation-independent-cloning as previously described and BlaER1 cells were electroporated using a Biorad GenePulser device. Automated cell sorting was used to collect mCherry positive cells that were cloned by limiting dilution. Monoclonal cell lines were identified, rearranged and duplicated for genotyping using deep sequencing as previously described. Knockout cell clones contained all-allelic frame shift mutations without any wild type reads. Two independent knockout single-cell clones were analyzed per genotype, and one representative clone per genotype is shown. For polyclonal gene targeting, cell lines were transduced with lentiCas9-Blast, a gift from Feng Zhang (Addgene plasmid #52962; http://n2t.net/addgene:52962; RRID: Addgene 52962). sgRNAs were designed as above and cloned into lentiGuide-Puro, a gift from Feng Zhang (Addgene plasmid #52963; http://n2t.net/addgene:52963; RRID: Addgene 52963), using ligation-independent-cloning. Cas9-expressing cells were transduced with indicated sgRNA-encoding lenti-viruses.
sgRNA Target Sites (PAM is Highlighted in Bold):
Cytokine Quantification Cytokine secretion was quantified by ELISA of cell-free supernatants after stimulations (IFNβ: R&D, DY814-05; IP-10: BD, 550926).
Lenti- and retro-virus was produced in HEK293T cells. 4.5 million cells were plated per 10 cm dish and transfected with 5 μg of transfer vector, 3.75 μg of packaging vector (pd8.9 for lenti- and pGAGPOL for retro-virus) and 1.5 μg pVSVG using 30.75 μg PEI-MAX (Polysciences, 24765-1). 12 h after transfection the medium was replaced with DMEM medium containing 30% (v/v) FCS. After 24-36 h, viral supernatants were harvested, centrifugated at 1000×g for 10 min, and filtered through a 0.45 μm filter. Cells were culture for 48 h after transduction, prior to selection with puromycin or Blasticidine S hydrochloride (both Sigma-Aldrich).
A doxycycline-inducible lenti-virus system was used for ectopic gene expression as previously described. Codon-optimized constructs for HSV-1-ICP0 and HA-Adenovirus5-E4ORF3 were synthesized by Integrated DNA Technologies and cloned into pLIP. ICP0 variants were generated by overlap-extension PCR.
The 1 kb upstream of the transcription start site of huma IFNB1 (hg38 chr9:21077923-21078922) was synthesized by Integrated DNA Technologies and cloned in front of a luciferase reporter from Gaussia princeps into a retro-viral transfer vector in opposite direction to the 5′LTR. BLaER1 cells were transduced and sorted for reporter integration.
BLaER1 were harvested for flow cytometry, fixed and permeabilized using eBioscience™ IC Fixation Buffer and eBioscience™ Permeabilization Buffer (both Thermo Fisher) according to the provider's protocol. Cells were incubated for 1 h with PE-Anti-Viperin (Clone MaP.VIP; BD, 565196) and analyzed using a BD LSRFortessa™ Flow Cytometer. If indicated, cells were sorted on a BD FACSAria™ Fusion Cell Sorter. For analysis of HSV-1 infection BLaER1 were collected for flow cytometry, fixed in 4% PFA (Electron Microscopy Sciences) for 15 (min at room temperature and washed 3 times with PBS. Cells were permeabilized with HSV-1 stain buffer (PBS, 10% FCS, 1 mM EDTA and 0.1% saponin) for 30 min on ice, incubated with Human BD Fc Block (BD) for 30 min on ice and stained with anti-HSV-1 antibody (ab9533, Abcam) at 1:100 dilution for 1 hon ice. After 3 washes with HSV-1 staining buffer, cells were stained with anti-rabbit secondary antibody (A-21244, Thermo Fisher Scientific) at 1:2,000 dilution in HSV-1 stain buffer, washed 4 times in HSV-1 stain buffer and analysed using a BD LSRFortessa Flow Cytometer.
Monoclonal Cas9-expressing BLaER1 cells were re-selected with blasticidine and 9 million cells were transduced in four biological replicates with a pooled Human CRISPR Knockout library at an MOI of approximately 0.3. The library was a gift from Michael Bassik (Addgene #101926, 101927, 101928, 101929, 101930, 101931, 101932, 101933, 101934). Two days after transduction, cells were selected with puromycin for 3 days and trans-differentiated. Cells were stained for Viperin expression. Per biological replicate, 46-80×103 cells with increased spontaneous Viperin expression were sorted (
Details of the nested PCR approach and primers for the second level PCR have been described. PCR products were sequenced on Illumina HiSeq4000 50SR. Deep sequencing data was analyzed with PinAPL-Py. The recovery of the sgRNA library was suboptimal, probably due to low number of sorted cells. Subsequently, reads from all technical and biological replicates were combined and enriched sgRNAs over control were identified. Modified robust ranking aggregation (RRA) to gene level revealed candidate negative regulators of IFN (Extended Data Table 1). Candidates with a significantly highly ranked sgRNAs (p.adjust <0.01) were validated in an arrayed format (
RNA from 2.8 million trans-differentiated BLaER1 monocytes was isolated using TRIzol™ Reagent (Thermo Fisher) according to the manufacturer's recommendation. DNA was removed with RQ1 RNase-free DNase (Promega) in the presence of RNasin plus Ribonuclease Inhibitor (Promega) and RNA isolated with Agencourt AMPure XP beads (Beckman Coulter). mRNA-seq libraries were prepared by the QB3 Genomics Functional Genomics Laboratory from poly-A-enriched mRNA using a KAPA mRNA HyperPrep Kit (Roche) and sequenced on the Illumina Novaseq S4 150PE. Sequencing quality of fastq files was evaluated with FASTQC and paired end RNA-seq reads were aligned to the reference genome (GRCh38.83) using Bowtie2 with default settings. Transcript and gene counts were quantified using RSEM with the parameter strandedness' set to ‘reverse’ to account for strand-specific library preparation protocol. DeSeq2 was used to identify differentially expressed genes between conditions by building a single DeSeq2 model using counts from RSEM and performed pairwise comparisons of conditions. All genes with a false discovery rate (FDR) below 0.05 were considered to be significantly differential. Log normalized counts from DeSeq2 were used to perform principal component analysis (PCA) shown in
ATAC-seq was performed using methods in the art. 50,000 BLaER1 monocytes were washed with PBS and lysed in 50 (μl of cold lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630). Nuclei were collected by centrifugation and resuspended in 50 (μl TD Buffer (Illumina, FC-121-1030) with 2.5 μl Tn5 Transposase (Illumina, FC-121-1030). The reaction was incubated for 30 (min at 37(° C. and DNA was isolated with a MinElute Kit (Qiagen). Transposed DNA fragments were amplified to reach 30% of maximal amplification using Ad1 and Ad2 primer and sequenced on an Illumina Nova-Seq SP 50PE.
Primers:
FASTQC version 0.11.539 was used to assess quality of ATAC-seq reads. Adapter sequences were removed using Cutadapt version 2.1046 using a default error rate of 0.1. Reads shorter than 5 were discarded. Reads were aligned to the hg19 reference genome using bowtie 2 version 2.3.240 and discordant alignments were removed. Reads with mapping quality less than 30 were removed using SAMtools version 1.3.147 and duplicates were removed using Picard Tools version 2.5.0 (broadinstitute.github.io/picard/). Additionally, regions overlapping black list regions, identified from the ENCODE consortium, were removed. Blacklist regions were downloaded from ENCODE (accession ENCFF000KJP). ATAC-seq reads aligned to the positive strand were shifted +4 bp and reads aligned to the negative strand were shifted −5 bp to adjust read start sites to represent the center of the transposase-binding event. Peaks were called on shifted reads using MACS2 version 2.2.7.150, setting the FDR to 0.05 and the default human genome size. Peaks from all samples were combined by taking the union of all peaks. Counts representing peak strength for all samples were obtained by counting the number of cut sites that overlapped each peak for each sample. DeSeq2 version 1.30.142 was used to identify the differential abundance of cut sites between conditions. All regions with an FDR below 0.05 were marked as significantly differentially accessible. Annotatr was used to gather annotations of ATAC-seq peaks from the hg19 genome. To identify peaks that did not overlap promoters, all ATAC-seq peaks that overlapped at least one annotated promoter were removed.
RNA-seq reads from IFNAR1−/−IFNAR2−/− mCherry and MORC3−/− IFNAR1−/−IFNAR2−/− BLaER1 monocytes were aligned to the hg38 genome using the STAR aligner with parameter ‘outFilterMultimapNmax’ set to ‘100000000’ to allow for lenient alignment of multimapped reads. RepEnrich2 was used to quantify expression of ERV families. The MAPQ threshold for subsetting uniquely mapping and multi-mapping reads in RepEnrich2 was set to 255. The pre-built repeat annotations for RepEnrich2, available through the RepEnrich2 GitHub was used. Differential expression of ERV counts from RepEnrich2 was analyzed using both the recommended edgeR and DeSeq2 pipelines to identify an overlapping set of high confidence differentially expressed ERVs. All ERVs with an FDR below 0.05 were considered to be significantly differential.
Human peripheral blood mononuclear cells (PBMCs) from de-identified donors were obtained from AllCells (Alameda) under donor-informed consent and Alpha IRB approval obtained by AllCells (7000-SOP-045) for the study ‘Non-Mobilized Mononuclear Cell Apheresis Collection from Healthy Donors for the Research Market’. Monocytes were isolated by negative selection (Pan Monocyte Isolation Kit, Miltenyi Biotec) and nucleofected with Cas9 gRNA ribonucleoparticles as previously described55. Alt-R CRISPR RNAs (crRNAs) and Alt-trans-activating CRISPR RNA (tracrRNA) (IDT) were resuspended to 100 μM in nuclease-free duplex buffer (IDT) and annealed at equimolar concentrations for 5 min at 95° C. and 15 min at 20° C. 10 μg Cas9 (IDT Alt-R S.p. Cas9 Nuclease V3) was mixed with 2011 of the crRNA-tracrRNA complex and incubated for 20 min at room temperature before 1 μl of a 4 μM solution of electroporation enhancer (IDT) in nuclease-free duplex buffer (IDT) was added. One-million monocytes in 20 μl P3 nucleofection solution (Lonza) were added to the Cas9-crRNA-tracrRNA complex and nucleofected with a Lonza 4D-Nucleofector (4D-Nucleofector Core Unit, 4D-Nucleofector X Unit) using the settings Buffer P3, CM-137. Cells were immediately resuspended in pre-warmed medium and cultivated for 5 days. Every other day half of the medium was replaced with fresh medium.
crRNA Target Sites:
Assays for MORC3 Inhibitors that Induce an IFN Response
The following assays may be used to screen for MORC3 inhibitors that induce an IFN response:
BLaER1 human monocytes: Transdifferentiated 70,000 BLaER1 human monocytes are cultivated in RPMI 1640 Medium supplemented with 2 mM L-Glutamine, 1 mM Sodium Pyruvate, 100 U/mL Penicillin, 100 U/mL Streptomycin, 10% (v/v) heat-inactivated FCS, 10 ng/mL hrIL-3, 10 ng/mL hr-M-CSF and 100 nM Estradiol for 5 days at 37° C. and 5% CO2. The culture media is change to plain RPMI without hrIL-3, hr-M-CSF, and Estradiol. Then a given candidate MORC3 inhibitor is added thereto and incubated for about 24-48 hours at 37° C. and 5% CO2. Cell-free supernatant is harvested therefrom and an IFNB1 ELISA (R&D, DY814-05) is performed according to the manufacturer's protocol and Type I IFN Bioassay (HEK-Blue™ IFN-α/(3 Cells, Invivogen, hkb-ifnab) against a recombinant protein standard as recommended by the provider and the results are compared to a control. Gene-deficient BLaER1 monocytes (e.g., TBK1−/IKKe−, IKKa−/b−, or IRF3−/7−) may be used to validate that the IFN response induced by a candidate MORC3 inhibitor mirrors the IFN response induced by a genetic MORC3 deficiency.
Primary human monocytes: PBMCs are isolated from peripheral blood of human donors and overlaid with 13 ml of Ficoll solution (Millipore Sigma, GE17-1440-02) and 25 ml of anti-coagulated peripheral blood. The cells are pelletized, e.g., at about 2000 rpm for 20 minutes at 22° C. to result in a pellet of and a white disc on top of the ficoll layer. The disc is aspirated from slightly above with a 10 ml pipet and transferred to a new tube. NaCl is added thereto to give a final volume of 50 ml. The mixture is spun at 450 rcf for 7 min. The pellet is resuspended in 10 ml of erythrocyte lysis solution (e.g., 1 mL BD Pharm Lysis concentrate and 9 ml H2O). Cells are lysed for 5 min. Then NaCl is added to give a final volume of 50 ml. The mixture is centrifuged at 450 rcf for 7 min. The pellet is resuspended in 50 ml fresh NaCl. The cells are counted and cells to be used are spun down and resuspended in RPMI 1640 Medium supplemented with 2 mM L-Glutamine, 1 mM Sodium Pyruvate, 100 U/mL Penicillin, 100 U/mL Streptomycin, 10% (v/v) heat-inactivated FCS. CD14+ monocytes may be optionally isolated using CD14 MicroBeads, human (Miltenyi, 130-050-201). The cells are plated and the given candidate MORC3 inhibitor is added thereto and then incubated for 24-48 h at 37° C. and 5% CO2. The cell-free supernatant is harvested and an IFNB1 ELISA (R&D, DY814-05) is performed according to the manufacturer's protocol and Type I IFN Bioassay (HEK-Blue™ IFN-α/β Cells, InvivoGen, hkb-ifnab) against a recombinant protein standard as recommended by the provider and the results are compared to a control.
The following is an exemplary protocol for assessing the ATPase activity of MORC3:
Data was analyzed for statistical significant differences using GraphPad Prism 8. Gene expression values were log 2 transformed and viral titers were log 10 transformed for statistical analysis. Statistical tests are indicated in the Figure legends and were RM one-way or two-way ANOVA with Geisser-Greenhouse correction and Dunnett's post hoc test or paired, two-sided T-test. In case of two-way ANOVA the factors were genotype and stimulus. Normality of data was assumed and not tested. * p<0.05; ** p<0.01 *** p<0.001.
RNA-seq datasets were deposited at GEO.
The following references are herein incorporated by reference in their entirety with the exception that, should the scope and meaning of a term conflict with a definition explicitly set forth herein, the definition explicitly set forth herein controls:
All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified.
As used herein, a human MORC3 comprises at least 90% sequence identity to Accession No. NP_001307374 or NP_056173.1. In some embodiments, a human MORC3 comprises at least 95% sequence identity to Accession No. NP_001307374 or NP_056173.1. In some embodiments, a human MORC3 comprises at least 97% sequence identity to Accession No. NP_001307374 or NP_056173.1. In some embodiments, the sequence of a human MORC3 is NP_001307374.1 or NP_056173.1. In some embodiments, a “MORC3 protein” refers to a protein having at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, an “ICP0 protein” refers to a protein having at least about 95% sequence identity to SEQ ID NO: 2.
As used herein, the terms “subject”, “patient”, and “individual” are used interchangeably to refer to humans and non-human animals. The terms “non-human animal” and “animal” refer to all non-human vertebrates, e.g., non-human mammals and non-mammals, such as non-human primates, horses, sheep, dogs, cows, pigs, chickens, and other veterinary subjects and test animals. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
As used herein, the term “diagnosing” refers to the physical and active step of informing, i.e., communicating verbally or by writing (on, e.g., paper or electronic media), another party, e.g., a patient, of the diagnosis. Similarly, “providing a prognosis” refers to the physical and active step of informing, i.e., communicating verbally or by writing (on, e.g., paper or electronic media), another party, e.g., a patient, of the prognosis.
The use of the singular can include the plural unless specifically stated otherwise. As used in the specification and the appended claims, the singular forms “a”, “an”, and “the” can include plural referents unless the context clearly dictates otherwise.
As used herein, “and/or” means “and” or “or”. For example, “A and/or B” means “A, B, or both A and B” and “A, B, C, and/or D” means “A, B, C, D, or a combination thereof” and said “A, B, C, D, or a combination thereof” means any subset of A, B, C, and D, for example, a single member subset (e.g., A or B or C or D), a two-member subset (e.g., A and B; A and C; etc.), or a three-member subset (e.g., A, B, and C; or A, B, and D; etc.), or all four members (e.g., A, B, C, and D).
As used herein, the phrase “one or more of”, e.g., “one or more of A, B, and/or C” means “one or more of A”, “one or more of B”, “one or more of C”, “one or more of A and one or more of B”, “one or more of B and one or more of C”, “one or more of A and one or more of C” and “one or more of A, one or more of B, and one or more of C”.
As used herein, the phrase “consists essentially of” in the context of a given ingredient in a composition, means that the composition may include additional ingredients so long as the additional ingredients do not adversely impact the activity, e.g., biological or pharmaceutical function, of the given ingredient.
The phrase “comprises, consists essentially of, or consists of A” is used as a tool to avoid excess page and translation fees and means that in some embodiments the given thing at issue: comprises A, consists essentially of A, or consists of A. For example, the sentence “In some embodiments, the composition comprises, consists essentially of, or consists of A” is to be interpreted as if written as the following three separate sentences: “In some embodiments, the composition comprises A. In some embodiments, the composition consists essentially of A. In some embodiments, the composition consists of A.”
Similarly, a sentence reciting a string of alternates is to be interpreted as if a string of sentences were provided such that each given alternate was provided in a sentence by itself. For example, the sentence “In some embodiments, the composition comprises A, B, or C” is to be interpreted as if written as the following three separate sentences: “In some embodiments, the composition comprises A. In some embodiments, the composition comprises B. In some embodiments, the composition comprises C.” As another example, the sentence “In some embodiments, the composition comprises at least A, B, or C” is to be interpreted as if written as the following three separate sentences: “In some embodiments, the composition comprises at least A. In some embodiments, the composition comprises at least B. In some embodiments, the composition comprises at least C.”
As used herein, the terms “protein”, “polypeptide” and “peptide” are used interchangeably to refer to two or more amino acids linked together. Groups or strings of amino acid abbreviations are used to represent peptides. Except when specifically indicated, peptides are indicated with the N-terminus on the left and the sequence is written from the N-terminus to the C-terminus. Except when specifically indicated, peptides are indicated with the N-terminus on the left and the sequences are written from the N-terminus to the C-terminus. Similarly, except when specifically indicated, nucleic acid sequences are indicated with the 5′ end on the left and the sequences are written from 5′ to 3′.
As used herein, a given percentage of “sequence identity” refers to the percentage of nucleotides or amino acid residues that are the same between sequences, when compared and optimally aligned for maximum correspondence over a given comparison window, as measured by visual inspection or by a sequence comparison algorithm in the art, such as the BLAST algorithm, which is described in Altschul et al., (1990) J Mol Biol 215:403-410. Software for performing BLAST (e.g., BLASTP and BLASTN) analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov). The comparison window can exist over a given portion, e.g., a functional domain, or an arbitrarily selection a given number of contiguous nucleotides or amino acid residues of one or both sequences. Alternatively, the comparison window can exist over the full length of the sequences being compared. For purposes herein, where a given comparison window (e.g., over 80% of the given sequence) is not provided, the recited sequence identity is over 100% of the given sequence. Additionally, for the percentages of sequence identity of the proteins provided herein, the percentages are determined using BLASTP 2.8.0+, scoring matrix BLOSUM62, and the default parameters available at blast.ncbi.nlm.nih.gov/Blast.cgi. See also Altschul, et al., (1997) Nucleic Acids Res 25:3389-3402; and Altschul, et al., (2005) FEBS J 272:5101-5109.
Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv Appl Math 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J Mol Biol 48:443 (1970), by the search for similarity method of Pearson & Lipman, PNAS USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection.
To the extent necessary to understand or complete the disclosure of the present invention, all publications, patents, and patent applications mentioned herein are expressly incorporated by reference therein to the same extent as though each were individually so incorporated.
Having thus described exemplary embodiments of the present invention, it should be noted by those skilled in the art that the within disclosures are exemplary only and that various other alternatives, adaptations, and modifications may be made within the scope of the present invention. Accordingly, the present invention is not limited to the specific embodiments as illustrated herein, but is only limited by the following claims.
This application claims the benefit of U.S. Patent Application No. 63/148,775, filed Feb. 12, 2021, which is herein incorporated by reference in its entirety.
This invention was made with government support under Grant Number A1075039 awarded by the National Institutes of Health. The Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2022/016162 | 2/11/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63148775 | Feb 2021 | US |
