Insecticidal protein toxins from Photorhabdus

Abstract

Proteins from the genus Photorhabdus are toxic to insects upon exposure. Photorhabdus luminescens (formerly Xenorhabdus luminescens) have been found in mammalian clinical samples and as a bacterial symbiont of entomopathogenic nematodes of genus Heterorhabditis. These protein toxins can be applied to, or genetically engineered into, insect larvae food and plants for insect control.

Description

FIELD OF THE INVENTION

The present invention relates to toxins isolated from bacteria and the use of said toxins as insecticides.

BACKGROUND OF THE INVENTION

Many insects are widely regarded as pests to homeowners, to picnickers, to gardeners, and to farmers and others whose investments in agricultural products are often destroyed or diminished as a result of insect damage to field crops. Particularly in areas where the growing season is short, significant insect damage can mean the loss of all profits to growers and a dramatic decrease in crop yield. Scarce supply of particular agricultural products invariably results in higher costs to food processors and, then, to the ultimate consumers of food plants and products derived from those plants.

Preventing insect damage to crops and flowers and eliminating the nuisance of insect pests have typically relied on strong organic pesticides and insecticides with broad toxicities. These synthetic products have come under attack by the general population as being too harsh on the environment and on those exposed to such agents. Similarly in non-agricultural settings, homeowners would be satisfied to have insects avoid their homes or outdoor meals without needing to kill the insects.

The extensive use of chemical insecticides has raised environmental and health concerns for farmers, companies that produce the insecticides, government agencies, public interest groups, and the public in general. The development of less intrusive pest management strategies has been spurred along both by societal concern for the environment and by the development of biological tools which exploit mechanisms of insect management. Biological control agents present a promising alternative to chemical insecticides.

Organisms at every evolutionary development level have devised means to enhance their own success and survival. The use of biological molecules as tools of defense and aggression is known throughout the animal and plant kingdoms. In addition, the relatively new tools of the genetic engineer allow modifications to biological insecticides to accomplish particular solutions to particular problems.

One such agent, Bacillus thuringiensis (Bt), is an effective insecticidal agent, and is widely commercially used as such. In fact, the insecticidal agent of the Bt bacterium is a protein which has such limited toxicity, it can be used on human food crops on the day of harvest. To non-targeted organisms, the Bt toxin is a digestible non-toxic protein.

Another known class of biological insect control agents are certain genera of nematodes known to be vectors of transmission for insect-killing bacterial symbionts. Nematodes containing insecticidal bacteria invade insect larvae. The bacteria then kill the larvae. The nematodes reproduce in the larval cadaver. The nematode progeny then eat the cadaver from within. The bacteria-containing nematode progeny thus produced can then invade additional larvae.

In the past, insecticidal nematodes in the Steinernema and Heterorhabditis genera were used as insect control agents. Apparently, each genus of nematode hosts a particular species of bacterium. In nematodes of the Heterorhabditis genus, the symbiotic bacterium is Photorhabdus luminescens.

Although these nematodes are effective insect control agents, it is presently difficult, expensive, and inefficient to produce, maintain, and distribute nematodes for insect control.

It has been known in the art that one may isolate an insecticidal toxin from Photorhabdus luminescens that has activity only when injected into Lepidopteran and Coleopteran insect larvae. This has made it impossible to effectively exploit the insecticidal properties of the nematode or its bacterial symbiont. What would be useful would be a more practical, less labor-intensive wide-area delivery method of an insecticidal toxin which would retain its biological properties after delivery. It would be quite desirous to discover toxins with oral activity produced by the genus Photorhabdus. The isolation and use of these toxins are desirous due to efficacious reasons. Until applicants' discoveries, these toxins had not been isolated or characterized.

SUMMARY OF THE INVENTION

The native toxins are protein complexes that are produced and secreted by growing bacteria cells of the genus Photorhabdus, of interest are the proteins produced by the species Photorhabdus luminescens. The protein complexes, with a molecular size of approximately 1,000 kDa, can be separated by SDS-PAGE gel analysis into numerous component proteins. The toxins contain no hemolysin, lipase, type C phospholipase, or nuclease activities. The toxins exhibit significant toxicity upon exposure administration to a number of insects.

The present invention provides an easily administered insecticidal protein as well as the expression of toxin in a heterologous system.

The present invention also provides a method for delivering insecticidal toxins that are functional active and effective against many orders of insects.

Objects, advantages, and features of the present invention will become apparent from the following specification.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is an illustration of a match of cloned DNA isolates used as a part of sequence genes for the toxin of the present invention.

FIG. 2 is a map of three plasmids used in the sequencing process.

FIG. 3 is a map illustrating the inter-relationship of several partial DNA fragments.

FIG. 4 is an illustration of a homology analysis between the protein sequences of TcbA ii and TcaB ii proteins.

FIG. 5 is a phenogram of Photorhabdus strains. Relationship of Photorhabdus Strains was defined by rep-PCR. The upper axis of FIG. 5 measures the percentage similarity of strains based on scoring of rep-PCR products (i.e., 0.0 [no similarity] to 1.0 [100% similarity]). At the right axis, the numbers and letters indicate the various strains tested; 14=W-14, Hm=Hm, H9=H9, 7=WX-7, 1=WX-1, 2=WX-2, 88=HP88, NC-1=NC-1, 4=WX-4, 9=WX-9, 8=WX-8, 10=WX-10, WIR=WIR, 3=WX-3, 11=WX-11, 5=WX-5, 6=WX-6, 12=WX-12, x14=WX-14, 15=WX-15, Hb=Hb, B2=B2, 48 through 52=ATCC 43948 through ATCC 43952. Vertical lines separating horizontal lines indicate the degree of relatedness (as read from the extrapolated intersection of the vertical line with the upper axis) between strains or groups of strains at the base of the horizontal lines (e.g., strain W-14 is approximately 60% similar to strains H9 and Hm).

FIG. 6A is an illustration of the genomic maps of the W-14 Strain.

FIG. 6B is an illustration of the tca and tcb loci and primary gene products.

FIG. 7 is a phenogram of Photorhabdus strains as defined by rep-PCR. The upper axis of FIG. 7 measures the percentage similarity of strains based on scoring of rep-PCR products (i.e., 0.0 [no similarity] to 1.0 [100% similarity]). At the right axis, the numbers and letters indicate the various strains tested. Vertical lines separating horizontal lines indicate the degree of relatedness (as read from the extrapolated intersection of the vertical line with the upper axis) between strains or groups of strains at the base of the horizontal lines (e.g., strain Indicus is approximately 30% similar to strains MP1 and HB Oswego). Note that the Photorhabdus strains on the phenogram are as follows: 14=W-14; Hm=Hm; H9=H9; 7=WX-7; 1=WX-1; 2=WX-2; 88=HP88; NC1=NC-1; 4=WX-4; 9=WX-9; 8=WX-8; 10=WX-10; 30=W30; WIR=WIR; 3-WX-3; 11=WX-11; 5=WX-5; 6=WX-6; 12=WX-12; 15=WX-15; X14=WX-14; Hb=Hb; B2=B2; 48=ATCC 43948; 49=ATCC 43949; 50=ATCC 43950; 51=ATCC 43951; 52=ATCC 43952.

DETAILED DESCRIPTION OF THE INVENTION

The present inventions are directed to the discovery of a unique class of insecticidal protein toxins from the genus Photorhabdus that have oral toxicity against insects. A unique feature of Photorhabdus is its bioluminescence. Photorhabdus may be isolated from a variety of sources. One such source is nematodes, more particularly nematodes of the genus Heterorhabditis. Another such source is from human clinical samples from wounds, see Farmer et al. 1989 J. Clin. Microbiol. 27 pp. 1594-1600. These saprohytic strains are deposited in the American Type Culture Collection (Rockville, Md.) ATCC #s 43948, 43949, 43950, 43951, and 43952, and are incorporated herein by reference. It is possible that other sources could harbor Photorhabdus bacteria that produce insecticidal toxins. Such sources in the environment could be either terrestrial or aquatic based.

The genus Photorhabdus is taxonomically defined as a member of the Family Enterobacteriaceae, although it has certain traits atypical of this family. For example, strains of this genus are nitrate reduction negative, yellow and red pigment producing and bioluminescent. This latter trait is otherwise unknown within the Enterobacteriaceae. Photorhabdus has only recently been described as a genus separate from the Xenorhabdus (Boemare et al., 1993 Int. J. Syst. Bacteriol. 43, 249-255). This differentiation is based on DNA-DNA hybridization studies, phenotypic differences (e.g., presence (Photorhabdus) or absence (Xenorhabdus) of catalase and bioluminescence) and the Family of the nematode host (Xenorhabdus; Steinernematidae, Photorhabdus; Heterorhabditidae). Comparative, cellular fatty-acid analyses (Janse et al. 1990, Lett. Appl. Microbiol 10, 131-135; Suzuki et al. 1990, J. Gen. Appl. Microbiol., 36, 393-401) support the separation of Photorhabdus from Xenorhabdus.

In order to establish that the strain collection disclosed herein was comprised of Photorhabdus strains, the strains were characterized based on recognized traits which define Photorhabdus and differentiate it from other Enterobacteriaceae and Xenorhabdus species. (Farmer, 1984 Bergey's Manual of Systemic Bacteriology Vol. 1 pp.510-511; Akhurst and Boemare 1988, J. Gen. Microbiol. 134 pp. 1835-1845; Boemare et al. 1993 Int. J. Syst. Bacteriol. 43 pp. 249-255, which are incorporated herein by reference). The traits studied were the following: gram stain negative rods, organism size, colony pigmentation, inclusion bodies, presence of catalase, ability to reduce nitrate, bioluminescence, dye uptake, gelatin hydrolysis, growth on selective media, growth temperature, survival under anerobic conditions and motility. Fatty acid analysis was used to confirm that the strains herein all belong to the single genus Photorhabdus.

Currently, the bacterial genus Photorhabdus is comprised of a single defined species, Photorhabdus luminescens (ATCC Type strain #29999, Poinar et al., 1977, Nematologica 23, 97-102). A variety of related strains have been described in the literature (e.g., Akhurst et al. 1988 J. Gen. Microbiol., 134, 1835-1845; Boemare et al. 1993 Int. J. Syst. Bacteriol. 43 pp. 249-255; Putz et al. 1990, Appl. Environ. Microbiol., 56, 181-186). Numerous Photorhabdus strains have been characterized herein. Because there is currently only one species ( luminescens ) defined within the genus Photorhabdus, the luminescens species traits were used to characterize the strains herein. As can be seen in FIG. 5 , these strains are quite diverse. It is not unforeseen that in the future there may be other Photorhabdus species that will have some of the attributes of the luminescens species as well as some different characteristics that are presently not defined as a trait of Photorhabdus luminescens . However, the scope of the invention herein is to any Photorhabdus species or strains which produce proteins that have functional activity as insect control agents, regardless of other traits and characteristics.

Furthermore, as is demonstrated herein, the bacteria of the genus Photorhabdus produce proteins that have functional activity as defined herein. Of particular interest are proteins produced by the species Photorhabdus luminescens . The inventions herein should in no way be limited to the strains which are disclosed herein. These strains illustrate for the first time that proteins produced by diverse isolates of Photorhabdus are toxic upon exposure to insects. Thus, included within the inventions described herein are the strains specified herein and any mutants thereof, as well as any strains or species of the genus Photorhabdus that have the functional activity described herein.

There are several terms that are used herein that have a particular meaning and are as follows:

By “functional activity” it is meant herein that the protein toxin(s) function as insect control agents in that the proteins are orally active, or have a toxic effect, or are able to disrupt or deter feeding, which may or may not cause death of the insect. When an insect comes into contact with an effective amount of toxin delivered via transgenic plant expression, formulated protein compositions(s), sprayable protein composition(s), a bait matrix or other delivery system, the results are typically death of the insect, or the insects do not feed upon the source which makes the toxins available to the insects.

By the use of the term “genetic material” herein, it is meant to include all genes, nucleic acid, DNA and RNA.

By “homolog” it is meant an amino acid sequence that is identified as possessing homology to a reference W-14 toxin polypeptide amino acid sequence.

By “homology” it is meant an amino acid sequence that has a similarity index of at least 33% and/or an identity index of at least 26% to a reference W-14 toxin polypeptide amino acid sequence, as scored by the GAP algorithm using the B10sum 62 protein scoring matrix (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.).

By “identity” is meant an amino acid sequence that contains an identical residue at a given position, following alignment with a reference W-14 toxin polypeptide amino acid sequence by the GAP algorithm.

The protein toxins discussed herein are typically referred to as “insecticides”. By insecticides it is meant herein that the protein toxins have a “functional activity” as further defined herein and are used as insect control agents.

By the use of the term “oligonucleotides” it is meant a macromolecule consisting of a short chain of nucleotides of either RNA or DNA. Such length could be at least one nucleotide, but typically are in the range of about 10 to about 12 nucleotides. The determination of the length of the oligonucleotide is well within the skill of an artisan and should not be a limitation herein. Therefore, oligonucleotides may be less than 10 or greater than 12.

By the use of the term “Photorhabdus toxin” it is meant any protein produced by a Photorhabdus microorganism strain which has functional activity against insects, where the Photorhabdustoxin could be formulated as a sprayable composition, expressed by a transgenic plant, formulated as a bait matrix, delivered via baculovirus, or delivered by any other applicable host or delivery system.

By the use of the term “toxic” or “toxicity” as used herein it is meant that the toxins produced by Photorhabdus have “functional activity” as defined herein.

By “truncated peptide” it is meant herein to include any peptide that is fragment(s) of the peptides observed to have functional activity.

By “substantial sequence homology” is meant either: a DNA fragment having a nucleotide sequence sufficiently similar to another DNA fragment to produce a protein having similar biochemical properties; or a polypeptide having an amino acid sequence sufficiently similar to another polypeptide to exhibit similar biochemical properties.

Fermentation broths from selected strains reported in Table 20 were used to determine the following: breadth of insecticidal toxin production by the Photorhabdus genus, the insecticidal spectrum of these toxins, and to provide source material to purify the toxin complexes. The strains characterized herein have been shown to have oral toxicity against a variety of insect orders. Such insect orders include but are not limited to Coleoptera, Homoptera, Lepidoptera, Diptera, Acarina, Hymenoptera and Dictyoptera.

As with other bacterial toxins, the rate of mutation of the bacteria in a population causes many related toxins slightly different in sequence to exist. Toxins of interest here are those which produce protein complexes toxic to a variety of insects upon exposure, as described herein. Preferably, the toxins are active against Lepidoptera, Coleoptera, Homopotera, Diptera, Hymenoptera, Dictyoptera and Acarina. The inventions herein are intended to capture the protein toxins homologous to protein toxins produced by the strains herein and any derivative strains thereof, as well as any protein toxins produced by Photorhabdus. These homologous proteins may differ in sequence, but do not differ in function from those toxins described herein. Homologous toxins are meant to include protein complexes of between 300 kDa to 2,000 kDa and are comprised of at least two (2) subunits, where a subunit is a peptide which may or may not be the same as the other subunit. Various protein subunits have been identified and are taught in the Examples herein. Typically, the protein subunits are between about 18 kDa to about 230 kDa; between about 160 kDa to about 230 kDa; 100 kDa to 160 kDa; about 80 kDa to about 100 kDa; and about 50 kDa to about 80 kDa.

As discussed above, some Photorhabdus strains can be isolated from nematodes. Some nematodes, elongated cylindrical parasitic worms of the phylum Nematoda, have evolved an ability to exploit insect larvae as a favored growth environment. The insect larvae provide a source of food for growing nematodes and an environment in which to reproduce. One dramatic effect that follows invasion of larvae by certain nematodes is larval death. Larval death results from the presence of, in certain nematodes, bacteria that produce an insecticidal toxin which arrests larval growth and inhibits feeding activity.

Interestingly, it appears that each genus of insect parasitic nematode hosts a particular species of bacterium, uniquely adapted for symbiotic growth with that nematode. In the interim since this research was initiated, the name of the bacterial genus Xenorhabdus was reclassified into the Xenorhabdus and the Photorhabdus. Bacteria of the genus Photorhabdus are characterized as being symbionts of Heterorhabditus nematodes while Xenorhabdus species are symbionts of the Steinernema species. This change in nomenclature is reflected in this specification, but in no way should a change in nomenclature alter the scope of the inventions described herein.

The peptides and genes that are disclosed herein are named according to the guidelines recently published in the Journal of Bacteriology “Instructions to Authors” p. i-xii (January 1996), which is incorporated herein by reference. The following peptides and genes were isolated from Photorhabdus strain W-14.

TABLE 1
Peptide/Gene Nomenclature
Toxin Complex
1	2	3	4
Peptide	Peptide	Gene	Gene
Name	Sequence ID No.*	Name	Sequence ID No.*
tca genomic region
TcaA	34 c	tcaA	33
TcaA i	pro-peptide	tcaA	—
TcaA ii	[15] a , 34 c	tcaA	—
TcaA iii	[4] a , 35 c	tcaA	—
TcaA iv	[62] a	tcaA	—
TcaB	[3] a , (19, 20) b , 26 c	tcaB	25
TcaB i	[3] a , (19, 20) b , 28 c	tcaB	27
TcaB ii	[5] a , 30 c	tcaB	29
TcaC	[2] a , 32 c	tcaC	31
tcb genomic region
TcbA	12 c , [16] a , (21,	tcbA	11
	22, 23, 24) b
TcbA i	pro-peptide	tcbA	—
TcbA ii	[1] a , (21, 22, 23,	tcbA	52
	24) b , 53 c
TcbA iii	[40] a , 55 c	tcbA	54
tcc genomic region
TccA	[8] a , 57 c	tccA	56
TccB	[7] a , 59 c	tccB	58
TccC	61 c	tccC	60
tcd genomic region
TcdA	(17, 18, 37, 38,	tcdA	(36) d , 46
	39, 42, 43) b , 47 c
TcdA i	pro-peptide	tcdA	—
TcdA ii	[13] a , (17, 18, 37,	tcdA	48
	38, 39) b , 49 c
TcdA iii	[41] a , (42, 43) b ,	tcdA	50
	51 c
TcdB	[14] a	tcdB	—
a Sequence ID No.'s in brackets are peptide N-termini;
b Numbers in parentheses are N-termini of internal peptide tryptic fragments
c deduced from gene sequence
d internal gene fragment

The sequences listed above are grouped by genomic region. More specifically, the Photorhabdus luminesence bacteria (W-14) has at least four distinct genomic regions- tca, tcb, tcc and tcd. As can be seen in Table 1, peptide products are produced from these distinct genomic regions. Furthermore, as illustrated in the Examples, specifically Examples 15 and 21, individual gene products produced from three genomic regions are associated with insect activity. There is also considerable homology between these four genomic regions.

As is further illustrated in the Examples, the tcbA gene was expressed in E. coli as two possible biological active protein fragments (TcbA and TcbAii/iii). The tcda gene was also expressed in E. coli . As illustrated in Example 16, when the native unprocessed TcbA toxin was treated with the endogeneous metalloproteases or insect gut contents containing proteases, the TcbA protein toxin was processed into smaller subunits that were less than the size of the native peptides and Southern Corn Rootworm activity increased. The smaller toxin peptides remained associated as part of a toxin complex. It may be desirable in some situations to increase activation of the toxin(s) by proteolytic processing or using truncated peptides. Thus, it may be more desirable to use truncated peptide(s) in some applications, i.e., commercial transgenic plant applications.

In addition to the W-14 strain, there are other species within the Photorhabdus genus that have functional activity which is differential (specifically see Tables 20 and 36). Even though there is differential activity, the amino acid sequences in some cases have substantial sequence homology. Moreover, the molecular probes indicate that some genes contained in the strains are homologous to the genes contained in the W-14 strain. In fact all of the strains illustrated herein have one or more homologs of W-14 toxin genes. The antibody data in Example 26 and the N-terminal sequence data in Example 25 further support the conclusion that there is homology and identity (based on amino acid sequence) between the protein toxin(s) produced by these strains. At the molecular level, the W-14 gene probes indicated that the homologs or the W-14 genes themselves (Tables 37, 38, and 39) are dispersed throughout the Photorhabdus genus. Further, it is possible that new toxin genes exist in other strains which are not homologous to W-14, but maintain overall protein attributes (see specifically Examples 14 and 25).

Even though there is homology or identity between toxin genes produced by the Photorhabdus strains, the strains themselves are quite diverse. Using polymerase chain reaction technology further discussed in Example 22, most of the strains illustrated herein are quite distinguishable. For example as can be seen in FIGS. 5 , the percentage relative similarity of some of the strains, such as HP8B and NC-1, was about 0.8, which indicates that the strains are similar, while HP88 and Hb was about 0.1, which indicates substantial diversity. Therefore, even though the insect toxin genes or gene products that the strains produce are the same or similar, the strains themselves are diverse.

In view of the data further disclosed in the Examples and discussions herein, it is clear that a new and unique family of insecticidal protein toxin(s) has been discovered. It has been further illustrated herein that these toxin(s) widely exist within bacterial strains of the Photorhabdus genus. It may also be the case that these toxin genes widely exist within the family Enterobacteracaea. Antibodies prepared as described in Example 21 or gene probes prepared as described in Example 25 may be used to further screen for bacterial strains within the family Enterobacteracaea that produce the homologous toxin(s) that have functional activity. It may also be the case that specific primer sets exist that could facilitate the identification of new genes within the Photorhabdus genus or family Enterobacteracaea.

As stated above, the antibodies may be used to rapidly screen bacteria of the genus Photorhabdus or the family Enterbacteracaea for homologous toxin products as illustrated in Example 26. Those skilled in the art are quite familiar with the use of antibodies as an analysis or screening tool (see U.S. Pat. No. 5,430,137, which is incorporated herein by reference). Moreover, it is generally accepted in the literature that antibodies are elicited against 6 to 20 amino acid residue segments that tend to occupy exposed surface of polypeptides (Current Protocols in Immunology, Coligan et al, National Institutes of Health, John Wiley & Sons, Inc.). Usually the amino acid consist of contiguous amino acid residues, however, in certain cases they may be formed by non-contiguous amino acids that are constrained by specific conformation. The amino acid segments recognized by antibodies are highly specific and commonly referred to epitopes. The amino acid fragment can be generated by chemical and/or enzymatic cleavage of the native protein, by automated, solid-phase peptide synthesis, or by production from genetic engineering organisms. Polypeptide fragments can be isolated by a variety and/or combination of HPLC and FPLC chromatographic methods known in the art. Selection of polypeptide fragment can be aided by the use of algorithms, for example Kyte and Doolittle, 1982, Journal of Molecular Biology 157: 105-132 and Chou and Fasman, 1974, Biochemistry 13: 222-245, that predict those sequences most likely to exposed on the surface of the protein. For preparation of immunogen containing the polypeptide fragment of interest, in general, polypeptides are covalently coupled using chemical reactions to carrier proteins such as keyhole limpet hemocyanin via free amino (lysine), sulfhydyl (cysteine), phenolic (tyrosine) or carboxylic (aspartate or glutamate) groups. Immunogen with an adjuvant is injected in animals, such as mice or rabbits, or chickens to elicit an immune response against the immunogen. Analysis of antibody titer in antisera of inject animals against polypeptide fragment can be determined by a variety of immunological methods such as ELISA and Western blot. Alternatively, monoclonal antibodies can be prepared using spleen cells of the injected animal for fusion with tumor cells to produce immortalized hybridomas cells producing a single antibody species. Hybridomas cells are screened using immunological methods to select lines that produce a specific antibody to the polypeptide fragment of interest. Purification of antibodies from different sources can be performed by a variety of antigen affinity or antibody affinity columns or other chromatographic HPLC or FPLC methods.

The toxins described herein are quite unique in that the toxins have functional activity, which is key to developing an insect management strategy. In developing an insect management strategy, it is possible to delay or circumvent the protein degradation process by injecting a protein directly into an organism, avoiding its digestive tract. In such cases, the protein administered to the organism will retain its function until it is denatured, non-specifically degraded, or eliminated by the immune system in higher organisms. Injection into insects of an insecticidal toxin has potential application only in the laboratory, and then only on large insects which are easily injected. The observation that the insecticidal protein toxins herein described exhibits their toxic activity after oral ingestion or contact with the toxins permits the development of an insect management plan based solely on the ability to incorporate the protein toxins into the insect diet. Such a plan could result in the production of insect baits.

The Photorhabdus toxins may be administered to insects in a purified form. The toxins may also be delivered in amounts from about 1 to about 100 mg/liter of broth. This may vary upon formulation condition, conditions of the inoculum source, techniques for isolation of the toxin, and the like. The toxins may be administered as an exudate secretion or cellular protein originally expressed in a heterologous prokaryotic or eukaryotic host. Bacteria are typically the hosts in which proteins are expressed. Eukaryotic hosts could include but are not limited to plants, insects and yeast. Alternatively, the toxins may be produced in bacteria or transgenic plants in the field or in the insect by a baculovirus vector. Typically the toxins will be introduced to the insect by incorporating one or more of the toxins into the insects' feed.

Complete lethality to feeding insects is useful but is not required to achieve useful toxicity. If the insects avoid the toxin or cease feeding, that avoidance will be useful in some applications, even if the effects are sublethal. For example, if insect resistant transgenic crop plants are desired, a reluctance of insects to feed on the plants is as useful as lethal toxicity to the insects since the ultimate objective is protection of the plants rather than killing the insect.

There are many other ways in which toxins can be incorporated into an insect's diet. As an example, it is possible to adulterate the larval food source with the toxic protein by spraying the food with a protein solution, as disclosed herein. Alternatively, the purified protein could be genetically engineered into an otherwise harmless bacterium, which could then be grown in culture, and either applied to the food source or allowed to reside in the soil in an area in which insect eradication was desirable. Also, the protein could be genetically engineered directly into an insect food source. For instance, the major food source of many insect larvae is plant material.

By incorporating genetic material that encodes the insecticidal properties of the Photorhabdus toxins into the genome of a plant eaten by a particular insect pest, the adult or larvae would die after consuming the food plant. Numerous members of the monocotyledonous and dictyledenous genera have been transformed. Transgenic agronmonic crops as well as fruits and vegetables are of commercial interest. Such crops include but are not limited to maize, rice, soybeans, canola, sunflower, alfalfa, sorghum, wheat, cotton, peanuts, tomatoes, potatoes, and the like. Several techniques exist for introducing foreign genetic material into plant cells, and for obtaining plants that stably maintain and express the introduced gene. Such techniques include acceleration of genetic material coated onto microparticles directly into cells (U.S. Pat. No. 4,945,050 to Cornell and U.S. Pat. No. 5,141,131 to DowElanco). Plants may be transformed using Agrobacterium technology, see U.S. Pat. No. 5,177,010 to University of Toledo, U.S. Pat. No. 5,104,310 to Texas A&M, European Patent Application 0131624B1, European Patent Applications 120516, 159418B1 and 176,112 to Schilperoot, U.S. Pat. Nos. 5,149,645, 5,469,976, 5,464,763 and 4,940,838 and 4,693,976 to Schilperoot, European Patent Applications 116718, 290799, 320500 all to MaxPlanck, European Patent Applications 604662 and 627752 to Japan Tobacco, European Patent Applications 0267159, and 0292435 and U.S. Pat. No. 5,231,019 all to Ciba Geigy, U.S. Pat. Nos. 5,463,174 and 4,762,785 both to Calgene, and U.S. Pat. Nos. 5,004,863 and 5,159,135 both to Agracetus. Other transformation technology includes whiskers technology, see U.S. Pat. Nos. 5,302,523 and 5,464,765 both to Zeneca. Electroporation technology has also been used to transform plants, see WO 87/06614 to Boyce Thompson Institute, U.S. Pat. Nos. 5,472,869 and 5,384,253 both to Dekalb, WO9209696 and WO9321335 both to PGS. All of these transformation patents and publications are incorporated by reference. In addition to numerous technologies for transforming plants, the type of tissue which is contacted with the foreign genes may vary as well. Such tissue would include but would not be limited to embryogenic tissue, callus tissue type I and II, hypocotyl, meristem, and the like. Almost all plant tissues may be transformed during dedifferentiation using appropriate techniques within the skill of an artisan.

Another variable is the choice of a selectable marker. The preference for a particular marker is at the discretion of the artisan, but any of the following selectable markers may be used along with any other gene not listed herein which could function as a selectable marker. Such selectable markers include but are not limited to aminoglycoside phosphotransferase gene of transposon Tn5 (Aph II) which encodes resistance to the antibiotics kanamycin, neomycin and G418, as well as those genes which code for resistance or tolerance to glyphosate; hygromycin; methotrexate; phosphinothricin (bialophos); imidazolinones, sulfonylureas and triazolopyrimidine herbicides, such as chlorosulfuron; bromoxynil, dalapon and the like.

In addition to a selectable marker, it may be desirous to use a reporter gene. In some instances a reporter gene may be used without a selectable marker. Reporter genes are genes which are typically not present or expressed in the recipient organism or tissue. The reporter gene typically encodes for a protein which provides for some phenotypic change or enzymatic property. Examples of such genes are provided in K. Weising et al. Ann. Rev. Genetics, 22, 421 (1988), which is incorporated herein by reference. A preferred reporter gene is the glucuronidase (GUS) gene.

Regardless of transformation technique, the gene is preferably incorporated into a gene transfer vector adapted to express the Photorhabdus toxins in the plant cell by including in the vector a plant promoter. In addition to plant promoters, promoters from a variety of sources can be used efficiently in plant cells to express foreign genes. For example, promoters of bacterial origin, such as the octopine synthase promoter, the nopaline synthase promoter, the mannopine synthase promoter; promoters of viral origin, such as the cauliflower mosaic virus (35S and 19S), reengineered 35S, known as 35T (see PCT/US96/16582, WO 97/13402 published Apr. 17, 1997, which is incorporated herein by reference) and the like may be used.

Plant promoters include, but are not limited to ribulose-1,6-bisphosphate (RUBP) carboxylase small subunit (ssu), beta-conglycinin promoter, phaseolin promoter, ADH promoter, heat-shock promoters and tissue specific promoters. Promoters may also contain certain enhancer sequence elements that may improve the transcription efficiency. Typical enhancers include but are not limited to Adh-intron 1 and Adh-intron 6. Constitutive promoters may be used. Constitutive promoters direct continuous gene expression in all cells types and at all times (e.g., actin, ubiquitin, CaMV 35S). Tissue specific promoters are responsible for gene expression in specific cell or tissue types, such as the leaves or seeds (e.g., zein, oleosin, napin, ACP) and these promoters may also be used. Promoters may also be are active during a certain stage of the plants' development as well as active in plant tissues and organs. Examples of such promoters include but are not limited to pollen-specific, embryo specific, corn silk specific, cotton fiber specific, root specific, seed endosperm specific promoters and the like.

Under certain circumstances it may be desirable to use an inducible promoter. An inducible promoter is responsible for expression of genes in response to a specific signal, such as: physical stimulus (heat shock genes); light (RUBP carboxylase); hormone (Em); metabolites; and stress. Other desirable transcription and translation elements that function in plants may be used. Numerous plant-specific gene transfer vectors are known to the art.

In addition, it is known that to obtain high expression of bacterial genes in plants it is preferred to reengineer the bacterial genes so that they are more efficiently expressed in the cytoplasm of plants. Maize is one such plant where it is preferred to reengineer the bacterial gene(s) prior to transformation to increase the expression level of the toxin in the plant. One reason for the reengineering is the very low G+C content of the native bacterial gene(s) (and consequent skewing towards high A+T content). This results in the generation of sequences mimicking or duplicating plant gene control sequences that are known to be highly A+T rich. The presence of some A+T-rich sequences within the DNA of the gene(s) introduced into plants (e.g., TATA box regions normally found in gene promoters) may result in aberrant transcription of the gene(s). On the other hand, the presence of other regulatory sequences residing in the transcribed mRNA (e.g., polyadenylation signal sequences (AAUAAA), or sequences complementary to small nuclear RNAs involved in pre-mRNA splicing) may lead to RNA instability. Therefore, one goal in the design of reengineered bacterial gene(s), more preferably referred to as plant optimized gene(s), is to generate a DNA sequence having a higher G+C content, and preferably one close to that of plant genes coding for metabolic enzymes. Another goal in the design of the plant optimized gene(s) is to generate a DNA sequence that not only has a higher G+C content, but by modifying the sequence changes, should be made so as to not hinder translation.

An example of a plant that has a high G+C content is maize. The table below illustrates how high the G+C content is in maize. As in maize, it is thought that G+C content in other plants is also high.

TABLE 2
Compilation of G + C Contents of Protein Coding Regions
of Maize Genes
Protein Class a	Range % G + C	Mean % G + C b
Metabolic Enzymes (40)	44.4-75.3	59.0 (8.0)
Storage Proteins
Group I (23)	46.0-51.9	48.1 (1.3)
Group II (13)	60.4-74.3	67.5 (3.2)
Group I + II (36)	46.0-74.3	55.1 (9.6) c
Structural Proteins (18)	48.6-70.5	63.6 (6.7)
Regulatory Proteins (5)	57.2-68.9	62.0 (4.9)
Uncharacterized Proteins (9)	41.5-70.3	64.3 (7.2)
All Proteins (108)	44.4-75.3	60.8 (5.2)
a Number of genes in class given in parentheses.
b Standard deviations given in parentheses.
c Combined groups mean ignored in calculation of overall mean.

For the data in Table 2, coding regions of the genes were extracted from GenBank (Release 71) entries, and base compositions were calculated using the MacVector™ program (IBI, New Haven, Conn.). Intron sequences were ignored in the calculations. Group I and II storage protein gene sequences were distinguished by their marked difference in base composition.

Due to the plasticity afforded by the redundancy of the genetic code (i.e., some amino acids are specified by more than one codon), evolution of the genomes of different organisms or classes or organisms has resulted in differential usage of redundant codons. This “codon bias” is reflected in the mean base composition of protein coding regions. For example, organisms with relatively low G+C contents utilize codons having A or T in the third position of redundant codons, whereas those having higher G+C contents utilize codons having G or C in the third position. It is thought that the presence of “minor” codons within a gene's mRNA may reduce the absolute translation rate of that mRNA, especially when the relative abundance of the charged tRNA corresponding to the minor codon is low. An extension of this is that the diminution of translation rate by individual minor codons would be at least additive for multiple minor codons. Therefore, mRNAs having high relative contents of minor codons would have correspondingly low translation rates. This rate would be reflected by the synthesis of low levels of the encoded protein.

In order to reengineer the bacterial gene(s), the codon bias of the plant is determined. The codon bias is the statistical codon distribution that the plant uses for coding its proteins. After determining the bias, the percent frequency of the codons in the gene(s) of interest is determined. The primary codons preferred by the plant should be determined as well as the second and third choice of preferred codons. The amino acid sequence of the protein of interest is reverse translated so that the resulting nucleic acid sequence codes for the same protein as the native bacterial gene, but the resulting nucleic acid sequence corresponds to the first preferred codons of the desired plant. The new sequence is analyzed for restriction enzyme sites that might have been created by the modification. The identified sites are further modified by replacing the codons with second or third choice preferred codons. Other sites in the sequence which could affect the transcription or translation of the gene of interest are the exon:intron 5′ or 3′ junctions, poly A addition signals, or RNA polymerase termination signals. The sequence is further analyzed and modified to reduce the frequency of TA or GC doublets. In addition to the doublets, G or C sequence blocks that have more than about four residues that are the same can affect transcription of the sequence. Therefore, these blocks are also modified by replacing the codons of first or second choice, etc. with the next preferred codon of choice. It is preferred that the plant optimized gene(s) contains about 63% of first choice codons, between about 22% to about 37% second choice codons, and between 15% and 0% third choice codons, wherein the total percentage is 100%. Most preferred the plant optimized gene(s) contain about 63% of first choice codons, at least about 22% second choice codons, about 7.5% third choice codons, and about 7.5% fourth choice codons, wherein the total percentage is 100%. The method described above enables one skilled in the art to modify gene(s) that are foreign to a particular plant so that the genes are optimally expressed in plants. The method is further illustrated in application PCT/US96/16582, WO 97/13402 published Apr. 17, 1997.

Thus, in order to design plant optimized gene(s) the amino acid sequence of the toxins are reverse translated into a DNA sequence, utilizing a nonredundant genetic code established from a codon bias table compiled for the gene DNA sequence for the particular plant being transformed. The resulting DNA sequence, which is completely homogeneous in codon usage, is further modified to establish a DNA sequence that, besides having a higher degree of codon diversity, also contains strategically placed restriction enzyme recognition sites, desirable base composition, and a lack of sequences that might interfere with transcription of the gene, or translation of the product mRNA.

It is theorized that bacterial genes may be more easily expressed in plants if the bacterial genes are expressed in the plastids. Thus, it may be possible to express bacterial genes in plants, without optimizing the genes for plant expression, and obtain high express of the protein. See U.S. Pat. Nos. 4,762,785; 5,451,513 and 5,545,817, which are incorporated herein by reference.

One of the issues regarding commercial exploiting transgenic plants is resistance management. This is of particular concern with Bacillus thuringiensis toxins. There are numerous companies commerically exploiting Bacillus thuringiensis and there has been much concern about Bt toxins becoming resistant. One strataegy for insect resistant management would be to combine the toxins produced by Photorhabdus with toxins such as Bt, vegetative insect proteins (Ciba Geigy) or other toxins. The combinations could be formulated for a sprayable application or could be molecular combinations. Plants could be transformed with Photorhabdus genes that produce insect toxins and other insect toxin genes such as Bt as with other insect toxin genes such as Bt.

European Patent Application 0400246A1 describes transformation of 2 Bt in a plant, which could be any 2 genes. Another way to produce a transgenic plant that contains more than one insect resistant gene would be to produce two plants, with each plant containing an insect resistant gene. These plants would be backcrossed using traditional plant breeding techniques to produce a plant containing more than one insect resistant gene.

In addition to producing a transformed plant containing plant optimized gene(s), there are other delivery systems where it may be desirable to reengineer the bacterial gene(s). Along the same lines, a genetically engineered, easily isolated protein toxin fusing together both a molecule attractive to insects as a food source and the insecticidal activity of the toxin may be engineered and expressed in bacteria or in eukaryotic cells using standard, well-known techniques. After purification in the laboratory such a toxic agent with “built-in” bait could be packaged inside standard insect trap housings.

Another delivery scheme is the incorporation of the genetic material of toxins into a baculovirus vector. Baculoviruses infect particular insect hosts, including those desirably targeted with the Photorhabdus toxins. Infectious baculovirus harboring an expression construct for the Photorhabdus toxins could be introduced into areas of insect infestation to thereby intoxicate or poison infected insects.

Transfer of the insecticidal properties requires nucleic acid sequences encoding the coding the amino acid sequences for the Photorhabdus toxins integrated into a protein expression vector appropriate to the host in which the vector will reside. One way to obtain a nucleic acid sequence encoding a protein with insecticidal properties is to isolate the native genetic material which produces the toxins from Photorhabdus, using information deduced from the toxin's amino acid sequence, large portions of which are set forth below. As described below, methods of purifying the proteins responsible for toxin activity are also disclosed.

Using N-terminal amino acid sequence data, such as set forth below, one can construct oligonucleotides complementary to all, or a section of, the DNA bases that encode the first amino acids of the toxin. These oligonucleotides can be radiolabeled and used as molecular probes to isolate the genetic material from a genomic genetic library built from genetic material isolated from strains of Photorhabdus. The genetic library can be cloned in plasmid, cosmid, phage or phagemid vectors. The library could be transformed into Escherichia coli and screened for toxin production by the transformed cells using antibodies raised against the toxin or direct assays for insect toxicity.

This approach requires the production of a battery of oligonucleotides, since the degenerate genetic code allows an amino acid to be encoded in the DNA by any of several three-nucleotide combinations. For example, the amino acid arginine can be encoded by nucleic acid triplets CGA, CGC, CGG, CGT, AGA, and AGG. Since one cannot predict which triplet is used at those positions in the toxin gene, one must prepare oligonucleotides with each potential triplet represented. More than one DNA molecule corresponding to a protein subunit may be necessary to construct a sufficient number of oligonucleotide probes to recover all of the protein subunits necessary to achieve oral toxicity.

From the amino acid sequence of the purified protein, genetic materials responsible for the production of toxins can readily be isolated and cloned, in whole or in part, into an expression vector using any of several techniques well-known to one skilled in the art of molecular biology. A typical expression vector is a DNA plasmid, though other transfer means including, but not limited to, cosmids, phagemids and phage are also envisioned. In addition to features required or desired for plasmid replication, such as an origin of replication and antibiotic resistance or other form of a selectable marker such as the bar gene of Streptomyces hygroscopicus or viridochromogenes , protein expression vectors normally additionally require an expression cassette which incorporates the cis-acting sequences necessary for transcription and translation of the gene of interest. The cis-acting sequences required for expression in prokaryotes differ from those required in eukaryotes and plants.

A eukaryotic expression cassette requires a transcriptional promoter upstream (5′) to the gene of interest, a transcriptional termination region such as a poly-A addition site, and a ribosome binding site upstream of the gene of interest's first codon. In bacterial cells, a useful transcriptional promoter that could be included in the vector is the T7 RNA Polymerase-binding promoter. Promoters, as previously described herein, are known to efficiently promote transcription of mRNA. Also upstream from the gene of interest the vector may include a nucleotide sequence encoding a signal sequence known to direct a covalently linked protein to a particular compartment of the host cells such as the cell surface.

Insect viruses, or baculoviruses, are known to infect and adversely affect certain insects. The affect of the viruses on insects is slow, and viruses do not stop the feeding of insects. Thus viruses are not viewed as being useful as insect pest control agents. Combining the Photorhabdus toxins genes into a baculovirus vector could provide an efficient way of transmitting the toxins while increasing the lethality of the virus. In addition, since different baculoviruses are specific to different insects, it may be possible to use a particular toxin to selectively target particularly damaging insect pests. A particularly useful vector for the toxins genes is the nuclear polyhedrosis virus. Transfer vectors using this virus have been described and are now the vectors of choice for transferring foreign genes into insects. The virus-toxin gene recombinant may be constructed in an orally transmissible form. Baculoviruses normally infect insect victims through the mid-gut intestinal mucosa. The toxin gene inserted behind a strong viral coat protein promoter would be expressed and should rapidly kill the infected insect.

In addition to an insect virus or baculovirus or transgenic plant delivery system for the protein toxins of the present invention, the proteins may be encapsulated using Bacillus thuringiensis encapsulation technology such as but not limited to U.S. Pat. Nos. 4,695,455; 4,695,462; 4,861,595 which are all incorporated herein by reference. Another delivery system for the protein toxins of the present invention is formulation of the protein into a bait matrix, which could then be used in above and below ground insect bait stations. Examples of such technology include but are not limited to PCT Patent Application WO 93/23998, which is incorporated herein by reference.

As is described above, it might become necessary to modify the sequence encoding the protein when expressing it in a non-native host, since the codon preferences of other hosts may differ from that of Photorhabdus. In such a case, translation may be quite inefficient in a new host unless compensating modifications to the coding sequence are made. Additionally, modifications to the amino acid sequence might be desirable to avoid inhibitory cross-reactivity with proteins of the new host, or to refine the insecticidal properties of the protein in the new host. A genetically modified toxin gene might encode a toxin exhibiting, for example, enhanced or reduced toxicity, altered insect resistance development, altered stability, or modified target species specificity.

In addition to the Photorhabdus genes encoding the toxins, the scope of the present invention is intended to include related nucleic acid sequences which encode amino acid biopolymers homologous to the toxin proteins and which retain the toxic effect of the Photorhabdus proteins in insect species after oral ingestion.

For instance, the toxins used in the present invention seem to first inhibit larval feeding before death ensues. By manipulating the nucleic acid sequence of Photorhabdus toxins or its controlling sequences, genetic engineers placing the toxin gene into plants could modulate its potency or its mode of action to, for example, keep the eating-inhibitory activity while eliminating the absolute toxicity to the larvae. This change could permit the transformed plant to survive until harvest without having the unnecessarily dramatic effect on the ecosystem of wiping out all target insects. All such modifications of the gene encoding the toxin, or of the protein encoded by the gene, are envisioned to fall within the scope of the present invention.

Other envisioned modifications of the nucleic acid include the addition of targeting sequences to direct the toxin to particular parts of the insect larvae for improving its efficiency.

Strains W-14, ATCC 55397, 43948, 43949, 43950, 43951, 43952 have been deposited in the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 USA. Amino acid and nucleotide sequence data for the W-14 native toxin (ATCC 55397) is presented below. Isolation of the genomic DNA for the toxins from the bacterial hosts is also exemplified herein. The other strains identified herein have been deposited with the United States Department of Agriculture, 1815 North University Drive, Peoria, Ill. 61604. The deposits were made under the Budapest Treaty. The deposited strains and the corresponding deposit numbers are indicated in the following table:

strain name    deposit number
W-14           ATCC 55397
WX1            NRRL B-21710
WX2            NRRL B-21711
WX3            NRRL B-21712
WX4            NRRL B-21713
WX5            NRRL B-21714
WX6            NRRL B-21715
WX7            NRRL B-21716
WX8            NRRL B-21717
WX9            NRRL B-21718
WX10           NRRL B-21719
WX11           NRRL B-21720
WX12           NRRL B-21721
WX14           NRRL B-21722
WX15           NRRL B-21723
H9             NRRL B-21727
Hb             NRRL B-21726
Hm             NRRL B-21725
HP88           NRRL B-21724
NC-1           NRRL B-21728
W30            NRRL B-21729
WIR            NRRL B-21730
B2             NRRL B-21731
ATCC 43948     ATCC 55878
ATCC 43949     ATCC 55879
ATCC 43950     ATCC 55880
ATCC 43951     ATCC 55881
ATCC 43952     ATCC 55882
DEPI           NRRL B-21707
DEP2           NRRL B-21708
DEP3           NRRL B-21709
P. zealandrica NRRL B-21683
P. hepialus    NRRL B-21684
HB-Arg         NRRL B-21685
HB Oswego      NRRL B-21686
Hb Lewiston    NRRL B-21687
K-122          NRRL B-21688
HMGD           NRRL B-21689
Indicus        NRRL B-21690
GD             NRRL B-21691
PWH-5          NRRL B-21692
Megidis        NRRL B-21693
HF-85          NRRL B-21694
A. Cows        NRRL B-21695
MP1            NRRL B-21696
MP2            NRRL B-21697
MP3            NRRL B-21698
MP4            NRRL B-21699
MP5            NRRL B-21700
GL98           NRRL B-21701
G1101          NRRL B-21702
GL138          NRRL B-21703
GL155          NRRL B-21704
GL217          NRRL B-21705
GL257          NRRL B-21706

Standard and molecular biology techniques were followed and taught in the specification herein. Additional information may be found in Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989), Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Press; Current Protocol in Molecular Biology , ed. F. M. Ausubel et al., (1997), which are both incorporated herein by reference.

The following abbreviations are used throughout the Examples: Tris=tris (hydroxymethyl)amino methane; SDS=sodium dodecyl sulfate; EDTA=ethylenediaminetetraacetic acid, IPTG=isopropylthio-B-galactoside, X-gal=5-bromo-4-chloro-3-indoyl-β-D-galactoside, CTAB=cetyltrimethylammonium bromide; kbp=kilobase pairs; DATP, dCTP, dGTP, dTTP, I=2′-deoxynucleoside 5′-triphosphates of adenine, cytosine, guanine, thymine, and inosine, respectively; ATP=adenosine 5′triphosphate.

EXAMPLE 1

Purification of Toxin from Photorhabdus luminescens and Demonstration of Toxicity After Oral Delivery of Purified Toxin

The insecticidal protein toxin of the present invention was purified from Photorhabdus luminescens strain W-14, ATCC Accession Number 55397. Stock cultures of Photorhabdus luminescens were maintained on petri dishes containing 2% Proteose Peptone No. 3 (i.e., PP3, Difco Laboratories, Detroit Mich.) in 1.5% agar, incubated at 25° C. and transferred weekly. Colonies of the primary form of the bacteria were inoculated into 200 ml of PP3 broth supplemented with 0.5% polyoxyethylene sorbitan mono-stearate (TWEEN-60, Sigma Chemical Company, St. Louis, Mo.) in a one liter flask. The broth cultures were grown for 72 hours at 30° C. on a rotary shaker. The toxin proteins can be recovered from cultures grown in the presence or absence of TWEEN surfactant; however, the absence of Tween can affect the form of the bacteria grown and the profile of-proteins produced by the bacteria. In the absence of TWEEN surfactant, a variant shift occurs insofar as the molecular weight of at least one identified toxin subunit shifts from about 200 kDa to about 185 kDa.

The 72 hour cultures were centrifuged at 10,000×g for 30 minutes to remove cells and debris. The supernatant fraction that contained the insecticidal activity was decanted and brought to 50 mM K 2 HPO 4 by adding an appropriate volume of 1.0 M K 2 HPO 4 . The pH was adjusted to 8.6 by adding potassium hydroxide. This supernatant fraction was then mixed with DEAE-SEPHACEL resin (Pharmacia LKB Biotechnology) which had been equilibrated with 50 mM K 2 HPO 4 . The toxic activity was adsorbed to the DEAE resin. This mixture was then poured into a 2.6×40 cm column and washed with 50 mM K 2 HPO 4 at room temperature at a flow rate of 30 ml/hr until the effluent reached a steady baseline UV absorbance at 280 nm. The column was then washed with 150 mM KCl until the effluent again reached a steady 280 nm baseline. Finally the column was washed with 300 mM KCl and fractions were collected.

Fractions containing the toxin were pooled and filter sterilized using a 0.2 micron pore membrane filter. The toxin was then concentrated and equilibrated to 100 mM KPO 4 , pH 6.9, using an ultrafiltration membrane with a molecular weight cutoff of 100 kDa at 4° C. (Centriprep 100, Amicon Division-W.R. Grace and Company). A 3 ml sample of the toxin concentrate was applied to the top of a 2.6×95 cm SEPHACRYL resin S-400 HR gel filtration column (Pharmacia LKB Biotechnology). The eluent buffer was 100 mM KPO 4 , pH 6.9, which was run at a flow rate of 17 ml/hr, at 4° C. The effluent was monitored at 280 nm.

Fractions were collected and tested for toxic activity. Toxicity of chromatographic fractions was examined in a biological assay using Manduca sexta larvae. Fractions were either applied directly onto the insect diet (Gypsy moth wheat germ diet, ICN Biochemicals Division—ICN Biomedicals, Inc.) or administered by intrahemocelic injection of a 5 μl sample through the first proleg of 4th or 5th instar larva using a 30 gauge needle. The weight of each larva within a treatment group was recorded at 24 hour intervals. Toxicity was presumed if the insect ceased feeding and died within several days of consuming treated insect diet or if death occurred within 24 hours after injection of a fraction.

The toxic fractions were pooled and concentrated using the Centriprep-100 and were then analyzed by HPLC using a 7.5 mm×60 cm TSK-GEL G-4000 SW gel permeation column with 100 mM potassium phosphate, pH 6.9 eluent buffer running at 0.4 ml/min. This analysis revealed the toxin protein to be contained within a single sharp peak that eluted from the column with a retention time of approximately 33.6 minutes. This retention time corresponded to an estimated molecular weight of 1,000 kDa. Peak fractions were collected for further purification while fractions not containing this protein were discarded. The peak eluted from the HPLC absorbs UV light at 218 and 280 nm but did not absorb at 405 nm. Absorbance at 405 nm was shown to be an attribute of xenorhabdin antibiotic compounds.

Electrophoresis of the pooled peak fractions in a non-denaturing agarose gel (Metaphor Agarose, FMC BioProducts) showed that two protein complexes are present in the peak. The peak material, buffered in 50 mM Tris-HCl, pH 7.0, was separated on a 1.5% agarose stacking gel buffered with 100 mM Tris-HCl at pH 7.0 and 1.9% agarose resolving gel buffered with 200 mM Tris-borate at pH 8.3 under standard buffer conditions (anode buffer 1M Tris-HCl, pH 8.3; cathode buffer 0.025 M Tris, 0.192 M glycine). The gels were run at 13 mA constant current at 15° C. until the phenol red tracking dye reached the end of the gel. Two protein bands were visualized in the agarose gels using Coomassie brilliant blue staining.

The slower migrating band was referred to as “protein band 1” and faster migrating band was referred to as “protein band 2.” The two protein bands were present in approximately equal amounts. The Coomassie stained agarose gels were used as a guide to precisely excise the two protein bands from unstained portions of the gels. The excised pieces containing the protein bands were macerated and a small amount of sterile water was added. As a control, a portion of the gel that contained no protein was also excised and treated in the same manner as the gel pieces containing the protein. Protein was recovered from the gel pieces by electroelution into 100 mM Tris-borate pH 8.3, at 100 volts (constant voltage) for two hours. Alternatively, protein was passively eluted from the gel pieces by adding an equal volume of 50 mM Tris-HCl, pH 7.0, to the gel pieces, then incubating at 30° C. for 16 hours. This allowed the protein to diffuse from the gel into the buffer, which was then collected.

Results of insect toxicity tests using HPLC-purified toxin (33.6 min. peak) and agarose gel purified toxin demonstrated toxicity of the extracts. Injection of 1.5 μg of the HPLC purified protein kills within 24 hours. Both protein bands 1 and 2, recovered from agarose gels by passive elution or electroelution, were lethal upon injection. The protein concentration estimated for these samples was less than 50 ng/larva. A comparison of the weight gain and the mortality between the groups of larvae injected with protein bands 1 or 2 indicate that protein band 1 was more toxic by injection delivery.

When HPLC-purified toxin was applied to larval diet at a concentration of 7.5 μg/larva, it caused a halt in larval weight gain (24 larvae tested). The larvae begin to feed, but after consuming only a very small portion of the toxin treated diet they began to show pathological symptoms induced by the toxin and the larvae cease feeding. The insect frass became discolored and most larva showed signs of diarrhea. Significant insect mortality resulted when several 5 μg toxin doses were applied to the diet over a 7-10 day period.

Agarose-separated protein band 1 significantly inhibited larval weight gain at a dose of 200 ng/larva. Larvae fed similar concentrations of protein band 2 were not inhibited and gained weight at the same rate as the control larvae. Twelve larvae_were fed eluted protein and 45 larvae were fed protein-containing agarose pieces. These two sets of data indicate that protein band 1 was orally toxic to Manduca sexta . In this experiment it appeared that protein band 2 was not toxic to Manduca sexta.

Further analysis of protein bands 1 and 2 by SDS-PAGE under denaturing conditions showed that each band was composed of several smaller protein subunits. Proteins were visualized by Coomassie brilliant blue staining followed by silver staining to achieve maximum sensitivity.

The protein subunits in the two bands were very similar. Protein band 1 contains 8 protein subunits of 25.1, 56.2, 60.8, 65.6, 166, 171, 184 and 208 kDa. Protein band 2 had an identical profile except that the 25.1, 60.8, and 65.6 kDa proteins were not present. The 56.2, 60.8, 65.6, and 184 kDa proteins were present in the complex of protein band 1 at approximately equal concentrations and represent 80% or more of the total protein content of that complex.

The native HPLC-purified toxin was further characterized as follows. The toxin was heat labile in that after being heated to 60° C. for 15 minutes it lost its ability to kill or to inhibit weight gain when injected or fed to Manduca sexta larvae. Assays were designed to detect lipase, type C phospholipase, nuclease or red blood cell hemolysis activities and were performed with purified toxin. None of these activities were present. Antibiotic zone inhibition assays were also done and the purified toxin failed to inhibit growth of Gram-negative or -positive bacteria, yeast or filamentous fungi, indicating that the toxic is not a xenorhabdin antibiotic.

The native HPLC-purified toxin was tested for ability to kill insects other than Manduca sexta . Table 3 lasts insects killed by the HPLC-purified Photorhabdus luminescens toxin in this study.

TABLE 3
Insects Killed by Photorhabdus luminescens Toxin
		Genus and	Route of
Common Name	Order	species	Delivery
Tobacco	Lepidoptera	Manduca sexta	Oral and
horn worm			injected
Mealworm	Coleoptera	Tenebrio molitor	Oral
Pharaoh ant	Hymenoptera	Monomorium pharoanis	Oral
German	Dictyoptera	Blattella germanica	Oral and
cockroach			injected
Mosquito	Diptera	Aedes aegypti	Oral

Further Characterization of the High Molecular Weight Toxin Complex

In yet further analysis, the toxin protein complex was subjected to further characterization from W-14 growth medium. The culture conditions and initial purification steps through the S-400 HR column were identical to those described above. After isolation of the high molecular weight toxin complex from the S-400 HR column fractions, the toxic fractions were equilibrated with 10 mM Tris-HCl, pH 8.6, and concentrated in the centriplus 100 (Amicon) concentrators. The protein toxin complex was then applied to a weak anion exchange (WAX) column, Vydac 301VPH575 (Hesparia, Calif.), at a flow rate of 0.5 ml/min. The proteins were eluted with a linear potassium chloride gradient, 0-250 mM KCl, in 10 mM Tris-HCl pH 8.6 for 50 min. Eight protein peaks were detected by absorbance at 280 nm.

Bioassays using neonate southern corn rootworm ( Diabrotica undecimpunctata howardi , SCR) larvae and tobacco horn worm ( Manduca sexta , THW) were performed on all fractions eluted from the HPLC column. THW were grown on Gypsy Moth wheat germ diet (ICN) at 25° C. with a 16 hr light 8 hr dark cycle. SCR were grown on Southern Corn Rootworm Larval Insecta-Diet (BioServ) at 25° C. with a 16 hr light/8 hr dark cycle.

The highest mortality for SCR and THW larvae was observed for peak 6, which eluted with ca. 112 mM to 132mM KCl. SDS-PAGE analysis of peak 6 showed predominant peptides of 170 kDa, 66 kDa, 63 kDa, 59.5 kDa and 31 kDa. Western blot analysis was performed on peak 6 protein fraction with a mixture of polyclonal antibodies made against TcaA ii -syn, TcaA iii -syn, TcaB ii -syn, TcaC-syn, and TcbA ii -syn peptides (described in Example 21) and C5F2, a monoclonal antibody against the TcbA iii peptide. Peak 6 contained immuno-reactive bands of 170 kDa, 90 kDa, 66 kDa, 59.5 kDa and 31 kDa. These are very close to the predicted sizes for the TcaC (166 kDa), TcaA ii +TcaA iii (92 kDa), TcaA iii (66 kDa), TcaB ii (60 kDa) and TcaA ii (25 kDa), respectively. Peak 6 which was further analyzed by native agarose gel electrophoresis, as described herein, migrated as a single band with similar mobility to that of band 1.

The protein concentration of the purified peak 6 toxin protein was determined using the BCA reagents (Pierce). Dilutions of the protein were made in 10 mM Tris, pH 8.6 and applied to the diet bioassays. After 240 hours all neonate larvae on diet bioassays that received 450 ng or greater of the peak 6 protein fraction were dead. The group of larvae that received 90 ng of the same fraction had 40% mortality. After 240 hrs the survivors that received 90 ng and 20 ng of peak 6 protein fraction were ca. 10% and 70%, respectively, of the control weight.

EXAMPLE 2

Insecticide Utility

The Photorhabdus luminescens utility and toxicity were further characterized. Photorhabdus luminescens (strain W-14) culture broth was produced as follows. The production medium was 2% Bacto Proteose Peptone® Number 3 (PP3, Difco Laboratories, Detroit, Mich.) in Milli-Q® deionized water. Seed culture flasks consisted of 175 ml medium placed in a 500 ml tribaffled flask with a Delong neck, covered with a Kaput and autoclaved for 20 minutes, T=250° F. Production flasks consisted of 500 mls in a 2.8 liter 500 ml tribaffled flask with a Delong neck, covered by a Shin-etsu silicon foam closure. These were autoclaved for 45 minutes, T=250° F. The seed culture was incubated at 28° C. at 150 rpm in a gyrotory shaking incubator with a 2 inch throw. After 16 hours of growth, 1% of the seed culture was placed in the production flask which was allowed to grow for 24 hours before harvest. Production of the toxin appears to be during log phase growth. The microbial broth was transferred to a 1 L centrifuge bottle and the cellular biomass was pelleted (30 minutes at 2500 RPM at 4° C., [R.C.F.=about 1600] HG-4L Rotor RC3 Sorval centrifuge, Dupont, Wilmington, Del.). The primary broth was chilled at 4° C. for 8-16 hours and recentrifuged at least 2 hours (conditions above) to further clarify the broth by removal of a putative mucopolysaccharide which precipitated upon standing. (An alternative processing method combined both steps and involved the use of a 16 hour clarification centrifugation, same conditions as above.) This broth was then stored at 4° C. prior to bioassay or filtration.

Photorhabdus culture broth and protein toxin(s) purified from this broth showed activity (mortality and/or growth inhibition, reduced adult emergence) against a number of insects. More specifically, the activity is seen against corn rootworm (larvae and adult), Colorado potato beetle, and turf grubs, which are members of the insect order Coleoptera. Other members of the Coleoptera include wireworms, pollen beetles, flea beetles, seed beetles and weevils. Activity has also been observed against aster leafhopper, which is a member of the order, Homoptera. Other members of the Homoptera include planthoppers, pear pyslla, apple sucker, scale insects, whiteflies, and spittle bugs, as well as numerous host specific aphid species. The broth and purified fractions are also active against beet armyworm, cabbage looper, black cutworm, tobacco budworm, European corn borer, corn earworm, and codling moth, which are members of the order Lepidoptera. Other typical members of this order are clothes moth, Indian mealmoth, leaf rollers, cabbage worm, cotton bollworm, bagworm, Eastern tent caterpillar, sod webworm, and fall armyworm. Activity is also seen against fruitfly and mosquito larvae, which are members of the order Diptera. Other members of the order Diptera are pea midge, carrot fly, cabbage root fly, turnip root fly, onion fly, crane fly, house fly, and various mosquito species. Activity is seen against carpenter ant and Argentine ant, which are members of the order that also includes fire ants, oderous house ants, and little black ants.

The broth/fraction is useful for reducing populations of insects and were used in a method of inhibiting an insect population. The method may comprise applying to a locus of the insect an effective insect inactivating amount of the active described. Results are reported in Table 4.

Activity against corn rootworm larvae was tested as follows. Photorhabdus culture broth (filter sterilized, cell-free) or purified HPLC fractions were applied directly to the surface (about 1.5 cm 2 ) of 0.25 ml of artificial diet in 30 μl aliquots following dilution in control medium or 10 mM sodium phosphate buffer, pH 7.0, respectively. The diet plates were allowed to air-dry in a sterile flow-hood and the wells were infested with single, neonate Diabrotica undecimpunctata howardi (Southern corn rootworm, SCR) hatched from sterilized eggs, with second instar SCR grown on artificial diet or with second instar Diabrotica virgifera virgifera (Western corn rootworm, WCR) reared on corn seedlings grown in Metromix®. Second instar larvae were weighed prior to addition to the diet. The plates were sealed, placed in a humidified growth chamber and maintained at 27° C. for the appropriate period (4 days for neonate and adult SCR, 2-5 days for WCR larvae, 7-14 days for second instar SCR). Mortality and weight determinations were scored as indicated. Generally, 16 insects per treatment were used in all studies. Control mortalities were as follows: neonate larvae, <5%, adult beetles, 5%.

Activity against Colorado potato beetle was tested as follows. Photorhabdus culture broth or control medium was applied to the surface (about 2.0 cm 2 ) of 1.5 ml of standard artificial diet held in the wells of a 24-well tissue culture plate. Each well received 50 μl of treatment and was allowed to air dry. Individual second instar Colorado potato beetle ( Leptinotarsa decemlineata , CPB) larvae were then placed onto the diet and mortality was scored after 4 days. Ten larvae per treatment were used in all studies. Control mortality was 3.3%.

Activity against Japanese beetle grubs and beetles was tested as follows. Turf grubs ( Popillia japonica , 2-3rd instar) were collected from infested lawns and maintained in the laboratory in soil/peat mixture with carrot slices added as additional diet. Turf beetles were pheromone-trapped locally and maintained in the laboratory in plastic containers with maple leaves as food. Following application of undiluted Photorhabdus culture broth or control medium to corn rootworm artificial diet (30 μl/1.54 cm 2 , beetles) or carrot slices (larvae), both stages were placed singly in a diet well and observed for any mortality and feeding. In both cases there was a clear reduction in the amount of feeding (and feces production) observed.

Activity against mosquito larvae was tested as follows. The assay was conducted in a 96-well microtiter plate. Each well contained 200 μl of aqueous solution (Photorhabdus culture broth, control medium or H 2 O) and approximately 20, 1-day old larvae ( Aedes aegypti ). There were 6 wells per treatment. The results were read at 2 hours after infestation and did not change over the three day observation period. No control mortality was seen.

Activity against fruitflies was tested as follows. Purchased Drosophila melanogaster medium was prepared using 50% dry medium and a 50% liquid of either water, control medium or Photorhabdus culture broth. This was accomplished by placing 8.0 ml of dry medium in each of 3 rearing vials per treatment and adding 8.0 ml of the appropriate liquid. Ten late instar Drosophila melanogaster maggots were then added to each vial. The vials were held on a laboratory bench, at room temperature, under fluorescent ceiling lights. Pupal or adult counts were made after 3, 7 and 10 days of exposure. Incorporation of Photorhabdus culture broth into the diet media for fruitfly maggots caused a slight (17%) but significant reduction in day-10 adult emergence as compared to water and control medium (3% reduction).

Activity against aster leafhopper was tested as follows. The ingestion assay for aster leafhopper ( Macrosteles severini ) is designed to allow ingestion of the active without other external contact. The reservoir for the active/“food” solution is made by making 2 holes in the center of the bottom portion of a 35×10 mm Petri dish. A 2 inch Parafilm M® square is placed across the top of the dish and secured with an “O” ring. A 1 oz. plastic cup is then infested with approximately 7 leafhoppers and the reservoir is placed on top of the cup, Parafilm down. The test solution is then added to the reservoir through the holes. In tests using undiluted Photorhabdus culture broth, the broth and control medium were dialyzed against water to reduce control mortality. Mortality is reported at day 2 where 26.5% control mortality was seen. In the tests using purified fractions (200 mg protein/ml) a final concentration of 5% sucrose was used in all treatments to improve survivability of the aster leafhoppers. The assay was held in an incubator at 28° C., 70% RH with a 16/8 photoperiod. The assay was graded for mortality at 72 hours. Control mortality was 5.5%.

Activity against Argentine ants was tested as follows. A 1.5 ml aliquot of 100% Photorhabdus culture broth, control medium or water was pipetted into 2.0 ml clear glass vials. The vials were plugged with a piece of cotton dental wick that was moistened with the appropriate treatment. Each vial was placed into a separate 60×16mm Petri dish with 8 to 12 adult Argentine ants ( Linepithema humile ). There were three replicates per treatment. Bioassay plates were held on a laboratory bench, at room temperature under fluorescent ceiling lights. Mortality readings were made after 5 days of exposure. Control mortality was 24%.

Activity against carpenter ant was tested as follows. Black carpenter ant workers ( Camponotus pennsylvanicus ) were collected from trees on DowElanco property in Indianapolis, Ind. Tests with Photorhabdus culture broth were performed as follows. Each plastic bioassay container (7⅛″×3″) held fifteen workers, a paper harborage and 10 ml of broth or control media in a plastic shot glass. A cotton wick delivered the treatment to the ants through a hole in the shot glass lid. All treatments contained 5% sucrose. Bioassays were held in the dark at room temperature and graded at 19 days. Control mortality was 9%. Assays delivering purified fractions utilized artificial ant diet mixed with the treatment (purified fraction or control solution) at a rate of 0.2 ml treatment/2.0 g diet in a plastic test tube. The final protein concentration of the purified fraction was less than 10 μg/g diet. Ten ants per treatment, a water source, harborage and the treated diet were placed in sealed plastic containers and maintained in the dark at 27° C. in a humidified incubator. Mortality was scored at day 10. No control mortality was seen.

Activity against various lepidopteran larvae was tested as follows. Photorhabdus culture broth or purified fractions were applied directly to the surface (about 1.5 cm 2 ) of 0.25 ml of standard artificial diet in 30 μl aliquots following dilution in control medium or 10 mM sodium phosphate buffer, pH 7.0, respectively. The diet plates were allowed to air-dry in a sterile flow-hood and the wells were infested with single, neonate larva. European corn borer ( Ostrinia nubilalis ) and corn earworm ( Helicoverpa zea ) eggs were supplied from commercial sources and hatched in-house, whereas beet armyworm ( Spodoptera exigua ), cabbage looper ( Trichoplusia ni ), tobacco budworm ( Heliothis virescens ), codling moth ( Laspeyresia pomonella ) and black cutworm ( Agrotis ipsilon ) larvae were supplied internally. Following infestation with larvae, the diet plates were sealed, placed in a humidified growth chamber and maintained in the dark at 27° C. for the appropriate period. Mortality and weight determinations were scored at days 5-7 for Photorhabdus culture broth and days 4-7 for the purified fraction. Generally, 16 insects per treatment were used in all studies. Control mortality ranged from 4-12.5% for control medium and was less than 10% for phosphate buffer.

TABLE 4
Effect of Photohabdus luminescens (Strain W-14)
Culture Broth and Purified Toxin Fraction on Mortality and Growth
Inhibition of Different Insect Orders/Species
	Broth	Purified Fraction
Insect Order/Species	% Mort.	% G. I.	% Mort.	% G. I.
COLEOPTERA
Corn Rootworm
Southern/neonate larva	100	na	100	na
Southern/2 nd instar	na	38.5	nt	nt
Southern/adult	45	nt	nt	nt
Western/2 nd instar	na	35	nt	nt
Colorado Potato Beetle	93	nt	nt	nt
2 nd instar
Turf Grub	na	a.f.	nt	nt
3 rd instar	na	a.f.	nt	nt
adult
DIPTERA
Fruit Fly (adult emergence)	17	nt	nt	nt
Mosquito larvae	100	na	nt	nt
HOMOPTERA
Aster Leafhopper	96.5	na	100	na
HYMENOPTERA
Argentine Ant	75	na	nt	na
Carpenter Ant	71	na	100	na
LEPIDOPTERA
Beet Armyworm	12.5	36	18.75	41.4
Black Cutworm	nt	nt	0	71.2
Cabbage Looper	nt	nt	21.9	66.8
Codling Moth	nt	nt	6.25	45.9
Corn Earworm	56.3	94.2	97.9	na
European Corn Borer	96.7	98.4	100	na
Tobacco Budworm	13.5	52.5	19.4	85.6
Mort. = mortality, G. I. = growth inhibition, na = not applicable, nt = not tested, a.f. = anti-feedant

EXAMPLE 3

Insecticide Utility upon Soil Application

Photorhabdus luminescens (strain W-14) culture broth was shown to be active against corn rootworm when applied directly to soil or a soil-mix (Metromix®). Activity against neonate SCR and WCR in Metromix® was tested as follows (Table 5). The test was run using corn seedlings (United Agriseeds brand CL614) that were germinated in the light on moist filter paper for 6 days. After roots were approximately 3-6 cm long, a single kernel/seedling was planted in a 591 ml clear plastic cup with 50 gm of dry Metromix®. Twenty neonate SCR or WCR were then placed directly on the roots of the seedling and covered with Metromix®. Upon infestation, the seedlings were then drenched with 50 ml total volume of a diluted broth solution. After drenching, the cups were sealed and left at room temperature in the light for 7 days. Afterwards, the seedlings were washed to remove all Metromix® and the roots were excised and weighed. Activity was rated as the percentage of corn root remaining relative to the control plants and as leaf damage induced by feeding. Leaf damage was scored visually and rated as either −, +, ++, or +++, with − representing no damage and +++ representing severe damage.

Activity against neonate SCR in soil was tested as follows (Table 6). The test was run using corn seedlings (United Agriseeds brand CL614) that were germinated in the light on moist filter paper for 6 days. After the roots were approximately 3-6 cm long, a single kernel/seedling was planted in a 591 ml clear plastic cup with 150 gm of soil from a field in Lebanon, Ind. planted the previous year with corn. This soil had not been previously treated with insecticides. Twenty neonate SCR were then placed directly on the roots of the seedling and covered with soil. After infestation, the seedlings were drenched with 50 ml total volume of a diluted broth solution. After drenching, the unsealed cups were incubated in a high relative humidity chamber (80%) at 78° F. Afterwards, the seedlings were washed to remove all soil and the roots were excised and weighed. Activity was rated as the percentage of corn root remaining relative to the control plants and as leaf damage induced by feeding. Leaf damage was scored visually and rated as either −, +, ++, or +++, with − representing no damage and +++ representing severe damage.

TABLE 5
Effect of Photorhabdus luminescens (Strain W-14) Culture Broth on
Rootworm Larvae after Post-Infestation Drenching (Metromix ® )
		Leaf
Treatment	Larvae	Damage	Root Weight (g)	%
Southern Corn Rootworm
Water	−	−	0.4916 ± 0.023	100
Medium (2.0% v/v)	−	−	0.4415 ± 0.029	100
Broth (6.25% v/v)	−	−	0.4641 ± 0.081	100
Water	+	+++	0.1410 ± 0.006	28.7
Media (2.0% v/v)	+	+++	0.1345 ± 0.028	30.4
Broth (1.56% v/v)	+	−	0.4830 ± 0.031	104
Western Corn Rootworm
Water	−	−	0.4446 ± 0.019	100
Broth (2.0% v/v)	−	−	0.4069 ± 0.026	100
Water	+	−	0.2202 ± 0.015	49
Broth (2.0% v/v)	+	−	0.3879 ± 0.013	95

TABLE 6
Effect of Photorhabdus luminescens (Strain W-14) Culture Broth on
Southern Corn Rootworm Larvae after Post-Infestation Drenching
(Soil)
Treatment	Larvae	Leaf Damage	Root Weight (g)	%
Water	−	−	0.2148 ± 0.014	100
Broth (50% v/v)	−	−	0.2260 ± 0.016	103
Water	+	+++	0.0916 ± 0.009	43
Broth (50% v/v)	+	−	0.2428 ± 0.032	113

Activity of Photorhabdus luminescens (strain W-14) culture broth against second instar turf grubs in Metromix® was observed in tests conducted as follows (Table 7). Approximately 50 gm of dry Metromix® was added to a 591 ml clear plastic cup. The Metromix® was then drenched with 50 ml total volume of a 50% (v/v) diluted Photorhabdus broth solution. The dilution of crude broth was made with water, with 50% broth being prepared by adding 25 ml of crude broth to 25 ml of water for 50 ml total volume. A 1% (w/v) solution of proteose peptone #3 (PP3), which is a 50% dilution of the normal media concentration, was used as a broth control. After drenching, five second instar turf grubs were placed on the top of the moistened Metromix®. Healthy turf grub larvae burrowed rapidly into the Metromix®. Those larvae that did not burrow within 1 h were removed and replaced with fresh larvae. The cups were sealed and placed in a 28° C. incubator, in the dark. After seven days, larvae were removed from the Metromix® and scored for mortality. Activity was rated the percentage of mortality relative to control.

TABLE 7
Effect of Photorhabdus luminescens (Strain W-14) Culture Broth on
Turf Grub after Pre-Infestation Drenching (Metromix ® )
	Treatment	Mortality*	Mortality %
	Water	7/15	47
	Control medium	12/19	63
	(1.0% w/v)
	Broth	17/20	85
	(50% v/v)
	*expressed as a ratio of dead/living larvae

EXAMPLE 4

Insecticide Utility upon Leaf Application

Activity of Photorhabdus broth against European corn borer was seen when the broth was applied directly to the surface of maize leaves (Table 8). In these assays Photorhabdus broth was diluted 100-fold with culture medium and applied manually to the surface of excised maize leaves at a rate of about 6.0 μl/cm 2 of leaf surface. The leaves were air dried and cut into equal sized strips approximately 2×2 inches. The leaves were rolled, secured with paper clips and placed in 1 oz plastic shot glasses with 0.25 inch of 2% agar on the bottom surface to provide moisture. Twelve neonate European corn borers were then placed onto the rolled leaf and the cup was sealed. After incubation for 5 days at 27° C. in the dark, the samples were scored for feeding damage and recovered larvae.

TABLE 8
Effect of Photorhabdus luminescens (Strain W-14) Culture Broth on
European Corn Borer Larvae Following Pre-Infestation Application to
Excised Maize Leaves
Treatment	Leaf Damage	Larvae Recovered	Weight (mg)
Water	Extensive	55/120	0.42 mg
Control Medium	Extensive	40/120	0.50 mg
Broth (1.0% v/v)	Trace	3/120	0.15 mg

Activity of the culture broth against neonate tobacco budworm ( Heliothis virescens ) was demonstrated using a leaf dip methodology. Fresh cotton leaves were excised from the plant and leaf disks were cut with an 18.5 mm cork-borer. The disks were individually emersed in control medium (PP3) or Photorhabdus luminescens (strain W-14) culture broth which had been concentrated approximately 10-fold using an Amicon (Beverly, Mass.), Proflux M12 tangential filtration system with a 10 kDa filter. Excess liquid was removed and a straightened paper clip was placed through the center of the disk. The paper clip was then wedged into a plastic, 1.0 oz shot glass containing approximately 2.0 ml of 1% Agar. This served to suspend the leaf disk above the agar. Following drying of the leaf disk, a single neonate tobacco budworm larva was placed on the disk and the cup was capped. The cups were then sealed in a plastic bag and placed in a darkened, 27° C. incubator for 5 days. At this time the remaining larvae and leaf material were weighed to establish a measure of leaf damage (Table 9).

TABLE 9
Effect of Photorhabdus luminescens (Strain W-14) Culture Broth on
Tobacco Budworm Neonates in a Cotton-Leaf Dip Assay
			Final Weights (mg)
	Treatment	Leaf Disk	Larvae
	Control leaves	55.7 ± 1.3	na*
	Control Medium	34.0 ± 2.9	4.3 ± 0.91
	Photorhabdus broth	54.3 ± 1.4	0.0**
	*- not applicable, **- no live larvae found

EXAMPLE 5

Part A

Characterization of Toxin Peptide Components

In a subsequent analysis, the toxin protein subunits of the bands isolated as in Example 1 were resolved on a 7% SDS polyacrylamide electrophoresis gel with a ratio of 30:0.8 (acrylamide:BIS-acrylamide). This gel matrix facilitates better resolution of the larger proteins. The gel system used to estimate the Band 1 and Band 2 subunit molecular weights in Example 1 was an 18% gel with a ratio of 38:0.18 (acrylamide:BIS-acrylamide), which allowed for a broader range of size separation, but less resolution of higher molecular weight components.

In this analysis, 10, rather than 8, protein bands were resolved. Table 10 reports the calculated molecular weights of the 10 resolved bands, and directly compares the molecular weights estimated under these conditions to those of the prior example. It is not surprising that additional bands were detected under the different separation conditions used in this example. Variations between the prior and new estimates of molecular weight are also to be expected given the differences in analytical conditions. In the analysis of this example, it is thought that the higher molecular weight estimates are more accurate than in Example 1, as a result of improved resolution. However, these are estimates based on SDS PAGE analysis, which are typically not analytically precise and result in estimates of peptides and which may have been further altered due to post- and co-translational modifications.

Amino acid sequences were determined for the N-terminal portions of five of the 10 resolved peptides. Table 10+correlates the molecular weight of the proteins and the identified sequences. In SEQ ID NO:2, certain analyses suggest that the proline at residue 5 may be an asparagine (asn). In SEQ ID NO:3, certain analyses suggest that the amino acid residues at positions 13 and 14 are both arginine (arg). In SEQ ID NO:4, certain analyses suggest that the amino acid residue at position 6 may be either alanine (ala) or serine (ser). In SEQ ID NO:5, certain analyses suggest that the amino acid residue at position 3 may be aspartic acid (asp).

TABLE 10
ESTIMATE	NEW ESTIMATE*	SEQ. LISTING
208	200.2 kDa	SEQ ID NO: 1
184	175.0 kDa	SEQ ID NO: 2
65.6	68.1 kDa	SEQ ID NO: 3
60.8	65.1 kDa	SEQ ID NO: 4
56.2	58.3 kDa	SEQ ID NO: 5
25.1	23.2 kDa	SEQ ID NO: 15
*New estimates are based on SDS PAGE and are not based on gene sequences. SDS PAGE is not analytically precise.

EXAMPLE 5

Part B

Characterization of Toxin Peptide Components

New N-terminal sequence, SEQ ID NO:15, Ala Gln Asp Gly Asn Gln Asp Thr Phe Phe Ser Gly Asn Thr, was obtained by further N-terminal sequencing of peptides isolated from Native HPLC-purified toxin as described in Example 5, Part A, above. This peptide comes from the tcaA gene. The peptide labeled TcaA ii , starts at position 254 and goes to position 491, where the TcaA iii peptide starts, SEQ ID NO:4. The estimated size of the peptide based on the gene sequence is 25,240 Da.

EXAMPLE 6

Characterization of Toxin Peptide Components

In yet another analysis, the toxin protein complex was re-isolated from the Photorhabdus luminescens growth medium (after culture without TWEEN surfactant) by performing a 10%-80% ammonium sulfate precipitation followed by an ion exchange chromatography step (Mono Q) and two molecular sizing chromatography steps. These conditions were like those used in Example 1. During the first molecular sizing step, a second biologically active peak was found at about 100±10 kDa. Based upon protein measurements, this fraction was 20-50 fold less active than the larger, or primary, active peak of about 860±100 kDa (native). During this isolation experiment, a smaller active peak of about 325±50 kDa that retained a considerable portion of the starting biological activity was also resolved. It is thought that the 325 kDa peak is related to or derived from the 860 kDa peak.

A 56 kDa protein was resolved in this analysis. The N-terminal sequence of this protein is presented in SEQ ID NO:6. It is noteworthy that this protein shares significant identity and conservation with SEQ ID NO:5 at the N-terminus, suggesting that the two may be encoded by separate members of a gene family and that the proteins produced by each gene are sufficiently similar to both be operable in the insecticidal toxin complex.

A second, prominent 185 kDa protein was consistently present in amounts comparable to that of protein 3 from Table 10, and may be the same protein or protein fragment. The N-terminal sequence of this 185 kDa protein is shown at SEQ ID NO:7.

Additional N-terminal amino acid sequence data were also obtained from isolated proteins. None of the determined N-terminal sequences appear identical to a protein identified in Table 10. Other proteins were present in isolated preparation. One such protein has an estimated molecular weight of 108 kDa and an N-terminal sequence as shown in SEQ ID NO:8. A second such protein has an estimated molecular weight of 80 kDa and an N-terminal sequence as shown in SEQ ID NO:9.

When the protein material in the approximately 325 kDa active peak was analyzed by size, bands of approximately 51, 31, 28, and 22 kDa were observed. As in all cases in which a molecular weight was determined by analysis of electrophoretic mobility, these molecular weights were subject to error effects introduced by buffer ionic strength differences, electrophoresis power differences, and the like. One of ordinary skill would understand that definitive molecular weight values cannot be determined using these standard methods and that each was subject to variation. It was hypothesized that proteins of these sizes are degradation products of the larger protein species (of approximately 200 kDa size) that were observed in the larger primary toxin complex.

Finally, several preparations included a protein having the N-terminal sequence shown in SEQ ID NO:10. This sequence was strongly homologous to known chaperonin proteins, accessory proteins known to function in the assembly of large protein complexes. Although the applicants could not ascribe such an assembly function to the protein identified in SEQ ID NO:10, it was consistent with the existence of the described toxin protein complex that such a chaperonin protein could be involved in its assembly. Moreover, although such proteins have not directly been suggested to have toxic activity, this protein may be important to determining the overall structural nature of the protein toxin, and thus, may contribute to the toxic activity or durability of the complex in vivo after oral delivery.

Subsequent analysis of the stability of the protein toxin complex to proteinase K was undertaken. It was determined that after 24 hour incubation of the complex in the presence of a 10-fold molar excess of proteinase K, activity was virtually eliminated (mortality on oral application dropped to about 5%). These data confirm the proteinaceous nature of the toxin.

The toxic activity was also retained by a dialysis membrane, again confirming the large size of the native toxin complex.

EXAMPLE 7

Isolation, Characterization and Partial Amino Acid Sequencing of Photorhabdus Toxins

Isolation and N-Terminal Amino Acid Sequencing

In a set of experiments conducted in parallel to Examples 5 and 6, ammonium sulfate precipitation of Photorhabdus proteins was performed by adjusting Photorhabdus broth, typically 2-3 liters, to a final concentration of either 10% or 20% by the slow addition of ammonium sulfate crystals. After stirring for 1 hour at 4° C., the material was centrifuged at 12,000×g for 30 minutes. The supernatant was adjusted to 80% ammonium sulfate, stirred at 4° C. for 1 hour, and centrifuged at 12,000×g for 60 minutes. The pellet was resuspended in one-tenth the volume of 10 mM Na 2 .PO 4 , pH 7.0 and dialyzed against the same phosphate buffer overnight at 4° C. The dialyzed material was centrifuged at 12,000×g for 1 hour prior to ion exchange chromatography.

A.HR 16/50 Q Sepharose (Pharmacia) anion exchange column was equilibrated with 10 mM Na 2 .PO 4 , pH 7.0. Centrifuged, dialyzed ammonium sulfate pellet was applied to the Q Sepharose column at a rate of 1.5 ml/min and washed extensively at 3.0 ml/min with equilibration buffer until the optical density (O.D. 280) reached less than 0.100. Next, either a 60 minute NaCl gradient ranging from 0 to 0.5 M at 3 ml/min, or a series of step elutions using 0.1 M, 0.4 M and finally 1.0 NaCl for 60 minutes each was applied to the column. Fractions were pooled and concentrated using a Centriprep 100. Alternatively, proteins could be eluted by a single 0.4 M NaCl wash without prior elution with 0.1 M NaCl.

Two milliliter aliquots of concentrated Q Sepharose samples were loaded at 0.5 ml/min onto a HR 16/50 Superose 12 (Pharmacia) gel filtration column equilibrated with 10 mM Na 2 .PO 4 , pH 7.0. The column was washed with the same buffer for 240 min at 0.5 ml/min and 2 min samples were collected. The void volume material was collected and concentrated using a centriprep 100. Two milliliter aliquots of concentrated Superose 12 samples were loaded at 0.5 ml/min onto a HR 16/50 Sepharose 4B-CL (Pharmacia) gel filtration column equilibrated with 10 mM Na 2 .PO 4 , pH 7.0. The column was washed with the same buffer for 240 min at 0.5 ml/min and 2 min samples were collected.

The excluded protein peak was subjected to a second fractionation by application to a gel filtration column that used a Sepharose CL-4B resin, which separates proteins ranging from about 30 kDa to 1000 kDa. This fraction was resolved into two peaks; a minor peak at the void volume (>1000 kDa) and a major peak which eluted at an apparent molecular weight of about 860 kDa. Over a one week period subsequent samples subjected to gel filtration showed the gradual appearance of a third peak (approximately 325 kDa) that seemed to arise from the major peak, perhaps by limited proteolysis. Bioassays performed on the three peaks showed that the void peak had no activity, while the 860 kDa toxin complex fraction was highly active, and the 325 kDa peak was less active, although quite potent. SDS PAGE analysis of Sepharose CL-4B toxin complex peaks from different fermentation productions revealed two distinct peptide patterns, denoted “P” and “S”. The two patterns had marked differences in the molecular weights and concentrations of peptide components in their fractions. The “S” pattern, produced most frequently, had 4 high molecular weight peptides (>150 kDa) while the “P” pattern had 3 high molecular weight peptides. In addition, the “S” peptide fraction was found to have 2-3 fold more activity against European Corn Borer. This shift may be related to variations in protein expression due to age of inoculum and/or other factors based on growth parameters of aged cultures.

Milligram quantities of peak toxin complex fractions determined to be “P” or “S” peptide patterns were subjected to preparative SDS PAGE, and transblotted with TRIS-glycine (Seprabuff™ to PVDF membranes (ProBlott™, Applied Biosystems) for 3-4 hours. Blots were sent for amino acid analysis and N-terminal amino acid sequencing at Harvard MicroChem and Cambridge ProChem, respectively. Three peptides in the “S” pattern had unique N-terminal amino acid sequences compared to the sequences identified in the previous example. A 201 kDa (TcdA ii ) peptide set forth as SEQ ID NO:13 below shared between 33% amino acid identity and 50% similarity (similarity and identity were calculated by hand) with SEQ ID NO:1 (TcbA ii )(in Table 10 vertical lines denote amino acid identities and colons indicate conservative amino acid substitutions). A second peptide of 197 kDa, SEQ ID NO:14 (TcdB), had 42% identity and 58% similarity with SEQ ID NO:2 (TcaC) (similarity and identity were calculated by hand). Yet a third peptide of 205 kDa was denoted TcdA ii . In addition, a limited N-terminal amino acid sequence, SEQ ID NO:16 (TcbA), of a peptide of at least 235 kDa was identical with the amino acid sequence, SEQ ID NO:12, deduced from a cloned gene (tcbA), SEQ ID NO:11, containing a deduced amino acid sequence corresponding to SEQ ID NO:1 (TcbA ii ). This indicates that the larger 235+ kDa peptide was proteolytically processed to the 201 kDa peptide, (TcbA ii ), (SEQ ID NO:1) during fermentation, possibly resulting in activation of the molecule. In yet another sequence, the sequence originally reported as SEQ ID NO:5 (TcaB ii ) reported in Example 5 above, was found to contain an aspartic acid residue (Asp) at the third position rather than glycine (Gly) and two additional amino acids Gly and Asp at the eighth and ninth positions, respectively. In yet two other sequences, SEQ ID NO:2 (TcaC) and SEQ ID NO:3 (TcaB i ), additional amino acid sequence was obtained. Densitometric quantitation was performed using a sample that was identical to the “S” preparation sent for N-terminal analysis. This analysis showed that the 201 kDa and 197 kDa peptides represent 7.0% and 7.2%, respectively, of the total Coomassie brillant blue stained protein in the “S” pattern and are present in amounts similar to the other abundant peptides. It was speculated that these peptides may represent protein homologs, analogous to the situation found with other bacterial toxins, such as various CryI Bt toxins. These proteins vary from 40-90% similarity at their N-terminal amino acid sequence, which encompasses the toxic fragment.

Internal Amino Acid Sequencing

To facilitate cloning of toxin peptide genes, internal amino acid sequences of selected peptides were obtained as followed. Milligram quantities of peak 2A fractions determined to be “P” or “S” peptide patterns were subjected to preparative SDS PAGE, and transblotted with TRIS-glycine (Seprabuff™ to PVDF membranes (ProBlott™, Applied Biosystems) for 3-4 hours. Blots were sent for amino acid analysis and N-terminal amino acid sequencing at Harvard MicroChem and Cambridge ProChem, respectively. Three peptides, referred to as TcbA ii (containing SEQ ID NO:1), TcdA ii , and TcaB i (containing SEQ ID NO:3) were subjected to trypsin digestion by Harvard MicroChem followed by HPLC chromatography to separate individual peptides. N-terminal amino acid analysis was performed on selected tryptic peptide fragments. Two internal peptides were sequenced for the peptide TcdA ii (205 kDa peptide) referred to as TcdA ii -PT111 (SEQ ID NO:17) and TcdA ii -PT79 (SEQ ID NO:18). Two internal peptides were sequenced for the peptide TcaB i (68 kDa peptide) referred to as TcaB i -PT158 (SEQ ID NO:19) and TcaB i -PT108 (SEQ ID NO:20). Four internal peptides were sequenced for the peptide TcbA ii (201 kDa peptide) referred to as TcbA ii -PT103 (SEQ ID NO:21), TcbA ii -PTS6 (SEQ ID NO:22), TcbA ii -PT81(a) (SEQ ID NO:23), and TcbA ii -PT81(b) (SEQ ID NO:24).

TABLE 11
N-Terminal Amino Acid Sequences
(similarity and identity were calculated by hand)
201 kDa (33% identity & 50% similarity to
SEQ ID NO.1)
L I G Y N N                                                                         O                                                                     F S G * A SEQ ID NO:13
:   | |      | :     |
F I Q G Y S D L F G N - A SEQ ID NO:1
197 kDa (42% identity & 58% similarity to
SEQ ID NO.2)
M Q N S Q T F                                                                         S                                                                     V G E L SEQ ID NO.14
| | : |       | : :   |
M Q D S P E V S I T T L SEQ ID NO.2

EXAMPLE 8

Construction of a Cosmid Library of Photorhabdus luminescens W-14 Genomic DNA and its Screening to Isolate Genes Encoding Peptides Comprising the Toxic Protein Preparation

As a prerequisite for the production of Photorhabdus insect toxic proteins in heterologous hosts, and for other uses, it is necessary to isolate and characterize the genes that encode those peptides. This objective was pursued in parallel. One approach, described later, was based on the use of monoclonal and polyclonal antibodies raised against the purified toxin which were then used to isolate clones from an expression library. The other approach, described in this example, is based on the use of the N-terminal and internal amino acid sequence data to design degenerate oligonucleotides for use in PCR amplication. Either method can be used to identify DNA clones that contain the peptide-encoding genes so as to permit the isolation of the respective genes, and the determination of their DNA base sequence.

Genomic DNA Isolation

Photorhabdus luminescens strain W-14 (ATCC accession number 55397) was grown on 2% proteose peptone #3 agar (Difco Laboratories, Detroit, Mich.) and insecticidal toxin competence was maintained by repeated bioassay after passage, using the method described in Example 1 above. A 50 ml shake culture was produced in a 175 ml baffled flask in 2% proteose peptone #3 medium, grown at 28° C. and 150 rpm for approximately 24 hours. 15 ml of this culture was pelleted and frozen in its medium at −20° C. until it was thawed for DNA isolation. The thawed culture was centrifuged, (700×g, 30 min) and the floating orange mucopolysaccharide material was removed. The remaining cell material was centrifuged (25,000×g, 15 min) to pellet the bacterial cells, and the medium was removed and discarded.

Genomic DNA was isolated by an adaptation of the CTAB method described in section 2.4.1 of Current Protocols in Molecular Biology (Ausubel et al. eds, John Wiley & Sons, 1994) [modified to include a salt shock and with all volumes increased 10-fold]. The pelleted bacterial cells were resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a final volume of 10 ml, then 12 ml of 5 M NaCl was added; this mixture was centrifuged 20 min at 15,000×g. The pellet was resuspended in 5.7 ml TE and 300 ml of 10% SDS and 60 ml of 20 mg/ml proteinase K (Gibco BRL Products, Grand Island, N.Y.; in sterile distilled water) were added to the suspension. This mixture was incubated at 37° C. for 1 hr; then approximately 10 mg lysozyme (Worthington Biochemical Corp., Freehold, N.J.) was added. After an additional 45 min, 1 ml of 5 M NaCl and 800 ml of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) were added. This preparation was incubated 10 min at 65° C., then gently agitated and further incubated and agitated for approximately 20 min to assist clearing of the cellular material. An equal volume of chloroform/isoamyl alcohol solution (24:1, v/v) was added, mixed gently and centrifuged. After two extractions with an equal volume of PCI (phenol/chloroform/isoamyl alcohol; 50:49:1, v/v/v; equilibrated with 1 M Tris-HCl, pH 8.0; Intermountain Scientific Corporation, Kaysville, Utah), the DNA was precipitated with 0.6 volume of isopropanol. The DNA precipitate was gently removed with a glass rod, washed twice with 70% ethanol, dried, and dissolved in 2 ml STE (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 1 mM EDTA). This preparation contained 2.5 mg/ml DNA, as determined by optical density at 260 nm (i.e., OD 260 )

The molecular size range of the isolated genomic DNA was evaluated for suitability for library construction. CHEF gel analysis was performed in 1.5% agarose (Seakem® LE, FMC BioProducts, Rockland, Me.) gels with 0.5×TBE buffer (44.5 mM Tris-HCl pH 8.0, 44.5 mM H 3 BO 3 , 1 mM EDTA) on a BioRad CHEF-DR II apparatus with a Pulsewave 760 Switcher (Bio-Rad Laboratories, Inc., Richmond, Calif.). The running parameters were: initial A time, 3 sec; final A time, 12 sec; 200 volts; running temperature, 4-18° C.; run time, 16.5 hr. Ethidium bromide staining and examination of the gel under ultraviolet light indicated the DNA ranged from 30-250 kbp in size.

Construction of Library

A partial Sau3A 1 digest was made of this Photorhabdus genomic DNA preparation. The method was based on section 3.1.3 of Ausubel (supra.). Adaptions included running smaller scale reactions under various conditions until nearly optimal results were achieved. Several scaled-up large reactions with varied conditions were run, the results analyzed on CHEF gels, and only the best large scale preparation was carried forward. In the optimal case, 200 μg of Photorhabdus genomic DNA was incubated with 1.5 units of Sau3A 1 (New England Biolabs, “NEB”, Beverly, Mass.) for 15 min at 37° C. in 2 ml total volume of 1×NEB 4 buffer (supplied as 10× by the manufacturer). The reaction was stopped by adding 2 ml of PCI and centrifuging at 8000×g for 10 min. To the supernatant were added 200 μl of 5 M NaCl plus 6 ml of ice-cold ethanol. This preparation was chilled for 30 min at −20° C., then centrifuged at 12,000×g for 15 min. The supernatant was removed and the precipitate was dried in a vacuum oven at 40° C., then resuspended in 400 μl STE. Spectrophotometric assay indicated about 40% recovery of the input DNA. The digested DNA was size fractionated on a sucrose gradient according to section 5.3.2 of CPMB (op. cit.). A 10% to 40% (w/v) linear sucrose gradient was prepared with a gradient maker in Ultra-Clear™ tubes (Beckman Instruments, Inc., Palo Alto, Calif.) and the DNA sample was layered on top. After centrifugation, (26,000 rpm, 17 hr, Beckman SW41 rotor, 20° C.), fractions (about 750 μl) were drawn from the top of the gradient and analyzed by CHEF gel electrophoresis (as described earlier). Fractions containing Sau3A 1 fragments in the size range 20-40 kbp were selected and DNA was precipitated by a modification (amounts of all solutions increased approximately 6.3-fold) of the method in section 5.3.3 of Ausubel (supra.). After overnight precipitation, the DNA was collected by centrifugation (17,000×g, 15 min), dried, redissolved in TE, pooled into a final volume of 80 μl, and reprecipitated with the addition of 8 μl 3 M sodium acetate and 220 μl ethanol. The pellet collected by centrifugation as above was resuspended in 12 μl TE. Concentration of the DNA was determined by Hoechst 33258 dye (Polysciences, Inc., Warrington, Pa.) fluorometry in a Hoefer TKO100 fluorimeter (Hoefer Scientific Instruments, San Francisco, Calif.). Approximately 2.5 μg of the size-fractionated DNA was recovered.

Thirty μg of cosmid pWE15 DNA (Stratagene, La Jolla, Calif.) was digested to completion with 100 units of restriction enzyme BamH 1 (NEB) in the manufacturer's buffer (final volume of 200 μl, 37° C., 1 hr). The reaction was extracted with 100 μl of PCI and DNA was precipitated from the aqueous phase by addition of 20 μl 3M sodium acetate and 550 μl −20° C. absolute ethanol. After 20 min at −70° C., the DNA was collected by centrifugation (17,000×g, 15 min), dried under vacuum, and dissolved in 180 μl of 10 mM Tris-HCl, pH 8.0. To this were added 20 μl of 10×CIP buffer (100 mM Tris-HCl, pH 8.3; 10 mM ZnCl 2 ; 10 mM MgCl 2 ), and 1 μl (0.25 units) of 1:4 diluted calf intestinal alkaline phosphatase (Boehringer Mannheim Corporation, Indianapolis, Ind.). After 30 min at 37° C., the following additions were made: 2 μl 0.5 M EDTA, pH 8.0; 10 μl 10% SDS; 0.5 μl of 20 mg/ml proteinase K (as above), followed by incubation at 55° C. for 30 min. Following sequential extractions with 100 μl of PCI and 100 μl phenol (Intermountain Scientific Corporation, equilibrated with 1 M Tris-HCl, pH 8.0), the dephosphorylated DNA was precipitated by addition of 72 μl of 7.5 M ammonium acetate and 550 μl −20° C. ethanol, incubation on ice for 30 min, and centrifugation as above. The pelleted DNA was washed once with 500 μl −20° C. 70% ethanol, dried under vacuum, and dissolved in 20 μl of TE buffer.

Ligation of the size-fractionated Sau3A 1 fragments to the BamH 1-digested and phosphatased pWE15 vector was accomplished using T4 ligase (NEB) by a modification (i.e., use of premixed 10×ligation buffer supplied by the manufacturer) of the protocol in section 3.33 of Ausubel. Ligation was carried out overnight in a total volume of 20 μl at 15° C., followed by storage at −20° C.

Four μl of the cosmid DNA ligation reaction, containing about 1 μl of DNA, was packaged into bacteriophage lambda using a commercial packaging extract (Gigapack® III Gold Packaging Extract, Stratagene), following the manufacturer's directions. The packaged preparation was stored at 4° C. until use. The packaged cosmid preparation was used to infect Escherichia coli XL1 Blue MR cells (Stratagene) according to the Gigapack® III Gold protocols (“Titering the Cosmid Library”), as follows. XL1 Blue MR cells were grown in LB medium (g/L: Bacto-tryptone, 10; Bacto-yeast extract, 5; Bacto-agar, 15; NaCl, 5; [Difco Laboratories, Detroit, Mich.] containing 0.2% (w/v) maltose plus 10 mM MgSO 4 , at 37° C. After 5 hr growth, cells were pelleted at 700×g (15 min) and resuspended in 6 ml of 10 mM MgSO 4 . The culture density was adjusted with 10 mM MgSO 4 to OD 600 =0.5. The packaged cosmid library was diluted 1:10 or 1:20 with sterile SM medium (0.1 M NaCl, 10 mM MgSO 4 , 50 mM Tris-HCl pH 7.5, 0.01% w/v gelatin), and 25 μl of the diluted preparation was mixed with 25 μl of the diluted XL1 Blue MR cells. The mixture was incubated at 25° C. for 30 min (without shaking), then 200 μl of LB broth was added, and incubation was continued for approximately 1 hr with occasional gentle shaking. Aliquots (20-40 μl) of this culture were spread on LB agar plates containing 100 mg/l ampicillin (i.e., LB-Amp 100 ) and incubated overnight at 37° C. To store the library without amplification, single colonies were picked and inoculated into individual wells of sterile 96-well microwell plates; each well containing 75 μl of Terrific Broth (TB media: 12 g/l Bacto-tryptone, 24 g/l Bacto-yeast extract, 0.4% v/v glycerol, 17 mM KH 2 PO 4 , 72 mM K 2 HPO 4 ) plus 100 mg/l ampicillin (i.e., TB-Amp 100 ) and incubated (without shaking) overnight at 37° C. After replicating the 96-well plate into a copy plate, 75 μl/well of filter-sterilized TB:glycerol (1:1, v/v; with, or without, 100 mg/l ampicillin) was added to the plate, it was shaken briefly at 100 rpm, 37° C., and then closed with Parafilm® (American National Can, Greenwich, Conn.) and placed in a −70° C. freezer for storage. Copy plates were grown and processed identically to the master plates. A total of 40 such master plates (and their copies) were prepared.

Screening of the Library with Radiolabeled DNA Probes

To prepare colony filters for probing with radioactively labeled probes, ten 96-well plates of the library were thawed at 25° C. (bench top at room temperature). A replica plating tool with 96 prongs was used to inoculate a fresh 96-well copy plate containing 75 μl/well of TB-Amp 100 . The copy plate was grown overnight (stationary) at 37° C., then shaken about 30 min at 100 rpm at 37° C. A total of 800 colonies was represented in these copy plates, due to nongrowth of some isolates. The replica tool was used to inoculate duplicate impressions of the 96-well arrays onto Magna NT (MSI, Westboro, Mass.) nylon membranes (0.45 micron, 220×250 mm) which had been placed on solid LB-Amp 100 (100 ml/dish) in Bio-assay plastic dishes (Nunc, 243×243×18 mm; Curtin Mathison Scientific, Inc., Wood Dale, Ill.). The colonies were grown on the membranes at 37° C. for about 3 hr.

A positive control colony (a bacterial clone containing a GZ4 sequence insert, see below) was grown on a separate Magna NT membrane (Nunc, 0.45 micron, 82 mm circle) on LB medium supplemented with 35 mg/l chloramphenicol (i.e., LB-Cam 35 ), and processed alongside the library colony membranes. Bacterial colonies on the membranes were lysed, and the DNA was denatured and neutralized according to a protocol taken from the Genius™ System User's Guide version 2.0 (Boehringer Mannheim, Indianapolis, Ind.). Membranes were placed colony side up on filter paper soaked with 0.5 N NaOH plus 1.5 M NaCl for 15 min to denature, and neutralized on filter paper soaked with 1 M Tris-HCl pH 8.0, 1.5 M NaCl for 15 min. After UV-crosslinking using a Stratagene UV Stratalinker set on auto crosslink, the membranes were stored dry at 25° C. until use. Membranes were trimmed into strips containing the duplicate impressions of a single 96-well plate, then washed extensively by the method of section 6.4.1 in CPMB (op. cit.): 3 hr at 25° C. in 3×SSC, 0.1% (w/v) SDS, followed by 1 hr at 65° C. in the same solution, then rinsed in 2×SSC in preparation for the hybridization step (20×SSC=3 M NaCl, 0.3 M sodium citrate, pH 7.0).

Amplification of a Specific Genomic Fragment of a TcaC Gene

Based on the N-terminal amino acid sequence determined for the purified TcaC peptide fraction [disclosed herein as SEQ ID NO:2], a pool of degenerate oligonucleotides (pool S4Psh) was synthesized by standard β-cyanoethyl chemistry on an Applied BioSystem ABI394 DNA/RNA Synthesizer (Perkin Elmer, Foster City, Calif.). The oligonucleotides were deprotected 8 hours at 55° C., dissolved in water, quantitated by spectrophotometric measurement, and diluted for use. This pool corresponds to the determined N-terminal amino acid sequence of the TcaC peptide. The determined amino acid sequence and the corresponding degenerate DNA sequence are given below, where A, C, G, and T are the standard DNA bases, and I represents inosine:

Amino
Acid	Met	Gln	Asp	Ser	Pro	Glu	Val
S4Psh	5′ ATG	CA(A/G)	GA(T/C)	(T/A)(C/G)(T/A)	CCI	GA(A/G)	GT 3′

Another set of degenerate oligonucleotides was synthesized (pool P2.3.5R), representing the complement of the coding strand for determined amino acid sequence of the SEQ ID NO:17:

Amino
Acid	Ala	Phe	Asn	Ile	Asp	Asp	Val
Codons	5′ GCN	TT(T/C)	AA(T/C)	AT(A/T/C)	GA(T/C)	GA(T/C)	GT 3′
P2.3.5R	3′ CG(A/C/G/T)	AA(A/G)	TT(A/G)	TA(T/A/G)	CT(A/G)	CT(A/G)	CA 5′

These oligonucleotides were used as primers in Polymerase Chain Reactions (PCR®, Roche Molecular Systems, Branchburg, N.J.) to amplify a specific DNA fragment from genomic DNA prepared from Photorhabdus strain W-14 (see above). A typical reaction (50 μl) contained 125 pmol of each primer pool P2Psh and P2.3.5R, 253 ng of genomic template DNA, 10 nmol each of dATP, dCTP, dGTP, and dTTP, 1×GeneAmp® PCR buffer, and 2.5 units of AmpliTaq® DNA polymerase (both from Roche Molecular Systems; 10×GeneAmp buffer is 100 mM Tris-HCl pH 8.3, 500 mM KCl, 0.01% w/v gelatin). Amplifications were performed in a Perkin Elmer Cetus DNA Thermal Cycler (Perkin Elmer, Foster City, Calif., using 35 cycles of 94° C. (1.0 min), 55° C. (2.0 min), 72° C. (3.0 min), followed by an extension period of 7.0 min at 72° C. Amplification products were analyzed by electrophoresis through 2% w/v NuSieve® 3:1 agarose (FMC BioProducts) in TEA buffer (40 mM Tris-acetate, 2 mM EDTA, pH 8.0). A specific product of estimated size 250 bp was observed amongst numerous other amplification products by ethidium bromide (0.5 μg/ml) staining of the gel and examination under ultraviolet light.

The region of the gel containing an approximately 250 bp product was excised, and a small plug (0.5 mm dia.) was removed and used to supply template for PCR amplification (40 cycles). The reaction (50 μl) contained the same components as above, minus genomic template DNA. Following amplification, the ends of the fragments were made blunt and were phosphorylated by incubation at 25° C. for 20 min with 1 unit of T4 DNA polymerase (NEB), 1 nmol ATP, and 2.15 units of T4 kinase (Pharmacia Biotech Inc., Piscataway, N.J.).

DNA fragments were separated from residual primers by electrophoresis through 1% w/v GTG® agarose (FMC) in TEA. A gel slice containing fragments of apparent size 250 bp was excised, and the DNA was extracted using a Qiaex kit (Qiagen Inc., Chatsworth, Calif.).

The extracted DNA fragments were ligated to plasmid vector pBC KS(+) (Stratagene) that had been digested to completion with restriction enzyme Sma 1 and extracted in a manner similar to that described for pWE15 DNA above. A typical ligation reaction (16.3 μl) contained 100 ng of digested pBC KS(+) DNA, 70 ng of 250 bp fragment DNA, 1 nmol [Co(NH 3 ) 6 ]Cl 3 , and 3.9 Weiss units of T4 DNA ligase (Collaborative Biomedical Products, Bedford, Mass.), in 1×ligation buffer (50 mM Tris-HCl, pH 7.4; 10 mM MgCl 2 ; 10 M dithiothreitol; 1 mM spermidine, 1 mM ATP, 100 mg/ml bovine serum albumin). Following overnight incubation at 14° C., the ligated products were transformed into frozen, competent Escherichia coli DHSα cells (Gibco BRL) according to the suppliers' recommendations, and plated on LB-Cam 35 plates, containing IPTG (119 μg/ml) and X-gal (50 μg/ml). Independent white colonies were picked, and plasmid DNA was prepared by a modified alkaline-lysis/PEG precipitation method (PRISM™ Ready Reaction DyeDeoxy™ Terminator Cycle Sequencing Kit Protocols; ABI/Perkin Elmer). The nucleotide sequence of both strands of the insert DNA was determined, using T7 primers [pBC KS(+) bases 601-623: TAAAACGACGGCCAGTGAGCGCG) and LacZ primers [pBC KS(+) bases 792-816: ATGACCATGATTACGCCAAGCGCGC) and protocols supplied with the PRISM™ sequencing kit (ABI/Perkin Elmer) Nonincorporated dye-terminator dideoxyribonucleotides were removed by passage through Centri-Sep 100 columns (Princeton Separations, Inc., Adelphia, N.J.) according to the manufacturer's instructions. The DNA sequence was obtained by analysis of the samples on an ABI Model 373A DNA Sequencer (ABI/Perkin Elmer). The DNA sequences of two isolates, GZ4 and HB14, were found to be as illustrated in FIG. 1 .

This sequence illustrates the following features: 1) bases 1-20 represent one of the 64 possible sequences of the S4Psh degenerate oligonucleotides, ii) the sequence of amino acids 1-3 and 6-12 correspond exactly to that determined for the N-terminus of TcaC (disclosed as SEQ ID NO:2), iii) the fourth amino acid encoded is a cysteine residue rather than serine. This difference is encoded within the degeneracy for the serine codons (see above), iv) the fifth amino acid encoded is proline, corresponding to the TcaC N-terminal sequence given as SEQ ID NO:2, v) bases 257-276 encode one of the 192 possible sequences designed into the degenerate pool, vi) the TGA termination codon introduced at bases 268-270 is the result of complementarity to the degeneracy built into the oligonucleotide pool at the corresponding position, and does not indicate a shortened reading frame for the corresponding gene.

Labeling of a TcaC Peptide Gene-specific Probe

DNA fragments corresponding to the above 276 bases were amplified (35 cycles) by PCR® in a 100 μl reaction volume, using 100 pmol each of P2Psh and P2.3.5R primers, 10 ng of plasmids GZ4 or HB14 as templates, 20 nmol each of DATP, dCTP, dGTP, and dTTP, 5 units of AmpliTAq® DNA polymerase, and 1× concentration of GeneAmp® buffer, under the same temperature regimes as described above. The amplification products were extracted from a 1% GTG® agarose gel by Qiaex kit and quantitated by fluorometry.

The extracted amplification products from plasmid HB14 template (approximately 400 ng) were split into five aliquots and labeled with 32 P-dCTP using the High Prime Labeling Mix (Boehringer Mannheim) according to the manufacturer's instructions. Nonincorporated radioisotope was removed by passage through NucTrap® Probe Purification Columns (Stratagene), according to the supplier's instructions. The specific activity of the labeled DNA product was determined by scintillation counting to be 3.11×10 8 dpm/μg. This labeled DNA was used to probe membranes prepared from 800 members of the genomic library.

Screening with a TcaC-peptide Gene Specific Probe

The radiolabeled HB14 probe was boiled approximately 10 min, then added to “minimal hyb” solution. [Note: The “minimal hyb” method is taken from a CERES protocol; “Restriction Fragment Length Polymorphism Laboratory Manual version 4.0”, sections 4-40 and 4-47; CERES/NPI, Salt Lake City, Utah. NPI is now defunct, with its successors operating as Linkage Genetics]. “Minimal hyb” solution contains 10% w/v PEG (polyethylene glycol, M.W. approx. 8000), 7% w/v SDS; 0.6×SSC, 10 mM sodium phosphate buffer (from a 1M stock containing 95 g/l NaH 2 PO 4 .1H 2 O and 84.5 g/l Na 2 HPO 4 .7H 2 O), 5 mM EDTA, and 100 mg/ml denatured salmon sperm DNA. Membranes were blotted dry briefly then, without prehybridization, 5 strips of membrane were placed in each of 2 plastic boxes containing 75 ml of “minimal hyb” and 2.6 ng/ml of radiolabeled HB14 probe. These were incubated overnight with slow shaking (50 rpm) at 60° C. The filters were washed three times for approximately 10 min each at 25° C. in “minimal hyb wash solution” (0.25×SSC, 0.2% SDS), followed by two 30-min washes with slow shaking at 60° C. in the same solution. The filters were placed on paper covered with Saran Wrap® (Dow Brands, Indianapolis, Ind.) in a light-tight autoradiographic cassette and exposed to X-Omat X-ray film (Kodak, Rochester, N.Y.) with two DuPont Cronex Lightning-Plus C1 enhancers (Sigma Chemical Co., St. Louis, Mo.), for 4 hr at −70° C. Upon development (standard photographic procedures), significant signals were evident in both replicates amongst a high background of weaker, more irregular signals. The filters were again washed for about 4 hr at 68° C. in “minimal hyb wash solution” and then placed again in the cassettes and film was exposed overnight at −70° C. Twelve possible positives were identified due to strong signals on both of the duplicate 96-well colony impressions. No signal was seen with negative control membranes (colonies of XL1 Blue MR cells containing pWE15), and a very strong signal was seen with positive control membranes (DH5α cells containing the GZ4 isolate of the PCR product) that had been processed concurrently with the experimental samples.

The twelve putative hybridization-positive colonies were retrieved from the frozen 96-well library plates and grown overnight at 37° C. on solid LB-Amp 100 medium. They were then patched (3/plate, plus three negative controls: XL1 Blue MR cells containing the pWE15 vector) onto solid LB-Amp 100 . Two sets of membranes (Magna NT nylon, 0.45 micron) were prepared for hybridization. The first set was prepared by placing a filter directly onto the colonies on a patch plate, then removing it with adherent bacterial cells, and processing as below. Filters of the second set were placed on plates containing LB-Amp 100 medium, then inoculated by transferring cells from the patch plates onto the filters. After overnight growth at 37° C., the filters were removed from the plates and processed.

Bacterial cells on the filters were lysed and DNA denatured by placing each filter colony-side-up on a pool (1.0 ml) of 0.5 N NaOH in a plastic plate for 3 min. The filters were blotted dry on a paper towel, then the process was repeated with fresh 0.5 N NaOH. After blotting dry, the filters were neutralized by placing each on a 1.0 ml pool of 1 M Tris-HCl, pH 7.5 for 3 min, blotted dry, and reneutralised with fresh buffer. This was followed by two similar soakings (5 min each) on pools of 0.5 M Tris-HCl pH 7.5 plus 1.5 M NaCl. After blotting dry, the DNA was UV crosslinked to the filter (as above), and the filters were washed (25° C., 100 rpm) in about 100 ml of 3×SSC plus 0.1%(w/v) SDS (4 times, 30 min each with fresh solution for each wash). They were then placed in a minimal volume of prehybridization solution [6×SSC plus 1% w/v each of Ficoll 400 (Pharmacia), polyvinylpyrrolidone (av. M.W. 360,000; Sigma) and bovine serum albumin Fraction V; (Sigma)] for 2 hr at 65° C., 50 rpm. The prehybridization solution was removed, and replaced with the HB14 32 P-labeled probe that had been saved from the previous hybridization of the library membranes and which had been denatured at 95° C. for 5 min. Hybridization was performed at 60° C. for 16 hr with shaking at 50 rpm.

Following removal of the labeled probe solution, the membranes were washed 3 times at 25° C. (50 rpm, 15 min) in 3×SSC (about 150 ml each wash). They were then washed for 3 hr at 68° C. (50 rpm) in 0.25×SSC plus 0.2% SDS (minimal hyb wash solution), and exposed to X-ray film as described above for 1.5 hr at 25° C. (no enhancer screens). This exposure revealed very strong hybridization signals to cosmid isolates 22G12, 25A10, 26A5, and 26B10, and a very weak signal with cosmid isolate 8B10. No signal was seen with the negative control (pWE15) colonies, and a very strong signal was seen with positive control membranes (DH5a cells containing the GZ4 isolate of the PCR product) that had been processed concurrently with the experimental samples.

Amplification of a Specific Genomic Fragment of a TcaB Gene

Based on the N-terminal amino acid sequence determined for the purified TcaB i peptide fraction (disclosed here as SEQ ID NO:3) a pool of degenerate oligonucleotides (pool P8F) was synthesized as described for peptide TcaC. The determined amino acid sequence and the corresponding degenerate DNA sequence are given below, where A, C, G, and T are the standard DNA bases, and I represents inosine:

Amino
Acid	Leu	Phe	Thr	Gln	Thr	Leu	Lys	Glu	Ala	Arg
P8F	5′ (C/T)TI	TTT	ACI	CA(A/G)	ACI	(C/T)TI	AAA	GAA	GCI	(A/C)G 3′

Another set of degenerate oligonucleotides was synthesized (pool P8.108.3R), representing the complement of the coding strand for the determined amino acid sequence of the TcaB i -PT108 internal peptide (disclosed herein as SEQ ID NO:20):

Amino
Acid	Met	Tyr	Tyr	Ile	Gln	Ala	Gln	Gln
Codons	ATG	TA(T/C)	TA(T/C)	AT(T/C/A)	CA(A/G)	GC(A/C/G/T)	CA(A/G	CA(A/G)
P8.108.3R	3′ TAC	AT(A/G)	AT(A/G)	TA(A/G/T)	GT(T/C)	CGI	GT(T/C)	GT 5′

These oligonucleotides were used as primers for PCR® using HotStart 50 Tubes™ (Molecular Bio-Products, Inc., San Diego, Calif.) to amplify a specific DNA fragment from genomic DNA prepared from Photorhabdus strain W-14 (see above). A typical reaction (50 μl) contained (bottom layer) 25 pmol of each primer pool P8F and PB.108.3R, with 2 nmol each of DATP, dCTP, dGTP, and dTTP, in 1×GeneAmp® PCR buffer, and (top layer) 230 ng of genomic template DNA, 8 nmol each of DATP, dCTP, dGTP, and dTTP, and 2.5 units of AmpliTaq® DNA polymerase, in 1×GeneAmp® PCR buffer. Amplifications were performed by 35 cycles as described for the TcaC peptide. Amplification products were analyzed by electrophoresis through 0.7% w/v SeaKem® LE agarose (FMC) in TEA buffer. A specific product of estimated size 1600 bp was observed.

Four such reactions were pooled, and the amplified DNA was extracted from a 1.0% SeaKem® LE gel by Qiaex kit as described for the TcaC peptide. The extracted DNA was used directly as the template for sequence determination (PRISM™ Sequencing Kit) using the P8F and P8.108.3R primer pools. Each reaction contained about 100 ng template DNA and 25 pmol of one primer pool, and was processed according to standard protocols as described for the TcaC peptide. An analysis of the sequence derived from extension of the P8F primers revealed the short DNA sequence (and encoded amino acid sequence):

GAT	GCA	TTG	NTT	GCT
Asp	Ala	Leu	(Val)	Ala

which corresponds to a portion of the N-terminal peptide sequence disclosed as SEQ ID NO:3 (TcaB i ).

Labeling of a TcaB i -peptide Gene-specific Probe

Approximately 50 ng of gel-purified TcaB i DNA fragment was labeled with 32 P-dCTP as described above, and nonincorporated radioisotopes were removed by passage through a NICK Column® (Pharmacia). The specific activity of the labelled DNA was determined to be 6×10 9 dpm/μg. This labeled DNA was used to probe colony membranes prepared from members of the genomic library that had hybridized to the TcaC-peptide specific probe.

The membranes containing the 12 colonies identified in the TcaC-probe library screen (see above) were stripped of radioactive TcaC-specific label by boiling twice for approximately 30 min each time in 1 liter of 0.1×SSC plus 0.1% SDS. Removal of radiolabel was checked with a 6 hr film exposure. The stripped membranes were then incubated with the TcaB i peptide-specific probe prepared above. The labeled DNA was denatured by boiling for 10 min, and then added to the filters that had been incubated for 1 hr in 100 ml of “minimal hyb” solution at 60° C. After overnight hybridization at this temperature, the probe solution was removed, and the filters were washed as follows (all in 0.3×SSC plus 0.1% SDS): once for 5 min at 25° C., once for 1 hr at 60° C. in fresh solution, and once for 1 hr at 63° C. in fresh solution. After 1.5 hr exposure to X-ray film by standard procedures, 4 strongly-hybridizing colonies were observed. These were, as with the TcaC-specific probe, isolates 22G12, 25A10, 26A5, and 26B10.

The same TcaB i probe solution was diluted with an equal volume (about 100 ml) of “minimal hyb” solution, and then used to screen the membranes containing the 800 members of the genomic library. After hybridization, washing, and exposure to X-ray film as described above, only the four cosmid clones 22G12, 25A10, 26A5, and 26B10, were found to hybridize strongly to this probe.

Isolation of Subclones Containing Genes Encoding TcaC and YcaB i Peptides, and Determination of DNA Base Sequence Thereof

Three hybridization-positive cosmids in strain XL1 Blue MR were grown with shaking overnight (200 rpm) at 30° C. in 100 ml TB-Amp 100 . After harvesting the cells by centrifugation, cosmid DNA was prepared using a commercially available kit (BIGprep™, 5 Prime 3 Prime, Inc., Boulder, Colo.), following the manufacturer's protocols. Only one cosmid, 26A5, was successfully isolated by this procedure. When digested with restriction enzyme EcoR 1 (NEB) and analyzed by gel electrophoresis, fragments of approximate sizes 14, 10, 8 (vector), 5, 3.3, 2.9, and 1.5 kbp were detected. A second attempt to isolate cosmid DNA from the same three strains (8 ml cultures; TB-Amp 100 , 30° C.) utilized a boiling miniprep method (Evans G. and G. Wahl., 1987, “Cosmid vectors for genomic walking and rapid restriction mapping.” in Guide to Molecular Cloning Techniques, Meth. Enzymology, Vol. 152, S. Berger and A. Kimmel, eds., pgs. 604-610). Only one cosmid, 25A10, was successfully isolated by this method. When digested with restriction enzyme EcoR I (NEB) and analyzed by gel electrophoresis, this cosmid showed a fragmentation pattern identical to that previously seen with cosmid 26A5.

A 0.15 μg sample of 26A5 cosmid DNA was used to transform 50 ml of E. coli DH5α cells (Gibco BRL), by the supplier's protocols. A single colony isolate of that strain was inoculated into 4 ml of TB-Amp 100 , and grown for 8 hr at 37° C. Chloramphenicol was added to a final concentration of 225 μg/ml, incubation was continued for another 24 hr, then cells were harvested by centrifugation and frozen at −20° C. Isolation of the 26A5 cosmid DNA was by a standard alkaline lysis miniprep (Maniatis et al., op. cit., p. 382), modified by increasing all volumes by 50% and with stirring or gentle mixing, rather than vortexing, at every step. After washing the DNA pellet in 70% ethanol, it was dissolved in TE containing 25 μg/ml ribonuclease A (Boehringer Mannheim).

Identification of EcoR I Fragments Hybridizing to GZ4-derived and TcaB i -Probes

Approximately 0.4 μg of cosmid 25A10 (from XL1 Blue MR cells) and about 0.5 μg of cosmid 26A5 (from chloramphenicol-amplified DH5α cells) were each digested with about 15 units of EcoR I(NEB) for 85 min, frozen overnight, then heated at 65° C. for five min, and electrophoresed in a 0.7% agarose gel (Seakem® LE, 1×TEA, 80 volts, 90 min). The DNA was stained with ethidium bromide as described above, and photographed under ultraviolet light. The EcoR I digest of cosmid 25A10 was a complete digestion, but the sample of cosmid 26A5 was only partially digested under these conditions. The agarose gel containing the DNA fragments was subjected to depurination, denaturation and neutralization, followed by Southern blotting onto a Magna NT nylon membrane, using a high salt (20×SSC) protocol, all as described in section 2.9 of Ausubel et al. (CPMB, op. cit.). The transferred DNA was then UV-crosslinked to the nylon membrane as before.

An TcaC-peptide specific DNA fragment corresponding to the insert of plasmid isolate GZ4 was amplified by PCR® in a 100 ml reaction volume as described previously above. The amplification products from three such reactions were pooled and were extracted from a 1% GTR® agarose gel by Qiaex kit, as described above, and quantitated by fluorometry. The gel-purified DNA (100 ng) was labeled with 32 P-dCTP using the High Prime Labeling Mix (Boehringer Mannheim) as described above, to a specific activity of 6.34×10 8 dpm/μg.

The 32 P-labeled GZ4 probe was boiled 10 min, then added to “minimal hyb” buffer (at 1 ng/ml), and the Southern blot membrane containing the digested cosmid DNA fragments was added, and incubated for 4 hr at 60° C. with gentle shaking at 50 rpm. The membrane was then washed 3 times at 25° C. for about 5 min each (minimal hyb wash solution), followed by two washes for 30 min each at 60° C. The blot was exposed to film (with enhancer screens) for about 30 min at −70° C. The GZ4 probe hybridized strongly to the 5.0 kbp (apparent size) EcoR I fragment of both these two cosmids, 26A5 and 25A10.

The membrane was stripped of radioactivity by boiling for about 30 min in 0.1×SSC plus 0.1% SDS, and absence of radiolabel was checked by exposure to film. It was then hybridized at 60° C. for 3.5 hours with the (denatured) TcaB i probe in “minimal hyb” buffer previously used for screening the colony membranes (above), washed as described previously, and exposed to film for 40 min at −70° C. with two enhancer screens. With both cosmids, the TcaB i probe hybridized lightly with the about 5.0 kbp EcoR 1 fragment, and strongly with a fragment of approximately 2.9 kbp.

The sample of cosmid 26A5 DNA previously described, (from DH5α cells) was used as the source of DNA from which to subclone the bands of interest. This DNA (2.5 μg) was digested with about 3 units of EcoR I (NEB) in a total volume of 30 μl for 1.5 hr, to give a partial digest, as confirmed by gel electrophoresis. Ten μg of pBC KS (+) DNA (Stratagene) were digested for 1.5 hr with 20 units of EcoR I in a total volume of 20 μl, leading to total digestion as confirmed by electrophoresis. Both EcoR I-cut DNA preparations were diluted to 50 μl with water, to each an equal volume of PCI was added, the suspension was gently mixed, spun in a microcentrifuge and the aqueous supernatant was collected. DNA was precipitated by 150 μl ethanol, and the mixture was placed at −20° C. overnight. Following centrifugation and drying, the EcoR I -digested pBC KS (+) was dissolved in 100 μl TE; the partially digested 26A5 was dissolved in 20 μl TE. DNA recovery was checked by fluorometry.

In separate reactions, approximately 60 ng of EcoR I-digested pBC KS(+) DNA was ligated with approximately 180 ng or 270 ng of partially digested cosmid 26A5 DNA. Ligations were carried out in a volume of 20 μl at 15° C. for 5 hr, using T4 ligase and buffer from New England BioLabs. The ligation mixture, diluted to 100 μl with sterile TE, was used to transform frozen, competent DH5α cells (Gibco BRL) according to the supplier's instructions. Varying amounts (25-200 μl) of the transformed cells were plated on freshly prepared solid LB-Cam 35 medium with 1 mM IPTG and 50 mg/l X-gal. Plates were incubated at 37° C. about 20 hr, then chilled in the dark for approximately 3 hr to intensify color for insert selection. White colonies were picked onto patch plates of the same composition and incubated overnight at 37° C.

Two colony lifts of each of the selected patch plates were prepared as follows. After picking white colonies to fresh plates, round Magna NT nylon membranes were pressed onto the patch plates, the membrane was lifted off, and subjected to denaturation, neutralization and UV crosslinking as described above for the library colony membranes. The crosslinked colony lifts were vigorously washed, including gently wiping off the excess cell debris with a tissue. One set was hybridized with the GZ4(TcaC) probe solution described earlier, and the other set was hybridized with the TcaB i probe solution described earlier, according to the ‘minimal hyb’ protocol, followed by washing and film exposure as described for the library colony membranes.

Colonies showing hybridization signals either only with the GZ4 probe, with both GZ4 and TcaB i probes, or only with the TcaB i probe, were selected for further work and cells were streaked for single colony isolation onto LB-Cam 35 media with IPTG and X-gal as before. Approximately 35 single colonies, from 16 different isolates, were picked into liquid LB-Cam 35 media and grown overnight at 37° C.; the cells were collected by centrifugation and plasmid DNA was isolated by a standard alkaline lysis miniprep according to Maniatis et al. (op. cit. p. 368). DNA pellets were dissolved in TE+25 μg/ml ribonuclease A and DNA concentration was determined by fluorometry. The EcoR I digestion pattern was analyzed by gel electrophoresis. The following isolates were picked as useful. Isolate A17.2 contains religated pBC KS(+) only and was used for a (negative) control. Isolates D38.3 and C44.1 each contain only the 2.9 kbp, TcaB i -hybridizing EcoR I fragment inserted into pBC KS(+). These plasmids, named pDAB2000 and pDAB2001, respectively, are illustrated in FIG. 2 .

Isolate A35.3 contains only the approximately 5 kbp, GZ4)-hybridizing EcoR 1 fragment, inserted into pBC KS(+). This plasmid was named pDAB2002 (also FIG. 2 ). These isolates provided templates for DNA sequencing.

Plasmids pDAB2000 and pDAB2001 were prepared using the BIGprep™ kit as before. Cultures (30 ml) were grown overnight in TB-Cam 35 to an OD 600 of 2, then plasmid was isolated according to the manufacturer's directions. DNA pellets were redissolved in 100 μl TE each, and sample integrity was checked by EcoR I digestion and gel electrophoretic analysis.

Sequencing reactions were run in duplicate, with one replicate using as template pDAB2000 DNA, and the other replicate using as template pDAB2001 DNA. The reactions were carried out using the dideoxy dye terminator cycle sequencing method, as described above for the sequencing of the GZ4/HB14 DNAs. Initial sequencing runs utilized as primers the LacZ and T7 primers described above, plus primers based on the determined sequence of the TcaB i PCR amplification product (TH1=ATTGCAGACTGCCAATCGCTTCGG, TH12=GAGAGTATCCAGACCGCGGATGATCTG).

After alignment and editing of each sequencing output, each was truncated to between 250 to 350 bases, depending on the integrity of the chromatographic data as interpreted by the Perkin Elmer Applied Biosystems Division SeqEd 675 software. Subsequent sequencing “steps” were made by selecting appropriate sequence for new primers. With a few exceptions, primers (synthesized as described above) were 24 bases in length with a 50% G+C composition. Sequencing by this method was carried out on both strands of the approximately 2.9 kbp EcoR I fragment.

To further serve as template for DNA sequencing, plasmid DNA from isolate pDAB2002 was prepared by BIGprep™ kit. Sequencing reactions were performed and analyzed as described above. Initially, a T3 primer (pBS SK (+) bases 774-796: CGCGCAATTAACCCTCACTAAAG) and a T7 primer (pBS KS (+) bases 621-643: GCGCGTAATACGACTCACTATAG) were used to prime the sequencing reactions from the flanking vector sequences, reading into the insert DNA. Another set of primers, (GZ4F: GTATCGATTACAACGCTGTCACTTCCC; TH13: GGGAAGTGACAGCGTTGTAATCGATAC; TH14: ATGTTGGGTGCGTCGGCTAATGGACATAAC; and LW1-204: GGGAAGTGACAGCGTTGTAATCGATAC) was made to prime from internal sequences, which were determined previously by degenerate oligonucleotide-mediated sequencing of subcloned TcaC-peptide PCR products. From the data generated during the initial rounds of sequencing, new sets of primers were designed and used to walk the entire length of the about 5 kbp fragment. A total of 55 oligo primers was used, enabling the identification of 4832 total bp of contiguous sequence.

When the DNA sequence of the EcoR I fragment insert of pDAB2002 is combined with part of the determined sequence of the pDAB2000/pDAB2001 isolates, a total contiguous sequence of 6005 bp was generated (disclosed herein as SEQ ID NO:25). When long open reading frames were translated into the corresponding amino acids, the sequence clearly shows the TcaB i N-terminal peptide (disclosed as SEQ ID NO:3), encoded by bases 68-124, immediately following a methionine residue (start of translation). Upstream lies a potential ribosome binding site (bases 51-58), and downstream, at bases 215-277 is encoded the TcaB i -PT158 internal peptide (disclosed herein as SEQ ID NO:19). Further downstream, in the same reading frame, at bases 1787-1822, exists a sequence encoding the TcaB i -PT108 internal peptide (disclosed herein as SEQ ID NO:20). Also in the same reading frame, at bases 1946-1972, is encoded the TcaB ii N-terminal peptide (disclosed herein as SEQ ID NO:5), and the reading frame continues uninterrupted to a translation termination codon at nucleotides 3632-3634.

The lack of an in-frame stop codon between the end of the sequence encoding TcaB i -PT108 and the start of the TcaB ii encoding region, and the lack of a discernible ribosome binding site immediately upstream of the TcaB ii coding region, indicate that peptides TcaB ii and TcaB i are encoded by a single open reading frame of 3567 bp beginning at base pair 65 in SEQ ID NO:25), and are most likely derived from a single primary gene product TcaB of 1189 amino acids (131,586 Daltons; disclosed herein as SEQ ID NO:26) by post-translational cleavage. If the amino acid immediately preceding the TcaB ii N-terminal peptide represents the C-terminal amino acid of peptide TcaB i , then the predicted mass of TcaB ii (627 amino acids) is 70,814 Daltons (disclosed herein as SEQ ID NO:28), somewhat higher than the size observed by SDS-PAGE (68 kDa). This peptide would be encoded by a contiguous stretch of 1881 base pairs (disclosed herein as SEQ ID NO:27). It is thought that the native C-terminus of TcaB i lies somewhat closer to the C-terminus of TcaB i -PT108. The molecular mass of PT108 [3.438 kDa; determined during N-terminal amino acid sequence analysis of this peptide] predicts a size of 30 amino acids. Using the size of this peptide to designate the C-terminus of the TcaB i coding region [Glu at position 604 of SEQ ID NO:28], the derived size of TcaB i is determined to be 604 amino acids or 68,463 Daltons, more in agreement with experimental observations.

Translation of the TcaB ii peptide coding region of 1686 base pairs (disclosed herein as SEQ ID NO:29) yields a protein of 562 amino acids (disclosed herein as SEQ ID NO:30) with predicted mass of 60,789 Daltons, which corresponds well with the observed 61 kDa.

A potential ribosome binding site (bases 3682-3687) is found 48 bp downstream of the stop codon for the tcaB open reading frame. At bases 3694-3726 is found a sequence encoding the N-terminus of peptide TcaC, (disclosed as SEQ ID NO.2). The open reading frame initiated by this N-terminal peptide continues uninterrupted to base 6005 (2361 base pairs, disclosed herein as the first 2361 base pairs of SEQ ID NO.31). A gene (tcaC) encoding the entire TcaC peptide, (apparent size about 165 kDa; about 1500 amino acids), would comprise about 4500 bp.

Another isolate containing cloned EcoR I fragments of cosmid 26A5, E20.6, was also identified by its homology to the previously mentioned GZ4 and TcaB i probes. Agarose gel analysis of EcoR I digests of the DNA of the plasmid harbored by this strain (pDAB2004, FIG. 2 ), revealed insert fragments of estimated sizes 2.9, 5, and 3.3 kbp. DNA sequence analysis initiated from primers designed from the sequence of plasmid pDAB2002 revealed that the 3.3 kbp EcoR I fragment of pDAB2004 lies adjacent to the 5 kbp EcoR I fragment represented in pDAB2002. The 2361 base pair open reading frame discovered in pDAB2002 continues uninterrupted for another 2094 bases in pDAB2004 [disclosed herein as base pairs 2362 to 4458 of SEQ ID NO:31]. DNA sequence analysis using the parent cosmid 26A5 DNA as template confirmed the continuity of the open reading frame. Altogether, the open reading frame (tcaC SEQ ID NO:31) comprises 4455 base pairs, and encodes a protein (TcaC) of 1485 amino acids [disclosed herein as SEQ ID NO:32]. The calculated molecular size of 166,214 Daltons is consistent with the estimated size of the TcaC peptide (165 kDa), and the derived amino acid sequence matches exactly that disclosed for the TcaC N-terminal sequence [SEQ ID NO:2].

The lack of an amino acid sequence corresponding to SEQ ID NO:17; used to design the degenerate oligonucleotide primer pool in the discovered sequence indicates that the generation of the PCR® products found in isolates GZ4 and HB14, which were used as probes in the initial library screen, were fortuitously generated by reverse-strand priming by one of the primers in the degenerate pool. Further, the derived protein sequence does not include the internal fragment disclosed herein as SEQ ID NO:18. These sequences reveal that plasmid pDAB2004 contains the complete coding region for the TcaC peptide.

Further analysis of SEQ ID NO:25 reveals the end of an open reading frame (bases 1-43), which encodes the final 13 amino acids of the TcaA iii peptide, disclosed herein as SEQ ID NO:35. Only 24 bases separate the end of the TcaA iii coding region and the start of the TcaB i coding region. Included within the 24 bases are sequences that may serve as a ribosome binding site. Although possible, it is not likely that a Photorhabdus gene promoter is encoded within this short region. We propose that genomic region tca, which includes three long open reading frames [tcaA (SEQ ID NO:33), tcaB (SEQ ID NO:25, bases 65-36334), and tcaC (SEQ ID NO:31),which is separated from the end of tcaB by only 59 bases] is regulated as an operon, with transcription initiating upstream of the start of the tcaA gene (SEQ ID NO:33), and resulting in a polycistronic messenger RNA.

EXAMPLE 9

Screening of the Photorhabdus Genomic Library for Genes Encoding the TcbA ii Peptide

This example describes a method used to identify DNA clones that contain the TcbA ii peptide-encoding genes, the isolation of the gene, and the determination of its partial DNA base sequence.

Primers and PCR Reactions

The TcbA ii polypeptide of the insect active preparation is about 206 kDa. The amino acid sequence of the N-terminus of this peptide is disclosed as SEQ ID NO:1. Four pools of degenerate oligonucleotide primers (“Forward primers”: TH-4, TH-5, TH-6, and TH-7) were synthesized to encode a portion of this amino acid sequence, as described in Example 8, and are shown below.

TABLE 12
Amino
Acid	Phe	Ile	Gln	Gly	Tyr	Ser	Asp	Leu	Phe
TH-4	5′-TT(T/C)	ATI	CA(A/G)	GGI	TA(T/C)	TCI	GA(T/C)	CTI	TT-3′
TH-5	5′-TT(T/C)	ATI	CA(A/G)	GGI	TA(T/C)	AG(T/C)	GA(T/C)	CTI	TT-3′
TH-6	5′-TT(T/C)	ATI	CA(A/G)	GGI	TA(T/C)	TCI	GA(T/C)	TA(A/G)	TT-3′
TH-7	5′-TT(T/C)	ATI	CA(A/G)	GGI	TA(T/C)	AG(T/C)	GA(T/C)	TT(A/G)	TT-3′

In addition, a primary (“a”) and a secondary (“b”) sequence of an internal peptide preparation (TcbA ii -PT81) have been determined and are disclosed herein as SEQ ID NO:23 and SEQ ID NO:24, respectively. Four pools of degenerate oligonucleotides (“Reverse Primers”: TH-8, TH-9, TH-10 and TH-11) were similarly designed and synthesized to encode the reverse complement of sequences that encode,a portion of the peptide of SEQ ID NO:23, as shown below.

TABLE 13
Amino
Acid	Thr	Tyr	Leu	Thr	Ser	Phe	Glu	Gln	Val	Ala	Asn
TH-8	3′-TGI	AT(A/G)	GAI	TGI	AGI	AA(A/G)	CT(T/C)	GT(T/C)	CAI	CGI	TT(G/A)-5′
TH-9	3′-TGI	AT(A/G)	TT(A/G)	TGI	AGI	AA(A/G)	CT(T/C)	GT(T/C)	CAI	CGI	TT(G/A)-5′
TH-10	3′-TGI	AT(A/G)	GAI	TGI	TC(G/A)	AA(A/G)	CT(T/C)	GT(T/C)	CAI	CGI	TT(G/A)-5′
TH-11	3′-TGI	AT(A/G)	TT(A/G)	TGI	TC(G/A)	AA(A/G)	CT(T/C)	GT(T/C)	CAI	CGI	TT(G/A)-5′

Sets of these primers were used in PCR® reactions to amplify TcbA ii -encoding gene fragments from the genomic Photorhabdus luminescens W-14 DNA prepared in Example 6. All PCR® reactions were run with the “Hot Start” technique using AmpliWax™ gems and other Perkin Elmer reagents and protocols. Typically, a mixture (total volume 11 μl) of MgCl 2 , dNTP's, 10×GeneAmp® PCR Buffer II, and the primers were added to tubes containing a single wax bead. [10×GeneAmp® PCR Buffer II is composed of 100 mM Tris-HCl, pH 8.3; and 500 mM KCl.] The tubes were heated to 80° C. for 2 minutes and allowed to cool. To the top of the wax seals, a solution containing 10×GeneAmp PCR Buffer II, DNA template, and AmpliTaq® DNA polymerase were added. Following melting of the wax seal and mixing of components by thermal cycling, final reaction conditions (volume of 50 μl) were: 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 2.5 mM MgCl 2 ; 200 μM each in dATP, dCTP, dGTP, dTTP; 1.25 mM in a single Forward primer pool; 1.25 μM in a single Reverse primer pool, 1.25 units of AmpliTaq® DNA polymerase, and 170 ng of template DNA.

The reactions were placed in a thermocycler (as in Example 8) and run with the following program:

TABLE 14
Temperature	Time	Cycle Repetition
94° C.	2 minutes	1X
94° C.	15 seconds
55-65° C.	30 seconds	30X
72° C.	1 minute
72° C.	7 minutes	1X
15° C.	Constant

A series of amplifications was run at three different annealing temperatures (55°, 60°, 65° C.) using the degenerate primer pools. Reactions with annealing at 65° C. had no amplification products visible following agarose gel electrophoresis. Reactions having a 60° C. annealing regime and containing primers TH-5+TH-10 produced an amplification product that had a mobility corresponding to 2.9 kbp. A lesser amount of the 2.9 kbp product was produced under these conditions with primers TH-7+TH-10. When reactions were annealed at 55° C.,these primer pairs produced more of the 2.9 kbp product, and this product was also produced by primer pairs TH-5+TH-8 and TH-5+TH-11. Additional very faint 2.9 kbp bands were seen in lanes containing amplification products from primer pairs TH-7 plus TH-8, TH-9, TH-10, or TH-11.

To obtain sufficient PCR amplification product for cloning and DNA sequence determination, 10 separate PCR reactions were set up using the primers TH-5+TH-10, and were run using the above conditions with a 55° C. annealing temperature. All reactions were pooled and the 2.9 kbp product was purified by Qiaex extraction from an agarose gel as described above.

Additional sequences determined for TcbA ii internal peptides are disclosed herein as SEQ ID NO:21 and SEQ ID NO:22. As before, degenerate oligonucleotides (Reverse primers TH-17 and TH-18) were made corresponding to the reverse complement of sequences that encode a portion of the amino acid sequence of these peptides.

TABLE 15
From SEQ ID NO: 21
Amino
Acid	Met	Glu	Thr	Gln	Asn	Ile	Gln	Glu	Pro
TH-17	3′-TAC	CTT/C	TGI	GTT/C	TTA/G	TAI	GTT/C	GTT/C	GG-5′

TABLE 16
From SEQ ID NO: 22
Amino
Acid	Asn	Pro	Ile	Asn	Ile	Asn	Thr	Gly	Ile	Asp
TH-18	3′-TT(A/G)	GGI	TAI	TT(A/G)	TAI	TT(A?G)	TGI	CCI	TAI	CT(A/G)-5′

Degenerate oligonucleotides TH-18 and TH-17 were used in an amplification experiment with Photorhabdus luminescens W-14 DNA as template and primers TH-4, TH-5, TH-6, or TH-7 as the 5′-(Forward) primers. These reactions amplified products of approximately 4 kbp and 4.5 kbp, respectively. These DNAs were transferred from agarose gels to nylon membranes and hybridized with a 32 P-labeled probe (as described above) prepared from the 2.9 kbp product amplified by the TH-5+TH10 primer pair. Both the 4 kbp and the 4.5 kbp amplification products hybridized strongly to the 2.9 kbp probe. These results were used to construct a map ordering the TcbA ii internal peptide sequences as shown in FIG. 3 . Approximate distances between the primers are shown in nucleotides in FIG. 3 .

DNA Sequence of the 2.9 kbp TcbA ii -encoding Fragment

Approximately 200 ng of the purified 2.9 kbp fragment (prepared above) was precipitated with ethanol and dissolved in 17 ml of water. One-half of this was used as sequencing template with 25 pmol of the TH-5 pool as primers, the other half was used as template for TH-10 priming. Sequencing reactions were as given in Example 8. No reliable sequence was produced using the TH-10 primer pool; however, reactions with TH-5 primer pool produced the sequence disclosed below:.

1 AATCGTGTTG ATCCCTATGC CGNGCCGGGT TCGGTGGAAT CGATGTCCTC ACCGGGGGTT
61 TATTNGAGGG ANTNGTCCCG TGAGGCCAAA AANTGGAATG AAAGAAGTTC AATTTNTTAC
121 CTAGATAAAC GTCGCCCGGN TTTAGAAAGN TTANTGNTCA GCCAGAAAAT TTTGGTTGAG
181 GAAATTCCAC CGNTGGTTCT CTCTATTGAT TNGGGCCTGG CCGGGTTCGA ANNAAAACNA
241 GGAAATNCAC AAGTTGAGGT GATGGNTTTG TNGCNANCTT NTCGTTTAGG TGGGGAGAAA
301 CCTTNTCANC ACGNTTNTGA AACTGTCCGG GAAATCGTCC ATGANCGTGA NCCAGGNTTN
361 CGCCATTGG

Based on this sequence, a sequencing primer (TH-21, 5′-CCGGGCGACGTTTATCTAGG-3′) was designed to reverse complement bases 120-139, and initiate polymerization towards the 5′ end (i.e., TH-5 end) of the gel-purified 2.9 kbp TcbA ii -encoding PCR fragment. The determined sequence is shown below, and is compared to the biochemically determined N-terminal peptide sequence of TcbA ii SEQ ID NO:1.

TcbA ii 2.9 kbp PCR Fragment Sequence Confirmation

[Underlined amino acids=encoded by degenerate oligonucleotides]

SEQ ID NO:1                                                                         F   I   O   G   Y   S   D   L   F                                                                       G   -   -   A
|   |   |   |   |   |   |   |   |   |   |
2.9 kbp seq GC ATG CAG GGG TAT AGT GAC CTG TTT GGT AAT CGT GCT
M   Q   G   Y   S   D   L   F   G   N   R   A >

From the homology of the derived amino acid sequence to the biochemically determined one, it is clear that the 2.9 kbp PCR fragment represents the TcbA coding region. This 2.9 kbp fragment was then used as a hybridization probe to screen the Photorhabdus W-14 genomic library prepared in Example 8 for cosmids containing the TcbA ii -encoding gene.

Screening the Photorhabdus Cosmid Library

The 2.9 kb gel-purified PCR fragment was labeled with 32 P using the Boehringer Mannheim High Prime labeling kit as described in Example 8. Filters containing remnants of approximately 800 colonies from the cosmid library were screened as described previously (Example 8), and positive clones were streaked for isolated colonies and rescreened. Three clones (8A11, 25G8, and 26D1) gave positive results through several screening and characterization steps. No hybridization of the TcbA ii -specific probe was ever observed with any of the four cosmids identified in Example 8, and which contain the tcaB and tcaC genes. DNA from cosmids 8A11, 25G8, and 26D1 was digested with restriction enzymes Bgl II, EcoR I or Hind III (either alone or in combination with one another), and the fragments were separated on an agarose gel and transferred to a nylon membrane as described in Example 8. The membrane was hybridized with 32 P-labeled probe prepared from the 4.5 kbp fragment (generated by amplification of Photorhabdus genomic DNA with primers TH-5+TH-17). The patterns generated from cosmid DNAs 8A11 and 26D1 were identical to those generated with similarly-cut genomic DNA on the same membrane. It is concluded that cosmids 8A11 and 26D1 are accurate representations of the genomic TcbA ii encoding locus. However, cosmid 25G8 has a single Bgl II fragment which is slightly larger than the genomic DNA. This may result from positioning of the insert within the vector.

DNA Sequence of the tcbA-encoding Gene

The membrane hybridization analysis of cosmid 26D1 revealed that the 4.5 kbp probe hybridized to a single large EcoR I fragment (greater than 9 kbp). This fragment was gel purified and ligated into the EcoR I site of pBC KS (+) as described in Example 8, to generate plasmid pBC-S1/R1. The partial DNA sequence of the insert DNA of this plasmid was determined by “primer walking” from the flanking vector sequence, using procedures described in Example 8. Further sequence was generated by extension from new oligonucleotides designed from the previously determined sequence. When compared to the determined DNA sequence for the tcbA gene identified by other methods (disclosed herein as SEQ ID NO:1l as described in Example 12 below), complete homology was found to nucleotides 1-272, 319-826, 2578-3036, and 3068-3540 (total bases=1712). It was concluded that both approaches can be used to identify DNA fragments encoding the TcbA ii peptide.

Analysis of the Derived Amino Acid Sequence of the tcbA Gene

The sequence of the DNA fragment identified as SEQ ID NO:11 encodes a protein whose derived amino acid sequence is disclosed herein as SEQ ID NO:12. Several features verify the identity of the gene as that encoding the TcbA ii protein. The TcbA ii N-terminal peptide (SEQ ID NO:1; Phe Ile Gln Gly Tyr Ser Asp Leu Phe Gly Asn Arg Ala) is encoded as amino acids 88-100. The TcbA ii internal peptide TcbA ii -PT81(a) (SEQ ID NO:23) is encoded as amino acids 1065-1077, and TcbA ii -PT81(b) (SEQ ID NO:24) is encoded as amino acids 1571-1592. Further, the internal peptide TcbA ii -PT56 (SEQ ID NO:22) is encoded as amino acids 1474-1488, and the internal peptide TcbA ii -PT103 (SEQ ID NO:21) is encoded as amino acids 1614-1639. It is obvious that this gene is an authentic clone encoding the TcbA ii peptide as isolated from insecticidal protein preparations of Photorhabdus luminescens strain W-14.

The protein isolated as peptide TcbA ii is derived from cleavage of a longer peptide. Evidence for this is provided by the fact that the nucleotides encoding the TcbA ii N-terminal peptide SEQ ID NO:1are preceded by 261 bases (encoding 87 N-terminal-proximal amino acids) of a longer open reading frame (SEQ ID NO:11). This reading frame begins with nucleotides that encode the amino acid sequence Met Gln Asn Ser Leu, which corresponds to the N-terminal sequence of the large peptide TcbA, and is disclosed herein as SEQ ID NO:16. It is thought that TcbA is the precursor protein for TcbA ii .

Relationship of tcbA, tcaB and tcaC Genes

The tcaB and tcaC genes are closely linked and may be transcribed as a single mRNA (Example 8). The tcbA gene is borne on cosmids that apparently do not overlap the ones harboring the tcaB and tcaC cluster, since the respective genomic library screens identified different cosmids. However, comparison of the amino sequences encoded by the tcaB and tcaC genes with the tcbA gene reveals a substantial degree of homology. The amino acid conservation (Protein Alignment Mode of MacVector™ Sequence Analysis Software, scoring matrix pam250, hash value=2; Oxford Molecular Group, Campbell, Calif.) is shown in FIG. 4 . On the score line of each panel in FIG. 4 , up carats ({circumflex over ( )}) indicate homology or conservative amino acid changes,and down carats (v) indicate nonhomology.

This analysis shows that the amino acid sequence of the TcbA peptide from residues 1739 to 1894 is highly homologous to amino acids 441 to 603 of the TcaB i peptide (162 of the total 627 amino acids of TcaB; SEQ ID NO:28). In addition, the sequence of TcbA amino acids 1932 to 2459 is highly homologous to amino acids 12 to 531 of peptide TcaB ii (520 of the total 562 amino acids; SEQ ID NO:30). Considering that the TcbA peptide (SEQ ID NO:12) comprises 2505 amino acids, a total of 684 amino acids (27%) at the C-proximal end of it is homologous to the TcaB i or TcaB ii peptides, and the homologies are arranged colinear to the arrangement of the putative TcaB preprotein (SEQ ID NO:26). A sizeable gap in the TcbA homology coincides with the junction between the TcaB i and TcaB ii portions of the TcaB preprotein. Clearly the TcbA and TcaB gene products are evolutionarily related, and it is proposed that they share some common function(s) in Photorhabdus.

EXAMPLE 10

Characterization of Zinc-metalloproteases in Photorhabdus Broth: Protease Inhibition, Classification, and Purification

Protease Inhibition and Classification Assays: Protease assays were performed using FITC-casein dissolved in water as substrate (0.08% final assay concentration). Proteolysis reactions were performed at 25° C. for 1 h in the appropriate buffer with 25 μl of Photorhabdus broth (150 μl total reaction volume). Samples were also assayed in the presence and absence of dithiothreitol. After incubation, an equal volume of 12% trichloroacetic acid was added to precipitate undigested protein. Following precipitation for 0.5 h and subsequent centrifugation, 100 μl of the supernatant was placed into a 96-well microtiter plate and the pH of the solution was adjusted by addition of an equal volume of 4N NaOH. Proteolysis was then quantitated using a Fluoroskan II fluorometric plate reader at excitation and emission wavelengths of 485 and 538 nm, respectively. Protease activity was tested over a range from pH 5.0-10.0 in 0.5 units increments. The following buffers were used at 50 mM final concentration: sodium acetate (pH 5.0-6.5); Tris-HCL (pH 7.0-8.0); and bis-Tris propane (pH 8.5-10.0). To identify the class of protease(s) observed, crude broth was treated with a variety of protease inhibitors (0.5 μg/μl final concentration) and then examined for protease activity at pH 8.0 using the substrate described above. The protease inhibitors used included E-64 (L-trans-expoxysaccinylleucylamido[4-,-guanidino]-butane), 3,4 dichloroisocoumarin, Leupeptin, pepstatin, amastatin, ethylenediaminetetraacetic acid (EDTA) and 1,10 phenanthroline.

Protease assays performed over a pH range revealed that indeed protease(s) were present which exhibited maximal activity at about pH 8.0 (Table 17). Addition of DTT did not have any effect on protease activity. Crude broth was then treated with a variety of protease inhibitors (Table 18). Treatment of crude broth with the inhibitors described above revealed that 1,10 phenanthroline caused complete inhibition of all protease activity when added at a final concentration of 50 μg, with the IC 50 =5 μg in 100 μl of a 2 mg/ml crude broth solution. These data indicate that the most abundant protease(s) found in the Photorhabdus broth are from the zinc-metalloprotease class of enzymes.

TABLE 17
Effect of pH on the Protease Activity Found in a Day 1 Production of
Photorhabdus luminescens (Strain W-14)
	Flu.	Percent
pH	Units a	Activity b
5.0	3013 ± 78	17
5.5	7994 ± 448	45
6.0	12965 ± 483	74
6.5	14390 ± 1291	82
7.0	14386 ± 1287	82
7.5	14135 ± 198	80
8.0	17582 ± 831	100
8.5	16183 ± 953	92
9.0	16795 ± 760	96
9.5	16279 ± 1022	93
10.0	15225 ± 210	87
a Flu. Units = Fluorescence Units (Maximum = about 28,000; background = about 2200).
b Percent activity relative to the maximum at pH 8.0

TABLE 18
Effect of Different Protease Inhibitors on the Protease Activity at
pH 8 Found in a Day 1 Production of Photorhabdus luminescens
(Strain W-14)
Inhibitor	Corrected Flu. Units a	Percent Inhibition b
Control	13053	0
E-64	14259	0
1,10 Phenanthroline c	15	99
3,4 Dichloroisocoumarin d	7956	39
Leupeptin	13074	0
Pepstatin c	13441	0
Amastatin	12474	4
DMSO Control	12005	8
Methanol Control	12125	7
a Corrected Flu. Units = Fluorescence Units - background (2200 flu. units).
b Percent Inhibition relative to protease activity at pH 8.0.
c Inhibitors were dissolved in methanol.
d Inhibitors were dissolved in DMSO.

The isolation of a zinc-metalloprotease was performed by applying dialyzed 10-80% ammonium sulfate pellet to a Q Sepharose column equilibrated at 50 mM Na 2 PO 4 , pH 7.0 as described in Example 5 for Photorhabdus toxin. After extensive washing, a 0 to 0.5 M NaCl gradient was used to elute toxin protein. The majority of biological activity and protein was eluted from 0.15-0.45 M NaCl. However, it was observed that the majority of proteolytic activity was present in the 0.25-0.35 M NaCl fraction with some activity in the 0.15-0.25 M NaCl fraction. SDS PAGE analysis of the 0.25-0.35 M NaCl fraction showed a major peptide band of approximately 60 kDa. The 0.15-0.25 M NaCl fraction contained a similar 60 kDa band but at lower relative protein concentration. Subsequent gel filtration of this fraction using a Superose 12 HR 16/50 column resulted in a major peak migrating at 57.5 kDa that contained a predominant (>90% of total stained protein) 58.5 kDa band by SDS PAGE analysis. Additional analysis of this fraction using various protease inhibitors as described above determined that the protease was a zinc-metalloprotease. Nearly all of the protease activity present in Photorhabdus broth at day 1 of fermentation corresponded to the about 58 kDa zinc-metalloprotease.

In yet a second isolation of zinc-metalloprotease(s), W-14 Photorhabdus broth grown for three days was taken and protease activity was visualized using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) laced with gelatin as described in Schmidt, T. M., Bleakley, B. and Nealson, K. M. 1988. SDS running gels (5.5×8 cm) were made with 12.5% polyacrylamide (40% stock solution of acrylamide/bis-acrylamide; Sigma Chemical Co., St. Louis, Mo.) into which 0.1% gelatin final concentration (Biorad EIA grade reagent; Richmond Calif.) was incorporated upon dissolving in water. SDS-stacking gels (1.0×8 cm) were made with 5% polyacrylamide, also laced with 0.1% gelatin. Typically, 2.5 μg of protein to be tested was diluted in 0.03 ml of SDS-PAGE loading buffer without dithiothreitol (DTT) and loaded onto the gel. Proteins were electrophoresed in SDS running buffer (Laemmli, U.K. 1970. Nature 227, 680) at 0° C. and at 8 mA. After electrophoresis was complete, the gel was washed for 2 h in 2.5% (v/v) Triton X-100. Gels were then incubated for 1 h at 37° C. in 0.1 M glycine (pH 8.0). After incubation, gels were fixed and stained overnight with 0.1% amido black in methanol-acetic acid- water (30:10:60, vol./vol./vol.; Sigma Chemical Co.). Protease activity was visualized as light areas against a dark, amido black stained background due to proteolysis and subsequent diffusion of incorporated gelatin. At least three distinct bands produced by proteolytic activity at 58-, 41-, and 38 kDa were observed.

Activity assays of the different proteases in W-14 day three culture broth were performed using FITC-casein dissolved in water as substrate (0.02% final assay concentration). Proteolysis experiments were performed at 37° C. for 0-0.5 h in 0.1M Tris-HCl (pH 8.0) with different protein fractions in a total volume of 0.15 ml. Reactions were terminated by addition of an equal volume of 12% trichloroacetic acid (TCA) dissolved in water. After incubation at room temperature for 0.25 h, samples were centrifuged at 10,000×9 for 0.25 h and 0.10 ml aliquots were removed and placed into 96-well microtiter plates. The solution was then neutralized by the addition of an equal volume of 2 N sodium hydroxide, followed by quantitation using a Fluoroskan II fluorometric plate reader with excitation and emission wavelengths of 485 and 538 nm, respectively. Activity measurements were performed using FITC-Casein with different protease concentrations at 37° C. for 0-10 min. A unit of activity was arbitrarily defined as the amount of enzyme needed to produce 1000 fluorescent units/min and specific activity was defined as units/mg of protease.

Inhibition studies were performed using two zinc-metalloprotease inhibitors; 1,10 phenanthroline and N-(a-rhamnopyranosyloxyhydroxyphosphinyl)-Leu-Trp(phosphoramidon) with stock solutions of the inhibitors dissolved in 100% ethanol and water, respectively. Stock concentrations were typically 10 mg/ml and 5 mg/ml for 1,10 phenanthroline and phosphoramidon, respectively, with final concentrations of inhibitor at 0.5-1.0 mg/ml per reaction. Treatment of three day W-14 crude broth with 1,10 phenanthroline, an inhibitor of all zinc metalloproteases, resulted in complete elimination of all protease activity while treatment with phosphoramidon, an inhibitor of thermolysin-like proteases (Weaver, L. H., Kester, W. R., and Matthews, B. W. 1977. J. Mol. Biol. 114, 119-132), resulted in about 56% reduction of protease activity. The residual proteolytic activity could not be further reduced with additional phosphoramidon.

The proteases of three day W-14 Photorhabdus broth were purified as follows: 4.0 liters of broth were concentrated using an Amicon spiral ultra filtration cartridge Type S1Y100 attached to an Amicon M-12 filtration device. The flow-through material having native proteins less than 100 kDa in size (3.8 L) was concentrated to 0.375 L using an Amicon spiral ultra filtration cartridge Type S1Y10 attached to an Amicon M-12 filtration device. The retentate material contained proteins ranging in size from 10-100 kDa. This material was loaded onto a Pharmacia HR16/10 column which had been packed with PerSeptive Biosystem (Framington, Mass.) Poros® 50 HQ strong anion exchange packing that had been equilibrated in 10 mM sodium phosphate buffer (pH 7.0). Proteins were loaded on the column at a flow rate of 5 ml/min, followed by washing unbound protein with buffer until A280=0.00. Afterwards, proteins were eluted using a NaCl gradient of 0-1.0 M NaCl in 40 min at a flow rate of 7.5 ml/min. Fractions were assayed for protease activity, supra., and active fractions were pooled. Proteolytically active fractions were diluted with 50% (v/v) 10 mM sodium phosphate buffer (pH 7.0) and loaded onto a Pharmacia HR 10/10 Mono Q column equilibrated in 10 mM sodium phosphate. After washing the column with buffer until A 280 =0.00, proteins were eluted using a NaCl gradient of 0-0.5 M NaCl for 1 h at a flow rate of 2.0 ml/min. Fractions were assayed for protease activity. Those fractions having the greatest amount of phosphoramidon-sensitive protease activity, the phosphoramidon sensitive activity being due to the 41/38 kDa protease, infra., were pooled. These fractions were found to elute at a range of 0.15-0.25 M NaCl. Fractions containing a predominance of phosphoramidon-insensitive protease activity, the 58 kDa protease, were also pooled. These fractions were found to elute at a range of 0.25-0.35 M NaCl. The phosphoramidon-sensitive protease fractions were then concentrated to a final volume of 0.75 ml using a Millipore Ultrafree®-15 centrifugal filter device Biomax-5K NMWL membrane. This material was applied at a flow rate of 0.5 ml/min to a Pharmacia HR 10/30 column that had been packed with Pharmacia Sephadex G-50 equilibrated in 10 mM sodium phosphate buffer (pH 7.0)/0.1 M NaCl. Fractions having the maximal phosphoramidon-sensitive protease activity were then pooled and centrifuged over a Millipore Ultrafree®-15 centrifugal filter device Biomax-50K NMWL membrane. Proteolytic activity analysis, supra., indicated this material to have only phosphoramidon-sensitive protease activity. Pooling of the phosphoramidon-insensitive protease, the 58 kDa protein, was followed by concentrating in a Millipore Ultrafree®-15 centrifugal filter device Biomax-50K NMWL membrane and further separation on a Pharmacia Superdex-75 column. Fractions containing the protease were pooled.

Analysis of purified 58—and 41/38 kDa purified proteases revealed that, while both types of protease were completely inhibited with 1,10 phenanthroline, only the 41/38 kDa protease was inhibited with phosphoramidon. Further analysis of crude broth indicated that protease activity of day 1 W-14 broth has 23% of the total protease activity due to the 41/38 kDa protease, increasing to 44% in day three W-14 broth.

Standard SDS-PAGE analysis for examining protein purity and obtaining amino terminal sequence was performed using 4-20% gradient MiniPlus SepraGels purchased from Integrated Separation Systems (Natick, Mass.). Proteins to be amino-terminal sequenced were blotted onto PVDF membrane following purification, infra., (ProBlott™ Membranes; Applied Biosystems, Foster City, Calif.), visualized with 0.1% amido black, excised, and sent to Cambridge Prochem; Cambridge, Mass., for sequencing.

Deduced amino terminal sequence of the 58-(SEQ ID NO:45) and 41/38 kDa (SEQ ID NO:44) proteases from three day old W-14 broth were DV-GSEKANEKLK (SEQ ID NO: 45) and DSGDDDKVTNTDIHR (SEQ ID NO:44), respectively.

Sequencing of the 41/38 kDa protease revealed several amino termini, each one having an additional amino acid removed by proteolysis. Examination of the primary, secondary, tertiary and quartenary sequences for the 38 and 41 kDa polypeptides allowed for deduction of the sequence shown above and revealed that these two proteases are homologous.

EXAMPLE 11

Part A

Screening of Photorhabdus Genomic Library Via Use of Antibodies for Genes Encoding TcbA Peptide

In parallel to the sequencing described above, suitable probing and sequencing was done based on the TcbA ii peptide (SEQ ID No:1) . This sequencing was performed by preparing bacterial culture broths and purifying the toxin as described in Examples 1 and 2 above.

Genomic DNA was isolated from the Photorhabdus luminescens strain W-14 grown in Grace's insect tissue culture medium. The bacteria were grown in 5 ml of culture medium in a 250 ml Erlenmeyer flask at 28° C. and 250 rpm for approximately 24 hours. Bacterial cells from 100 ml of culture medium were pelleted at 5000×g for 10 minutes. The supernatant was discarded, and the cell pellets then were used for the genomic DNA isolation.

The genomic DNA was isolated using a modification of the CTAB method described in Section 2.4.3 of Ausubel (supra.). The section entitled “Large Scale CsCl prep of bacterial genomic DNA” was followed through step 6. At this point, an additional chloroform/isoamyl alcohol (24:1) extraction was performed followed by a phenol/chloroform/isoamyl (25:24:1) extraction step and a final chloroform/isoamyl/alcohol (24:1) extraction. The DNA was precipitated by the addition of a 0.6 volume of isopropanol. The precipitated DNA was hooked and wound around the end of a bent glass rod, dipped briefly into 70% ethanol as a final wash, and dissolved in 3 ml of TE buffer.

The DNA concentration, estimated by optical density at 280/260 nm, was approximately 2 mg/ml.

Using this genomic DNA, a library was prepared. Approximately 50 μg of genomic DNA was partly digested with Sau3 A1. Then NaCl density gradient centrifugation was used to size fractionate the partially digested DNA fragments. Fractions containing DNA fragments with an average size of 12 kb, or larger, as determined by agarose gel electrophoresis, were ligated into the plasmid BluScript, Stratagene, La Jolla, Calif., and transformed into an E. coli DH5α or DHB10 strain.

Separately, purified aliquots of the protein were sent to the biotechnology hybridoma center at the University of Wisconsin, Madison for production of monoclonal antibodies to the proteins. The material that was sent was the HPLC purified fraction containing native bands 1 and 2 which had been denatured at 65° C., and 20 μg of which was injected into each of four mice. Stable monoclonal antibody-producing hybridoma cell lines were recovered after spleen cells from unimmunized mouse were fused with a stable myeloma cell line. Monoclonal antibodies were recovered from the hybridomas.

Separately, polyclonal antibodies were created by taking native agarose gel purified band 1 (see Example 1) protein which was then used to immunize a New Zealand white rabbit. The protein was prepared by excising the band from the native agarose gels, briefly heating the gel pieces to 65° C. to melt the agarose, and immediately emulsifying with adjuvant. Freund's complete adjuvant was used for the primary immunizations and Freund's incomplete was used for 3 additional injections at monthly intervals. For each injection, approximately 0.2 ml of emulsified band 1, containing 50 to 100 micrograms of protein, was delivered by multiple subcontaneous injections into the back of the rabbit. Serum was obtained 10 days after the final injection and additional bleeds were performed at weekly intervals for 3 weeks. The serum complement was inactivated by heating to 56° C. for 15 minutes and then stored at −20° C.

The monoclonal and polyclonal antibodies were then used to screen the genomic library for the expression of antigens which could be detected by the epitope. Positive clones were detected on nitrocellulose filter colony lifts. An immunoblot analysis of the positive clones was undertaken.

An analysis of the clones as defined by both immunoblot and Southern analysis resulted in the tentative identification of four genomic regions.

In the first region was a gene encoding the peptide designated here as TcbA ii . Full DNA sequence of this gene (tcbA) was obtained. It is set forth as SEQ ID NO:11. Confirmation that the sequence encodes the internal sequence of SEQ ID NO:1 is demonstrated by the presence of SEQ ID NO:1 at amino acid number 88 from the deduced amino acid sequence created by the open reading frame of SEQ ID NO:11. This can be confirmed by referring to SEQ ID NO:12, which is the deduced amino acid sequence created by SEQ ID NO:11.

The second region of toxin peptides contains the segments referred to above as TcaB i , TcaB ii and TcaC. Following the screening of the library with the polyclonal antisera, this second region of toxin genes was identified by several clones which produced different size proteins, all of which cross-reacted with the polyclonal antibody on an immunoblot and were also found to share DNA homology on a Southern Blot. Sequence comparison revealed that they belonged to the gene complex designated TcaBand TcaC above.

Two other regions of antibody toxin clones were also isolated in the polyclonal screen. These regions produced proteins that cross-react with a polyclonal antibody and also shared DNA homology with the regions as determined by Southern blotting. Thus, it appears that the Photorhabdus luminescens extracellular protein genes represent a family of genes which are evolutionarily related.

To further pursue the concept that there might be evolutionarily related variations in the toxin peptides contained within this organism, two approaches have been undertaken to examine other strains of Photorhabdus luminescens for the presence of related proteins. This was done both by PCR amplification of genomic DNA and by immunoblot analysis using the polyclonal and monoclonal antibodies.

The results indicate that related proteins are produced by Photorhabdus. luminescens strains WX-2, WX-3, WX-4, WX-5, WX-6, WX-7, WX-8, WX-11, WX-12, WX-15 and W-14.

EXAMPLE 11

Part B

Sequence and Analysis of tcc Toxin Clones

Further DNA sequencing was performed on plasmids isolated from E. coli clones described in Example 11, Part A. The nucleotide sequence from the third region of E. coli clones was shown to be three closely linked open reading frames at this genomic locus. This locus was designated tcc with the three open reading frames designated tccA SEQ ID NO:56, tccB SEQ ID NO:58 and tccC SEQ ID NO:60. The close linkage between these open reading frames is revealed by examination of SEQ ID NO:56, in which 93 bp separate the stop codon of tccA from the start codon of tccb (bases 2992-2994 of SEQ ID NO:56), and by examination of SEQ ID NO:58, in which 131 bases separate the stop codon of tccB and the tccC (bases 4930-4932 of SEQ ID NO:58). The physical map is presented in FIG. 6 B.

The deduced amino acid sequence from the tccA open reading frame indicates that the gene encodes a protein of 10S,459 Da. This protein was designated TccA (SEQ ID NO:57). The first 12 amino acids of this protein match the N-terminal sequence obtained from a 108 kDa protein, SEQ ID NO:8, previously identified as part of the toxin complex.

The deduced amino acid sequence from the tccB open reading frame indicates that this gene encodes a protein of 175,716 Da. This protein was designated TccB (SEQ ID NO:59). The first 11 amino acids of this protein match the N-terminal sequence obtained from a protein with estimated molecular weight of 185 kDa, SEQ ID NO:7. Similarity analysis revealed that the TccB protein is related to the proteins identified as TcbA SEQ ID NO:12; 37% similarity and 28% identity, TcdA SEQ ID NO:47; 35% similarity and 28%identity, and TcaB SEQ ID NO:26; 32% similarity and 26% identity (using the GAP algorithm Wisconsin Package Version 9.0, Genetics Computer Group (GCG) Madison Wis.).

The deduced amino acid sequence of tccC indicated that this open reading frame encodes a protein of 111,694 Da and the protein product was designated TccC (SEQ ID NO:61).

EXAMPLE 12

Characterization of Photorhabdus Strains

In order to establish that the collection described herein was comprised of Photorhabdus strains, the strains herein were assessed in terms of recognized microbiological traits that are characteristic of Photorhabdus and which differentiate it from other Enterobacteriaceae and Xenorhabdus spp. (Farmer, J. J. 1984. Bergey's Manual of Systemic Bacteriology, Vol 1. pp. 510-511. (ed. Kreig N. R. and Holt, J. G.). Williams & Wilkins, Baltimore; Akhurst and Boemare, 1988, Boemare et al., 1993). These characteristic traits are as follows: Gram's stain negative rods, organism size of 0.5-2 μm in width and 2-10 μm in length, red/yellow colony pigmentation, presence of crystalline inclusion bodies, presence of catalase, inability to reduce nitrate, presence of bioluminescence, ability to take up dye from growth media, positive for protease production, growth-temperature range below 37° C., survival under anaerobic conditions and positively motile. (Table 20). Reference Escherichia coli , Xenorhabdus and Photorhabdus strains were included in all tests for comparison. The overall results are consistent with all strains being part of the family Enterobacteriaceae and the genus Photorhabdus.

A luminometer was used to establish the bioluminescence of each strain and provide a quantitative and relative measurement of light production. For measurement of relative light emitting units, the broths from each strain (cells and media) were measured at three time intervals after inoculation in liquid culture (6, 12, and 24 hr) and compared to background luminosity (uninoculated media and water). Prior to measuring light emission from the various broths, cell density was established by measuring light absorbance (560 nM) in a Gilford Systems (Oberlin, Ohio) spectrophotometer using a sipper cell. Appropriate dilutions were then made (to normalize optical density to 1.0 unit) before measuring luminosity. Aliquots of the diluted broths were then placed into cuvettes (300 μl each) and read in a Bio-Orbit 1251 Luminometer (Bio-Orbit Oy, Twiku, Finland). The integration period for each sample was 45 seconds. The samples were continuously mixed (spun in baffled cuvettes) while being read to provide oxygen availability. A positive test was determined as being ≧5-fold background luminescence (about 5-10 units). In addition, colony luminosity was detected with photographic film overlays and visually, after adaptation in a darkroom. The Gram's staining characteristics of each strain were established with a commercial Gram's stain kit (BBL, Cockeysville, Md.) used in conjunction with Gram's stain control slides (Fisher Scientific, Pittsburgh, Pa.). Microscopic evaluation was then performed using a Zeiss microscope (Carl Zeiss, Germany) 100×oil immersion objective lens (with 10×ocular and 2×body magnification). Microscopic examination of individual strains for organism size, cellular description and inclusion bodies (the latter after logarithmic growth) was performed using wet mount slides (10×ocular, 2×body and 40×objective magnification) with oil immersion and phase contrast microscopy with a micrometer (Akhurst, R. J. and Boemare, N. E. 1990. Entomopathogenic Nematodes in Biological Control (ed. Gaugler, R. and Kaya, H.). pp. 75-90. CRC Press, Boca Raton, USA.; Baghdiguian S., Boyer-Giglio M. H., Thaler, J. O., Bonnot G., Boemare N. 1993. Biol. Cell 79, 177-185.). Colony pigmentation was observed after inoculation on Bacto nutrient agar, (Difco Laboratories, Detroit, Mich.) prepared as per label instructions. Incubation occurred at 28° C. and descriptions were produced after 5-7 days. To test for the presence of the enzyme catalase, a colony of the test organism was removed on a small plug from a nutrient agar plate and placed into the bottom of a glass test tube. One ml of a household hydrogen peroxide solution was gently added down the side of the tube. A positive reaction was recorded when bubbles of gas (presumptive oxygen) appeared immediately or within 5 seconds. Controls of uninoculated nutrient agar and hydrogen peroxide solution were also examined. To test for nitrate reduction, each culture was inoculated into 10 ml of Bacto Nitrate Broth (Difco Laboratories, Detroit, Mich.). After 24 hours incubation at 28° C., nitrite production was tested by the addition of two drops of sulfanilic acid reagent and two drops of alpha-naphthylamine reagent (see Difco Manual, 10th edition, Difco Laboratories, Detroit, Mich., 1984). The generation of a distinct pink or red color indicates the formation of nitrite from nitrate. The ability of each strain to uptake dye from growth media was tested with Bacto MacConkey agar containing the dye neutral red; Bacto Tergitol-7 agar containing the dye bromothymol blue and Bacto EMB Agar containing the dye eosin-Y (agars from Difco Laboratories, Detroit, Mich., all prepared according to label instructions). After inoculation on these media, dye uptake was recorded after incubation at 28° C. for 5 days. Growth on these latter media is characteristic for members of the family Enterobacteriaceae. Motility of each strain was tested using a solution of Bacto Motility Test Medium (Difco Laboratories, Detroit, Mich.) prepared as per label instructions. A butt-stab inoculation was performed with each strain and motility was judged macroscopically by a diffuse zone of growth spreading from the line of inoculum. In many cases, motility was also observed microscopically from liquid culture under wet mount slides. Biochemical nutrient evaluation for each strain was performed using BBL Enterotube II (Benton, Dickinson, Germany). Product instructions were followed with the exception that incubation was carried out at 28° C. for 5 days. Results were consistent with previously cited reports for Photorhabdus. The production of protease was tested by observing hydrolysis of gelatin using Bacto gelatin (Difco Laboratories, Detroit, Mich.) plates made as per label instructions. Cultures were inoculated and the plates were incubated at 28° C. for 5 days. To assess growth at different temperatures, agar plates [2% proteose peptone #3 with two percent Bacto-Agar (Difco, Detroit, Mich.) in deionized water] were streaked from a common source of inoculum. Plates were sealed with Nesco® film and incubated at 20, 28 and 37° C. for up to three weeks. Plates showing no growth at 37° C. showed no cell viability after transfer to a 28° C. incubator for one week. Oxygen requirements for Photorhabdus strains were tested in the following manner. A butt-stab inoculation into fluid thioglycolate broth medium (Difco, Detroit, Mich.) was made. The tubes were incubated at room temperature for one week and cultures were then examined for type and extent of growth. The indicator resazurin demonstrates the level of medium oxidation or the aerobiosis zone (Difco Manual, 10th edition, Difco Laboratories, Detroit, Mich.). Growth zone results obtained for the Photorhabdus strains tested were consistent with those of a facultative anaerobic microorganism.

TABLE 19

Taxonomic Traits of Photorhabdus Strains

Traits Assessed*

Strain

A

B

C

D

E

F

G

H

I

J

K

L

M

N

O

P

Q

W-14

− †

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

WX-1

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

WX-2

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

WX-3

−

+

+

rd S

+

−

+

+

+

YT

+

+

+

+

+

+

−

WX-4

−

+

+

rd S

+

−

+

+

+

YT

+

+

+

+

+

+

−

WX-5

−

+

+

rd S

+

−

+

+

+

LO

+

+

+

+

+

+

−

WX-6

−

+

+

rd S

+

−

+

+

+

LY

+

+

+

+

+

+

−

WX-7

−

+

+

rd S

+

−

+

+

+

R

+

+

+

+

+

+

−

WX-8

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

WX-9

−

+

+

rd S

+

−

+

+

+

YT

+

+

+

+

+

+

−

WX-10

−

+

+

rd S

+

−

+

+

+

Ro

+

+

+

+

+

+

−

WX-11

−

+

+

rd S

+

−

+

+

+

Ro

+

+

+

+

+

+

−

WX-12

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

WX-14

−

+

+

rd S

+

−

+

+

+

LR

+

+

+

+

+

+

−

WX-15

−

+

+

rd S

+

−

+

+

+

LR

+

+

+

+

+

+

−

H9

−

+

+

rd S

+

−

+

+

+

LY

+

+

+

+

+

+

−

Hb

−

+

+

rd S

+

−

+

+

+

YT

+

+

+

+

+

+

−

Hm

−

+

+

rd S

+

−

+

+

+

TY

+

+

+

+

+

+

−

HP88

−

+

+

rd S

+

−

+

+

+

LY

+

+

+

+

+

+

−

NC-1

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

W30

−

+

+

rd S

+

−

+

+

+

YT

+

+

+

+

+

+

−

WIR

−

+

+

rd S

+

−

+

+

+

RO

+

+

+

+

+

+

−

B2

−

+

+

rd S

+

−

+

+

+

R

+

+

+

+

+

+

−

43948

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

43949

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

43950

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

43951

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

43952

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

*- A = Gram's stain, B = Crystaline inclusion bodies, C = Bioluminescence, D = Cell form, E = Motility, F = Nitrate reduction, G = Presence of catalase, H = Gelatin hydrolysis, I = Dye uptake, J = Pigmentation, K = Growth on EMB agar, L = Growth on MacConkey agar, M = Growth on Tergitol-7 agar, N = Facultative anaerobe, O = Growth at 20° C., P = Growth at 28° C.,

# Q = Growth at 37° C., †: + = positive for trait, − = negative for trait, rd = rod, S = sized within Genus descriptors, RO = red-orange, LR = light red, R = red, O = orange, Y = yellow, T = tan, LY = light yellow, YT = yellow tan, and LO = light orange.

Cellular fatty acid analysis is a recognized tool for bacterial characterization at the genus and species level (Tornabene, T. G. 1985. Lipid Analysis and the Relationship to Chemotaxonomy in Methods in Microbiology , Vol. 18, 209-234.; Goodfellow, M. and O'Donnell, A. G. 1993. Roots of Bacterial Systematics in Handbook of New Bacterial Systematics (ed. Goodfellow, M. & O'Donnell, A. G.) pp. 3-54. London: Academic Press Ltd.), these references are incorporated herein by reference, and were used to confirm that our collection was related at the genus level. Cultures were shipped to an external, contract laboratory for fatty acid methyl ester analysis (FAME) using a Microbial ID (MIDI, Newark, Del., USA) Microbial Identification System (MIS). The MIS system consists of a Hewlett Packard HP5890A gas chromatograph with a 25 mm×0.2 mm 5% methylphenyl silicone fused silica capillary column. Hydrogen is used as the carrier gas and a flame-ionization detector functions in conjunction with an automatic sampler, integrator and computer. The computer compares the sample fatty acid methyl esters to a microbial fatty acid library and against a calibration mix of known fatty acids. As selected by the contract laboratory, strains were grown for 24 hours at 28° C. on trypticase soy agar prior to analysis. Extraction of samples was performed by the contract lab as per standard FAME methodology. There was no direct identification of the strains to any luminescent bacterial group other than Photorhabdus. When the cluster analysis was performed, which compares the fatty acid profiles of a group of isolates, the strain fatty acid profiles were related at the genus level.

The evolutionary diversity of the Photorhabdus strains in our collection was measured by analysis of PCR (Polymerase Chain Reaction) mediated genomic fingerprinting using genomic DNA from each strain. This technique is based on families of repetitive DNA sequences present throughout the genome of diverse bacterial species (reviewed by Versalovic, J., Schneider, M., Del. Bruijn, F. J. and Lupski, J. R. 1994. Methods Mol. Cell. Biol., 5, 25-40.). Three of these, repetitive extragenic palindromic sequence (REP), enterobacterial repetitive intergenic consensus (ERIC) and the BOX element are thought to play an important role in the organization of the bacterial genome. Genomic organization is believed to be shaped by selection and the differential dispersion of these elements within the genome of closely related bacterial strains can be used to discriminate these strains (e.g., Louws, F. J., Fulbright, D. W., Stephens, C. T. and D E Bruijn, F. J. 1994. Appl. Environ. Micro. 60, 2286-2295). Rep-PCR utilizes oligonucleotide primers complementary to these repetitive sequences to amplify the variably sized DNA fragments lying between them. The resulting products are separated by electrophoresis to establish the DNA “fingerprint” for each strain.

To isolate genomic DNA from our strains, cell pellets were resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a final volume of 10 ml and 12 ml of 5 M NaCl was then added. This mixture was centrifuged 20 min. at 15,000×g. The resulting pellet was resuspended in 5.7 ml of TE and 300 μl of 10% SDS and 60 μl 20 mg/ml proteinase K (Gibco BRL Products, Grand Island, N.Y.) were added. This mixture was incubated at 37° C. for 1 hr, approximately 10 mg of lysozyme was then added and the mixture was incubated for an additional 45 min. One milliliter of 5M NaCl and 800 μl of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) were then added and the mixture was incubated 10 min. at 65° C., gently agitated, then incubated and agitated for an additional 20 min. to aid in clearing of the cellular material. An equal volume of chloroform/isoamyl alcohol solution (24:1, v/v) was added, mixed gently then centrifuged. Two extractions were then performed with an equal volume of phenol/chloroform/isoamyl alcohol (50:49:1). Genomic DNA was precipitated with 0.6 volume of isopropanol. Precipitated DNA was removed with a glass rod, washed twice with 70% ethanol, dried and dissolved in 2 ml of STE (10 mM Tris-HCl pH8.0, 10 mM NaCl, 1 mM EDTA). The DNA was then quantitated by optical density at 260 nm. To perform rep-PCR analysis of Photorhabdus genomic DNA the following primers were used, REP1R-I; 5′-IIIICGICGICATCIGGC-3′ and REP2-I; 5′-ICGICTTATCIGGCCTAC-3′. PCR was performed using the following 25 μl reaction: 7.75 μl H 2 O, 2.5 μl 10×LA buffer (PanVera Corp., Madison, Wis.), 16 μl dNTP mix (2.5 mM each), 1 μl of each primer at 50 pM/μl, 1 μl DMSO, 1.5 μl genomic DNA (concentrations ranged from 0.075-0.480 μg/μl) and 0.25 μl TaKaRa EX Taq (PanVera Corp., Madison, Wis.). The PCR amplification was performed in a Perkin Elmer DNA Thermal Cycler (Norwalk, Conn.) using the following conditions: 95° C./7 min. then 35 cycles of; 94° C./1 min.,44° C./1 min., 65° C./8 min., followed by 15 min. at 65° C. After cycling, the 25 μl reaction was added to 5 μl of 6×gel loading buffer (0.25% bromophenol blue, 40% w/v sucrose in H 2 O). A 15×20 cm 1%-agarose gel was then run in TBE buffer (0.09 M Tris-borate, 0.002 M EDTA) using 8 μl of each reaction. The gel was run for approximately 16 hours at 45 v. Gels were then stained in 20 μg/ml ethidium bromide for 1 hour and destained in TBE buffer for approximately 3 hours. Polaroid® photographs of the gels were then taken under UV illumination.

The presence or absence of bands at specific sizes for each strain was scored from the photographs and entered as a similarity matrix in the numerical taxonomy software program, NTSYS-pc (Exeter Software, Setauket, N.Y.). Controls of E. coli strain HB101 and Xanthomonas oryzae pv. oryzae assayed at the same time produced PCR “fingerprints” corresponding to published reports (Versalovic, J., Koeuth, T. and Lupski, J. R. 1991. Nucleic Acids Res. 19, 6823-6831; Vera Cruz, C. M., Halda-Alija, L., Louws, F., Skinner, D. Z., George, M. L., Nelson, R. J., Del. Bruijn, F. J., Rice, C. and Leach, J. E. 1995. Int. Rice Res. Notes, 20, 23-24.; Vera Cruz, C. M., Ardales, E. Y., Skinner, D. Z., Talag, J., Nelson, R. J., Louws, F. J., Leung, H., Mew, T. W. and Leach, J. E. 1996. Phytopathology (in press, respectively). The data from Photorhabdus strains were then analyzed with a series of programs within NTSYS-pc; SIMQUAL (Similarity for Qualitative data) to generate a matrix of similarity coefficients (using the Jaccard coefficient) and SAHN (Sequential, Agglomerative, Heirarchical and Nested) clustering [using the UPGMA (Unweighted Pair-Group Method with Arithmetic Averages) method] which groups related strains and can be expressed as a phenogram (FIG. 5 ). The COPH (cophenetic values) and MXCOMP (matrix comparison) programs were used to generate a cophenetic value matrix and compare the correlation between this and the original matrix upon which the clustering was based. A resulting normalized Mantel statistic (r) was generated which is a measure of the goodness of fit for a cluster analysis (r=0.8-0.9 represents a very good fit). In our case r=0.919. Therefore, our collection is comprised of a diverse group of easily distinguishable strains representative of the Photorhabdus genus.

EXAMPLE 13

Insecticidal Utility of Toxin(s) Produced by Various Photorhabdus Strains

Initial “seed” cultures of the various Photorhabdus strains were produced by inoculating 175 ml of 2% Proteose Peptone #3 (PP3) (Difco Laboratories, Detroit, Mich.) liquid media with a primary variant subclone in a 500 ml tribaffled flask with a Delong neck, covered with a Kaput. Inoculum for each seed culture was derived from oil-overlay agar slant cultures or plate cultures. After inoculation, these flasks were incubated for 16 hrs at 28° C. on a rotary shaker at 150 rpm. These seed cultures were then used as uniform inoculum sources for a given fermentation of each strain. Additionally, overlaying the post-log seed culture with sterile mineral oil, adding a sterile magnetic stir bar for future resuspension and storing the culture in the dark, at room temperature provided long-term preservation of inoculum in a toxin-competent state. The production broths were inoculated by adding 1% of the actively growing seed culture to fresh 2% PP3 media (e.g., 1.75 ml per 175 ml fresh media). Production of broths occurred in either 500 ml tribaffled flasks (see above), or 2800 ml baffled, convex bottom flasks (500 ml volume) covered by a silicon foam closure. Production flasks were incubated for 24-48 hrs under the above mentioned conditions. Following incubation, the broths were dispensed into sterile 1 L polyethylene bottles, spun at 2600×g for 1 hr at 10° C. and decanted from the cell and debris pellet. The liquid broth was then vacuum filtered through Whatman GF/D (2.7 μM retention) and GF/B (1.0 μM retention) glass filters to remove debris. Further broth clarification was achieved with a tangential flow microfiltration device (Pall Filtron, Northborough, Mass.) using a 0.5 M open-channel filter. When necessary, additional clarification could be obtained by chilling the broth (to 4° C.) and centrifuging for several hours at 2600×g. Following these procedures, the broth was filter sterilized using a 0.2 μM nitrocellulose membrane filter. Sterile broths were then used directly for biological assay, biochemical analysis or concentrated (up to 15-fold) using a 10,000 MW cut-off, M12 ultra-filtration device (Amicon, Beverly Mass.) or centrifugal concentrators (Millipore, Bedford, Mass. and Pall Filtron, Northborough, Mass.) with a 10,000 MW pore size. In the case of centrifugal concentrators, the broth was spun at 2000×g for approximately 2 hr. The 10,000 MW permeate was added to the corresponding retentate to achieve the desired concentration of components greater than 10,000 MW. Heat inactivation of processed broth samples was acheived by heating the samples at 100° C. in a sand-filled heat block for 10 minutes.

The broth(s) and toxin complex(es) from different Photorhabdus strains are useful for reducing populations of insects and were used in a method of inhibiting an insect population which comprises applying to a locus of the insect an effective insect inactivating amount of the active described. A demonstration of the breadth of insecticidal activity observed from broths of a selected group of Photorhabdus strains fermented as described above is shown in Table 20. It is possible that additional insecticidal activities could be detected with these strains through increased concentration of the broth or by employing different fermentation methods. Consistent with the activity being associated with a protein, the insecticidal activity of all strains tested was heat labile (see above).

Culture broth(s) from diverse Photorhabdus strains show differential insecticidal activity (mortality and/or growth inhibition, reduced adult emergence) against a number of insects. More specifically, the activity is seen against corn rootworm larvae and boll weevil larvae which are members of the insect order Coleoptera. Other members of the Coleoptera include wireworms, pollen beetles, flea beetles, seed beetles and Colorado potato beetle. Activity is also observed against aster leafhopper and corn plant hopper, which are members of the order Homoptera. Other members of the Homoptera include planthoppers, pear psylla, apple sucker, scale insects, whiteflies, spittle bugs as well as numerous host specific aphid species. The broths and purified toxin complex(es) are also active against tobacco budworm, tobacco hornworm and European corn borer which are members of the order Lepidoptera. Other typical members of this order are beet armyworm, cabbage looper, black cutworm, corn earworm, codling moth, clothes moth, Indian mealmoth, leaf rollers, cabbage worm, cotton bollworm, bagworm, Eastern tent caterpillar, sod webworm and fall armyworm. Activity is also seen against fruitfly and mosquito larvae which are members of the order Diptera. Other members of the order Diptera are, pea midge, carrot fly, cabbage root fly, turnip root fly, onion fly, crane fly and house fly and various mosquito species. Activity with broth(s) and toxin complex(es) is also seen against two-spotted spider mite which is a member of the order Acarina which includes strawberry spider mites, broad mites, citrus red mite, European red mite, pear rust mite and tomato russet mite.

Activity against corn rootworm larvae was tested as follows. Photorhabdus culture broth(s) (0-15 fold concentrated, filter sterilized), 2% Proteose Peptone #3, purified toxin complex(es), 10 mM sodium phosphate buffer , pH 7.0 were applied directly to the surface (about 1.5 cm 2 ) of artificial diet (Rose, R. I. and McCabe, J. M. (1973). J. Econ. Entomol. 66, (398-400) in 40 μl aliquots. Toxin complex was diluted in 10 mM sodium phosphate buffer, pH 7.0. The diet plates were allowed to air-dry in a sterile flow-hood and the wells were infested with single, neonate Diabrotica undecimpunctata howardi (Southern corn rootworm, SCR) hatched from surface sterilized eggs. The plates were sealed, placed in a humidified growth chamber and maintained at 27° C. for the appropriate period (3-5 days). Mortality and larval weight determinations were then scored. Generally, 16 insects per treatment were used in all studies. Control mortality was generally less than 5%.

Activity against boll weevil ( Anthomonas grandis ) was tested as follows. Concentrated (1-10 fold) Photorhabdus broths, control medium (2% Proteose Peptone #3), purified toxin complex(es) [0.23 mg/ml] or 10 mM sodium phosphate buffer, pH 7.0 were applied in 60 μl aliquots to the surface of 0.35 g of artificial diet (Stoneville Yellow lepidopteran diet) and allowed to dry. A single, 12-24 hr boll weevil larva was placed on the diet, and the wells were sealed and held at 25° C., 50% RH for 5 days. Mortality and larval weights were then assessed. Control mortality ranged between 0-13%.

Activity against mosquito larvae was tested as follows. The assay was conducted in a 96-well microtiter plate. Each well contained 200 μl of aqueous solution (10-fold concentrated Photorhabdus culture broth(s), control medium (2% Proteose Peptone #3), 10 mM sodium phosphate buffer, toxin complex(es) @ 0.23 mg/ml or H 2 O) and approximately 20, 1-day old larvae ( Aedes aegypti ). There were 6 wells per treatment. The results were read at 3-4 days after infestation. Control mortality was between 0-20%.

Activity against fruitflies was tested as follows. Purchased Drosophila melanogaster medium was prepared using 50% dry medium and a 50% liquid of either water, control medium (2% Proteose Peptone #3), 10-fold concentrated Photorhabdus culture broth(s), purified toxin complex(es) [0.23 mg/ml] or 10 mM sodium phosphate buffer , pH 7.0. This was accomplished by placing 4.0 ml of dry medium in each of 3 rearing vials per treatment and adding 4.0 ml of the appropriate liquid. Ten late instar Drosophila melanogaster maggots were then added to each 25 ml vial. The vials were held on a laboratory bench, at room temperature, under fluorescent ceiling lights. Pupal or adult counts were made after 15 days of exposure. Adult emergence as compared to water and control medium (0-16% reduction).

Activity against aster leafhopper adults ( Macrosteles severini ) and corn planthopper nymphs ( Peregrinus maidis ) was tested with an ingestion assay designed to allow ingestion of the active without other external contact. The reservoir for the active/“food” solution is made by making 2 holes in the center of the bottom portion of a 35×10 mm Petri dish. A 2 inch Parafilm M® square is placed across the top of the dish and secured with an “O” ring. A 1 oz. plastic cup is then infested with approximately 7 hoppers and the reservoir is placed on top of the cup, Parafilm down. The test solution is then added to the reservoir through the holes. In tests using 10-fold concentrated Photorhabdus culture broth(s), the broth and control medium (2% Proteose Peptone #3) were dialyzed against 10 mM sodium phosphate buffer, pH 7.0 and sucrose (to 5%) was added to the resulting solution to reduce control mortality. Purified toxin complex(es) [0.23 mg/ml] or 10 mM sodium phosphate buffer, pH 7.0 was also tested. Mortality is reported at day 3. The assay was held in an incubator at 28° C., 70% RH with a 16/8 photoperiod. The assays were graded for mortality at 72 hours. Control mortality was less than 6%.

Activity against lepidopteran larvae was tested as follows. Concentrated (10-fold) Photorhabdus culture broth(s), control medium (2% Proteose Peptone #3), purified toxin complex(es) [0.23 mg/ml] or 10 mM sodium phosphate buffer, pH 7.0 were applied directly to the surface (about 1.5 cm 2 ) of standard artificial lepidopteran diet (Stoneville Yellow diet) in 40 μl aliquots. The diet plates were allowed to air-dry in a sterile flow-hood and each well was infested with a single, neonate larva. European corn borer ( Ostrinia nubilalis ) and tobacco hornworm ( Manduca sexta ) eggs were obtained from commercial sources and hatched in-house, whereas tobacco budworm ( Heliothis virescens ) larvae were supplied internally. Following infestation with larvae, the diet plates were sealed, placed in a humidified growth chamber and maintained in the dark at 27° C. for the appropriate period. Mortality and weight determinations were scored at day 5. Generally, 16 insects per treatment were used in all studies. Control mortality generally ranged from about 4 to about 12.5% for control medium and was less than 10% for phosphate buffer.

Activity against two-spotted spider mite ( Tetranychus urticae ) was determined as follows. Young squash plants were trimmed to a single cotyledon and sprayed to run-off with 10-fold concentrated broth(s), control medium (2% Proteose Peptone #3), purified toxin complex(es), 10 mM sodium phosphate buffer, pH 7.0. After drying, the plants were infested with a mixed population of spider mites and held at lab temperature and humidity for 72 hr. Live mites were then counted to determine levels of control.

TABLE 20
Observed Insecticidal Spectrum of Broths from
Different Photorhabdus Strains
Photorhabdus Strain Sensitive* Insect Species
WX-1                3**, 4, 5, 6, 7, 8
WX-2                2, 4
WX-3                1, 4
WX-4                1, 4
WX-5                4
WX-6                4
WX-7                3, 4, 5, 6, 7, 8
WX-8                1, 2, 4
WX-9                1, 2, 4
WX-10               4
WX-11               1, 2, 4
WX-12               2, 4, 5, 6, 7, 8
WX-14               1, 2, 4
WX-15               1, 2, 4
W30                 3, 4, 5, 8
NC-1                1, 2, 3, 4, 5, 6, 7, 8, 9
WIR                 2, 3, 5, 6, 7, 8
HP88                1, 3, 4, 5, 7, 8
Hb                  3, 4, 5, 7, 8
Hm                  1, 2, 3, 4, 5, 7, 8
H9                  1, 2, 3, 4, 5, 6, 7, 8
W-14                1, 2, 3, 4, 5, 6, 7, 8, 10
ATCC 43948          4
ATCC 43949          4
ATCC 43950          4
ATCC 43951          4
ATCC 43952          4
*= ≧25% mortality and/or growth inhibition vs. control
**= 1; Tobacco budworm, 2; European corn borer, 3; Tobacco hornworm, 4; Southern corn rootworm, 5; Boll weevil, 6; Mosquito, 7; Fruit fly, 8; Aster Leafhopper, 9; Corn planthopper, 10; Two-spotted spider mite.

EXAMPLE 14

Non W-14 Photorhabdus Strains: Purification, Characterization and Activity Spectrum

Purification

The protocol, as follows, is similar to that developed for the purification of W-14 and was established based on purifying those fractions having the most activity against Southern corn root worm (SCR), as determined in bioassays (see Example 13). Typically, 4-20 L of broth that had been filtered, as described in Example 13, were received and concentrated using an Amicon spiral ultra filtration cartridge Type S1Y100 attached to an Amicon M-12 filtration device. The retentate contained native proteins consisting of molecular sizes greater than 100 kDa, whereas the flow through material contained native proteins less than 100 kDa in size. The majority of the activity against-SCR was contained in the 100 kDa retentate. The retentate was then continually diafiltered with 10 mM sodium phosphate (pH=7.0) until the filtrate reached an A 280 <0.100. Unless otherwise stated, all procedures from this point were performed in buffer as defined by 10 mM sodium phosphate (pH 7.0). The retentate was then concentrated to a final volume of approximately 0.20 L and filtered using a 0.45 mm Nalgene™ Filterware sterile filtration unit. The filtered material was loaded at 7.5 ml/min onto a Pharmacia HR16/10 column which had been packed with PerSeptive Biosystem Poros® 50 HQ strong anion exchange matrix equilibrated in buffer using a PerSeptive Biosystem Sprint® HPLC system. After loading, the column was washed with buffer until an A 280 <0.100 was achieved. Proteins were then eluted from the column at 2.5 ml/min using buffer with 0.4 M NaCl for 20 min for a total volume of 50 ml. The column was then washed using buffer with 1.0 M NaCl at the same flow rate for an additional 20 min (final volume=50 ml). Proteins eluted with 0.4 M and 1.0 M NaCl were placed in separate dialysis bags (Spectra/Por® Membrane MWCO: 2,000) and allowed to dialyze overnight at 4° C. in 12 L buffer. The majority of the activity against SCR was contained in the 0.4 M fraction. The 0.4 M fraction was further purified by application of 20 ml to a Pharmacia XK 26/100 column that had been prepacked with Sepharose CL4B (Pharmacia) using a flow rate of 0.75 ml/min. Fractions were pooled based on A 280 peak profile and concentrated to a final volume of 0.75 ml using a Millipore Ultrafree®-15 centrifugal filter device Biomax-50K NMWL membrane. Protein concentrations were determined using a Biorad Protein Assay Kit with bovine gamma globulin as a standard.

Characterization

The native molecular weight of the SCR toxin complex was determined using a Pharmacia HR 16/50 that had been prepacked with Sepharose CL4B in buffer. The column was then calibrated using proteins of known molecular size thereby allowing for calculation of the toxin approximate native molecular size. As shown in Table 21, the molecular size of the toxin complex ranged from 777 kDa with strain Hb to 1,900 kDa with strain WX-14. The yield of toxin complex also varied, from strain WX-12 producing 0.8 mg/L to strain Hb, which produced 7.0 mg/L.

Proteins found in the toxin complex were examined for individual polypeptide size using SDS-PAGE analysis. Typically, 20 mg protein of the toxin complex from each strain was loaded onto a 2-15% polyacrylamide gel (Integrated Separation Systems) and electrophoresed at 20 mA in Biorad SDS-PAGE buffer. After completion of electrophoresis, the gels were stained overnight in Biorad Coomassie blue R-250 (0.2% in methanol: acetic acid: water; 40:10:40 v/v/v). Subsequently, gels were destained in methanol:acetic acid: water; 40:10:40 (v/v/v). The gels were then rinsed with water for 15 min and scanned using a Molecular Dynamics Personal Laser Densitometer®. Lanes were quantitated and molecular sizes were calculated as compared to Biorad high molecular weight standards, which ranged from 200-45 kDa.

Sizes of the individual polypeptides comprising the SCR toxin complex from each strain are listed in Table 22. The sizes of the individual polypeptides ranged from 230 kDa with strain WX-1 to a size of 16 kDa, as seen with strain WX-7. Every strain, with the exception of strain Hb, had polypeptides comprising the toxin complex that were in the 160-230 kDa range, the 100-160 kDa range, and the 50-80 kDa range. These data indicate that the toxin complex may vary in peptide composition and components from strain to strain, however, in all cases the toxin attributes appears to consist of a large, oligomeric protein complex.

TABLE 21
Characterization of a Toxin Complex from
Non W-14 Photorhabdus Strains
			Yield
		Approx.	Active
		Native	Fraction
	Strain	Molecular Wt. a	(mg/L) b
	H9	972,000	1.8
	Hb	777,000	7.0
	Hm	1,400,000	1.1
	HP88	813,000	2.5
	NCl	1,092,000	3.3
	WIR	979,000	1.0
	WX-1	973,000	0.8
	WX-2	951,000	2.2
	WX-7	1,000,000	1.5
	WX-12	898,000	0.4
	WX-14	1,900,000	1.9
	W-14	860,000	7.5
	a Native molecular weight determined using a Pharmacia HR 16/50 column packed with Sepharose CL4B
	b Amount of toxin complex recovered from culture broth.

Activity Spectrum

As shown in Table 23, the toxin complexes purified from strains Hm and H9 were tested for activity against a variety of insects, with the toxin complex from strain W-14 for comparison. The assays were performed as described in Example 13. The toxin complex from all three strains exhibited activity against tobacco bud worm, European corn borer, Southern corn root worm, and aster leafhopper. Furthermore, the toxin complex from strains Hm and W-14 also exhibited activity against two-spotted spider mite. In addition, the toxin complex from W-14 exhibited activity against mosquito larvae. These data indicate that the toxin complex, while having similarities in activities between certain orders of insects, can also exhibit differential activities against other orders of insects.

TABLE 22
The Approximate Sizes (in kDa) of Peptides in a Purified
Toxin Complex From Non W-14 Photorhabdus
H9	Hb	Hm	HP 88	NC-1	WIR	WX-1	WX-2	WX-7	WX-12	WX-14	W-14
180	150	170	170	180	170	230	200	200	180	210	190
170	140	140	160	170	160	190	170	180	160	180	180
160	139	100	140	140	120	170	150	110	140	160	170
140	130	81	130	110	110	160	120	87	139	120	160
120	120	72	129	44	89	110	110	75	130	110	150
98	100	68	110	16	79	98	82	43	110	100	130
87	98	49	100		74	76	64	33	92	95	120
84	88	46	86		62	58	37	28	87	80	110
79	81	30	81		51	53	30	26	80	69	93
72	75	22	77		40	41		23	73	49	90
68	69	20	73		39	35		22	59	41	77
60	60	19	60		37	31		21	56	33	69
57	57		58		33	28		19	51		65
52	54		45		30	24		18	37		63
46	49		39		28	22		16	33		60
40	44		35		27				32		51
37	39				25				26		46
	37				23						40
	35										39
											29

TABLE 23
Observed Insecticidal Spectrum of a Purified Toxin Complex from
Photorhabdus Strains
Photorhabdus Strain Sensitive* Insect Species
Hm Toxin Complex    1**, 2, 3, 5, 6, 7, 8
H9 Toxin Complex    1, 2, 3, 6, 7, 8
W-14 Toxin Complex  1, 2, 3, 4, 5, 6, 7, 8
*= >25% mortality or growth inhibition
*= >25% mortality or growth inhibition
**= 1, Tobacco bud worm; 2, European corn borer; 3, Southern corn root worm; 4, Mosquito; 5, Two-spotted spider mite; 6, Aster Leafhopper; 7, Fruit Fly; 8, Boll Weevil

EXAMPLE 15

Sub-Fractionation of Photorhabdus Protein Toxin Complex

The Photorhabdus protein toxin complex was isolated as described in Example 14. Next, about 10 mg toxin was applied to a MonoQ 5/5 column equilibrated with 20 mM Tris-HCl, pH 7.0 at a flow rate of 1 ml/min. The column was washed with 20 mM Tris-HCl, pH 7.0 until the optical density at 280 nm returned to baseline absorbance. The proteins bound to the column were eluted with a linear gradient of 0 to 1.0 M NaCl in 20 mM Tris-HCl, pH 7.0 at 1 ml/min for 30 min. One ml fractions were collected and subjected to Southern corn rootworm (SCR) bioassay (see Example 13). Peaks of activity were determined by a series of dilutions of each fraction in SCR bioassays. Two activity peaks against SCR were observed and were named A (eluted at about 0.2-0.3 M NaCl) and B (eluted at 0.3-0.4 M NaCl). Activity peaks A and B were pooled separately and both peaks were further purified using a 3-step procedure described below.

Solid (NH 4 )2SO 4 was added to the above protein fraction to a final concentration of 1.7 M. Proteins were then applied to a phenyl-Superose 5/5 column equilibrated with 1.7 M (NH 4 ) 2 SO 4 in 50 mM potassium phosphate buffer, pH 7 at 1 ml/min. Proteins bound to the column were eluted with a linear gradient of 1.7 M (NH 4 )2SO 4 , 0% ethylene glycol, 50 mM potassium phosphate, pH 7.0 to 25% ethylene glycol, 25 mM potassium phosphate, pH 7.0 (no (NH 4 ) 2 SO 4 ) at 0.5 ml/min. Fractions were dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0. Activities in each fraction against SCR were determined by bioassay.

The fractions with the highest activity were pooled and applied to a MonoQ 5/5 column which was equilibrated with 20 mM Tris-HCl, pH 7.0 at 1 ml/min. The proteins bound to the column were eluted at 1 ml/min by a linear gradient of 0 to 1M NaCl in 20 mM Tris-HCl, pH 7.0.

For the final step of purification, the most active fractions above (determined by SCR bioassay) were pooled and subjected to a second phenyl-Superose 5/5/column. Solid (NH 4 ) 2 SO 4 was added to a final concentration of 1.7 M. The solution was then loaded onto the column equilibrated with 1.7 M (NH 4 ) 2 SO 4 in 50 mM potassium phosphate buffer, pH 7 at 1 ml/min. Proteins bound to the column were eluted with a linear gradient of 1.7 M (NH 4 ) 2 SO 4 , 50 mM potassium phosphate, pH 7.0 to 10 mM potassium phosphate, pH 7.0 at 0.5 ml/min. Fractions were dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0. Activities in each fraction against SCR were determined by bioassay.

The final purified protein by the above 3-step procedure from peak A was named toxin A and the final purified protein from peak B was named toxin B.

Characterization and Amino Acid Sequencing of Toxin A and Toxin B

In SDS-PAGE, both toxin A and toxin B contained two major (>90% of total Commassie stained protein) peptides: 192 kDa (named A1 and B1, respectively) and 58 kDa (named A2 and B2, respectively). Both toxin A and toxin B revealed only one major band in native PAGE, indicating A1 and A2 were subunits of one protein complex, and B1 and B2 were subunits of one protein complex. Further, the native molecular weight of both toxin A and toxin B were determined to be 860 kDa by gel filtration chromatography. The relative molar concentrations of A1 to A2 was judged to be a 1 to 1 equivalence as determined by densiometric analysis of SDS-PAGE gels. Similarly, B1 and B2 peptides were present at the same molar concentration.

Toxin A and toxin B were electrophoresed in 10% SDS-PAGE and transblotted to PVDF membranes. Blots were sent for amino acid analysis and N-terminal amino acid sequencing at Harvard MicroChem and Cambridge ProChem, respectively. The N-terminal amino sequence of B1 was determined to be identical to SEQ ID NO:1, the TcbA ii region of the tcbA gene (SEQ ID NO:12, position 87 to 99). A unique N-terminal sequence was obtained for peptide B2 (SEQ ID NO:40). The N-terminal amino acid sequence of peptide B2 was identical to the TcbA iii region of the derived amino acid sequence for the tcbA gene (SEQ ID NO:12, position 1935 to 1945). Therefore, the B toxin contained predominantly two peptides, TcbA ii and TcbA iii , that were observed to be derived from the same gene product, TcbA.

The N-terminal sequence of A2 (SEQ ID NO:41) was unique in comparison to the TcbA iii peptide and other peptides. The A2 peptide was denoted TcdA iii (see Example 17). SEQ ID NO:6 was determined to be a mixture of amino acid sequences SEQ ID NO:40 and 41.

Peptides A1 and A2 were further subjected to internal amino acid sequencing. For internal amino acid sequencing, 10 μg of toxin A was electrophoresized in 10% SDS-PAGE and transblotted to PVDF membrane. After the blot was stained with amido black, peptides A1 and A2, denoted TcdA ii and TcdA iii , respectively, were excised from the blot and sent to Harvard MicroChem and Cambridge ProChem. Peptides were subjected to trypsin digestion followed by HPLC chromatography to separate individual peptides. N-terminal amino acid analysis was performed on selected tryptic peptide fragments. Two internal amino acid sequences of peptide A1 (TcdA ii -PK71, SEQ ID NO:38 and TcdA ii -PK44, SEQ ID NO:39) were found to have significant homologies with deduced amino acid sequences of the TcbA ii region of the tcbA gene (SEQ ID NO:12). Similarly, the N-terminal sequence (SEQ ID NO:41) and two internal sequences of peptides A2 (TcdA iii -PK57, SEQ ID NO:42 and TcdA iii -PK20, SEQ ID NO.43) also showed significant homology with deduced amino acid sequences of TcbA iii region of the tcbA gene (SEQ ID NO:12).

In summary of above results, the toxin complex has at least two active protein toxin complexes against SCR; toxin A and toxin B. Toxin A and toxin B are similar in their native and subunits molecular weight, however, their peptide compositions are different. Toxin A contained peptides TcdA ii and TcdA iii as the major peptides and the toxin B contains TcbA ii and TcbA iii as the major peptides.

Purification and Characterization of Toxin C, Tca Peptides

The Photorhabdus protein toxin complex was isolated as described above. Next, about 50 mg toxin was applied to a MonoQ 10/10 column equilibrated with 20 mM Tris-HCl, pH 7.0 at a flow rate of 2 ml/min. The column was washed with 20 mM Tris-HCl, pH7.0 until the optical density at 280 nm returned to baseline level. The proteins bound to the column were eluted with a linear gradient of 0 to 1M NaCl in 20 mM Tris-HCl, pH 7.0 at 2 ml/min for 60 min. 2 ml fractions were collected and subjected to Western analysis using pAb TcaB ii -syn antibody (see Example 21) as the primary antibody. Fractions reacted with pAb TcaB ii -syn antibody were combined and solid (NH 4 ) 2 SO 4 was added to a final concentration of 1.7 M. Proteins were then applied to a phenyl-Superose 10/10 column equilibrated with 1.7 M (NH 4 ) 2 SO 4 in 50 mM potassium phosphate buffer, pH 7 at 1 ml/min. Proteins bound to the column were eluted with a linear gradient of 1.7 M (NH 4 ) 2 SO 4 , 50 mM potassium phosphate, pH 7.0 to 10 mM potassium phosphate, pH 7.0 at 1 ml/min for 120 min. 2 ml Fractions were collected, dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0, and analyzed by Western blots using pAb TcaB ii -syn antibody as the primary antibody.

Fractions cross-reacted with the antibody were pooled and applied to a MonoQ 5/5 column which was equilibrated with 20 mM Tris-HCl, pH 7.0 at 1 ml/min. The proteins bound to the column were eluted at 1 ml/min by a linear gradient of 0 to 1M NaCl in 20 mM Tris-HCl, pH 7.0 for 30 min.

Fractions above reacted with pAb TcaB ii -syn antibody were pooled and subjected to a phenyl-Superose 5/5/column. Solid (NH 4 ) 2 SO 4 added to a final concentration of 1.7 M. The solution was then applied onto the column equilibrated with 1.7 M (NH 4 ) 2 SO 4 in 50 mM potassium phosphate buffer, pH 7 at 1 ml/min. Proteins bound to the column were then eluted with a linear gradient of 1.7 M (NH 4 ) 2 SO 4 , 50 mM potassium phosphate, pH 7.0 to 10 mM potassium phosphate, pH 7.0 at 0.5 ml/min for 60 min. Fractions were dialyzed overnight against 10 mM sodium phosphate buffer, pH 7.0.

For the final purification step, fractions reacted with pAb TcaB ii -syn antibody above determined by Western analysis were combined and applied to a Mono Q 5/5 column equilibrated with 20 mM Tris-HCl, pH 7.0 at 1 ml/min. The proteins bound to the column were eluted at 1 ml/min by a linear gradient of 0 to 1M NaCl in 20 mM Tris-HCl, pH 7.0 for 30 min.

The final purified protein fraction contained 6 major peptides examined by SDS-PAGE: 165 kDa, 90 kDa, 64 kDa, 62 kDa, 58 kDa, and 22 kDa. The LD50 of the insecticidal activities of this purified fraction were determined to be 100 ng and 500 ng against SCR and ECB, respectively.

The above peptides were blotted to PVDF membranes and blots were sent for amino acids analysis and 5 amino acid long N-terminal sequencing at Harvard MicroChem and Cambridge ProChem, respectively. The N-terminal amino acid sequence of the 165 kDa peptide was determined to be identical to peptide TcaC (SEQ ID 2, position 1 to 5). The N-terminal amino acid sequence of the 90 kDa peptide was determined to be TcaA ii region of the derived amino acid sequence for the tcaA gene (SEQ ID NO 33, position 254 to 258). The N-terminal amino acid sequence of 64 kDa peptide was determined to be identical to peptide TcaB i (SEQ ID 3, position 1 to 5). The N-terminal amino acid sequence of the 62 kDa peptide was determined to be TcaA ii region of the derived amino acid sequence for the tcaA gene (SEQ ID NO 33, position 489 to 493). The N-terminal amino acid sequence of 58 kDa peptide was determined to be identical to peptide TcaB ii (SEQ ID 5, position 1 to 5). The N-terminal amino acid sequence of the 22 kDa peptide (SEQ ID NO 62) was determined to be TcaA i region, denoted TcaA iv , of the derived amino acid sequence for the tcaA gene (SEQ ID NO 34, position 98 to 102). It is noted that all tcaA, tcaB, and tcaC genes reside in the same tca operon (FIG. 6 A).

Five μg of purified Tca fraction, purified toxin A, and purified toxin B were analyzed by western blot using the following antibodies individually as primary antibody: pAb TcaBii-syn antibody, mAb CF52 antibody, pAb TcdAii-syn antibody, and pAb Tcd iii -syn antibody (Example 21). With pAb TcaB ii -syn antibody only the purified Tca peptides fraction reacted, but not toxin A or toxin B. With mAb CF52 antibody, only toxin B reacted but not Tca peptides fraction or toxin A. With either pAb TcdAii-syn antibody or pAb Tcdiii-syn antibody only toxin A reacted, but not Tca peptides fraction or toxin B. This indicated that the insecticidal activity observed in the purified Tca peptides fraction is independent of toxin A and toxin B. The purified Tca peptide fraction is a third unique protein toxin, denoted toxin C.

EXAMPLE 16

Cleavage and Activation of TcbA Peptide

In the toxin B complex, peptide TcbA ii and TcbA iii originate from the single gene product TcbA (Example 15). The processing of TcbA peptide to TcbA ii and TcbA iii is presumably by the action of Photorhabdus protease(s), and most likely, the metalloproteases described in Example 10. In some cases, it was noted that when Photorhabdus W-14 broth was processed, TcbA peptide was present in toxin B complex as a major component, in addition to peptides TcbA ii and TcbA iii . Identical procedures, described for the purification of toxin B complex (Example 15), were used to enrich peptide TcbA from toxin complex fraction of W-14 broth. The final purified material was analyzed in a 4-20% gradient SDS-PAGE and major peptides were quantified by densitometry. It was determined that TcbA, TcbA ii and TcbA iii comprised 58%, 36%, and 6%, respectively, of total protein. The identities of these peptides were confirmed by their respective molecular sizes in SDS-PAGE and Western blot analysis using monospecific antibodies. The native molecular weight of this fraction was determined to be 860 kDa.

The cleavage of TcbA was evaluated by treating the above purified material with purified 38 kDa and 58 kDa W-14 Photorhabdus metalloproteases (Example 10), and trypsin as a control enzyme (Sigma, MO.). The standard reaction consisted 17.5 μg the above purified fraction, 1.5 unit protease, and 0.1 M Tris buffer, pH 8.0 in a total volume of 100 μl. For the control reaction, protease was omitted. The reaction mixtures were incubated at 37° C. for 90 min. At the end of the reaction, 20 μl was taken and boiled with SDS-PAGE sample buffer immediately for electrophoresis analysis in a 4-20% gradient SDS-PAGE. It was determined from SDS-PAGE that in both 38 kDa and 58 kDa protease treatments, the amount of peptides TcbA ii and TcbA iii increased about 3-fold while the amount of TcbA peptide decreased proportionally (Table 24). The relative reduction and augmentation of selected peptides was confirmed by Western blot analyses. Furthermore, gel filtration of the cleaved material revealed that the native molecular size of the complex remained the same. Upon trypsin treatment, peptides TcbA and TcbA ii were nonspecifically digested into small peptides. This indicated that 38 kDa and 58 kDa Photorhabdus proteases can specifically process peptide TcbA into peptides TcbA ii and TcbA iii . Protease treated and untreated control of the remaining 80 μl reaction mixture were serial diluted with 10 mM sodium phosphate buffer, pH 7.0 and analyzed by SCR bioassay. By comparing activity in several dilution, it was determined that the 38 kDa protease treatment increased SCR insecticidal activity approximately 3 to 4 fold. The growth inhibition of remaining insects in the protease treatment was also more severe than control (Table 24).

TABLE 24
Conversion and Activation of Peptide TcbA into Peptides TcbA ii and
TcbA iii by Protease Treatment
	Control	38 kDa protease treatment
TcbA (% of total protein)	58	18
TcbA ii (% of total protein)	36	64
TcbA iii (% of total protein)	6	18
LD50 (μg protein)	2.1	0.52
SCR Weight (mg/insect) *	0.2	0.1
* an indication of growth inhibition by measuring the average weight of live insect after 5 days on diet in the assay.

Activation and Procession of Toxin B by SCR Gut Proteases

In yet a second demonstration of proteolytic activation, it was examined whether W-14 toxins are processed by insects. Toxin B purified from Photorhabdus W-14 broth (see Example 15) was comprised of predominantly intact TcbA peptides as judged by SDS-PAGE and Western blot analysis using monoclonal antibody. The LD50 of this fraction against SCR was determined to be around 700 ng.

SCR larva were grown on coleopteran diet until they reached the fourth instar stage (about 100-125 mg total weight each insect). SCR gut content was collected as follows: the guts were removed using dissecting scissors and forceps. After removing the excess fatty material that coats the gut lining, about 40 guts were homogenized in a microcentrifuge tube containing 100 μl sterile water. The tube was then centrifuged at 14,000 rpm for 10 minutes and the pellet discarded. The supernatant was stored at a −70° C. freezer until use.

The processing of toxin B by insect gut was evaluated by treating the above purified toxin B with the SCR gut content collected. The reaction consisted 40 μg toxin B (1 mg/ml), 50 μl SCR gut content, and 0.1M Tris buffer, pH 8.0 in a total volume of 100 μl. For the control reaction, SCR gut content was omitted. The reaction mixtures were incubated at 37° C. for overnight. At the end of reaction, 10 μl was withdraw and boiled with equal volume 2×SDS-PAGE sample buffer for SDS-PAGE analysis. The remaining 90 μl reaction mixture was serial diluted with 10 mM sodium phosphate buffer, pH 7.0 and analyzed by SCR bioassay. SDS-PAGE analysis indicated in SCR gut content treatment, peptide TcbA was digested completely into smaller peptides. Analysis of the undenatured toxin fraction showed that the native size, about 860 kDa, remained the same even though larger peptides were fragmented. In SCR bioassays, it was found that the LDSO of SCR gut treated toxin B to be about 70 ng; representing a 10-fold increase. In a separate experiment, protease K treatment completely eliminated toxin activity.

EXAMPLE 17

Screening of the Library for a Gene Encoding the TcdA ii Peptide

The cloning and characterization of a gene encoding the TcdA ii peptide, described as SEQ ID NO:17 (internal peptide TcdA ii -PT111 N-terminal sequence) and SEQ ID NO:18 (internal peptide TcdA ii -PT79 N-terminal sequence) was completed. Two pools of degenerate oligonucleotides, designed to encode the amino acid sequences of SEQ ID NO:17 (Table 25) and SEQ ID NO:18 (Table 26), and the reverse complements of those sequences, were synthesized as described in Example 8. The DNA sequence of the oligonucleotides is given below:

TABLE 25
Degenerate Oligonucleotide for SEQ ID NO: 17
P2-PT111	1	2	3	4	5	6	7	8
Amino Acid	Ala	Phe	Asn	Ile	Asp	Asp	Val	Ser
Codons	5′ GCN	TT(T/C)	AA(T/C)	AT(T/C/A)	GA(T/C)	GA(T/C)	GTN 3′
P2.3.6.CB	5′ GC(A/C/G/T)	TT(T/C)	AAT	ATT	GAT	GAT	GT 3′
P2.3.5	5′ GC(A/C/G/T)	TT(T/C)	AA(T/C)	AT(T/C/A)	GA(T/C)	GA(T/C)	GT 3′
P2.3.5R	5′ AC	(G/A)TC	(G/A)TC	(T/G/A)AT	(G/A)TT	(G/A)AA	(A/C/G/T)GC 3′
P2.3.5RI	5′ ACI	TCI	TCI	ATI	TTI	AAI	GC 3′
P2.3R.CB	5′ CAG	(A/G)CT	(A/C)AC	ATC	ATC	AAT	ATT	AAA 3′

TABLE 26

Degenerate Oligonucleotide for SEQ ID NO: 18

P2-PT79

1

2

3

4

5

6

7

8

9

10

11

12

13

Amino Acid

Phe

Ile

Val

Tyr

Thr

Ser

Leu

Gly

Val

Asn

Pro

Asn

Asn

Codons*

5′ TTY

ATH

GTN

TAY

ACN

6

6

GGN

GTN

AAY

CCN

AAY

AAY 3′

P2.79.2

5′ TTY

ATY

GTK

TAT

ACY

TCI

YTR

GGY

GTK

AAT

CCR

AAT

AAT 3′

P2.79.3

5′ TTT

ATT

GTK

TAT

ACY

AGY

YTR

GGY

GTK

AAT

CCR

AAT

AAT 3′

P2.79.R.1

5′ ATT

ATT

YGG

ATT

MAC

RCC

YAR

RCT

RGT

ATA

MAC

AAT

AAA 3′

P2.79R.CB

5′ ATT

ATT

YGG

ATT

MAC

ACC

CAG

RCT

GGT

ATA

MAC

AAT

AAA 3′

*According to IUPAC-IUB codes for nucleotides, Y = C or T, H = A, C or T, N = A, C, G or T, K = G or T, R = A or G, and M = A or C

Polymerase Chain Reactions (PCR) were performed essentially as described in Example 8, using as forward primers P2.3.6.CB or P2.3.5, and as reverse primers P2.79.R.1 or P2.79R.CB, in all forward/reverse combinations, using Photorhabdus W-14 genomic DNA as template. In another set of reactions, primers P2.79.2 or P2.79.3 were used as forward primers, and P2.3.5R, P2.3.5RI, and P2.3R.CB were used as reverse primers in all forward/reverse combinations. Only in the reactions containing P2.3.6.CB as the forward primers combined with P2.79.R.1 or P2.79R.CB as the reverse primers was a non-artifactual amplified product seen, of estimated size (mobility on agarose gels) of 2500 base pairs. The order of the primers used to obtain this amplification product indicates that the peptide fragment TcdA ii -PT111 lies amino-proximal to the peptide fragment TcdA ii -PT79.

The 2500 bp PCR products were ligated to the plasmid vector pCR™II (Invitrogen, San Diego, Calif.) according to the supplier's instructions, and the DNA sequences across the ends of the insert fragments of two isolates (HS24 and HS27) were determined using the supplier's recommended primers and the sequencing methods described previously. The sequence of both isolates was the same. New primers were synthesized based on the determined sequence, and used to prime additional sequencing reactions to obtain a total of 2557 bases of the insert [SEQ ID NO:36]. Translation of the partial peptide encoded by SEQ ID No: 36 yields the 845 amino acid sequence disclosed as SEQ ID NO:37. Protein homology analysis of this portion of the TcdA ii peptide fragment reveals substantial amino acid homology ((68% similarity,and 53% identity using the Wisconsin Package Version 8.0, Genetics Computer Group (GCG), Madison, Wis.) to residues 542 to 1390 of protein TcbA [SEQ ID NO:12] or (60% similarity, and 54% identity using the Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis. to residues 567 to 1389)). It is therefore apparent that the gene represented in part by SEQ ID NO:36 produces a protein of similar, but not identical, amino acid sequence as the TcbA protein, and which likely has similar, but not identical biological activity as the TcbA protein.

In yet another instance, a gene encoding the peptides TcdA ii -PK44 and the TcdA iii 58 kDa N-terminal peptide, described as SEQ ID NO:39 (internal peptide TcdA ii -PK44 sequence), and SEQ ID NO:41 (TcdA iii 58 kDa N-terminal peptide sequence) was isolated. Two pools of degenerate oligonucleotides, designed to encode the amino acid sequences described as SEQ ID NO:39 (Table 28) and SEQ ID NO:41 (Table 27), and the reverse complements of those sequences, were synthesized as described in Example 8, and their DNA sequences.

TABLE 27

Degenerate Oligonucleotide for SEQ ID NO: 41

Codon #

1

2

3

4

5

6

7

8

9

10

11

12

13

14

Amino Acid

Leu

Arg

Ser

Ala

Asn

Thr

Leu

Thr

Asp

Leu

Phe

Leu

Pro

Gln

A2.1

5′ YTR

CGY

AGY

GCI

AAT

ACY

YTR

ACY

GAT

YTR

TTT

YTR

CCR

CA 3′

A2.2

GCI

AAT

ACI

YTR

ACI

GAY

YTR

TTY

YTR

CCI

CA 3′

A2.3.R

5′ TG

YGG

YAR

AAA

YAR

RTC

RGT

YAR

RGT

RIT

IGC

RCT

RCG 3′

A2.4.R

5′ TG

IGG

CAG

AAA

CAG

RTC

IGT

CAG

IGT

ATT

IGC 3′

TABLE 28
Degenerate Oligonucleotide for SEQ ID NO: 39
Amino Acid #	(8)	(9)	(10)	(11)	(12)	(13)	(14)	(15)	(16)
Codon #	1	2	3	4	5	6	7	8	9
Amino Acid	Gly	Pro	Val	Glu	Ile	Asn	Thr	Ala	Ile
A1.44.1	5′ GGY	CCR	GTK	GAA	ATT	AAT	ACC	GCI	AT 3′
A1.44.1R	5′ ATI	GCG	GTA	TTA	ATT	TCM	ACY	GGR	CC 3′
A1.44.2	5′ GGI	CCI	GTI	GAR	ATY	AAY	ACI	GCI	AT 3′
A1.44.2R	5′ ATI	GCI	GTR	TTR	ATY	TCI	ACI	GGI	CC 3′

Polymerase Chain Reactions (PCR) were performed essentially as described in Example 8, using as forward primers A1.44.1 or A1.44.2, and reverse primers A2.3R or A2.4R, in all forward/reverse combinations, using Photorhabdus W-14 genomic DNA as template. In another set of reactions, primers A2.1 or A2.2 were used as forward primers, and A1.44.1R, and A1.44.2R were used as reverse primers in all forward/reverse combinations. Only in the reactions containing A1.44.1 or A1.44.2 as the forward primers combined with A2.3R as the reverse primer was a non-artifactual amplified product seen, of estimated size (mobility on agarose gels) of 1400 base pairs. The order of the primers used to obtain this amplification product indicates that the peptide fragment TcdA ii -PK44 lies amino-proximal to the 58 kDa peptide fragment of TcdA iii .

The 1400 bp PCR products were ligated to the plasmid vector pCR™II according to the supplier's instructions. The DNA sequences across the ends of the insert fragments of four isolates were determined using primers similar in sequence to the supplier's recommended primers and using sequencing methods described previously. The nucleic acid sequence of all isolates differed as expected in the regions corresponding to the degenerate primer sequences, but the amino acid sequences deduced from these data were the same as the actual amino acid sequences for the peptides determined previously, (SEQ ID NOS:41 and 39).

Screening of the W-14 genomic cosmid library as described in Example 8 with a radiolabeled probe comprised of the DNA prepared above (SEQ ID NO:36) identified five hybridizing cosmid isolates, namely 17D9, 20B10, 21D2, 27B10, and 26D1. These cosmids were distinct from those previously identified with probes corresponding to the genes described as SEQ ID NO:11 or SEQ ID NO:25. Restriction enzyme analysis and DNA blot hybridizations identified three EcoR I fragments, of approximate sizes 3.7, 3.7, and 1.1 kbp, that span the region comprising the DNA of SEQ ID NO:36. Screening of the W-14 genomic cosmid library using as probe the radiolabeled 1.4 kbp DNA fragment prepared in this example identified the same five cosmids (17D9, 20B10, 21D2, 27B10, and 26D1). DNA blot hybridization to EcoR I-digested cosmid DNAs also showed hybridization to the same subset of EcoR I fragments as seen with the 2.5 kbp TcdA ii gene probe, indicating that both fragments are encoded on the genomic DNA.

DNA sequence determination of the cloned EcoR I fragments revealed an uninterrupted reading frame of 7551 base pairs (SEQ ID NO:46), encoding a 282.9 kDa protein of 2516 amino acids (SEQ ID NO:47). Analysis of the amino acid sequence of this protein revealed all expected internal fragments of peptides TcdA ii (SEQ ID NOS:17, 18, 37, 38 and 39) and the TcdA iii peptide N-terminus (SEQ ID NO:41) and all TcdA iii internal peptides (SEQ ID NOS:42 and 43). The peptides isolated and identified as TcdA ii and TcdA iii are each products of the open reading frame, denoted tcda, disclosed as SEQ ID NO:46. Further, SEQ ID NO:47 shows, starting at position 89, the sequence disclosed as SEQ ID NO:13, which is the N-terminal sequence of a peptide of size approximately 201 kDa, indicating that the initial protein produced from SEQ ID NO: 46 is processed in a manner similar to that previously disclosed for SEQ ID NO:12. In addition, the protein is further cleaved to generate a product of size 209.2 kDa, encoded by SEQ ID NO:48 and disclosed as SEQ ID NO:49 (TcdA ii peptide), and a product of size 63.6 kDa, encoded by SEQ ID NO:50 and disclosed as SEQ ID NO:51 (TcdA iii peptide). Thus, it is thought that the insecticidal activity identified as toxin A (Example 15) derived from the products of SEQ ID NO:46, as exemplified by the full-length protein of 282.9 kDa disclosed as SEQ ID NO:47, is processed to produce the peptides disclosed as SEQ ID NOS:49 and 51. It is thought that the insecticidal activity identified as toxin B (Example 15) derives from the products of SEQ ID NO:11, as exemplified by the 280.6 kDa protein disclosed as SEQ ID NO:12. This protein is proteolytically processed to yield the 207.6 kDa peptide disclosed as SEQ ID NO:53, which is encoded by SEQ ID NO:52, and the 62.9 kDa peptide having N-terminal sequence disclosed as SEQ ID NO:40, and further disclosed as SEQ ID NO:55, which is encoded by SEQ ID NO:54.

Amino acid sequence comparisons between the proteins disclosed as SEQ ID NO:12 and SEQ ID NO:47 reveal that they have 69% similarity and 54% identity using the Wisconsin Package Version 8.0, Genetics Computer Group (GCG), Madison, Wis. or 60% similarity and 54% identity using version 9.0 of the program. This high degree of evolutionary relationship is not uniform throughout the entire amino acid sequence of these peptides, but is higher towards the carboxy-terminal end of the proteins, since the peptides disclosed as SEQ ID NO:51 (derived from SEQ ID NO:47) and SEQ ID NO:55 (derived from SEQ ID NO:12) have 76% similarity and 64% identity using the Wisconsin Package Version 8.0, Genetics Computer Group (GCG), Madison, Wis. or 71% similarity and 64% identity using version 9.0 of the program.

EXAMPLE 18

Control of European Cornborer-Induced Leaf Damage on Maize Plants by Spray Application of Photorhabdus (Strain W-14) Broth

The ability of Photorhabdus toxin(s) to reduce plant damage caused by insect larvae was demonstrated by measuring leaf damage caused by European corn borer ( Ostrinia nubilalis ) infested onto maize plants treated with Photorhabdus broth. Fermentation broth from Photorhabdus strain W-14 was produced and concentrated approximately 10-fold using ultrafiltration (10,000 MW pore-size) as described in Example 13. The resulting concentrated broth was then filter sterilized using 0.2 micron nitrocellulose membrane filters. A similarly prepared sample of uninoculated 2% proteose peptone #3 was used for control purposes. Maize plants (an inbred line) were grown from seed to vegetative stage 7 or 8 in pots containing a soilless mixture in a greenhouse (27° C. day; 22° C. night, about 50%RH, 14 hr day-length, watered/fertilized as needed). The test plants were arranged in a randomized complete block design (3 reps/treatment, 6 plants/treatment) in a greenhouse with temperature about 22° C. day; 18° C. night, no artificial light and with partial shading, about 50%RH and watered/fertilized as needed. Treatments (uninoculated media and concentrated Photorhabdus broth) were applied with a syringe sprayer, 2.0 mls applied from directly (about 6 inches) over the whorl and 2.0 additional mls applied in a circular motion from approximately one foot above the whorl. In addition, one group of plants received no treatment. After the treatments had dried (approximately 30 minutes), twelve neonate European corn borer larvae (eggs obtained from commercial sources and hatched in-house) were applied directly to the whorl. After one week, the plants were scored for damage to the leaves using a modified Guthrie Scale (Koziel, M. G., Beland, G. L., Bowman, C., Carozzi, N. B., Crenshaw, R., Crossland, L., Dawson, J., Desai, N., Hill, M., Kadwell, S., Launis, K., Lewis, K., Maddox, D., McPherson, K., Meghji, M. Z., Merlin, E., Rhodes, R., Warren, G. W., Wright, M. and Evola, S. V. 1993).

Bio/Technology, 11, 194-195.) and the scores were compared statistically [T-test (LSD) p<0.05 and Tukey's Studentized Range (HSD) Test p<0.1]. The results are shown in Table 29. For reference, a score of 1 represents no damage, a score of 2 represents fine “window pane” damage on the unfurled leaf with no pinhole penetration and a score of 5 represents leaf penetration with elongated lesions and/or mid rib feeding evident on more than three leaves (lesions <1 inch). These data indicate that broth or other protein containing fractions may confer protection against specific insect pests when delivered in a sprayable formulation or when the gene or derivative thereof, encoding the protein or part thereof, is delivered via a transgenic plant or microbe.

TABLE 29
Effect of Photorhabdus Culture Broth on
European Corn Borer-Induced Leaf Damage on Maize
Treatment           Average Guthrie Score
No Treatment        5.02                                                                        a
Uninoculated medium 5.15                                                                        a
Photorhabdus Broth  2.24                                                                        b
Means with different letters are statistically different (p < 0.05 or < 0.1).

EXAMPLE 19

Genetic Engineering of Genes for Expression in E. coli

Summary of Constructions

A series of plasmids were constructed to express the tcbA gene of Photorhabdus W-14 in Escherichia coli . A list of the plasmids is shown in Table 30. A brief description of each construction follows as well as a summary of the E. coli expression data obtained.

TABLE 30
Expression Plasmids for the tcbA Gene
	Plasmid	Gene	Vector/Selection	Compartment
	pDAB2025	tcbA	pBC/Chl	Intracellular
	pDAB2026	tcbA	pAcGP67B/Amp	Baculovirus,
				secreted
	pDAB2027	tcbA	pET27b/Kan	Periplasm
	pDAB2028	tcbA	pET15-tcbA	Intracellular
	Abbreviations:
	Kan = kanamycin, Chl = chloramphenicol, Amp = ampicillin

Construction of pDAB2025

In Example 9, a large EcoR I fragment which hybridizes to the TcbA ii probe is described. This fragment was subcloned into pBC (Stratagene, La Jolla Calif.) to create pDAB2025. Sequence analysis indicates that the fragment is 8816 base pairs. The fragment encodes the tcbA gene with the initiating ATG at position 571 and the terminating TAA at position 8086. The fragment therefore carries 570 base pairs of Photorhabdus DNA upstream of the ATG and 730 base pairs downstream of the TAA.

Construction of Plasmid pDAB2026

The tcbA gene was PCR amplified from plasmid pDAB202S using the following primers; 5′ primer (SlAc51) 5′ TTT AAA CCA TGG GAA ACT CAT TAT CAA GCA CTA TC 3′ and 3′ primer (SlAc31) 5′ TTT AAA GCG GCC GCT TAA CGG ATG GTA TAA CGA ATA TG 3′. PCR was performed using a TaKaRa LA PCR kit from PanVera (Madison, Wis.) in the following reaction: 57.5 microliters water, 10 microliters 10×LA buffer, 16 microliters dNTPs (2.5 mM each stock solution), 20 microliters each primer at 10 pmoles/microliters, 300 ng of the plasmid pDAB2025 containing the W-14 tcbA gene and one microliter of TaKaRa LA Taq polymerase. The cycling conditions were 98° C./20 sec, 68° C./5 min, 72° C./10 min for 30 cycles. A PCR product of the expected about 7526 bp was isolated in a 0.8% agarose gel in TBE (100 mM Tris, 90 mM boric acid, 1 mM EDTA) buffer and purified using a Qiaex II kit from Qiagen (Chatsworth, Calif.). The purified tcbA gene was digested with Nco I and Not I and ligated into the baculovirus transfer vector pAcGP67B (PharMingen (San Diego, Calif.)) and transformed into DH5 α E. coli. The resulting recombinant is called pDAB2026. The tcbA gene was then cut from pDAB2026 and transferred to pET27b to create plasmid pDAB2027. A missense mutation in the tcbA gene was repaired in pDAB2027.

The repaired tcbA gene contains two changes from the sequence shown in Sequence ID NO:11; an A>G at 212 changing an asparagine 71 to serine 71 and a G>A at 229 changing an alanine 77 to threonine 77. These changes are both upstream of the proposed TcbA ii N-terminus.

Construction of pDAB2028

The tcbA coding region of pDAB2027 was transferred to vector pET15b. This was accomplished using shotgun ligations, the DNAs were cut with restriction enzymes Nco I and Xho I. The resulting recombinant is called pDAB2028.

Expression of TcbA in E. coli from Plasmid pDAB2028

Expression of tcbA in E. coli was obtained by modification of the methods previously described by Studier et al. (Studier, F. W., Rosenberg, A., Dunn, J., and Dubendorff, J., (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol., 185: 60-89.). Competent E. coli cells strain BL21(DE3) were transformed with plasmid pDAB2028 and plated on LB agar containing 100 μg/mL ampicillin and 40 mM glucose. The transformed cells were plated to a density of several hundred isolated colonies/plate. Following overnight incubation at 37° C. the cells were scraped from the plates and suspended in LB broth containing 100 μg/mL ampicillin. Typical culture volumes were from 200-500 mL. At time zero, culture densities (OD600) were from 0.05-0.15 depending on the experiment. Cultures were shaken at one of three temperatures (22° C., 30° C. or 37° C.) until a density of 0.15-0.5 was obtained at which time they were induced with 1 mM isopropylthio-β-galactoside (IPTG). Cultures were incubated at the designated temperature for 4-5 hours and then were transferred to 4° C. until processing (12-72 hours).

Purification and Characterization of TcbA Expressed in E.coli from Plasmid pDAB2028

E. coli cultures expressing TcbA peptides were processed as follows. Cells were harvested by centrifugation at 17,000×G and the media was decanted and saved in a separate container.

The media was concentrated about 8× using the M12 (Amicon, Beverly Mass.) filtration system and a 100 kD molecular mass cut-off filter. The concentrated media was loaded onto an anion exchange column and the bound proteins were eluted with 1.0 M NaCl. The 1.0 M NaCl elution peak was found to cause mortality against Southern corn rootworm (SCR) larvae Table 30). The 1.0 M NaCl fraction was dialyzed against 10 mM sodium phosphate buffer pH 7.0, concentrated, and subjected to gel filtration on Sepharose CL-4B (Pharmacia, Piscataway, N.J.). The region of the CL-4B elution profile corresponding to calculated molecular weight (about 900 kDa) as the native W-14 toxin complex was collected, concentrated and bioassayed against larvae. The collected 900 kDa fraction was found to have insecticidal activity (see Table 31 below), with symptomology similar to that caused by native W-14 toxin complex. This fraction was subjected to Proteinase K and heat treatment, the activity in both cases was either eliminated or reduced, providing evidence that the activity is proteinaceous in nature. In addition, the active fraction tested immunologically positive for the TcbA and TcbA iii peptides in immunoblot analysis when tested with an anti-TcbA iii monoclonal antibody (Table 31).

TABLE 31
Results of Immunoblot and SCR Bioassays
	SCR Activity	Immunoblot	Native Size
	%	% Growth	Peptides	[CL-4B
Fraction	Mortality	Inhibit.	Detected	Estimated Size]
TcbA Media 1.0 M	+++	+++	TcbA
Ion Exchange
TcbA Media CL-4B	+++	+++	TcbA,	about
			TcbA iii	900 kDa
TcbA Media CL-4B +	++	+++	NT
Proteinase K
TcbA Media CL-4B +	−	−	NT
heat treatment
TcbA Cell Sup CL-4B	−	+++	NT	about
				900 kD
PK = Proteinase K treatment 2 hours; Heat treatment = 100° C. for 10 minutes; ND = None Detected; NT = Not Tested. Scoring system for mortality and growth inhibition as compared to control samples; 5-24% = “+”, 25-49% = “++”, 50-100% = “+++”.

The cell pellet was resuspended in 10 mM sodium phosphate buffer, pH=7.0, and lysed by passage through a Bio-Neb™ cell nebulizer (Glas-Col Inc., Terra Haute, Ind.). The pellets were treated with DNase to remove DNA and centrifuged at 17,000×g to separate the cell pellet from the cell supernatant. The supernatant fraction was decanted and filtered through a 0.2 micron filter to remove large particles and subjected to anion exchange chromatography. Bound proteins were eluted with 1.0 M NaCl, dialyzed and concentrated using Biomax™ (Millipore Corp, Bedford, Mass.) concentrators with a molecular mass cut-off of 50,000 Daltons. The concentrated fraction was subjected to gel filtration chromatography using Sepharose CL-4B beaded matrix. Bioassay data for material prepared in this way is shown in Table 30 and is denoted as “TcbA Cell Sup”.

In yet another method to handle large amounts of material, the cell pellets were re-suspended in 10 mM sodium phosphate buffer, pH=7.0 and thoroughly homogenized by using a Kontes Glass Company (Vineland, N.J.) 40 ml tissue grinder. The cellular debris was pelleted by centrifugation at 25,000×g and the cell supernatant was decanted, passed through a 0.2 micron filter and subjected to anion exchange chromatography using a Pharmacia 10/10 column packed with Poros HQ 50 beads. The bound proteins were eluted by performing a NaCl gradient of 0.0 to 1.0 M. Fractions containing the TcbA protein were combined and concentrated using a 50 kDa concentrator and subjected to gel filtration chromatography using Pharmacia CL-4B beaded matrix. The fractions containing TcbA oligomer, molecular mass of approximately 900 kDa, were collected and subjected to anion exchange chromatography using a Pharmacia Mono Q 10/10 column equilibrated with 20 mM Tris buffer pH=7.3. A gradient of 0.0 to 1.0 M NaCl was used to elute recombinant TcbA protein. Recombinant TcbA eluted from the column at a salt concentration of approximately 0.3-0.4 M NaCl, the same molarity at which native TcbA oligomer is eluted from the Mono Q 10/10 column. The recombinant TcbA fraction was found to cause SCR mortality in bioassay experiments similar to those in Table 31.

A second set of expression constructions were prepared and tested for expression of the TcbA protein toxin.

Construction of pDAB2030: An Expression Plasmid for the tcbA Coding Region

The plasmid pDAB2028 (see herein) contains the tcbA coding region in the commercial vector pET15 (Novagen, Madison, Wis.), encodes an ampicillin selection marker. The plasmid pDAB2030 was created to express the tcbA coding region from a plasmid which encodes a kanamycin selection marker. This was done by cutting pET27 (Novagen, Madison, Wis.) a kanamycin selection plasmid, and pDAB2028 with Xba I and Xho I. This releases the entire multiple cloning site, including the tcbA coding region from plasmid pDAB2028. The two cut plasmids, were mixed and ligated. Recombinant plasmids were selected on kanamycin and those containing the pDAB2028 fragment were identified by restriction analysis. The new recombinant plasmid is called pDAB2030.

Construction of Plasmid pDAB2031: Correction of Mutations in tcbA i

The two mutations in the N-terminus of the tcbA coding region as described in Example 19 (Sequence ID NO:11; A>G at 212 changing an asparagine 71 to serine 71; G>A at 229 changing an alanine 77 to threonine 77) were corrected as follows: A PCR product was generated using the primers TH50 (5′ ACC GTC TTC TTT ACG ATC AGT G 3′) and S1Ac51 (5′ TTT AAA CCA TGG GAA ACT CAT TAT CAA GCA CTA TC 3′) and pDAB2025 as template to generate a 1778 bp product. This PCR product was cloned into plasmid pCR2.1 (Invitrogen, San Diego, Calif.) and a clone was isolated and sequenced. The clone was digested with Nco I and Pin AI and a 1670 bp fragment was purified from a 1% agarose gel. A plasmid containing the mutated tcbA coding region (pDAB2030) was digested with Nco I and Not I and purified away from the 1670 bp fragment in a 0.8% agarose with Qiaex II (Qiagen, Chatsworth, Calif.). The corrected Nco I/Pin AI fragment was then ligated into pDAB2030. The ligated DNA was transformed into DH5 α E. coli. A clone was isolated, sequenced and found to be correct. This plasmid, containing the corrected tcbA coding region, is called pDAB2031.

Construction of pDAB2033 and pDAB2034: Expression Plasmids for tcbA

The expression plasmids pDAB2025 and pDAB2027-2031 all rely on the Bacteriophage T7 expression system. An additional vector system was used for bacterial expression of the tcbA gene and its derivatives. The expression vector Trc99a (Pharmacia Biotech, Piscataway, N.J.) contains a strong trc promoter upstream of a multiple cloning site with a 5′ Nco I site which is compatible with the tcbA coding region from pDAB2030 and 2031. However, the plasmid does not have a compatible 3′ site. Therefore, the Hind III site of Trc99a was cut and made blunt by treatment with T4 DNA polymerase (Boehringer Mannheim, Indianapolis, Ind.). The vector plasmid was then cut by Nco I followed by treatment with alkaline phosphatase. The plasmids pDAB2030 and pDAB2031 were each cut with Xho I (cuts at the 3′ end of the tcbA coding region) followed by treatment with T4 DNA polymerase to blunt the ends. The plasmids were then cut with Nco I, the DNAs were extracted with phenol, ethanol precipitated and resuspended in buffer. The Trc99a and pDAB2030 and pDAB2031 plasmids were mixed separately, ligated and transformed into DH5α cells and plated on LB media containing ampicillin and 50 mM glucose. Recombinant plasmids were identified by restriction digestion. The new plasmids are called pDAB2033 (contains the tcbA coding sequence with the two mutations in tcbA i ) and pDAB2034 (contains the corrected version of tcbA from pDAB2031).

Construction of Plasmid pDAB2032: An Expression Plasmid for tcbA ii A iii

A plasmid encoding the TcbA ii A iii portion of TcbA was created in a similar way as plasmid pDAB2031. A PCR product was generated using TH42 (5′ TAG GTC TCC ATG GCT TTT ATA CAA GGT TAT AGT GAT CTG 3′) and TH50 (5′ ACC GTC TTC TTT ACG ATC AGT G 3′) primers and plasmid pDAB2025 as template. This yielded a product of 1521 bp having an initiation codon at the beginning of the coding sequence of tcbA ii . This PCR product was isolated in a 1% agarose gel and purified. The purified product was cloned into pCR2.1 as above and a correct clone was identified by DNA sequence analysis. This clone was digested with Nco I and Pin AI, a 1414 bp fragment was isolated in a 1% agarose gel and ligated into the Nco I and Pin AI sites of plasmid pDAB2030 and transformed into DHα E. coli . This new plasmid, designed to express TcbA ii A iii in E. coli , is called pDAB2032.

Expression of tcbA and tcbA ii A iii from Plasmids pDAB2030, pDAB2031 and pDAB2032

Expression of tcbA in E. coli from plasmids pDAB2030, pDAB2031 and pDAB2032 was as described herein, except expression of tcbA ii A iii was done in E. coli strain HMS174(DE3)(Novagen, Madison, Wis.).

Expression of tcbA from Plasmid pDAB2033

The plasmid pDAB2033 was transformed into BL21 cells (Novagen, Madison, Wis.) and plated on LB containing 100 micrograms/mL ampicillin and 50 mM glucose. The plates were spread such that several hundred well separated colonies were present on each plate following incubation at either 30° C. or 37° C. overnight. The colonies were scraped from the plates and suspended in LB containing 100 micrograms/mL ampicillin, but no glucose. Typical culture volume was 250 mL in a single 1 L baffle bottom flask. The cultures were induced when the culture reached a density of 0.3-0.6 OD600 nm. Most often this density was achieved immediately after suspension of the cells from the plates and did not require a growth period in liquid media. Two induction methods were used. Method 1: cells were induced with 1 mM IPTG at 37° C. The cultures were shaken at 200 rpm on a platform shaker for 5 hours and harvested. Method 2: The cultures were induced with 25 micromolar IPTG at 30° C. and shaken at 200 rpm for 15 hours at either 20° C. or 30° C. The cultures were stored at 4° C. until used for purification.

Purification of TcbA from E. coli

Purification, bioassay and immunoblot analysis of TcbA and TcbA ii A iii was as described herein. Results of several representative E. coli expression experiments are shown in Table 32. All materials shown in Table 32 were purified from the media fraction of the cultures. The predicted native molecular weight is approximately 900 kD as described herein. The purity of the samples, the amount of TcbA relative to contaminating proteins, varied with each preparation.

TABLE 32
Bioassay Activity and Immunoblot Analysis of TcbA and Derivatives
Produced in E. coli and Purified from the Culture Media
	Southern Corn
	Rootworm Bioassay	Peptides	Micrograms
	Activity	Detected	Protein
	Coding	E. coli	% Growth	%	by Im-	Applied to
Plasmid	Region	Strain	Inhibit.	Mortal.	munoblot	Diet
pDAB2030	tcbA	BL21	−	+++	TcbA +	1-8
		(DE3)			TcbA iii
pDAB2031	tcbA	BL21	−	+++	TcbA +	1-10
		(DE3)			TcbA iii
pDAB2033	tcbA	BL21	−	+++	TcbA +	1-2
					TcbA iii
pDAB2032	tcbA ii A iii	HMS174	+++	+	TcbA ii A iii +	13-27
		(DE3)			TcbA iii
Scoring system for mortality and growth inhibition on Southern Corn Rootworm as compared to control samples; 5-24% = “+”, 25-49% = “++”, 50-100% = “+++”.

EXAMPLE 20

Characterization of Toxin Peptides with Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectroscopy

Toxins isolated from W-14 broth were purified as described in Example 15. In some cases, the TcaB protein toxin was pretreated with proteases (Example 16) that had been isolated from W-14 broth as previously described (Example 15). Protein molecular mass was determined using matrix-assisted laser desorption ionization time-of-flight mass spectroscopy, hereinafter MALDI-TOF, on a VOYAGER BIOSPECTROMETRY workstation with DELAYED EXTRACTION technology (PerSeptive Biosystems, Framingham, Mass.). Typically, the protein of interest (100-500 pmoles in 5 μl) was mixed with 1 μl of acetonitrile and dialyzed for 0.5 to 1 h on a Millipore VS filter having a pore size of 0.025 μM (Millipore Corp. Bedford, Mass.). Dialysis was performed by floating the filter on water(shinny side up) followed by adding protein-acetonitrile mixture as a droplet to the surface of the filter. After dialysis, the dialyzed protein removed using a pipette and was then mixed with a matrix consisting of sinapinic acid and trifluoroacetic acid according to manufacturers instructions. The protein and matrix were allowed to co-crystallize on a about 3 cm 2 gold-plated sample plate (PerSeptive Corp.). Excitation of the crystals and subsequent mass analysis was performed using the following conditions: laser setting of 3050; pressure of 4.55e-07; low mass gate of 1500.0; negative ions off; accelerating voltage of 25,000; grid voltage of 90.0%; guide wire voltage of 0.010%; linear mode; and a pulse delay time of 350 ns.

Protein mass analysis data are shown in Table 33. The data obtained from MALDI-TOF was compared to that hypothesized from gene sequence information and as previously determined by SDS-PAGE.

TABLE 33
Molecular Analysis of Peptides by MALDI-TOF, SDS-PAGE and
Predicted Determination Based on Gene Sequence
Peptide	Predicted (Gene)	SDS PAGE	MALDI-TOF
TcbA	280,634 Da	240,000 Da	281,040 Da
TcbA i/ii	217,710 Da	not resolved	216,812 Da
TcbA ii	207,698 Da	201,000 Da	206,473 Da
TcbA iii	62,943 Da	58,000 Da	63,520 Da
TcdA ii	209,218 Da	188,000 Da	208,186 Da
TcdA iii	63,520 Da	56,000 Da	63,544 Da
TcbA ii	Protease Generated	201,000 Da	216,614 Da{circumflex over ( )}
			215,123 Da{circumflex over ( )}
			210,391 Da{circumflex over ( )}
			208,680 Da{circumflex over ( )}
TcbA iii	Protease Generated	56,000 Da	64,111 Da
{circumflex over ( )}Data normalized TcbA, multiple fragments observed at TcbAi/ii

EXAMPLE 21

Production of Peptide Specific Polyclonal Antibodies

Nine peptide components of the W-14 toxin complex, namely, TcaA, TcaA iii , TcaB i , TcaB ii , TcaC, TcbA ii , TcbA iii , TcdA ii , and TcdA iii were selected as targets against which antibodies were produced. Comprehensive DNA and deduced amino acid sequence data for these peptides indicated that the sequence homology between some of these peptides was substantial. If a whole peptide was used as the immunogen to induce antibody production, the resulting antibodies might bind to multiple peptides in the toxin preparation. To avoid this problem antibodies were generated that would bind specifically to a unique region of each peptide of interest. The unique region (subpeptide) of each target peptide was selected based on the analyses described below.

Each entire peptide sequence was analyzed using MacVector™ Protein Analysis Tool (IBI Sequence Analysis Software, International Biotechnologies, Inc:, P.O. Box 9558, New Haven, Conn. 06535) to determine its antigenicity index. This program was designed to locate possible externally-located amino acid sequences, i.e., regions that might be antigenic sites. This method combined information from hydrophilicity, surface probability, and backbone flexibility predictions along with the secondary structure predictions in order to produce a composite prediction of the surface contour of a protein. The scores for each of the analyses were normalized to a value between −1.0 and +1.0 (MacVector™ Manual). The antigenicity index value was obtained for the entire sequence of the target peptide. From each peptide, an area covering 19 or more amino acids that showed a high antigenicity index from the original sequence was re-analyzed to determine the antigenicity index of the subpeptide without the flanking residues. This re-analysis was necessary because the antigenicity index of a peptide could be influenced by the flanking amino acid residues. If the isolated subpeptide sequence did not maintain a high antigenicity index, a new region was chosen and the analysis was repeated.

Each selected subpeptide sequence was aligned and compared to all seven target peptide sequences using MacVector™ alignment program. If a selected subpeptide sequence showed identity (greater than 20%) to another target peptide, a new 19 or more amino acid region was isolated and re-analyzed. Unique subpeptide sequences covering 19 or more amino acid showing high antigenicity index were selected from all target peptides.

The sequences of seven subpeptides were sent to Genemed Biotechnology Inc. The last amino acid residue on each subpeptide was deleted because it showed no apparent effect on the antigenicity index. A cysteine residue was added to the N-terminal of each subpeptide sequence, except TcaB i -syn which contains an internal cysteine residue. The present of a cysteine residue facilitates conjugation of a carrier protein (KLH). The final peptide products corresponding to the appropriate toxin peptides and SEQ ID NO.s are shown in Table 34.

TABLE 34
Amino Acid Sequences for Synthetic Peptides
SEQ ID NO.	Pepide	Amino Acid Sequence
63	TcaA ii -syn	NH2-(C)LRGNSPTNPDKDGIFAQVA
64	TcaA iii -syn	NH2-(C)YTPDQTPSFYETAFRSADG
65	TcaB i -syn	NH2-(C)HGQSYNDNNYCNFTLSINT
66	TcaB iii -syn	NH2-(C)VDPKTLQRQQAGGDGTGSS
67	TcaC-syn	NH2-(C)YKAPQRQEDGDSNAVTYDK
68	TcbA ii -syn	NH2-(C)YNENPSSEDKKWYFSSKDD
69	TcbA iii -syn	NH2-(C)FDSYSQLYEENINAGEQRA
70	TcdA ii -syn	NH2-(C)NPNNSSNKLMFYPVYQYSGNT
71	TcdA iii -syn	NH2-(C)VSQGSGSAGSGNNNLAFGAG

Each conjugated synthetic peptide was injected into two rabbits according to Genemed accelerated program. The pre- and post-immune sera were available for testing after one month.

The preliminary test of both pre- and post-immune sera from each rabbit was performed by Genemed Biotechnologies Inc. Genemed reported that by using both ELISA and Western blot techniques, they detected the reaction of post-immune sera to the respective synthetic peptides. Subsequently, the sera were tested with the whole target peptides, by Western blot analysis. Two batches of partially purified Photorhabdus strain W-14 toxin complex was used as the antigen. The two samples had shown activity against the Southern corn rootworm. Their peptide patterns on an SDS-PAGE gel were slightly different.

Pre-cast SDS-polyacrylamide gels with 4-20% gradient (Integrated Separation Systems, Natick, Mass. 01760) were used. Between 1 to 8 μg of protein was applied to each gel well. Electrophoresis was performed and the protein was electroblotted onto Hybond-ECL™ nitrocellulose membrane (Amersham International). The membrane was blocked with 10% milk, in TBST (25 mM Tris HCl pH 7.4, 136 mM NaCl, 2.7 mM KCl, 0.1% TWEEN 20 surfactant) for one hour at room temperature. Each rabbit serum was diluted in 10% milk/TBST to 1:500. Other dilutions between 1:50 to 1:1000 were also used. The serum was added to the membrane and placed on a platform rocker for at least one hour. The membrane was washed thoroughly with the blocking solution or TBST. A 1:2000 dilution of secondary antibodies (goat anti-mouse IgG conjugated to horse radish peroxidase; BioRad Laboratories) in 10% milk/TBST was applied to the membrane placed on a platform rocker for one hour. The membrane was subsequently washed with excess amount of TBST. The detection of the protein was performed by using an ECL (Enhanced Chemiluminescence) detection kit (Amersham International).

Western blot analyses were performed to identify binding specificity of each anti-synthetic peptide antibodies. All synthetic polyclonal antibodies showed specificity toward to processed and, when applicable, unprocessed target peptides from protein fractions derived from Photorhabdus culture broth. Various antibodies were shown to recognize either unprocessed or processed recombinant proteins derived from heterologous expression systems such as bacteria or insect cells, using baculovirus expression constructs. In one case, the anti-TcbA iii -syn antibody showed some cross-reactivity to anti-TcdA iii peptide. In a second case, the anti-TcaC-syn antibody, recognized an unidentified 190 kDa peptide in W-14 toxin complex fractions.

EXAMPLE 22

Characterization of Photorhabdus Strains

In order to establish that the collection described herein was comprised of Photorhabdus strains, the strains herein were assessed in terms of recognized microbiological traits that are characteristic of the bacterial genus Photorhabdus and which differentiate it from other Enterobacteriaceae and Xenorhabdus spp. (Farmer, J. J. 1984. Bergey's Manual of Systemic Bacteriology, Vol 1. pp. 510-511. (ed. Kreig N. R. and Holt, J. G.). Williams & Wilkins, Baltimore.; Akhurst and Boemare, 1988, J. Gen. Microbiol. 134, 1835-1845; Forst and Nealson, 1996. Microbiol. Rev. 60, 21-43). These characteristic traits are as follows: Gram stain negative rods, organism size of 0.3-2 μm in width and 2-10 μm in length [with occasional filaments (15-50 μm) and spheroplasts], yellow to orange/red colony pigmentation on nutrient agar, presence of crystalline inclusion bodies, presence of catalase, inability to reduce nitrate, presence of bioluminescence, ability to take up dye from growth media, positive for protease production, growth at temperatures below 37° C., survival under anaerobic conditions and positively motile. (Table 33). Test methods were checked using reference Escherichia coli , Xenorhabdus and Photorhabdus strains. The overall results are consistent with all strains being part of the family Enterobacteriaceae and the genus Photorhabdus. Note that DEP1, DEP2, and DEP3 refer to Photorhabdus strains obtained from the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. 20852 USA (#29304, 29999 and 51583, respectively).

A luminometer was used to establish the bioluminescence associated with these Photorhabdus strains. To measure the presence or absence of relative light emitting units, the broths from each strain (cells and media) were measured at three time intervals after inoculation in liquid culture (24, 48, 72 hr) and compared to background luminosity (uninoculated media). Several Xenorhabdus strains were tested as negative controls for luminosity. Prior to measuring light emission from the various broths, cell density was established by measuring light absorbance (560 nM) in a Gilford Systems (Oberlin, Ohio) spectrophotometer using a sipper cell. The resulting light emitting units could then be normalized to density of cells. Aliquots of the broths were placed into 96-well microtiter plates (100 μl each) and read in a Packard Lumicount™ luminometer (Packard Instrument Co., Meriden, Conn.). The measurement period for each sample was 0.1 to 1.0 second. The samples were agitated in the luminometer for 10 sec prior to taking readings. A positive test was determined as being about 5-fold background luminescence (about 1-15 relative light units). In addition, degree of colony luminosity was confirmed with photographic film overlays and by eye, after visual adaptation in a darkroom. The Gram's staining characteristics of each strain were established with a commercial Gram's stain kit (BBL, Cockeysville, Md.) used in conjunction with Gram's stain control slides (Fisher Scientific, Pittsburgh, Pa.). Microscopic evaluation was then performed using a Zeiss microscope (Carl Zeiss, Germany) 100×oil immersion objective lens (with 10×ocular and 2×body magnification). Microscopic examination of individual strains for organism size, cellular description and inclusion bodies (the latter two observations after logarithmic growth) was performed using wet mount slides (10×ocular, 2×body and 40×objective magnification) and phase contrast microscopy with a micrometer (Akhurst, R. J. and Boemare, N. E. 1990. Entomopathogenic Nematodes in Biological Control (ed. Gaugler, R. and Kaya, H.). pp. 75-90. CRC Press, Boca Raton, USA.; Baghdiguian S., Boyer-Giglio M. H., Thaler, J. O., Bonnot G., Boemare N. 1993. Biol. Cell 79, 177-185.). Colony pigmentation was observed after inoculation on Bacto nutrient agar, (Difco Laboratories, Detroit, Mich.) prepared as per label instructions. Incubation occurred at 28° C. and descriptions were produced after 5 days. To test for the presence of the enzyme catalase, a colony of the test organism was removed on a small plug from a nutrient agar plate and placed into the bottom of a glass test tube. One ml of a household hydrogen peroxide solution was gently added down the side of the tube. A positive reaction was recorded when bubbles of gas (presumptive oxygen) appeared immediately or within 5 seconds. Controls of uninoculated nutrient agar and hydrogen peroxide solution were also examined. To test for nitrate reduction, each culture was inoculated into 10 ml of Bacto Nitrate Broth (Difco Laboratories, Detroit, Mich.). After 24 hours incubation with gentle agitation at 28° C., nitrite production was tested by the addition of two drops of sulfanilic acid reagent and two drops of alpha-naphthylamine reagent (see Difco Manual, 10th edition, Difco Laboratories, Detroit, Mich., 1984). The generation of a distinct pink or red color indicates the formation of nitrite from nitrate whereas the lack of color formation indicates that the strain is nitrate reduction negative. In the latter case, finely powdered zinc was added to further confirm the presence of unreduced nitrate; established by the formation of nitrite and the resultant red color. The ability of each strain to uptake dye from growth media was tested with Bacto MacConkey agar containing the dye neutral red; Bacto Tergitol-7 agar containing the dye bromothymol blue and Bacto EMB Agar containing the dye eosin-Y (formulated agars from Difco Laboratories, Detroit, Mich., all prepared according to label instructions). After inoculation on these media, dye uptake was recorded after incubation at 28° C. for 5 days. Growth on these latter media is characteristic for members of the family Enterobacteriaceae. Motility of each strain was tested using a solution of Bacto Motility Test Medium (Difco Laboratories, Detroit, Mich.) prepared as per label instructions. A butt-stab inoculation was performed with each strain and motility was judged macroscopically by a diffuse zone of growth spreading from the line of inoculum. The production of protease was tested by observing hydrolysis of gelatin using Bacto gelatin (Difco Laboratories, Detroit, Mich.) made as per label instructions. Cultures were inoculated and the tubes or plates were incubated at 28° C. for 5 days. Gelatin hydrolysis was then checked at room temperature, i.e. less than 22° C. To assess growth at different temperatures, agar plates [2% proteose peptone #3 with two percent Bacto-Agar (Difco, Detroit, Mich.) in deionized water] were streaked from a common source of inoculum. Plates were incubated at 20, 28 and 37° C. for up to three weeks. The incubator temperature levels were checked with an electronic thermocouple and meter to insure valid temperature settings. Oxygen requirements for Photorhabdus strains were tested in the following manner. A butt-stab inoculation into fluid thioglycolate broth medium (Difco, Detroit, Mich.) was made. The tubes were incubated at room temperature for one week and cultures were then examined for type and extent of growth. The indicator resazurin demonstrates the presence of medium oxygenation or the aerobiosis zone (Difco Manual, 10th edition, Difco Laboratories, Detroit, Mich.). Growth zone results obtained for the Photorhabdus strains tested were consistent with those of a facultative anaerobic microorganism. In the case of unclear. results, the final agar concentration of fluid thioglycolate broth medium was raised to 0.75% and the growth characteristics rechecked.

TABLE 35

Taxonomic Traits of Photorhabdus Strains

Strain

A*

B

C

D

E

F

G

H

I

J §

K

L

M

N

O

P

Q

P. zealandica

− †

+

+

rd S

+

−

+

+

+

PO

+

+

+

+

+

+

−

P. hepialus

−

+

+

rd S

+

−

+

+

+

Y

+

+

+

+

+

+

−

HB-Arg

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

HB Oswego

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

HB Lewiston

−

+

+

rd S

+

−

+

+

+

T

+

+

+

+

+

+

−

K-122

−

+

+

rd S

+

−

+

+

+

Y

+

+

+

+

+

+

−

HMGD

−

+

+

rd S

+

−

+

+

+

Rd

+

+

+

+

+

+

−

Indicus

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

GD

−

+

+

rd S

+

−

+

+

+

YT

+

+

+

+

+

+

−

PWH-5

−

+

+

rd S

+

−

+

+

+

Y

+

+

+

+

+

+

−

Megidis

−

+

+

rd S

+

−

+

+

+

R

+

+

+

+

+

+

−

HF-85

−

+

+

rd S

+

−

+

+

+

R

+

+

+

+

+

+

−

A. Cows

−

+

+

rd S

+

−

+

+

+

PR

+

+

+

+

+

+

−

MP1

−

+

+

rd S

+

−

+

+

+

T

+

+

+

+

+

+

−

MP2

−

+

+

rd S

+

−

+

+

+

T

+

+

+

+

+

+

−

MP3

−

+

+

rd S

+

−

+

+

+

R

+

+

+

+

+

+

−

MP4

−

+

+

rd S

+

−

+

+

+

Y

+

+

+

+

+

+

−

MP5

−

+

+

rd S

+

−

+

+

+

PR

+

+

+

+

+

+

−

GL98

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

GL101

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

GL138

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

GL155

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

GL217

−

+

+

rd S

+

−

+

+

+

Y

+

+

+

+

+

+

−

GL257

−

+

+

rd S

+

−

+

+

+

O

+

+

+

+

+

+

−

DEP1

−

+

+

rd S

+

−

+

+

+

W

+

+

+

+

+

+

−

DEP2

−

+

+

rd S

+

−

+

+

+

PR

+

+

+

+

+

+

−

DEP3

−

+

+

rd S

+

−

+

+

+

CR

+

+

+

+

+

+

−

*A = Gram's stain, B = Crystaline inclusion bodies, C = Bioluminescence, D = Cell form, E = Motility, F = Nitrate reduction, G = Presence of catalase, H = Gelatin hydrolysis, I = Dye uptake, J = Pigmentation on Nutrient Agar (some color shifts after Day 5), K = Growth on EMB agar, L = Growth on MacConkey agar, M = Growth on Tergitol-7 agar, N = Facultative anaerobe,

# O = Growth at 20° C., P = Growth at 28° C., Q = Growth at 37° C.

† + = positive for trait, − = negative for trait, rd = rod, S = sized within Genus descriptors.

§ W = white, CR = cream, Y = yellow, YT = yellow tan, T = tan PO = pale orange, O = orange, PR = pale red, R = red.

The evolutionary diversity of the Photorhabdus strains in our collection was measured by analysis of PCR (Polymerase Chain Reaction) mediated genomic fingerprinting using genomic DNA from each strain. This technique is based on families of repetitive DNA sequences present throughout the genome of diverse bacterial species (reviewed by Versalovic, J., Schneider, M., D E. Bruijn, F. J. and Lupski, J. R. 1994. Methods Mol. Cell. Biol., 5, 25-40). Three of these, repetitive extragenic palindromic sequence (REP), enterobacterial repetitive intergenic consensus (ERIC) and the BOX element are thought to play an important role in the organization of the bacterial genome. Genomic organization is believed to be shaped by selection and the differential dispersion of these elements within the genome of closely related bacterial strains can be used to discriminate these strains (e.g., Louws, F. J., Fulbright, D. W., Stephens, C. T. and D E Bruijn, F. J. 1994. Appl. Environ. Micro. 60, 2286-2295). Rep-PCR utilizes oligonucleotide primers complementary to these repetitive sequences to amplify the variably sized DNA fragments lying between them. The resulting products are separated by electrophoresis to establish the DNA “fingerprint” for each strain.

To isolate genomic DNA from our strains, cell pellets were resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a final volume of 10 ml and 12 ml of 5 M NaCl was then added. This mixture was centrifuged 20 min. at 15,000×g. The resulting pellet was resuspended in 5.7 ml of TE and 300 μl of 10% SDS and 60 μl 20 mg/ml proteinase K (Gibco BRL Products, Grand Island, N.Y.) were added. This mixture was incubated at 37° C. for 1 hr, approximately 10 mg of lysozyme was then added and the mixture was incubated for an additional 45 min. One milliliter of 5M NaCl and 800 μl of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) were then added and the mixture was incubated 10 min. at 65° C., gently agitated, then incubated and agitated for an additional 20 min. to aid in clearing of the cellular material. An equal volume of chloroform/isoamyl alcohol solution (24:1, v/v) was added, mixed gently then centrifuged. Two extractions were then performed with an equal volume of phenol/chloroform/isoamyl alcohol (50:49:1). Genomic DNA was precipitated with 0.6 volume of isopropanol. Precipitated DNA was removed with a glass rod, washed twice with 70% ethanol, dried and dissolved in 2 ml of STE (10 mM Tris-HCl pH8.0, 10 mM NaCl, 1 mM EDTA). The DNA was then quantitated by optical density at 260 nm. To perform rep-PCR analysis of Photorhabdus genomic DNA the following primers were used, REP1R-I; 5′-IIIICGICGICATCIGGC-3′ and REP2-I; 5′-ICGICTTATCIGGCCTAC-3′. PCR was performed using the following 25 μl reaction: 7.75 μl H 2 O, 2.5 μl 10×LA buffer (PanVera Corp., Madison, Wis.), 16 μl dNTP mix (2.5 mM each), 1 μl of each primer at 50 pM/μl, 1 μl DMSO, 1.5 μl genomic DNA (concentrations ranged from 0.075-0.480 μg/μl) and 0.25 μl TaKaRa EX Taq (PanVera Corp., Madison, Wis.). The PCR amplification was performed in a Perkin Elmer DNA Thermal Cycler (Norwalk, Conn.) using the following conditions: 95° C./7 min. then 35 cycles of; 94° C./1 min.,44° C./1 min., 65° C./8 min., followed by 15 min. at 65° C. After cycling, the 25 μl reaction was added to 5 μl of 6×gel loading buffer (0.25% bromophenol blue, 40% w/v sucrose in H 2 O). A 15×20 cm 1%-agarose gel was then run in TBE buffer (0.09 M Tris-borate, 0.002 M EDTA) using 8 μl of each reaction. The gel was run for approximately 16 hours at 45 v. Gels were then stained in 20 μg/ml ethidium bromide for 1 hour and destained in TBE buffer for approximately 3 hours. Polaroid® photographs of the gels were then taken under UV illumination.

The presence or absence of bands at specific sizes for each strain was scored from the photographs and entered as a similarity matrix in the numerical taxonomy software program, NTSYS-pc (Exeter Software, Setauket, N.Y.). Controls of E. coli strain HB101 and Xanthomonas oryzae pv. oryzae assayed under the same conditions produced PCR fingerprints corresponding to published reports (Versalovic, J., Koeuth, T. and Lupski, J. R. 1991. Nucleic Acids Res. 19, 6823-6831; Vera Cruz, C. M., Halda-Alija, L., Louws, F., Skinner, D. Z., George, M. L., Nelson, R. J., D E. Bruijn, F. J., Rice, C. and Leach, J. E. 1995. Int. Rice Res. Notes, 20, 23-24.; Vera Cruz, C. M., Ardales, E. Y., Skinner, D. Z., Talag, J., Nelson, R. J., Louws, F. J., Leung, H., Mew, T. W. and Leach, J. E. 1996. Phytopathology 86, 1352-1359). The data from Photorhabdus strains were then analyzed with a series of programs within NTSYS-pc; SIMQUAL (Similarity for Qualitative data) to generate a matrix of similarity coefficients (using the Jaccard coefficient) and SAHN (Sequential, Agglomerative, Heirarchical and Nested) clustering [using the UPGMA (Unweighted Pair-Group Method with Arithmetic Averages) method] which groups related strains and can be expressed as a phenogram (FIG. 7 ). The COPH (cophenetic values) and MXCOMP (matrix comparison) programs were used to generate a cophenetic value matrix and compare the correlation between this and the original matrix upon which the clustering was based. A resulting normalized Mantel statistic (r) was generated which is a measure of the goodness of fit for a cluster analysis (r=0.8-0.9 represents a very good fit). In our case r=0.924. Therefore, the collection is comprised of a diverse group of easily distinguishable strains representative of the Photorhabdus genus.

EXAMPLE 23

Insecticidal Utility of Toxin(s) Produced by Various Photorhabdus Strains

Initial “storage” cultures of the various Photorhabdus strains were produced by inoculating 175 ml of 2% Proteose Peptone #3 (PP3) (Difco Laboratories, Detroit, Mich.) liquid medium with a primary variant colony in a 500 ml tribaffled flask with a Delong neck, covered with a Kaput closure. After inoculation, the flask was incubated for between 24-72 hrs at 28° C. on a rotary shaker at 150 rpm, until stationary phase was reached. The culture was transferred to a sterile bottle containing a sterile magnetic stir bar and the culture was overlayered with sterile mineral oil, to limit exposure to air. The storage culture was kept in the dark, at room temperature. These cultures were then used as inoculum sources for the fermentation of each strain.

“Seed” flasks or cultures were produced by either inoculating 2 mls of an oil overlayered storage culture or by transferring a primary variant colony into 175 ml sterile medium in a 500 ml tribaffled flask covered with a Kaput closure. (The use of other inoculum sources is also possible.) Typically, following 16 hours incubation at 28° C. on a rotary shaker at 150 rpm, the seed culture was transferred into production flasks. Production flasks were usually inoculated by adding about 1% of the actively growing seed culture to sterile 2% PP3 medium (e.g. 2.0 ml per 175 ml sterile medium). Production of broths occurred in 500 ml tribaffled flasks covered with a Kaput. Production flasks were agitated at 28° C. on a rotary shaker at 150 rpm. Production fermentations were terminated after 24-72 hrs although successful fermentation is not confined to this time duration. Following appropriate incubation, the broths were dispensed into sterile 1.0 L polyethylene bottles, spun at 2600×g for 1 hr at 10° C. and decanted from the cell and debris pellet. Further broth clarification was achieved with a tangential flow microfiltration device (Pall Filtron, Northborough, Mass.) using a 0.5 μM open-channel poly-ether sulfone (PES) membrane filter. The resulting broths were then concentrated (up to 10-fold) using a 10,000 or 100,000 MW cut-off membrane, M12 ultra-filtration device (Amicon, Beverly Mass.) or centrifugal concentrators (Millipore, Bedford, Mass. and Pall Filtron, Northborough, Mass.) with a 10,000 or 100,000 MW pore size. In the case of centrifugal concentrators, the broth was spun at 2000×g for approximately 2 hr. The membrane permeate was added to the corresponding retentate to achieve the desired concentration of components greater than the pore size used. Following these procedures, the broth was used for biochemical analysis or filter sterilized using a 0.2 μM cellulose nitrate membrane filter for biological assessment. Heat inactivation of processed broth samples was achieved by heating the samples at 100° C. in a sand-filled heat block for 10 minutes.

The broth(s) and toxin complex(es) from different Photorhabdus strains are useful for reducing populations of insects and were used in a method of inhibiting an insect population which comprises applying to a locus of the insect an effective insect inactivating amount of the active described. A demonstration of the breadth of insecticidal activity observed from broths of a selected group of Photorhabdus strains fermented as described above is shown in Table 36. It is possible that improved or additional insecticidal activities could be detected with these strains through increased concentration of the broth or by employing different fermentation methods. Consistent with the activity being associated with a protein, the insecticidal activity of all strains tested was heat labile.

Culture broth(s) from diverse Photorhabdus strains show differential insecticidal activity (mortality and/or growth inhibition) against a number of insects. More specifically, the activity is seen against corn rootworm which is a member of the insect order Coleoptera. Other members of the Coleoptera include boll weevils, wireworms, pollen beetles, flea beetles, seed beetles and Colorado potato beetle. The broths and purified toxin complex(es) are also active against tobacco budworm, tobacco hornworm and European corn borer which are members of the order Lepidoptera. Other typical members of this order are beet armyworm, cabbage looper, black cutworm, corn earworm, codling moth, clothes moth, Indian mealmoth, leaf rollers, cabbage worm, cotton bollworm, bagworm, Eastern tent caterpillar, sod webworm and fall armyworm. Activity is also observed against German cockroach which is a member of the order Dictyoptera (or Blattodea). Other members of this order are oriental cockroach and American cockroach.

Activity against corn rootworm larvae was tested as follows. Photorhabdus culture broth(s) (10 fold concentrated, filter sterilized), 2% Proteose Peptone #3 (10 fold concentrated), purified toxin complex(es), 10 mM sodium phosphate buffer, pH 7.0 were applied directly to the surface (about 1.5 cm 2 ) of artificial diet (Rose, R. I. and McCabe, J. M. 1973. J. Econ. Entomol. 66, 398-400) in 40 μl aliquots. Toxin complex was diluted in 10 mM sodium phosphate buffer, pH 7.0. The diet plates were allowed to air-dry in a sterile flow-hood and the wells were infested with single, neonate Diabrotica undecimpunctata howardi (Southern corn rootworm, SCR) hatched from surface sterilized eggs. The plates were sealed, placed in a humidified growth chamber and maintained at 27° C. for the appropriate period (3-5 days). Mortality and larval weight determinations were then scored. Generally, 16 insects per treatment were used in all studies. Control mortality was generally less than 5%.

Activity against lepidopteran larvae was tested as follows. Concentrated (10-fold) Photorhabdus culture broth(s), control medium (2% Proteose Peptone #3), purified toxin complex(es), 10 mM sodium phosphate buffer, pH 7.0 were applied directly to the surface (about 1.5 cm 2 ) of standard artificial lepidopteran diet (Stoneville Yellow diet) in 40 μl aliquots. The diet plates were allowed to air-dry in a sterile flow-hood and each well was infested with a single, neonate larva. European corn borer ( Ostrinia nubilalis ) and tobacco hornworm ( Manduca sexta ) eggs were obtained from commercial sources and hatched in-house, whereas tobacco budworm ( Heliothis virescens ) larvae were supplied internally. Following infestation with larvae, the diet plates were sealed, placed in a humidified growth chamber and maintained in the dark at 27° C. for the appropriate period. Mortality and weight determinations were scored at day 5. Generally, 16 insects per treatment were used in all studies. Control mortality generally ranged from about 0 to about 12.5% for control medium and was less than 10% for phosphate buffer.

Activity against cockroach was tested as follows. Concentrated (10-fold) Photorhabdus culture broth(s) and control medium (2% Proteose Peptone #3) were applied directly to the surface (about 1.5 cm 2 ) of standard artificial lepidopteran diet (Stoneville Yellow diet) in 40 μl aliquots. The diet plates were allowed to air-dry in a sterile flow-hood and each well was infested with a single, CO 2 anesthetized first instar German cockroach ( Blatella germanica ). Following infestation, the diet plates were sealed, placed in a humidified growth chamber and maintained in the dark at 27° C. for the appropriate period. Mortality and weight determinations were scored at day 5. Control mortality less than 10%.

TABLE 36
Observed Insecticidal Spectrum of Broths
from Different Photorhabdus Strains
Photorhabdus Strain Sensitive* Insect Species
P. zealandica       1**, 2, 4
P. hepialus         1, 2, 4
HB-Arg              1, 2, 4
HB Oswego           1, 2, 4
HB Lewiston         1, 2, 4
K-122               1, 4
HMGD                1, 4
Indicus             1, 2, 4
GD                  2, 4
PWH-5               1, 2, 4
Megidis             1, 2, 4
HF-85               1, 2, 4
A. Cows             1, 4
MP1                 1, 2, 4
MP2                 1, 2, 4
MP3                 4
MP4                 1, 4
MP5                 4
GL98                1, 4
GL101               1, 4, 5
GL138               1, 2, 4
GL155               1, 4
GL217               1, 2, 4
GL257               1, 4
DEP1                1, 4
DEP2                1, 2, 3, 4
DEP3                4
*=                                                                                     3                                                                                25% mortality and/or growth inhibition vs. control
**= 1; Tobacco budworm, 2; European corn borer, 3; Tobacco hornworm, 4; Southern corn rootworm, 5; German cockroach.

EXAMPLE 24

Southern Analysis of Non-W-14 Photorhabdus Strains Using W-14 Gene Probes

Photorhabdus strains were grown on 2% proteose peptone #3 agar (Difco Laboratories, Detroit, Mich.) and insecticidal toxin competence was maintained by repeated bioassay after passage. A 50 ml shake culture was produced in 175 ml baffled flasks in 2% proteose peptone #3 medium, grown at 28° and 150 rpm for approximately 24 hours. Fifteen ml of this culture were centrifuged (700×g, 30 min) and frozen in its medium at −20° until it was thawed (slowly in ice water) for DNA isolation. The thawed W-14 culture was centrifuged (900×g, 15 min 4°), and the floating orange mucopolysaccharide material was removed. The remaining cell material was centrifuged (25,000×g, 4°) to pellet the bacterial cells, and the medium was removed and discarded.

Total DNA was isolated by an adaptation of the CTAB method described in section 2.4.1 of Ausubel et al. (1994). The modifications included a high salt shock, and all volumes were increased ten-fold over the “miniprep” recommended volumes. All centrifugations were at 4° C. unless otherwise specified. The pelleted bacterial cells were resuspended in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8) to a final volume of 10 ml, then 12 ml 5 M NaCl were added; this mixture was centrifuged 20 min at 15,000×g. The pellet was resuspended in 5.7 ml TE, and 300 μl of 10% SDS and 60 μl of 20 mg/ml proteinase K (in sterile distilled water, Gibco BRL Products, Grand Island, N.Y.) were added to the suspension. The mixture was incubated at 37° C. for 1 hr; then approximately 10 mg lysozyme (Worthington Biochemical Corp., Freehold, N.J.) were added. After an additional 45 min incubation, 1 ml of 5 M NaCl and 800 Al of CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) were added. This preparation was incubated 10 min at 65° C., then gently agitated and further incubated and agitated for approximately 20 min to assist clearing of the cellular material. An equal volume of chloroform/isoamyl alcohol solution (24:1, v:v) was added, mixed very gently, and the phases separated by centrifugation at 12,000×g for 15 min. The upper (aqueous) phase was gently removed with a wide-bore pipette and extracted twice as above with an equal volume of PCI (phenol/choloroform/isoamyl alcohol; 50:49:1, v:v:v; equilibrated with 1M Tris-HCl, pH 8.0; Intermountain Scientific Corporation, Kaysville, Utah). The DNA precipitated with 0.6 volume of isopropanol was gently removed on a glass rod, washed twice with 70% ethanol, dried, and dissolved in 2 ml STE (10 mM Tris-HCl, 10 mM NaCl, 1 mM EDTA, pH 8). This preparation contained 2.5 mg/ml DNA, as determined by optical density at 260 nm.

Identification of Bgl II/Hind III Fragments Hybridizing to tc-gene Specific Probes

Approximately 10 μg of genomic DNA was digested to completion with about 30 units each of Bgl II and Hind III (NEB) for 180 min, frozen overnight, then heated at 65° C. for five min, and electrophoresed in a 0.8% agarose gel (Seakem® LE, 1×TEA, 80 volts, 90 min). The DNA was stained with ethidium bromide (50 μg/ml) as described earlier, and photographed under ultraviolet light. The DNA fragments in the agarose gel were subjected to depurination (5 min in 0.2 M HCl), denaturation (15 min in 0.5 M NaOH, 1.5 M NaCl), and neutralization (15 min in 0.5 M Tris HCl pH 8.0, 1.5 M NaCl), with 3 rinses of distilled water between each step. The DNA was transferred by Southern blotting from the gel onto a NYTRAN nylon membrane (Amersham, Arlington Heights, Ill.) using a high salt (20×SSC) protocol, as described in section 2.9 of Ausubel et al. (CPMB, op. cit.). The transferred DNA was then UV-crosslinked to the nylon membrane using a Stratagene UV Stratalinker set on auto crosslink. The membranes were stored dry at 25° C. until use.

Hybidization was performed using the ECL™direct (Amersham, Arlington Heights, Ill.) labeling and detection system following protocols provided by the manufacturer. In brief, probes were prepared by covalently linking the denatured DNA to the enzyme horseradish peroxidase. Once labeled the probe was used under hybridization conditions which maintain the enzymatic activity. Unhybridized probe was removed by two gentle washes 20 minutes each at 42° C. in 0.5×SSC, 0.4% SDS, and 6M Urea. This was followed by two washes 5 minutes each at room temperature in 2×SSC. As directed by the manufacturer, ECL™ reagents were used to detect the hybridizing DNA bands. There are several factors which influence the ability to detect gene relatedness between various Photorhabdus strains and strain W-14. First, high stringency conditions have not been employed in these hybridizations. It is known in the art that varying the stringency of hybridization and wash conditions will influence the pattern and intensity of hybridizing bands. Second, Southern blots' blot to blot variation will influence the mobility of hybridizing bands and molecular weight estamates. Therefore, W-14 was included as a standard on all Southern blots.

Gene specific probes derived from the W-14 toxin genes were used in these hybridizations. The following lists the specific coordinates within each gene sequence to which the probe corresponds. A probe specific for tcaB i /B ii : 1174 to 3642 of Sequence ID #25, a probe specific for tcaC: 3637 to 6005 of Sequence ID #25, a probe specific for tcbA: 2097 to 4964 of Sequence ID #11, and a probe specific for tcda: 1660 to 4191 of sequence ID #46. The following tables summarize Southern Blot analyses of Photorhabdus strains. In the event that hybridization of probes occurred, the hybridized fragment(s) were noted as either identical or different from the pattern observed for the W-14 strain.

TABLE 37
Southern Analysis of Photorhabdus Strains
	Strains	tcdA	tcbA	tcaC	tcaB i/ii
	WX-1	D	D	D	D
	WX-2	D	D	−	D
	WX-3	D	D	D	D
	WX-4	D	D	ND	D
	WX-5	D	D	D	D
	WX-6	D	D	D	D
	WX-7	D	D	ND	D
	WX-8	D	D	D	D
	WX-9	ND	D	D	D
	WX-10	ND	D	D	D
	WX-11	ND	D	D	D
	WX-12	D	D	D	D
	WX-14	D	D	D	D
	WX-15	D	D	D	D
	HP88	D	−	D	D
	Hm	D	−	D	D
	Hb	D	−	D	−
	H9	D	−	I	D
	B2	D	−	D	−
	NC-1	D	−	D	D
	WIR	D	−	D	D
	W30	D	D	D	D
	W-14	I	I	I	I
	ND = Not determined; − = no detectable hybridization product; I = Identical fragment pattern; D = Different fragment pattern.

TABLE 38
Southern Analysis of Photorhabdus Strains
	Strains	tcdA	tcbA	tcaC	tcaB i/ii
	K-122	3.3, 2.8	D	−	ND
	PWH-5	+	D	D	−
	Indicus	D	D	3.0	I
	Megidis	D	D	D	−
	GD	D	D	D	−
	HF-85	D	D	D	−
	MP 3	D	−	D	−
	MP 1	D	+	D	−
	A. Cows	D	+	D	−
	HB-Arg	D	ND	D	−
	HMGD	D	D	D	−
	HB Lewiston	D	D	D	−
	HB Oswego	D	D	D	−
	W-14	I	I	I	I
	ND = Not determined; − = no detectable hybridization product; I = Identical fragment pattern; D = Different fragment pattern.
	+ = Hybridization fragment pattern not determined.

TABLE 39
Southern Analysis of Photorhabdus Strains
	Strains	tcdA	tcbA	tcaC	tcaB i/ii
	GL98	+	+	D
	GL101	−	+	D
	GL138	−	+	D
	GL155	−	−	−
	GL217	+	−	D
	GL257	+	+	D
	MP4	−	+	−
	MP5	−	−	−
	P. hepialus	+	−	D
	P. zealandia	+	−	11.0
	DEP1
	DEP2
	DEP3
	W-14	3.8, 2.8	2.8	2.8
	ND = Not determined; − = no detectable hybridization product; I = Identical fragment pattern; D = Different fragment pattern.
	+ = Hybridization fragment pattern not determined.

From these analyses it is apparent that homologs of W-14 genes are dispersed throughout these diverse Photorhabdus strains, as evidenced by differences in gene fragment sizes between W-14 and the other strains.

EXAMPLE 25

N-Terminal Amino Acid Sequences of Toxin Complex Peptides from Different Photorhabdus Strains

The relationship of peptides isolated from different Photorhabdus strains, as described in Example 14, were subjected to N-terminal amino acid sequencing. The N-terminal amino acid sequences of toxin peptides in several strains were compared to W-14 toxin peptides. In Table 40, a comparison of toxin peptides compared to date showed that identical or homologous (at least 40% similarity to W14 gene/peptides) toxin peptides were present in all of the strains. For example, the N-terminal amino acid sequence of TcaC, SEQ ID NO: 2, was found to be identical to that for 160 kDa peptide in HP88 but also homologs were present in strains WIR, H9, Hb, WX-1, and Hm. Some W-14 peptides or homologs have not been observed in other strains; however, not all peptides have been sequenced for toxin complexes from other strains due to N-terminal blockage or low abundance. In addition, many other N-terminal amino acid sequences (SEQ ID NOS: 82 to 88) have been obtained for toxin complex peptides from other strains that have no similarity to peptides from W-14 and in some case were identical to each other. For example, an identical amino acid sequence, SEQ ID NO: 82, was obtained for 64 kDa peptide present in both HP88 and Hb strains and a homologous sequence for a 70 kDa peptide in NC-1 strain (SEQ ID NO: 83).

TABLE 40
A Comparison of Amino Terminal Sequence Homology Between
Proteins Isolated From Non-W-14 Strains
W-14	W-14	W-14	SEQ ID
Peptide	Gene	SEQ ID	NO:	Strain	Identical	Homology
TcaAii	tcaA	15
TcaAiii	tcaA	4
TcaBi	tcaB	3	76	H9	—	74 kDa
			76	Hm	—	71 kDa
TcaBii	tcaB	5		H9	61 kDa	—
				Hm	61 kDa	—
TcaC	tcaA	2	72	Hb	—	160 kDa
				HP88	160 kDa	—
			73	WIR	—	170 kDa
			74	H9	—	180 kDa
			75	Hm	—	170 kDa
			80	WX-1	—	170 kDa
TcbAii	tcbA	1
TcbAiii	tcbA	40
TccA	tccA	8	77	Hb	—	81 kDa
TccB	tccB	7		WX-1	170 kDa	—
				WX-2	180 kDa	—
				WX-14	180 kDa	—
				WIR	170 kDa	—
			78	H9	—	170 kDa
				NC-1	140 kDa	—
			79	Hm	—	190 kDa
TcdAii	tcdA
TcdAiii	tcdA	41		Hb	57 kDa	—
			81	H9	—	69 kDa
?	?	9		Hb	86 kDa	—
				HP88	86 kDa	—
Homology refers to amino acid sequences that were at least 40% similarity to W14 gene/peptides. Similar residues were identified as being a member in one of the following five groups: (P, A, G, S, T); (Q, N, E, B, D, Z); (H, K, R); (L, I, V, M); and (F, Y, W).

EXAMPLE 26

Immunological Analysis of Photorhabdus Strains

Culture broths of Photorhabdus strains were concentrated 10 to 15 times using Centriprep-10 ultrafiltration device (amicon, Inc. Beverly, Mass. 01915). The concentration of the protein ranges from 0.3 to 3.0 mg per ml. Ten to 20 μg of total protein was loaded in each well of a precast 4-20% polyacrylamide gel (Integrated Separation Systems, Natick, Mass. 01760). Gel electrophoresis was performed for 1.25 hours using a constant current set at 25 ma per gel. The gel was electro-blotted on to Hybond-ECL™ nitrocellulose membrane (Amersham Corporation, Arlington Hts, Ill. 60005) using a semi-dry electro-blotter (Pharmacia Biotech Inc., Piscataway , N.J. 08854). A constant current was applied at 0.75 ma per cm for 2.5 hours. The membrane was blocked with 10% milk in TBST (25 mM Tris HCl pH 7.4, 136 mM NaCl, 2.7 mM KCl, 0.1% Tween 20) for one hour at room temperature. Each primary antibody was diluted in 10% milk/TBST to 1:500. Other dilution between 1:50 to 1:1000 was also used. The membrane was incubated in primary antibody for at least one hour. Then it was washed thoroughly with the blocking solution or TBST. A 1:2000 dilution of secondary antibodies (goat anti-mouse IgG or goat anti rabbit TgG conjugated to horseradish peroxidase; BioRad Laboratories, Hercules, Calif. 94547) in 10% milk/TBST was applied to the membrane which was placed on a platform rocker for one hour. The membrane was subsequently washed with excess amount of TBST. The detection of the protein was performed by using an ECL (Enhanced Chemiluminescence) detection kit (Amersham International).

A panel of peptide specific-antibodies generated against W-14 peptides were used to characterize the protein composition of broths from nine non-W-14 Photorhabdus strains using Western blot analysis. In addition, one monoclonal antibody (MAb-C5F2) which recognizes TcbA iii protein in W-14-derived toxin complex was used. The results (Table 39) showed cross recognition of the antibodies to some of the proteins in these broths. In some cases, the proteins that were recognized by the antibodies were the same size as the W-14 target peptides. In other cases, the proteins that were recognized by the antibodies were smaller than the W-14 target peptides. This data indicate that some of the non-W-14 Photorhabdus strains may produce similar proteins to the W-14 strain. The difference could be due to deletion or protein processing or degradation process. Some of the strains did not contain protein(s) that could be recognized by some antibodies, however, it is possible that the concentration is significantly lower than those observed for W-14 peptides. When compared for various toxin peptide homologs these results showed peptide diversity among the Photorhabdus strains.

TABLE 41
Cross Recognition by Monoclonal Antibodies or Polyclonal Antibodies
Generated Against W−14 Peptides to Protein(s) in Broths of Selected Non-W-14 Photorhabdus
Photo-		PAb	PAb		PAb-	PAb	PAb	PAb	PAb
rhadbus	MAb	TcdAii-	TcdAiii-	TcaC-	TcaBii-	TcbAiii-	TcaBi-	TcaAii-	TcaAiii-
Strain	C5F2	syn	syn	syn	syn	syn	syn	syn	syn
MP1	−	+	+	+	−	+	+	+	+
MP2	+	+	+	+	−	+	+	+	+
MP3	−	+	+	+	−	NT	+	+	−
A. Cows	−	+	+	+	−	NT	+	+	+
Hb-osw	−	−	NT	+	+	NT	+	+	+
H-Arg	−	+	+	+	−	NT	+	+	+
Hb-leu	−	+	+	+	−	NT	+	+	+
Indicus	+	+	+	+	+	NT	+	+	+
HF85	−	+	+	+	−	+	+	+	+
W-14	+	+	+	+	+	+	+	+	+
+: Positive reaction; −: Negative reaction; NT: Not Tested

Additional non-W-14 Photorhabdus strains were characterized by Western blot analysis using the culture broth and/or partial purified protein fractions as antigen. The panel of antibodies include MAb-C5F2, MAb-DE1 (recognizing TcdA ii ), Pab-DE2 (recognizing TcaB), Pab-TcbA ii -syn, Pab-TcaC-syn, Pab TcaB ii -syn, Pab-TcbA iii -syn, Pab-TcaB i -syn. These antibodies showed cross-reactivity with proteins in the broth and in the partial purified fractions of non-W-14 strains.

The data indicate that antibodies could be used to identify proteins in the broth as well as in the partially purified protein fractions.

TABLE 42
Cross Recognition by Monoclonal Antibodies or Plyclonal Antibodies
Generated Against W-14 Peptides to Protein(s) in Broths and/or
Partial Purified Protein Fractions of Selected Non-W14 Photorhabdus
	Monoclonal	Polyclonal Antibodies
Photo-	Antibodies		PAb	PAb	PAb	PAb-	PAb-
rhabdus	Mab	Mab-	PAb-	TcbA ii -	TcaC-	TcaB ii -	TcbA iii -	TcaB i -
Strain	C5F2	DE1	DE2	syn	syn	syn	syn	syn
WX-1	+	+	+	+	+	+	+	+
WX-2	+	+	+	+	+	+	NT	+
WX-3	+	NT	+	NT	NT	NT	NT	NT
WX-5	+	NT	+	NT	NT	NT	NT	NT
WX-6	+	NT	NT	NT	NT	NT	NT	NT
WX-7	+	+	+	+	+	+	NT	+
WX-8	+	NT	NT	NT	NT	NT	NT	NT
WX-9	+	NT	NT	NT	NT	NT	NT	NT
WX-10	+	NT	NT	NT	NT	NT	NT	NT
WX-12	+	+	+	+	+	+	+	+
WX-14	+	+	+	+	NT	+	NT	+
WX-15	+	NT	NT	NT	NT	NT	NT	NT
W30	+	+	+	NT	NT	NT	NT	NT
Hb	−	NT	+	NT	+	NT	−	+
H9	−	−	+	NT	+	+	NT	NT
Hm	−	NT	+	+	+	+	NT	++
HP88	−	NT	+	−	+	−	−	+
NC-1	+	−	+	+	+	+	NT	+
WIR	−	NT	+	+	+	+	+	+
W-14	+	+	+	+	+	+	+	+
−: Negative reaction; +: Positive reaction; NT: Not tested

EXAMPLE 27

Bacterial Expression of the tcdA Coding Region

Engineering of the tcdA Gene for Bacterial Expression

The 5′ and 3′ ends of the tcdA coding region (SEQ ID NO:46) were modified to add useful cloning sites for inserting the segment into heterologous expression vectors. The ends were modified using unique primers in Polymerase Chain Reactions (PCR), performed essentially as described in Example 8. Primer sets, as described below, were used in conjunction with cosmid 21D2.4 as template, to created products with the appropriately modified ends.

The first primer set was used to modify the 5′ end of the gene, to insert a unique Nco I site at the initiator codon using the forward primer A0F1 (5′ GAT CGA TCG ATC CAT GGC CAA CGA GTC TGT AAA AGA GAT ACC TGA TG TAT TAA AAA GCC AGT GTG 3′) and to add unique Bgl II, Sal I and Not I sites to facilitate insertion of the remainder of the gene using the reverse primer A0R1 (5′ GAT CGA TCG TAC GCG GCC GCT CGA TCG ATC GTC GAC CCA TTG ATT TGA GAT CTG GGC GGC GGG TAT CCA GAT AAT AAA CGG AGT CAC 3′).

Another PCR reaction was designed to modify the 3′ end of the gene by adding an additional stop codon and convenient restriction sites for cloning. The forward primer A0F2 (5′ ACT GGC TGC GTG GTC GAC TGG CGG CGA TTT ACT 3′) was used to amplify across a unique Sal I site in the gene, later used to clone the modified 3′ end. The reverse primer A0R2 (5′ CGA TGC ATG CTG CGG CCG CAG GCC TTC CTC GAG TCA TTA TTT AAT GGT GTA GCG AAT ATG CAA AAT 3′) was used to insert a second stop codon (TGA) and cloning sites Xho I, Stu I and Not I. Bacterial expression vector pET27b (Novagen, Madison, Wis.), was modified to delete the Bgl II site at position 446, according to standard molecular biology techniques.

The 497 bp PCR product from the first amplification reaction (AOF1+AOR1), to modify the 5′ end of the gene, was ligated to the modified pET27b vector according to the supplier's instructions. The DNA sequences of the amplified portion of three isolates were determined using the supplier's recommended primers and the sequencing methods described previously. The sequence of all isolates was the same.

One isolate was then used as a cloning vector to insert the middle portion of the tcdA gene on a 6341 bp Bgl II to Sal I fragment. The resulting clone was called MC4 and contained all but the 3′ most portion of the tcdA coding sequence. Finally, to complete the full-length coding region, the 832 bp PCR product from the second PCR amplification (AOF2+AOR2), to modify the 3′ end of the gene, was ligated to isolate MC4 on a Sal I to Not I fragment, according to standard molecular biology techniques. The tcda coding region was sequenced and found to be complete, the resulting plasmid is called pDAB2035.

Construction of Plasmids pDAB2036, pDAB2037 and pDAB2038 for Bacterial Expression of tcdA

The tcdA coding region was cut from plasmid pDAB2035 with restriction enzymes Nco I and Xho I and gel purified. The fragment was ligated into the Nco I and Xho I sites of the expression vector pET15 to create plasmid pDAB2036. Additionally, pDAB2035 was cut with Nco I and Not I to release the tcdA coding region which was ligated into the Nco I and Not I sites of the expression vector pET28b to create plasmid pDAB2037. Finally, plasmid pDAB2035 was cut with Nco I and Stu I to release the tcdA coding region. This fragment was ligated into the expression vector Trc99a which was cut with Hind III followed by treatment with T4 DNA polymerase to blunt the ends. The vector was then cut with Nco I and ligated with the Nco I/Stu I cut tcdA fragment. The resulting plasmid is called pDAB2038.

Expression of tcdA from Plasmid pDAB2038

Plasmid pDAB2038 was transformed into BL21 cells and expressed as described above for plasmid pDAB2033 in Example 19.

Purification of tcdA from E. coli

The expression culture was centrifuged at 10,300 g for 30 min and the supernatant was collected. It was diluted with two volumes of H 2 O and applied at a flow rate of 7.5 ml/min to a poros 50 HQ (Perspective Systems, Mass.) column (1.6 cm×10 cm) which was pre-equilibrated with 10 mM sodium phosphate buffer, pH 7.0 (Buffer A). The column was washed with Buffer A until the optical density at 280 nm returned to baseline level. The proteins bound to the column were then eluted with 1M NaCl in Buffer A.

The fraction was loaded in 20 ml aliquots onto a gel filtration column, Sepharose CL-4B (2.6×100 cm), which was equilibrated with Buffer A. The protein was eluted in Buffer A at a flow rate of 0.75 mL/min. Fractions with a retention time between 260 minutes and 460 minutes were pooled and applied at 1 mL/min to a Mono Q 5/5 column which was equilibrated with 20 mM Tris-HCl, pH 7.0 (Buffer B). The column was washed with Buffer B until the optical density at 280 nm returned to baseline level. The proteins bound to the column were eluted with a linear gradient of 0 to 1 M NaCl in Buffer B at 1 mL/min for 30 min. One milliliter fractions were collected, serial diluted, and subjected to SCR bioassay. Fractions eluted out between 0.1 and 0.3 M NaCl were found to have the highest insecticidal activity. Western analysis of the active fractions using pAb TcdA ii -syn antibody and pAb Tcd iii -syn antibody indicated the presence of peptides TcdA ii and TcdA iii .

88 11 amino acids amino acid linear protein N-terminal 1Phe Ile Gln Gly Tyr Ser Asp Leu Phe Gly Asn1 5 10 12 amino acids amino acid linear protein N-terminal 2Met Gln Asp Ser Pro Glu Val Ser Ile Thr Thr Trp1 5 10 19 amino acids amino acid linear protein N-terminal 3Ser Glu Ser Leu Phe Thr Gln Thr Leu Lys Glu Ala Arg Arg Asp Ala1 5 10 15Leu Val Ala 14 amino acids amino acid linear protein N-terminal 4Ala Ser Pro Leu Ser Thr Ser Glu Leu Thr Ser Lys Leu Asn1 5 10 9 amino acids amino acid linear protein N-terminal 5Ala Gly Asp Thr Ala Asn Ile Gly Asp1 5 15 amino acids amino acid single linear protein N-terminal 6Leu Gly Gly Ala Ala Thr Leu Leu Asp Leu Leu Leu Pro Gln Ile1 5 10 15 11 amino acids amino acid linear protein N-terminal 7Met Leu Ser Thr Met Glu Lys Gln Leu Asn Glu1 5 10 9 amino acids amino acid linear protein N-terminal 8Met Asn Leu Ala Ser Pro Leu Ile Ser1 5 16 amino acids amino acid linear protein N-terminal 9Met Ile Asn Leu Asp Ile Asn Glu Gln Asn Lys Ile Met Val Val Ser1 5 10 15 20 amino acids amino acid linear protein N-terminal 10Ala Ala Lys Asp Val Lys Phe Gly Ser Asp Ala Arg Val Lys Met Leu1 5 10 15Arg Gly Val Asn 20 7515 base pairs nucleic acid double linear DNA (genomic) CDS 1..7515 11ATG CAA AAC TCA TTA TCA AGC ACT ATC GAT ACT ATT TGT CAG AAA CTG 48Met Gln Asn Ser Leu Ser Ser Thr Ile Asp Thr Ile Cys Gln Lys Leu1 5 10 15CAA TTA ACT TGT CCG GCG GAA ATT GCT TTG TAT CCC TTT GAT ACT TTC 96Gln Leu Thr Cys Pro Ala Glu Ile Ala Leu Tyr Pro Phe Asp Thr Phe 20 25 30CGG GAA AAA ACT CGG GGA ATG GTT AAT TGG GGG GAA GCA AAA CGG ATT 144Arg Glu Lys Thr Arg Gly Met Val Asn Trp Gly Glu Ala Lys Arg Ile 35 40 45TAT GAA ATT GCA CAA GCG GAA CAG GAT AGA AAC CTA CTT CAT GAA AAA 192Tyr Glu Ile Ala Gln Ala Glu Gln Asp Arg Asn Leu Leu His Glu Lys 50 55 60CGT ATT TTT GCC TAT GCT AAT CCG CTG CTG AAA AAC GCT GTT CGG TTG 240Arg Ile Phe Ala Tyr Ala Asn Pro Leu Leu Lys Asn Ala Val Arg Leu65 70 75 80GGT ACC CGG CAA ATG TTG GGT TTT ATA CAA GGT TAT AGT GAT CTG TTT 288Gly Thr Arg Gln Met Leu Gly Phe Ile Gln Gly Tyr Ser Asp Leu Phe 85 90 95GGT AAT CGT GCT GAT AAC TAT GCC GCG CCG GGC TCG GTT GCA TCG ATG 336Gly Asn Arg Ala Asp Asn Tyr Ala Ala Pro Gly Ser Val Ala Ser Met 100 105 110TTC TCA CCG GCG GCT TAT TTG ACG GAA TTG TAC CGT GAA GCC AAA AAC 384Phe Ser Pro Ala Ala Tyr Leu Thr Glu Leu Tyr Arg Glu Ala Lys Asn 115 120 125TTG CAT GAC AGC AGC TCA ATT TAT TAC CTA GAT AAA CGT CGC CCG GAT 432Leu His Asp Ser Ser Ser Ile Tyr Tyr Leu Asp Lys Arg Arg Pro Asp 130 135 140TTA GCA AGC TTA ATG CTC AGC CAG AAA AAT ATG GAT GAG GAA ATT TCA 480Leu Ala Ser Leu Met Leu Ser Gln Lys Asn Met Asp Glu Glu Ile Ser145 150 155 160ACG CTG GCT CTC TCT AAT GAA TTG TGC CTT GCC GGG ATC GAA ACA AAA 528Thr Leu Ala Leu Ser Asn Glu Leu Cys Leu Ala Gly Ile Glu Thr Lys 165 170 175ACA GGA AAA TCA CAA GAT GAA GTG ATG GAT ATG TTG TCA ACT TAT CGT 576Thr Gly Lys Ser Gln Asp Glu Val Met Asp Met Leu Ser Thr Tyr Arg 180 185 190TTA AGT GGA GAG ACA CCT TAT CAT CAC GCT TAT GAA ACT GTT CGT GAA 624Leu Ser Gly Glu Thr Pro Tyr His His Ala Tyr Glu Thr Val Arg Glu 195 200 205ATC GTT CAT GAA CGT GAT CCA GGA TTT CGT CAT TTG TCA CAG GCA CCC 672Ile Val His Glu Arg Asp Pro Gly Phe Arg His Leu Ser Gln Ala Pro 210 215 220ATT GTT GCT GCT AAG CTC GAT CCT GTG ACT TTG TTG GGT ATT AGC TCC 720Ile Val Ala Ala Lys Leu Asp Pro Val Thr Leu Leu Gly Ile Ser Ser225 230 235 240CAT ATT TCG CCA GAA CTG TAT AAC TTG CTG ATT GAG GAG ATC CCG GAA 768His Ile Ser Pro Glu Leu Tyr Asn Leu Leu Ile Glu Glu Ile Pro Glu 245 250 255AAA GAT GAA GCC GCG CTT GAT ACG CTT TAT AAA ACA AAC TTT GGC GAT 816Lys Asp Glu Ala Ala Leu Asp Thr Leu Tyr Lys Thr Asn Phe Gly Asp 260 265 270ATT ACT ACT GCT CAG TTA ATG TCC CCA AGT TAT CTG GCC CGG TAT TAT 864Ile Thr Thr Ala Gln Leu Met Ser Pro Ser Tyr Leu Ala Arg Tyr Tyr 275 280 285GGC GTC TCA CCG GAA GAT ATT GCC TAC GTG ACG ACT TCA TTA TCA CAT 912Gly Val Ser Pro Glu Asp Ile Ala Tyr Val Thr Thr Ser Leu Ser His 290 295 300GTT GGA TAT AGC AGT GAT ATT CTG GTT ATT CCG TTG GTC GAT GGT GTG 960Val Gly Tyr Ser Ser Asp Ile Leu Val Ile Pro Leu Val Asp Gly Val305 310 315 320GGT AAG ATG GAA GTA GTT CGT GTT ACC CGA ACA CCA TCG GAT AAT TAT 1008Gly Lys Met Glu Val Val Arg Val Thr Arg Thr Pro Ser Asp Asn Tyr 325 330 335ACC AGT CAG ACG AAT TAT ATT GAG CTG TAT CCA CAG GGT GGC GAC AAT 1056Thr Ser Gln Thr Asn Tyr Ile Glu Leu Tyr Pro Gln Gly Gly Asp Asn 340 345 350TAT TTG ATC AAA TAC AAT CTA AGC AAT AGT TTT GGT TTG GAT GAT TTT 1104Tyr Leu Ile Lys Tyr Asn Leu Ser Asn Ser Phe Gly Leu Asp Asp Phe 355 360 365TAT CTG CAA TAT AAA GAT GGT TCC GCT GAT TGG ACT GAG ATT GCC CAT 1152Tyr Leu Gln Tyr Lys Asp Gly Ser Ala Asp Trp Thr Glu Ile Ala His 370 375 380AAT CCC TAT CCT GAT ATG GTC ATA AAT CAA AAG TAT GAA TCA CAG GCG 1200Asn Pro Tyr Pro Asp Met Val Ile Asn Gln Lys Tyr Glu Ser Gln Ala385 390 395 400ACA ATC AAA CGT AGT GAC TCT GAC AAT ATA CTC AGT ATA GGG TTA CAA 1248Thr Ile Lys Arg Ser Asp Ser Asp Asn Ile Leu Ser Ile Gly Leu Gln 405 410 415AGA TGG CAT AGC GGT AGT TAT AAT TTT GCC GCC GCC AAT TTT AAA ATT 1296Arg Trp His Ser Gly Ser Tyr Asn Phe Ala Ala Ala Asn Phe Lys Ile 420 425 430GAC CAA TAC TCC CCG AAA GCT TTC CTG CTT AAA ATG AAT AAG GCT ATT 1344Asp Gln Tyr Ser Pro Lys Ala Phe Leu Leu Lys Met Asn Lys Ala Ile 435 440 445CGG TTG CTC AAA GCT ACC GGC CTC TCT TTT GCT ACG TTG GAG CGT ATT 1392Arg Leu Leu Lys Ala Thr Gly Leu Ser Phe Ala Thr Leu Glu Arg Ile 450 455 460GTT GAT AGT GTT AAT AGC ACC AAA TCC ATC ACG GTT GAG GTA TTA AAC 1440Val Asp Ser Val Asn Ser Thr Lys Ser Ile Thr Val Glu Val Leu Asn465 470 475 480AAG GTT TAT CGG GTA AAA TTC TAT ATT GAT CGT TAT GGC ATC AGT GAA 1488Lys Val Tyr Arg Val Lys Phe Tyr Ile Asp Arg Tyr Gly Ile Ser Glu 485 490 495GAG ACA GCC GCT ATT TTG GCT AAT ATT AAT ATC TCT CAG CAA GCT GTT 1536Glu Thr Ala Ala Ile Leu Ala Asn Ile Asn Ile Ser Gln Gln Ala Val 500 505 510GGC AAT CAG CTT AGC CAG TTT GAG CAA CTA TTT AAT CAC CCG CCG CTC 1584Gly Asn Gln Leu Ser Gln Phe Glu Gln Leu Phe Asn His Pro Pro Leu 515 520 525AAT GGT ATT CGC TAT GAA ATC AGT GAG GAC AAC TCC AAA CAT CTT CCT 1632Asn Gly Ile Arg Tyr Glu Ile Ser Glu Asp Asn Ser Lys His Leu Pro 530 535 540AAT CCT GAT CTG AAC CTT AAA CCA GAC AGT ACC GGT GAT GAT CAA CGC 1680Asn Pro Asp Leu Asn Leu Lys Pro Asp Ser Thr Gly Asp Asp Gln Arg545 550 555 560AAG GCG GTT TTA AAA CGC GCG TTT CAG GTT AAC GCC AGT GAG TTG TAT 1728Lys Ala Val Leu Lys Arg Ala Phe Gln Val Asn Ala Ser Glu Leu Tyr 565 570 575CAG ATG TTA TTG ATC ACT GAT CGT AAA GAA GAC GGT GTT ATC AAA AAT 1776Gln Met Leu Leu Ile Thr Asp Arg Lys Glu Asp Gly Val Ile Lys Asn 580 585 590AAC TTA GAG AAT TTG TCT GAT CTG TAT TTG GTT AGT TTG CTG GCC CAG 1824Asn Leu Glu Asn Leu Ser Asp Leu Tyr Leu Val Ser Leu Leu Ala Gln 595 600 605ATT CAT AAC CTG ACT ATT GCT GAA TTG AAC ATT TTG TTG GTG ATT TGT 1872Ile His Asn Leu Thr Ile Ala Glu Leu Asn Ile Leu Leu Val Ile Cys 610 615 620GGC TAT GGC GAC ACC AAC ATT TAT CAG ATT ACC GAC GAT AAT TTA GCC 1920Gly Tyr Gly Asp Thr Asn Ile Tyr Gln Ile Thr Asp Asp Asn Leu Ala625 630 635 640AAA ATA GTG GAA ACA TTG TTG TGG ATC ACT CAA TGG TTG AAG ACC CAA 1968Lys Ile Val Glu Thr Leu Leu Trp Ile Thr Gln Trp Leu Lys Thr Gln 645 650 655AAA TGG ACA GTT ACC GAC CTG TTT CTG ATG ACC ACG GCC ACT TAC AGC 2016Lys Trp Thr Val Thr Asp Leu Phe Leu Met Thr Thr Ala Thr Tyr Ser 660 665 670ACC ACT TTA ACG CCA GAA ATT AGC AAT CTG ACG GCT ACG TTG TCT TCA 2064Thr Thr Leu Thr Pro Glu Ile Ser Asn Leu Thr Ala Thr Leu Ser Ser 675 680 685ACT TTG CAT GGC AAA GAG AGT CTG ATT GGG GAA GAT CTG AAA AGA GCA 2112Thr Leu His Gly Lys Glu Ser Leu Ile Gly Glu Asp Leu Lys Arg Ala 690 695 700ATG GCG CCT TGC TTC ACT TCG GCT TTG CAT TTG ACT TCT CAA GAA GTT 2160Met Ala Pro Cys Phe Thr Ser Ala Leu His Leu Thr Ser Gln Glu Val705 710 715 720GCG TAT GAC CTG CTG TTG TGG ATA GAC CAG ATT CAA CCG GCA CAA ATA 2208Ala Tyr Asp Leu Leu Leu Trp Ile Asp Gln Ile Gln Pro Ala Gln Ile 725 730 735ACT GTT GAT GGG TTT TGG GAA GAA GTG CAA ACA ACA CCA ACC AGC TTG 2256Thr Val Asp Gly Phe Trp Glu Glu Val Gln Thr Thr Pro Thr Ser Leu 740 745 750AAG GTG ATT ACC TTT GCT CAG GTG CTG GCA CAA TTG AGC CTG ATC TAT 2304Lys Val Ile Thr Phe Ala Gln Val Leu Ala Gln Leu Ser Leu Ile Tyr 755 760 765CGT CGT ATT GGG TTA AGT GAA ACG GAA CTG TCA CTG ATC GTG ACT CAA 2352Arg Arg Ile Gly Leu Ser Glu Thr Glu Leu Ser Leu Ile Val Thr Gln 770 775 780TCT TCT CTG CTA GTG GCA GGC AAA AGC ATA CTG GAT CAC GGT CTG TTA 2400Ser Ser Leu Leu Val Ala Gly Lys Ser Ile Leu Asp His Gly Leu Leu785 790 795 800ACC CTG ATG GCC TTG GAA GGT TTT CAT ACC TGG GTT AAT GGC TTG GGG 2448Thr Leu Met Ala Leu Glu Gly Phe His Thr Trp Val Asn Gly Leu Gly 805 810 815CAA CAT GCC TCC TTG ATA TTG GCG GCG TTG AAA GAC GGA GCC TTG ACA 2496Gln His Ala Ser Leu Ile Leu Ala Ala Leu Lys Asp Gly Ala Leu Thr 820 825 830GTT ACC GAT GTA GCA CAA GCT ATG AAT AAG GAG GAA TCT CTC CTA CAA 2544Val Thr Asp Val Ala Gln Ala Met Asn Lys Glu Glu Ser Leu Leu Gln 835 840 845ATG GCA GCT AAT CAG GTG GAG AAG GAT CTA ACA AAA CTG ACC AGT TGG 2592Met Ala Ala Asn Gln Val Glu Lys Asp Leu Thr Lys Leu Thr Ser Trp 850 855 860ACA CAG ATT GAC GCT ATT CTG CAA TGG TTA CAG ATG TCT TCG GCC TTG 2640Thr Gln Ile Asp Ala Ile Leu Gln Trp Leu Gln Met Ser Ser Ala Leu865 870 875 880GCG GTT TCT CCA CTG GAT CTG GCA GGG ATG ATG GCC CTG AAA TAT GGG 2688Ala Val Ser Pro Leu Asp Leu Ala Gly Met Met Ala Leu Lys Tyr Gly 885 890 895ATA GAT CAT AAC TAT GCT GCC TGG CAA GCT GCG GCG GCT GCG CTG ATG 2736Ile Asp His Asn Tyr Ala Ala Trp Gln Ala Ala Ala Ala Ala Leu Met 900 905 910GCT GAT CAT GCT AAT CAG GCA CAG AAA AAA CTG GAT GAG ACG TTC AGT 2784Ala Asp His Ala Asn Gln Ala Gln Lys Lys Leu Asp Glu Thr Phe Ser 915 920 925AAG GCA TTA TGT AAC TAT TAT ATT AAT GCT GTT GTC GAT AGT GCT GCT 2832Lys Ala Leu Cys Asn Tyr Tyr Ile Asn Ala Val Val Asp Ser Ala Ala 930 935 940GGA GTA CGT GAT CGT AAC GGT TTA TAT ACC TAT TTG CTG ATT GAT AAT 2880Gly Val Arg Asp Arg Asn Gly Leu Tyr Thr Tyr Leu Leu Ile Asp Asn945 950 955 960CAG GTT TCT GCC GAT GTG ATC ACT TCA CGT ATT GCA GAA GCT ATC GCC 2928Gln Val Ser Ala Asp Val Ile Thr Ser Arg Ile Ala Glu Ala Ile Ala 965 970 975GGT ATT CAA CTG TAC GTT AAC CGG GCT TTA AAC CGA GAT GAA GGT CAG 2976Gly Ile Gln Leu Tyr Val Asn Arg Ala Leu Asn Arg Asp Glu Gly Gln 980 985 990CTT GCA TCG GAC GTT AGT ACC CGT CAG TTC TTC ACT GAC TGG GAA CGT 3024Leu Ala Ser Asp Val Ser Thr Arg Gln Phe Phe Thr Asp Trp Glu Arg 995 1000 1005TAC AAT AAA CGT TAC AGT ACT TGG GCT GGT GTC TCT GAA CTG GTC TAT 3072Tyr Asn Lys Arg Tyr Ser Thr Trp Ala Gly Val Ser Glu Leu Val Tyr 1010 1015 1020TAT CCA GAA AAC TAT GTT GAT CCC ACT CAG CGC ATT GGG CAA ACC AAA 3120Tyr Pro Glu Asn Tyr Val Asp Pro Thr Gln Arg Ile Gly Gln Thr Lys1025 1030 1035 1040ATG ATG GAT GCG CTG TTG CAA TCC ATC AAC CAG AGC CAG CTA AAT GCG 3168Met Met Asp Ala Leu Leu Gln Ser Ile Asn Gln Ser Gln Leu Asn Ala 1045 1050 1055GAT ACG GTG GAA GAT GCT TTC AAA ACT TAT TTG ACC AGC TTT GAG CAG 3216Asp Thr Val Glu Asp Ala Phe Lys Thr Tyr Leu Thr Ser Phe Glu Gln 1060 1065 1070GTA GCA AAT CTG AAA GTA ATT AGT GCT TAC CAC GAT AAT GTG AAT GTG 3264Val Ala Asn Leu Lys Val Ile Ser Ala Tyr His Asp Asn Val Asn Val 1075 1080 1085GAT CAA GGA TTA ACT TAT TTT ATC GGT ATC GAC CAA GCA GCT CCG GGT 3312Asp Gln Gly Leu Thr Tyr Phe Ile Gly Ile Asp Gln Ala Ala Pro Gly 1090 1095 1100ACG TAT TAC TGG CGT AGT GTT GAT CAC AGC AAA TGT GAA AAT GGC AAG 3360Thr Tyr Tyr Trp Arg Ser Val Asp His Ser Lys Cys Glu Asn Gly Lys1105 1110 1115 1120TTT GCC GCT AAT GCT TGG GGT GAG TGG AAT AAA ATT ACC TGT GCT GTC 3408Phe Ala Ala Asn Ala Trp Gly Glu Trp Asn Lys Ile Thr Cys Ala Val 1125 1130 1135AAT CCT TGG AAA AAT ATC ATC CGT CCG GTT GTT TAT ATG TCC CGC TTA 3456Asn Pro Trp Lys Asn Ile Ile Arg Pro Val Val Tyr Met Ser Arg Leu 1140 1145 1150TAT CTG CTA TGG CTG GAG CAG CAA TCA AAG AAA AGT GAT GAT GGT AAA 3504Tyr Leu Leu Trp Leu Glu Gln Gln Ser Lys Lys Ser Asp Asp Gly Lys 1155 1160 1165ACC ACG ATT TAT CAA TAT AAC TTA AAA CTG GCT CAT ATT CGT TAC GAC 3552Thr Thr Ile Tyr Gln Tyr Asn Leu Lys Leu Ala His Ile Arg Tyr Asp 1170 1175 1180GGT AGT TGG AAT ACA CCA TTT ACT TTT GAT GTG ACA GAA AAG GTA AAA 3600Gly Ser Trp Asn Thr Pro Phe Thr Phe Asp Val Thr Glu Lys Val Lys1185 1190 1195 1200AAT TAC ACG TCG AGT ACT GAT GCT GCT GAA TCT TTA GGG TTG TAT TGT 3648Asn Tyr Thr Ser Ser Thr Asp Ala Ala Glu Ser Leu Gly Leu Tyr Cys 1205 1210 1215ACT GGT TAT CAA GGG GAA GAC ACT CTA TTA GTT ATG TTC TAT TCG ATG 3696Thr Gly Tyr Gln Gly Glu Asp Thr Leu Leu Val Met Phe Tyr Ser Met 1220 1225 1230CAG AGT AGT TAT AGC TCC TAT ACC GAT AAT AAT GCG CCG GTC ACT GGG 3744Gln Ser Ser Tyr Ser Ser Tyr Thr Asp Asn Asn Ala Pro Val Thr Gly 1235 1240 1245CTA TAT ATT TTC GCT GAT ATG TCA TCA GAC AAT ATG ACG AAT GCA CAA 3792Leu Tyr Ile Phe Ala Asp Met Ser Ser Asp Asn Met Thr Asn Ala Gln 1250 1255 1260GCA ACT AAC TAT TGG AAT AAC AGT TAT CCG CAA TTT GAT ACT GTG ATG 3840Ala Thr Asn Tyr Trp Asn Asn Ser Tyr Pro Gln Phe Asp Thr Val Met1265 1270 1275 1280GCA GAT CCG GAT AGC GAC AAT AAA AAA GTC ATA ACC AGA AGA GTT AAT 3888Ala Asp Pro Asp Ser Asp Asn Lys Lys Val Ile Thr Arg Arg Val Asn 1285 1290 1295AAC CGT TAT GCG GAG GAT TAT GAA ATT CCT TCC TCT GTG ACA AGT AAC 3936Asn Arg Tyr Ala Glu Asp Tyr Glu Ile Pro Ser Ser Val Thr Ser Asn 1300 1305 1310AGT AAT TAT TCT TGG GGT GAT CAC AGT TTA ACC ATG CTT TAT GGT GGT 3984Ser Asn Tyr Ser Trp Gly Asp His Ser Leu Thr Met Leu Tyr Gly Gly 1315 1320 1325AGT GTT CCT AAT ATT ACT TTT GAA TCG GCG GCA GAA GAT TTA AGG CTA 4032Ser Val Pro Asn Ile Thr Phe Glu Ser Ala Ala Glu Asp Leu Arg Leu 1330 1335 1340TCT ACC AAT ATG GCA TTG AGT ATT ATT CAT AAT GGA TAT GCG GGA ACC 4080Ser Thr Asn Met Ala Leu Ser Ile Ile His Asn Gly Tyr Ala Gly Thr1345 1350 1355 1360CGC CGT ATA CAA TGT AAT CTT ATG AAA CAA TAC GCT TCA TTA GGT GAT 4128Arg Arg Ile Gln Cys Asn Leu Met Lys Gln Tyr Ala Ser Leu Gly Asp 1365 1370 1375AAA TTT ATA ATT TAT GAT TCA TCA TTT GAT GAT GCA AAC CGT TTT AAT 4176Lys Phe Ile Ile Tyr Asp Ser Ser Phe Asp Asp Ala Asn Arg Phe Asn 1380 1385 1390CTG GTG CCA TTG TTT AAA TTC GGA AAA GAC GAG AAC TCA GAT GAT AGT 4224Leu Val Pro Leu Phe Lys Phe Gly Lys Asp Glu Asn Ser Asp Asp Ser 1395 1400 1405ATT TGT ATA TAT AAT GAA AAC CCT TCC TCT GAA GAT AAG AAG TGG TAT 4272Ile Cys Ile Tyr Asn Glu Asn Pro Ser Ser Glu Asp Lys Lys Trp Tyr 1410 1415 1420TTT TCT TCG AAA GAT GAC AAT AAA ACA GCG GAT TAT AAT GGT GGA ACT 4320Phe Ser Ser Lys Asp Asp Asn Lys Thr Ala Asp Tyr Asn Gly Gly Thr1425 1430 1435 1440CAA TGT ATA GAT GCT GGA ACC AGT AAC AAA GAT TTT TAT TAT AAT CTC 4368Gln Cys Ile Asp Ala Gly Thr Ser Asn Lys Asp Phe Tyr Tyr Asn Leu 1445 1450 1455CAG GAG ATT GAA GTA ATT AGT GTT ACT GGT GGG TAT TGG TCG AGT TAT 4416Gln Glu Ile Glu Val Ile Ser Val Thr Gly Gly Tyr Trp Ser Ser Tyr 1460 1465 1470AAA ATA TCC AAC CCG ATT AAT ATC AAT ACG GGC ATT GAT AGT GCT AAA 4464Lys Ile Ser Asn Pro Ile Asn Ile Asn Thr Gly Ile Asp Ser Ala Lys 1475 1480 1485GTA AAA GTC ACC GTA AAA GCG GGT GGT GAC GAT CAA ATC TTT ACT GCT 4512Val Lys Val Thr Val Lys Ala Gly Gly Asp Asp Gln Ile Phe Thr Ala 1490 1495 1500GAT AAT AGT ACC TAT GTT CCT CAG CAA CCG GCA CCC AGT TTT GAG GAG 4560Asp Asn Ser Thr Tyr Val Pro Gln Gln Pro Ala Pro Ser Phe Glu Glu1505 1510 1515 1520ATG ATT TAT CAG TTC AAT AAC CTG ACA ATA GAT TGT AAG AAT TTA AAT 4608Met Ile Tyr Gln Phe Asn Asn Leu Thr Ile Asp Cys Lys Asn Leu Asn 1525 1530 1535TTC ATC GAC AAT CAG GCA CAT ATT GAG ATT GAT TTC ACC GCT ACG GCA 4656Phe Ile Asp Asn Gln Ala His Ile Glu Ile Asp Phe Thr Ala Thr Ala 1540 1545 1550CAA GAT GGC CGA TTC TTG GGT GCA GAA ACT TTT ATT ATC CCG GTA ACT 4704Gln Asp Gly Arg Phe Leu Gly Ala Glu Thr Phe Ile Ile Pro Val Thr 1555 1560 1565AAA AAA GTT CTC GGT ACT GAG AAC GTG ATT GCG TTA TAT AGC GAA AAT 4752Lys Lys Val Leu Gly Thr Glu Asn Val Ile Ala Leu Tyr Ser Glu Asn 1570 1575 1580AAC GGT GTT CAA TAT ATG CAA ATT GGC GCA TAT CGT ACC CGT TTG AAT 4800Asn Gly Val Gln Tyr Met Gln Ile Gly Ala Tyr Arg Thr Arg Leu Asn1585 1590 1595 1600ACG TTA TTC GCT CAA CAG TTG GTT AGC CGT GCT AAT CGT GGC ATT GAT 4848Thr Leu Phe Ala Gln Gln Leu Val Ser Arg Ala Asn Arg Gly Ile Asp 1605 1610 1615GCA GTG CTC AGT ATG GAA ACT CAG AAT ATT CAG GAA CCG CAA TTA GGA 4896Ala Val Leu Ser Met Glu Thr Gln Asn Ile Gln Glu Pro Gln Leu Gly 1620 1625 1630GCG GGC ACA TAT GTG CAG CTT GTG TTG GAT AAA TAT GAT GAG TCT ATT 4944Ala Gly Thr Tyr Val Gln Leu Val Leu Asp Lys Tyr Asp Glu Ser Ile 1635 1640 1645CAT GGC ACT AAT AAA AGC TTT GCT ATT GAA TAT GTT GAT ATA TTT AAA 4992His Gly Thr Asn Lys Ser Phe Ala Ile Glu Tyr Val Asp Ile Phe Lys 1650 1655 1660GAG AAC GAT AGT TTT GTG ATT TAT CAA GGA GAA CTT AGC GAA ACA AGT 5040Glu Asn Asp Ser Phe Val Ile Tyr Gln Gly Glu Leu Ser Glu Thr Ser1665 1670 1675 1680CAA ACT GTT GTG AAA GTT TTC TTA TCC TAT TTT ATA GAG GCG ACT GGA 5088Gln Thr Val Val Lys Val Phe Leu Ser Tyr Phe Ile Glu Ala Thr Gly 1685 1690 1695AAT AAG AAC CAC TTA TGG GTA CGT GCT AAA TAC CAA AAG GAA ACG ACT 5136Asn Lys Asn His Leu Trp Val Arg Ala Lys Tyr Gln Lys Glu Thr Thr 1700 1705 1710GAT AAG ATC TTG TTC GAC CGT ACT GAT GAG AAA GAT CCG CAC GGT TGG 5184Asp Lys Ile Leu Phe Asp Arg Thr Asp Glu Lys Asp Pro His Gly Trp 1715 1720 1725TTT CTC AGC GAC GAT CAC AAG ACC TTT AGT GGT CTC TCT TCC GCA CAG 5232Phe Leu Ser Asp Asp His Lys Thr Phe Ser Gly Leu Ser Ser Ala Gln 1730 1735 1740GCA TTA AAG AAC GAC AGT GAA CCG ATG GAT TTC TCT GGC GCC AAT GCT 5280Ala Leu Lys Asn Asp Ser Glu Pro Met Asp Phe Ser Gly Ala Asn Ala1745 1750 1755 1760CTC TAT TTC TGG GAA CTG TTC TAT TAC ACG CCG ATG ATG ATG GCT CAT 5328Leu Tyr Phe Trp Glu Leu Phe Tyr Tyr Thr Pro Met Met Met Ala His 1765 1770 1775CGT TTG TTG CAG GAA CAG AAT TTT GAT GCG GCG AAC CAT TGG TTC CGT 5376Arg Leu Leu Gln Glu Gln Asn Phe Asp Ala Ala Asn His Trp Phe Arg 1780 1785 1790TAT GTC TGG AGT CCA TCC GGT TAT ATC GTT GAT GGT AAA ATT GCT ATC 5424Tyr Val Trp Ser Pro Ser Gly Tyr Ile Val Asp Gly Lys Ile Ala Ile 1795 1800 1805TAC CAC TGG AAC GTG CGA CCG CTG GAA GAA GAC ACC AGT TGG AAT GCA 5472Tyr His Trp Asn Val Arg Pro Leu Glu Glu Asp Thr Ser Trp Asn Ala 1810 1815 1820CAA CAA CTG GAC TCC ACC GAT CCA GAT GCT GTA GCC CAA GAT GAT CCG 5520Gln Gln Leu Asp Ser Thr Asp Pro Asp Ala Val Ala Gln Asp Asp Pro1825 1830 1835 1840ATG CAC TAC AAG GTG GCT ACC TTT ATG GCG ACG TTG GAT CTG CTA ATG 5568Met His Tyr Lys Val Ala Thr Phe Met Ala Thr Leu Asp Leu Leu Met 1845 1850 1855GCC CGT GGT GAT GCT GCT TAC CGC CAG TTA GAG CGT GAT ACG TTG GCT 5616Ala Arg Gly Asp Ala Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Ala 1860 1865 1870GAA GCT AAA ATG TGG TAT ACA CAG GCG CTT AAT CTG TTG GGT GAT GAG 5664Glu Ala Lys Met Trp Tyr Thr Gln Ala Leu Asn Leu Leu Gly Asp Glu 1875 1880 1885CCA CAA GTG ATG CTG AGT ACG ACT TGG GCT AAT CCA ACA TTG GGT AAT 5712Pro Gln Val Met Leu Ser Thr Thr Trp Ala Asn Pro Thr Leu Gly Asn 1890 1895 1900GCT GCT TCA AAA ACC ACA CAG CAG GTT CGT CAG CAA GTG CTT ACC CAG 5760Ala Ala Ser Lys Thr Thr Gln Gln Val Arg Gln Gln Val Leu Thr Gln1905 1910 1915 1920TTG CGT CTC AAT AGC AGG GTA AAA ACC CCG TTG CTA GGA ACA GCC AAT 5808Leu Arg Leu Asn Ser Arg Val Lys Thr Pro Leu Leu Gly Thr Ala Asn 1925 1930 1935TCC CTG ACC GCT TTA TTC CTG CCG CAG GAA AAT AGC AAG CTC AAA GGC 5856Ser Leu Thr Ala Leu Phe Leu Pro Gln Glu Asn Ser Lys Leu Lys Gly 1940 1945 1950TAC TGG CGG ACA CTG GCG CAG CGT ATG TTT AAT TTA CGT CAT AAT CTG 5904Tyr Trp Arg Thr Leu Ala Gln Arg Met Phe Asn Leu Arg His Asn Leu 1955 1960 1965TCG ATT GAC GGC CAG CCG CTC TCC TTG CCG CTG TAT GCT AAA CCG GCT 5952Ser Ile Asp Gly Gln Pro Leu Ser Leu Pro Leu Tyr Ala Lys Pro Ala 1970 1975 1980GAT CCA AAA GCT TTA CTG AGT GCG GCG GTT TCA GCT TCT CAA GGG GGA 6000Asp Pro Lys Ala Leu Leu Ser Ala Ala Val Ser Ala Ser Gln Gly Gly1985 1990 1995 2000GCC GAC TTG CCG AAG GCG CCG CTG ACT ATT CAC CGC TTC CCT CAA ATG 6048Ala Asp Leu Pro Lys Ala Pro Leu Thr Ile His Arg Phe Pro Gln Met 2005 2010 2015CTA GAA GGG GCA CGG GGC TTG GTT AAC CAG CTT ATA CAG TTC GGT AGT 6096Leu Glu Gly Ala Arg Gly Leu Val Asn Gln Leu Ile Gln Phe Gly Ser 2020 2025 2030TCA CTA TTG GGG TAC AGT GAG CGT CAG GAT GCG GAA GCT ATG AGT CAA 6144Ser Leu Leu Gly Tyr Ser Glu Arg Gln Asp Ala Glu Ala Met Ser Gln 2035 2040 2045CTA CTG CAA ACC CAA GCC AGC GAG TTA ATA CTG ACC AGT ATT CGT ATG 6192Leu Leu Gln Thr Gln Ala Ser Glu Leu Ile Leu Thr Ser Ile Arg Met 2050 2055 2060CAG GAT AAC CAA TTG GCA GAG CTG GAT TCG GAA AAA ACC GCC TTG CAA 6240Gln Asp Asn Gln Leu Ala Glu Leu Asp Ser Glu Lys Thr Ala Leu Gln2065 2070 2075 2080GTC TCT TTA GCT GGA GTG CAA CAA CGG TTT GAC AGC TAT AGC CAA CTG 6288Val Ser Leu Ala Gly Val Gln Gln Arg Phe Asp Ser Tyr Ser Gln Leu 2085 2090 2095TAT GAG GAG AAC ATC AAC GCA GGT GAG CAG CGA GCG CTG GCG TTA CGC 6336Tyr Glu Glu Asn Ile Asn Ala Gly Glu Gln Arg Ala Leu Ala Leu Arg 2100 2105 2110TCA GAA TCT GCT ATT GAG TCT CAG GGA GCG CAG ATT TCC CGT ATG GCA 6384Ser Glu Ser Ala Ile Glu Ser Gln Gly Ala Gln Ile Ser Arg Met Ala 2115 2120 2125GGC GCG GGT GTT GAT ATG GCA CCA AAT ATC TTC GGC CTG GCT GAT GGC 6432Gly Ala Gly Val Asp Met Ala Pro Asn Ile Phe Gly Leu Ala Asp Gly 2130 2135 2140GGC ATG CAT TAT GGT GCT ATT GCC TAT GCC ATC GCT GAC GGT ATT GAG 6480Gly Met His Tyr Gly Ala Ile Ala Tyr Ala Ile Ala Asp Gly Ile Glu2145 2150 2155 2160TTG AGT GCT TCT GCC AAG ATG GTT GAT GCG GAG AAA GTT GCT CAG TCG 6528Leu Ser Ala Ser Ala Lys Met Val Asp Ala Glu Lys Val Ala Gln Ser 2165 2170 2175GAA ATA TAT CGC CGT CGC CGT CAA GAA TGG AAA ATT CAG CGT GAC AAC 6576Glu Ile Tyr Arg Arg Arg Arg Gln Glu Trp Lys Ile Gln Arg Asp Asn 2180 2185 2190GCA CAA GCG GAG ATT AAC CAG TTA AAC GCG CAA CTG GAA TCA CTG TCT 6624Ala Gln Ala Glu Ile Asn Gln Leu Asn Ala Gln Leu Glu Ser Leu Ser 2195 2200 2205ATT CGC CGT GAA GCC GCT GAA ATG CAA AAA GAG TAC CTG AAA ACC CAG 6672Ile Arg Arg Glu Ala Ala Glu Met Gln Lys Glu Tyr Leu Lys Thr Gln 2210 2215 2220CAA GCT CAG GCG CAG GCA CAA CTT ACT TTC TTA AGA AGC AAA TTC AGT 6720Gln Ala Gln Ala Gln Ala Gln Leu Thr Phe Leu Arg Ser Lys Phe Ser2225 2230 2235 2240AAT CAA GCG TTA TAT AGT TGG TTA CGA GGG CGT TTG TCA GGT ATT TAT 6768Asn Gln Ala Leu Tyr Ser Trp Leu Arg Gly Arg Leu Ser Gly Ile Tyr 2245 2250 2255TTC CAG TTC TAT GAC TTG GCC GTA TCA CGT TGC CTG ATG GCA GAG CAA 6816Phe Gln Phe Tyr Asp Leu Ala Val Ser Arg Cys Leu Met Ala Glu Gln 2260 2265 2270TCC TAT CAA TGG GAA GCT AAT GAT AAT TCC ATT AGC TTT GTC AAA CCG 6864Ser Tyr Gln Trp Glu Ala Asn Asp Asn Ser Ile Ser Phe Val Lys Pro 2275 2280 2285GGT GCA TGG CAA GGA ACT TAC GCC GGC TTA TTG TGT GGA GAA GCT TTG 6912Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu Leu Cys Gly Glu Ala Leu 2290 2295 2300ATA CAA AAT CTG GCA CAA ATG GAA GAG GCA TAT CTG AAA TGG GAA TCT 6960Ile Gln Asn Leu Ala Gln Met Glu Glu Ala Tyr Leu Lys Trp Glu Ser2305 2310 2315 2320CGC GCT TTG GAA GTA GAA CGC ACG GTT TCA TTG GCA GTG GTT TAT GAT 7008Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu Ala Val Val Tyr Asp 2325 2330 2335TCA CTG GAA GGT AAT GAT CGT TTT AAT TTA GCG GAA CAA ATA CCT GCA 7056Ser Leu Glu Gly Asn Asp Arg Phe Asn Leu Ala Glu Gln Ile Pro Ala 2340 2345 2350TTA TTG GAT AAG GGG GAG GGA ACA GCA GGA ACT AAA GAA AAT GGG TTA 7104Leu Leu Asp Lys Gly Glu Gly Thr Ala Gly Thr Lys Glu Asn Gly Leu 2355 2360 2365TCA TTG GCT AAT GCT ATC CTG TCA GCT TCG GTC AAA TTG TCC GAC TTG 7152Ser Leu Ala Asn Ala Ile Leu Ser Ala Ser Val Lys Leu Ser Asp Leu 2370 2375 2380AAA CTG GGA ACG GAT TAT CCA GAC AGT ATC GTT GGT AGC AAC AAG GTT 7200Lys Leu Gly Thr Asp Tyr Pro Asp Ser Ile Val Gly Ser Asn Lys Val2385 2390 2395 2400CGT CGT ATT AAG CAA ATC AGT GTT TCG CTA CCT GCA TTG GTT GGG CCT 7248Arg Arg Ile Lys Gln Ile Ser Val Ser Leu Pro Ala Leu Val Gly Pro 2405 2410 2415TAT CAG GAT GTT CAG GCT ATG CTC AGC TAT GGT GGC AGT ACT CAA TTG 7296Tyr Gln Asp Val Gln Ala Met Leu Ser Tyr Gly Gly Ser Thr Gln Leu 2420 2425 2430CCG AAA GGT TGT TCA GCG TTG GCT GTG TCT CAT GGT ACC AAT GAT AGT 7344Pro Lys Gly Cys Ser Ala Leu Ala Val Ser His Gly Thr Asn Asp Ser 2435 2440 2445GGT CAG TTC CAG TTG GAT TTC AAT GAC GGC AAA TAC CTG CCA TTT GAA 7392Gly Gln Phe Gln Leu Asp Phe Asn Asp Gly Lys Tyr Leu Pro Phe Glu 2450 2455 2460GGT ATT GCT CTT GAT GAT CAG GGT ACA CTG AAT CTT CAA TTT CCG AAT 7440Gly Ile Ala Leu Asp Asp Gln Gly Thr Leu Asn Leu Gln Phe Pro Asn2465 2470 2475 2480GCT ACC GAC AAG CAG AAA GCA ATA TTG CAA ACT ATG AGC GAT ATT ATT 7488Ala Thr Asp Lys Gln Lys Ala Ile Leu Gln Thr Met Ser Asp Ile Ile 2485 2490 2495TTG CAT ATT CGT TAT ACC ATC CGT TAA 7515Leu His Ile Arg Tyr Thr Ile Arg 2500 2504 amino acids amino acid linear protein 12Met Gln Asn Ser Leu Ser Ser Thr Ile Asp Thr Ile Cys Gln Lys Leu1 5 10 15Gln Leu Thr Cys Pro Ala Glu Ile Ala Leu Tyr Pro Phe Asp Thr Phe 20 25 30Arg Glu Lys Thr Arg Gly Met Val Asn Trp Gly Glu Ala Lys Arg Ile 35 40 45Tyr Glu Ile Ala Gln Ala Glu Gln Asp Arg Asn Leu Leu His Glu Lys 50 55 60Arg Ile Phe Ala Tyr Ala Asn Pro Leu Leu Lys Asn Ala Val Arg Leu65 70 75 80Gly Thr Arg Gln Met Leu Gly Phe Ile Gln Gly Tyr Ser Asp Leu Phe 85 90 95Gly Asn Arg Ala Asp Asn Tyr Ala Ala Pro Gly Ser Val Ala Ser Met 100 105 110Phe Ser Pro Ala Ala Tyr Leu Thr Glu Leu Tyr Arg Glu Ala Lys Asn 115 120 125Leu His Asp Ser Ser Ser Ile Tyr Tyr Leu Asp Lys Arg Arg Pro Asp 130 135 140Leu Ala Ser Leu Met Leu Ser Gln Lys Asn Met Asp Glu Glu Ile Ser145 150 155 160Thr Leu Ala Leu Ser Asn Glu Leu Cys Leu Ala Gly Ile Glu Thr Lys 165 170 175Thr Gly Lys Ser Gln Asp Glu Val Met Asp Met Leu Ser Thr Tyr Arg 180 185 190Leu Ser Gly Glu Thr Pro Tyr His His Ala Tyr Glu Thr Val Arg Glu 195 200 205Ile Val His Glu Arg Asp Pro Gly Phe Arg His Leu Ser Gln Ala Pro 210 215 220Ile Val Ala Ala Lys Leu Asp Pro Val Thr Leu Leu Gly Ile Ser Ser225 230 235 240His Ile Ser Pro Glu Leu Tyr Asn Leu Leu Ile Glu Glu Ile Pro Glu 245 250 255Lys Asp Glu Ala Ala Leu Asp Thr Leu Tyr Lys Thr Asn Phe Gly Asp 260 265 270Ile Thr Thr Ala Gln Leu Met Ser Pro Ser Tyr Leu Ala Arg Tyr Tyr 275 280 285Gly Val Ser Pro Glu Asp Ile Ala Tyr Val Thr Thr Ser Leu Ser His 290 295 300Val Gly Tyr Ser Ser Asp Ile Leu Val Ile Pro Leu Val Asp Gly Val305 310 315 320Gly Lys Met Glu Val Val Arg Val Thr Arg Thr Pro Ser Asp Asn Tyr 325 330 335Thr Ser Gln Thr Asn Tyr Ile Glu Leu Tyr Pro Gln Gly Gly Asp Asn 340 345 350Tyr Leu Ile Lys Tyr Asn Leu Ser Asn Ser Phe Gly Leu Asp Asp Phe 355 360 365Tyr Leu Gln Tyr Lys Asp Gly Ser Ala Asp Trp Thr Glu Ile Ala His 370 375 380Asn Pro Tyr Pro Asp Met Val Ile Asn Gln Lys Tyr Glu Ser Gln Ala385 390 395 400Thr Ile Lys Arg Ser Asp Ser Asp Asn Ile Leu Ser Ile Gly Leu Gln 405 410 415Arg Trp His Ser Gly Ser Tyr Asn Phe Ala Ala Ala Asn Phe Lys Ile 420 425 430Asp Gln Tyr Ser Pro Lys Ala Phe Leu Leu Lys Met Asn Lys Ala Ile 435 440 445Arg Leu Leu Lys Ala Thr Gly Leu Ser Phe Ala Thr Leu Glu Arg Ile 450 455 460Val Asp Ser Val Asn Ser Thr Lys Ser Ile Thr Val Glu Val Leu Asn465 470 475 480Lys Val Tyr Arg Val Lys Phe Tyr Ile Asp Arg Tyr Gly Ile Ser Glu 485 490 495Glu Thr Ala Ala Ile Leu Ala Asn Ile Asn Ile Ser Gln Gln Ala Val 500 505 510Gly Asn Gln Leu Ser Gln Phe Glu Gln Leu Phe Asn His Pro Pro Leu 515 520 525Asn Gly Ile Arg Tyr Glu Ile Ser Glu Asp Asn Ser Lys His Leu Pro 530 535 540Asn Pro Asp Leu Asn Leu Lys Pro Asp Ser Thr Gly Asp Asp Gln Arg545 550 555 560Lys Ala Val Leu Lys Arg Ala Phe Gln Val Asn Ala Ser Glu Leu Tyr 565 570 575Gln Met Leu Leu Ile Thr Asp Arg Lys Glu Asp Gly Val Ile Lys Asn 580 585 590Asn Leu Glu Asn Leu Ser Asp Leu Tyr Leu Val Ser Leu Leu Ala Gln 595 600 605Ile His Asn Leu Thr Ile Ala Glu Leu Asn Ile Leu Leu Val Ile Cys 610 615 620Gly Tyr Gly Asp Thr Asn Ile Tyr Gln Ile Thr Asp Asp Asn Leu Ala625 630 635 640Lys Ile Val Glu Thr Leu Leu Trp Ile Thr Gln Trp Leu Lys Thr Gln 645 650 655Lys Trp Thr Val Thr Asp Leu Phe Leu Met Thr Thr Ala Thr Tyr Ser 660 665 670Thr Thr Leu Thr Pro Glu Ile Ser Asn Leu Thr Ala Thr Leu Ser Ser 675 680 685Thr Leu His Gly Lys Glu Ser Leu Ile Gly Glu Asp Leu Lys Arg Ala 690 695 700Met Ala Pro Cys Phe Thr Ser Ala Leu His Leu Thr Ser Gln Glu Val705 710 715 720Ala Tyr Asp Leu Leu Leu Trp Ile Asp Gln Ile Gln Pro Ala Gln Ile 725 730 735Thr Val Asp Gly Phe Trp Glu Glu Val Gln Thr Thr Pro Thr Ser Leu 740 745 750Lys Val Ile Thr Phe Ala Gln Val Leu Ala Gln Leu Ser Leu Ile Tyr 755 760 765Arg Arg Ile Gly Leu Ser Glu Thr Glu Leu Ser Leu Ile Val Thr Gln 770 775 780Ser Ser Leu Leu Val Ala Gly Lys Ser Ile Leu Asp His Gly Leu Leu785 790 795 800Thr Leu Met Ala Leu Glu Gly Phe His Thr Trp Val Asn Gly Leu Gly 805 810 815Gln His Ala Ser Leu Ile Leu Ala Ala Leu Lys Asp Gly Ala Leu Thr 820 825 830Val Thr Asp Val Ala Gln Ala Met Asn Lys Glu Glu Ser Leu Leu Gln 835 840 845Met Ala Ala Asn Gln Val Glu Lys Asp Leu Thr Lys Leu Thr Ser Trp 850 855 860Thr Gln Ile Asp Ala Ile Leu Gln Trp Leu Gln Met Ser Ser Ala Leu865 870 875 880Ala Val Ser Pro Leu Asp Leu Ala Gly Met Met Ala Leu Lys Tyr Gly 885 890 895Ile Asp His Asn Tyr Ala Ala Trp Gln Ala Ala Ala Ala Ala Leu Met 900 905 910Ala Asp His Ala Asn Gln Ala Gln Lys Lys Leu Asp Glu Thr Phe Ser 915 920 925Lys Ala Leu Cys Asn Tyr Tyr Ile Asn Ala Val Val Asp Ser Ala Ala 930 935 940Gly Val Arg Asp Arg Asn Gly Leu Tyr Thr Tyr Leu Leu Ile Asp Asn945 950 955 960Gln Val Ser Ala Asp Val Ile Thr Ser Arg Ile Ala Glu Ala Ile Ala 965 970 975Gly Ile Gln Leu Tyr Val Asn Arg Ala Leu Asn Arg Asp Glu Gly Gln 980 985 990Leu Ala Ser Asp Val Ser Thr Arg Gln Phe Phe Thr Asp Trp Glu Arg 995 1000 1005Tyr Asn Lys Arg Tyr Ser Thr Trp Ala Gly Val Ser Glu Leu Val Tyr 1010 1015 1020Tyr Pro Glu Asn Tyr Val Asp Pro Thr Gln Arg Ile Gly Gln Thr Lys1025 1030 1035 1040Met Met Asp Ala Leu Leu Gln Ser Ile Asn Gln Ser Gln Leu Asn Ala 1045 1050 1055Asp Thr Val Glu Asp Ala Phe Lys Thr Tyr Leu Thr Ser Phe Glu Gln 1060 1065 1070Val Ala Asn Leu Lys Val Ile Ser Ala Tyr His Asp Asn Val Asn Val 1075 1080 1085Asp Gln Gly Leu Thr Tyr Phe Ile Gly Ile Asp Gln Ala Ala Pro Gly 1090 1095 1100Thr Tyr Tyr Trp Arg Ser Val Asp His Ser Lys Cys Glu Asn Gly Lys1105 1110 1115 1120Phe Ala Ala Asn Ala Trp Gly Glu Trp Asn Lys Ile Thr Cys Ala Val 1125 1130 1135Asn Pro Trp Lys Asn Ile Ile Arg Pro Val Val Tyr Met Ser Arg Leu 1140 1145 1150Tyr Leu Leu Trp Leu Glu Gln Gln Ser Lys Lys Ser Asp Asp Gly Lys 1155 1160 1165Thr Thr Ile Tyr Gln Tyr Asn Leu Lys Leu Ala His Ile Arg Tyr Asp 1170 1175 1180Gly Ser Trp Asn Thr Pro Phe Thr Phe Asp Val Thr Glu Lys Val Lys1185 1190 1195 1200Asn Tyr Thr Ser Ser Thr Asp Ala Ala Glu Ser Leu Gly Leu Tyr Cys 1205 1210 1215Thr Gly Tyr Gln Gly Glu Asp Thr Leu Leu Val Met Phe Tyr Ser Met 1220 1225 1230Gln Ser Ser Tyr Ser Ser Tyr Thr Asp Asn Asn Ala Pro Val Thr Gly 1235 1240 1245Leu Tyr Ile Phe Ala Asp Met Ser Ser Asp Asn Met Thr Asn Ala Gln 1250 1255 1260Ala Thr Asn Tyr Trp Asn Asn Ser Tyr Pro Gln Phe Asp Thr Val Met1265 1270 1275 1280Ala Asp Pro Asp Ser Asp Asn Lys Lys Val Ile Thr Arg Arg Val Asn 1285 1290 1295Asn Arg Tyr Ala Glu Asp Tyr Glu Ile Pro Ser Ser Val Thr Ser Asn 1300 1305 1310Ser Asn Tyr Ser Trp Gly Asp His Ser Leu Thr Met Leu Tyr Gly Gly 1315 1320 1325Ser Val Pro Asn Ile Thr Phe Glu Ser Ala Ala Glu Asp Leu Arg Leu 1330 1335 1340Ser Thr Asn Met Ala Leu Ser Ile Ile His Asn Gly Tyr Ala Gly Thr1345 1350 1355 1360Arg Arg Ile Gln Cys Asn Leu Met Lys Gln Tyr Ala Ser Leu Gly Asp 1365 1370 1375Lys Phe Ile Ile Tyr Asp Ser Ser Phe Asp Asp Ala Asn Arg Phe Asn 1380 1385 1390Leu Val Pro Leu Phe Lys Phe Gly Lys Asp Glu Asn Ser Asp Asp Ser 1395 1400 1405Ile Cys Ile Tyr Asn Glu Asn Pro Ser Ser Glu Asp Lys Lys Trp Tyr 1410 1415 1420Phe Ser Ser Lys Asp Asp Asn Lys Thr Ala Asp Tyr Asn Gly Gly Thr1425 1430 1435 1440Gln Cys Ile Asp Ala Gly Thr Ser Asn Lys Asp Phe Tyr Tyr Asn Leu 1445 1450 1455Gln Glu Ile Glu Val Ile Ser Val Thr Gly Gly Tyr Trp Ser Ser Tyr 1460 1465 1470Lys Ile Ser Asn Pro Ile Asn Ile Asn Thr Gly Ile Asp Ser Ala Lys 1475 1480 1485Val Lys Val Thr Val Lys Ala Gly Gly Asp Asp Gln Ile Phe Thr Ala 1490 1495 1500Asp Asn Ser Thr Tyr Val Pro Gln Gln Pro Ala Pro Ser Phe Glu Glu1505 1510 1515 1520Met Ile Tyr Gln Phe Asn Asn Leu Thr Ile Asp Cys Lys Asn Leu Asn 1525 1530 1535Phe Ile Asp Asn Gln Ala His Ile Glu Ile Asp Phe Thr Ala Thr Ala 1540 1545 1550Gln Asp Gly Arg Phe Leu Gly Ala Glu Thr Phe Ile Ile Pro Val Thr 1555 1560 1565Lys Lys Val Leu Gly Thr Glu Asn Val Ile Ala Leu Tyr Ser Glu Asn 1570 1575 1580Asn Gly Val Gln Tyr Met Gln Ile Gly Ala Tyr Arg Thr Arg Leu Asn1585 1590 1595 1600Thr Leu Phe Ala Gln Gln Leu Val Ser Arg Ala Asn Arg Gly Ile Asp 1605 1610 1615Ala Val Leu Ser Met Glu Thr Gln Asn Ile Gln Glu Pro Gln Leu Gly 1620 1625 1630Ala Gly Thr Tyr Val Gln Leu Val Leu Asp Lys Tyr Asp Glu Ser Ile 1635 1640 1645His Gly Thr Asn Lys Ser Phe Ala Ile Glu Tyr Val Asp Ile Phe Lys 1650 1655 1660Glu Asn Asp Ser Phe Val Ile Tyr Gln Gly Glu Leu Ser Glu Thr Ser1665 1670 1675 1680Gln Thr Val Val Lys Val Phe Leu Ser Tyr Phe Ile Glu Ala Thr Gly 1685 1690 1695Asn Lys Asn His Leu Trp Val Arg Ala Lys Tyr Gln Lys Glu Thr Thr 1700 1705 1710Asp Lys Ile Leu Phe Asp Arg Thr Asp Glu Lys Asp Pro His Gly Trp 1715 1720 1725Phe Leu Ser Asp Asp His Lys Thr Phe Ser Gly Leu Ser Ser Ala Gln 1730 1735 1740Ala Leu Lys Asn Asp Ser Glu Pro Met Asp Phe Ser Gly Ala Asn Ala1745 1750 1755 1760Leu Tyr Phe Trp Glu Leu Phe Tyr Tyr Thr Pro Met Met Met Ala His 1765 1770 1775Arg Leu Leu Gln Glu Gln Asn Phe Asp Ala Ala Asn His Trp Phe Arg 1780 1785 1790Tyr Val Trp Ser Pro Ser Gly Tyr Ile Val Asp Gly Lys Ile Ala Ile 1795 1800 1805Tyr His Trp Asn Val Arg Pro Leu Glu Glu Asp Thr Ser Trp Asn Ala 1810 1815 1820Gln Gln Leu Asp Ser Thr Asp Pro Asp Ala Val Ala Gln Asp Asp Pro1825 1830 1835 1840Met His Tyr Lys Val Ala Thr Phe Met Ala Thr Leu Asp Leu Leu Met 1845 1850 1855Ala Arg Gly Asp Ala Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Ala 1860 1865 1870Glu Ala Lys Met Trp Tyr Thr Gln Ala Leu Asn Leu Leu Gly Asp Glu 1875 1880 1885Pro Gln Val Met Leu Ser Thr Thr Trp Ala Asn Pro Thr Leu Gly Asn 1890 1895 1900Ala Ala Ser Lys Thr Thr Gln Gln Val Arg Gln Gln Val Leu Thr Gln1905 1910 1915 1920Leu Arg Leu Asn Ser Arg Val Lys Thr Pro Leu Leu Gly Thr Ala Asn 1925 1930 1935Ser Leu Thr Ala Leu Phe Leu Pro Gln Glu Asn Ser Lys Leu Lys Gly 1940 1945 1950Tyr Trp Arg Thr Leu Ala Gln Arg Met Phe Asn Leu Arg His Asn Leu 1955 1960 1965Ser Ile Asp Gly Gln Pro Leu Ser Leu Pro Leu Tyr Ala Lys Pro Ala 1970 1975 1980Asp Pro Lys Ala Leu Leu Ser Ala Ala Val Ser Ala Ser Gln Gly Gly1985 1990 1995 2000Ala Asp Leu Pro Lys Ala Pro Leu Thr Ile His Arg Phe Pro Gln Met 2005 2010 2015Leu Glu Gly Ala Arg Gly Leu Val Asn Gln Leu Ile Gln Phe Gly Ser 2020 2025 2030Ser Leu Leu Gly Tyr Ser Glu Arg Gln Asp Ala Glu Ala Met Ser Gln 2035 2040 2045Leu Leu Gln Thr Gln Ala Ser Glu Leu Ile Leu Thr Ser Ile Arg Met 2050 2055 2060Gln Asp Asn Gln Leu Ala Glu Leu Asp Ser Glu Lys Thr Ala Leu Gln2065 2070 2075 2080Val Ser Leu Ala Gly Val Gln Gln Arg Phe Asp Ser Tyr Ser Gln Leu 2085 2090 2095Tyr Glu Glu Asn Ile Asn Ala Gly Glu Gln Arg Ala Leu Ala Leu Arg 2100 2105 2110Ser Glu Ser Ala Ile Glu Ser Gln Gly Ala Gln Ile Ser Arg Met Ala 2115 2120 2125Gly Ala Gly Val Asp Met Ala Pro Asn Ile Phe Gly Leu Ala Asp Gly 2130 2135 2140Gly Met His Tyr Gly Ala Ile Ala Tyr Ala Ile Ala Asp Gly Ile Glu2145 2150 2155 2160Leu Ser Ala Ser Ala Lys Met Val Asp Ala Glu Lys Val Ala Gln Ser 2165 2170 2175Glu Ile Tyr Arg Arg Arg Arg Gln Glu Trp Lys Ile Gln Arg Asp Asn 2180 2185 2190Ala Gln Ala Glu Ile Asn Gln Leu Asn Ala Gln Leu Glu Ser Leu Ser 2195 2200 2205Ile Arg Arg Glu Ala Ala Glu Met Gln Lys Glu Tyr Leu Lys Thr Gln 2210 2215 2220Gln Ala Gln Ala Gln Ala Gln Leu Thr Phe Leu Arg Ser Lys Phe Ser2225 2230 2235 2240Asn Gln Ala Leu Tyr Ser Trp Leu Arg Gly Arg Leu Ser Gly Ile Tyr 2245 2250 2255Phe Gln Phe Tyr Asp Leu Ala Val Ser Arg Cys Leu Met Ala Glu Gln 2260 2265 2270Ser Tyr Gln Trp Glu Ala Asn Asp Asn Ser Ile Ser Phe Val Lys Pro 2275 2280 2285Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu Leu Cys Gly Glu Ala Leu 2290 2295 2300Ile Gln Asn Leu Ala Gln Met Glu Glu Ala Tyr Leu Lys Trp Glu Ser2305 2310 2315 2320Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu Ala Val Val Tyr Asp 2325 2330 2335Ser Leu Glu Gly Asn Asp Arg Phe Asn Leu Ala Glu Gln Ile Pro Ala 2340 2345 2350Leu Leu Asp Lys Gly Glu Gly Thr Ala Gly Thr Lys Glu Asn Gly Leu 2355 2360 2365Ser Leu Ala Asn Ala Ile Leu Ser Ala Ser Val Lys Leu Ser Asp Leu 2370 2375 2380Lys Leu Gly Thr Asp Tyr Pro Asp Ser Ile Val Gly Ser Asn Lys Val2385 2390 2395 2400Arg Arg Ile Lys Gln Ile Ser Val Ser Leu Pro Ala Leu Val Gly Pro 2405 2410 2415Tyr Gln Asp Val Gln Ala Met Leu Ser Tyr Gly Gly Ser Thr Gln Leu 2420 2425 2430Pro Lys Gly Cys Ser Ala Leu Ala Val Ser His Gly Thr Asn Asp Ser 2435 2440 2445Gly Gln Phe Gln Leu Asp Phe Asn Asp Gly Lys Tyr Leu Pro Phe Glu 2450 2455 2460Gly Ile Ala Leu Asp Asp Gln Gly Thr Leu Asn Leu Gln Phe Pro Asn2465 2470 2475 2480Ala Thr Asp Lys Gln Lys Ala Ile Leu Gln Thr Met Ser Asp Ile Ile 2485 2490 2495Leu His Ile Arg Tyr Thr Ile Arg 2500 12 amino acids amino acid single linear peptide 13Leu Ile Gly Tyr Asn Asn Gln Phe Ser Gly Xaa Ala1 5 10 12 amino acids amino acid single linear peptide 14Met Gln Asn Ser Gln Thr Phe Ser Val Gly Glu Leu1 5 10 14 amino acids amino acid single linear peptide 15Ala Gln Asp Gly Asn Gln Asp Thr Phe Phe Ser Gly Asn Thr1 5 10 5 amino acids amino acid single linear peptide 16Met Gln Asn Ser Leu1 5 10 amino acids amino acid single linear peptide 17Ala Phe Asn Ile Asp Asp Val Ser Leu Phe1 5 10 16 amino acids amino acid single linear peptide 18Phe Ile Val Tyr Thr Ser Leu Gly Val Asn Pro Asn Asn Ser Ser Asn1 5 10 15 21 amino acids amino acid single linear peptide 19Ile Ser Asp Leu Val Thr Thr Ser Pro Leu Ser Glu Ala Ile Gly Ser1 5 10 15Leu Gln Leu Phe Ile 20 12 amino acids amino acid single linear peptide 20Met Tyr Tyr Ile Gln Ala Gln Gln Leu Leu Gly Pro1 5 10 26 amino acids amino acid single linear peptide 21Gly Ile Asp Ala Val Leu Ser Met Glu Thr Gln Asn Ile Gln Glu Pro1 5 10 15Gln Leu Gly Ala Gly Thr Tyr Val Gln Leu 20 25 15 amino acids amino acid single linear peptide 22Ile Ser Asn Pro Ile Asn Ile Asn Thr Gly Ile Asp Ser Ala Lys1 5 10 15 13 amino acids amino acid single linear peptide 23Thr Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn Leu Lys1 5 10 22 amino acids amino acid single linear peptide 24Val Leu Gly Thr Glu Asn Val Ile Ala Leu Tyr Ser Glu Asn Asn Gly1 5 10 15Val Gln Tyr Met Gln Ile 20 6055 base pairs nucleic acid double linear DNA (genomic) CDS 66..3635 25AGTAGCCCAA AACTTAAGTG CCGCAATCAG CAATCGTCAG TAACCGGATA AAGAAGGAAT 60TGATT ATG TCT GAA TCT TTA TTT ACA CAA ACG TTG AAA GAA GCG CGC 107 Met Ser Glu Ser Leu Phe Thr Gln Thr Leu Lys Glu Ala Arg 1 5 10CGT GAT GCA TTG GTT GCT CAT TAT ATT GCT ACT CAG GTG CCC GCA GAT 155Arg Asp Ala Leu Val Ala His Tyr Ile Ala Thr Gln Val Pro Ala Asp 15 20 25 30TTA AAA GAG AGT ATC CAG ACC GCG GAT GAT CTG TAC GAA TAT CTG TTG 203Leu Lys Glu Ser Ile Gln Thr Ala Asp Asp Leu Tyr Glu Tyr Leu Leu 35 40 45CTG GAT ACC AAA ATT AGC GAT CTG GTT ACT ACT TCA CCG CTG TCC GAA 251Leu Asp Thr Lys Ile Ser Asp Leu Val Thr Thr Ser Pro Leu Ser Glu 50 55 60GCG ATT GGC AGT CTG CAA TTG TTT ATT CAT CGT GCG ATA GAG GGC TAT 299Ala Ile Gly Ser Leu Gln Leu Phe Ile His Arg Ala Ile Glu Gly Tyr 65 70 75GAC GGC ACG CTG GCA GAC TCA GCA AAA CCC TAT TTT GCC GAT GAA CAG 347Asp Gly Thr Leu Ala Asp Ser Ala Lys Pro Tyr Phe Ala Asp Glu Gln 80 85 90TTT TTA TAT AAC TGG GAT AGT TTT AAC CAC CGT TAT AGC ACT TGG GCT 395Phe Leu Tyr Asn Trp Asp Ser Phe Asn His Arg Tyr Ser Thr Trp Ala 95 100 105 110GGC AAG GAA CGG TTG AAA TTC TAT GCC GGG GAT TAT ATT GAT CCA ACA 443Gly Lys Glu Arg Leu Lys Phe Tyr Ala Gly Asp Tyr Ile Asp Pro Thr 115 120 125TTG CGA TTG AAT AAG ACC GAG ATA TTT ACC GCA TTT GAA CAA GGT ATT 491Leu Arg Leu Asn Lys Thr Glu Ile Phe Thr Ala Phe Glu Gln Gly Ile 130 135 140TCT CAA GGG AAA TTA AAA AGT GAA TTA GTC GAA TCT AAA TTA CGT GAT 539Ser Gln Gly Lys Leu Lys Ser Glu Leu Val Glu Ser Lys Leu Arg Asp 145 150 155TAT CTA ATT AGT TAT GAC ACT TTA GCC ACC CTT GAT TAT ATT ACT GCC 587Tyr Leu Ile Ser Tyr Asp Thr Leu Ala Thr Leu Asp Tyr Ile Thr Ala 160 165 170TGC CAA GGC AAA GAT AAT AAA ACC ATC TTC TTT ATT GGC CGT ACA CAG 635Cys Gln Gly Lys Asp Asn Lys Thr Ile Phe Phe Ile Gly Arg Thr Gln175 180 185 190AAT GCA CCC TAT GCA TTT TAT TGG CGA AAA TTA ACT TTA GTC ACT GAT 683Asn Ala Pro Tyr Ala Phe Tyr Trp Arg Lys Leu Thr Leu Val Thr Asp 195 200 205GGC GGT AAG TTG AAA CCA GAT CAA TGG TCA GAG TGG CGA GCA ATT AAT 731Gly Gly Lys Leu Lys Pro Asp Gln Trp Ser Glu Trp Arg Ala Ile Asn 210 215 220GCC GGG ATT AGT GAG GCA TAT TCA GGG CAT GTC GAG CCT TTC TGG GAA 779Ala Gly Ile Ser Glu Ala Tyr Ser Gly His Val Glu Pro Phe Trp Glu 225 230 235AAT AAC AAG CTG CAC ATC CGT TGG TTT ACT ATC TCG AAA GAA GAT AAA 827Asn Asn Lys Leu His Ile Arg Trp Phe Thr Ile Ser Lys Glu Asp Lys 240 245 250ATA GAT TTT GTT TAT AAA AAC ATC TGG GTG ATG AGT AGC GAT TAT AGC 875Ile Asp Phe Val Tyr Lys Asn Ile Trp Val Met Ser Ser Asp Tyr Ser255 260 265 270TGG GCA TCA AAG AAA AAA ATC TTG GAA CTT TCT TTT ACT GAC TAC AAT 923Trp Ala Ser Lys Lys Lys Ile Leu Glu Leu Ser Phe Thr Asp Tyr Asn 275 280 285AGA GTT GGA GCA ACA GGA TCA TCA AGC CCG ACT GAA GTA GCT TCA CAA 971Arg Val Gly Ala Thr Gly Ser Ser Ser Pro Thr Glu Val Ala Ser Gln 290 295 300TAT GGT TCT GAT GCT CAG ATG AAT ATT TCT GAT GAT GGG ACT GTA CTT 1019Tyr Gly Ser Asp Ala Gln Met Asn Ile Ser Asp Asp Gly Thr Val Leu 305 310 315ATT TTT CAG AAT GCC GGC GGA GCT ACT CCC AGT ACT GGA GTG ACG TTA 1067Ile Phe Gln Asn Ala Gly Gly Ala Thr Pro Ser Thr Gly Val Thr Leu 320 325 330TGT TAT GAC TCT GGC AAC GTG ATT AAG AAC CTA TCT AGT ACA GGA AGT 1115Cys Tyr Asp Ser Gly Asn Val Ile Lys Asn Leu Ser Ser Thr Gly Ser335 340 345 350GCA AAT TTA TCG TCA AAG GAT TAT GCC ACA ACT AAA TTA CGC ATG TGT 1163Ala Asn Leu Ser Ser Lys Asp Tyr Ala Thr Thr Lys Leu Arg Met Cys 355 360 365CAT GGA CAA AGT TAC AAT GAT AAT AAC TAC TGC AAT TTT ACA CTC TCT 1211His Gly Gln Ser Tyr Asn Asp Asn Asn Tyr Cys Asn Phe Thr Leu Ser 370 375 380ATT AAT ACA ATA GAA TTC ACC TCC TAC GGC ACA TTC TCA TCA GAT GGA 1259Ile Asn Thr Ile Glu Phe Thr Ser Tyr Gly Thr Phe Ser Ser Asp Gly 385 390 395AAA CAA TTT ACA CCA CCT TCT GGT TCT GCC ATT GAT TTA CAC CTC CCT 1307Lys Gln Phe Thr Pro Pro Ser Gly Ser Ala Ile Asp Leu His Leu Pro 400 405 410AAT TAT GTA GAT CTC AAC GCG CTA TTA GAT ATT AGC CTC GAT TCA CTA 1355Asn Tyr Val Asp Leu Asn Ala Leu Leu Asp Ile Ser Leu Asp Ser Leu415 420 425 430CTT AAT TAT GAC GTT CAG GGG CAG TTT GGC GGA TCT AAT CCG GTT GAT 1403Leu Asn Tyr Asp Val Gln Gly Gln Phe Gly Gly Ser Asn Pro Val Asp 435 440 445AAT TTC AGT GGT CCC TAT GGT ATT TAT CTA TGG GAA ATC TTC TTC CAT 1451Asn Phe Ser Gly Pro Tyr Gly Ile Tyr Leu Trp Glu Ile Phe Phe His 450 455 460ATT CCG TTC CTT GTT ACG GTC CGT ATG CAA ACC GAA CAA CGT TAC GAA 1499Ile Pro Phe Leu Val Thr Val Arg Met Gln Thr Glu Gln Arg Tyr Glu 465 470 475GAC GCG GAC ACT TGG TAC AAA TAT ATT TTC CGC AGC GCC GGT TAT CGC 1547Asp Ala Asp Thr Trp Tyr Lys Tyr Ile Phe Arg Ser Ala Gly Tyr Arg 480 485 490GAT GCT AAT GGC CAG CTC ATT ATG GAT GGC AGT AAA CCA CGT TAT TGG 1595Asp Ala Asn Gly Gln Leu Ile Met Asp Gly Ser Lys Pro Arg Tyr Trp495 500 505 510AAT GTG ATG CCA TTG CAA CTG GAT ACC GCA TGG GAT ACC ACA CAG CCC 1643Asn Val Met Pro Leu Gln Leu Asp Thr Ala Trp Asp Thr Thr Gln Pro 515 520 525GCC ACC ACT GAT CCA GAT GTG ATC GCT ATG GCG GAC CCG ATG CAT TAC 1691Ala Thr Thr Asp Pro Asp Val Ile Ala Met Ala Asp Pro Met His Tyr 530 535 540AAG CTG GCG ATA TTC CTG CAT ACC CTT GAT CTA TTG ATT GCC CGA GGC 1739Lys Leu Ala Ile Phe Leu His Thr Leu Asp Leu Leu Ile Ala Arg Gly 545 550 555GAC AGC GCT TAC CGT CAA CTT GAA CGC GAT ACT CTA GTC GAA GCC AAA 1787Asp Ser Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Val Glu Ala Lys 560 565 570ATG TAC TAC ATT CAG GCA CAA CAG CTA CTG GGA CCG CGC CCT GAT ATC 1835Met Tyr Tyr Ile Gln Ala Gln Gln Leu Leu Gly Pro Arg Pro Asp Ile575 580 585 590CAT ACC ACC AAT ACT TGG CCA AAT CCC ACC TTG AGT AAA GAA GCT GGC 1883His Thr Thr Asn Thr Trp Pro Asn Pro Thr Leu Ser Lys Glu Ala Gly 595 600 605GCT ATT GCC ACA CCG ACA TTC CTC AGT TCA CCG GAG GTG ATG ACG TTC 1931Ala Ile Ala Thr Pro Thr Phe Leu Ser Ser Pro Glu Val Met Thr Phe 610 615 620GCT GCC TGG CTA AGC GCA GGC GAT ACC GCA AAT ATT GGC GAC GGT GAT 1979Ala Ala Trp Leu Ser Ala Gly Asp Thr Ala Asn Ile Gly Asp Gly Asp 625 630 635TTC TTG CCA CCG TAC AAC GAT GTA CTA CTC GGT TAC TGG GAT AAA CTT 2027Phe Leu Pro Pro Tyr Asn Asp Val Leu Leu Gly Tyr Trp Asp Lys Leu 640 645 650GAG TTA CGC CTA TAC AAC CTG CGC CAC AAT CTG AGT CTG GAT GGT CAA 2075Glu Leu Arg Leu Tyr Asn Leu Arg His Asn Leu Ser Leu Asp Gly Gln655 660 665 670CCG CTA AAT CTG CCA CTG TAT GCC ACG CCG GTA GAC CCG AAA ACC CTG 2123Pro Leu Asn Leu Pro Leu Tyr Ala Thr Pro Val Asp Pro Lys Thr Leu 675 680 685CAA CGC CAG CAA GCC GGA GGG GAC GGT ACA GGC AGT AGT CCG GCT GGT 2171Gln Arg Gln Gln Ala Gly Gly Asp Gly Thr Gly Ser Ser Pro Ala Gly 690 695 700GGT CAA GGC AGT GTT CAG GGC TGG CGC TAT CCG TTA TTG GTA GAA CGC 2219Gly Gln Gly Ser Val Gln Gly Trp Arg Tyr Pro Leu Leu Val Glu Arg 705 710 715GCC CGC TCT GCC GTG AGT TTG TTG ACT CAG TTC GGC AAC AGC TTA CAA 2267Ala Arg Ser Ala Val Ser Leu Leu Thr Gln Phe Gly Asn Ser Leu Gln 720 725 730ACA ACG TTA GAA CAT CAG GAT AAT GAA AAA ATG ACG ATA CTG TTG CAG 2315Thr Thr Leu Glu His Gln Asp Asn Glu Lys Met Thr Ile Leu Leu Gln735 740 745 750ACT CAA CAG GAA GCC ATC CTG AAA CAT CAG CAC GAT ATA CAA CAA AAT 2363Thr Gln Gln Glu Ala Ile Leu Lys His Gln His Asp Ile Gln Gln Asn 755 760 765AAT CTA AAA GGA TTA CAA CAC AGC CTG ACC GCA TTA CAG GCT AGC CGT 2411Asn Leu Lys Gly Leu Gln His Ser Leu Thr Ala Leu Gln Ala Ser Arg 770 775 780GAT GGC GAC ACA TTG CGG CAA AAA CAT TAC AGC GAC CTG ATT AAC GGT 2459Asp Gly Asp Thr Leu Arg Gln Lys His Tyr Ser Asp Leu Ile Asn Gly 785 790 795GGT CTA TCT GCG GCA GAA ATC GCC GGT CTG ACA CTA CGC AGC ACC GCC 2507Gly Leu Ser Ala Ala Glu Ile Ala Gly Leu Thr Leu Arg Ser Thr Ala 800 805 810ATG ATT ACC AAT GGC GTT GCA ACG GGA TTG CTG ATT GCC GGC GGA ATC 2555Met Ile Thr Asn Gly Val Ala Thr Gly Leu Leu Ile Ala Gly Gly Ile815 820 825 830GCC AAC GCG GTA CCT AAC GTC TTC GGG CTG GCT AAC GGT GGA TCG GAA 2603Ala Asn Ala Val Pro Asn Val Phe Gly Leu Ala Asn Gly Gly Ser Glu 835 840 845TGG GGA GCG CCA TTA ATT GGC TCC GGG CAA GCA ACC CAA GTT GGC GCC 2651Trp Gly Ala Pro Leu Ile Gly Ser Gly Gln Ala Thr Gln Val Gly Ala 850 855 860GGC ATC CAG GAT CAG AGC GCG GGC ATT TCA GAA GTG ACA GCA GGC TAT 2699Gly Ile Gln Asp Gln Ser Ala Gly Ile Ser Glu Val Thr Ala Gly Tyr 865 870 875CAG CGT CGT CAG GAA GAA TGG GCA TTG CAA CGG GAT ATT GCT GAT AAC 2747Gln Arg Arg Gln Glu Glu Trp Ala Leu Gln Arg Asp Ile Ala Asp Asn 880 885 890GAA ATA ACC CAA CTG GAT GCC CAG ATA CAA AGC CTG CAA GAG CAA ATC 2795Glu Ile Thr Gln Leu Asp Ala Gln Ile Gln Ser Leu Gln Glu Gln Ile895 900 905 910ACG ATG GCA CAA AAA CAG ATC ACG CTC TCT GAA ACC GAA CAA GCG AAT 2843Thr Met Ala Gln Lys Gln Ile Thr Leu Ser Glu Thr Glu Gln Ala Asn 915 920 925GCC CAA GCG ATT TAT GAC CTG CAA ACC ACT CGT TTT ACC GGG CAG GCA 2891Ala Gln Ala Ile Tyr Asp Leu Gln Thr Thr Arg Phe Thr Gly Gln Ala 930 935 940CTG TAT AAC TGG ATG GCC GGT CGT CTC TCC GCG CTC TAT TAC CAA ATG 2939Leu Tyr Asn Trp Met Ala Gly Arg Leu Ser Ala Leu Tyr Tyr Gln Met 945 950 955TAT GAT TCC ACT CTG CCA ATC TGT CTC CAG CCA AAA GCC GCA TTA GTA 2987Tyr Asp Ser Thr Leu Pro Ile Cys Leu Gln Pro Lys Ala Ala Leu Val 960 965 970CAG GAA TTA GGC GAG AAA GAG AGC GAC AGT CTT TTC CAG GTT CCG GTG 3035Gln Glu Leu Gly Glu Lys Glu Ser Asp Ser Leu Phe Gln Val Pro Val975 980 985 990TGG AAT GAT CTG TGG CAA GGG CTG TTA GCA GGA GAA GGT TTA AGT TCA 3083Trp Asn Asp Leu Trp Gln Gly Leu Leu Ala Gly Glu Gly Leu Ser Ser 995 1000 1005GAG CTA CAG AAA CTG GAT GCC ATC TGG CTT GCA CGT GGT GGT ATT GGG 3131Glu Leu Gln Lys Leu Asp Ala Ile Trp Leu Ala Arg Gly Gly Ile Gly 1010 1015 1020CTA GAA GCC ATC CGC ACC GTG TCG CTG GAT ACC CTG TTT GGC ACA GGG 3179Leu Glu Ala Ile Arg Thr Val Ser Leu Asp Thr Leu Phe Gly Thr Gly 1025 1030 1035ACG TTA AGT GAA AAT ATC AAT AAA GTG CTT AAC GGG GAA ACG GTA TCT 3227Thr Leu Ser Glu Asn Ile Asn Lys Val Leu Asn Gly Glu Thr Val Ser 1040 1045 1050CCA TCC GGT GGC GTC ACT CTG GCG CTG ACA GGG GAT ATC TTC CAA GCA 3275Pro Ser Gly Gly Val Thr Leu Ala Leu Thr Gly Asp Ile Phe Gln Ala1055 1060 1065 1070ACA CTG GAT TTG AGT CAG CTA GGT TTG GAT AAC TCT TAC AAC TTG GGT 3323Thr Leu Asp Leu Ser Gln Leu Gly Leu Asp Asn Ser Tyr Asn Leu Gly 1075 1080 1085AAC GAG AAG AAA CGT CGT ATT AAA CGT ATC GCC GTC ACC CTG CCA ACA 3371Asn Glu Lys Lys Arg Arg Ile Lys Arg Ile Ala Val Thr Leu Pro Thr 1090 1095 1100CTT CTG GGG CCA TAT CAA GAT CTT GAA GCC ACA CTG GTA ATG GGT GCG 3419Leu Leu Gly Pro Tyr Gln Asp Leu Glu Ala Thr Leu Val Met Gly Ala 1105 1110 1115GAA ATC GCC GCC TTA TCA CAC GGT GTG AAT GAC GGA GGC CGG TTT GTT 3467Glu Ile Ala Ala Leu Ser His Gly Val Asn Asp Gly Gly Arg Phe Val 1120 1125 1130ACC GAC TTT AAC GAC AGC CGT TTT CTG CCT TTT GAA GGT CGA GAT GCA 3515Thr Asp Phe Asn Asp Ser Arg Phe Leu Pro Phe Glu Gly Arg Asp Ala1135 1140 1145 1150ACA ACC GGC ACA CTG GAG CTC AAT ATT TTC CAT GCG GGT AAA GAG GGA 3563Thr Thr Gly Thr Leu Glu Leu Asn Ile Phe His Ala Gly Lys Glu Gly 1155 1160 1165ACG CAA CAC GAG TTG GTC GCG AAT CTG AGT GAC ATC ATT GTG CAT CTG 3611Thr Gln His Glu Leu Val Ala Asn Leu Ser Asp Ile Ile Val His Leu 1170 1175 1180AAT TAC ATC ATT CGA GAC GCG TAA ATTTCTTTTC TTTGTCGATT ACAGGTCCCT 3665Asn Tyr Ile Ile Arg Asp Ala * 1185 1190ATCAGGGGCC TGTTATTAAG GAGTACTTTA TGCAGGATTC ACCAGAAGTA TCGATTACAA 3725CGCTGTCACT TCCCAAAGGT GGCGGTGCTA TCAATGGCAT GGGAGAAGCA CTGAATGCTG 3785CCGGCCCTGA TGGAATGGCC TCCCTATCTC TGCCATTACC CCTTTCGACC GGCAGAGGGA 3845CGGCTCCTGG ATTATCGCTG ATTTACAGCA ACAGTGCAGG TAATGGGCCT TTCGGCATCG 3905GCTGGCAATG CGGTGTTATG TCCATTAGCC GACGCACCCA ACATGGCATT CCACAATACG 3965GTAATGACGA CACGTTCCTA TCCCCACAAG GCGAGGTCAT GAATATCGCC CTGAATGACC 4025AAGGGCAACC TGATATCCGT CAAGACGTTA AAACGCTGCA AGGCGTTACC TTGCCAATTT 4085CCTATACCGT GACCCGCTAT CAAGCCCGCC AGATCCTGGA TTTCAGTAAA ATCGAATACT 4145GGCAACCTGC CTCCGGTCAA GAAGGACGCG CTTTCTGGCT GATATCGACA CCGGACGGGC 4205ATCTACACAT CTTAGGGAAA ACCGCGCAGG CTTGTCTGGC AAATCCGCAA AATGACCAAC 4265AAATCGCCCA GTGGTTGCTG GAAGAAACTG TGACGCCAGC CGGTGAACAT GTCAGCTATC 4325AATATCGAGC CGAAGATGAA GCCCATTGTG ACGACAATGA AAAAACCGCT CATCCCAATG 4385TTACCGCACA GCGCTATCTG GTACAGGTGA ACTACAGGCA ACATCAAACC ACAAGCCAGC 4445CTGTTCGTAC TGGATAACGC ACCTCCCGCA CCGGAAGAGT GGCTGTTTCA TCTGGTCTTT 4505GACCACGGTG AGCGCGTACC TCACTTCATA CCGTGCCAAC ATGGGATGCA GGTACAGCGC 4565AATGGTCTGT ACGCCCGGAT ATCTTCTCTC GCTATGAATA TGGTTTTGAA GTGCGTACTC 4625GCCGCTTATG TCAACAAGTG CTGATGTTTC ACCGCACCGC GCTCATGGCC GGAGAAGCCA 4685GTACCAATGA CGCCCCGGAA CTGGTTGGAC GCTTAATACT GGAATATGAC AAAAACGCCA 4745GCGTCACCAC GTTGATTACC ATCCGTCAAT TAAGCCATGA ATCGGACGGG AGGCCAGTCA 4805CCCAGCCACC ACTAGAACTA GCCTGGCAAC GGTTTGATCT GGAGAAAATC CCGACATGGC 4865AACGCTTTGA CGCACTAGAT AATTTTAACT CGCAGCAACG TTATCAACTG GTTGATCTGC 4925GGGGAGAAGG GTTGCCAGGT ATGCTGTATC AAGATCGAGG CGCTTGGTGG TATAAAGCTC 4985CGCAACGTCA GGAAGACGGA GACAGCAATG CCGTCACTTA CGACAAAATC GCCCCACTGC 5045CTACCCTACC CAATTTGCAG GATAATGCCT CATTGATGGA TATCAACGGA GACGGCCAAC 5105TGGATTGGGT TGTTACCGCC TCCGGTATTC GCGGATACCA TAGTCAGCAA CCCGATGGAA 5165AGTGGACGCA CTTTACGCCA ATCAATGCCT TGCCCGTGGA ATATTTTCAT CCAAGCATCC 5225AGTTCGCTGA CCTTACCGGG GCAGGCTTAT CTGATTTAGT GTTGATCGGG CCGAAAAGCG 5285TGCGTCTATA TGCCAACCAG CGAAACGGCT GGCGTAAAGG AGAAGATGTC CCCCAATCCA 5345CAGGTATCAC CCTGCCTGTC ACAGGGACCG ATGCCCGCAA ACTGGTGGCT TTCAGTGATA 5405TGCTCGGTTC CGGTCAACAA CATCTGGTGG AAATCAAGGG TAATCGCGTC ACCTGTTGGC 5465CGAATCTAGG GCATGGCCGT TTCGGTCAAC CACTAACTCT GTCAGGATTT AGCCAGCCCG 5525AAAATAGCTT CAATCCCGAA CGGCTGTTTC TGGCGGATAT CGACGGCTCC GGCACCACCG 5585ACCTTATCTA TGCGCAATCC GGCTCTTTGC TCATTTATCT CAACCAAAGT GGTAATCAGT 5645TTGATGCCCC GTTGACATTA GCGTTGCCAG AAGGCGTACA ATTTGACAAC ACTTGCCAAC 5705TTCAAGTCGC CGATATTCAG GGATTAGGGA TAGCCAGCTT GATTCTGACT GTGCCACATA 5765TCGCGCCACA TCACTGGCGT TGTGACCTGT CACTGACCAA ACCCTGGTTG TTGAATGTAA 5825TGAACAATAA CCGGGGCGCA CATCACACGC TACATTATCG TAGTTCCGCG CAATTCTGGT 5885TGGATGAAAA ATTACAGCTC ACCAAAGCAG GCAAATCTCC GGCTTGTTAT CTGCCGTTTC 5945CAATGCATTT GCTATGGTAT ACCGAAATTC AGGATGAAAT CAGCGGCAAC CGGCTCACCA 6005GTGAAGTCAA CTACAGCCAC GGCGTCTGGG ATGGTAAAGA GCGGGAATTC 6055 1189 amino acids amino acid linear protein 26Met Ser Glu Ser Leu Phe Thr Gln Thr Leu Lys Glu Ala Arg Arg Asp1 5 10 15Ala Leu Val Ala His Tyr Ile Ala Thr Gln Val Pro Ala Asp Leu Lys 20 25 30Glu Ser Ile Gln Thr Ala Asp Asp Leu Tyr Glu Tyr Leu Leu Leu Asp 35 40 45Thr Lys Ile Ser Asp Leu Val Thr Thr Ser Pro Leu Ser Glu Ala Ile 50 55 60Gly Ser Leu Gln Leu Phe Ile His Arg Ala Ile Glu Gly Tyr Asp Gly65 70 75 80Thr Leu Ala Asp Ser Ala Lys Pro Tyr Phe Ala Asp Glu Gln Phe Leu 85 90 95Tyr Asn Trp Asp Ser Phe Asn His Arg Tyr Ser Thr Trp Ala Gly Lys 100 105 110Glu Arg Leu Lys Phe Tyr Ala Gly Asp Tyr Ile Asp Pro Thr Leu Arg 115 120 125Leu Asn Lys Thr Glu Ile Phe Thr Ala Phe Glu Gln Gly Ile Ser Gln 130 135 140Gly Lys Leu Lys Ser Glu Leu Val Glu Ser Lys Leu Arg Asp Tyr Leu145 150 155 160Ile Ser Tyr Asp Thr Leu Ala Thr Leu Asp Tyr Ile Thr Ala Cys Gln 165 170 175Gly Lys Asp Asn Lys Thr Ile Phe Phe Ile Gly Arg Thr Gln Asn Ala 180 185 190Pro Tyr Ala Phe Tyr Trp Arg Lys Leu Thr Leu Val Thr Asp Gly Gly 195 200 205Lys Leu Lys Pro Asp Gln Trp Ser Glu Trp Arg Ala Ile Asn Ala Gly 210 215 220Ile Ser Glu Ala Tyr Ser Gly His Val Glu Pro Phe Trp Glu Asn Asn225 230 235 240Lys Leu His Ile Arg Trp Phe Thr Ile Ser Lys Glu Asp Lys Ile Asp 245 250 255Phe Val Tyr Lys Asn Ile Trp Val Met Ser Ser Asp Tyr Ser Trp Ala 260 265 270Ser Lys Lys Lys Ile Leu Glu Leu Ser Phe Thr Asp Tyr Asn Arg Val 275 280 285Gly Ala Thr Gly Ser Ser Ser Pro Thr Glu Val Ala Ser Gln Tyr Gly 290 295 300Ser Asp Ala Gln Met Asn Ile Ser Asp Asp Gly Thr Val Leu Ile Phe305 310 315 320Gln Asn Ala Gly Gly Ala Thr Pro Ser Thr Gly Val Thr Leu Cys Tyr 325 330 335Asp Ser Gly Asn Val Ile Lys Asn Leu Ser Ser Thr Gly Ser Ala Asn 340 345 350Leu Ser Ser Lys Asp Tyr Ala Thr Thr Lys Leu Arg Met Cys His Gly 355 360 365Gln Ser Tyr Asn Asp Asn Asn Tyr Cys Asn Phe Thr Leu Ser Ile Asn 370 375 380Thr Ile Glu Phe Thr Ser Tyr Gly Thr Phe Ser Ser Asp Gly Lys Gln385 390 395 400Phe Thr Pro Pro Ser Gly Ser Ala Ile Asp Leu His Leu Pro Asn Tyr 405 410 415Val Asp Leu Asn Ala Leu Leu Asp Ile Ser Leu Asp Ser Leu Leu Asn 420 425 430Tyr Asp Val Gln Gly Gln Phe Gly Gly Ser Asn Pro Val Asp Asn Phe 435 440 445Ser Gly Pro Tyr Gly Ile Tyr Leu Trp Glu Ile Phe Phe His Ile Pro 450 455 460Phe Leu Val Thr Val Arg Met Gln Thr Glu Gln Arg Tyr Glu Asp Ala465 470 475 480Asp Thr Trp Tyr Lys Tyr Ile Phe Arg Ser Ala Gly Tyr Arg Asp Ala 485 490 495Asn Gly Gln Leu Ile Met Asp Gly Ser Lys Pro Arg Tyr Trp Asn Val 500 505 510Met Pro Leu Gln Leu Asp Thr Ala Trp Asp Thr Thr Gln Pro Ala Thr 515 520 525Thr Asp Pro Asp Val Ile Ala Met Ala Asp Pro Met His Tyr Lys Leu 530 535 540Ala Ile Phe Leu His Thr Leu Asp Leu Leu Ile Ala Arg Gly Asp Ser545 550 555 560Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Val Glu Ala Lys Met Tyr 565 570 575Tyr Ile Gln Ala Gln Gln Leu Leu Gly Pro Arg Pro Asp Ile His Thr 580 585 590Thr Asn Thr Trp Pro Asn Pro Thr Leu Ser Lys Glu Ala Gly Ala Ile 595 600 605Ala Thr Pro Thr Phe Leu Ser Ser Pro Glu Val Met Thr Phe Ala Ala 610 615 620Trp Leu Ser Ala Gly Asp Thr Ala Asn Ile Gly Asp Gly Asp Phe Leu625 630 635 640Pro Pro Tyr Asn Asp Val Leu Leu Gly Tyr Trp Asp Lys Leu Glu Leu 645 650 655Arg Leu Tyr Asn Leu Arg His Asn Leu Ser Leu Asp Gly Gln Pro Leu 660 665 670Asn Leu Pro Leu Tyr Ala Thr Pro Val Asp Pro Lys Thr Leu Gln Arg 675 680 685Gln Gln Ala Gly Gly Asp Gly Thr Gly Ser Ser Pro Ala Gly Gly Gln 690 695 700Gly Ser Val Gln Gly Trp Arg Tyr Pro Leu Leu Val Glu Arg Ala Arg705 710 715 720Ser Ala Val Ser Leu Leu Thr Gln Phe Gly Asn Ser Leu Gln Thr Thr 725 730 735Leu Glu His Gln Asp Asn Glu Lys Met Thr Ile Leu Leu Gln Thr Gln 740 745 750Gln Glu Ala Ile Leu Lys His Gln His Asp Ile Gln Gln Asn Asn Leu 755 760 765Lys Gly Leu Gln His Ser Leu Thr Ala Leu Gln Ala Ser Arg Asp Gly 770 775 780Asp Thr Leu Arg Gln Lys His Tyr Ser Asp Leu Ile Asn Gly Gly Leu785 790 795 800Ser Ala Ala Glu Ile Ala Gly Leu Thr Leu Arg Ser Thr Ala Met Ile 805 810 815Thr Asn Gly Val Ala Thr Gly Leu Leu Ile Ala Gly Gly Ile Ala Asn 820 825 830Ala Val Pro Asn Val Phe Gly Leu Ala Asn Gly Gly Ser Glu Trp Gly 835 840 845Ala Pro Leu Ile Gly Ser Gly Gln Ala Thr Gln Val Gly Ala Gly Ile 850 855 860Gln Asp Gln Ser Ala Gly Ile Ser Glu Val Thr Ala Gly Tyr Gln Arg865 870 875 880Arg Gln Glu Glu Trp Ala Leu Gln Arg Asp Ile Ala Asp Asn Glu Ile 885 890 895Thr Gln Leu Asp Ala Gln Ile Gln Ser Leu Gln Glu Gln Ile Thr Met 900 905 910Ala Gln Lys Gln Ile Thr Leu Ser Glu Thr Glu Gln Ala Asn Ala Gln 915 920 925Ala Ile Tyr Asp Leu Gln Thr Thr Arg Phe Thr Gly Gln Ala Leu Tyr 930 935 940Asn Trp Met Ala Gly Arg Leu Ser Ala Leu Tyr Tyr Gln Met Tyr Asp945 950 955 960Ser Thr Leu Pro Ile Cys Leu Gln Pro Lys Ala Ala Leu Val Gln Glu 965 970 975Leu Gly Glu Lys Glu Ser Asp Ser Leu Phe Gln Val Pro Val Trp Asn 980 985 990Asp Leu Trp Gln Gly Leu Leu Ala Gly Glu Gly Leu Ser Ser Glu Leu 995 1000 1005Gln Lys Leu Asp Ala Ile Trp Leu Ala Arg Gly Gly Ile Gly Leu Glu 1010 1015 1020Ala Ile Arg Thr Val Ser Leu Asp Thr Leu Phe Gly Thr Gly Thr Leu1025 1030 1035 1040Ser Glu Asn Ile Asn Lys Val Leu Asn Gly Glu Thr Val Ser Pro Ser 1045 1050 1055Gly Gly Val Thr Leu Ala Leu Thr Gly Asp Ile Phe Gln Ala Thr Leu 1060 1065 1070Asp Leu Ser Gln Leu Gly Leu Asp Asn Ser Tyr Asn Leu Gly Asn Glu 1075 1080 1085Lys Lys Arg Arg Ile Lys Arg Ile Ala Val Thr Leu Pro Thr Leu Leu 1090 1095 1100Gly Pro Tyr Gln Asp Leu Glu Ala Thr Leu Val Met Gly Ala Glu Ile1105 1110 1115 1120Ala Ala Leu Ser His Gly Val Asn Asp Gly Gly Arg Phe Val Thr Asp 1125 1130 1135Phe Asn Asp Ser Arg Phe Leu Pro Phe Glu Gly Arg Asp Ala Thr Thr 1140 1145 1150Gly Thr Leu Glu Leu Asn Ile Phe His Ala Gly Lys Glu Gly Thr Gln 1155 1160 1165His Glu Leu Val Ala Asn Leu Ser Asp Ile Ile Val His Leu Asn Tyr 1170 1175 1180Ile Ile Arg Asp Ala1185 1881 base pairs nucleic acid double linear DNA (genomic) CDS 1..1881 27ATG TCT GAA TCT TTA TTT ACA CAA ACG TTG AAA GAA GCG CGC CGT GAT 48Met Ser Glu Ser Leu Phe Thr Gln Thr Leu Lys Glu Ala Arg Arg Asp1 5 10 15GCA TTG GTT GCT CAT TAT ATT GCT ACT CAG GTG CCC GCA GAT TTA AAA 96Ala Leu Val Ala His Tyr Ile Ala Thr Gln Val Pro Ala Asp Leu Lys 20 25 30GAG AGT ATC CAG ACC GCG GAT GAT CTG TAC GAA TAT CTG TTG CTG GAT 144Glu Ser Ile Gln Thr Ala Asp Asp Leu Tyr Glu Tyr Leu Leu Leu Asp 35 40 45ACC AAA ATT AGC GAT CTG GTT ACT ACT TCA CCG CTG TCC GAA GCG ATT 192Thr Lys Ile Ser Asp Leu Val Thr Thr Ser Pro Leu Ser Glu Ala Ile 50 55 60GGC AGT CTG CAA TTG TTT ATT CAT CGT GCG ATA GAG GGC TAT GAC GGC 240Gly Ser Leu Gln Leu Phe Ile His Arg Ala Ile Glu Gly Tyr Asp Gly65 70 75 80ACG CTG GCA GAC TCA GCA AAA CCC TAT TTT GCC GAT GAA CAG TTT TTA 288Thr Leu Ala Asp Ser Ala Lys Pro Tyr Phe Ala Asp Glu Gln Phe Leu 85 90 95TAT AAC TGG GAT AGT TTT AAC CAC CGT TAT AGC ACT TGG GCT GGC AAG 336Tyr Asn Trp Asp Ser Phe Asn His Arg Tyr Ser Thr Trp Ala Gly Lys 100 105 110GAA CGG TTG AAA TTC TAT GCC GGG GAT TAT ATT GAT CCA ACA TTG CGA 384Glu Arg Leu Lys Phe Tyr Ala Gly Asp Tyr Ile Asp Pro Thr Leu Arg 115 120 125TTG AAT AAG ACC GAG ATA TTT ACC GCA TTT GAA CAA GGT ATT TCT CAA 432Leu Asn Lys Thr Glu Ile Phe Thr Ala Phe Glu Gln Gly Ile Ser Gln 130 135 140GGG AAA TTA AAA AGT GAA TTA GTC GAA TCT AAA TTA CGT GAT TAT CTA 480Gly Lys Leu Lys Ser Glu Leu Val Glu Ser Lys Leu Arg Asp Tyr Leu145 150 155 160ATT AGT TAT GAC ACT TTA GCC ACC CTT GAT TAT ATT ACT GCC TGC CAA 528Ile Ser Tyr Asp Thr Leu Ala Thr Leu Asp Tyr Ile Thr Ala Cys Gln 165 170 175GGC AAA GAT AAT AAA ACC ATC TTC TTT ATT GGC CGT ACA CAG AAT GCA 576Gly Lys Asp Asn Lys Thr Ile Phe Phe Ile Gly Arg Thr Gln Asn Ala 180 185 190CCC TAT GCA TTT TAT TGG CGA AAA TTA ACT TTA GTC ACT GAT GGC GGT 624Pro Tyr Ala Phe Tyr Trp Arg Lys Leu Thr Leu Val Thr Asp Gly Gly 195 200 205AAG TTG AAA CCA GAT CAA TGG TCA GAG TGG CGA GCA ATT AAT GCC GGG 672Lys Leu Lys Pro Asp Gln Trp Ser Glu Trp Arg Ala Ile Asn Ala Gly 210 215 220ATT AGT GAG GCA TAT TCA GGG CAT GTC GAG CCT TTC TGG GAA AAT AAC 720Ile Ser Glu Ala Tyr Ser Gly His Val Glu Pro Phe Trp Glu Asn Asn225 230 235 240AAG CTG CAC ATC CGT TGG TTT ACT ATC TCG AAA GAA GAT AAA ATA GAT 768Lys Leu His Ile Arg Trp Phe Thr Ile Ser Lys Glu Asp Lys Ile Asp 245 250 255TTT GTT TAT AAA AAC ATC TGG GTG ATG AGT AGC GAT TAT AGC TGG GCA 816Phe Val Tyr Lys Asn Ile Trp Val Met Ser Ser Asp Tyr Ser Trp Ala 260 265 270TCA AAG AAA AAA ATC TTG GAA CTT TCT TTT ACT GAC TAC AAT AGA GTT 864Ser Lys Lys Lys Ile Leu Glu Leu Ser Phe Thr Asp Tyr Asn Arg Val 275 280 285GGA GCA ACA GGA TCA TCA AGC CCG ACT GAA GTA GCT TCA CAA TAT GGT 912Gly Ala Thr Gly Ser Ser Ser Pro Thr Glu Val Ala Ser Gln Tyr Gly 290 295 300TCT GAT GCT CAG ATG AAT ATT TCT GAT GAT GGG ACT GTA CTT ATT TTT 960Ser Asp Ala Gln Met Asn Ile Ser Asp Asp Gly Thr Val Leu Ile Phe305 310 315 320CAG AAT GCC GGC GGA GCT ACT CCC AGT ACT GGA GTG ACG TTA TGT TAT 1008Gln Asn Ala Gly Gly Ala Thr Pro Ser Thr Gly Val Thr Leu Cys Tyr 325 330 335GAC TCT GGC AAC GTG ATT AAG AAC CTA TCT AGT ACA GGA AGT GCA AAT 1056Asp Ser Gly Asn Val Ile Lys Asn Leu Ser Ser Thr Gly Ser Ala Asn 340 345 350TTA TCG TCA AAG GAT TAT GCC ACA ACT AAA TTA CGC ATG TGT CAT GGA 1104Leu Ser Ser Lys Asp Tyr Ala Thr Thr Lys Leu Arg Met Cys His Gly 355 360 365CAA AGT TAC AAT GAT AAT AAC TAC TGC AAT TTT ACA CTC TCT ATT AAT 1152Gln Ser Tyr Asn Asp Asn Asn Tyr Cys Asn Phe Thr Leu Ser Ile Asn 370 375 380ACA ATA GAA TTC ACC TCC TAC GGC ACA TTC TCA TCA GAT GGA AAA CAA 1200Thr Ile Glu Phe Thr Ser Tyr Gly Thr Phe Ser Ser Asp Gly Lys Gln385 390 395 400TTT ACA CCA CCT TCT GGT TCT GCC ATT GAT TTA CAC CTC CCT AAT TAT 1248Phe Thr Pro Pro Ser Gly Ser Ala Ile Asp Leu His Leu Pro Asn Tyr 405 410 415GTA GAT CTC AAC GCG CTA TTA GAT ATT AGC CTC GAT TCA CTA CTT AAT 1296Val Asp Leu Asn Ala Leu Leu Asp Ile Ser Leu Asp Ser Leu Leu Asn 420 425 430TAT GAC GTT CAG GGG CAG TTT GGC GGA TCT AAT CCG GTT GAT AAT TTC 1344Tyr Asp Val Gln Gly Gln Phe Gly Gly Ser Asn Pro Val Asp Asn Phe 435 440 445AGT GGT CCC TAT GGT ATT TAT CTA TGG GAA ATC TTC TTC CAT ATT CCG 1392Ser Gly Pro Tyr Gly Ile Tyr Leu Trp Glu Ile Phe Phe His Ile Pro 450 455 460TTC CTT GTT ACG GTC CGT ATG CAA ACC GAA CAA CGT TAC GAA GAC GCG 1440Phe Leu Val Thr Val Arg Met Gln Thr Glu Gln Arg Tyr Glu Asp Ala465 470 475 480GAC ACT TGG TAC AAA TAT ATT TTC CGC AGC GCC GGT TAT CGC GAT GCT 1488Asp Thr Trp Tyr Lys Tyr Ile Phe Arg Ser Ala Gly Tyr Arg Asp Ala 485 490 495AAT GGC CAG CTC ATT ATG GAT GGC AGT AAA CCA CGT TAT TGG AAT GTG 1536Asn Gly Gln Leu Ile Met Asp Gly Ser Lys Pro Arg Tyr Trp Asn Val 500 505 510ATG CCA TTG CAA CTG GAT ACC GCA TGG GAT ACC ACA CAG CCC GCC ACC 1584Met Pro Leu Gln Leu Asp Thr Ala Trp Asp Thr Thr Gln Pro Ala Thr 515 520 525ACT GAT CCA GAT GTG ATC GCT ATG GCG GAC CCG ATG CAT TAC AAG CTG 1632Thr Asp Pro Asp Val Ile Ala Met Ala Asp Pro Met His Tyr Lys Leu 530 535 540GCG ATA TTC CTG CAT ACC CTT GAT CTA TTG ATT GCC CGA GGC GAC AGC 1680Ala Ile Phe Leu His Thr Leu Asp Leu Leu Ile Ala Arg Gly Asp Ser545 550 555 560GCT TAC CGT CAA CTT GAA CGC GAT ACT CTA GTC GAA GCC AAA ATG TAC 1728Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Val Glu Ala Lys Met Tyr 565 570 575TAC ATT CAG GCA CAA CAG CTA CTG GGA CCG CGC CCT GAT ATC CAT ACC 1776Tyr Ile Gln Ala Gln Gln Leu Leu Gly Pro Arg Pro Asp Ile His Thr 580 585 590ACC AAT ACT TGG CCA AAT CCC ACC TTG AGT AAA GAA GCT GGC GCT ATT 1824Thr Asn Thr Trp Pro Asn Pro Thr Leu Ser Lys Glu Ala Gly Ala Ile 595 600 605GCC ACA CCG ACA TTC CTC AGT TCA CCG GAG GTG ATG ACG TTC GCT GCC 1872Ala Thr Pro Thr Phe Leu Ser Ser Pro Glu Val Met Thr Phe Ala Ala 610 615 620TGG CTA AGC 1881Trp Leu Ser625 627 amino acids amino acid linear protein 28Met Ser Glu Ser Leu Phe Thr Gln Thr Leu Lys Glu Ala Arg Arg Asp1 5 10 15Ala Leu Val Ala His Tyr Ile Ala Thr Gln Val Pro Ala Asp Leu Lys 20 25 30Glu Ser Ile Gln Thr Ala Asp Asp Leu Tyr Glu Tyr Leu Leu Leu Asp 35 40 45Thr Lys Ile Ser Asp Leu Val Thr Thr Ser Pro Leu Ser Glu Ala Ile 50 55 60Gly Ser Leu Gln Leu Phe Ile His Arg Ala Ile Glu Gly Tyr Asp Gly65 70 75 80Thr Leu Ala Asp Ser Ala Lys Pro Tyr Phe Ala Asp Glu Gln Phe Leu 85 90 95Tyr Asn Trp Asp Ser Phe Asn His Arg Tyr Ser Thr Trp Ala Gly Lys 100 105 110Glu Arg Leu Lys Phe Tyr Ala Gly Asp Tyr Ile Asp Pro Thr Leu Arg 115 120 125Leu Asn Lys Thr Glu Ile Phe Thr Ala Phe Glu Gln Gly Ile Ser Gln 130 135 140Gly Lys Leu Lys Ser Glu Leu Val Glu Ser Lys Leu Arg Asp Tyr Leu145 150 155 160Ile Ser Tyr Asp Thr Leu Ala Thr Leu Asp Tyr Ile Thr Ala Cys Gln 165 170 175Gly Lys Asp Asn Lys Thr Ile Phe Phe Ile Gly Arg Thr Gln Asn Ala 180 185 190Pro Tyr Ala Phe Tyr Trp Arg Lys Leu Thr Leu Val Thr Asp Gly Gly 195 200 205Lys Leu Lys Pro Asp Gln Trp Ser Glu Trp Arg Ala Ile Asn Ala Gly 210 215 220Ile Ser Glu Ala Tyr Ser Gly His Val Glu Pro Phe Trp Glu Asn Asn225 230 235 240Lys Leu His Ile Arg Trp Phe Thr Ile Ser Lys Glu Asp Lys Ile Asp 245 250 255Phe Val Tyr Lys Asn Ile Trp Val Met Ser Ser Asp Tyr Ser Trp Ala 260 265 270Ser Lys Lys Lys Ile Leu Glu Leu Ser Phe Thr Asp Tyr Asn Arg Val 275 280 285Gly Ala Thr Gly Ser Ser Ser Pro Thr Glu Val Ala Ser Gln Tyr Gly 290 295 300Ser Asp Ala Gln Met Asn Ile Ser Asp Asp Gly Thr Val Leu Ile Phe305 310 315 320Gln Asn Ala Gly Gly Ala Thr Pro Ser Thr Gly Val Thr Leu Cys Tyr 325 330 335Asp Ser Gly Asn Val Ile Lys Asn Leu Ser Ser Thr Gly Ser Ala Asn 340 345 350Leu Ser Ser Lys Asp Tyr Ala Thr Thr Lys Leu Arg Met Cys His Gly 355 360 365Gln Ser Tyr Asn Asp Asn Asn Tyr Cys Asn Phe Thr Leu Ser Ile Asn 370 375 380Thr Ile Glu Phe Thr Ser Tyr Gly Thr Phe Ser Ser Asp Gly Lys Gln385 390 395 400Phe Thr Pro Pro Ser Gly Ser Ala Ile Asp Leu His Leu Pro Asn Tyr 405 410 415Val Asp Leu Asn Ala Leu Leu Asp Ile Ser Leu Asp Ser Leu Leu Asn 420 425 430Tyr Asp Val Gln Gly Gln Phe Gly Gly Ser Asn Pro Val Asp Asn Phe 435 440 445Ser Gly Pro Tyr Gly Ile Tyr Leu Trp Glu Ile Phe Phe His Ile Pro 450 455 460Phe Leu Val Thr Val Arg Met Gln Thr Glu Gln Arg Tyr Glu Asp Ala465 470 475 480Asp Thr Trp Tyr Lys Tyr Ile Phe Arg Ser Ala Gly Tyr Arg Asp Ala 485 490 495Asn Gly Gln Leu Ile Met Asp Gly Ser Lys Pro Arg Tyr Trp Asn Val 500 505 510Met Pro Leu Gln Leu Asp Thr Ala Trp Asp Thr Thr Gln Pro Ala Thr 515 520 525Thr Asp Pro Asp Val Ile Ala Met Ala Asp Pro Met His Tyr Lys Leu 530 535 540Ala Ile Phe Leu His Thr Leu Asp Leu Leu Ile Ala Arg Gly Asp Ser545 550 555 560Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Val Glu Ala Lys Met Tyr 565 570 575Tyr Ile Gln Ala Gln Gln Leu Leu Gly Pro Arg Pro Asp Ile His Thr 580 585 590Thr Asn Thr Trp Pro Asn Pro Thr Leu Ser Lys Glu Ala Gly Ala Ile 595 600 605Ala Thr Pro Thr Phe Leu Ser Ser Pro Glu Val Met Thr Phe Ala Ala 610 615 620Trp Leu Ser625 1689 base pairs nucleic acid double linear DNA (genomic) CDS 1..1689 29GCA GGC GAT ACC GCA AAT ATT GGC GAC GGT GAT TTC TTG CCA CCG TAC 48Ala Gly Asp Thr Ala Asn Ile Gly Asp Gly Asp Phe Leu Pro Pro Tyr1 5 10 15AAC GAT GTA CTA CTC GGT TAC TGG GAT AAA CTT GAG TTA CGC CTA TAC 96Asn Asp Val Leu Leu Gly Tyr Trp Asp Lys Leu Glu Leu Arg Leu Tyr 20 25 30AAC CTG CGC CAC AAT CTG AGT CTG GAT GGT CAA CCG CTA AAT CTG CCA 144Asn Leu Arg His Asn Leu Ser Leu Asp Gly Gln Pro Leu Asn Leu Pro 35 40 45CTG TAT GCC ACG CCG GTA GAC CCG AAA ACC CTG CAA CGC CAG CAA GCC 192Leu Tyr Ala Thr Pro Val Asp Pro Lys Thr Leu Gln Arg Gln Gln Ala 50 55 60GGA GGG GAC GGT ACA GGC AGT AGT CCG GCT GGT GGT CAA GGC AGT GTT 240Gly Gly Asp Gly Thr Gly Ser Ser Pro Ala Gly Gly Gln Gly Ser Val65 70 75 80CAG GGC TGG CGC TAT CCG TTA TTG GTA GAA CGC GCC CGC TCT GCC GTG 288Gln Gly Trp Arg Tyr Pro Leu Leu Val Glu Arg Ala Arg Ser Ala Val 85 90 95AGT TTG TTG ACT CAG TTC GGC AAC AGC TTA CAA ACA ACG TTA GAA CAT 336Ser Leu Leu Thr Gln Phe Gly Asn Ser Leu Gln Thr Thr Leu Glu His 100 105 110CAG GAT AAT GAA AAA ATG ACG ATA CTG TTG CAG ACT CAA CAG GAA GCC 384Gln Asp Asn Glu Lys Met Thr Ile Leu Leu Gln Thr Gln Gln Glu Ala 115 120 125ATC CTG AAA CAT CAG CAC GAT ATA CAA CAA AAT AAT CTA AAA GGA TTA 432Ile Leu Lys His Gln His Asp Ile Gln Gln Asn Asn Leu Lys Gly Leu 130 135 140CAA CAC AGC CTG ACC GCA TTA CAG GCT AGC CGT GAT GGC GAC ACA TTG 480Gln His Ser Leu Thr Ala Leu Gln Ala Ser Arg Asp Gly Asp Thr Leu145 150 155 160CGG CAA AAA CAT TAC AGC GAC CTG ATT AAC GGT GGT CTA TCT GCG GCA 528Arg Gln Lys His Tyr Ser Asp Leu Ile Asn Gly Gly Leu Ser Ala Ala 165 170 175GAA ATC GCC GGT CTG ACA CTA CGC AGC ACC GCC ATG ATT ACC AAT GGC 576Glu Ile Ala Gly Leu Thr Leu Arg Ser Thr Ala Met Ile Thr Asn Gly 180 185 190GTT GCA ACG GGA TTG CTG ATT GCC GGC GGA ATC GCC AAC GCG GTA CCT 624Val Ala Thr Gly Leu Leu Ile Ala Gly Gly Ile Ala Asn Ala Val Pro 195 200 205AAC GTC TTC GGG CTG GCT AAC GGT GGA TCG GAA TGG GGA GCG CCA TTA 672Asn Val Phe Gly Leu Ala Asn Gly Gly Ser Glu Trp Gly Ala Pro Leu 210 215 220ATT GGC TCC GGG CAA GCA ACC CAA GTT GGC GCC GGC ATC CAG GAT CAG 720Ile Gly Ser Gly Gln Ala Thr Gln Val Gly Ala Gly Ile Gln Asp Gln225 230 235 240AGC GCG GGC ATT TCA GAA GTG ACA GCA GGC TAT CAG CGT CGT CAG GAA 768Ser Ala Gly Ile Ser Glu Val Thr Ala Gly Tyr Gln Arg Arg Gln Glu 245 250 255GAA TGG GCA TTG CAA CGG GAT ATT GCT GAT AAC GAA ATA ACC CAA CTG 816Glu Trp Ala Leu Gln Arg Asp Ile Ala Asp Asn Glu Ile Thr Gln Leu 260 265 270GAT GCC CAG ATA CAA AGC CTG CAA GAG CAA ATC ACG ATG GCA CAA AAA 864Asp Ala Gln Ile Gln Ser Leu Gln Glu Gln Ile Thr Met Ala Gln Lys 275 280 285CAG ATC ACG CTC TCT GAA ACC GAA CAA GCG AAT GCC CAA GCG ATT TAT 912Gln Ile Thr Leu Ser Glu Thr Glu Gln Ala Asn Ala Gln Ala Ile Tyr 290 295 300GAC CTG CAA ACC ACT CGT TTT ACC GGG CAG GCA CTG TAT AAC TGG ATG 960Asp Leu Gln Thr Thr Arg Phe Thr Gly Gln Ala Leu Tyr Asn Trp Met305 310 315 320GCC GGT CGT CTC TCC GCG CTC TAT TAC CAA ATG TAT GAT TCC ACT CTG 1008Ala Gly Arg Leu Ser Ala Leu Tyr Tyr Gln Met Tyr Asp Ser Thr Leu 325 330 335CCA ATC TGT CTC CAG CCA AAA GCC GCA TTA GTA CAG GAA TTA GGC GAG 1056Pro Ile Cys Leu Gln Pro Lys Ala Ala Leu Val Gln Glu Leu Gly Glu 340 345 350AAA GAG AGC GAC AGT CTT TTC CAG GTT CCG GTG TGG AAT GAT CTG TGG 1104Lys Glu Ser Asp Ser Leu Phe Gln Val Pro Val Trp Asn Asp Leu Trp 355 360 365CAA GGG CTG TTA GCA GGA GAA GGT TTA AGT TCA GAG CTA CAG AAA CTG 1152Gln Gly Leu Leu Ala Gly Glu Gly Leu Ser Ser Glu Leu Gln Lys Leu 370 375 380GAT GCC ATC TGG CTT GCA CGT GGT GGT ATT GGG CTA GAA GCC ATC CGC 1200Asp Ala Ile Trp Leu Ala Arg Gly Gly Ile Gly Leu Glu Ala Ile Arg385 390 395 400ACC GTG TCG CTG GAT ACC CTG TTT GGC ACA GGG ACG TTA AGT GAA AAT 1248Thr Val Ser Leu Asp Thr Leu Phe Gly Thr Gly Thr Leu Ser Glu Asn 405 410 415ATC AAT AAA GTG CTT AAC GGG GAA ACG GTA TCT CCA TCC GGT GGC GTC 1296Ile Asn Lys Val Leu Asn Gly Glu Thr Val Ser Pro Ser Gly Gly Val 420 425 430ACT CTG GCG CTG ACA GGG GAT ATC TTC CAA GCA ACA CTG GAT TTG AGT 1344Thr Leu Ala Leu Thr Gly Asp Ile Phe Gln Ala Thr Leu Asp Leu Ser 435 440 445CAG CTA GGT TTG GAT AAC TCT TAC AAC TTG GGT AAC GAG AAG AAA CGT 1392Gln Leu Gly Leu Asp Asn Ser Tyr Asn Leu Gly Asn Glu Lys Lys Arg 450 455 460CGT ATT AAA CGT ATC GCC GTC ACC CTG CCA ACA CTT CTG GGG CCA TAT 1440Arg Ile Lys Arg Ile Ala Val Thr Leu Pro Thr Leu Leu Gly Pro Tyr465 470 475 480CAA GAT CTT GAA GCC ACA CTG GTA ATG GGT GCG GAA ATC GCC GCC TTA 1488Gln Asp Leu Glu Ala Thr Leu Val Met Gly Ala Glu Ile Ala Ala Leu 485 490 495TCA CAC GGT GTG AAT GAC GGA GGC CGG TTT GTT ACC GAC TTT AAC GAC 1536Ser His Gly Val Asn Asp Gly Gly Arg Phe Val Thr Asp Phe Asn Asp 500 505 510AGC CGT TTT CTG CCT TTT GAA GGT CGA GAT GCA ACA ACC GGC ACA CTG 1584Ser Arg Phe Leu Pro Phe Glu Gly Arg Asp Ala Thr Thr Gly Thr Leu 515 520 525GAG CTC AAT ATT TTC CAT GCG GGT AAA GAG GGA ACG CAA CAC GAG TTG 1632Glu Leu Asn Ile Phe His Ala Gly Lys Glu Gly Thr Gln His Glu Leu 530 535 540GTC GCG AAT CTG AGT GAC ATC ATT GTG CAT CTG AAT TAC ATC ATT CGA 1680Val Ala Asn Leu Ser Asp Ile Ile Val His Leu Asn Tyr Ile Ile Arg545 550 555 560GAC GCG TAA 1689Asp Ala 562 amino acids amino acid linear protein 30Ala Gly Asp Thr Ala Asn Ile Gly Asp Gly Asp Phe Leu Pro Pro Tyr1 5 10 15Asn Asp Val Leu Leu Gly Tyr Trp Asp Lys Leu Glu Leu Arg Leu Tyr 20 25 30Asn Leu Arg His Asn Leu Ser Leu Asp Gly Gln Pro Leu Asn Leu Pro 35 40 45Leu Tyr Ala Thr Pro Val Asp Pro Lys Thr Leu Gln Arg Gln Gln Ala 50 55 60Gly Gly Asp Gly Thr Gly Ser Ser Pro Ala Gly Gly Gln Gly Ser Val65 70 75 80Gln Gly Trp Arg Tyr Pro Leu Leu Val Glu Arg Ala Arg Ser Ala Val 85 90 95Ser Leu Leu Thr Gln Phe Gly Asn Ser Leu Gln Thr Thr Leu Glu His 100 105 110Gln Asp Asn Glu Lys Met Thr Ile Leu Leu Gln Thr Gln Gln Glu Ala 115 120 125Ile Leu Lys His Gln His Asp Ile Gln Gln Asn Asn Leu Lys Gly Leu 130 135 140Gln His Ser Leu Thr Ala Leu Gln Ala Ser Arg Asp Gly Asp Thr Leu145 150 155 160Arg Gln Lys His Tyr Ser Asp Leu Ile Asn Gly Gly Leu Ser Ala Ala 165 170 175Glu Ile Ala Gly Leu Thr Leu Arg Ser Thr Ala Met Ile Thr Asn Gly 180 185 190Val Ala Thr Gly Leu Leu Ile Ala Gly Gly Ile Ala Asn Ala Val Pro 195 200 205Asn Val Phe Gly Leu Ala Asn Gly Gly Ser Glu Trp Gly Ala Pro Leu 210 215 220Ile Gly Ser Gly Gln Ala Thr Gln Val Gly Ala Gly Ile Gln Asp Gln225 230 235 240Ser Ala Gly Ile Ser Glu Val Thr Ala Gly Tyr Gln Arg Arg Gln Glu 245 250 255Glu Trp Ala Leu Gln Arg Asp Ile Ala Asp Asn Glu Ile Thr Gln Leu 260 265 270Asp Ala Gln Ile Gln Ser Leu Gln Glu Gln Ile Thr Met Ala Gln Lys 275 280 285Gln Ile Thr Leu Ser Glu Thr Glu Gln Ala Asn Ala Gln Ala Ile Tyr 290 295 300Asp Leu Gln Thr Thr Arg Phe Thr Gly Gln Ala Leu Tyr Asn Trp Met305 310 315 320Ala Gly Arg Leu Ser Ala Leu Tyr Tyr Gln Met Tyr Asp Ser Thr Leu 325 330 335Pro Ile Cys Leu Gln Pro Lys Ala Ala Leu Val Gln Glu Leu Gly Glu 340 345 350Lys Glu Ser Asp Ser Leu Phe Gln Val Pro Val Trp Asn Asp Leu Trp 355 360 365Gln Gly Leu Leu Ala Gly Glu Gly Leu Ser Ser Glu Leu Gln Lys Leu 370 375 380Asp Ala Ile Trp Leu Ala Arg Gly Gly Ile Gly Leu Glu Ala Ile Arg385 390 395 400Thr Val Ser Leu Asp Thr Leu Phe Gly Thr Gly Thr Leu Ser Glu Asn 405 410 415Ile Asn Lys Val Leu Asn Gly Glu Thr Val Ser Pro Ser Gly Gly Val 420 425 430Thr Leu Ala Leu Thr Gly Asp Ile Phe Gln Ala Thr Leu Asp Leu Ser 435 440 445Gln Leu Gly Leu Asp Asn Ser Tyr Asn Leu Gly Asn Glu Lys Lys Arg 450 455 460Arg Ile Lys Arg Ile Ala Val Thr Leu Pro Thr Leu Leu Gly Pro Tyr465 470 475 480Gln Asp Leu Glu Ala Thr Leu Val Met Gly Ala Glu Ile Ala Ala Leu 485 490 495Ser His Gly Val Asn Asp Gly Gly Arg Phe Val Thr Asp Phe Asn Asp 500 505 510Ser Arg Phe Leu Pro Phe Glu Gly Arg Asp Ala Thr Thr Gly Thr Leu 515 520 525Glu Leu Asn Ile Phe His Ala Gly Lys Glu Gly Thr Gln His Glu Leu 530 535 540Val Ala Asn Leu Ser Asp Ile Ile Val His Leu Asn Tyr Ile Ile Arg545 550 555 560Asp Ala 4458 base pairs nucleic acid double linear DNA (genomic) CDS 1..4458 31ATG CAG GAT TCA CCA GAA GTA TCG ATT ACA ACG CTG TCA CTT CCC AAA 48Met Gln Asp Ser Pro Glu Val Ser Ile Thr Thr Leu Ser Leu Pro Lys1 5 10 15GGT GGC GGT GCT ATC AAT GGC ATG GGA GAA GCA CTG AAT GCT GCC GGC 96Gly Gly Gly Ala Ile Asn Gly Met Gly Glu Ala Leu Asn Ala Ala Gly 20 25 30CCT GAT GGA ATG GCC TCC CTA TCT CTG CCA TTA CCC CTT TCG ACC GGC 144Pro Asp Gly Met Ala Ser Leu Ser Leu Pro Leu Pro Leu Ser Thr Gly 35 40 45AGA GGG ACG GCT CCT GGA TTA TCG CTG ATT TAC AGC AAC AGT GCA GGT 192Arg Gly Thr Ala Pro Gly Leu Ser Leu Ile Tyr Ser Asn Ser Ala Gly 50 55 60AAT GGG CCT TTC GGC ATC GGC TGG CAA TGC GGT GTT ATG TCC ATT AGC 240Asn Gly Pro Phe Gly Ile Gly Trp Gln Cys Gly Val Met Ser Ile Ser65 70 75 80CGA CGC ACC CAA CAT GGC ATT CCA CAA TAC GGT AAT GAC GAC ACG TTC 288Arg Arg Thr Gln His Gly Ile Pro Gln Tyr Gly Asn Asp Asp Thr Phe 85 90 95CTA TCC CCA CAA GGC GAG GTC ATG AAT ATC GCC CTG AAT GAC CAA GGG 336Leu Ser Pro Gln Gly Glu Val Met Asn Ile Ala Leu Asn Asp Gln Gly 100 105 110CAA CCT GAT ATC CGT CAA GAC GTT AAA ACG CTG CAA GGC GTT ACC TTG 384Gln Pro Asp Ile Arg Gln Asp Val Lys Thr Leu Gln Gly Val Thr Leu 115 120 125CCA ATT TCC TAT ACC GTG ACC CGC TAT CAA GCC CGC CAG ATC CTG GAT 432Pro Ile Ser Tyr Thr Val Thr Arg Tyr Gln Ala Arg Gln Ile Leu Asp 130 135 140TTC AGT AAA ATC GAA TAC TGG CAA CCT GCC TCC GGT CAA GAA GGA CGC 480Phe Ser Lys Ile Glu Tyr Trp Gln Pro Ala Ser Gly Gln Glu Gly Arg145 150 155 160GCT TTC TGG CTG ATA TCG ACA CCG GAC GGG CAT CTA CAC ATC TTA GGG 528Ala Phe Trp Leu Ile Ser Thr Pro Asp Gly His Leu His Ile Leu Gly 165 170 175AAA ACC GCG CAG GCT TGT CTG GCA AAT CCG CAA AAT GAC CAA CAA ATC 576Lys Thr Ala Gln Ala Cys Leu Ala Asn Pro Gln Asn Asp Gln Gln Ile 180 185 190GCC CAG TGG TTG CTG GAA GAA ACT GTG ACG CCA GCC GGT GAA CAT GTC 624Ala Gln Trp Leu Leu Glu Glu Thr Val Thr Pro Ala Gly Glu His Val 195 200 205AGC TAT CAA TAT CGA GCC GAA GAT GAA GCC CAT TGT GAC GAC AAT GAA 672Ser Tyr Gln Tyr Arg Ala Glu Asp Glu Ala His Cys Asp Asp Asn Glu 210 215 220AAA ACC GCT CAT CCC AAT GTT ACC GCA CAG CGC TAT CTG GTA CAG GTG 720Lys Thr Ala His Pro Asn Val Thr Ala Gln Arg Tyr Leu Val Gln Val225 230 235 240AAC TAC GGC AAC ATC AAA CCA CAA GCC AGC CTG TTC GTA CTG GAT AAC 768Asn Tyr Gly Asn Ile Lys Pro Gln Ala Ser Leu Phe Val Leu Asp Asn 245 250 255GCA CCT CCC GCA CCG GAA GAG TGG CTG TTT CAT CTG GTC TTT GAC CAC 816Ala Pro Pro Ala Pro Glu Glu Trp Leu Phe His Leu Val Phe Asp His 260 265 270GGT GAG CGC GAT ACC TCA CTT CAT ACC GTG CCA ACA TGG GAT GCA GGT 864Gly Glu Arg Asp Thr Ser Leu His Thr Val Pro Thr Trp Asp Ala Gly 275 280 285ACA GCG CAA TGG TCT GTA CGC CCG GAT ATC TTC TCT CGC TAT GAA TAT 912Thr Ala Gln Trp Ser Val Arg Pro Asp Ile Phe Ser Arg Tyr Glu Tyr 290 295 300GGT TTT GAA GTG CGT ACT CGC CGC TTA TGT CAA CAA GTG CTG ATG TTT 960Gly Phe Glu Val Arg Thr Arg Arg Leu Cys Gln Gln Val Leu Met Phe305 310 315 320CAC CGC ACC GCG CTC ATG GCC GGA GAA GCC AGT ACC AAT GAC GCC CCG 1008His Arg Thr Ala Leu Met Ala Gly Glu Ala Ser Thr Asn Asp Ala Pro 325 330 335GAA CTG GTT GGA CGC TTA ATA CTG GAA TAT GAC AAA AAC GCC AGC GTC 1056Glu Leu Val Gly Arg Leu Ile Leu Glu Tyr Asp Lys Asn Ala Ser Val 340 345 350ACC ACG TTG ATT ACC ATC CGT CAA TTA AGC CAT GAA TCG GAC GGG AGG 1104Thr Thr Leu Ile Thr Ile Arg Gln Leu Ser His Glu Ser Asp Gly Arg 355 360 365CCA GTC ACC CAG CCA CCA CTA GAA CTA GCC TGG CAA CGG TTT GAT CTG 1152Pro Val Thr Gln Pro Pro Leu Glu Leu Ala Trp Gln Arg Phe Asp Leu 370 375 380GAG AAA ATC CCG ACA TGG CAA CGC TTT GAC GCA CTA GAT AAT TTT AAC 1200Glu Lys Ile Pro Thr Trp Gln Arg Phe Asp Ala Leu Asp Asn Phe Asn385 390 395 400TCG CAG CAA CGT TAT CAA CTG GTT GAT CTG CGG GGA GAA GGG TTG CCA 1248Ser Gln Gln Arg Tyr Gln Leu Val Asp Leu Arg Gly Glu Gly Leu Pro 405 410 415GGT ATG CTG TAT CAA GAT CGA GGC GCT TGG TGG TAT AAA GCT CCG CAA 1296Gly Met Leu Tyr Gln Asp Arg Gly Ala Trp Trp Tyr Lys Ala Pro Gln 420 425 430CGT CAG GAA GAC GGA GAC AGC AAT GCC GTC ACT TAC GAC AAA ATC GCC 1344Arg Gln Glu Asp Gly Asp Ser Asn Ala Val Thr Tyr Asp Lys Ile Ala 435 440 445CCA CTG CCT ACC CTA CCC AAT TTG CAG GAT AAT GCC TCA TTG ATG GAT 1392Pro Leu Pro Thr Leu Pro Asn Leu Gln Asp Asn Ala Ser Leu Met Asp 450 455 460ATC AAC GGA GAC GGC CAA CTG GAT TGG GTT GTT ACC GCC TCC GGT ATT 1440Ile Asn Gly Asp Gly Gln Leu Asp Trp Val Val Thr Ala Ser Gly Ile465 470 475 480CGC GGA TAC CAT AGT CAG CAA CCC GAT GGA AAG TGG ACG CAC TTT ACG 1488Arg Gly Tyr His Ser Gln Gln Pro Asp Gly Lys Trp Thr His Phe Thr 485 490 495CCA ATC AAT GCC TTG CCC GTG GAA TAT TTT CAT CCA AGC ATC CAG TTC 1536Pro Ile Asn Ala Leu Pro Val Glu Tyr Phe His Pro Ser Ile Gln Phe 500 505 510GCT GAC CTT ACC GGG GCA GGC TTA TCT GAT TTA GTG TTG ATC GGG CCG 1584Ala Asp Leu Thr Gly Ala Gly Leu Ser Asp Leu Val Leu Ile Gly Pro 515 520 525AAA AGC GTG CGT CTA TAT GCC AAC CAG CGA AAC GGC TGG CGT AAA GGA 1632Lys Ser Val Arg Leu Tyr Ala Asn Gln Arg Asn Gly Trp Arg Lys Gly 530 535 540GAA GAT GTC CCC CAA TCC ACA GGT ATC ACC CTG CCT GTC ACA GGG ACC 1680Glu Asp Val Pro Gln Ser Thr Gly Ile Thr Leu Pro Val Thr Gly Thr545 550 555 560GAT GCC CGC AAA CTG GTG GCT TTC AGT GAT ATG CTC GGT TCC GGT CAA 1728Asp Ala Arg Lys Leu Val Ala Phe Ser Asp Met Leu Gly Ser Gly Gln 565 570 575CAA CAT CTG GTG GAA ATC AAG GGT AAT CGC GTC ACC TGT TGG CCG AAT 1776Gln His Leu Val Glu Ile Lys Gly Asn Arg Val Thr Cys Trp Pro Asn 580 585 590CTA GGG CAT GGC CGT TTC GGT CAA CCA CTA ACT CTG TCA GGA TTT AGC 1824Leu Gly His Gly Arg Phe Gly Gln Pro Leu Thr Leu Ser Gly Phe Ser 595 600 605CAG CCC GAA AAT AGC TTC AAT CCC GAA CGG CTG TTT CTG GCG GAT ATC 1872Gln Pro Glu Asn Ser Phe Asn Pro Glu Arg Leu Phe Leu Ala Asp Ile 610 615 620GAC GGC TCC GGC ACC ACC GAC CTT ATC TAT GCG CAA TCC GGC TCT TTG 1920Asp Gly Ser Gly Thr Thr Asp Leu Ile Tyr Ala Gln Ser Gly Ser Leu625 630 635 640CTC ATT TAT CTC AAC CAA AGT GGT AAT CAG TTT GAT GCC CCG TTG ACA 1968Leu Ile Tyr Leu Asn Gln Ser Gly Asn Gln Phe Asp Ala Pro Leu Thr 645 650 655TTA GCG TTG CCA GAA GGC GTA CAA TTT GAC AAC ACT TGC CAA CTT CAA 2016Leu Ala Leu Pro Glu Gly Val Gln Phe Asp Asn Thr Cys Gln Leu Gln 660 665 670GTC GCC GAT ATT CAG GGA TTA GGG ATA GCC AGC TTG ATT CTG ACT GTG 2064Val Ala Asp Ile Gln Gly Leu Gly Ile Ala Ser Leu Ile Leu Thr Val 675 680 685CCA CAT ATC GCG CCA CAT CAC TGG CGT TGT GAC CTG TCA CTG ACC AAA 2112Pro His Ile Ala Pro His His Trp Arg Cys Asp Leu Ser Leu Thr Lys 690 695 700CCC TGG TTG TTG AAT GTA ATG AAC AAT AAC CGG GGC GCA CAT CAC ACG 2160Pro Trp Leu Leu Asn Val Met Asn Asn Asn Arg Gly Ala His His Thr705 710 715 720CTA CAT TAT CGT AGT TCC GCG CAA TTC TGG TTG GAT GAA AAA TTA CAG 2208Leu His Tyr Arg Ser Ser Ala Gln Phe Trp Leu Asp Glu Lys Leu Gln 725 730 735CTC ACC AAA GCA GGC AAA TCT CCG GCT TGT TAT CTG CCG TTT CCA ATG 2256Leu Thr Lys Ala Gly Lys Ser Pro Ala Cys Tyr Leu Pro Phe Pro Met 740 745 750CAT TTG CTA TGG TAT ACC GAA ATT CAG GAT GAA ATC AGC GGC AAC CGG 2304His Leu Leu Trp Tyr Thr Glu Ile Gln Asp Glu Ile Ser Gly Asn Arg 755 760 765CTC ACC AGT GAA GTC AAC TAC AGC CAC GGC GTC TGG GAT GGT AAA GAG 2352Leu Thr Ser Glu Val Asn Tyr Ser His Gly Val Trp Asp Gly Lys Glu 770 775 780CGG GAA TTC AGA GGA TTT GGC TGC ATC AAA CAG ACA GAT ACC ACA ACG 2400Arg Glu Phe Arg Gly Phe Gly Cys Ile Lys Gln Thr Asp Thr Thr Thr785 790 795 800TTT TCT CAC GGC ACC GCC CCC GAA CAG GCG GCA CCG TCG CTG AGT ATT 2448Phe Ser His Gly Thr Ala Pro Glu Gln Ala Ala Pro Ser Leu Ser Ile 805 810 815AGC TGG TTT GCC ACC GGC ATG GAT GAA GTA GAC AGC CAA TTA GCT ACG 2496Ser Trp Phe Ala Thr Gly Met Asp Glu Val Asp Ser Gln Leu Ala Thr 820 825 830GAA TAT TGG CAG GCA GAC ACG CAA GCT TAT AGC GGA TTT GAA ACC CGT 2544Glu Tyr Trp Gln Ala Asp Thr Gln Ala Tyr Ser Gly Phe Glu Thr Arg 835 840 845TAT ACC GTC TGG GAT CAC ACC AAC CAG ACA GAC CAA GCA TTT ACC CCC 2592Tyr Thr Val Trp Asp His Thr Asn Gln Thr Asp Gln Ala Phe Thr Pro 850 855 860AAT GAG ACA CAA CGT AAC TGG CTG ACG CGA GCG CTT AAA GGC CAA CTG 2640Asn Glu Thr Gln Arg Asn Trp Leu Thr Arg Ala Leu Lys Gly Gln Leu865 870 875 880CTA CGC ACT GAG CTC TAC GGT CTG GAC GGA ACA GAT AAG CAA ACA GTG 2688Leu Arg Thr Glu Leu Tyr Gly Leu Asp Gly Thr Asp Lys Gln Thr Val 885 890 895CCT TAT ACC GTC AGT GAA TCG CGC TAT CAG GTA CGC TCT ATT CCC GTA 2736Pro Tyr Thr Val Ser Glu Ser Arg Tyr Gln Val Arg Ser Ile Pro Val 900 905 910AAT AAA GAA ACT GAA TTA TCT GCC TGG GTG ACT GCT ATT GAA AAT CGC 2784Asn Lys Glu Thr Glu Leu Ser Ala Trp Val Thr Ala Ile Glu Asn Arg 915 920 925AGC TAC CAC TAT GAA CGT ATC ATC ACT GAC CCA CAG TTC AGC CAG AGT 2832Ser Tyr His Tyr Glu Arg Ile Ile Thr Asp Pro Gln Phe Ser Gln Ser 930 935 940ATC AAG TTG CAA CAC GAT ATC TTT GGT CAA TCA CTG CAA AGT GTC GAT 2880Ile Lys Leu Gln His Asp Ile Phe Gly Gln Ser Leu Gln Ser Val Asp945 950 955 960ATT GCC TGG CCG CGC CGC GAA AAA CCA GCA GTG AAT CCC TAC CCG CCT 2928Ile Ala Trp Pro Arg Arg Glu Lys Pro Ala Val Asn Pro Tyr Pro Pro 965 970 975ACC CTG CCG GAA ACG CTA TTT GAC AGC AGC TAT GAT GAT CAA CAA CAA 2976Thr Leu Pro Glu Thr Leu Phe Asp Ser Ser Tyr Asp Asp Gln Gln Gln 980 985 990CTA TTA CGT CTG GTG AGA CAA AAA AAT AGC TGG CAT CAC CTG ACT GAT 3024Leu Leu Arg Leu Val Arg Gln Lys Asn Ser Trp His His Leu Thr Asp 995 1000 1005GGG GAA AAC TGG CGA TTA GGT TTA CCG AAT GCA CAA CGC CGT GAT GTT 3072Gly Glu Asn Trp Arg Leu Gly Leu Pro Asn Ala Gln Arg Arg Asp Val 1010 1015 1020TAT ACT TAT GAC CGG AGC AAA ATT CCA ACC GAA GGG ATT TCC CTT GAA 3120Tyr Thr Tyr Asp Arg Ser Lys Ile Pro Thr Glu Gly Ile Ser Leu Glu1025 1030 1035 1040ATC TTG CTG AAA GAT GAT GGC CTG CTA GCA GAT GAA AAA GCG GCC GTT 3168Ile Leu Leu Lys Asp Asp Gly Leu Leu Ala Asp Glu Lys Ala Ala Val 1045 1050 1055TAT CTG GGA CAA CAA CAG ACG TTT TAC ACC GCC GGT CAA GCG GAA GTC 3216Tyr Leu Gly Gln Gln Gln Thr Phe Tyr Thr Ala Gly Gln Ala Glu Val 1060 1065 1070ACT CTA GAA AAA CCC ACG TTA CAA GCA CTG GTC GCG TTC CAA GAA ACC 3264Thr Leu Glu Lys Pro Thr Leu Gln Ala Leu Val Ala Phe Gln Glu Thr 1075 1080 1085GCC ATG ATG GAC GAT ACC TCA TTA CAG GCG TAT GAA GGC GTG ATT GAA 3312Ala Met Met Asp Asp Thr Ser Leu Gln Ala Tyr Glu Gly Val Ile Glu 1090 1095 1100GAG CAA GAG TTG AAT ACC GCG CTG ACA CAG GCC GGT TAT CAG CAA GTC 3360Glu Gln Glu Leu Asn Thr Ala Leu Thr Gln Ala Gly Tyr Gln Gln Val1105 1110 1115 1120GCG CGG TTG TTT AAT ACC AGA TCA GAA AGC CCG GTA TGG GCG GCA CGG 3408Ala Arg Leu Phe Asn Thr Arg Ser Glu Ser Pro Val Trp Ala Ala Arg 1125 1130 1135CAA GGT TAT ACC GAT TAC GGT GAC GCC GCA CAG TTC TGG CGG CCT CAG 3456Gln Gly Tyr Thr Asp Tyr Gly Asp Ala Ala Gln Phe Trp Arg Pro Gln 1140 1145 1150GCT CAG CGT AAC TCG TTG CTG ACA GGG AAA ACC ACA CTG ACC TGG GAT 3504Ala Gln Arg Asn Ser Leu Leu Thr Gly Lys Thr Thr Leu Thr Trp Asp 1155 1160 1165ACC CAT CAT TGT GTA ATA ATA CAG ACT CAA GAT GCC GCT GGA TTA ACG 3552Thr His His Cys Val Ile Ile Gln Thr Gln Asp Ala Ala Gly Leu Thr 1170 1175 1180ACG CAA GCC CAT TAC GAT TAT CGT TTC CTT ACA CCG GTA CAA CTG ACA 3600Thr Gln Ala His Tyr Asp Tyr Arg Phe Leu Thr Pro Val Gln Leu Thr1185 1190 1195 1200GAT ATT AAT GAT AAT CAA CAT ATT GTG ACT CTG GAC GCG CTA GGT CGC 3648Asp Ile Asn Asp Asn Gln His Ile Val Thr Leu Asp Ala Leu Gly Arg 1205 1210 1215GTA ACC ACC AGC CGG TTC TGG GGC ACA GAG GCA GGA CAA GCC GCA GGC 3696Val Thr Thr Ser Arg Phe Trp Gly Thr Glu Ala Gly Gln Ala Ala Gly 1220 1225 1230TAT TCC AAC CAG CCC TTC ACA CCA CCG GAC TCC GTA GAT AAA GCG CTG 3744Tyr Ser Asn Gln Pro Phe Thr Pro Pro Asp Ser Val Asp Lys Ala Leu 1235 1240 1245GCA TTA ACC GGC GCA CTC CCT GTT GCC CAA TGT TTA GTC TAT GCC GTT 3792Ala Leu Thr Gly Ala Leu Pro Val Ala Gln Cys Leu Val Tyr Ala Val 1250 1255 1260GAT AGC TGG ATG CCG TCG TTA TCT TTG TCT CAG CTT TCT CAG TCA CAA 3840Asp Ser Trp Met Pro Ser Leu Ser Leu Ser Gln Leu Ser Gln Ser Gln1265 1270 1275 1280GAA GAG GCA GAA GCG CTA TGG GCG CAA CTG CGT GCC GCT CAT ATG ATT 3888Glu Glu Ala Glu Ala Leu Trp Ala Gln Leu Arg Ala Ala His Met Ile 1285 1290 1295ACC GAA GAT GGG AAA GTG TGT GCG TTA AGC GGG AAA CGA GGA ACA AGC 3936Thr Glu Asp Gly Lys Val Cys Ala Leu Ser Gly Lys Arg Gly Thr Ser 1300 1305 1310CAT CAG AAC CTG ACG ATT CAA CTT ATT TCG CTA TTG GCA AGT ATT CCC 3984His Gln Asn Leu Thr Ile Gln Leu Ile Ser Leu Leu Ala Ser Ile Pro 1315 1320 1325CGT TTA CCG CCA CAT GTA CTG GGG ATC ACC ACT GAT CGC TAT GAT AGC 4032Arg Leu Pro Pro His Val Leu Gly Ile Thr Thr Asp Arg Tyr Asp Ser 1330 1335 1340GAT CCG CAA CAG CAG CAC CAA CAG ACG GTG AGC TTT AGT GAC GGT TTT 4080Asp Pro Gln Gln Gln His Gln Gln Thr Val Ser Phe Ser Asp Gly Phe1345 1350 1355 1360GGC CGG TTA CTC CAG AGT TCA GCT CGT CAT GAG TCA GGT GAT GCC TGG 4128Gly Arg Leu Leu Gln Ser Ser Ala Arg His Glu Ser Gly Asp Ala Trp 1365 1370 1375CAA CGT AAA GAG GAT GGC GGG CTG GTC GTG GAT GCA AAT GGC GTT CTG 4176Gln Arg Lys Glu Asp Gly Gly Leu Val Val Asp Ala Asn Gly Val Leu 1380 1385 1390GTC AGT GCC CCT ACA GAC ACC CGA TGG GCC GTT TCC GGT CGC ACA GAA 4224Val Ser Ala Pro Thr Asp Thr Arg Trp Ala Val Ser Gly Arg Thr Glu 1395 1400 1405TAT GAC GAC AAA GGC CAA CCT GTG CGT ACT TAT CAA CCC TAT TTT CTA 4272Tyr Asp Asp Lys Gly Gln Pro Val Arg Thr Tyr Gln Pro Tyr Phe Leu 1410 1415 1420AAT GAC TGG CGT TAC GTT AGT GAT GAC AGC GCA CGA GAT GAC CTG TTT 4320Asn Asp Trp Arg Tyr Val Ser Asp Asp Ser Ala Arg Asp Asp Leu Phe1425 1430 1435 1440GCC GAT ACC CAC CTT TAT GAT CCA TTG GGA CGG GAA TAC AAA GTC ATC 4368Ala Asp Thr His Leu Tyr Asp Pro Leu Gly Arg Glu Tyr Lys Val Ile 1445 1450 1455ACT GCT AAG AAA TAT TTG CGA GAA AAG CTG TAC ACC CCG TGG TTT ATT 4416Thr Ala Lys Lys Tyr Leu Arg Glu Lys Leu Tyr Thr Pro Trp Phe Ile 1460 1465 1470GTC AGT GAG GAT GAA AAC GAT ACA GCA TCA AGA ACC CCA TAG 4458Val Ser Glu Asp Glu Asn Asp Thr Ala Ser Arg Thr Pro 1475 1480 1485 1485 amino acids amino acid linear protein 32Met Gln Asp Ser Pro Glu Val Ser Ile Thr Thr Leu Ser Leu Pro Lys1 5 10 15Gly Gly Gly Ala Ile Asn Gly Met Gly Glu Ala Leu Asn Ala Ala Gly 20 25 30Pro Asp Gly Met Ala Ser Leu Ser Leu Pro Leu Pro Leu Ser Thr Gly 35 40 45Arg Gly Thr Ala Pro Gly Leu Ser Leu Ile Tyr Ser Asn Ser Ala Gly 50 55 60Asn Gly Pro Phe Gly Ile Gly Trp Gln Cys Gly Val Met Ser Ile Ser65 70 75 80Arg Arg Thr Gln His Gly Ile Pro Gln Tyr Gly Asn Asp Asp Thr Phe 85 90 95Leu Ser Pro Gln Gly Glu Val Met Asn Ile Ala Leu Asn Asp Gln Gly 100 105 110Gln Pro Asp Ile Arg Gln Asp Val Lys Thr Leu Gln Gly Val Thr Leu 115 120 125Pro Ile Ser Tyr Thr Val Thr Arg Tyr Gln Ala Arg Gln Ile Leu Asp 130 135 140Phe Ser Lys Ile Glu Tyr Trp Gln Pro Ala Ser Gly Gln Glu Gly Arg145 150 155 160Ala Phe Trp Leu Ile Ser Thr Pro Asp Gly His Leu His Ile Leu Gly 165 170 175Lys Thr Ala Gln Ala Cys Leu Ala Asn Pro Gln Asn Asp Gln Gln Ile 180 185 190Ala Gln Trp Leu Leu Glu Glu Thr Val Thr Pro Ala Gly Glu His Val 195 200 205Ser Tyr Gln Tyr Arg Ala Glu Asp Glu Ala His Cys Asp Asp Asn Glu 210 215 220Lys Thr Ala His Pro Asn Val Thr Ala Gln Arg Tyr Leu Val Gln Val225 230 235 240Asn Tyr Gly Asn Ile Lys Pro Gln Ala Ser Leu Phe Val Leu Asp Asn 245 250 255Ala Pro Pro Ala Pro Glu Glu Trp Leu Phe His Leu Val Phe Asp His 260 265 270Gly Glu Arg Asp Thr Ser Leu His Thr Val Pro Thr Trp Asp Ala Gly 275 280 285Thr Ala Gln Trp Ser Val Arg Pro Asp Ile Phe Ser Arg Tyr Glu Tyr 290 295 300Gly Phe Glu Val Arg Thr Arg Arg Leu Cys Gln Gln Val Leu Met Phe305 310 315 320His Arg Thr Ala Leu Met Ala Gly Glu Ala Ser Thr Asn Asp Ala Pro 325 330 335Glu Leu Val Gly Arg Leu Ile Leu Glu Tyr Asp Lys Asn Ala Ser Val 340 345 350Thr Thr Leu Ile Thr Ile Arg Gln Leu Ser His Glu Ser Asp Gly Arg 355 360 365Pro Val Thr Gln Pro Pro Leu Glu Leu Ala Trp Gln Arg Phe Asp Leu 370 375 380Glu Lys Ile Pro Thr Trp Gln Arg Phe Asp Ala Leu Asp Asn Phe Asn385 390 395 400Ser Gln Gln Arg Tyr Gln Leu Val Asp Leu Arg Gly Glu Gly Leu Pro 405 410 415Gly Met Leu Tyr Gln Asp Arg Gly Ala Trp Trp Tyr Lys Ala Pro Gln 420 425 430Arg Gln Glu Asp Gly Asp Ser Asn Ala Val Thr Tyr Asp Lys Ile Ala 435 440 445Pro Leu Pro Thr Leu Pro Asn Leu Gln Asp Asn Ala Ser Leu Met Asp 450 455 460Ile Asn Gly Asp Gly Gln Leu Asp Trp Val Val Thr Ala Ser Gly Ile465 470 475 480Arg Gly Tyr His Ser Gln Gln Pro Asp Gly Lys Trp Thr His Phe Thr 485 490 495Pro Ile Asn Ala Leu Pro Val Glu Tyr Phe His Pro Ser Ile Gln Phe 500 505 510Ala Asp Leu Thr Gly Ala Gly Leu Ser Asp Leu Val Leu Ile Gly Pro 515 520 525Lys Ser Val Arg Leu Tyr Ala Asn Gln Arg Asn Gly Trp Arg Lys Gly 530 535 540Glu Asp Val Pro Gln Ser Thr Gly Ile Thr Leu Pro Val Thr Gly Thr545 550 555 560Asp Ala Arg Lys Leu Val Ala Phe Ser Asp Met Leu Gly Ser Gly Gln 565 570 575Gln His Leu Val Glu Ile Lys Gly Asn Arg Val Thr Cys Trp Pro Asn 580 585 590Leu Gly His Gly Arg Phe Gly Gln Pro Leu Thr Leu Ser Gly Phe Ser 595 600 605Gln Pro Glu Asn Ser Phe Asn Pro Glu Arg Leu Phe Leu Ala Asp Ile 610 615 620Asp Gly Ser Gly Thr Thr Asp Leu Ile Tyr Ala Gln Ser Gly Ser Leu625 630 635 640Leu Ile Tyr Leu Asn Gln Ser Gly Asn Gln Phe Asp Ala Pro Leu Thr 645 650 655Leu Ala Leu Pro Glu Gly Val Gln Phe Asp Asn Thr Cys Gln Leu Gln 660 665 670Val Ala Asp Ile Gln Gly Leu Gly Ile Ala Ser Leu Ile Leu Thr Val 675 680 685Pro His Ile Ala Pro His His Trp Arg Cys Asp Leu Ser Leu Thr Lys 690 695 700Pro Trp Leu Leu Asn Val Met Asn Asn Asn Arg Gly Ala His His Thr705 710 715 720Leu His Tyr Arg Ser Ser Ala Gln Phe Trp Leu Asp Glu Lys Leu Gln 725 730 735Leu Thr Lys Ala Gly Lys Ser Pro Ala Cys Tyr Leu Pro Phe Pro Met 740 745 750His Leu Leu Trp Tyr Thr Glu Ile Gln Asp Glu Ile Ser Gly Asn Arg 755 760 765Leu Thr Ser Glu Val Asn Tyr Ser His Gly Val Trp Asp Gly Lys Glu 770 775 780Arg Glu Phe Arg Gly Phe Gly Cys Ile Lys Gln Thr Asp Thr Thr Thr785 790 795 800Phe Ser His Gly Thr Ala Pro Glu Gln Ala Ala Pro Ser Leu Ser Ile 805 810 815Ser Trp Phe Ala Thr Gly Met Asp Glu Val Asp Ser Gln Leu Ala Thr 820 825 830Glu Tyr Trp Gln Ala Asp Thr Gln Ala Tyr Ser Gly Phe Glu Thr Arg 835 840 845Tyr Thr Val Trp Asp His Thr Asn Gln Thr Asp Gln Ala Phe Thr Pro 850 855 860Asn Glu Thr Gln Arg Asn Trp Leu Thr Arg Ala Leu Lys Gly Gln Leu865 870 875 880Leu Arg Thr Glu Leu Tyr Gly Leu Asp Gly Thr Asp Lys Gln Thr Val 885 890 895Pro Tyr Thr Val Ser Glu Ser Arg Tyr Gln Val Arg Ser Ile Pro Val 900 905 910Asn Lys Glu Thr Glu Leu Ser Ala Trp Val Thr Ala Ile Glu Asn Arg 915 920 925Ser Tyr His Tyr Glu Arg Ile Ile Thr Asp Pro Gln Phe Ser Gln Ser 930 935 940Ile Lys Leu Gln His Asp Ile Phe Gly Gln Ser Leu Gln Ser Val Asp945 950 955 960Ile Ala Trp Pro Arg Arg Glu Lys Pro Ala Val Asn Pro Tyr Pro Pro 965 970 975Thr Leu Pro Glu Thr Leu Phe Asp Ser Ser Tyr Asp Asp Gln Gln Gln 980 985 990Leu Leu Arg Leu Val Arg Gln Lys Asn Ser Trp His His Leu Thr Asp 995 1000 1005Gly Glu Asn Trp Arg Leu Gly Leu Pro Asn Ala Gln Arg Arg Asp Val 1010 1015 1020Tyr Thr Tyr Asp Arg Ser Lys Ile Pro Thr Glu Gly Ile Ser Leu Glu1025 1030 1035 1040Ile Leu Leu Lys Asp Asp Gly Leu Leu Ala Asp Glu Lys Ala Ala Val 1045 1050 1055Tyr Leu Gly Gln Gln Gln Thr Phe Tyr Thr Ala Gly Gln Ala Glu Val 1060 1065 1070Thr Leu Glu Lys Pro Thr Leu Gln Ala Leu Val Ala Phe Gln Glu Thr 1075 1080 1085Ala Met Met Asp Asp Thr Ser Leu Gln Ala Tyr Glu Gly Val Ile Glu 1090 1095 1100Glu Gln Glu Leu Asn Thr Ala Leu Thr Gln Ala Gly Tyr Gln Gln Val1105 1110 1115 1120Ala Arg Leu Phe Asn Thr Arg Ser Glu Ser Pro Val Trp Ala Ala Arg 1125 1130 1135Gln Gly Tyr Thr Asp Tyr Gly Asp Ala Ala Gln Phe Trp Arg Pro Gln 1140 1145 1150Ala Gln Arg Asn Ser Leu Leu Thr Gly Lys Thr Thr Leu Thr Trp Asp 1155 1160 1165Thr His His Cys Val Ile Ile Gln Thr Gln Asp Ala Ala Gly Leu Thr 1170 1175 1180Thr Gln Ala His Tyr Asp Tyr Arg Phe Leu Thr Pro Val Gln Leu Thr1185 1190 1195 1200Asp Ile Asn Asp Asn Gln His Ile Val Thr Leu Asp Ala Leu Gly Arg 1205 1210 1215Val Thr Thr Ser Arg Phe Trp Gly Thr Glu Ala Gly Gln Ala Ala Gly 1220 1225 1230Tyr Ser Asn Gln Pro Phe Thr Pro Pro Asp Ser Val Asp Lys Ala Leu 1235 1240 1245Ala Leu Thr Gly Ala Leu Pro Val Ala Gln Cys Leu Val Tyr Ala Val 1250 1255 1260Asp Ser Trp Met Pro Ser Leu Ser Leu Ser Gln Leu Ser Gln Ser Gln1265 1270 1275 1280Glu Glu Ala Glu Ala Leu Trp Ala Gln Leu Arg Ala Ala His Met Ile 1285 1290 1295Thr Glu Asp Gly Lys Val Cys Ala Leu Ser Gly Lys Arg Gly Thr Ser 1300 1305 1310His Gln Asn Leu Thr Ile Gln Leu Ile Ser Leu Leu Ala Ser Ile Pro 1315 1320 1325Arg Leu Pro Pro His Val Leu Gly Ile Thr Thr Asp Arg Tyr Asp Ser 1330 1335 1340Asp Pro Gln Gln Gln His Gln Gln Thr Val Ser Phe Ser Asp Gly Phe1345 1350 1355 1360Gly Arg Leu Leu Gln Ser Ser Ala Arg His Glu Ser Gly Asp Ala Trp 1365 1370 1375Gln Arg Lys Glu Asp Gly Gly Leu Val Val Asp Ala Asn Gly Val Leu 1380 1385 1390Val Ser Ala Pro Thr Asp Thr Arg Trp Ala Val Ser Gly Arg Thr Glu 1395 1400 1405Tyr Asp Asp Lys Gly Gln Pro Val Arg Thr Tyr Gln Pro Tyr Phe Leu 1410 1415 1420Asn Asp Trp Arg Tyr Val Ser Asp Asp Ser Ala Arg Asp Asp Leu Phe1425 1430 1435 1440Ala Asp Thr His Leu Tyr Asp Pro Leu Gly Arg Glu Tyr Lys Val Ile 1445 1450 1455Thr Ala Lys Lys Tyr Leu Arg Glu Lys Leu Tyr Thr Pro Trp Phe Ile 1460 1465 1470Val Ser Glu Asp Glu Asn Asp Thr Ala Ser Arg Thr Pro 1475 1480 1485 3288 base pairs nucleic acid double linear DNA (genomic) 33ATG GTG ACT GTT ATG CAA AAT AAA ATA TCA TTT TTA TCA GGT ACA TCC 48Met Val Thr Val Met Gln Asn Lys Ile Ser Phe Leu Ser Gly Thr Ser1 5 10 15GAA CAG CCC CTG CTT GAC GCC GGT TAT CAA AAC GTA TTT GAT ATC GCA 96Glu Gln Pro Leu Leu Asp Ala Gly Tyr Gln Asn Val Phe Asp Ile Ala 20 25 30TCA ATC AGC CGG GCT ACT TTC GTT CAA TCC GTT CCC ACC CTG CCC GTT 144Ser Ile Ser Arg Ala Thr Phe Val Gln Ser Val Pro Thr Leu Pro Val 35 40 45AAA GAG GCT CAT ACC GTC TAT CGT CAG GCG CGG CAA CGT GCG GAA AAT 192Lys Glu Ala His Thr Val Tyr Arg Gln Ala Arg Gln Arg Ala Glu Asn 50 55 60CTG AAA TCC CTC TAC CGA GCC TGG CAA TTG CGT CAG GAG CCG GTT ATT 240Leu Lys Ser Leu Tyr Arg Ala Trp Gln Leu Arg Gln Glu Pro Val Ile65 70 75 80AAA GGG CTG GCT AAA CTT AAC CTA CAA TCC AAC GTT TCT GTG CTT CAA 288Lys Gly Leu Ala Lys Leu Asn Leu Gln Ser Asn Val Ser Val Leu Gln 85 90 95GAT GCT TTG GTA GAG AAT ATT GGC GGT GAT GGG GAT TTC AGC GAT TTA 336Asp Ala Leu Val Glu Asn Ile Gly Gly Asp Gly Asp Phe Ser Asp Leu 100 105 110ATG AAC CGT GCC AGT CAA TAT GCT GAC GCT GCC TCT ATT CAA TCC CTA 384Met Asn Arg Ala Ser Gln Tyr Ala Asp Ala Ala Ser Ile Gln Ser Leu 115 120 125TTT TCA CCG GGC CGT TAT GCT TCC GCA CTC TAC AGA GTT GCT AAA GAT 432Phe Ser Pro Gly Arg Tyr Ala Ser Ala Leu Tyr Arg Val Ala Lys Asp 130 135 140CTG CAT AAA TCA GAT TCC AGT TTG CAT ATT GAT AAT CGC CGC GCT GAT 480Leu His Lys Ser Asp Ser Ser Leu His Ile Asp Asn Arg Arg Ala Asp145 150 155 160CTG AAG GAT CTG ATA TTA AGC GAA ACG ACG ATG AAT AAA GAG GTC ACT 528Leu Lys Asp Leu Ile Leu Ser Glu Thr Thr Met Asn Lys Glu Val Thr 165 170 175TCC CTT GAT ATC TTG TTG GAT GTG CTA CAA AAA GGC GGT AAA GAT ATT 576Ser Leu Asp Ile Leu Leu Asp Val Leu Gln Lys Gly Gly Lys Asp Ile 180 185 190ACT GAG CTG TCC GGC GCA TTC TTC CCA ATG ACG TTA CCT TAT GAC GAT 624Thr Glu Leu Ser Gly Ala Phe Phe Pro Met Thr Leu Pro Tyr Asp Asp 195 200 205CAT CTG TCG CAA ATC GAT TCC GCT TTA TCG GCA CAA GCC AGA ACG CTG 672His Leu Ser Gln Ile Asp Ser Ala Leu Ser Ala Gln Ala Arg Thr Leu 210 215 220AAC GGT GTG TGG AAT ACT TTG ACA GAT ACC ACG GCA CAA GCG GTT TCA 720Asn Gly Val Trp Asn Thr Leu Thr Asp Thr Thr Ala Gln Ala Val Ser225 230 235 240GAA CAA ACC AGT AAT ACG AAT ACA CGC AAA CTG TTC GCT GCC CAA GAT 768Glu Gln Thr Ser Asn Thr Asn Thr Arg Lys Leu Phe Ala Ala Gln Asp 245 250 255GGT AAT CAA GAT ACA TTT TTT TCC GGA AAC ACT TTT TAT TTC AAA GCG 816Gly Asn Gln Asp Thr Phe Phe Ser Gly Asn Thr Phe Tyr Phe Lys Ala 260 265 270GTG GGA TTC AGC GGG CAA CCT ATG GTT TAC CTG TCA CAG TAC ACC AGC 864Val Gly Phe Ser Gly Gln Pro Met Val Tyr Leu Ser Gln Tyr Thr Ser 275 280 285GGG AAC GGC ATT GTC GGC GCA CAA TTG ATT GCA GGT AAT CCA GAC CAA 912Gly Asn Gly Ile Val Gly Ala Gln Leu Ile Ala Gly Asn Pro Asp Gln 290 295 300GCC GCC GCC GCA ATA GTC GCA CCG TTG AAA CTC ACT TGG TCA ATG GCA 960Ala Ala Ala Ala Ile Val Ala Pro Leu Lys Leu Thr Trp Ser Met Ala305 310 315 320AAA CAG TGT TAC TAC CTC GTC GCT CCC GAT GGT ACA ACG ATG GGA GAC 1008Lys Gln Cys Tyr Tyr Leu Val Ala Pro Asp Gly Thr Thr Met Gly Asp 325 330 335GGT AAT GTT CTG ACC GGC TGT TTC TTA AGA GGC AAC AGC CCA ACT AAC 1056Gly Asn Val Leu Thr Gly Cys Phe Leu Arg Gly Asn Ser Pro Thr Asn 340 345 350CCG GAT AAA GAC GGT ATT TTT GCT CAG GTA GCC AAC AAA TCA GGC AGT 1104Pro Asp Lys Asp Gly Ile Phe Ala Gln Val Ala Asn Lys Ser Gly Ser 355 360 365ACT CAG CCT TTG CCA AGC TTC CAT CTG CCG GTC ACA CTG GAA CAC AGC 1152Thr Gln Pro Leu Pro Ser Phe His Leu Pro Val Thr Leu Glu His Ser 370 375 380GAG AAT AAA GAT CAG TAC TAT CTG AAA ACA GAG CAG GGT TAT ATC ACG 1200Glu Asn Lys Asp Gln Tyr Tyr Leu Lys Thr Glu Gln Gly Tyr Ile Thr385 390 395 400GTA GAT AGT TCC GGA CAG TCA AAT TGG AAA AAC GCG CTG GTT ATC AAT 1248Val Asp Ser Ser Gly Gln Ser Asn Trp Lys Asn Ala Leu Val Ile Asn 405 410 415GGG ACA AAA GAC AAG GGG CTG TTA TTA ACC TTT TGC AGC GAT AGC TCA 1296Gly Thr Lys Asp Lys Gly Leu Leu Leu Thr Phe Cys Ser Asp Ser Ser 420 425 430GGC ACT CCG ACA AAC CCT GAT GAT GTG ATT CCT CCC GCT ATC AAT GAT 1344Gly Thr Pro Thr Asn Pro Asp Asp Val Ile Pro Pro Ala Ile Asn Asp 435 440 445ATT CCA TCG CCG CCA GCC CGC GAA ACA CTG TCA CTG ACG CCG GTC AGT 1392Ile Pro Ser Pro Pro Ala Arg Glu Thr Leu Ser Leu Thr Pro Val Ser 450 455 460TAT CAA TTG ATG ACC AAT CCG GCA CCG ACA GAA GAT GAT ATT ACC AAC 1440Tyr Gln Leu Met Thr Asn Pro Ala Pro Thr Glu Asp Asp Ile Thr Asn465 470 475 480CAT TAT GGT TTT AAC GGC GCT AGC TTA CGG GCT TCT CCA TTG TCA ACC 1488His Tyr Gly Phe Asn Gly Ala Ser Leu Arg Ala Ser Pro Leu Ser Thr 485 490 495AGC GAG TTG ACC AGC AAA CTG AAT TCT ATC GAT ACT TTC TGT GAG AAG 1536Ser Glu Leu Thr Ser Lys Leu Asn Ser Ile Asp Thr Phe Cys Glu Lys 500 505 510ACC CGG TTA AGC TTC AAT CAG TTA ATG GAT TTG ACC GCT CAG CAA TCT 1584Thr Arg Leu Ser Phe Asn Gln Leu Met Asp Leu Thr Ala Gln Gln Ser 515 520 525TAC AGT CAA AGC AGC ATT GAT GCG AAA GCA GCC AGC CGC TAT GTT CGT 1632Tyr Ser Gln Ser Ser Ile Asp Ala Lys Ala Ala Ser Arg Tyr Val Arg 530 535 540TTT GGG GAA ACC ACC CCA ACC CGC GTC AAT GTC TAC GGT GCC GCT TAT 1680Phe Gly Glu Thr Thr Pro Thr Arg Val Asn Val Tyr Gly Ala Ala Tyr545 550 555 560CTG AAC AGC ACA CTG GCA GAC GCG GCT GAT GGT CAA TAT CTG TGG ATT 1728Leu Asn Ser Thr Leu Ala Asp Ala Ala Asp Gly Gln Tyr Leu Trp Ile 565 570 575CAG ACT GAT GGC AAG AGC CTA AAT TTC ACT GAC GAT ACG GTA GTC GCC 1776Gln Thr Asp Gly Lys Ser Leu Asn Phe Thr Asp Asp Thr Val Val Ala 580 585 590TTA GCC GGT CGC GCT GAA AAG CTG GTA CGT TTA TCA TCC CAG ACC GGG 1824Leu Ala Gly Arg Ala Glu Lys Leu Val Arg Leu Ser Ser Gln Thr Gly 595 600 605CTA TCA TTT GAA GAA TTG GAC TGG CTG ATT GCC AAT GCC AGT CGT AGT 1872Leu Ser Phe Glu Glu Leu Asp Trp Leu Ile Ala Asn Ala Ser Arg Ser 610 615 620GTG CCG GAC CAC CAC GAC AAA ATT GTG CTG GAT AAG CCG GTC CTT GAA 1920Val Pro Asp His His Asp Lys Ile Val Leu Asp Lys Pro Val Leu Glu625 630 635 640GCA CTG GCA GAG TAT GTC AGC CTA AAA CAG CGC TAT GGG CTT GAT GCC 1968Ala Leu Ala Glu Tyr Val Ser Leu Lys Gln Arg Tyr Gly Leu Asp Ala 645 650 655AAT ACC TTT GCG ACC TTC ATT AGT GCA GTA AAT CCT TAT ACG CCA GAT 2016Asn Thr Phe Ala Thr Phe Ile Ser Ala Val Asn Pro Tyr Thr Pro Asp 660 665 670CAG ACA CCC AGT TTC TAT GAA ACC GCT TTC CGC TCT GCC GAC GGT AAT 2064Gln Thr Pro Ser Phe Tyr Glu Thr Ala Phe Arg Ser Ala Asp Gly Asn 675 680 685CAT GTC ATT GCG CTA GGT ACA GAG GTG AAA TAT GCA GAA AAT GAG CAG 2112His Val Ile Ala Leu Gly Thr Glu Val Lys Tyr Ala Glu Asn Glu Gln 690 695 700GAT GAG TTA GCC GCC ATA TGC TGC AAA GCA TTG GGT GTC ACC AGT GAT 2160Asp Glu Leu Ala Ala Ile Cys Cys Lys Ala Leu Gly Val Thr Ser Asp705 710 715 720GAA CTG CTC CGT ATT GGT CGC TAT TGC TTC GGT AAT GCA GGC AGT TTT 2208Glu Leu Leu Arg Ile Gly Arg Tyr Cys Phe Gly Asn Ala Gly Ser Phe 725 730 735ACC TTG GAT GAA TAT ACC GCC AGT CAG TTG TAT CGC TTC GGC GCC ATT 2256Thr Leu Asp Glu Tyr Thr Ala Ser Gln Leu Tyr Arg Phe Gly Ala Ile 740 745 750CCC CGT TTG TTT GGG CTG ACA TTT GCC CAA GCC GAA ATT TTA TGG CGT 2304Pro Arg Leu Phe Gly Leu Thr Phe Ala Gln Ala Glu Ile Leu Trp Arg 755 760 765CTG ATG GAA GGC GGA AAA GAT ATC TTA TTG CAA CAG TTA GGT CAG GCA 2352Leu Met Glu Gly Gly Lys Asp Ile Leu Leu Gln Gln Leu Gly Gln Ala 770 775 780AAA TCC CTG CAA CCA CTG GCT ATT TTA CGC CGT ACC GAG CAG GTG CTG 2400Lys Ser Leu Gln Pro Leu Ala Ile Leu Arg Arg Thr Glu Gln Val Leu785 790 795 800GAT TGG ATG TCG TCC GTA AAT CTA AGT CTG ACT TAT CTG CAA GGG ATG 2448Asp Trp Met Ser Ser Val Asn Leu Ser Leu Thr Tyr Leu Gln Gly Met 805 810 815GTA AGT ACG CAA TGG AGC GGT ACC GCC ACC GCT GAG ATG TTC AAT TTC 2496Val Ser Thr Gln Trp Ser Gly Thr Ala Thr Ala Glu Met Phe Asn Phe 820 825 830TTG GAA AAC GTT TGT GAC AGC GTG AAT AGT CAA GCT GCC ACT AAA GAA 2544Leu Glu Asn Val Cys Asp Ser Val Asn Ser Gln Ala Ala Thr Lys Glu 835 840 845ACA ATG GAT TCG GCG TTA CAG CAG AAA GTG CTG CGG GCG CTA AGC GCC 2592Thr Met Asp Ser Ala Leu Gln Gln Lys Val Leu Arg Ala Leu Ser Ala 850 855 860GGT TTC GGC ATT AAG AGC AAT GTG ATG GGT ATC GTC ACC TTC TGG CTG 2640Gly Phe Gly Ile Lys Ser Asn Val Met Gly Ile Val Thr Phe Trp Leu865 870 875 880GAG AAA ATC ACA ATC GGT AGT GAT AAT CCT TTT ACA TTG GCA AAC TAC 2688Glu Lys Ile Thr Ile Gly Ser Asp Asn Pro Phe Thr Leu Ala Asn Tyr 885 890 895TGG CAT GAT ATT CAA ACC CTG TTT AGC CAT GAC AAT GCC ACG TTA GAG 2736Trp His Asp Ile Gln Thr Leu Phe Ser His Asp Asn Ala Thr Leu Glu 900 905 910TCC TTA CAA ACC GAC ACT TCT CTG GTA ATT GCT ACT CAG CAA CTT AGC 2784Ser Leu Gln Thr Asp Thr Ser Leu Val Ile Ala Thr Gln Gln Leu Ser 915 920 925CAG CTA GTG TTA ATT GTG AAA TGG CTG AGC CTG ACC GAG CAG GAT CTG 2832Gln Leu Val Leu Ile Val Lys Trp Leu Ser Leu Thr Glu Gln Asp Leu 930 935 940CAA TTA CTG ACA ACC TAT CCC GAA CGT TTA ATC AAC GGC ATC ACG AAT 2880Gln Leu Leu Thr Thr Tyr Pro Glu Arg Leu Ile Asn Gly Ile Thr Asn945 950 955 960GTT CCT GTA CCC AAT CCG GAG CTA TTA CTC ACG CTA TCA CGT TTT AAG 2928Val Pro Val Pro Asn Pro Glu Leu Leu Leu Thr Leu Ser Arg Phe Lys 965 970 975CAG TGG GAA ACT CAA GTC ACC GTT TCC CGT GAT GAA GCG ATG CGC TGT 2976Gln Trp Glu Thr Gln Val Thr Val Ser Arg Asp Glu Ala Met Arg Cys 980 985 990TTC GAT CAA TTA AAT GCC AAT GAT ATG ACG ACT GAA AAT GCA GGT TCA 3024Phe Asp Gln Leu Asn Ala Asn Asp Met Thr Thr Glu Asn Ala Gly Ser 995 1000 1005CTG ATC GCC ACA TTG TAT GAG ATG GAT AAA GGT ACG GGA GCG CAA GTT 3072Leu Ile Ala Thr Leu Tyr Glu Met Asp Lys Gly Thr Gly Ala Gln Val 1010 1015 1020AAT ACC TTG CTA TTA GGT GAA AAT AAC TGG CCG AAA AGT TTT ACC TCT 3120Asn Thr Leu Leu Leu Gly Glu Asn Asn Trp Pro Lys Ser Phe Thr Ser1025 1030 1035 1040CTC TGG CAA CTT CTG ACC TGG TTA CGC GTC GGG CAA AGA CTG AAT GTC 3168Leu Trp Gln Leu Leu Thr Trp Leu Arg Val Gly Gln Arg Leu Asn Val 1045 1050 1055GGT AGT ACC ACT CTG GGC AAT CTG TTG TCC ATG ATG CAA GCA GAC CCT 3216Gly Ser Thr Thr Leu Gly Asn Leu Leu Ser Met Met Gln Ala Asp Pro 1060 1065 1070GCT GCC GAG AGT AGC GCT TTA TTG GCA TCA GTA GCC CAA AAC TTA AGT 3264Ala Ala Glu Ser Ser Ala Leu Leu Ala Ser Val Ala Gln Asn Leu Ser 1075 1080 1085GCC GCA ATC AGC AAT CGT CAG TAA 3288Ala Ala Ile Ser Asn Arg Gln 1090 1095 1095 amino acids amino acids linear protein 34Met Val Thr Val Met Gln Asn Lys Ile Ser Phe Leu Ser Gly Thr Ser1 5 10 15Glu Gln Pro Leu Leu Asp Ala Gly Tyr Gln Asn Val Phe Asp Ile Ala 20 25 30Ser Ile Ser Arg Ala Thr Phe Val Gln Ser Val Pro Thr Leu Pro Val 35 40 45Lys Glu Ala His Thr Val Tyr Arg Gln Ala Arg Gln Arg Ala Glu Asn 50 55 60Leu Lys Ser Leu Tyr Arg Ala Trp Gln Leu Arg Gln Glu Pro Val Ile65 70 75 80Lys Gly Leu Ala Lys Leu Asn Leu Gln Ser Asn Val Ser Val Leu Gln 85 90 95Asp Ala Leu Val Glu Asn Ile Gly Gly Asp Gly Asp Phe Ser Asp Leu 100 105 110Met Asn Arg Ala Ser Gln Tyr Ala Asp Ala Ala Ser Ile Gln Ser Leu 115 120 125Phe Ser Pro Gly Arg Tyr Ala Ser Ala Leu Tyr Arg Val Ala Lys Asp 130 135 140Leu His Lys Ser Asp Ser Ser Leu His Ile Asp Asn Arg Arg Ala Asp145 150 155 160Leu Lys Asp Leu Ile Leu Ser Glu Thr Thr Met Asn Lys Glu Val Thr 165 170 175Ser Leu Asp Ile Leu Leu Asp Val Leu Gln Lys Gly Gly Lys Asp Ile 180 185 190Thr Glu Leu Ser Gly Ala Phe Phe Pro Met Thr Leu Pro Tyr Asp Asp 195 200 205His Leu Ser Gln Ile Asp Ser Ala Leu Ser Ala Gln Ala Arg Thr Leu 210 215 220Asn Gly Val Trp Asn Thr Leu Thr Asp Thr Thr Ala Gln Ala Val Ser225 230 235 240Glu Gln Thr Ser Asn Thr Asn Thr Arg Lys Leu Phe Ala Ala Gln Asp 245 250 255Gly Asn Gln Asp Thr Phe Phe Ser Gly Asn Thr Phe Tyr Phe Lys Ala 260 265 270Val Gly Phe Ser Gly Gln Pro Met Val Tyr Leu Ser Gln Tyr Thr Ser 275 280 285Gly Asn Gly Ile Val Gly Ala Gln Leu Ile Ala Gly Asn Pro Asp Gln 290 295 300Ala Ala Ala Ala Ile Val Ala Pro Leu Lys Leu Thr Trp Ser Met Ala305 310 315 320Lys Gln Cys Tyr Tyr Leu Val Ala Pro Asp Gly Thr Thr Met Gly Asp 325 330 335Gly Asn Val Leu Thr Gly Cys Phe Leu Arg Gly Asn Ser Pro Thr Asn 340 345 350Pro Asp Lys Asp Gly Ile Phe Ala Gln Val Ala Asn Lys Ser Gly Ser 355 360 365Thr Gln Pro Leu Pro Ser Phe His Leu Pro Val Thr Leu Glu His Ser 370 375 380Glu Asn Lys Asp Gln Tyr Tyr Leu Lys Thr Glu Gln Gly Tyr Ile Thr385 390 395 400Val Asp Ser Ser Gly Gln Ser Asn Trp Lys Asn Ala Leu Val Ile Asn 405 410 415Gly Thr Lys Asp Lys Gly Leu Leu Leu Thr Phe Cys Ser Asp Ser Ser 420 425 430Gly Thr Pro Thr Asn Pro Asp Asp Val Ile Pro Pro Ala Ile Asn Asp 435 440 445Ile Pro Ser Pro Pro Ala Arg Glu Thr Leu Ser Leu Thr Pro Val Ser 450 455 460Tyr Gln Leu Met Thr Asn Pro Ala Pro Thr Glu Asp Asp Ile Thr Asn465 470 475 480His Tyr Gly Phe Asn Gly Ala Ser Leu Arg Ala Ser Pro Leu Ser Thr 485 490 495Ser Glu Leu Thr Ser Lys Leu Asn Ser Ile Asp Thr Phe Cys Glu Lys 500 505 510Thr Arg Leu Ser Phe Asn Gln Leu Met Asp Leu Thr Ala Gln Gln Ser 515 520 525Tyr Ser Gln Ser Ser Ile Asp Ala Lys Ala Ala Ser Arg Tyr Val Arg 530 535 540Phe Gly Glu Thr Thr Pro Thr Arg Val Asn Val Tyr Gly Ala Ala Tyr545 550 555 560Leu Asn Ser Thr Leu Ala Asp Ala Ala Asp Gly Gln Tyr Leu Trp Ile 565 570 575Gln Thr Asp Gly Lys Ser Leu Asn Phe Thr Asp Asp Thr Val Val Ala 580 585 590Leu Ala Gly Arg Ala Glu Lys Leu Val Arg Leu Ser Ser Gln Thr Gly 595 600 605Leu Ser Phe Glu Glu Leu Asp Trp Leu Ile Ala Asn Ala Ser Arg Ser 610 615 620Val Pro Asp His His Asp Lys Ile Val Leu Asp Lys Pro Val Leu Glu625 630 635 640Ala Leu Ala Glu Tyr Val Ser Leu Lys Gln Arg Tyr Gly Leu Asp Ala 645 650 655Asn Thr Phe Ala Thr Phe Ile Ser Ala Val Asn Pro Tyr Thr Pro Asp 660 665 670Gln Thr Pro Ser Phe Tyr Glu Thr Ala Phe Arg Ser Ala Asp Gly Asn 675 680 685His Val Ile Ala Leu Gly Thr Glu Val Lys Tyr Ala Glu Asn Glu Gln 690 695 700Asp Glu Leu Ala Ala Ile Cys Cys Lys Ala Leu Gly Val Thr Ser Asp705 710 715 720Glu Leu Leu Arg Ile Gly Arg Tyr Cys Phe Gly Asn Ala Gly Ser Phe 725 730 735Thr Leu Asp Glu Tyr Thr Ala Ser Gln Leu Tyr Arg Phe Gly Ala Ile 740 745 750Pro Arg Leu Phe Gly Leu Thr Phe Ala Gln Ala Glu Ile Leu Trp Arg 755 760 765Leu Met Glu Gly Gly Lys Asp Ile Leu Leu Gln Gln Leu Gly Gln Ala 770 775 780Lys Ser Leu Gln Pro Leu Ala Ile Leu Arg Arg Thr Glu Gln Val Leu785 790 795 800Asp Trp Met Ser Ser Val Asn Leu Ser Leu Thr Tyr Leu Gln Gly Met 805 810 815Val Ser Thr Gln Trp Ser Gly Thr Ala Thr Ala Glu Met Phe Asn Phe 820 825 830Leu Glu Asn Val Cys Asp Ser Val Asn Ser Gln Ala Ala Thr Lys Glu 835 840 845Thr Met Asp Ser Ala Leu Gln Gln Lys Val Leu Arg Ala Leu Ser Ala 850 855 860Gly Phe Gly Ile Lys Ser Asn Val Met Gly Ile Val Thr Phe Trp Leu865 870 875 880Glu Lys Ile Thr Ile Gly Ser Asp Asn Pro Phe Thr Leu Ala Asn Tyr 885 890 895Trp His Asp Ile Gln Thr Leu Phe Ser His Asp Asn Ala Thr Leu Glu 900 905 910Ser Leu Gln Thr Asp Thr Ser Leu Val Ile Ala Thr Gln Gln Leu Ser 915 920 925Gln Leu Val Leu Ile Val Lys Trp Leu Ser Leu Thr Glu Gln Asp Leu 930 935 940Gln Leu Leu Thr Thr Tyr Pro Glu Arg Leu Ile Asn Gly Ile Thr Asn945 950 955 960Val Pro Val Pro Asn Pro Glu Leu Leu Leu Thr Leu Ser Arg Phe Lys 965 970 975Gln Trp Glu Thr Gln Val Thr Val Ser Arg Asp Glu Ala Met Arg Cys 980 985 990Phe Asp Gln Leu Asn Ala Asn Asp Met Thr Thr Glu Asn Ala Gly Ser 995 1000 1005Leu Ile Ala Thr Leu Tyr Glu Met Asp Lys Gly Thr Gly Ala Gln Val 1010 1015 1020Asn Thr Leu Leu Leu Gly Glu Asn Asn Trp Pro Lys Ser Phe Thr Ser1025 1030 1035 1040Leu Trp Gln Leu Leu Thr Trp Leu Arg Val Gly Gln Arg Leu Asn Val 1045 1050 1055Gly Ser Thr Thr Leu Gly Asn Leu Leu Ser Met Met Gln Ala Asp Pro 1060 1065 1070Ala Ala Glu Ser Ser Ala Leu Leu Ala Ser Val Ala Gln Asn Leu Ser 1075 1080 1085Ala Ala Ile Ser Asn Arg Gln 1090 1095 603 amino acids amino acid linear protein 35Pro Leu Ser Thr Ser Glu Leu Thr Ser Lys Leu Asn Ser Ile Asp Thr1 5 10 15Phe Cys Glu Lys Thr Arg Leu Ser Phe Asn Gln Leu Met Asp Leu Thr 20 25 30Ala Gln Gln Ser Tyr Ser Gln Ser Ser Ile Asp Ala Lys Ala Ala Ser 35 40 45Arg Tyr Val Arg Phe Gly Glu Thr Thr Pro Thr Arg Val Asn Val Tyr 50 55 60Gly Ala Ala Tyr Leu Asn Ser Thr Leu Ala Asp Ala Ala Asp Gly Gln65 70 75 80Tyr Leu Trp Ile Gln Thr Asp Gly Lys Ser Leu Asn Phe Thr Asp Asp 85 90 95Thr Val Val Ala Leu Ala Gly Arg Ala Glu Lys Leu Val Arg Leu Ser 100 105 110Ser Gln Thr Gly Leu Ser Phe Glu Glu Leu Asp Trp Leu Ile Ala Asn 115 120 125Ala Ser Arg Ser Val Pro Asp His His Asp Lys Ile Val Leu Asp Lys 130 135 140Pro Val Leu Glu Ala Leu Ala Glu Tyr Val Ser Leu Lys Gln Arg Tyr145 150 155 160Gly Leu Asp Ala Asn Thr Phe Ala Thr Phe Ile Ser Ala Val Asn Pro 165 170 175Tyr Thr Pro Asp Gln Thr Pro Ser Phe Tyr Glu Thr Ala Phe Arg Ser 180 185 190Ala Asp Gly Asn His Val Ile Ala Leu Gly Thr Glu Val Lys Tyr Ala 195 200 205Glu Asn Glu Gln Asp Glu Leu Ala Ala Ile Cys Cys Lys Ala Leu Gly 210 215 220Val Thr Ser Asp Glu Leu Leu Arg Ile Gly Arg Tyr Cys Phe Gly Asn225 230 235 240Ala Gly Arg Phe Thr Leu Asp Glu Tyr Thr Ala Ser Gln Leu Tyr Arg 245 250 255Phe Gly Ala Ile Pro Arg Leu Phe Gly Leu Thr Phe Ala Gln Ala Glu 260 265 270Ile Leu Trp Arg Leu Met Glu Gly Gly Lys Asp Ile Leu Leu Gln Gln 275 280 285Xaa Gly Gln Ala Lys Ser Leu Gln Pro Leu Ala Ile Leu Arg Arg Thr 290 295 300Glu Gln Val Leu Asp Trp Met Ser Pro Val Asn Leu Ser Leu Thr Tyr305 310 315 320Leu Gln Gly Met Val Ser Thr Gln Trp Ser Gly Thr Ala Thr Ala Glu 325 330 335Met Phe Asn Phe Leu Glu Asn Val Cys Asp Ser Val Asn Ser Gln Ala 340 345 350Xaa Thr Lys Glu Thr Met Asp Ser Ala Leu Gln Gln Lys Val Leu Arg 355 360 365Ala Leu Ser Ala Gly Phe Gly Ile Lys Ser Asn Val Met Gly Ile Val 370 375 380Thr Phe Trp Leu Glu Lys Ile Thr Ile Gly Arg Asp Asn Pro Phe Thr385 390 395 400Leu Ala Asn Tyr Trp His Asp Ile Gln Thr Leu Phe Ser His Asp Asn 405 410 415Ala Thr Leu Glu Ser Leu Gln Thr Asp Thr Ser Leu Val Ile Ala Thr 420 425 430Gln Gln Leu Ser Gln Leu Val Leu Ile Val Lys Trp Val Ser Leu Thr 435 440 445Glu Gln Asp Leu Gln Leu Leu Thr Thr Tyr Pro Glu Arg Leu Ile Asn 450 455 460Gly Ile Thr Asn Val Pro Val Pro Asn Pro Glu Leu Leu Leu Thr Leu465 470 475 480Ser Arg Phe Lys Gln Trp Glu Thr Gln Val Thr Val Ser Arg Asp Glu 485 490 495Ala Met Arg Cys Phe Asp Gln Leu Asn Ala Asn Asp Met Thr Thr Glu 500 505 510Asn Ala Gly Ser Leu Ile Ala Thr Leu Tyr Glu Met Asp Lys Gly Thr 515 520 525Gly Ala Gln Val Asn Thr Leu Leu Leu Gly Glu Asn Asn Trp Pro Lys 530 535 540Ser Phe Thr Ser Leu Trp Gln Leu Leu Thr Trp Leu Arg Val Gly Gln545 550 555 560Arg Leu Asn Val Gly Ser Thr Thr Leu Gly Asn Leu Leu Ser Met Met 565 570 575Gln Ala Asp Pro Ala Ala Glu Ser Ser Ala Leu Leu Ala Ser Val Ala 580 585 590Gln Asn Leu Ser Ala Ala Ile Ser Asn Arg Gln 595 600 2557 base pairs nucleic acid double linear DNA (genomic) 36GAATTCGGCT TGCGTTTAAT ATTGATGATG TCTCGCTCTT CCGCCTGCTT AAAATTACCG 60ACCATGATAA TAAAGATGGA AAAATTAAAA ATAACCTAAA GAATCTTTCC AATTTATATA 120TTGGAAAATT ACTGGCAGAT ATTCATCAAT TAACCATTGA TGAACTGGAT TTATTACTGA 180TTGCCGTAGG TGAAGGAAAA ACTAATTTAT CCGCTATCAG TGATAAGCAA TTGGCTACCC 240TGATCAGAAA ACTCAATACT ATTACCAGCT GGCTACATAC ACAGAAGTGG AGTGTATTCC 300AGCTATTTAT CATGACCTCC ACCAGCTATA ACAAAACGCT AACGCCTGAA ATTAAGAATT 360TGCTGGATAC CGTCTACCAC GGTTTACAAG GTTTTGATAA AGACAAAGCA GATTTGCTAC 420ATGTCATGGC GCCCTATATT GCGGCCACCT TGCAATTATC ATCGGAAAAT GTCGCCCACT 480CGGTACTCCT TTGGGCAGAT AAGTTACAGC CCGGCGACGG CGCAATGACA GCAGAGGGAN 540TCTGGGACTG GTTGAATACT AAGTATACGC CGGGTTCATC GGAAGCCGTA GAAACGCAGG 600AACATATCGT TCAGTATTGT CAGGCTCTGG CACAATTGGA AATGGTTTAC CATTCCACCG 660GCATCAACGA AAACGCCTTC CGTCTATTTG TGACAAAACC AGAGATGTTT GGCGCTGCAA 720CTGGAGCAGC GCCCGCGCAT GATGCCCTTT CACTGATTAT GCTGACACGT TTTGCGGATT 780GGGTGAACGC ACTAGGCGAA AAAGCGTCCT CGGTGCTAGC GGCATTTGAA GCTAACTCGT 840TAACGGCAGA ACAACTGGCT GATGCCATGA ATCTTGATGC TAATTTGCTG TTGCAAGCCA 900GTATTCAAGC ACAAAATCAT CAACATCTTC CCCCAGTAAC TCCAGAAAAT GCGTTCTCCT 960GTTGGACATC TATCAATACT ATCCTGCAAT GGGTTAATGT CGCACAACAA TTGAAATGTC 1020GCCCCACAGG GCGTTTCCGC TTTGGTCGGG CTGGATTATA TTCAATCAAT GAAAGAGACA 1080CCGACCTATG CCCAGTGGGA AAACGCGGCA GGCGTATTAA CCGCCGGGTT GAATTCAACA 1140ACAGGCTAAT ACATTACAAC GCTTTTCTGG ATGAATCTCG CAGTGCCGCA TTAAGCACCT 1200ACTATATCCG TCAAGTCGCC AAGGCAGCGG CGGCTATTAA AAGCCGTGAT GACTTGTATC 1260AATACTTACT GATTGATAAT CAGGTTTCTG CGGCAATAAA AACCACCCGG ATCGCCGAAG 1320CCATTGCCAG TATTCAACTG TACGTCAACC GGGCATTGGA AAATGTGGAA GAAAATGCCA 1380ATTCGGGGGT TATCAGCCGC CAATTCTTTA TCGACTGGGA CAAATACAAT AAACGCTACA 1440GCACTTGGGC GGGTGTTTCT CAATTAGTTT ACTACCCGGA AAACTATATT GATCCGACCA 1500TGCGTATCGG ACAAACCAAA ATGATGGACG CATTACTGCA ATCCGTCAGC CAAAGCCAAT 1560TAAACGCCGA TACCGTCGAA GATGCCTTTA TGTCTTATCT GACATCGTTT GAACAAGTGG 1620CTAATCTTAA AGTTATTAGC GCATATCACG ATAATATTAA TAACGATCAA GGGCTGACCT 1680ATTTTATCGG ACTCAGTGAA ACTGATGCCG GTGAATATTA TTGGCGCAGT GTCGATCACA 1740GTAAATTCAA CGACGGTAAA TTCGCGGCTA ATGCCTGGAG TGAATGGCAT AAAATTGATT 1800GTCCAATTAA CCCTTATAAA AGCACTATCC GTCCAGTGAT ATATAAATCC CGCCTGTATC 1860TGCTCTGGTT GGAACAAAAG GAGATCACCA AACAGACAGG AAATAGTAAA GATGGCTATC 1920AAACTGAAAC GGATTATCGT TATGAACTAA AATTGGCGCA TATCCGCTAT GATGGCACTT 1980GGAATACGCC AATCACCTTT GATGTCAATA AAAAAATATC CGAGCTAAAA CTGGAAAAAA 2040ATAGAGCGCC CGGACTCTAT TGTGCCGGTT ATCAAGGTGA AGATACGTTG CTGGTGATGT 2100TTTATAACCA ACAAGACACA CTAGATAGTT ATAAAAACGC TTCAATGCAA GGACTATATA 2160TCTTTGCTGA TATGGCATCC AAAGATATGA CCCCAGAACA GAGCAATGTT TATCGGGATA 2220ATAGCTATCA ACAATTTGAT ACCAATAATG TCAGAAGAGT GAATAACCGC TATGCAGAGG 2280ATTATGAGAT TCCTTCTTCG GTAAGTAGCC GTAAAGACTA TGGTTGGGGA GATTATTACC 2340TCAGCATGGT ATATAACGGA GATATTCCAA CTATCAATTA CAAAGCCGCA TCAAGTGATT 2400TAAAAATTTA TATTTCACCA AAATTAAGAA TTATTCATAA TGGATATGAA GGACAGAAGC 2460GCAATCAATG CAATTTGATG AATAAATATG GCAAACTAGG TGATAAATTT ATTGTGTATA 2520CCAGCCTGGG CGTTAATCCG AATAATAAGC CGAATTC 2557 845 amino acids amino acids linear protein (partial) 37Ala Phe Asn Ile Asp Asp Val Ser Leu Phe Arg Leu Leu Lys Ile Thr1 5 10 15Asp His Asp Asn Lys Asp Gly Lys Ile Lys Asn Asn Leu Lys Asn Leu 20 25 30Ser Asn Leu Tyr Ile Gly Lys Leu Leu Ala Asp Ile His Gln Leu Thr 35 40 45Ile Asp Glu Leu Asp Leu Leu Leu Ile Ala Val Gly Glu Gly Lys Thr 50 55 60Asn Leu Ser Ala Ile Ser Asp Lys Gln Leu Ala Thr Leu Ile Arg Lys65 70 75 80Leu Asn Thr Ile Thr Ser Trp Leu His Thr Gln Lys Trp Ser Val Phe 85 90 95Gln Leu Phe Ile Met Thr Ser Thr Ser Tyr Asn Lys Thr Leu Thr Pro 100 105 110Glu Ile Lys Asn Leu Leu Asp Thr Val Tyr His Gly Leu Gln Gly Phe 115 120 125Asp Lys Asp Lys Ala Asp Leu Leu His Val Met Ala Pro Tyr Ile Ala 130 135 140Ala Thr Leu Gln Leu Ser Ser Glu Asn Val Ala His Ser Val Leu Leu145 150 155 160Trp Ala Asp Lys Leu Gln Pro Gly Asp Gly Ala Met Thr Ala Glu Gly 165 170 175Phe Trp Asp Trp Leu Asn Thr Lys Tyr Thr Pro Gly Ser Ser Glu Ala 180 185 190Val Glu Thr Gln Glu His Ile Val Gln Tyr Cys Gln Ala Leu Ala Gln 195 200 205Leu Glu Met Val Tyr His Ser Thr Gly Ile Asn Glu Asn Ala Phe Arg 210 215 220Leu Phe Val Thr Lys Pro Glu Met Phe Gly Ala Ala Thr Gly Ala Ala225 230 235 240Pro Ala His Asp Ala Leu Ser Leu Ile Met Leu Thr Arg Phe Ala Asp 245 250 255Trp Val Asn Ala Leu Gly Glu Lys Ala Ser Ser Val Leu Ala Ala Phe 260 265 270Glu Ala Asn Ser Leu Thr Ala Glu Gln Leu Ala Asp Ala Met Asn Leu 275 280 285Asp Ala Asn Leu Leu Leu Gln Ala Ser Ile Gln Ala Gln Asn His Gln 290 295 300His Leu Pro Pro Val Thr Pro Glu Asn Ala Phe Ser Cys Trp Thr Ser305 310 315 320Ile Asn Thr Ile Leu Gln Trp Val Asn Val Ala Gln Gln Leu Lys Cys 325 330 335Arg Pro Thr Gly Arg Phe Arg Phe Gly Arg Ala Gly Leu Tyr Ser Ile 340 345 350Asn Glu Arg Asp Thr Asp Leu Cys Pro Val Gly Lys Arg Gly Arg Arg 355 360 365Ile Asn Arg Arg Val Glu Phe Asn Asn Arg Leu Ile His Tyr Asn Ala 370 375 380Phe Leu Asp Glu Ser Arg Ser Ala Ala Leu Ser Thr Tyr Tyr Ile Arg385 390 395 400Gln Val Ala Lys Ala Ala Ala Ala Ile Lys Ser Arg Asp Asp Leu Tyr 405 410 415Gln Tyr Leu Leu Ile Asp Asn Gln Val Ser Ala Ala Ile Lys Thr Thr 420 425 430Arg Ile Ala Glu Ala Ile Ala Ser Ile Gln Leu Tyr Val Asn Arg Ala 435 440 445Leu Glu Asn Val Glu Glu Asn Ala Asn Ser Gly Val Ile Ser Arg Gln 450 455 460Phe Phe Ile Asp Trp Asp Lys Tyr Asn Lys Arg Tyr Ser Thr Trp Ala465 470 475 480Gly Val Ser Gln Leu Val Tyr Tyr Pro Glu Asn Tyr Ile Asp Pro Thr 485 490 495Met Arg Ile Gly Gln Thr Lys Met Met Asp Ala Leu Leu Gln Ser Val 500 505 510Ser Gln Ser Gln Leu Asn Ala Asp Thr Val Glu Asp Ala Phe Met Ser 515 520 525Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn Leu Lys Val Ile Ser Ala 530 535 540Tyr His Asp Asn Ile Asn Asn Asp Gln Gly Leu Thr Tyr Phe Ile Gly545 550 555 560Leu Ser Glu Thr Asp Ala Gly Glu Tyr Tyr Trp Arg Ser Val Asp His 565 570 575Ser Lys Phe Asn Asp Gly Lys Phe Ala Ala Asn Ala Trp Ser Glu Trp 580 585 590His Lys Ile Asp Cys Pro Ile Asn Pro Tyr Lys Ser Thr Ile Arg Pro 595 600 605Val Ile Tyr Lys Ser Arg Leu Tyr Leu Leu Trp Leu Glu Gln Lys Glu 610 615 620Ile Thr Lys Gln Thr Gly Asn Ser Lys Asp Gly Tyr Gln Thr Glu Thr625 630 635 640Asp Tyr Arg Tyr Glu Leu Lys Leu Ala His Ile Arg Tyr Asp Gly Thr 645 650 655Trp Asn Thr Pro Ile Thr Phe Asp Val Asn Lys Lys Ile Ser Glu Leu 660 665 670Lys Leu Glu Lys Asn Arg Ala Pro Gly Leu Tyr Cys Ala Gly Tyr Gln 675 680 685Gly Glu Asp Thr Leu Leu Val Met Phe Tyr Asn Gln Gln Asp Thr Leu 690 695 700Asp Ser Tyr Lys Asn Ala Ser Met Gln Gly Leu Tyr Ile Phe Ala Asp705 710 715 720Met Ala Ser Lys Asp Met Thr Pro Glu Gln Ser Asn Val Tyr Arg Asp 725 730 735Asn Ser Tyr Gln Gln Phe Asp Thr Asn Asn Val Arg Arg Val Asn Asn 740 745 750Arg Tyr Ala Glu Asp Tyr Glu Ile Pro Ser Ser Val Ser Ser Arg Lys 755 760 765Asp Tyr Gly Trp Gly Asp Tyr Tyr Leu Ser Met Val Tyr Asn Gly Asp 770 775 780Ile Pro Thr Ile Asn Tyr Lys Ala Ala Ser Ser Asp Leu Lys Ile Tyr785 790 795 800Ile Ser Pro Lys Leu Arg Ile Ile His Asn Gly Tyr Glu Gly Gln Lys 805 810 815Arg Asn Gln Cys Asn Leu Met Asn Lys Tyr Gly Lys Leu Gly Asp Lys 820 825 830Phe Ile Val Tyr Thr Ser Leu Gly Val Asn Pro Asn Asn 835 840 845 16 amino acids amino acid linear protein N-terminal 38Arg Tyr Tyr Asn Leu Ser Asp Glu Glu Leu Ser Gln Phe Ile Gly1 5 10 15Lys 20 amino acids amino acid linear protein N-terminal 39Gly Thr Ala Thr Asp Val Ser Gly Pro Val Glu Ile Asn Thr Ala1 5 10 15Ile Ser Pro Ala Lys20 11 amino acids amino acid linear protein N-terminal 40Ala Asn Ser Leu Tyr Ala Leu Phe Leu Pro Gln1 5 10 14 amino acids amino acid linear protein N-terminal 41Leu Arg Ser Ala Asn Thr Leu Thr Asp Leu Phe Leu Pro Gln1 5 10 19 amino acids amino acid linear protein N-terminal 42Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu Ala Glu Val Tyr1 5 10 15Ala Gly Leu Glu 11 amino acids amino acid linear protein N-terminal 43Ile Arg Glu Asp Tyr Pro Ala Ser Leu Gly Lys1 5 10 16 amino acids amino acid linear protein N-terminal 44Asp Asp Ser Gly Asp Asp Asp Lys Val Thr Asn Thr Asp Ile His1 5 10 15Arg 13 amino acids amino acid linear protein N-terminal 45Asp Val Xaa Gly Ser Glu Lys Ala Asn Glu Lys Leu Lys1 5 10 7551 base pairs nucleic acid double linear DNA (genomic) 46ATG AAC GAG TCT GTA AAA GAG ATA CCT GAT GTA TTA AAA AGC CAG TGT 48Met Asn Glu Ser Val Lys Glu Ile Pro Asp Val Leu Lys Ser Gln Cys1 5 10 15GGT TTT AAT TGT CTG ACA GAT ATT AGC CAC AGC TCT TTT AAT GAA TTT 96Gly Phe Asn Cys Leu Thr Asp Ile Ser His Ser Ser Phe Asn Glu Phe 20 25 30CGC CAG CAA GTA TCT GAG CAC CTC TCC TGG TCC GAA ACA CAC GAC TTA 144Arg Gln Gln Val Ser Glu His Leu Ser Trp Ser Glu Thr His Asp Leu 35 40 45TAT CAT GAT GCA CAA CAG GCA CAA AAG GAT AAT CGC CTG TAT GAA GCG 192Tyr His Asp Ala Gln Gln Ala Gln Lys Asp Asn Arg Leu Tyr Glu Ala 50 55 60CGT ATT CTC AAA CGC GCC AAT CCC CAA TTA CAA AAT GCG GTG CAT CTT 240Arg Ile Leu Lys Arg Ala Asn Pro Gln Leu Gln Asn Ala Val His Leu65 70 75 80GCC ATT CTC GCT CCC AAT GCT GAA CTG ATA GGC TAT AAC AAT CAA TTT 288Ala Ile Leu Ala Pro Asn Ala Glu Leu Ile Gly Tyr Asn Asn Gln Phe 85 90 95AGC GGT AGA GCC AGT CAA TAT GTT GCG CCG GGT ACC GTT TCT TCC ATG 336Ser Gly Arg Ala Ser Gln Tyr Val Ala Pro Gly Thr Val Ser Ser Met 100 105 110TTC TCC CCC GCC GCT TAT TTG ACT GAA CTT TAT CGT GAA GCA CGC AAT 384Phe Ser Pro Ala Ala Tyr Leu Thr Glu Leu Tyr Arg Glu Ala Arg Asn 115 120 125TTA CAC GCA AGT GAC TCC GTT TAT TAT CTG GAT ACC CGC CGC CCA GAT 432Leu His Ala Ser Asp Ser Val Tyr Tyr Leu Asp Thr Arg Arg Pro Asp 130 135 140CTC AAA TCA ATG GCG CTC AGT CAG CAA AAT ATG GAT ATA GAA TTA TCC 480Leu Lys Ser Met Ala Leu Ser Gln Gln Asn Met Asp Ile Glu Leu Ser145 150 155 160ACA CTC TCT TTG TCC AAT GAG CTG TTA TTG GAA AGC ATT AAA ACT GAA 528Thr Leu Ser Leu Ser Asn Glu Leu Leu Leu Glu Ser Ile Lys Thr Glu 165 170 175TCT AAA CTG GAA AAC TAT ACT AAA GTG ATG GAA ATG CTC TCC ACT TTC 576Ser Lys Leu Glu Asn Tyr Thr Lys Val Met Glu Met Leu Ser Thr Phe 180 185 190CGT CCT TCC GGC GCA ACG CCT TAT CAT GAT GCT TAT GAA AAT GTG CGT 624Arg Pro Ser Gly Ala Thr Pro Tyr His Asp Ala Tyr Glu Asn Val Arg 195 200 205GAA GTT ATC CAG CTA CAA GAT CCT GGA CTT GAG CAA CTC AAT GCA TCA 672Glu Val Ile Gln Leu Gln Asp Pro Gly Leu Glu Gln Leu Asn Ala Ser 210 215 220CCG GCA ATT GCC GGG TTG ATG CAT CAA GCC TCC CTA TTG GGT ATT AAC 720Pro Ala Ile Ala Gly Leu Met His Gln Ala Ser Leu Leu Gly Ile Asn225 230 235 240GCT TCA ATC TCG CCT GAG CTA TTT AAT ATT CTG ACG GAG GAG ATT ACC 768Ala Ser Ile Ser Pro Glu Leu Phe Asn Ile Leu Thr Glu Glu Ile Thr 245 250 255GAA GGT AAT GCT GAG GAA CTT TAT AAG AAA AAT TTT GGT AAT ATC GAA 816Glu Gly Asn Ala Glu Glu Leu Tyr Lys Lys Asn Phe Gly Asn Ile Glu 260 265 270CCG GCC TCA TTG GCT ATG CCG GAA TAC CTT AAA CGT TAT TAT AAT TTA 864Pro Ala Ser Leu Ala Met Pro Glu Tyr Leu Lys Arg Tyr Tyr Asn Leu 275 280 285AGC GAT GAA GAA CTT AGT CAG TTT ATT GGT AAA GCC AGC AAT TTT GGT 912Ser Asp Glu Glu Leu Ser Gln Phe Ile Gly Lys Ala Ser Asn Phe Gly 290 295 300CAA CAG GAA TAT AGT AAT AAC CAA CTT ATT ACT CCG GTA GTC AAC AGC 960Gln Gln Glu Tyr Ser Asn Asn Gln Leu Ile Thr Pro Val Val Asn Ser305 310 315 320AGT GAT GGC ACG GTT AAG GTA TAT CGG ATC ACC CGC GAA TAT ACA ACC 1008Ser Asp Gly Thr Val Lys Val Tyr Arg Ile Thr Arg Glu Tyr Thr Thr 325 330 335AAT GCT TAT CAA ATG GAT GTG GAG CTA TTT CCC TTC GGT GGT GAG AAT 1056Asn Ala Tyr Gln Met Asp Val Glu Leu Phe Pro Phe Gly Gly Glu Asn 340 345 350TAT CGG TTA GAT TAT AAA TTC AAA AAT TTT TAT AAT GCC TCT TAT TTA 1104Tyr Arg Leu Asp Tyr Lys Phe Lys Asn Phe Tyr Asn Ala Ser Tyr Leu 355 360 365TCC ATC AAG TTA AAT GAT AAA AGA GAA CTT GTT CGA ACT GAA GGC GCT 1152Ser Ile Lys Leu Asn Asp Lys Arg Glu Leu Val Arg Thr Glu Gly Ala 370 375 380CCT CAA GTC AAT ATA GAA TAC TCC GCA AAT ATC ACA TTA AAT ACC GCT 1200Pro Gln Val Asn Ile Glu Tyr Ser Ala Asn Ile Thr Leu Asn Thr Ala385 390 395 400GAT ATC AGT CAA CCT TTT GAA ATT GGC CTG ACA CGA GTA CTT CCT TCC 1248Asp Ile Ser Gln Pro Phe Glu Ile Gly Leu Thr Arg Val Leu Pro Ser 405 410 415GGT TCT TGG GCA TAT GCC GCC GCA AAA TTT ACC GTT GAA GAG TAT AAC 1296Gly Ser Trp Ala Tyr Ala Ala Ala Lys Phe Thr Val Glu Glu Tyr Asn 420 425 430CAA TAC TCT TTT CTG CTA AAA CTT AAC AAG GCT ATT CGT CTA TCA CGT 1344Gln Tyr Ser Phe Leu Leu Lys Leu Asn Lys Ala Ile Arg Leu Ser Arg 435 440 445GCG ACA GAA TTG TCA CCC ACG ATT CTG GAA GGC ATT GTG CGC AGT GTT 1392Ala Thr Glu Leu Ser Pro Thr Ile Leu Glu Gly Ile Val Arg Ser Val 450 455 460AAT CTA CAA CTG GAT ATC AAC ACA GAC GTA TTA GGT AAA GTT TTT CTG 1440Asn Leu Gln Leu Asp Ile Asn Thr Asp Val Leu Gly Lys Val Phe Leu465 470 475 480ACT AAA TAT TAT ATG CAG CGT TAT GCT ATT CAT GCT GAA ACT GCC CTG 1488Thr Lys Tyr Tyr Met Gln Arg Tyr Ala Ile His Ala Glu Thr Ala Leu 485 490 495ATA CTA TGC AAC GCG CCT ATT TCA CAA CGT TCA TAT GAT AAT CAA CCT 1536Ile Leu Cys Asn Ala Pro Ile Ser Gln Arg Ser Tyr Asp Asn Gln Pro 500 505 510AGC CAA TTT GAT CGC CTG TTT AAT ACG CCA TTA CTG AAC GGA CAA TAT 1584Ser Gln Phe Asp Arg Leu Phe Asn Thr Pro Leu Leu Asn Gly Gln Tyr 515 520 525TTT TCT ACC GGC GAT GAG GAG ATT GAT TTA AAT TCA GGT AGC ACC GGC 1632Phe Ser Thr Gly Asp Glu Glu Ile Asp Leu Asn Ser Gly Ser Thr Gly 530 535 540GAT TGG CGA AAA ACC ATA CTT AAG CGT GCA TTT AAT ATT GAT GAT GTC 1680Asp Trp Arg Lys Thr Ile Leu Lys Arg Ala Phe Asn Ile Asp Asp Val545 550 555 560TCG CTC TTC CGC CTG CTT AAA ATT ACC GAC CAT GAT AAT AAA GAT GGA 1728Ser Leu Phe Arg Leu Leu Lys Ile Thr Asp His Asp Asn Lys Asp Gly 565 570 575AAA ATT AAA AAT AAC CTA AAG AAT CTT TCC AAT TTA TAT ATT GGA AAA 1776Lys Ile Lys Asn Asn Leu Lys Asn Leu Ser Asn Leu Tyr Ile Gly Lys 580 585 590TTA CTG GCA GAT ATT CAT CAA TTA ACC ATT GAT GAA CTG GAT TTA TTA 1824Leu Leu Ala Asp Ile His Gln Leu Thr Ile Asp Glu Leu Asp Leu Leu 595 600 605CTG ATT GCC GTA GGT GAA GGA AAA ACT AAT TTA TCC GCT ATC AGT GAT 1872Leu Ile Ala Val Gly Glu Gly Lys Thr Asn Leu Ser Ala Ile Ser Asp 610 615 620AAG CAA TTG GCT ACC CTG ATC AGA AAA CTC AAT ACT ATT ACC AGC TGG 1920Lys Gln Leu Ala Thr Leu Ile Arg Lys Leu Asn Thr Ile Thr Ser Trp625 630 635 640CTA CAT ACA CAG AAG TGG AGT GTA TTC CAG CTA TTT ATC ATG ACC TCC 1968Leu His Thr Gln Lys Trp Ser Val Phe Gln Leu Phe Ile Met Thr Ser 645 650 655ACC AGC TAT AAC AAA ACG CTA ACG CCT GAA ATT AAG AAT TTG CTG GAT 2016Thr Ser Tyr Asn Lys Thr Leu Thr Pro Glu Ile Lys Asn Leu Leu Asp 660 665 670ACC GTC TAC CAC GGT TTA CAA GGT TTT GAT AAA GAC AAA GCA GAT TTG 2064Thr Val Tyr His Gly Leu Gln Gly Phe Asp Lys Asp Lys Ala Asp Leu 675 680 685CTA CAT GTC ATG GCG CCC TAT ATT GCG GCC ACC TTG CAA TTA TCA TCG 2112Leu His Val Met Ala Pro Tyr Ile Ala Ala Thr Leu Gln Leu Ser Ser 690 695 700GAA AAT GTC GCC CAC TCG GTA CTC CTT TGG GCA GAT AAG TTA CAG CCC 2160Glu Asn Val Ala His Ser Val Leu Leu Trp Ala Asp Lys Leu Gln Pro705 710 715 720GGC GAC GGC GCA ATG ACA GCA GAA AAA TTC TGG GAC TGG TTG AAT ACT 2208Gly Asp Gly Ala Met Thr Ala Glu Lys Phe Trp Asp Trp Leu Asn Thr 725 730 735AAG TAT ACG CCG GGT TCA TCG GAA GCC GTA GAA ACG CAG GAA CAT ATC 2256Lys Tyr Thr Pro Gly Ser Ser Glu Ala Val Glu Thr Gln Glu His Ile 740 745 750GTT CAG TAT TGT CAG GCT CTG GCA CAA TTG GAA ATG GTT TAC CAT TCC 2304Val Gln Tyr Cys Gln Ala Leu Ala Gln Leu Glu Met Val Tyr His Ser 755 760 765ACC GGC ATC AAC GAA AAC GCC TTC CGT CTA TTT GTG ACA AAA CCA GAG 2352Thr Gly Ile Asn Glu Asn Ala Phe Arg Leu Phe Val Thr Lys Pro Glu 770 775 780ATG TTT GGC GCT GCA ACT GGA GCA GCG CCC GCG CAT GAT GCC CTT TCA 2400Met Phe Gly Ala Ala Thr Gly Ala Ala Pro Ala His Asp Ala Leu Ser785 790 795 800CTG ATT ATG CTG ACA CGT TTT GCG GAT TGG GTG AAC GCA CTA GGC GAA 2448Leu Ile Met Leu Thr Arg Phe Ala Asp Trp Val Asn Ala Leu Gly Glu 805 810 815AAA GCG TCC TCG GTG CTA GCG GCA TTT GAA GCT AAC TCG TTA ACG GCA 2496Lys Ala Ser Ser Val Leu Ala Ala Phe Glu Ala Asn Ser Leu Thr Ala 820 825 830GAA CAA CTG GCT GAT GCC ATG AAT CTT GAT GCT AAT TTG CTG TTG CAA 2544Glu Gln Leu Ala Asp Ala Met Asn Leu Asp Ala Asn Leu Leu Leu Gln 835 840 845GCC AGT ATT CAA GCA CAA AAT CAT CAA CAT CTT CCC CCA GTA ACT CCA 2592Ala Ser Ile Gln Ala Gln Asn His Gln His Leu Pro Pro Val Thr Pro 850 855 860GAA AAT GCG TTC TCC TGT TGG ACA TCT ATC AAT ACT ATC CTG CAA TGG 2640Glu Asn Ala Phe Ser Cys Trp Thr Ser Ile Asn Thr Ile Leu Gln Trp865 870 875 880GTT AAT GTC GCA CAA CAA TTG AAT GTC GCC CCA CAG GGC GTT TCC GCT 2688Val Asn Val Ala Gln Gln Leu Asn Val Ala Pro Gln Gly Val Ser Ala 885 890 895TTG GTC GGG CTG GAT TAT ATT CAA TCA ATG AAA GAG ACA CCG ACC TAT 2736Leu Val Gly Leu Asp Tyr Ile Gln Ser Met Lys Glu Thr Pro Thr Tyr 900 905 910GCC CAG TGG GAA AAC GCG GCA GGC GTA TTA ACC GCC GGG TTG AAT TCA 2784Ala Gln Trp Glu Asn Ala Ala Gly Val Leu Thr Ala Gly Leu Asn Ser 915 920 925CAA CAG GCT AAT ACA TTA CAC GCT TTT CTG GAT GAA TCT CGC AGT GCC 2832Gln Gln Ala Asn Thr Leu His Ala Phe Leu Asp Glu Ser Arg Ser Ala 930 935 940GCA TTA AGC ACC TAC TAT ATC CGT CAA GTC GCC AAG GCA GCG GCG GCT 2880Ala Leu Ser Thr Tyr Tyr Ile Arg Gln Val Ala Lys Ala Ala Ala Ala945 950 955 960ATT AAA AGC CGT GAT GAC TTG TAT CAA TAC TTA CTG ATT GAT AAT CAG 2928Ile Lys Ser Arg Asp Asp Leu Tyr Gln Tyr Leu Leu Ile Asp Asn Gln 965 970 975GTT TCT GCG GCA ATA AAA ACC ACC CGG ATC GCC GAA GCC ATT GCC AGT 2976Val Ser Ala Ala Ile Lys Thr Thr Arg Ile Ala Glu Ala Ile Ala Ser 980 985 990ATT CAA CTG TAC GTC AAC CGG GCA TTG GAA AAT GTG GAA GAA AAT GCC 3024Ile Gln Leu Tyr Val Asn Arg Ala Leu Glu Asn Val Glu Glu Asn Ala 995 1000 1005AAT TCG GGG GTT ATC AGC CGC CAA TTC TTT ATC GAC TGG GAC AAA TAC 3072Asn Ser Gly Val Ile Ser Arg Gln Phe Phe Ile Asp Trp Asp Lys Tyr 1010 1015 1020AAT AAA CGC TAC AGC ACT TGG GCG GGT GTT TCT CAA TTA GTT TAC TAC 3120Asn Lys Arg Tyr Ser Thr Trp Ala Gly Val Ser Gln Leu Val Tyr Tyr1025 1030 1035 1040CCG GAA AAC TAT ATT GAT CCG ACC ATG CGT ATC GGA CAA ACC AAA ATG 3168Pro Glu Asn Tyr Ile Asp Pro Thr Met Arg Ile Gly Gln Thr Lys Met 1045 1050 1055ATG GAC GCA TTA CTG CAA TCC GTC AGC CAA AGC CAA TTA AAC GCC GAT 3216Met Asp Ala Leu Leu Gln Ser Val Ser Gln Ser Gln Leu Asn Ala Asp 1060 1065 1070ACC GTC GAA GAT GCC TTT ATG TCT TAT CTG ACA TCG TTT GAA CAA GTG 3264Thr Val Glu Asp Ala Phe Met Ser Tyr Leu Thr Ser Phe Glu Gln Val 1075 1080 1085GCT AAT CTT AAA GTT ATT AGC GCA TAT CAC GAT AAT ATT AAT AAC GAT 3312Ala Asn Leu Lys Val Ile Ser Ala Tyr His Asp Asn Ile Asn Asn Asp 1090 1095 1100CAA GGG CTG ACC TAT TTT ATC GGA CTC AGT GAA ACT GAT GCC GGT GAA 3360Gln Gly Leu Thr Tyr Phe Ile Gly Leu Ser Glu Thr Asp Ala Gly Glu1105 1110 1115 1120TAT TAT TGG CGC AGT GTC GAT CAC AGT AAA TTC AAC GAC GGT AAA TTC 3408Tyr Tyr Trp Arg Ser Val Asp His Ser Lys Phe Asn Asp Gly Lys Phe 1125 1130 1135GCG GCT AAT GCC TGG AGT GAA TGG CAT AAA ATT GAT TGT CCA ATT AAC 3456Ala Ala Asn Ala Trp Ser Glu Trp His Lys Ile Asp Cys Pro Ile Asn 1140 1145 1150CCT TAT AAA AGC ACT ATC CGT CCA GTG ATA TAT AAA TCC CGC CTG TAT 3504Pro Tyr Lys Ser Thr Ile Arg Pro Val Ile Tyr Lys Ser Arg Leu Tyr 1155 1160 1165CTG CTC TGG TTG GAA CAA AAG GAG ATC ACC AAA CAG ACA GGA AAT AGT 3552Leu Leu Trp Leu Glu Gln Lys Glu Ile Thr Lys Gln Thr Gly Asn Ser 1170 1175 1180AAA GAT GGC TAT CAA ACT GAA ACG GAT TAT CGT TAT GAA CTA AAA TTG 3600Lys Asp Gly Tyr Gln Thr Glu Thr Asp Tyr Arg Tyr Glu Leu Lys Leu1185 1190 1195 1200GCG CAT ATC CGC TAT GAT GGC ACT TGG AAT ACG CCA ATC ACC TTT GAT 3648Ala His Ile Arg Tyr Asp Gly Thr Trp Asn Thr Pro Ile Thr Phe Asp 1205 1210 1215GTC AAT AAA AAA ATA TCC GAG CTA AAA CTG GAA AAA AAT AGA GCG CCC 3696Val Asn Lys Lys Ile Ser Glu Leu Lys Leu Glu Lys Asn Arg Ala Pro 1220 1225 1230GGA CTC TAT TGT GCC GGT TAT CAA GGT GAA GAT ACG TTG CTG GTG ATG 3744Gly Leu Tyr Cys Ala Gly Tyr Gln Gly Glu Asp Thr Leu Leu Val Met 1235 1240 1245TTT TAT AAC CAA CAA GAC ACA CTA GAT AGT TAT AAA AAC GCT TCA ATG 3792Phe Tyr Asn Gln Gln Asp Thr Leu Asp Ser Tyr Lys Asn Ala Ser Met 1250 1255 1260CAA GGA CTA TAT ATC TTT GCT GAT ATG GCA TCC AAA GAT ATG ACC CCA 3840Gln Gly Leu Tyr Ile Phe Ala Asp Met Ala Ser Lys Asp Met Thr Pro1265 1270 1275 1280GAA CAG AGC AAT GTT TAT CGG GAT AAT AGC TAT CAA CAA TTT GAT ACC 3888Glu Gln Ser Asn Val Tyr Arg Asp Asn Ser Tyr Gln Gln Phe Asp Thr 1285 1290 1295AAT AAT GTC AGA AGA GTG AAT AAC CGC TAT GCA GAG GAT TAT GAG ATT 3936Asn Asn Val Arg Arg Val Asn Asn Arg Tyr Ala Glu Asp Tyr Glu Ile 1300 1305 1310CCT TCC TCG GTA AGT AGC CGT AAA GAC TAT GGT TGG GGA GAT TAT TAC 3984Pro Ser Ser Val Ser Ser Arg Lys Asp Tyr Gly Trp Gly Asp Tyr Tyr 1315 1320 1325CTC AGC ATG GTA TAT AAC GGA GAT ATT CCA ACT ATC AAT TAC AAA GCC 4032Leu Ser Met Val Tyr Asn Gly Asp Ile Pro Thr Ile Asn Tyr Lys Ala 1330 1335 1340GCA TCA AGT GAT TTA AAA ATC TAT ATC TCA CCA AAA TTA AGA ATT ATT 4080Ala Ser Ser Asp Leu Lys Ile Tyr Ile Ser Pro Lys Leu Arg Ile Ile1345 1350 1355 1360CAT AAT GGA TAT GAA GGA CAG AAG CGC AAT CAA TGC AAT CTG ATG AAT 4128His Asn Gly Tyr Glu Gly Gln Lys Arg Asn Gln Cys Asn Leu Met Asn 1365 1370 1375AAA TAT GGC AAA CTA GGT GAT AAA TTT ATT GTT TAT ACT AGC TTG GGG 4176Lys Tyr Gly Lys Leu Gly Asp Lys Phe Ile Val Tyr Thr Ser Leu Gly 1380 1385 1390GTC AAT CCA AAT AAC TCG TCA AAT AAG CTC ATG TTT TAC CCC GTC TAT 4224Val Asn Pro Asn Asn Ser Ser Asn Lys Leu Met Phe Tyr Pro Val Tyr 1395 1400 1405CAA TAT AGC GGA AAC ACC AGT GGA CTC AAT CAA GGG AGA CTA CTA TTC 4272Gln Tyr Ser Gly Asn Thr Ser Gly Leu Asn Gln Gly Arg Leu Leu Phe 1410 1415 1420CAC CGT GAC ACC ACT TAT CCA TCT AAA GTA GAA GCT TGG ATT CCT GGA 4320His Arg Asp Thr Thr Tyr Pro Ser Lys Val Glu Ala Trp Ile Pro Gly1425 1430 1435 1440GCA AAA CGT TCT CTA ACC AAC CAA AAT GCC GCC ATT GGT GAT GAT TAT 4368Ala Lys Arg Ser Leu Thr Asn Gln Asn Ala Ala Ile Gly Asp Asp Tyr 1445 1450 1455GCT ACA GAC TCT CTG AAT AAA CCG GAT GAT CTT AAG CAA TAT ATC TTT 4416Ala Thr Asp Ser Leu Asn Lys Pro Asp Asp Leu Lys Gln Tyr Ile Phe 1460 1465 1470ATG ACT GAC AGT AAA GGG ACT GCT ACT GAT GTC TCA GGC CCA GTA GAG 4464Met Thr Asp Ser Lys Gly Thr Ala Thr Asp Val Ser Gly Pro Val Glu 1475 1480 1485ATT AAT ACT GCA ATT TCT CCA GCA AAA GTT CAG ATA ATA GTC AAA GCG 4512Ile Asn Thr Ala Ile Ser Pro Ala Lys Val Gln Ile Ile Val Lys Ala 1490 1495 1500GGT GGC AAG GAG CAA ACT TTT ACC GCA GAT AAA GAT GTC TCC ATT CAG 4560Gly Gly Lys Glu Gln Thr Phe Thr Ala Asp Lys Asp Val Ser Ile Gln1505 1510 1515 1520CCA TCA CCT AGC TTT GAT GAA ATG AAT TAT CAA TTT AAT GCC CTT GAA 4608Pro Ser Pro Ser Phe Asp Glu Met Asn Tyr Gln Phe Asn Ala Leu Glu 1525 1530 1535ATA GAC GGT TCT GGT CTG AAT TTT ATT AAC AAC TCA GCC AGT ATT GAT 4656Ile Asp Gly Ser Gly Leu Asn Phe Ile Asn Asn Ser Ala Ser Ile Asp 1540 1545 1550GTT ACT TTT ACC GCA TTT GCG GAG GAT GGC CGC AAA CTG GGT TAT GAA 4704Val Thr Phe Thr Ala Phe Ala Glu Asp Gly Arg Lys Leu Gly Tyr Glu 1555 1560 1565AGT TTC AGT ATT CCT GTT ACC CTC AAG GTA AGT ACC GAT AAT GCC CTG 4752Ser Phe Ser Ile Pro Val Thr Leu Lys Val Ser Thr Asp Asn Ala Leu 1570 1575 1580ACC CTG CAC CAT AAT GAA AAT GGT GCG CAA TAT ATG CAA TGG CAA TCC 4800Thr Leu His His Asn Glu Asn Gly Ala Gln Tyr Met Gln Trp Gln Ser1585 1590 1595 1600TAT CGT ACC CGC CTG AAT ACT CTA TTT GCC CGC CAG TTG GTT GCA CGC 4848Tyr Arg Thr Arg Leu Asn Thr Leu Phe Ala Arg Gln Leu Val Ala Arg 1605 1610 1615GCC ACC ACC GGA ATC GAT ACA ATT CTG AGT ATG GAA ACT CAG AAT ATT 4896Ala Thr Thr Gly Ile Asp Thr Ile Leu Ser Met Glu Thr Gln Asn Ile 1620 1625 1630CAG GAA CCG CAG TTA GGC AAA GGT TTC TAT GCT ACG TTC GTG ATA CCT 4944Gln Glu Pro Gln Leu Gly Lys Gly Phe Tyr Ala Thr Phe Val Ile Pro 1635 1640 1645CCC TAT AAC CTA TCA ACT CAT GGT GAT GAA CGT TGG TTT AAG CTT TAT 4992Pro Tyr Asn Leu Ser Thr His Gly Asp Glu Arg Trp Phe Lys Leu Tyr 1650 1655 1660ATC AAA CAT GTT GTT GAT AAT AAT TCA CAT ATT ATC TAT TCA GGC CAG 5040Ile Lys His Val Val Asp Asn Asn Ser His Ile Ile Tyr Ser Gly Gln1665 1670 1675 1680CTA ACA GAT ACA AAT ATA AAC ATC ACA TTA TTT ATT CCT CTT GAT GAT 5088Leu Thr Asp Thr Asn Ile Asn Ile Thr Leu Phe Ile Pro Leu Asp Asp 1685 1690 1695GTC CCA TTG AAT CAA GAT TAT CAC GCC AAG GTT TAT ATG ACC TTC AAG 5136Val Pro Leu Asn Gln Asp Tyr His Ala Lys Val Tyr Met Thr Phe Lys 1700 1705 1710AAA TCA CCA TCA GAT GGT ACC TGG TGG GGC CCT CAC TTT GTT AGA GAT 5184Lys Ser Pro Ser Asp Gly Thr Trp Trp Gly Pro His Phe Val Arg Asp 1715 1720 1725GAT AAA GGA ATA GTA ACA ATA AAC CCT AAA TCC ATT TTG ACC CAT TTT 5232Asp Lys Gly Ile Val Thr Ile Asn Pro Lys Ser Ile Leu Thr His Phe 1730 1735 1740GAG AGC GTC AAT GTC CTG AAT AAT ATT AGT AGC GAA CCA ATG GAT TTC 5280Glu Ser Val Asn Val Leu Asn Asn Ile Ser Ser Glu Pro Met Asp Phe1745 1750 1755 1760AGC GGC GCT AAC AGC CTC TAT TTC TGG GAA CTG TTC TAC TAT ACC CCG 5328Ser Gly Ala Asn Ser Leu Tyr Phe Trp Glu Leu Phe Tyr Tyr Thr Pro 1765 1770 1775ATG CTG GTT GCT CAA CGT TTG CTG CAT GAA CAG AAC TTC GAT GAA GCC 5376Met Leu Val Ala Gln Arg Leu Leu His Glu Gln Asn Phe Asp Glu Ala 1780 1785 1790AAC CGT TGG CTG AAA TAT GTC TGG AGT CCA TCC GGT TAT ATT GTC CAC 5424Asn Arg Trp Leu Lys Tyr Val Trp Ser Pro Ser Gly Tyr Ile Val His 1795 1800 1805GGC CAG ATT CAG AAC TAC CAG TGG AAC GTC CGC CCG TTA CTG GAA GAC 5472Gly Gln Ile Gln Asn Tyr Gln Trp Asn Val Arg Pro Leu Leu Glu Asp 1810 1815 1820ACC AGT TGG AAC AGT GAT CCT TTG GAT TCC GTC GAT CCT GAC GCG GTA 5520Thr Ser Trp Asn Ser Asp Pro Leu Asp Ser Val Asp Pro Asp Ala Val1825 1830 1835 1840GCA CAG CAC GAT CCA ATG CAC TAC AAA GTT TCA ACT TTT ATG CGT ACC 5568Ala Gln His Asp Pro Met His Tyr Lys Val Ser Thr Phe Met Arg Thr 1845 1850 1855TTG GAT CTA TTG ATA GCA CGC GGC GAC CAT GCT TAT CGC CAA CTG GAA 5616Leu Asp Leu Leu Ile Ala Arg Gly Asp His Ala Tyr Arg Gln Leu Glu 1860 1865 1870CGA GAT ACA CTC AAC GAA GCG AAG ATG TGG TAT ATG CAA GCG CTG CAT 5664Arg Asp Thr Leu Asn Glu Ala Lys Met Trp Tyr Met Gln Ala Leu His 1875 1880 1885CTA TTA GGT GAC AAA CCT TAT CTA CCG CTG AGT ACG ACA TGG AGT GAT 5712Leu Leu Gly Asp Lys Pro Tyr Leu Pro Leu Ser Thr Thr Trp Ser Asp 1890 1895 1900CCA CGA CTA GAC AGA GCC GCG GAT ATC ACT ACC CAA AAT GCT CAC GAC 5760Pro Arg Leu Asp Arg Ala Ala Asp Ile Thr Thr Gln Asn Ala His Asp1905 1910 1915 1920AGC GCA ATA GTC GCT CTG CGG CAG AAT ATA CCT ACA CCG GCA CCT TTA 5808Ser Ala Ile Val Ala Leu Arg Gln Asn Ile Pro Thr Pro Ala Pro Leu 1925 1930 1935TCA TTG CGC AGC GCT AAT ACC CTG ACT GAT CTC TTC CTG CCG CAA ATC 5856Ser Leu Arg Ser Ala Asn Thr Leu Thr Asp Leu Phe Leu Pro Gln Ile 1940 1945 1950AAT GAA GTG ATG ATG AAT TAC TGG CAG ACA TTA GCT CAG AGA GTA TAC 5904Asn Glu Val Met Met Asn Tyr Trp Gln Thr Leu Ala Gln Arg Val Tyr 1955 1960 1965AAT CTG CGT CAT AAC CTC TCT ATC GAC GGC CAG CCG TTA TAT CTG CCA 5952Asn Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Tyr Leu Pro 1970 1975 1980ATC TAT GCC ACA CCG GCC GAT CCG AAA GCG TTA CTC AGC GCC GCC GTT 6000Ile Tyr Ala Thr Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala Ala Val1985 1990 1995 2000GCC ACT TCT CAA GGT GGA GGC AAG CTA CCG GAA TCA TTT ATG TCC CTG 6048Ala Thr Ser Gln Gly Gly Gly Lys Leu Pro Glu Ser Phe Met Ser Leu 2005 2010 2015TGG CGT TTC CCG CAC ATG CTG GAA AAT GCG CGC GGC ATG GTT AGC CAG 6096Trp Arg Phe Pro His Met Leu Glu Asn Ala Arg Gly Met Val Ser Gln 2020 2025 2030CTC ACC CAG TTC GGC TCC ACG TTA CAA AAT ATT ATC GAA CGT CAG GAC 6144Leu Thr Gln Phe Gly Ser Thr Leu Gln Asn Ile Ile Glu Arg Gln Asp 2035 2040 2045GCG GAA GCG CTC AAT GCG TTA TTA CAA AAT CAG GCC GCC GAG CTG ATA 6192Ala Glu Ala Leu Asn Ala Leu Leu Gln Asn Gln Ala Ala Glu Leu Ile 2050 2055 2060TTG ACT AAC CTG AGC ATT CAG GAC AAA ACC ATT GAA GAA TTG GAT GCC 6240Leu Thr Asn Leu Ser Ile Gln Asp Lys Thr Ile Glu Glu Leu Asp Ala2065 2070 2075 2080GAG AAA ACG GTG TTG GAA AAA TCC AAA GCG GGA GCA CAA TCG CGC TTT 6288Glu Lys Thr Val Leu Glu Lys Ser Lys Ala Gly Ala Gln Ser Arg Phe 2085 2090 2095GAT AGC TAC GGC AAA CTG TAC GAT GAG AAT ATC AAC GCC GGT GAA AAC 6336Asp Ser Tyr Gly Lys Leu Tyr Asp Glu Asn Ile Asn Ala Gly Glu Asn 2100 2105 2110CAA GCC ATG ACG CTA CGA GCG TCC GCC GCC GGG CTT ACC ACG GCA GTT 6384Gln Ala Met Thr Leu Arg Ala Ser Ala Ala Gly Leu Thr Thr Ala Val 2115 2120 2125CAG GCA TCC CGT CTG GCC GGT GCG GCG GCT GAT CTG GTG CCT AAC ATC 6432Gln Ala Ser Arg Leu Ala Gly Ala Ala Ala Asp Leu Val Pro Asn Ile 2130 2135 2140TTC GGC TTT GCC GGT GGC GGC AGC CGT TGG GGG GCT ATC GCT GAG GCG 6480Phe Gly Phe Ala Gly Gly Gly Ser Arg Trp Gly Ala Ile Ala Glu Ala2145 2150 2155 2160ACA GGT TAT GTG ATG GAA TTC TCC GCG AAT GTT ATG AAC ACC GAA GCG 6528Thr Gly Tyr Val Met Glu Phe Ser Ala Asn Val Met Asn Thr Glu Ala 2165 2170 2175GAT AAA ATT AGC CAA TCT GAA ACC TAC CGT CGT CGC CGT CAG GAG TGG 6576Asp Lys Ile Ser Gln Ser Glu Thr Tyr Arg Arg Arg Arg Gln Glu Trp 2180 2185 2190GAG ATC CAG CGG AAT AAT GCC GAA GCG GAA TTG AAG CAA ATC GAT GCT 6624Glu Ile Gln Arg Asn Asn Ala Glu Ala Glu Leu Lys Gln Ile Asp Ala 2195 2200 2205CAG CTC AAA TCA CTC GCT GTA CGC CGC GAA GCC GCC GTA TTG CAG AAA 6672Gln Leu Lys Ser Leu Ala Val Arg Arg Glu Ala Ala Val Leu Gln Lys 2210 2215 2220ACC AGT CTG AAA ACC CAA CAA GAA CAG ACC CAA TCT CAA TTG GCC TTC 6720Thr Ser Leu Lys Thr Gln Gln Glu Gln Thr Gln Ser Gln Leu Ala Phe2225 2230 2235 2240CTG CAA CGT AAG TTC AGC AAT CAG GCG TTA TAC AAC TGG CTG CGT GGT 6768Leu Gln Arg Lys Phe Ser Asn Gln Ala Leu Tyr Asn Trp Leu Arg Gly 2245 2250 2255CGA CTG GCG GCG ATT TAC TTC CAG TTC TAC GAT TTG GCC GTC GCG CGT 6816Arg Leu Ala Ala Ile Tyr Phe Gln Phe Tyr Asp Leu Ala Val Ala Arg 2260 2265 2270TGC CTG ATG GCA GAA CAA GCT TAC CGT TGG GAA CTC AAT GAT GAC TCT 6864Cys Leu Met Ala Glu Gln Ala Tyr Arg Trp Glu Leu Asn Asp Asp Ser 2275 2280 2285GCC CGC TTC ATT AAA CCG GGC GCC TGG CAG GGA ACC TAT GCC GGT CTG 6912Ala Arg Phe Ile Lys Pro Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu 2290 2295 2300CTT GCA GGT GAA ACC TTG ATG CTG AGT CTG GCA CAA ATG GAA GAC GCT 6960Leu Ala Gly Glu Thr Leu Met Leu Ser Leu Ala Gln Met Glu Asp Ala2305 2310 2315 2320CAT CTG AAA CGC GAT AAA CGC GCA TTA GAG GTT GAA CGC ACA GTA TCG 7008His Leu Lys Arg Asp Lys Arg Ala Leu Glu Val Glu Arg Thr Val Ser 2325 2330 2335CTG GCC GAA GTT TAT GCA GGA TTA CCA AAA GAT AAC GGT CCA TTT TCC 7056Leu Ala Glu Val Tyr Ala Gly Leu Pro Lys Asp Asn Gly Pro Phe Ser 2340 2345 2350CTG GCT CAG GAA ATT GAC AAG CTG GTG AGT CAA GGT TCA GGC AGT GCC 7104Leu Ala Gln Glu Ile Asp Lys Leu Val Ser Gln Gly Ser Gly Ser Ala 2355 2360 2365GGC AGT GGT AAT AAT AAT TTG GCG TTC GGC GCC GGC ACG GAC ACT AAA 7152Gly Ser Gly Asn Asn Asn Leu Ala Phe Gly Ala Gly Thr Asp Thr Lys 2370 2375 2380ACC TCT TTG CAG GCA TCA GTT TCA TTC GCT GAT TTG AAA ATT CGT GAA 7200Thr Ser Leu Gln Ala Ser Val Ser Phe Ala Asp Leu Lys Ile Arg Glu2385 2390 2395 2400GAT TAC CCG GCA TCG CTT GGC AAA ATT CGA CGT ATC AAA CAG ATC AGC 7248Asp Tyr Pro Ala Ser Leu Gly Lys Ile Arg Arg Ile Lys Gln Ile Ser 2405 2410 2415GTC ACT TTG CCC GCG CTA CTG GGA CCG TAT CAG GAT GTA CAG GCA ATA 7296Val Thr Leu Pro Ala Leu Leu Gly Pro Tyr Gln Asp Val Gln Ala Ile 2420 2425 2430TTG TCT TAC GGC GAT AAA GCC GGA TTA GCT AAC GGC TGT GAA GCG CTG 7344Leu Ser Tyr Gly Asp Lys Ala Gly Leu Ala Asn Gly Cys Glu Ala Leu 2435 2440 2445GCA GTT TCT CAC GGT ATG AAT GAC AGC GGC CAA TTC CAG CTC GAT TTC 7392Ala Val Ser His Gly Met Asn Asp Ser Gly Gln Phe Gln Leu Asp Phe 2450 2455 2460AAC GAT GGC AAA TTC CTG CCA TTC GAA GGC ATC GCC ATT GAT CAA GGC 7440Asn Asp Gly Lys Phe Leu Pro Phe Glu Gly Ile Ala Ile Asp Gln Gly2465 2470 2475 2480ACG CTG ACA CTG AGC TTC CCA AAT GCA TCT ATG CCG GAG AAA GGT AAA 7488Thr Leu Thr Leu Ser Phe Pro Asn Ala Ser Met Pro Glu Lys Gly Lys 2485 2490 2495CAA GCC ACT ATG TTA AAA ACC CTG AAC GAT ATC ATT TTG CAT ATT CGC 7536Gln Ala Thr Met Leu Lys Thr Leu Asn Asp Ile Ile Leu His Ile Arg 2500 2505 2510TAC ACC ATT AAA TAA 7551Tyr Thr Ile Lys 2515 2516 amino acids amino acids linear protein 47Met Asn Glu Ser Val Lys Glu Ile Pro Asp Val Leu Lys Ser Gln Cys1 5 10 15Gly Phe Asn Cys Leu Thr Asp Ile Ser His Ser Ser Phe Asn Glu Phe 20 25 30Arg Gln Gln Val Ser Glu His Leu Ser Trp Ser Glu Thr His Asp Leu 35 40 45Tyr His Asp Ala Gln Gln Ala Gln Lys Asp Asn Arg Leu Tyr Glu Ala 50 55 60Arg Ile Leu Lys Arg Ala Asn Pro Gln Leu Gln Asn Ala Val His Leu65 70 75 80Ala Ile Leu Ala Pro Asn Ala Glu Leu Ile Gly Tyr Asn Asn Gln Phe 85 90 95Ser Gly Arg Ala Ser Gln Tyr Val Ala Pro Gly Thr Val Ser Ser Met 100 105 110Phe Ser Pro Ala Ala Tyr Leu Thr Glu Leu Tyr Arg Glu Ala Arg Asn 115 120 125Leu His Ala Ser Asp Ser Val Tyr Tyr Leu Asp Thr Arg Arg Pro Asp 130 135 140Leu Lys Ser Met Ala Leu Ser Gln Gln Asn Met Asp Ile Glu Leu Ser145 150 155 160Thr Leu Ser Leu Ser Asn Glu Leu Leu Leu Glu Ser Ile Lys Thr Glu 165 170 175Ser Lys Leu Glu Asn Tyr Thr Lys Val Met Glu Met Leu Ser Thr Phe 180 185 190Arg Pro Ser Gly Ala Thr Pro Tyr His Asp Ala Tyr Glu Asn Val Arg 195 200 205Glu Val Ile Gln Leu Gln Asp Pro Gly Leu Glu Gln Leu Asn Ala Ser 210 215 220Pro Ala Ile Ala Gly Leu Met His Gln Ala Ser Leu Leu Gly Ile Asn225 230 235 240Ala Ser Ile Ser Pro Glu Leu Phe Asn Ile Leu Thr Glu Glu Ile Thr 245 250 255Glu Gly Asn Ala Glu Glu Leu Tyr Lys Lys Asn Phe Gly Asn Ile Glu 260 265 270Pro Ala Ser Leu Ala Met Pro Glu Tyr Leu Lys Arg Tyr Tyr Asn Leu 275 280 285Ser Asp Glu Glu Leu Ser Gln Phe Ile Gly Lys Ala Ser Asn Phe Gly 290 295 300Gln Gln Glu Tyr Ser Asn Asn Gln Leu Ile Thr Pro Val Val Asn Ser305 310 315 320Ser Asp Gly Thr Val Lys Val Tyr Arg Ile Thr Arg Glu Tyr Thr Thr 325 330 335Asn Ala Tyr Gln Met Asp Val Glu Leu Phe Pro Phe Gly Gly Glu Asn 340 345 350Tyr Arg Leu Asp Tyr Lys Phe Lys Asn Phe Tyr Asn Ala Ser Tyr Leu 355 360 365Ser Ile Lys Leu Asn Asp Lys Arg Glu Leu Val Arg Thr Glu Gly Ala 370 375 380Pro Gln Val Asn Ile Glu Tyr Ser Ala Asn Ile Thr Leu Asn Thr Ala385 390 395 400Asp Ile Ser Gln Pro Phe Glu Ile Gly Leu Thr Arg Val Leu Pro Ser 405 410 415Gly Ser Trp Ala Tyr Ala Ala Ala Lys Phe Thr Val Glu Glu Tyr Asn 420 425 430Gln Tyr Ser Phe Leu Leu Lys Leu Asn Lys Ala Ile Arg Leu Ser Arg 435 440 445Ala Thr Glu Leu Ser Pro Thr Ile Leu Glu Gly Ile Val Arg Ser Val 450 455 460Asn Leu Gln Leu Asp Ile Asn Thr Asp Val Leu Gly Lys Val Phe Leu465 470 475 480Thr Lys Tyr Tyr Met Gln Arg Tyr Ala Ile His Ala Glu Thr Ala Leu 485 490 495Ile Leu Cys Asn Ala Pro Ile Ser Gln Arg Ser Tyr Asp Asn Gln Pro 500 505 510Ser Gln Phe Asp Arg Leu Phe Asn Thr Pro Leu Leu Asn Gly Gln Tyr 515 520 525Phe Ser Thr Gly Asp Glu Glu Ile Asp Leu Asn Ser Gly Ser Thr Gly 530 535 540Asp Trp Arg Lys Thr Ile Leu Lys Arg Ala Phe Asn Ile Asp Asp Val545 550 555 560Ser Leu Phe Arg Leu Leu Lys Ile Thr Asp His Asp Asn Lys Asp Gly 565 570 575Lys Ile Lys Asn Asn Leu Lys Asn Leu Ser Asn Leu Tyr Ile Gly Lys 580 585 590Leu Leu Ala Asp Ile His Gln Leu Thr Ile Asp Glu Leu Asp Leu Leu 595 600 605Leu Ile Ala Val Gly Glu Gly Lys Thr Asn Leu Ser Ala Ile Ser Asp 610 615 620Lys Gln Leu Ala Thr Leu Ile Arg Lys Leu Asn Thr Ile Thr Ser Trp625 630 635 640Leu His Thr Gln Lys Trp Ser Val Phe Gln Leu Phe Ile Met Thr Ser 645 650 655Thr Ser Tyr Asn Lys Thr Leu Thr Pro Glu Ile Lys Asn Leu Leu Asp 660 665 670Thr Val Tyr His Gly Leu Gln Gly Phe Asp Lys Asp Lys Ala Asp Leu 675 680 685Leu His Val Met Ala Pro Tyr Ile Ala Ala Thr Leu Gln Leu Ser Ser 690 695 700Glu Asn Val Ala His Ser Val Leu Leu Trp Ala Asp Lys Leu Gln Pro705 710 715 720Gly Asp Gly Ala Met Thr Ala Glu Lys Phe Trp Asp Trp Leu Asn Thr 725 730 735Lys Tyr Thr Pro Gly Ser Ser Glu Ala Val Glu Thr Gln Glu His Ile 740 745 750Val Gln Tyr Cys Gln Ala Leu Ala Gln Leu Glu Met Val Tyr His Ser 755 760 765Thr Gly Ile Asn Glu Asn Ala Phe Arg Leu Phe Val Thr Lys Pro Glu 770 775 780Met Phe Gly Ala Ala Thr Gly Ala Ala Pro Ala His Asp Ala Leu Ser785 790 795 800Leu Ile Met Leu Thr Arg Phe Ala Asp Trp Val Asn Ala Leu Gly Glu 805 810 815Lys Ala Ser Ser Val Leu Ala Ala Phe Glu Ala Asn Ser Leu Thr Ala 820 825 830Glu Gln Leu Ala Asp Ala Met Asn Leu Asp Ala Asn Leu Leu Leu Gln 835 840 845Ala Ser Ile Gln Ala Gln Asn His Gln His Leu Pro Pro Val Thr Pro 850 855 860Glu Asn Ala Phe Ser Cys Trp Thr Ser Ile Asn Thr Ile Leu Gln Trp865 870 875 880Val Asn Val Ala Gln Gln Leu Asn Val Ala Pro Gln Gly Val Ser Ala 885 890 895Leu Val Gly Leu Asp Tyr Ile Gln Ser Met Lys Glu Thr Pro Thr Tyr 900 905 910Ala Gln Trp Glu Asn Ala Ala Gly Val Leu Thr Ala Gly Leu Asn Ser 915 920 925Gln Gln Ala Asn Thr Leu His Ala Phe Leu Asp Glu Ser Arg Ser Ala 930 935 940Ala Leu Ser Thr Tyr Tyr Ile Arg Gln Val Ala Lys Ala Ala Ala Ala945 950 955 960Ile Lys Ser Arg Asp Asp Leu Tyr Gln Tyr Leu Leu Ile Asp Asn Gln 965 970 975Val Ser Ala Ala Ile Lys Thr Thr Arg Ile Ala Glu Ala Ile Ala Ser 980 985 990Ile Gln Leu Tyr Val Asn Arg Ala Leu Glu Asn Val Glu Glu Asn Ala 995 1000 1005Asn Ser Gly Val Ile Ser Arg Gln Phe Phe Ile Asp Trp Asp Lys Tyr 1010 1015 1020Asn Lys Arg Tyr Ser Thr Trp Ala Gly Val Ser Gln Leu Val Tyr Tyr1025 1030 1035 1040Pro Glu Asn Tyr Ile Asp Pro Thr Met Arg Ile Gly Gln Thr Lys Met 1045 1050 1055Met Asp Ala Leu Leu Gln Ser Val Ser Gln Ser Gln Leu Asn Ala Asp 1060 1065 1070Thr Val Glu Asp Ala Phe Met Ser Tyr Leu Thr Ser Phe Glu Gln Val 1075 1080 1085Ala Asn Leu Lys Val Ile Ser Ala Tyr His Asp Asn Ile Asn Asn Asp 1090 1095 1100Gln Gly Leu Thr Tyr Phe Ile Gly Leu Ser Glu Thr Asp Ala Gly Glu1105 1110 1115 1120Tyr Tyr Trp Arg Ser Val Asp His Ser Lys Phe Asn Asp Gly Lys Phe 1125 1130 1135Ala Ala Asn Ala Trp Ser Glu Trp His Lys Ile Asp Cys Pro Ile Asn 1140 1145 1150Pro Tyr Lys Ser Thr Ile Arg Pro Val Ile Tyr Lys Ser Arg Leu Tyr 1155 1160 1165Leu Leu Trp Leu Glu Gln Lys Glu Ile Thr Lys Gln Thr Gly Asn Ser 1170 1175 1180Lys Asp Gly Tyr Gln Thr Glu Thr Asp Tyr Arg Tyr Glu Leu Lys Leu1185 1190 1195 1200Ala His Ile Arg Tyr Asp Gly Thr Trp Asn Thr Pro Ile Thr Phe Asp 1205 1210 1215Val Asn Lys Lys Ile Ser Glu Leu Lys Leu Glu Lys Asn Arg Ala Pro 1220 1225 1230Gly Leu Tyr Cys Ala Gly Tyr Gln Gly Glu Asp Thr Leu Leu Val Met 1235 1240 1245Phe Tyr Asn Gln Gln Asp Thr Leu Asp Ser Tyr Lys Asn Ala Ser Met 1250 1255 1260Gln Gly Leu Tyr Ile Phe Ala Asp Met Ala Ser Lys Asp Met Thr Pro1265 1270 1275 1280Glu Gln Ser Asn Val Tyr Arg Asp Asn Ser Tyr Gln Gln Phe Asp Thr 1285 1290 1295Asn Asn Val Arg Arg Val Asn Asn Arg Tyr Ala Glu Asp Tyr Glu Ile 1300 1305 1310Pro Ser Ser Val Ser Ser Arg Lys Asp Tyr Gly Trp Gly Asp Tyr Tyr 1315 1320 1325Leu Ser Met Val Tyr Asn Gly Asp Ile Pro Thr Ile Asn Tyr Lys Ala 1330 1335 1340Ala Ser Ser Asp Leu Lys Ile Tyr Ile Ser Pro Lys Leu Arg Ile Ile1345 1350 1355 1360His Asn Gly Tyr Glu Gly Gln Lys Arg Asn Gln Cys Asn Leu Met Asn 1365 1370 1375Lys Tyr Gly Lys Leu Gly Asp Lys Phe Ile Val Tyr Thr Ser Leu Gly 1380 1385 1390Val Asn Pro Asn Asn Ser Ser Asn Lys Leu Met Phe Tyr Pro Val Tyr 1395 1400 1405Gln Tyr Ser Gly Asn Thr Ser Gly Leu Asn Gln Gly Arg Leu Leu Phe 1410 1415 1420His Arg Asp Thr Thr Tyr Pro Ser Lys Val Glu Ala Trp Ile Pro Gly1425 1430 1435 1440Ala Lys Arg Ser Leu Thr Asn Gln Asn Ala Ala Ile Gly Asp Asp Tyr 1445 1450 1455Ala Thr Asp Ser Leu Asn Lys Pro Asp Asp Leu Lys Gln Tyr Ile Phe 1460 1465 1470Met Thr Asp Ser Lys Gly Thr Ala Thr Asp Val Ser Gly Pro Val Glu 1475 1480 1485Ile Asn Thr Ala Ile Ser Pro Ala Lys Val Gln Ile Ile Val Lys Ala 1490 1495 1500Gly Gly Lys Glu Gln Thr Phe Thr Ala Asp Lys Asp Val Ser Ile Gln1505 1510 1515 1520Pro Ser Pro Ser Phe Asp Glu Met Asn Tyr Gln Phe Asn Ala Leu Glu 1525 1530 1535Ile Asp Gly Ser Gly Leu Asn Phe Ile Asn Asn Ser Ala Ser Ile Asp 1540 1545 1550Val Thr Phe Thr Ala Phe Ala Glu Asp Gly Arg Lys Leu Gly Tyr Glu 1555 1560 1565Ser Phe Ser Ile Pro Val Thr Leu Lys Val Ser Thr Asp Asn Ala Leu 1570 1575 1580Thr Leu His His Asn Glu Asn Gly Ala Gln Tyr Met Gln Trp Gln Ser1585 1590 1595 1600Tyr Arg Thr Arg Leu Asn Thr Leu Phe Ala Arg Gln Leu Val Ala Arg 1605 1610 1615Ala Thr Thr Gly Ile Asp Thr Ile Leu Ser Met Glu Thr Gln Asn Ile 1620 1625 1630Gln Glu Pro Gln Leu Gly Lys Gly Phe Tyr Ala Thr Phe Val Ile Pro 1635 1640 1645Pro Tyr Asn Leu Ser Thr His Gly Asp Glu Arg Trp Phe Lys Leu Tyr 1650 1655 1660Ile Lys His Val Val Asp Asn Asn Ser His Ile Ile Tyr Ser Gly Gln1665 1670 1675 1680Leu Thr Asp Thr Asn Ile Asn Ile Thr Leu Phe Ile Pro Leu Asp Asp 1685 1690 1695Val Pro Leu Asn Gln Asp Tyr His Ala Lys Val Tyr Met Thr Phe Lys 1700 1705 1710Lys Ser Pro Ser Asp Gly Thr Trp Trp Gly Pro His Phe Val Arg Asp 1715 1720 1725Asp Lys Gly Ile Val Thr Ile Asn Pro Lys Ser Ile Leu Thr His Phe 1730 1735 1740Glu Ser Val Asn Val Leu Asn Asn Ile Ser Ser Glu Pro Met Asp Phe1745 1750 1755 1760Ser Gly Ala Asn Ser Leu Tyr Phe Trp Glu Leu Phe Tyr Tyr Thr Pro 1765 1770 1775Met Leu Val Ala Gln Arg Leu Leu His Glu Gln Asn Phe Asp Glu Ala 1780 1785 1790Asn Arg Trp Leu Lys Tyr Val Trp Ser Pro Ser Gly Tyr Ile Val His 1795 1800 1805Gly Gln Ile Gln Asn Tyr Gln Trp Asn Val Arg Pro Leu Leu Glu Asp 1810 1815 1820Thr Ser Trp Asn Ser Asp Pro Leu Asp Ser Val Asp Pro Asp Ala Val1825 1830 1835 1840Ala Gln His Asp Pro Met His Tyr Lys Val Ser Thr Phe Met Arg Thr 1845 1850 1855Leu Asp Leu Leu Ile Ala Arg Gly Asp His Ala Tyr Arg Gln Leu Glu 1860 1865 1870Arg Asp Thr Leu Asn Glu Ala Lys Met Trp Tyr Met Gln Ala Leu His 1875 1880 1885Leu Leu Gly Asp Lys Pro Tyr Leu Pro Leu Ser Thr Thr Trp Ser Asp 1890 1895 1900Pro Arg Leu Asp Arg Ala Ala Asp Ile Thr Thr Gln Asn Ala His Asp1905 1910 1915 1920Ser Ala Ile Val Ala Leu Arg Gln Asn Ile Pro Thr Pro Ala Pro Leu 1925 1930 1935Ser Leu Arg Ser Ala Asn Thr Leu Thr Asp Leu Phe Leu Pro Gln Ile 1940 1945 1950Asn Glu Val Met Met Asn Tyr Trp Gln Thr Leu Ala Gln Arg Val Tyr 1955 1960 1965Asn Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Tyr Leu Pro 1970 1975 1980Ile Tyr Ala Thr Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala Ala Val1985 1990 1995 2000Ala Thr Ser Gln Gly Gly Gly Lys Leu Pro Glu Ser Phe Met Ser Leu 2005 2010 2015Trp Arg Phe Pro His Met Leu Glu Asn Ala Arg Gly Met Val Ser Gln 2020 2025 2030Leu Thr Gln Phe Gly Ser Thr Leu Gln Asn Ile Ile Glu Arg Gln Asp 2035 2040 2045Ala Glu Ala Leu Asn Ala Leu Leu Gln Asn Gln Ala Ala Glu Leu Ile 2050 2055 2060Leu Thr Asn Leu Ser Ile Gln Asp Lys Thr Ile Glu Glu Leu Asp Ala2065 2070 2075 2080Glu Lys Thr Val Leu Glu Lys Ser Lys Ala Gly Ala Gln Ser Arg Phe 2085 2090 2095Asp Ser Tyr Gly Lys Leu Tyr Asp Glu Asn Ile Asn Ala Gly Glu Asn 2100 2105 2110Gln Ala Met Thr Leu Arg Ala Ser Ala Ala Gly Leu Thr Thr Ala Val 2115 2120 2125Gln Ala Ser Arg Leu Ala Gly Ala Ala Ala Asp Leu Val Pro Asn Ile 2130 2135 2140Phe Gly Phe Ala Gly Gly Gly Ser Arg Trp Gly Ala Ile Ala Glu Ala2145 2150 2155 2160Thr Gly Tyr Val Met Glu Phe Ser Ala Asn Val Met Asn Thr Glu Ala 2165 2170 2175Asp Lys Ile Ser Gln Ser Glu Thr Tyr Arg Arg Arg Arg Gln Glu Trp 2180 2185 2190Glu Ile Gln Arg Asn Asn Ala Glu Ala Glu Leu Lys Gln Ile Asp Ala 2195 2200 2205Gln Leu Lys Ser Leu Ala Val Arg Arg Glu Ala Ala Val Leu Gln Lys 2210 2215 2220Thr Ser Leu Lys Thr Gln Gln Glu Gln Thr Gln Ser Gln Leu Ala Phe2225 2230 2235 2240Leu Gln Arg Lys Phe Ser Asn Gln Ala Leu Tyr Asn Trp Leu Arg Gly 2245 2250 2255Arg Leu Ala Ala Ile Tyr Phe Gln Phe Tyr Asp Leu Ala Val Ala Arg 2260 2265 2270Cys Leu Met Ala Glu Gln Ala Tyr Arg Trp Glu Leu Asn Asp Asp Ser 2275 2280 2285Ala Arg Phe Ile Lys Pro Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu 2290 2295 2300Leu Ala Gly Glu Thr Leu Met Leu Ser Leu Ala Gln Met Glu Asp Ala2305 2310 2315 2320His Leu Lys Arg Asp Lys Arg Ala Leu Glu Val Glu Arg Thr Val Ser 2325 2330 2335Leu Ala Glu Val Tyr Ala Gly Leu Pro Lys Asp Asn Gly Pro Phe Ser 2340 2345 2350Leu Ala Gln Glu Ile Asp Lys Leu Val Ser Gln Gly Ser Gly Ser Ala 2355 2360 2365Gly Ser Gly Asn Asn Asn Leu Ala Phe Gly Ala Gly Thr Asp Thr Lys 2370 2375 2380Thr Ser Leu Gln Ala Ser Val Ser Phe Ala Asp Leu Lys Ile Arg Glu2385 2390 2395 2400Asp Tyr Pro Ala Ser Leu Gly Lys Ile Arg Arg Ile Lys Gln Ile Ser 2405 2410 2415Val Thr Leu Pro Ala Leu Leu Gly Pro Tyr Gln Asp Val Gln Ala Ile 2420 2425 2430Leu Ser Tyr Gly Asp Lys Ala Gly Leu Ala Asn Gly Cys Glu Ala Leu 2435 2440 2445Ala Val Ser His Gly Met Asn Asp Ser Gly Gln Phe Gln Leu Asp Phe 2450 2455 2460Asn Asp Gly Lys Phe Leu Pro Phe Glu Gly Ile Ala Ile Asp Gln Gly2465 2470 2475 2480Thr Leu Thr Leu Ser Phe Pro Asn Ala Ser Met Pro Glu Lys Gly Lys 2485 2490 2495Gln Ala Thr Met Leu Lys Thr Leu Asn Asp Ile Ile Leu His Ile Arg 2500 2505 2510Tyr Thr Ile Lys 2515 5547 base pairs nucleic acid double linear DNA (genomic) 48CTG ATA GGC TAT AAC AAT CAA TTT AGC GGT AGA GCC AGT CAA TAT GTT 48Leu Ile Gly Tyr Asn Asn Gln Phe Ser Gly Arg Ala Ser Gln Tyr Val1 5 10 15GCG CCG GGT ACC GTT TCT TCC ATG TTC TCC CCC GCC GCT TAT TTG ACT 96Ala Pro Gly Thr Val Ser Ser Met Phe Ser Pro Ala Ala Tyr Leu Thr 20 25 30GAA CTT TAT CGT GAA GCA CGC AAT TTA CAC GCA AGT GAC TCC GTT TAT 144Glu Leu Tyr Arg Glu Ala Arg Asn Leu His Ala Ser Asp Ser Val Tyr 35 40 45TAT CTG GAT ACC CGC CGC CCA GAT CTC AAA TCA ATG GCG CTC AGT CAG 192Tyr Leu Asp Thr Arg Arg Pro Asp Leu Lys Ser Met Ala Leu Ser Gln 50 55 60CAA AAT ATG GAT ATA GAA TTA TCC ACA CTC TCT TTG TCC AAT GAG CTG 240Gln Asn Met Asp Ile Glu Leu Ser Thr Leu Ser Leu Ser Asn Glu Leu65 70 75 80TTA TTG GAA AGC ATT AAA ACT GAA TCT AAA CTG GAA AAC TAT ACT AAA 288Leu Leu Glu Ser Ile Lys Thr Glu Ser Lys Leu Glu Asn Tyr Thr Lys 85 90 95GTG ATG GAA ATG CTC TCC ACT TTC CGT CCT TCC GGC GCA ACG CCT TAT 336Val Met Glu Met Leu Ser Thr Phe Arg Pro Ser Gly Ala Thr Pro Tyr 100 105 110CAT GAT GCT TAT GAA AAT GTG CGT GAA GTT ATC CAG CTA CAA GAT CCT 384His Asp Ala Tyr Glu Asn Val Arg Glu Val Ile Gln Leu Gln Asp Pro 115 120 125GGA CTT GAG CAA CTC AAT GCA TCA CCG GCA ATT GCC GGG TTG ATG CAT 432Gly Leu Glu Gln Leu Asn Ala Ser Pro Ala Ile Ala Gly Leu Met His 130 135 140CAA GCC TCC CTA TTG GGT ATT AAC GCT TCA ATC TCG CCT GAG CTA TTT 480Gln Ala Ser Leu Leu Gly Ile Asn Ala Ser Ile Ser Pro Glu Leu Phe145 150 155 160AAT ATT CTG ACG GAG GAG ATT ACC GAA GGT AAT GCT GAG GAA CTT TAT 528Asn Ile Leu Thr Glu Glu Ile Thr Glu Gly Asn Ala Glu Glu Leu Tyr 165 170 175AAG AAA AAT TTT GGT AAT ATC GAA CCG GCC TCA TTG GCT ATG CCG GAA 576Lys Lys Asn Phe Gly Asn Ile Glu Pro Ala Ser Leu Ala Met Pro Glu 180 185 190TAC CTT AAA CGT TAT TAT AAT TTA AGC GAT GAA GAA CTT AGT CAG TTT 624Tyr Leu Lys Arg Tyr Tyr Asn Leu Ser Asp Glu Glu Leu Ser Gln Phe 195 200 205ATT GGT AAA GCC AGC AAT TTT GGT CAA CAG GAA TAT AGT AAT AAC CAA 672Ile Gly Lys Ala Ser Asn Phe Gly Gln Gln Glu Tyr Ser Asn Asn Gln 210 215 220CTT ATT ACT CCG GTA GTC AAC AGC AGT GAT GGC ACG GTT AAG GTA TAT 720Leu Ile Thr Pro Val Val Asn Ser Ser Asp Gly Thr Val Lys Val Tyr225 230 235 240CGG ATC ACC CGC GAA TAT ACA ACC AAT GCT TAT CAA ATG GAT GTG GAG 768Arg Ile Thr Arg Glu Tyr Thr Thr Asn Ala Tyr Gln Met Asp Val Glu 245 250 255CTA TTT CCC TTC GGT GGT GAG AAT TAT CGG TTA GAT TAT AAA TTC AAA 816Leu Phe Pro Phe Gly Gly Glu Asn Tyr Arg Leu Asp Tyr Lys Phe Lys 260 265 270AAT TTT TAT AAT GCC TCT TAT TTA TCC ATC AAG TTA AAT GAT AAA AGA 864Asn Phe Tyr Asn Ala Ser Tyr Leu Ser Ile Lys Leu Asn Asp Lys Arg 275 280 285GAA CTT GTT CGA ACT GAA GGC GCT CCT CAA GTC AAT ATA GAA TAC TCC 912Glu Leu Val Arg Thr Glu Gly Ala Pro Gln Val Asn Ile Glu Tyr Ser 290 295 300GCA AAT ATC ACA TTA AAT ACC GCT GAT ATC AGT CAA CCT TTT GAA ATT 960Ala Asn Ile Thr Leu Asn Thr Ala Asp Ile Ser Gln Pro Phe Glu Ile305 310 315 320GGC CTG ACA CGA GTA CTT CCT TCC GGT TCT TGG GCA TAT GCC GCC GCA 1008Gly Leu Thr Arg Val Leu Pro Ser Gly Ser Trp Ala Tyr Ala Ala Ala 325 330 335AAA TTT ACC GTT GAA GAG TAT AAC CAA TAC TCT TTT CTG CTA AAA CTT 1056Lys Phe Thr Val Glu Glu Tyr Asn Gln Tyr Ser Phe Leu Leu Lys Leu 340 345 350AAC AAG GCT ATT CGT CTA TCA CGT GCG ACA GAA TTG TCA CCC ACG ATT 1104Asn Lys Ala Ile Arg Leu Ser Arg Ala Thr Glu Leu Ser Pro Thr Ile 355 360 365CTG GAA GGC ATT GTG CGC AGT GTT AAT CTA CAA CTG GAT ATC AAC ACA 1152Leu Glu Gly Ile Val Arg Ser Val Asn Leu Gln Leu Asp Ile Asn Thr 370 375 380GAC GTA TTA GGT AAA GTT TTT CTG ACT AAA TAT TAT ATG CAG CGT TAT 1200Asp Val Leu Gly Lys Val Phe Leu Thr Lys Tyr Tyr Met Gln Arg Tyr385 390 395 400GCT ATT CAT GCT GAA ACT GCC CTG ATA CTA TGC AAC GCG CCT ATT TCA 1248Ala Ile His Ala Glu Thr Ala Leu Ile Leu Cys Asn Ala Pro Ile Ser 405 410 415CAA CGT TCA TAT GAT AAT CAA CCT AGC CAA TTT GAT CGC CTG TTT AAT 1296Gln Arg Ser Tyr Asp Asn Gln Pro Ser Gln Phe Asp Arg Leu Phe Asn 420 425 430ACG CCA TTA CTG AAC GGA CAA TAT TTT TCT ACC GGC GAT GAG GAG ATT 1344Thr Pro Leu Leu Asn Gly Gln Tyr Phe Ser Thr Gly Asp Glu Glu Ile 435 440 445GAT TTA AAT TCA GGT AGC ACC GGC GAT TGG CGA AAA ACC ATA CTT AAG 1392Asp Leu Asn Ser Gly Ser Thr Gly Asp Trp Arg Lys Thr Ile Leu Lys 450 455 460CGT GCA TTT AAT ATT GAT GAT GTC TCG CTC TTC CGC CTG CTT AAA ATT 1440Arg Ala Phe Asn Ile Asp Asp Val Ser Leu Phe Arg Leu Leu Lys Ile465 470 475 480ACC GAC CAT GAT AAT AAA GAT GGA AAA ATT AAA AAT AAC CTA AAG AAT 1488Thr Asp His Asp Asn Lys Asp Gly Lys Ile Lys Asn Asn Leu Lys Asn 485 490 495CTT TCC AAT TTA TAT ATT GGA AAA TTA CTG GCA GAT ATT CAT CAA TTA 1536Leu Ser Asn Leu Tyr Ile Gly Lys Leu Leu Ala Asp Ile His Gln Leu 500 505 510ACC ATT GAT GAA CTG GAT TTA TTA CTG ATT GCC GTA GGT GAA GGA AAA 1584Thr Ile Asp Glu Leu Asp Leu Leu Leu Ile Ala Val Gly Glu Gly Lys 515 520 525ACT AAT TTA TCC GCT ATC AGT GAT AAG CAA TTG GCT ACC CTG ATC AGA 1632Thr Asn Leu Ser Ala Ile Ser Asp Lys Gln Leu Ala Thr Leu Ile Arg 530 535 540AAA CTC AAT ACT ATT ACC AGC TGG CTA CAT ACA CAG AAG TGG AGT GTA 1680Lys Leu Asn Thr Ile Thr Ser Trp Leu His Thr Gln Lys Trp Ser Val545 550 555 560TTC CAG CTA TTT ATC ATG ACC TCC ACC AGC TAT AAC AAA ACG CTA ACG 1728Phe Gln Leu Phe Ile Met Thr Ser Thr Ser Tyr Asn Lys Thr Leu Thr 565 570 575CCT GAA ATT AAG AAT TTG CTG GAT ACC GTC TAC CAC GGT TTA CAA GGT 1776Pro Glu Ile Lys Asn Leu Leu Asp Thr Val Tyr His Gly Leu Gln Gly 580 585 590TTT GAT AAA GAC AAA GCA GAT TTG CTA CAT GTC ATG GCG CCC TAT ATT 1824Phe Asp Lys Asp Lys Ala Asp Leu Leu His Val Met Ala Pro Tyr Ile 595 600 605GCG GCC ACC TTG CAA TTA TCA TCG GAA AAT GTC GCC CAC TCG GTA CTC 1872Ala Ala Thr Leu Gln Leu Ser Ser Glu Asn Val Ala His Ser Val Leu 610 615 620CTT TGG GCA GAT AAG TTA CAG CCC GGC GAC GGC GCA ATG ACA GCA GAA 1920Leu Trp Ala Asp Lys Leu Gln Pro Gly Asp Gly Ala Met Thr Ala Glu625 630 635 640AAA TTC TGG GAC TGG TTG AAT ACT AAG TAT ACG CCG GGT TCA TCG GAA 1968Lys Phe Trp Asp Trp Leu Asn Thr Lys Tyr Thr Pro Gly Ser Ser Glu 645 650 655GCC GTA GAA ACG CAG GAA CAT ATC GTT CAG TAT TGT CAG GCT CTG GCA 2016Ala Val Glu Thr Gln Glu His Ile Val Gln Tyr Cys Gln Ala Leu Ala 660 665 670CAA TTG GAA ATG GTT TAC CAT TCC ACC GGC ATC AAC GAA AAC GCC TTC 2064Gln Leu Glu Met Val Tyr His Ser Thr Gly Ile Asn Glu Asn Ala Phe 675 680 685CGT CTA TTT GTG ACA AAA CCA GAG ATG TTT GGC GCT GCA ACT GGA GCA 2112Arg Leu Phe Val Thr Lys Pro Glu Met Phe Gly Ala Ala Thr Gly Ala 690 695 700GCG CCC GCG CAT GAT GCC CTT TCA CTG ATT ATG CTG ACA CGT TTT GCG 2160Ala Pro Ala His Asp Ala Leu Ser Leu Ile Met Leu Thr Arg Phe Ala705 710 715 720GAT TGG GTG AAC GCA CTA GGC GAA AAA GCG TCC TCG GTG CTA GCG GCA 2208Asp Trp Val Asn Ala Leu Gly Glu Lys Ala Ser Ser Val Leu Ala Ala 725 730 735TTT GAA GCT AAC TCG TTA ACG GCA GAA CAA CTG GCT GAT GCC ATG AAT 2256Phe Glu Ala Asn Ser Leu Thr Ala Glu Gln Leu Ala Asp Ala Met Asn 740 745 750CTT GAT GCT AAT TTG CTG TTG CAA GCC AGT ATT CAA GCA CAA AAT CAT 2304Leu Asp Ala Asn Leu Leu Leu Gln Ala Ser Ile Gln Ala Gln Asn His 755 760 765CAA CAT CTT CCC CCA GTA ACT CCA GAA AAT GCG TTC TCC TGT TGG ACA 2352Gln His Leu Pro Pro Val Thr Pro Glu Asn Ala Phe Ser Cys Trp Thr 770 775 780TCT ATC AAT ACT ATC CTG CAA TGG GTT AAT GTC GCA CAA CAA TTG AAT 2400Ser Ile Asn Thr Ile Leu Gln Trp Val Asn Val Ala Gln Gln Leu Asn785 790 795 800GTC GCC CCA CAG GGC GTT TCC GCT TTG GTC GGG CTG GAT TAT ATT CAA 2448Val Ala Pro Gln Gly Val Ser Ala Leu Val Gly Leu Asp Tyr Ile Gln 805 810 815TCA ATG AAA GAG ACA CCG ACC TAT GCC CAG TGG GAA AAC GCG GCA GGC 2496Ser Met Lys Glu Thr Pro Thr Tyr Ala Gln Trp Glu Asn Ala Ala Gly 820 825 830GTA TTA ACC GCC GGG TTG AAT TCA CAA CAG GCT AAT ACA TTA CAC GCT 2544Val Leu Thr Ala Gly Leu Asn Ser Gln Gln Ala Asn Thr Leu His Ala 835 840 845TTT CTG GAT GAA TCT CGC AGT GCC GCA TTA AGC ACC TAC TAT ATC CGT 2592Phe Leu Asp Glu Ser Arg Ser Ala Ala Leu Ser Thr Tyr Tyr Ile Arg 850 855 860CAA GTC GCC AAG GCA GCG GCG GCT ATT AAA AGC CGT GAT GAC TTG TAT 2640Gln Val Ala Lys Ala Ala Ala Ala Ile Lys Ser Arg Asp Asp Leu Tyr865 870 875 880CAA TAC TTA CTG ATT GAT AAT CAG GTT TCT GCG GCA ATA AAA ACC ACC 2688Gln Tyr Leu Leu Ile Asp Asn Gln Val Ser Ala Ala Ile Lys Thr Thr 885 890 895CGG ATC GCC GAA GCC ATT GCC AGT ATT CAA CTG TAC GTC AAC CGG GCA 2736Arg Ile Ala Glu Ala Ile Ala Ser Ile Gln Leu Tyr Val Asn Arg Ala 900 905 910TTG GAA AAT GTG GAA GAA AAT GCC AAT TCG GGG GTT ATC AGC CGC CAA 2784Leu Glu Asn Val Glu Glu Asn Ala Asn Ser Gly Val Ile Ser Arg Gln 915 920 925TTC TTT ATC GAC TGG GAC AAA TAC AAT AAA CGC TAC AGC ACT TGG GCG 2832Phe Phe Ile Asp Trp Asp Lys Tyr Asn Lys Arg Tyr Ser Thr Trp Ala 930 935 940GGT GTT TCT CAA TTA GTT TAC TAC CCG GAA AAC TAT ATT GAT CCG ACC 2880Gly Val Ser Gln Leu Val Tyr Tyr Pro Glu Asn Tyr Ile Asp Pro Thr945 950 955 960ATG CGT ATC GGA CAA ACC AAA ATG ATG GAC GCA TTA CTG CAA TCC GTC 2928Met Arg Ile Gly Gln Thr Lys Met Met Asp Ala Leu Leu Gln Ser Val 965 970 975AGC CAA AGC CAA TTA AAC GCC GAT ACC GTC GAA GAT GCC TTT ATG TCT 2976Ser Gln Ser Gln Leu Asn Ala Asp Thr Val Glu Asp Ala Phe Met Ser 980 985 990TAT CTG ACA TCG TTT GAA CAA GTG GCT AAT CTT AAA GTT ATT AGC GCA 3024Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn Leu Lys Val Ile Ser Ala 995 1000 1005TAT CAC GAT AAT ATT AAT AAC GAT CAA GGG CTG ACC TAT TTT ATC GGA 3072Tyr His Asp Asn Ile Asn Asn Asp Gln Gly Leu Thr Tyr Phe Ile Gly 1010 1015 1020CTC AGT GAA ACT GAT GCC GGT GAA TAT TAT TGG CGC AGT GTC GAT CAC 3120Leu Ser Glu Thr Asp Ala Gly Glu Tyr Tyr Trp Arg Ser Val Asp His1025 1030 1035 1040AGT AAA TTC AAC GAC GGT AAA TTC GCG GCT AAT GCC TGG AGT GAA TGG 3168Ser Lys Phe Asn Asp Gly Lys Phe Ala Ala Asn Ala Trp Ser Glu Trp 1045 1050 1055CAT AAA ATT GAT TGT CCA ATT AAC CCT TAT AAA AGC ACT ATC CGT CCA 3216His Lys Ile Asp Cys Pro Ile Asn Pro Tyr Lys Ser Thr Ile Arg Pro 1060 1065 1070GTG ATA TAT AAA TCC CGC CTG TAT CTG CTC TGG TTG GAA CAA AAG GAG 3264Val Ile Tyr Lys Ser Arg Leu Tyr Leu Leu Trp Leu Glu Gln Lys Glu 1075 1080 1085ATC ACC AAA CAG ACA GGA AAT AGT AAA GAT GGC TAT CAA ACT GAA ACG 3312Ile Thr Lys Gln Thr Gly Asn Ser Lys Asp Gly Tyr Gln Thr Glu Thr 1090 1095 1100GAT TAT CGT TAT GAA CTA AAA TTG GCG CAT ATC CGC TAT GAT GGC ACT 3360Asp Tyr Arg Tyr Glu Leu Lys Leu Ala His Ile Arg Tyr Asp Gly Thr1105 1110 1115 1120TGG AAT ACG CCA ATC ACC TTT GAT GTC AAT AAA AAA ATA TCC GAG CTA 3408Trp Asn Thr Pro Ile Thr Phe Asp Val Asn Lys Lys Ile Ser Glu Leu 1125 1130 1135AAA CTG GAA AAA AAT AGA GCG CCC GGA CTC TAT TGT GCC GGT TAT CAA 3456Lys Leu Glu Lys Asn Arg Ala Pro Gly Leu Tyr Cys Ala Gly Tyr Gln 1140 1145 1150GGT GAA GAT ACG TTG CTG GTG ATG TTT TAT AAC CAA CAA GAC ACA CTA 3504Gly Glu Asp Thr Leu Leu Val Met Phe Tyr Asn Gln Gln Asp Thr Leu 1155 1160 1165GAT AGT TAT AAA AAC GCT TCA ATG CAA GGA CTA TAT ATC TTT GCT GAT 3552Asp Ser Tyr Lys Asn Ala Ser Met Gln Gly Leu Tyr Ile Phe Ala Asp 1170 1175 1180ATG GCA TCC AAA GAT ATG ACC CCA GAA CAG AGC AAT GTT TAT CGG GAT 3600Met Ala Ser Lys Asp Met Thr Pro Glu Gln Ser Asn Val Tyr Arg Asp1185 1190 1195 1200AAT AGC TAT CAA CAA TTT GAT ACC AAT AAT GTC AGA AGA GTG AAT AAC 3648Asn Ser Tyr Gln Gln Phe Asp Thr Asn Asn Val Arg Arg Val Asn Asn 1205 1210 1215CGC TAT GCA GAG GAT TAT GAG ATT CCT TCC TCG GTA AGT AGC CGT AAA 3696Arg Tyr Ala Glu Asp Tyr Glu Ile Pro Ser Ser Val Ser Ser Arg Lys 1220 1225 1230GAC TAT GGT TGG GGA GAT TAT TAC CTC AGC ATG GTA TAT AAC GGA GAT 3744Asp Tyr Gly Trp Gly Asp Tyr Tyr Leu Ser Met Val Tyr Asn Gly Asp 1235 1240 1245ATT CCA ACT ATC AAT TAC AAA GCC GCA TCA AGT GAT TTA AAA ATC TAT 3792Ile Pro Thr Ile Asn Tyr Lys Ala Ala Ser Ser Asp Leu Lys Ile Tyr 1250 1255 1260ATC TCA CCA AAA TTA AGA ATT ATT CAT AAT GGA TAT GAA GGA CAG AAG 3840Ile Ser Pro Lys Leu Arg Ile Ile His Asn Gly Tyr Glu Gly Gln Lys1265 1270 1275 1280CGC AAT CAA TGC AAT CTG ATG AAT AAA TAT GGC AAA CTA GGT GAT AAA 3888Arg Asn Gln Cys Asn Leu Met Asn Lys Tyr Gly Lys Leu Gly Asp Lys 1285 1290 1295TTT ATT GTT TAT ACT AGC TTG GGG GTC AAT CCA AAT AAC TCG TCA AAT 3936Phe Ile Val Tyr Thr Ser Leu Gly Val Asn Pro Asn Asn Ser Ser Asn 1300 1305 1310AAG CTC ATG TTT TAC CCC GTC TAT CAA TAT AGC GGA AAC ACC AGT GGA 3984Lys Leu Met Phe Tyr Pro Val Tyr Gln Tyr Ser Gly Asn Thr Ser Gly 1315 1320 1325CTC AAT CAA GGG AGA CTA CTA TTC CAC CGT GAC ACC ACT TAT CCA TCT 4032Leu Asn Gln Gly Arg Leu Leu Phe His Arg Asp Thr Thr Tyr Pro Ser 1330 1335 1340AAA GTA GAA GCT TGG ATT CCT GGA GCA AAA CGT TCT CTA ACC AAC CAA 4080Lys Val Glu Ala Trp Ile Pro Gly Ala Lys Arg Ser Leu Thr Asn Gln1345 1350 1355 1360AAT GCC GCC ATT GGT GAT GAT TAT GCT ACA GAC TCT CTG AAT AAA CCG 4128Asn Ala Ala Ile Gly Asp Asp Tyr Ala Thr Asp Ser Leu Asn Lys Pro 1365 1370 1375GAT GAT CTT AAG CAA TAT ATC TTT ATG ACT GAC AGT AAA GGG ACT GCT 4176Asp Asp Leu Lys Gln Tyr Ile Phe Met Thr Asp Ser Lys Gly Thr Ala 1380 1385 1390ACT GAT GTC TCA GGC CCA GTA GAG ATT AAT ACT GCA ATT TCT CCA GCA 4224Thr Asp Val Ser Gly Pro Val Glu Ile Asn Thr Ala Ile Ser Pro Ala 1395 1400 1405AAA GTT CAG ATA ATA GTC AAA GCG GGT GGC AAG GAG CAA ACT TTT ACC 4272Lys Val Gln Ile Ile Val Lys Ala Gly Gly Lys Glu Gln Thr Phe Thr 1410 1415 1420GCA GAT AAA GAT GTC TCC ATT CAG CCA TCA CCT AGC TTT GAT GAA ATG 4320Ala Asp Lys Asp Val Ser Ile Gln Pro Ser Pro Ser Phe Asp Glu Met1425 1430 1435 1440AAT TAT CAA TTT AAT GCC CTT GAA ATA GAC GGT TCT GGT CTG AAT TTT 4368Asn Tyr Gln Phe Asn Ala Leu Glu Ile Asp Gly Ser Gly Leu Asn Phe 1445 1450 1455ATT AAC AAC TCA GCC AGT ATT GAT GTT ACT TTT ACC GCA TTT GCG GAG 4416Ile Asn Asn Ser Ala Ser Ile Asp Val Thr Phe Thr Ala Phe Ala Glu 1460 1465 1470GAT GGC CGC AAA CTG GGT TAT GAA AGT TTC AGT ATT CCT GTT ACC CTC 4464Asp Gly Arg Lys Leu Gly Tyr Glu Ser Phe Ser Ile Pro Val Thr Leu 1475 1480 1485AAG GTA AGT ACC GAT AAT GCC CTG ACC CTG CAC CAT AAT GAA AAT GGT 4512Lys Val Ser Thr Asp Asn Ala Leu Thr Leu His His Asn Glu Asn Gly 1490 1495 1500GCG CAA TAT ATG CAA TGG CAA TCC TAT CGT ACC CGC CTG AAT ACT CTA 4560Ala Gln Tyr Met Gln Trp Gln Ser Tyr Arg Thr Arg Leu Asn Thr Leu1505 1510 1515 1520TTT GCC CGC CAG TTG GTT GCA CGC GCC ACC ACC GGA ATC GAT ACA ATT 4608Phe Ala Arg Gln Leu Val Ala Arg Ala Thr Thr Gly Ile Asp Thr Ile 1525 1530 1535CTG AGT ATG GAA ACT CAG AAT ATT CAG GAA CCG CAG TTA GGC AAA GGT 4656Leu Ser Met Glu Thr Gln Asn Ile Gln Glu Pro Gln Leu Gly Lys Gly 1540 1545 1550TTC TAT GCT ACG TTC GTG ATA CCT CCC TAT AAC CTA TCA ACT CAT GGT 4704Phe Tyr Ala Thr Phe Val Ile Pro Pro Tyr Asn Leu Ser Thr His Gly 1555 1560 1565GAT GAA CGT TGG TTT AAG CTT TAT ATC AAA CAT GTT GTT GAT AAT AAT 4752Asp Glu Arg Trp Phe Lys Leu Tyr Ile Lys His Val Val Asp Asn Asn 1570 1575 1580TCA CAT ATT ATC TAT TCA GGC CAG CTA ACA GAT ACA AAT ATA AAC ATC 4800Ser His Ile Ile Tyr Ser Gly Gln Leu Thr Asp Thr Asn Ile Asn Ile1585 1590 1595 1600ACA TTA TTT ATT CCT CTT GAT GAT GTC CCA TTG AAT CAA GAT TAT CAC 4848Thr Leu Phe Ile Pro Leu Asp Asp Val Pro Leu Asn Gln Asp Tyr His 1605 1610 1615GCC AAG GTT TAT ATG ACC TTC AAG AAA TCA CCA TCA GAT GGT ACC TGG 4896Ala Lys Val Tyr Met Thr Phe Lys Lys Ser Pro Ser Asp Gly Thr Trp 1620 1625 1630TGG GGC CCT CAC TTT GTT AGA GAT GAT AAA GGA ATA GTA ACA ATA AAC 4944Trp Gly Pro His Phe Val Arg Asp Asp Lys Gly Ile Val Thr Ile Asn 1635 1640 1645CCT AAA TCC ATT TTG ACC CAT TTT GAG AGC GTC AAT GTC CTG AAT AAT 4992Pro Lys Ser Ile Leu Thr His Phe Glu Ser Val Asn Val Leu Asn Asn 1650 1655 1660ATT AGT AGC GAA CCA ATG GAT TTC AGC GGC GCT AAC AGC CTC TAT TTC 5040Ile Ser Ser Glu Pro Met Asp Phe Ser Gly Ala Asn Ser Leu Tyr Phe1665 1670 1675 1680TGG GAA CTG TTC TAC TAT ACC CCG ATG CTG GTT GCT CAA CGT TTG CTG 5088Trp Glu Leu Phe Tyr Tyr Thr Pro Met Leu Val Ala Gln Arg Leu Leu 1685 1690 1695CAT GAA CAG AAC TTC GAT GAA GCC AAC CGT TGG CTG AAA TAT GTC TGG 5136His Glu Gln Asn Phe Asp Glu Ala Asn Arg Trp Leu Lys Tyr Val Trp 1700 1705 1710AGT CCA TCC GGT TAT ATT GTC CAC GGC CAG ATT CAG AAC TAC CAG TGG 5184Ser Pro Ser Gly Tyr Ile Val His Gly Gln Ile Gln Asn Tyr Gln Trp 1715 1720 1725AAC GTC CGC CCG TTA CTG GAA GAC ACC AGT TGG AAC AGT GAT CCT TTG 5232Asn Val Arg Pro Leu Leu Glu Asp Thr Ser Trp Asn Ser Asp Pro Leu 1730 1735 1740GAT TCC GTC GAT CCT GAC GCG GTA GCA CAG CAC GAT CCA ATG CAC TAC 5280Asp Ser Val Asp Pro Asp Ala Val Ala Gln His Asp Pro Met His Tyr1745 1750 1755 1760AAA GTT TCA ACT TTT ATG CGT ACC TTG GAT CTA TTG ATA GCA CGC GGC 5328Lys Val Ser Thr Phe Met Arg Thr Leu Asp Leu Leu Ile Ala Arg Gly 1765 1770 1775GAC CAT GCT TAT CGC CAA CTG GAA CGA GAT ACA CTC AAC GAA GCG AAG 5376Asp His Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Asn Glu Ala Lys 1780 1785 1790ATG TGG TAT ATG CAA GCG CTG CAT CTA TTA GGT GAC AAA CCT TAT CTA 5424Met Trp Tyr Met Gln Ala Leu His Leu Leu Gly Asp Lys Pro Tyr Leu 1795 1800 1805CCG CTG AGT ACG ACA TGG AGT GAT CCA CGA CTA GAC AGA GCC GCG GAT 5472Pro Leu Ser Thr Thr Trp Ser Asp Pro Arg Leu Asp Arg Ala Ala Asp 1810 1815 1820ATC ACT ACC CAA AAT GCT CAC GAC AGC GCA ATA GTC GCT CTG CGG CAG 5520Ile Thr Thr Gln Asn Ala His Asp Ser Ala Ile Val Ala Leu Arg Gln1825 1830 1835 1840AAT ATA CCT ACA CCG GCA CCT TTA TCA 5547Asn Ile Pro Thr Pro Ala Pro Leu Ser 1845 1849 amino acids amino acids linear protein 49Leu Ile Gly Tyr Asn Asn Gln Phe Ser Gly Arg Ala Ser Gln Tyr Val1 5 10 15Ala Pro Gly Thr Val Ser Ser Met Phe Ser Pro Ala Ala Tyr Leu Thr 20 25 30Glu Leu Tyr Arg Glu Ala Arg Asn Leu His Ala Ser Asp Ser Val Tyr 35 40 45Tyr Leu Asp Thr Arg Arg Pro Asp Leu Lys Ser Met Ala Leu Ser Gln 50 55 60Gln Asn Met Asp Ile Glu Leu Ser Thr Leu Ser Leu Ser Asn Glu Leu65 70 75 80Leu Leu Glu Ser Ile Lys Thr Glu Ser Lys Leu Glu Asn Tyr Thr Lys 85 90 95Val Met Glu Met Leu Ser Thr Phe Arg Pro Ser Gly Ala Thr Pro Tyr 100 105 110His Asp Ala Tyr Glu Asn Val Arg Glu Val Ile Gln Leu Gln Asp Pro 115 120 125Gly Leu Glu Gln Leu Asn Ala Ser Pro Ala Ile Ala Gly Leu Met His 130 135 140Gln Ala Ser Leu Leu Gly Ile Asn Ala Ser Ile Ser Pro Glu Leu Phe145 150 155 160Asn Ile Leu Thr Glu Glu Ile Thr Glu Gly Asn Ala Glu Glu Leu Tyr 165 170 175Lys Lys Asn Phe Gly Asn Ile Glu Pro Ala Ser Leu Ala Met Pro Glu 180 185 190Tyr Leu Lys Arg Tyr Tyr Asn Leu Ser Asp Glu Glu Leu Ser Gln Phe 195 200 205Ile Gly Lys Ala Ser Asn Phe Gly Gln Gln Glu Tyr Ser Asn Asn Gln 210 215 220Leu Ile Thr Pro Val Val Asn Ser Ser Asp Gly Thr Val Lys Val Tyr225 230 235 240Arg Ile Thr Arg Glu Tyr Thr Thr Asn Ala Tyr Gln Met Asp Val Glu 245 250 255Leu Phe Pro Phe Gly Gly Glu Asn Tyr Arg Leu Asp Tyr Lys Phe Lys 260 265 270Asn Phe Tyr Asn Ala Ser Tyr Leu Ser Ile Lys Leu Asn Asp Lys Arg 275 280 285Glu Leu Val Arg Thr Glu Gly Ala Pro Gln Val Asn Ile Glu Tyr Ser 290 295 300Ala Asn Ile Thr Leu Asn Thr Ala Asp Ile Ser Gln Pro Phe Glu Ile305 310 315 320Gly Leu Thr Arg Val Leu Pro Ser Gly Ser Trp Ala Tyr Ala Ala Ala 325 330 335Lys Phe Thr Val Glu Glu Tyr Asn Gln Tyr Ser Phe Leu Leu Lys Leu 340 345 350Asn Lys Ala Ile Arg Leu Ser Arg Ala Thr Glu Leu Ser Pro Thr Ile 355 360 365Leu Glu Gly Ile Val Arg Ser Val Asn Leu Gln Leu Asp Ile Asn Thr 370 375 380Asp Val Leu Gly Lys Val Phe Leu Thr Lys Tyr Tyr Met Gln Arg Tyr385 390 395 400Ala Ile His Ala Glu Thr Ala Leu Ile Leu Cys Asn Ala Pro Ile Ser 405 410 415Gln Arg Ser Tyr Asp Asn Gln Pro Ser Gln Phe Asp Arg Leu Phe Asn 420 425 430Thr Pro Leu Leu Asn Gly Gln Tyr Phe Ser Thr Gly Asp Glu Glu Ile 435 440 445Asp Leu Asn Ser Gly Ser Thr Gly Asp Trp Arg Lys Thr Ile Leu Lys 450 455 460Arg Ala Phe Asn Ile Asp Asp Val Ser Leu Phe Arg Leu Leu Lys Ile465 470 475 480Thr Asp His Asp Asn Lys Asp Gly Lys Ile Lys Asn Asn Leu Lys Asn 485 490 495Leu Ser Asn Leu Tyr Ile Gly Lys Leu Leu Ala Asp Ile His Gln Leu 500 505 510Thr Ile Asp Glu Leu Asp Leu Leu Leu Ile Ala Val Gly Glu Gly Lys 515 520 525Thr Asn Leu Ser Ala Ile Ser Asp Lys Gln Leu Ala Thr Leu Ile Arg 530 535 540Lys Leu Asn Thr Ile Thr Ser Trp Leu His Thr Gln Lys Trp Ser Val545 550 555 560Phe Gln Leu Phe Ile Met Thr Ser Thr Ser Tyr Asn Lys Thr Leu Thr 565 570 575Pro Glu Ile Lys Asn Leu Leu Asp Thr Val Tyr His Gly Leu Gln Gly 580 585 590Phe Asp Lys Asp Lys Ala Asp Leu Leu His Val Met Ala Pro Tyr Ile 595 600 605Ala Ala Thr Leu Gln Leu Ser Ser Glu Asn Val Ala His Ser Val Leu 610 615 620Leu Trp Ala Asp Lys Leu Gln Pro Gly Asp Gly Ala Met Thr Ala Glu625 630 635 640Lys Phe Trp Asp Trp Leu Asn Thr Lys Tyr Thr Pro Gly Ser Ser Glu 645 650 655Ala Val Glu Thr Gln Glu His Ile Val Gln Tyr Cys Gln Ala Leu Ala 660 665 670Gln Leu Glu Met Val Tyr His Ser Thr Gly Ile Asn Glu Asn Ala Phe 675 680 685Arg Leu Phe Val Thr Lys Pro Glu Met Phe Gly Ala Ala Thr Gly Ala 690 695 700Ala Pro Ala His Asp Ala Leu Ser Leu Ile Met Leu Thr Arg Phe Ala705 710 715 720Asp Trp Val Asn Ala Leu Gly Glu Lys Ala Ser Ser Val Leu Ala Ala 725 730 735Phe Glu Ala Asn Ser Leu Thr Ala Glu Gln Leu Ala Asp Ala Met Asn 740 745 750Leu Asp Ala Asn Leu Leu Leu Gln Ala Ser Ile Gln Ala Gln Asn His 755 760 765Gln His Leu Pro Pro Val Thr Pro Glu Asn Ala Phe Ser Cys Trp Thr 770 775 780Ser Ile Asn Thr Ile Leu Gln Trp Val Asn Val Ala Gln Gln Leu Asn785 790 795 800Val Ala Pro Gln Gly Val Ser Ala Leu Val Gly Leu Asp Tyr Ile Gln 805 810 815Ser Met Lys Glu Thr Pro Thr Tyr Ala Gln Trp Glu Asn Ala Ala Gly 820 825 830Val Leu Thr Ala Gly Leu Asn Ser Gln Gln Ala Asn Thr Leu His Ala 835 840 845Phe Leu Asp Glu Ser Arg Ser Ala Ala Leu Ser Thr Tyr Tyr Ile Arg 850 855 860Gln Val Ala Lys Ala Ala Ala Ala Ile Lys Ser Arg Asp Asp Leu Tyr865 870 875 880Gln Tyr Leu Leu Ile Asp Asn Gln Val Ser Ala Ala Ile Lys Thr Thr 885 890 895Arg Ile Ala Glu Ala Ile Ala Ser Ile Gln Leu Tyr Val Asn Arg Ala 900 905 910Leu Glu Asn Val Glu Glu Asn Ala Asn Ser Gly Val Ile Ser Arg Gln 915 920 925Phe Phe Ile Asp Trp Asp Lys Tyr Asn Lys Arg Tyr Ser Thr Trp Ala 930 935 940Gly Val Ser Gln Leu Val Tyr Tyr Pro Glu Asn Tyr Ile Asp Pro Thr945 950 955 960Met Arg Ile Gly Gln Thr Lys Met Met Asp Ala Leu Leu Gln Ser Val 965 970 975Ser Gln Ser Gln Leu Asn Ala Asp Thr Val Glu Asp Ala Phe Met Ser 980 985 990Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn Leu Lys Val Ile Ser Ala 995 1000 1005Tyr His Asp Asn Ile Asn Asn Asp Gln Gly Leu Thr Tyr Phe Ile Gly 1010 1015 1020Leu Ser Glu Thr Asp Ala Gly Glu Tyr Tyr Trp Arg Ser Val Asp His1025 1030 1035 1040Ser Lys Phe Asn Asp Gly Lys Phe Ala Ala Asn Ala Trp Ser Glu Trp 1045 1050 1055His Lys Ile Asp Cys Pro Ile Asn Pro Tyr Lys Ser Thr Ile Arg Pro 1060 1065 1070Val Ile Tyr Lys Ser Arg Leu Tyr Leu Leu Trp Leu Glu Gln Lys Glu 1075 1080 1085Ile Thr Lys Gln Thr Gly Asn Ser Lys Asp Gly Tyr Gln Thr Glu Thr 1090 1095 1100Asp Tyr Arg Tyr Glu Leu Lys Leu Ala His Ile Arg Tyr Asp Gly Thr1105 1110 1115 1120Trp Asn Thr Pro Ile Thr Phe Asp Val Asn Lys Lys Ile Ser Glu Leu 1125 1130 1135Lys Leu Glu Lys Asn Arg Ala Pro Gly Leu Tyr Cys Ala Gly Tyr Gln 1140 1145 1150Gly Glu Asp Thr Leu Leu Val Met Phe Tyr Asn Gln Gln Asp Thr Leu 1155 1160 1165Asp Ser Tyr Lys Asn Ala Ser Met Gln Gly Leu Tyr Ile Phe Ala Asp 1170 1175 1180Met Ala Ser Lys Asp Met Thr Pro Glu Gln Ser Asn Val Tyr Arg Asp1185 1190 1195 1200Asn Ser Tyr Gln Gln Phe Asp Thr Asn Asn Val Arg Arg Val Asn Asn 1205 1210 1215Arg Tyr Ala Glu Asp Tyr Glu Ile Pro Ser Ser Val Ser Ser Arg Lys 1220 1225 1230Asp Tyr Gly Trp Gly Asp Tyr Tyr Leu Ser Met Val Tyr Asn Gly Asp 1235 1240 1245Ile Pro Thr Ile Asn Tyr Lys Ala Ala Ser Ser Asp Leu Lys Ile Tyr 1250 1255 1260Ile Ser Pro Lys Leu Arg Ile Ile His Asn Gly Tyr Glu Gly Gln Lys1265 1270 1275 1280Arg Asn Gln Cys Asn Leu Met Asn Lys Tyr Gly Lys Leu Gly Asp Lys 1285 1290 1295Phe Ile Val Tyr Thr Ser Leu Gly Val Asn Pro Asn Asn Ser Ser Asn 1300 1305 1310Lys Leu Met Phe Tyr Pro Val Tyr Gln Tyr Ser Gly Asn Thr Ser Gly 1315 1320 1325Leu Asn Gln Gly Arg Leu Leu Phe His Arg Asp Thr Thr Tyr Pro Ser 1330 1335 1340Lys Val Glu Ala Trp Ile Pro Gly Ala Lys Arg Ser Leu Thr Asn Gln1345 1350 1355 1360Asn Ala Ala Ile Gly Asp Asp Tyr Ala Thr Asp Ser Leu Asn Lys Pro 1365 1370 1375Asp Asp Leu Lys Gln Tyr Ile Phe Met Thr Asp Ser Lys Gly Thr Ala 1380 1385 1390Thr Asp Val Ser Gly Pro Val Glu Ile Asn Thr Ala Ile Ser Pro Ala 1395 1400 1405Lys Val Gln Ile Ile Val Lys Ala Gly Gly Lys Glu Gln Thr Phe Thr 1410 1415 1420Ala Asp Lys Asp Val Ser Ile Gln Pro Ser Pro Ser Phe Asp Glu Met1425 1430 1435 1440Asn Tyr Gln Phe Asn Ala Leu Glu Ile Asp Gly Ser Gly Leu Asn Phe 1445 1450 1455Ile Asn Asn Ser Ala Ser Ile Asp Val Thr Phe Thr Ala Phe Ala Glu 1460 1465 1470Asp Gly Arg Lys Leu Gly Tyr Glu Ser Phe Ser Ile Pro Val Thr Leu 1475 1480 1485Lys Val Ser Thr Asp Asn Ala Leu Thr Leu His His Asn Glu Asn Gly 1490 1495 1500Ala Gln Tyr Met Gln Trp Gln Ser Tyr Arg Thr Arg Leu Asn Thr Leu1505 1510 1515 1520Phe Ala Arg Gln Leu Val Ala Arg Ala Thr Thr Gly Ile Asp Thr Ile 1525 1530 1535Leu Ser Met Glu Thr Gln Asn Ile Gln Glu Pro Gln Leu Gly Lys Gly 1540 1545 1550Phe Tyr Ala Thr Phe Val Ile Pro Pro Tyr Asn Leu Ser Thr His Gly 1555 1560 1565Asp Glu Arg Trp Phe Lys Leu Tyr Ile Lys His Val Val Asp Asn Asn 1570 1575 1580Ser His Ile Ile Tyr Ser Gly Gln Leu Thr Asp Thr Asn Ile Asn Ile1585 1590 1595 1600Thr Leu Phe Ile Pro Leu Asp Asp Val Pro Leu Asn Gln Asp Tyr His 1605 1610 1615Ala Lys Val Tyr Met Thr Phe Lys Lys Ser Pro Ser Asp Gly Thr Trp 1620 1625 1630Trp Gly Pro His Phe Val Arg Asp Asp Lys Gly Ile Val Thr Ile Asn 1635 1640 1645Pro Lys Ser Ile Leu Thr His Phe Glu Ser Val Asn Val Leu Asn Asn 1650 1655 1660Ile Ser Ser Glu Pro Met Asp Phe Ser Gly Ala Asn Ser Leu Tyr Phe1665 1670 1675 1680Trp Glu Leu Phe Tyr Tyr Thr Pro Met Leu Val Ala Gln Arg Leu Leu 1685 1690 1695His Glu Gln Asn Phe Asp Glu Ala Asn Arg Trp Leu Lys Tyr Val Trp 1700 1705 1710Ser Pro Ser Gly Tyr Ile Val His Gly Gln Ile Gln Asn Tyr Gln Trp 1715 1720 1725Asn Val Arg Pro Leu Leu Glu Asp Thr Ser Trp Asn Ser Asp Pro Leu 1730 1735 1740Asp Ser Val Asp Pro Asp Ala Val Ala Gln His Asp Pro Met His Tyr1745 1750 1755 1760Lys Val Ser Thr Phe Met Arg Thr Leu Asp Leu Leu Ile Ala Arg Gly 1765 1770 1775Asp His Ala Tyr Arg Gln Leu Glu Arg Asp Thr Leu Asn Glu Ala Lys 1780 1785 1790Met Trp Tyr Met Gln Ala Leu His Leu Leu Gly Asp Lys Pro Tyr Leu 1795 1800 1805Pro Leu Ser Thr Thr Trp Ser Asp Pro Arg Leu Asp Arg Ala Ala Asp 1810 1815 1820Ile Thr Thr Gln Asn Ala His Asp Ser Ala Ile Val Ala Leu Arg Gln1825 1830 1835 1840Asn Ile Pro Thr Pro Ala Pro Leu Ser 1845 1740 base pairs nucleic acid double linear DNA (genomic) 50TTG CGC AGC GCT AAT ACC CTG ACT GAT CTC TTC CTG CCG CAA ATC AAT 48Leu Arg Ser Ala Asn Thr Leu Thr Asp Leu Phe Leu Pro Gln Ile Asn 1 5 10 15GAA GTG ATG ATG AAT TAC TGG CAG ACA TTA GCT CAG AGA GTA TAC AAT 96Glu Val Met Met Asn Tyr Trp Gln Thr Leu Ala Gln Arg Val Tyr Asn 20 25 30CTG CGT CAT AAC CTC TCT ATC GAC GGC CAG CCG TTA TAT CTG CCA ATC 144Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Tyr Leu Pro Ile 35 40 45TAT GCC ACA CCG GCC GAT CCG AAA GCG TTA CTC AGC GCC GCC GTT GCC 192Tyr Ala Thr Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala Ala Val Ala 50 55 60ACT TCT CAA GGT GGA GGC AAG CTA CCG GAA TCA TTT ATG TCC CTG TGG 240Thr Ser Gln Gly Gly Gly Lys Leu Pro Glu Ser Phe Met Ser Leu Trp65 70 75 80CGT TTC CCG CAC ATG CTG GAA AAT GCG CGC GGC ATG GTT AGC CAG CTC 288Arg Phe Pro His Met Leu Glu Asn Ala Arg Gly Met Val Ser Gln Leu 85 90 95ACC CAG TTC GGC TCC ACG TTA CAA AAT ATT ATC GAA CGT CAG GAC GCG 336Thr Gln Phe Gly Ser Thr Leu Gln Asn Ile Ile Glu Arg Gln Asp Ala 100 105 110GAA GCG CTC AAT GCG TTA TTA CAA AAT CAG GCC GCC GAG CTG ATA TTG 384Glu Ala Leu Asn Ala Leu Leu Gln Asn Gln Ala Ala Glu Leu Ile Leu 115 120 125ACT AAC CTG AGC ATT CAG GAC AAA ACC ATT GAA GAA TTG GAT GCC GAG 432Thr Asn Leu Ser Ile Gln Asp Lys Thr Ile Glu Glu Leu Asp Ala Glu 130 135 140AAA ACG GTG TTG GAA AAA TCC AAA GCG GGA GCA CAA TCG CGC TTT GAT 480Lys Thr Val Leu Glu Lys Ser Lys Ala Gly Ala Gln Ser Arg Phe Asp145 150 155 160AGC TAC GGC AAA CTG TAC GAT GAG AAT ATC AAC GCC GGT GAA AAC CAA 528Ser Tyr Gly Lys Leu Tyr Asp Glu Asn Ile Asn Ala Gly Glu Asn Gln 165 170 175GCC ATG ACG CTA CGA GCG TCC GCC GCC GGG CTT ACC ACG GCA GTT CAG 576Ala Met Thr Leu Arg Ala Ser Ala Ala Gly Leu Thr Thr Ala Val Gln 180 185 190GCA TCC CGT CTG GCC GGT GCG GCG GCT GAT CTG GTG CCT AAC ATC TTC 624Ala Ser Arg Leu Ala Gly Ala Ala Ala Asp Leu Val Pro Asn Ile Phe 195 200 205GGC TTT GCC GGT GGC GGC AGC CGT TGG GGG GCT ATC GCT GAG GCG ACA 672Gly Phe Ala Gly Gly Gly Ser Arg Trp Gly Ala Ile Ala Glu Ala Thr 210 215 220GGT TAT GTG ATG GAA TTC TCC GCG AAT GTT ATG AAC ACC GAA GCG GAT 720Gly Tyr Val Met Glu Phe Ser Ala Asn Val Met Asn Thr Glu Ala Asp225 230 235 240AAA ATT AGC CAA TCT GAA ACC TAC CGT CGT CGC CGT CAG GAG TGG GAG 768Lys Ile Ser Gln Ser Glu Thr Tyr Arg Arg Arg Arg Gln Glu Trp Glu 245 250 255ATC CAG CGG AAT AAT GCC GAA GCG GAA TTG AAG CAA ATC GAT GCT CAG 816Ile Gln Arg Asn Asn Ala Glu Ala Glu Leu Lys Gln Ile Asp Ala Gln 260 265 270CTC AAA TCA CTC GCT GTA CGC CGC GAA GCC GCC GTA TTG CAG AAA ACC 864Leu Lys Ser Leu Ala Val Arg Arg Glu Ala Ala Val Leu Gln Lys Thr 275 280 285AGT CTG AAA ACC CAA CAA GAA CAG ACC CAA TCT CAA TTG GCC TTC CTG 912Ser Leu Lys Thr Gln Gln Glu Gln Thr Gln Ser Gln Leu Ala Phe Leu 290 295 300CAA CGT AAG TTC AGC AAT CAG GCG TTA TAC AAC TGG CTG CGT GGT CGA 960Gln Arg Lys Phe Ser Asn Gln Ala Leu Tyr Asn Trp Leu Arg Gly Arg305 310 315 320CTG GCG GCG ATT TAC TTC CAG TTC TAC GAT TTG GCC GTC GCG CGT TGC 1008Leu Ala Ala Ile Tyr Phe Gln Phe Tyr Asp Leu Ala Val Ala Arg Cys 325 330 335CTG ATG GCA GAA CAA GCT TAC CGT TGG GAA CTC AAT GAT GAC TCT GCC 1056Leu Met Ala Glu Gln Ala Tyr Arg Trp Glu Leu Asn Asp Asp Ser Ala 340 345 350CGC TTC ATT AAA CCG GGC GCC TGG CAG GGA ACC TAT GCC GGT CTG CTT 1104Arg Phe Ile Lys Pro Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu Leu 355 360 365GCA GGT GAA ACC TTG ATG CTG AGT CTG GCA CAA ATG GAA GAC GCT CAT 1152Ala Gly Glu Thr Leu Met Leu Ser Leu Ala Gln Met Glu Asp Ala His 370 375 380CTG AAA CGC GAT AAA CGC GCA TTA GAG GTT GAA CGC ACA GTA TCG CTG 1200Leu Lys Arg Asp Lys Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu385 390 395 400GCC GAA GTT TAT GCA GGA TTA CCA AAA GAT AAC GGT CCA TTT TCC CTG 1248Ala Glu Val Tyr Ala Gly Leu Pro Lys Asp Asn Gly Pro Phe Ser Leu 405 410 415GCT CAG GAA ATT GAC AAG CTG GTG AGT CAA GGT TCA GGC AGT GCC GGC 1296Ala Gln Glu Ile Asp Lys Leu Val Ser Gln Gly Ser Gly Ser Ala Gly 420 425 430AGT GGT AAT AAT AAT TTG GCG TTC GGC GCC GGC ACG GAC ACT AAA ACC 1344Ser Gly Asn Asn Asn Leu Ala Phe Gly Ala Gly Thr Asp Thr Lys Thr 435 440 445TCT TTG CAG GCA TCA GTT TCA TTC GCT GAT TTG AAA ATT CGT GAA GAT 1392Ser Leu Gln Ala Ser Val Ser Phe Ala Asp Leu Lys Ile Arg Glu Asp 450 455 460TAC CCG GCA TCG CTT GGC AAA ATT CGA CGT ATC AAA CAG ATC AGC GTC 1440Tyr Pro Ala Ser Leu Gly Lys Ile Arg Arg Ile Lys Gln Ile Ser Val465 470 475 480ACT TTG CCC GCG CTA CTG GGA CCG TAT CAG GAT GTA CAG GCA ATA TTG 1488Thr Leu Pro Ala Leu Leu Gly Pro Tyr Gln Asp Val Gln Ala Ile Leu 485 490 495TCT TAC GGC GAT AAA GCC GGA TTA GCT AAC GGC TGT GAA GCG CTG GCA 1536Ser Tyr Gly Asp Lys Ala Gly Leu Ala Asn Gly Cys Glu Ala Leu Ala 500 505 510GTT TCT CAC GGT ATG AAT GAC AGC GGC CAA TTC CAG CTC GAT TTC AAC 1584Val Ser His Gly Met Asn Asp Ser Gly Gln Phe Gln Leu Asp Phe Asn 515 520 525GAT GGC AAA TTC CTG CCA TTC GAA GGC ATC GCC ATT GAT CAA GGC ACG 1632Asp Gly Lys Phe Leu Pro Phe Glu Gly Ile Ala Ile Asp Gln Gly Thr 530 535 540CTG ACA CTG AGC TTC CCA AAT GCA TCT ATG CCG GAG AAA GGT AAA CAA 1680Leu Thr Leu Ser Phe Pro Asn Ala Ser Met Pro Glu Lys Gly Lys Gln545 550 555 560GCC ACT ATG TTA AAA ACC CTG AAC GAT ATC ATT TTG CAT ATT CGC TAC 1728Ala Thr Met Leu Lys Thr Leu Asn Asp Ile Ile Leu His Ile Arg Tyr 565 570 575ACC ATT AAA TAA 1740Thr Ile Lys 579 amino acids amino acids linear protein 51Leu Arg Ser Ala Asn Thr Leu Thr Asp Leu Phe Leu Pro Gln Ile Asn1 5 10 15Glu Val Met Met Asn Tyr Trp Gln Thr Leu Ala Gln Arg Val Tyr Asn 20 25 30Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Tyr Leu Pro Ile 35 40 45Tyr Ala Thr Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala Ala Val Ala 50 55 60Thr Ser Gln Gly Gly Gly Lys Leu Pro Glu Ser Phe Met Ser Leu Trp65 70 75 80Arg Phe Pro His Met Leu Glu Asn Ala Arg Gly Met Val Ser Gln Leu 85 90 95Thr Gln Phe Gly Ser Thr Leu Gln Asn Ile Ile Glu Arg Gln Asp Ala 100 105 110Glu Ala Leu Asn Ala Leu Leu Gln Asn Gln Ala Ala Glu Leu Ile Leu 115 120 125Thr Asn Leu Ser Ile Gln Asp Lys Thr Ile Glu Glu Leu Asp Ala Glu 130 135 140Lys Thr Val Leu Glu Lys Ser Lys Ala Gly Ala Gln Ser Arg Phe Asp145 150 155 160Ser Tyr Gly Lys Leu Tyr Asp Glu Asn Ile Asn Ala Gly Glu Asn Gln 165 170 175Ala Met Thr Leu Arg Ala Ser Ala Ala Gly Leu Thr Thr Ala Val Gln 180 185 190Ala Ser Arg Leu Ala Gly Ala Ala Ala Asp Leu Val Pro Asn Ile Phe 195 200 205Gly Phe Ala Gly Gly Gly Ser Arg Trp Gly Ala Ile Ala Glu Ala Thr 210 215 220Gly Tyr Val Met Glu Phe Ser Ala Asn Val Met Asn Thr Glu Ala Asp225 230 235 240Lys Ile Ser Gln Ser Glu Thr Tyr Arg Arg Arg Arg Gln Glu Trp Glu 245 250 255Ile Gln Arg Asn Asn Ala Glu Ala Glu Leu Lys Gln Ile Asp Ala Gln 260 265 270Leu Lys Ser Leu Ala Val Arg Arg Glu Ala Ala Val Leu Gln Lys Thr 275 280 285Ser Leu Lys Thr Gln Gln Glu Gln Thr Gln Ser Gln Leu Ala Phe Leu 290 295 300Gln Arg Lys Phe Ser Asn Gln Ala Leu Tyr Asn Trp Leu Arg Gly Arg305 310 315 320Leu Ala Ala Ile Tyr Phe Gln Phe Tyr Asp Leu Ala Val Ala Arg Cys 325 330 335Leu Met Ala Glu Gln Ala Tyr Arg Trp Glu Leu Asn Asp Asp Ser Ala 340 345 350Arg Phe Ile Lys Pro Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu Leu 355 360 365Ala Gly Glu Thr Leu Met Leu Ser Leu Ala Gln Met Glu Asp Ala His 370 375 380Leu Lys Arg Asp Lys Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu385 390 395 400Ala Glu Val Tyr Ala Gly Leu Pro Lys Asp Asn Gly Pro Phe Ser Leu 405 410 415Ala Gln Glu Ile Asp Lys Leu Val Ser Gln Gly Ser Gly Ser Ala Gly 420 425 430Ser Gly Asn Asn Asn Leu Ala Phe Gly Ala Gly Thr Asp Thr Lys Thr 435 440 445Ser Leu Gln Ala Ser Val Ser Phe Ala Asp Leu Lys Ile Arg Glu Asp 450 455 460Tyr Pro Ala Ser Leu Gly Lys Ile Arg Arg Ile Lys Gln Ile Ser Val465 470 475 480Thr Leu Pro Ala Leu Leu Gly Pro Tyr Gln Asp Val Gln Ala Ile Leu 485 490 495Ser Tyr Gly Asp Lys Ala Gly Leu Ala Asn Gly Cys Glu Ala Leu Ala 500 505 510Val Ser His Gly Met Asn Asp Ser Gly Gln Phe Gln Leu Asp Phe Asn 515 520 525Asp Gly Lys Phe Leu Pro Phe Glu Gly Ile Ala Ile Asp Gln Gly Thr 530 535 540Leu Thr Leu Ser Phe Pro Asn Ala Ser Met Pro Glu Lys Gly Lys Gln545 550 555 560Ala Thr Met Leu Lys Thr Leu Asn Asp Ile Ile Leu His Ile Arg Tyr 565 570 575Thr Ile Lys 5532 base pairs nucleic acid double linear DNA (genomic) 52TTT ATA CAA GGT TAT AGT GAT CTG TTT GGT AAT CGT GCT GAT AAC TAT 48Phe Ile Gln Gly Tyr Ser Asp Leu Phe Gly Asn Arg Ala Asp Asn Tyr1 5 10 15GCC GCG CCG GGC TCG GTT GCA TCG ATG TTC TCA CCG GCG GCT TAT TTG 96Ala Ala Pro Gly Ser Val Ala Ser Met Phe Ser Pro Ala Ala Tyr Leu 20 25 30ACG GAA TTG TAC CGT GAA GCC AAA AAC TTG CAT GAC AGC AGC TCA ATT 144Thr Glu Leu Tyr Arg Glu Ala Lys Asn Leu His Asp Ser Ser Ser Ile 35 40 45TAT TAC CTA GAT AAA CGT CGC CCG GAT TTA GCA AGC TTA ATG CTC AGC 192Tyr Tyr Leu Asp Lys Arg Arg Pro Asp Leu Ala Ser Leu Met Leu Ser 50 55 60CAG AAA AAT ATG GAT GAG GAA ATT TCA ACG CTG GCT CTC TCT AAT GAA 240Gln Lys Asn Met Asp Glu Glu Ile Ser Thr Leu Ala Leu Ser Asn Glu65 70 75 80TTG TGC CTT GCC GGG ATC GAA ACA AAA ACA GGA AAA TCA CAA GAT GAA 288Leu Cys Leu Ala Gly Ile Glu Thr Lys Thr Gly Lys Ser Gln Asp Glu 85 90 95GTG ATG GAT ATG TTG TCA ACT TAT CGT TTA AGT GGA GAG ACA CCT TAT 336Val Met Asp Met Leu Ser Thr Tyr Arg Leu Ser Gly Glu Thr Pro Tyr 100 105 110CAT CAC GCT TAT GAA ACT GTT CGT GAA ATC GTT CAT GAA CGT GAT CCA 384His His Ala Tyr Glu Thr Val Arg Glu Ile Val His Glu Arg Asp Pro 115 120 125GGA TTT CGT CAT TTG TCA CAG GCA CCC ATT GTT GCT GCT AAG CTC GAT 432Gly Phe Arg His Leu Ser Gln Ala Pro Ile Val Ala Ala Lys Leu Asp 130 135 140CCT GTG ACT TTG TTG GGT ATT AGC TCC CAT ATT TCG CCA GAA CTG TAT 480Pro Val Thr Leu Leu Gly Ile Ser Ser His Ile Ser Pro Glu Leu Tyr145 150 155 160AAC TTG CTG ATT GAG GAG ATC CCG GAA AAA GAT GAA GCC GCG CTT GAT 528Asn Leu Leu Ile Glu Glu Ile Pro Glu Lys Asp Glu Ala Ala Leu Asp 165 170 175ACG CTT TAT AAA ACA AAC TTT GGC GAT ATT ACT ACT GCT CAG TTA ATG 576Thr Leu Tyr Lys Thr Asn Phe Gly Asp Ile Thr Thr Ala Gln Leu Met 180 185 190TCC CCA AGT TAT CTG GCC CGG TAT TAT GGC GTC TCA CCG GAA GAT ATT 624Ser Pro Ser Tyr Leu Ala Arg Tyr Tyr Gly Val Ser Pro Glu Asp Ile 195 200 205GCC TAC GTG ACG ACT TCA TTA TCA CAT GTT GGA TAT AGC AGT GAT ATT 672Ala Tyr Val Thr Thr Ser Leu Ser His Val Gly Tyr Ser Ser Asp Ile 210 215 220CTG GTT ATT CCG TTG GTC GAT GGT GTG GGT AAG ATG GAA GTA GTT CGT 720Leu Val Ile Pro Leu Val Asp Gly Val Gly Lys Met Glu Val Val Arg225 230 235 240GTT ACC CGA ACA CCA TCG GAT AAT TAT ACC AGT CAG ACG AAT TAT ATT 768Val Thr Arg Thr Pro Ser Asp Asn Tyr Thr Ser Gln Thr Asn Tyr Ile 245 250 255GAG CTG TAT CCA CAG GGT GGC GAC AAT TAT TTG ATC AAA TAC AAT CTA 816Glu Leu Tyr Pro Gln Gly Gly Asp Asn Tyr Leu Ile Lys Tyr Asn Leu 260 265 270AGC AAT AGT TTT GGT TTG GAT GAT TTT TAT CTG CAA TAT AAA GAT GGT 864Ser Asn Ser Phe Gly Leu Asp Asp Phe Tyr Leu Gln Tyr Lys Asp Gly 275 280 285TCC GCT GAT TGG ACT GAG ATT GCC CAT AAT CCC TAT CCT GAT ATG GTC 912Ser Ala Asp Trp Thr Glu Ile Ala His Asn Pro Tyr Pro Asp Met Val 290 295 300ATA AAT CAA AAG TAT GAA TCA CAG GCG ACA ATC AAA CGT AGT GAC TCT 960Ile Asn Gln Lys Tyr Glu Ser Gln Ala Thr Ile Lys Arg Ser Asp Ser305 310 315 320GAC AAT ATA CTC AGT ATA GGG TTA CAA AGA TGG CAT AGC GGT AGT TAT 1008Asp Asn Ile Leu Ser Ile Gly Leu Gln Arg Trp His Ser Gly Ser Tyr 325 330 335AAT TTT GCC GCC GCC AAT TTT AAA ATT GAC CAA TAC TCC CCG AAA GCT 1056Asn Phe Ala Ala Ala Asn Phe Lys Ile Asp Gln Tyr Ser Pro Lys Ala 340 345 350TTC CTG CTT AAA ATG AAT AAG GCT ATT CGG TTG CTC AAA GCT ACC GGC 1104Phe Leu Leu Lys Met Asn Lys Ala Ile Arg Leu Leu Lys Ala Thr Gly 355 360 365CTC TCT TTT GCT ACG TTG GAG CGT ATT GTT GAT AGT GTT AAT AGC ACC 1152Leu Ser Phe Ala Thr Leu Glu Arg Ile Val Asp Ser Val Asn Ser Thr 370 375 380AAA TCC ATC ACG GTT GAG GTA TTA AAC AAG GTT TAT CGG GTA AAA TTC 1200Lys Ser Ile Thr Val Glu Val Leu Asn Lys Val Tyr Arg Val Lys Phe385 390 395 400TAT ATT GAT CGT TAT GGC ATC AGT GAA GAG ACA GCC GCT ATT TTG GCT 1248Tyr Ile Asp Arg Tyr Gly Ile Ser Glu Glu Thr Ala Ala Ile Leu Ala 405 410 415AAT ATT AAT ATC TCT CAG CAA GCT GTT GGC AAT CAG CTT AGC CAG TTT 1296Asn Ile Asn Ile Ser Gln Gln Ala Val Gly Asn Gln Leu Ser Gln Phe 420 425 430GAG CAA CTA TTT AAT CAC CCG CCG CTC AAT GGT ATT CGC TAT GAA ATC 1344Glu Gln Leu Phe Asn His Pro Pro Leu Asn Gly Ile Arg Tyr Glu Ile 435 440 445AGT GAG GAC AAC TCC AAA CAT CTT CCT AAT CCT GAT CTG AAC CTT AAA 1392Ser Glu Asp Asn Ser Lys His Leu Pro Asn Pro Asp Leu Asn Leu Lys 450 455 460CCA GAC AGT ACC GGT GAT GAT CAA CGC AAG GCG GTT TTA AAA CGC GCG 1440Pro Asp Ser Thr Gly Asp Asp Gln Arg Lys Ala Val Leu Lys Arg Ala465 470 475 480TTT CAG GTT AAC GCC AGT GAG TTG TAT CAG ATG TTA TTG ATC ACT GAT 1488Phe Gln Val Asn Ala Ser Glu Leu Tyr Gln Met Leu Leu Ile Thr Asp 485 490 495CGT AAA GAA GAC GGT GTT ATC AAA AAT AAC TTA GAG AAT TTG TCT GAT 1536Arg Lys Glu Asp Gly Val Ile Lys Asn Asn Leu Glu Asn Leu Ser Asp 500 505 510CTG TAT TTG GTT AGT TTG CTG GCC CAG ATT CAT AAC CTG ACT ATT GCT 1584Leu Tyr Leu Val Ser Leu Leu Ala Gln Ile His Asn Leu Thr Ile Ala 515 520 525GAA TTG AAC ATT TTG TTG GTG ATT TGT GGC TAT GGC GAC ACC AAC ATT 1632Glu Leu Asn Ile Leu Leu Val Ile Cys Gly Tyr Gly Asp Thr Asn Ile 530 535 540TAT CAG ATT ACC GAC GAT AAT TTA GCC AAA ATA GTG GAA ACA TTG TTG 1680Tyr Gln Ile Thr Asp Asp Asn Leu Ala Lys Ile Val Glu Thr Leu Leu545 550 555 560TGG ATC ACT CAA TGG TTG AAG ACC CAA AAA TGG ACA GTT ACC GAC CTG 1728Trp Ile Thr Gln Trp Leu Lys Thr Gln Lys Trp Thr Val Thr Asp Leu 565 570 575TTT CTG ATG ACC ACG GCC ACT TAC AGC ACC ACT TTA ACG CCA GAA ATT 1776Phe Leu Met Thr Thr Ala Thr Tyr Ser Thr Thr Leu Thr Pro Glu Ile 580 585 590AGC AAT CTG ACG GCT ACG TTG TCT TCA ACT TTG CAT GGC AAA GAG AGT 1824Ser Asn Leu Thr Ala Thr Leu Ser Ser Thr Leu His Gly Lys Glu Ser 595 600 605CTG ATT GGG GAA GAT CTG AAA AGA GCA ATG GCG CCT TGC TTC ACT TCG 1872Leu Ile Gly Glu Asp Leu Lys Arg Ala Met Ala Pro Cys Phe Thr Ser 610 615 620GCT TTG CAT TTG ACT TCT CAA GAA GTT GCG TAT GAC CTG CTG TTG TGG 1920Ala Leu His Leu Thr Ser Gln Glu Val Ala Tyr Asp Leu Leu Leu Trp625 630 635 640ATA GAC CAG ATT CAA CCG GCA CAA ATA ACT GTT GAT GGG TTT TGG GAA 1968Ile Asp Gln Ile Gln Pro Ala Gln Ile Thr Val Asp Gly Phe Trp Glu 645 650 655GAA GTG CAA ACA ACA CCA ACC AGC TTG AAG GTG ATT ACC TTT GCT CAG 2016Glu Val Gln Thr Thr Pro Thr Ser Leu Lys Val Ile Thr Phe Ala Gln 660 665 670GTG CTG GCA CAA TTG AGC CTG ATC TAT CGT CGT ATT GGG TTA AGT GAA 2064Val Leu Ala Gln Leu Ser Leu Ile Tyr Arg Arg Ile Gly Leu Ser Glu 675 680 685ACG GAA CTG TCA CTG ATC GTG ACT CAA TCT TCT CTG CTA GTG GCA GGC 2112Thr Glu Leu Ser Leu Ile Val Thr Gln Ser Ser Leu Leu Val Ala Gly 690 695 700AAA AGC ATA CTG GAT CAC GGT CTG TTA ACC CTG ATG GCC TTG GAA GGT 2160Lys Ser Ile Leu Asp His Gly Leu Leu Thr Leu Met Ala Leu Glu Gly705 710 715 720TTT CAT ACC TGG GTT AAT GGC TTG GGG CAA CAT GCC TCC TTG ATA TTG 2208Phe His Thr Trp Val Asn Gly Leu Gly Gln His Ala Ser Leu Ile Leu 725 730 735GCG GCG TTG AAA GAC GGA GCC TTG ACA GTT ACC GAT GTA GCA CAA GCT 2256Ala Ala Leu Lys Asp Gly Ala Leu Thr Val Thr Asp Val Ala Gln Ala 740 745 750ATG AAT AAG GAG GAA TCT CTC CTA CAA ATG GCA GCT AAT CAG GTG GAG 2304Met Asn Lys Glu Glu Ser Leu Leu Gln Met Ala Ala Asn Gln Val Glu 755 760 765AAG GAT CTA ACA AAA CTG ACC AGT TGG ACA CAG ATT GAC GCT ATT CTG 2352Lys Asp Leu Thr Lys Leu Thr Ser Trp Thr Gln Ile Asp Ala Ile Leu 770 775 780CAA TGG TTA CAG ATG TCT TCG GCC TTG GCG GTT TCT CCA CTG GAT CTG 2400Gln Trp Leu Gln Met Ser Ser Ala Leu Ala Val Ser Pro Leu Asp Leu785 790 795 800GCA GGG ATG ATG GCC CTG AAA TAT GGG ATA GAT CAT AAC TAT GCT GCC 2448Ala Gly Met Met Ala Leu Lys Tyr Gly Ile Asp His Asn Tyr Ala Ala 805 810 815TGG CAA GCT GCG GCG GCT GCG CTG ATG GCT GAT CAT GCT AAT CAG GCA 2496Trp Gln Ala Ala Ala Ala Ala Leu Met Ala Asp His Ala Asn Gln Ala 820 825 830CAG AAA AAA CTG GAT GAG ACG TTC AGT AAG GCA TTA TGT AAC TAT TAT 2544Gln Lys Lys Leu Asp Glu Thr Phe Ser Lys Ala Leu Cys Asn Tyr Tyr 835 840 845ATT AAT GCT GTT GTC GAT AGT GCT GCT GGA GTA CGT GAT CGT AAC GGT 2592Ile Asn Ala Val Val Asp Ser Ala Ala Gly Val Arg Asp Arg Asn Gly 850 855 860TTA TAT ACC TAT TTG CTG ATT GAT AAT CAG GTT TCT GCC GAT GTG ATC 2640Leu Tyr Thr Tyr Leu Leu Ile Asp Asn Gln Val Ser Ala Asp Val Ile865 870 875 880ACT TCA CGT ATT GCA GAA GCT ATC GCC GGT ATT CAA CTG TAC GTT AAC 2688Thr Ser Arg Ile Ala Glu Ala Ile Ala Gly Ile Gln Leu Tyr Val Asn 885 890 895CGG GCT TTA AAC CGA GAT GAA GGT CAG CTT GCA TCG GAC GTT AGT ACC 2736Arg Ala Leu Asn Arg Asp Glu Gly Gln Leu Ala Ser Asp Val Ser Thr 900 905 910CGT CAG TTC TTC ACT GAC TGG GAA CGT TAC AAT AAA CGT TAC AGT ACT 2784Arg Gln Phe Phe Thr Asp Trp Glu Arg Tyr Asn Lys Arg Tyr Ser Thr 915 920 925TGG GCT GGT GTC TCT GAA CTG GTC TAT TAT CCA GAA AAC TAT GTT GAT 2832Trp Ala Gly Val Ser Glu Leu Val Tyr Tyr Pro Glu Asn Tyr Val Asp 930 935 940CCC ACT CAG CGC ATT GGG CAA ACC AAA ATG ATG GAT GCG CTG TTG CAA 2880Pro Thr Gln Arg Ile Gly Gln Thr Lys Met Met Asp Ala Leu Leu Gln945 950 955 960TCC ATC AAC CAG AGC CAG CTA AAT GCG GAT ACG GTG GAA GAT GCT TTC 2928Ser Ile Asn Gln Ser Gln Leu Asn Ala Asp Thr Val Glu Asp Ala Phe 965 970 975AAA ACT TAT TTG ACC AGC TTT GAG CAG GTA GCA AAT CTG AAA GTA ATT 2976Lys Thr Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn Leu Lys Val Ile 980 985 990AGT GCT TAC CAC GAT AAT GTG AAT GTG GAT CAA GGA TTA ACT TAT TTT 3024Ser Ala Tyr His Asp Asn Val Asn Val Asp Gln Gly Leu Thr Tyr Phe 995 1000 1005ATC GGT ATC GAC CAA GCA GCT CCG GGT ACG TAT TAC TGG CGT AGT GTT 3072Ile Gly Ile Asp Gln Ala Ala Pro Gly Thr Tyr Tyr Trp Arg Ser Val 1010 1015 1020GAT CAC AGC AAA TGT GAA AAT GGC AAG TTT GCC GCT AAT GCT TGG GGT 3120Asp His Ser Lys Cys Glu Asn Gly Lys Phe Ala Ala Asn Ala Trp Gly1025 1030 1035 1040GAG TGG AAT AAA ATT ACC TGT GCT GTC AAT CCT TGG AAA AAT ATC ATC 3168Glu Trp Asn Lys Ile Thr Cys Ala Val Asn Pro Trp Lys Asn Ile Ile 1045 1050 1055CGT CCG GTT GTT TAT ATG TCC CGC TTA TAT CTG CTA TGG CTG GAG CAG 3216Arg Pro Val Val Tyr Met Ser Arg Leu Tyr Leu Leu Trp Leu Glu Gln 1060 1065 1070CAA TCA AAG AAA AGT GAT GAT GGT AAA ACC ACG ATT TAT CAA TAT AAC 3264Gln Ser Lys Lys Ser Asp Asp Gly Lys Thr Thr Ile Tyr Gln Tyr Asn 1075 1080 1085TTA AAA CTG GCT CAT ATT CGT TAC GAC GGT AGT TGG AAT ACA CCA TTT 3312Leu Lys Leu Ala His Ile Arg Tyr Asp Gly Ser Trp Asn Thr Pro Phe 1090 1095 1100ACT TTT GAT GTG ACA GAA AAG GTA AAA AAT TAC ACG TCG AGT ACT GAT 3360Thr Phe Asp Val Thr Glu Lys Val Lys Asn Tyr Thr Ser Ser Thr Asp1105 1110 1115 1120GCT GCT GAA TCT TTA GGG TTG TAT TGT ACT GGT TAT CAA GGG GAA GAC 3408Ala Ala Glu Ser Leu Gly Leu Tyr Cys Thr Gly Tyr Gln Gly Glu Asp 1125 1130 1135ACT CTA TTA GTT ATG TTC TAT TCG ATG CAG AGT AGT TAT AGC TCC TAT 3456Thr Leu Leu Val Met Phe Tyr Ser Met Gln Ser Ser Tyr Ser Ser Tyr 1140 1145 1150ACC GAT AAT AAT GCG CCG GTC ACT GGG CTA TAT ATT TTC GCT GAT ATG 3504Thr Asp Asn Asn Ala Pro Val Thr Gly Leu Tyr Ile Phe Ala Asp Met 1155 1160 1165TCA TCA GAC AAT ATG ACG AAT GCA CAA GCA ACT AAC TAT TGG AAT AAC 3552Ser Ser Asp Asn Met Thr Asn Ala Gln Ala Thr Asn Tyr Trp Asn Asn 1170 1175 1180AGT TAT CCG CAA TTT GAT ACT GTG ATG GCA GAT CCG GAT AGC GAC AAT 3600Ser Tyr Pro Gln Phe Asp Thr Val Met Ala Asp Pro Asp Ser Asp Asn1185 1190 1195 1200AAA AAA GTC ATA ACC AGA AGA GTT AAT AAC CGT TAT GCG GAG GAT TAT 3648Lys Lys Val Ile Thr Arg Arg Val Asn Asn Arg Tyr Ala Glu Asp Tyr 1205 1210 1215GAA ATT CCT TCC TCT GTG ACA AGT AAC AGT AAT TAT TCT TGG GGT GAT 3696Glu Ile Pro Ser Ser Val Thr Ser Asn Ser Asn Tyr Ser Trp Gly Asp 1220 1225 1230CAC AGT TTA ACC ATG CTT TAT GGT GGT AGT GTT CCT AAT ATT ACT TTT 3744His Ser Leu Thr Met Leu Tyr Gly Gly Ser Val Pro Asn Ile Thr Phe 1235 1240 1245GAA TCG GCG GCA GAA GAT TTA AGG CTA TCT ACC AAT ATG GCA TTG AGT 3792Glu Ser Ala Ala Glu Asp Leu Arg Leu Ser Thr Asn Met Ala Leu Ser 1250 1255 1260ATT ATT CAT AAT GGA TAT GCG GGA ACC CGC CGT ATA CAA TGT AAT CTT 3840Ile Ile His Asn Gly Tyr Ala Gly Thr Arg Arg Ile Gln Cys Asn Leu1265 1270 1275 1280ATG AAA CAA TAC GCT TCA TTA GGT GAT AAA TTT ATA ATT TAT GAT TCA 3888Met Lys Gln Tyr Ala Ser Leu Gly Asp Lys Phe Ile Ile Tyr Asp Ser 1285 1290 1295TCA TTT GAT GAT GCA AAC CGT TTT AAT CTG GTG CCA TTG TTT AAA TTC 3936Ser Phe Asp Asp Ala Asn Arg Phe Asn Leu Val Pro Leu Phe Lys Phe 1300 1305 1310GGA AAA GAC GAG AAC TCA GAT GAT AGT ATT TGT ATA TAT AAT GAA AAC 3984Gly Lys Asp Glu Asn Ser Asp Asp Ser Ile Cys Ile Tyr Asn Glu Asn 1315 1320 1325CCT TCC TCT GAA GAT AAG AAG TGG TAT TTT TCT TCG AAA GAT GAC AAT 4032Pro Ser Ser Glu Asp Lys Lys Trp Tyr Phe Ser Ser Lys Asp Asp Asn 1330 1335 1340AAA ACA GCG GAT TAT AAT GGT GGA ACT CAA TGT ATA GAT GCT GGA ACC 4080Lys Thr Ala Asp Tyr Asn Gly Gly Thr Gln Cys Ile Asp Ala Gly Thr1345 1350 1355 1360AGT AAC AAA GAT TTT TAT TAT AAT CTC CAG GAG ATT GAA GTA ATT AGT 4128Ser Asn Lys Asp Phe Tyr Tyr Asn Leu Gln Glu Ile Glu Val Ile Ser 1365 1370 1375GTT ACT GGT GGG TAT TGG TCG AGT TAT AAA ATA TCC AAC CCG ATT AAT 4176Val Thr Gly Gly Tyr Trp Ser Ser Tyr Lys Ile Ser Asn Pro Ile Asn 1380 1385 1390ATC AAT ACG GGC ATT GAT AGT GCT AAA GTA AAA GTC ACC GTA AAA GCG 4224Ile Asn Thr Gly Ile Asp Ser Ala Lys Val Lys Val Thr Val Lys Ala 1395 1400 1405GGT GGT GAC GAT CAA ATC TTT ACT GCT GAT AAT AGT ACC TAT GTT CCT 4272Gly Gly Asp Asp Gln Ile Phe Thr Ala Asp Asn Ser Thr Tyr Val Pro 1410 1415 1420CAG CAA CCG GCA CCC AGT TTT GAG GAG ATG ATT TAT CAG TTC AAT AAC 4320Gln Gln Pro Ala Pro Ser Phe Glu Glu Met Ile Tyr Gln Phe Asn Asn1425 1430 1435 1440CTG ACA ATA GAT TGT AAG AAT TTA AAT TTC ATC GAC AAT CAG GCA CAT 4368Leu Thr Ile Asp Cys Lys Asn Leu Asn Phe Ile Asp Asn Gln Ala His 1445 1450 1455ATT GAG ATT GAT TTC ACC GCT ACG GCA CAA GAT GGC CGA TTC TTG GGT 4416Ile Glu Ile Asp Phe Thr Ala Thr Ala Gln Asp Gly Arg Phe Leu Gly 1460 1465 1470GCA GAA ACT TTT ATT ATC CCG GTA ACT AAA AAA GTT CTC GGT ACT GAG 4464Ala Glu Thr Phe Ile Ile Pro Val Thr Lys Lys Val Leu Gly Thr Glu 1475 1480 1485AAC GTG ATT GCG TTA TAT AGC GAA AAT AAC GGT GTT CAA TAT ATG CAA 4512Asn Val Ile Ala Leu Tyr Ser Glu Asn Asn Gly Val Gln Tyr Met Gln 1490 1495 1500ATT GGC GCA TAT CGT ACC CGT TTG AAT ACG TTA TTC GCT CAA CAG TTG 4560Ile Gly Ala Tyr Arg Thr Arg Leu Asn Thr Leu Phe Ala Gln Gln Leu1505 1510 1515 1520GTT AGC CGT GCT AAT CGT GGC ATT GAT GCA GTG CTC AGT ATG GAA ACT 4608Val Ser Arg Ala Asn Arg Gly Ile Asp Ala Val Leu Ser Met Glu Thr 1525 1530 1535CAG AAT ATT CAG GAA CCG CAA TTA GGA GCG GGC ACA TAT GTG CAG CTT 4656Gln Asn Ile Gln Glu Pro Gln Leu Gly Ala Gly Thr Tyr Val Gln Leu 1540 1545 1550GTG TTG GAT AAA TAT GAT GAG TCT ATT CAT GGC ACT AAT AAA AGC TTT 4704Val Leu Asp Lys Tyr Asp Glu Ser Ile His Gly Thr Asn Lys Ser Phe 1555 1560 1565GCT ATT GAA TAT GTT GAT ATA TTT AAA GAG AAC GAT AGT TTT GTG ATT 4752Ala Ile Glu Tyr Val Asp Ile Phe Lys Glu Asn Asp Ser Phe Val Ile 1570 1575 1580TAT CAA GGA GAA CTT AGC GAA ACA AGT CAA ACT GTT GTG AAA GTT TTC 4800Tyr Gln Gly Glu Leu Ser Glu Thr Ser Gln Thr Val Val Lys Val Phe1585 1590 1595 1600TTA TCC TAT TTT ATA GAG GCG ACT GGA AAT AAG AAC CAC TTA TGG GTA 4848Leu Ser Tyr Phe Ile Glu Ala Thr Gly Asn Lys Asn His Leu Trp Val 1605 1610 1615CGT GCT AAA TAC CAA AAG GAA ACG ACT GAT AAG ATC TTG TTC GAC CGT 4896Arg Ala Lys Tyr Gln Lys Glu Thr Thr Asp Lys Ile Leu Phe Asp Arg 1620 1625 1630ACT GAT GAG AAA GAT CCG CAC GGT TGG TTT CTC AGC GAC GAT CAC AAG 4944Thr Asp Glu Lys Asp Pro His Gly Trp Phe Leu Ser Asp Asp His Lys 1635 1640 1645ACC TTT AGT GGT CTC TCT TCC GCA CAG GCA TTA AAG AAC GAC AGT GAA 4992Thr Phe Ser Gly Leu Ser Ser Ala Gln Ala Leu Lys Asn Asp Ser Glu 1650 1655 1660CCG ATG GAT TTC TCT GGC GCC AAT GCT CTC TAT TTC TGG GAA CTG TTC 5040Pro Met Asp Phe Ser Gly Ala Asn Ala Leu Tyr Phe Trp Glu Leu Phe1665 1670 1675 1680TAT TAC ACG CCG ATG ATG ATG GCT CAT CGT TTG TTG CAG GAA CAG AAT 5088Tyr Tyr Thr Pro Met Met Met Ala His Arg Leu Leu Gln Glu Gln Asn 1685 1690 1695TTT GAT GCG GCG AAC CAT TGG TTC CGT TAT GTC TGG AGT CCA TCC GGT 5136Phe Asp Ala Ala Asn His Trp Phe Arg Tyr Val Trp Ser Pro Ser Gly 1700 1705 1710TAT ATC GTT GAT GGT AAA ATT GCT ATC TAC CAC TGG AAC GTG CGA CCG 5184Tyr Ile Val Asp Gly Lys Ile Ala Ile Tyr His Trp Asn Val Arg Pro 1715 1720 1725CTG GAA GAA GAC ACC AGT TGG AAT GCA CAA CAA CTG GAC TCC ACC GAT 5232Leu Glu Glu Asp Thr Ser Trp Asn Ala Gln Gln Leu Asp Ser Thr Asp 1730 1735 1740CCA GAT GCT GTA GCC CAA GAT GAT CCG ATG CAC TAC AAG GTG GCT ACC 5280Pro Asp Ala Val Ala Gln Asp Asp Pro Met His Tyr Lys Val Ala Thr1745 1750 1755 1760TTT ATG GCG ACG TTG GAT CTG CTA ATG GCC CGT GGT GAT GCT GCT TAC 5328Phe Met Ala Thr Leu Asp Leu Leu Met Ala Arg Gly Asp Ala Ala Tyr 1765 1770 1775CGC CAG TTA GAG CGT GAT ACG TTG GCT GAA GCT AAA ATG TGG TAT ACA 5376Arg Gln Leu Glu Arg Asp Thr Leu Ala Glu Ala Lys Met Trp Tyr Thr 1780 1785 1790CAG GCG CTT AAT CTG TTG GGT GAT GAG CCA CAA GTG ATG CTG AGT ACG 5424Gln Ala Leu Asn Leu Leu Gly Asp Glu Pro Gln Val Met Leu Ser Thr 1795 1800 1805ACT TGG GCT AAT CCA ACA TTG GGT AAT GCT GCT TCA AAA ACC ACA CAG 5472Thr Trp Ala Asn Pro Thr Leu Gly Asn Ala Ala Ser Lys Thr Thr Gln 1810 1815 1820CAG GTT CGT CAG CAA GTG CTT ACC CAG TTG CGT CTC AAT AGC AGG GTA 5520Gln Val Arg Gln Gln Val Leu Thr Gln Leu Arg Leu Asn Ser Arg Val1825 1830 1835 1840AAA ACC CCG TTG 5532Lys Thr Pro Leu 1844 1844 amino acids amino acids linear protein 53Phe Ile Gln Gly Tyr Ser Asp Leu Phe Gly Asn Arg Ala Asp Asn Tyr1 5 10 15Ala Ala Pro Gly Ser Val Ala Ser Met Phe Ser Pro Ala Ala Tyr Leu 20 25 30Thr Glu Leu Tyr Arg Glu Ala Lys Asn Leu His Asp Ser Ser Ser Ile 35 40 45Tyr Tyr Leu Asp Lys Arg Arg Pro Asp Leu Ala Ser Leu Met Leu Ser 50 55 60Gln Lys Asn Met Asp Glu Glu Ile Ser Thr Leu Ala Leu Ser Asn Glu65 70 75 80Leu Cys Leu Ala Gly Ile Glu Thr Lys Thr Gly Lys Ser Gln Asp Glu 85 90 95Val Met Asp Met Leu Ser Thr Tyr Arg Leu Ser Gly Glu Thr Pro Tyr 100 105 110His His Ala Tyr Glu Thr Val Arg Glu Ile Val His Glu Arg Asp Pro 115 120 125Gly Phe Arg His Leu Ser Gln Ala Pro Ile Val Ala Ala Lys Leu Asp 130 135 140Pro Val Thr Leu Leu Gly Ile Ser Ser His Ile Ser Pro Glu Leu Tyr145 150 155 160Asn Leu Leu Ile Glu Glu Ile Pro Glu Lys Asp Glu Ala Ala Leu Asp 165 170 175Thr Leu Tyr Lys Thr Asn Phe Gly Asp Ile Thr Thr Ala Gln Leu Met 180 185 190Ser Pro Ser Tyr Leu Ala Arg Tyr Tyr Gly Val Ser Pro Glu Asp Ile 195 200 205Ala Tyr Val Thr Thr Ser Leu Ser His Val Gly Tyr Ser Ser Asp Ile 210 215 220Leu Val Ile Pro Leu Val Asp Gly Val Gly Lys Met Glu Val Val Arg225 230 235 240Val Thr Arg Thr Pro Ser Asp Asn Tyr Thr Ser Gln Thr Asn Tyr Ile 245 250 255Glu Leu Tyr Pro Gln Gly Gly Asp Asn Tyr Leu Ile Lys Tyr Asn Leu 260 265 270Ser Asn Ser Phe Gly Leu Asp Asp Phe Tyr Leu Gln Tyr Lys Asp Gly 275 280 285Ser Ala Asp Trp Thr Glu Ile Ala His Asn Pro Tyr Pro Asp Met Val 290 295 300Ile Asn Gln Lys Tyr Glu Ser Gln Ala Thr Ile Lys Arg Ser Asp Ser305 310 315 320Asp Asn Ile Leu Ser Ile Gly Leu Gln Arg Trp His Ser Gly Ser Tyr 325 330 335Asn Phe Ala Ala Ala Asn Phe Lys Ile Asp Gln Tyr Ser Pro Lys Ala 340 345 350Phe Leu Leu Lys Met Asn Lys Ala Ile Arg Leu Leu Lys Ala Thr Gly 355 360 365Leu Ser Phe Ala Thr Leu Glu Arg Ile Val Asp Ser Val Asn Ser Thr 370 375 380Lys Ser Ile Thr Val Glu Val Leu Asn Lys Val Tyr Arg Val Lys Phe385 390 395 400Tyr Ile Asp Arg Tyr Gly Ile Ser Glu Glu Thr Ala Ala Ile Leu Ala 405 410 415Asn Ile Asn Ile Ser Gln Gln Ala Val Gly Asn Gln Leu Ser Gln Phe 420 425 430Glu Gln Leu Phe Asn His Pro Pro Leu Asn Gly Ile Arg Tyr Glu Ile 435 440 445Ser Glu Asp Asn Ser Lys His Leu Pro Asn Pro Asp Leu Asn Leu Lys 450 455 460Pro Asp Ser Thr Gly Asp Asp Gln Arg Lys Ala Val Leu Lys Arg Ala465 470 475 480Phe Gln Val Asn Ala Ser Glu Leu Tyr Gln Met Leu Leu Ile Thr Asp 485 490 495Arg Lys Glu Asp Gly Val Ile Lys Asn Asn Leu Glu Asn Leu Ser Asp 500 505 510Leu Tyr Leu Val Ser Leu Leu Ala Gln Ile His Asn Leu Thr Ile Ala 515 520 525Glu Leu Asn Ile Leu Leu Val Ile Cys Gly Tyr Gly Asp Thr Asn Ile 530 535 540Tyr Gln Ile Thr Asp Asp Asn Leu Ala Lys Ile Val Glu Thr Leu Leu545 550 555 560Trp Ile Thr Gln Trp Leu Lys Thr Gln Lys Trp Thr Val Thr Asp Leu 565 570 575Phe Leu Met Thr Thr Ala Thr Tyr Ser Thr Thr Leu Thr Pro Glu Ile 580 585 590Ser Asn Leu Thr Ala Thr Leu Ser Ser Thr Leu His Gly Lys Glu Ser 595 600 605Leu Ile Gly Glu Asp Leu Lys Arg Ala Met Ala Pro Cys Phe Thr Ser 610 615 620Ala Leu His Leu Thr Ser Gln Glu Val Ala Tyr Asp Leu Leu Leu Trp625 630 635 640Ile Asp Gln Ile Gln Pro Ala Gln Ile Thr Val Asp Gly Phe Trp Glu 645 650 655Glu Val Gln Thr Thr Pro Thr Ser Leu Lys Val Ile Thr Phe Ala Gln 660 665 670Val Leu Ala Gln Leu Ser Leu Ile Tyr Arg Arg Ile Gly Leu Ser Glu 675 680 685Thr Glu Leu Ser Leu Ile Val Thr Gln Ser Ser Leu Leu Val Ala Gly 690 695 700Lys Ser Ile Leu Asp His Gly Leu Leu Thr Leu Met Ala Leu Glu Gly705 710 715 720Phe His Thr Trp Val Asn Gly Leu Gly Gln His Ala Ser Leu Ile Leu 725 730 735Ala Ala Leu Lys Asp Gly Ala Leu Thr Val Thr Asp Val Ala Gln Ala 740 745 750Met Asn Lys Glu Glu Ser Leu Leu Gln Met Ala Ala Asn Gln Val Glu 755 760 765Lys Asp Leu Thr Lys Leu Thr Ser Trp Thr Gln Ile Asp Ala Ile Leu 770 775 780Gln Trp Leu Gln Met Ser Ser Ala Leu Ala Val Ser Pro Leu Asp Leu785 790 795 800Ala Gly Met Met Ala Leu Lys Tyr Gly Ile Asp His Asn Tyr Ala Ala 805 810 815Trp Gln Ala Ala Ala Ala Ala Leu Met Ala Asp His Ala Asn Gln Ala 820 825 830Gln Lys Lys Leu Asp Glu Thr Phe Ser Lys Ala Leu Cys Asn Tyr Tyr 835 840 845Ile Asn Ala Val Val Asp Ser Ala Ala Gly Val Arg Asp Arg Asn Gly 850 855 860Leu Tyr Thr Tyr Leu Leu Ile Asp Asn Gln Val Ser Ala Asp Val Ile865 870 875 880Thr Ser Arg Ile Ala Glu Ala Ile Ala Gly Ile Gln Leu Tyr Val Asn 885 890 895Arg Ala Leu Asn Arg Asp Glu Gly Gln Leu Ala Ser Asp Val Ser Thr 900 905 910Arg Gln Phe Phe Thr Asp Trp Glu Arg Tyr Asn Lys Arg Tyr Ser Thr 915 920 925Trp Ala Gly Val Ser Glu Leu Val Tyr Tyr Pro Glu Asn Tyr Val Asp 930 935 940Pro Thr Gln Arg Ile Gly Gln Thr Lys Met Met Asp Ala Leu Leu Gln945 950 955 960Ser Ile Asn Gln Ser Gln Leu Asn Ala Asp Thr Val Glu Asp Ala Phe 965 970 975Lys Thr Tyr Leu Thr Ser Phe Glu Gln Val Ala Asn Leu Lys Val Ile 980 985 990Ser Ala Tyr His Asp Asn Val Asn Val Asp Gln Gly Leu Thr Tyr Phe 995 1000 1005Ile Gly Ile Asp Gln Ala Ala Pro Gly Thr Tyr Tyr Trp Arg Ser Val 1010 1015 1020Asp His Ser Lys Cys Glu Asn Gly Lys Phe Ala Ala Asn Ala Trp Gly1025 1030 1035 1040Glu Trp Asn Lys Ile Thr Cys Ala Val Asn Pro Trp Lys Asn Ile Ile 1045 1050 1055Arg Pro Val Val Tyr Met Ser Arg Leu Tyr Leu Leu Trp Leu Glu Gln 1060 1065 1070Gln Ser Lys Lys Ser Asp Asp Gly Lys Thr Thr Ile Tyr Gln Tyr Asn 1075 1080 1085Leu Lys Leu Ala His Ile Arg Tyr Asp Gly Ser Trp Asn Thr Pro Phe 1090 1095 1100Thr Phe Asp Val Thr Glu Lys Val Lys Asn Tyr Thr Ser Ser Thr Asp1105 1110 1115 1120Ala Ala Glu Ser Leu Gly Leu Tyr Cys Thr Gly Tyr Gln Gly Glu Asp 1125 1130 1135Thr Leu Leu Val Met Phe Tyr Ser Met Gln Ser Ser Tyr Ser Ser Tyr 1140 1145 1150Thr Asp Asn Asn Ala Pro Val Thr Gly Leu Tyr Ile Phe Ala Asp Met 1155 1160 1165Ser Ser Asp Asn Met Thr Asn Ala Gln Ala Thr Asn Tyr Trp Asn Asn 1170 1175 1180Ser Tyr Pro Gln Phe Asp Thr Val Met Ala Asp Pro Asp Ser Asp Asn1185 1190 1195 1200Lys Lys Val Ile Thr Arg Arg Val Asn Asn Arg Tyr Ala Glu Asp Tyr 1205 1210 1215Glu Ile Pro Ser Ser Val Thr Ser Asn Ser Asn Tyr Ser Trp Gly Asp 1220 1225 1230His Ser Leu Thr Met Leu Tyr Gly Gly Ser Val Pro Asn Ile Thr Phe 1235 1240 1245Glu Ser Ala Ala Glu Asp Leu Arg Leu Ser Thr Asn Met Ala Leu Ser 1250 1255 1260Ile Ile His Asn Gly Tyr Ala Gly Thr Arg Arg Ile Gln Cys Asn Leu1265 1270 1275 1280Met Lys Gln Tyr Ala Ser Leu Gly Asp Lys Phe Ile Ile Tyr Asp Ser 1285 1290 1295Ser Phe Asp Asp Ala Asn Arg Phe Asn Leu Val Pro Leu Phe Lys Phe 1300 1305 1310Gly Lys Asp Glu Asn Ser Asp Asp Ser Ile Cys Ile Tyr Asn Glu Asn 1315 1320 1325Pro Ser Ser Glu Asp Lys Lys Trp Tyr Phe Ser Ser Lys Asp Asp Asn 1330 1335 1340Lys Thr Ala Asp Tyr Asn Gly Gly Thr Gln Cys Ile Asp Ala Gly Thr1345 1350 1355 1360Ser Asn Lys Asp Phe Tyr Tyr Asn Leu Gln Glu Ile Glu Val Ile Ser 1365 1370 1375Val Thr Gly Gly Tyr Trp Ser Ser Tyr Lys Ile Ser Asn Pro Ile Asn 1380 1385 1390Ile Asn Thr Gly Ile Asp Ser Ala Lys Val Lys Val Thr Val Lys Ala 1395 1400 1405Gly Gly Asp Asp Gln Ile Phe Thr Ala Asp Asn Ser Thr Tyr Val Pro 1410 1415 1420Gln Gln Pro Ala Pro Ser Phe Glu Glu Met Ile Tyr Gln Phe Asn Asn1425 1430 1435 1440Leu Thr Ile Asp Cys Lys Asn Leu Asn Phe Ile Asp Asn Gln Ala His 1445 1450 1455Ile Glu Ile Asp Phe Thr Ala Thr Ala Gln Asp Gly Arg Phe Leu Gly 1460 1465 1470Ala Glu Thr Phe Ile Ile Pro Val Thr Lys Lys Val Leu Gly Thr Glu 1475 1480 1485Asn Val Ile Ala Leu Tyr Ser Glu Asn Asn Gly Val Gln Tyr Met Gln 1490 1495 1500Ile Gly Ala Tyr Arg Thr Arg Leu Asn Thr Leu Phe Ala Gln Gln Leu1505 1510 1515 1520Val Ser Arg Ala Asn Arg Gly Ile Asp Ala Val Leu Ser Met Glu Thr 1525 1530 1535Gln Asn Ile Gln Glu Pro Gln Leu Gly Ala Gly Thr Tyr Val Gln Leu 1540 1545 1550Val Leu Asp Lys Tyr Asp Glu Ser Ile His Gly Thr Asn Lys Ser Phe 1555 1560 1565Ala Ile Glu Tyr Val Asp Ile Phe Lys Glu Asn Asp Ser Phe Val Ile 1570 1575 1580Tyr Gln Gly Glu Leu Ser Glu Thr Ser Gln Thr Val Val Lys Val Phe1585 1590 1595 1600Leu Ser Tyr Phe Ile Glu Ala Thr Gly Asn Lys Asn His Leu Trp Val 1605 1610 1615Arg Ala Lys Tyr Gln Lys Glu Thr Thr Asp Lys Ile Leu Phe Asp Arg 1620 1625 1630Thr Asp Glu Lys Asp Pro His Gly Trp Phe Leu Ser Asp Asp His Lys 1635 1640 1645Thr Phe Ser Gly Leu Ser Ser Ala Gln Ala Leu Lys Asn Asp Ser Glu 1650 1655 1660Pro Met Asp Phe Ser Gly Ala Asn Ala Leu Tyr Phe Trp Glu Leu Phe1665 1670 1675 1680Tyr Tyr Thr Pro Met Met Met Ala His Arg Leu Leu Gln Glu Gln Asn 1685 1690 1695Phe Asp Ala Ala Asn His Trp Phe Arg Tyr Val Trp Ser Pro Ser Gly 1700 1705 1710Tyr Ile Val Asp Gly Lys Ile Ala Ile Tyr His Trp Asn Val Arg Pro 1715 1720 1725Leu Glu Glu Asp Thr Ser Trp Asn Ala Gln Gln Leu Asp Ser Thr Asp 1730 1735 1740Pro Asp Ala Val Ala Gln Asp Asp Pro Met His Tyr Lys Val Ala Thr1745 1750 1755 1760Phe Met Ala Thr Leu Asp Leu Leu Met Ala Arg Gly Asp Ala Ala Tyr 1765 1770 1775Arg Gln Leu Glu Arg Asp Thr Leu Ala Glu Ala Lys Met Trp Tyr Thr 1780 1785 1790Gln Ala Leu Asn Leu Leu Gly Asp Glu Pro Gln Val Met Leu Ser Thr 1795 1800 1805Thr Trp Ala Asn Pro Thr Leu Gly Asn Ala Ala Ser Lys Thr Thr Gln 1810 1815 1820Gln Val Arg Gln Gln Val Leu Thr Gln Leu Arg Leu Asn Ser Arg Val1825 1830 1835 1840Lys Thr Pro Leu 1722 base pairs nucleic acid double linear DNA (genomic) 54CTA GGA ACA GCC AAT TCC CTG ACC GCT TTA TTC CTG CCG CAG GAA AAT 48Leu Gly Thr Ala Asn Ser Leu Thr Ala Leu Phe Leu Pro Gln Glu Asn1 5 10 15AGC AAG CTC AAA GGC TAC TGG CGG ACA CTG GCG CAG CGT ATG TTT AAT 96Ser Lys Leu Lys Gly Tyr Trp Arg Thr Leu Ala Gln Arg Met Phe Asn 20 25 30TTA CGT CAT AAT CTG TCG ATT GAC GGC CAG CCG CTC TCC TTG CCG CTG 144Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Ser Leu Pro Leu 35 40 45TAT GCT AAA CCG GCT GAT CCA AAA GCT TTA CTG AGT GCG GCG GTT TCA 192Tyr Ala Lys Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala Ala Val Ser 50 55 60GCT TCT CAA GGG GGA GCC GAC TTG CCG AAG GCG CCG CTG ACT ATT CAC 240Ala Ser Gln Gly Gly Ala Asp Leu Pro Lys Ala Pro Leu Thr Ile His65 70 75 80CGC TTC CCT CAA ATG CTA GAA GGG GCA CGG GGC TTG GTT AAC CAG CTT 288Arg Phe Pro Gln Met Leu Glu Gly Ala Arg Gly Leu Val Asn Gln Leu 85 90 95ATA CAG TTC GGT AGT TCA CTA TTG GGG TAC AGT GAG CGT CAG GAT GCG 336Ile Gln Phe Gly Ser Ser Leu Leu Gly Tyr Ser Glu Arg Gln Asp Ala 100 105 110GAA GCT ATG AGT CAA CTA CTG CAA ACC CAA GCC AGC GAG TTA ATA CTG 384Glu Ala Met Ser Gln Leu Leu Gln Thr Gln Ala Ser Glu Leu Ile Leu 115 120 125ACC AGT ATT CGT ATG CAG GAT AAC CAA TTG GCA GAG CTG GAT TCG GAA 432Thr Ser Ile Arg Met Gln Asp Asn Gln Leu Ala Glu Leu Asp Ser Glu 130 135 140AAA ACC GCC TTG CAA GTC TCT TTA GCT GGA GTG CAA CAA CGG TTT GAC 480Lys Thr Ala Leu Gln Val Ser Leu Ala Gly Val Gln Gln Arg Phe Asp145 150 155 160AGC TAT AGC CAA CTG TAT GAG GAG AAC ATC AAC GCA GGT GAG CAG CGA 528Ser Tyr Ser Gln Leu Tyr Glu Glu Asn Ile Asn Ala Gly Glu Gln Arg 165 170 175GCG CTG GCG TTA CGC TCA GAA TCT GCT ATT GAG TCT CAG GGA GCG CAG 576Ala Leu Ala Leu Arg Ser Glu Ser Ala Ile Glu Ser Gln Gly Ala Gln 180 185 190ATT TCC CGT ATG GCA GGC GCG GGT GTT GAT ATG GCA CCA AAT ATC TTC 624Ile Ser Arg Met Ala Gly Ala Gly Val Asp Met Ala Pro Asn Ile Phe 195 200 205GGC CTG GCT GAT GGC GGC ATG CAT TAT GGT GCT ATT GCC TAT GCC ATC 672Gly Leu Ala Asp Gly Gly Met His Tyr Gly Ala Ile Ala Tyr Ala Ile 210 215 220GCT GAC GGT ATT GAG TTG AGT GCT TCT GCC AAG ATG GTT GAT GCG GAG 720Ala Asp Gly Ile Glu Leu Ser Ala Ser Ala Lys Met Val Asp Ala Glu225 230 235 240AAA GTT GCT CAG TCG GAA ATA TAT CGC CGT CGC CGT CAA GAA TGG AAA 768Lys Val Ala Gln Ser Glu Ile Tyr Arg Arg Arg Arg Gln Glu Trp Lys 245 250 255ATT CAG CGT GAC AAC GCA CAA GCG GAG ATT AAC CAG TTA AAC GCG CAA 816Ile Gln Arg Asp Asn Ala Gln Ala Glu Ile Asn Gln Leu Asn Ala Gln 260 265 270CTG GAA TCA CTG TCT ATT CGC CGT GAA GCC GCT GAA ATG CAA AAA GAG 864Leu Glu Ser Leu Ser Ile Arg Arg Glu Ala Ala Glu Met Gln Lys Glu 275 280 285TAC CTG AAA ACC CAG CAA GCT CAG GCG CAG GCA CAA CTT ACT TTC TTA 912Tyr Leu Lys Thr Gln Gln Ala Gln Ala Gln Ala Gln Leu Thr Phe Leu 290 295 300AGA AGC AAA TTC AGT AAT CAA GCG TTA TAT AGT TGG TTA CGA GGG CGT 960Arg Ser Lys Phe Ser Asn Gln Ala Leu Tyr Ser Trp Leu Arg Gly Arg305 310 315 320TTG TCA GGT ATT TAT TTC CAG TTC TAT GAC TTG GCC GTA TCA CGT TGC 1008Leu Ser Gly Ile Tyr Phe Gln Phe Tyr Asp Leu Ala Val Ser Arg Cys 325 330 335CTG ATG GCA GAG CAA TCC TAT CAA TGG GAA GCT AAT GAT AAT TCC ATT 1056Leu Met Ala Glu Gln Ser Tyr Gln Trp Glu Ala Asn Asp Asn Ser Ile 340 345 350AGC TTT GTC AAA CCG GGT GCA TGG CAA GGA ACT TAC GCC GGC TTA TTG 1104Ser Phe Val Lys Pro Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu Leu 355 360 365TGT GGA GAA GCT TTG ATA CAA AAT CTG GCA CAA ATG GAA GAG GCA TAT 1152Cys Gly Glu Ala Leu Ile Gln Asn Leu Ala Gln Met Glu Glu Ala Tyr 370 375 380CTG AAA TGG GAA TCT CGC GCT TTG GAA GTA GAA CGC ACG GTT TCA TTG 1200Leu Lys Trp Glu Ser Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu385 390 395 400GCA GTG GTT TAT GAT TCA CTG GAA GGT AAT GAT CGT TTT AAT TTA GCG 1248Ala Val Val Tyr Asp Ser Leu Glu Gly Asn Asp Arg Phe Asn Leu Ala 405 410 415GAA CAA ATA CCT GCA TTA TTG GAT AAG GGG GAG GGA ACA GCA GGA ACT 1296Glu Gln Ile Pro Ala Leu Leu Asp Lys Gly Glu Gly Thr Ala Gly Thr 420 425 430AAA GAA AAT GGG TTA TCA TTG GCT AAT GCT ATC CTG TCA GCT TCG GTC 1344Lys Glu Asn Gly Leu Ser Leu Ala Asn Ala Ile Leu Ser Ala Ser Val 435 440 445AAA TTG TCC GAC TTG AAA CTG GGA ACG GAT TAT CCA GAC AGT ATC GTT 1392Lys Leu Ser Asp Leu Lys Leu Gly Thr Asp Tyr Pro Asp Ser Ile Val 450 455 460GGT AGC AAC AAG GTT CGT CGT ATT AAG CAA ATC AGT GTT TCG CTA CCT 1440Gly Ser Asn Lys Val Arg Arg Ile Lys Gln Ile Ser Val Ser Leu Pro465 470 475 480GCA TTG GTT GGG CCT TAT CAG GAT GTT CAG GCT ATG CTC AGC TAT GGT 1488Ala Leu Val Gly Pro Tyr Gln Asp Val Gln Ala Met Leu Ser Tyr Gly 485 490 495GGC AGT ACT CAA TTG CCG AAA GGT TGT TCA GCG TTG GCT GTG TCT CAT 1536Gly Ser Thr Gln Leu Pro Lys Gly Cys Ser Ala Leu Ala Val Ser His 500 505 510GGT ACC AAT GAT AGT GGT CAG TTC CAG TTG GAT TTC AAT GAC GGC AAA 1584Gly Thr Asn Asp Ser Gly Gln Phe Gln Leu Asp Phe Asn Asp Gly Lys 515 520 525TAC CTG CCA TTT GAA GGT ATT GCT CTT GAT GAT CAG GGT ACA CTG AAT 1632Tyr Leu Pro Phe Glu Gly Ile Ala Leu Asp Asp Gln Gly Thr Leu Asn 530 535 540CTT CAA TTT CCG AAT GCT ACC GAC AAG CAG AAA GCA ATA TTG CAA ACT 1680Leu Gln Phe Pro Asn Ala Thr Asp Lys Gln Lys Ala Ile Leu Gln Thr545 550 555 560ATG AGC GAT ATT ATT TTG CAT ATT CGT TAT ACC ATC CGT TAA 1722Met Ser Asp Ile Ile Leu His Ile Arg Tyr Thr Ile Arg 565 570 573 573 amino acids amino acids single linear protein 55Leu Gly Thr Ala Asn Ser Leu Thr Ala Leu Phe Leu Pro Gln Glu Asn1 5 10 15Ser Lys Leu Lys Gly Tyr Trp Arg Thr Leu Ala Gln Arg Met Phe Asn 20 25 30Leu Arg His Asn Leu Ser Ile Asp Gly Gln Pro Leu Ser Leu Pro Leu 35 40 45Tyr Ala Lys Pro Ala Asp Pro Lys Ala Leu Leu Ser Ala Ala Val Ser 50 55 60Ala Ser Gln Gly Gly Ala Asp Leu Pro Lys Ala Pro Leu Thr Ile His65 70 75 80Arg Phe Pro Gln Met Leu Glu Gly Ala Arg Gly Leu Val Asn Gln Leu 85 90 95Ile Gln Phe Gly Ser Ser Leu Leu Gly Tyr Ser Glu Arg Gln Asp Ala 100 105 110Glu Ala Met Ser Gln Leu Leu Gln Thr Gln Ala Ser Glu Leu Ile Leu 115 120 125Thr Ser Ile Arg Met Gln Asp Asn Gln Leu Ala Glu Leu Asp Ser Glu 130 135 140Lys Thr Ala Leu Gln Val Ser Leu Ala Gly Val Gln Gln Arg Phe Asp145 150 155 160Ser Tyr Ser Gln Leu Tyr Glu Glu Asn Ile Asn Ala Gly Glu Gln Arg 165 170 175Ala Leu Ala Leu Arg Ser Glu Ser Ala Ile Glu Ser Gln Gly Ala Gln 180 185 190Ile Ser Arg Met Ala Gly Ala Gly Val Asp Met Ala Pro Asn Ile Phe 195 200 205Gly Leu Ala Asp Gly Gly Met His Tyr Gly Ala Ile Ala Tyr Ala Ile 210 215 220Ala Asp Gly Ile Glu Leu Ser Ala Ser Ala Lys Met Val Asp Ala Glu225 230 235 240Lys Val Ala Gln Ser Glu Ile Tyr Arg Arg Arg Arg Gln Glu Trp Lys 245 250 255Ile Gln Arg Asp Asn Ala Gln Ala Glu Ile Asn Gln Leu Asn Ala Gln 260 265 270Leu Glu Ser Leu Ser Ile Arg Arg Glu Ala Ala Glu Met Gln Lys Glu 275 280 285Tyr Leu Lys Thr Gln Gln Ala Gln Ala Gln Ala Gln Leu Thr Phe Leu 290 295 300Arg Ser Lys Phe Ser Asn Gln Ala Leu Tyr Ser Trp Leu Arg Gly Arg305 310 315 320Leu Ser Gly Ile Tyr Phe Gln Phe Tyr Asp Leu Ala Val Ser Arg Cys 325 330 335Leu Met Ala Glu Gln Ser Tyr Gln Trp Glu Ala Asn Asp Asn Ser Ile 340 345 350Ser Phe Val Lys Pro Gly Ala Trp Gln Gly Thr Tyr Ala Gly Leu Leu 355 360 365Cys Gly Glu Ala Leu Ile Gln Asn Leu Ala Gln Met Glu Glu Ala Tyr 370 375 380Leu Lys Trp Glu Ser Arg Ala Leu Glu Val Glu Arg Thr Val Ser Leu385 390 395 400Ala Val Val Tyr Asp Ser Leu Glu Gly Asn Asp Arg Phe Asn Leu Ala 405 410 415Glu Gln Ile Pro Ala Leu Leu Asp Lys Gly Glu Gly Thr Ala Gly Thr 420 425 430Lys Glu Asn Gly Leu Ser Leu Ala Asn Ala Ile Leu Ser Ala Ser Val 435 440 445Lys Leu Ser Asp Leu Lys Leu Gly Thr Asp Tyr Pro Asp Ser Ile Val 450 455 460Gly Ser Asn Lys Val Arg Arg Ile Lys Gln Ile Ser Val Ser Leu Pro465 470 475 480Ala Leu Val Gly Pro Tyr Gln Asp Val Gln Ala Met Leu Ser Tyr Gly 485 490 495Gly Ser Thr Gln Leu Pro Lys Gly Cys Ser Ala Leu Ala Val Ser His 500 505 510Gly Thr Asn Asp Ser Gly Gln Phe Gln Leu Asp Phe Asn Asp Gly Lys 515 520 525Tyr Leu Pro Phe Glu Gly Ile Ala Leu Asp Asp Gln Gly Thr Leu Asn 530 535 540Leu Gln Phe Pro Asn Ala Thr Asp Lys Gln Lys Ala Ile Leu Gln Thr545 550 555 560Met Ser Asp Ile Ile Leu His Ile Arg Tyr Thr Ile Arg 565 570 2994 base pairs nucleic acid double linear DNA (genomic) 56ATG AAT CAA CTC GCC AGT CCC CTG ATT TCC CGC ACC GAA GAG ATC CAC 48Met Asn Gln Leu Ala Ser Pro Leu Ile Ser Arg Thr Glu Glu Ile His1 5 10 15AAC TTA CCC GGT AAA TTG ACC GAT CTT GGT TAT ACC TCA GTG TTT GAT 96Asn Leu Pro Gly Lys Leu Thr Asp Leu Gly Tyr Thr Ser Val Phe Asp 20 25 30GTG GTA CGT ATG CCG CGT GAG CGT TTT ATT CGT GAG CAT CGT GCT GAT 144Val Val Arg Met Pro Arg Glu Arg Phe Ile Arg Glu His Arg Ala Asp 35 40 45CTC GGG CGC AGT GCT GAA AAA ATG TAT GAC CTG GCA GTG GGC TAT GCT 192Leu Gly Arg Ser Ala Glu Lys Met Tyr Asp Leu Ala Val Gly Tyr Ala 50 55 60CAT CAG GTG TTA CAC CAT TTT CGC CGT AAT TCT CTT AGT GAA GCT GTT 240His Gln Val Leu His His Phe Arg Arg Asn Ser Leu Ser Glu Ala Val65 70 75 80CAG TTT GGC TTG AGA AGT CCG TTC TCC GTA TCA GGC CCG GAT TAC GCC 288Gln Phe Gly Leu Arg Ser Pro Phe Ser Val Ser Gly Pro Asp Tyr Ala 85 90 95AAT CAG TTT CTT GAT GCA AAC ACG GGT TGG AAA GAT AAA GCA CCA AGT 336Asn Gln Phe Leu Asp Ala Asn Thr Gly Trp Lys Asp Lys Ala Pro Ser 100 105 110GGA TCA CCG GAA GCC AAT GAT GCG CCG GTA GCC TAT CTG ACT CAT ATT 384Gly Ser Pro Glu Ala Asn Asp Ala Pro Val Ala Tyr Leu Thr His Ile 115 120 125TAT CAA TTG GCC CTT GAA CAG GAA AAG AAT GGC GCC ACT ACC ATT ATG 432Tyr Gln Leu Ala Leu Glu Gln Glu Lys Asn Gly Ala Thr Thr Ile Met 130 135 140AAT ACG CTG GCG GAG CGT CGC CCC GAT CTG GGT GCT TTG TTA ATT AAT 480Asn Thr Leu Ala Glu Arg Arg Pro Asp Leu Gly Ala Leu Leu Ile Asn145 150 155 160GAT AAA GCA ATC AAT GAG GTG ATA CCG CAA TTG CAG TTG GTC AAT GAA 528Asp Lys Ala Ile Asn Glu Val Ile Pro Gln Leu Gln Leu Val Asn Glu 165 170 175ATT CTG TCC AAA GCT ATT CAG AAG AAA CTG AGT TTG ACT GAT CTG GAA 576Ile Leu Ser Lys Ala Ile Gln Lys Lys Leu Ser Leu Thr Asp Leu Glu 180 185 190GCG GTA AAC GCC AGA CTT TCC ACT ACC CGT TAC CCG AAT AAT CTG CCG 624Ala Val Asn Ala Arg Leu Ser Thr Thr Arg Tyr Pro Asn Asn Leu Pro 195 200 205TAT CAT TAT GGT CAT CAG CAG ATT CAG ACA GCT CAA TCG GTA TTG GGT 672Tyr His Tyr Gly His Gln Gln Ile Gln Thr Ala Gln Ser Val Leu Gly 210 215 220ACT ACG TTG CAA GAT ATC ACT TTG CCA CAG ACG CTG GAT CTG CCG CAA 720Thr Thr Leu Gln Asp Ile Thr Leu Pro Gln Thr Leu Asp Leu Pro Gln225 230 235 240AAC TTC TGG GCA ACA GCA AAA GGA AAA CTG AGC GAT ACG ACT GCC AGT 768Asn Phe Trp Ala Thr Ala Lys Gly Lys Leu Ser Asp Thr Thr Ala Ser 245 250 255GCT TTG ACC CGA CTG CAA ATC ATG GCG AGT CAG TTT TCG CCA GAG CAG 816Ala Leu Thr Arg Leu Gln Ile Met Ala Ser Gln Phe Ser Pro Glu Gln 260 265 270CAG AAA ATC ATT ACG GAG ACT GTC GGT CAG GAT TTC TAT CAG CTT AAC 864Gln Lys Ile Ile Thr Glu Thr Val Gly Gln Asp Phe Tyr Gln Leu Asn 275 280 286TAT GGT GAC AGT TCG CTT ACT GTG AAT AGT TTC AGC GAC ATG ACC ATA 912Tyr Gly Asp Ser Ser Leu Thr Val Asn Ser Phe Ser Asp Met Thr Ile 290 295 300ATG ACT GAT CGA ACA AGT TTG ACT GTA CCC CAG GTA GAA CTG ATG TTG 960Met Thr Asp Arg Thr Ser Leu Thr Val Pro Gln Val Glu Leu Met Leu305 310 315 320TGT TCA ACT GTC GGA GGT TCT ACG GTT GTT AAG TCT GAT AAT GTG AGT 1008Cys Ser Thr Val Gly Gly Ser Thr Val Val Lys Ser Asp Asn Val Ser 325 330 335TCT GGT GAC ACG ACA GCG ACG CCA TTT GCG TAT GGC GCC CGC TTT ATT 1056Ser Gly Asp Thr Thr Ala Thr Pro Phe Ala Tyr Gly Ala Arg Phe Ile 340 345 350CAT GCC GGT AAG CCG GAG GCG ATT ACC CTG AGT CGC AGT GGT GCG GAG 1104His Ala Gly Lys Pro Glu Ala Ile Thr Leu Ser Arg Ser Gly Ala Glu 355 360 365GCG CAT TTT GCT CTG ACG GTT AAC AAT CTG ACA GAT GAC AAG TTG GAC 1152Ala His Phe Ala Leu Thr Val Asn Asn Leu Thr Asp Asp Lys Leu Asp 370 375 380CGT ATT AAC CGC ACA GTG CGC CTG CAA AAA TGG CTG AAT CTG CCT TAT 1200Arg Ile Asn Arg Thr Val Arg Leu Gln Lys Trp Leu Asn Leu Pro Tyr385 390 395 400GAG GAT ATT GAC CTG TTA GTG ACT TCT GCT ATG GAT GCG GAA ACA GGA 1248Glu Asp Ile Asp Leu Leu Val Thr Ser Ala Met Asp Ala Glu Thr Gly 405 410 415AAT ACC GCG CTG TCG ATG AAC GAC AAT ACG CTG CGT ATG TTG GGA GTG 1296Asn Thr Ala Leu Ser Met Asn Asp Asn Thr Leu Arg Met Leu Gly Val 420 425 430TTC AAA CAT TAT CAG GCG AAG TAT GGT GTT AGC GCT AAA CAA TTT GCT 1344Phe Lys His Tyr Gln Ala Lys Tyr Gly Val Ser Ala Lys Gln Phe Ala 435 440 445GGC TGG CTG CGC GTA GTG GCC CCG TTT GCC ATT ACA CCG GCA ACG CCG 1392Gly Trp Leu Arg Val Val Ala Pro Phe Ala Ile Thr Pro Ala Thr Pro 450 455 460TTT TTA GAC CAA GTG TTT AAC TCC GTC GGC ACC TTT GAT ACA CCG TTT 1440Phe Leu Asp Gln Val Phe Asn Ser Val Gly Thr Phe Asp Thr Pro Phe465 470 475 480GTG ATA GAT AAT CAG GAT TTT GTC TAT ACA TTG ACC ACC GGG GGC GAT 1488Val Ile Asp Asn Gln Asp Phe Val Tyr Thr Leu Thr Thr Gly Gly Asp 485 490 495GGG GCG CGT GTT AAG CAT ATC AGC ACG GCA CTG GGC CTC AAT CAT CGT 1536Gly Ala Arg Val Lys His Ile Ser Thr Ala Leu Gly Leu Asn His Arg 500 505 510CAG TTC CTG TTA TTG GCG GAT AAT ATT GCC CGT CAA CAG GGG AAT GTC 1584Gln Phe Leu Leu Leu Ala Asp Asn Ile Ala Arg Gln Gln Gly Asn Val 515 520 525ACG CAA AGC ACA CTC AAC TGT AAT CTG TTT GTG GTG TCA GCT TTC TAC 1632Thr Gln Ser Thr Leu Asn Cys Asn Leu Phe Val Val Ser Ala Phe Tyr 530 535 540CGT CTG GCT AAT TTG GCG CGC ACA TTG GGG ATA AAT CCA GAG TCT TTC 1680Arg Leu Ala Asn Leu Ala Arg Thr Leu Gly Ile Asn Pro Glu Ser Phe545 550 555 560TGT GCC TTG GTT GAT CGA TTA GAT GCA GGT ACA GGC ATC GTC TGG CAG 1728Cys Ala Leu Val Asp Arg Leu Asp Ala Gly Thr Gly Ile Val Trp Gln 565 570 575CAA TTG GCA GGG AAA CCC ACA ATC ACG GTA CCA CAA AAA GAT TCC CCG 1776Gln Leu Ala Gly Lys Pro Thr Ile Thr Val Pro Gln Lys Asp Ser Pro 580 585 590CTG GCG GCG GAT ATT CTG AGT TTG CTG CAA GCG CTA AGT GCG ATT GCT 1824Leu Ala Ala Asp Ile Leu Ser Leu Leu Gln Ala Leu Ser Ala Ile Ala 595 600 605CAA TGG CAA CAA CAG CAC GAT TTA GAA TTT TCA GCA CTG CTT TTG CTG 1872Gln Trp Gln Gln Gln His Asp Leu Glu Phe Ser Ala Leu Leu Leu Leu 610 615 620TTG AGT GAC AAC CCT ATT TCT ACC TCG CAG GGC ACT GAC GAT CAA TTG 1920Leu Ser Asp Asn Pro Ile Ser Thr Ser Gln Gly Thr Asp Asp Gln Leu625 630 635 640AAC TTT ATC CGT CAA GTG TGG CAG AAC CTA GGC AGT ACG TTT GTG GGT 1968Asn Phe Ile Arg Gln Val Trp Gln Asn Leu Gly Ser Thr Phe Val Gly 645 650 655GCA ACA TTG TTG TCC CGC AGT GGG GCA CCA TTA GTC GAT ACC AAC GGC 2016Ala Thr Leu Leu Ser Arg Ser Gly Ala Pro Leu Val Asp Thr Asn Gly 660 665 670CAC GCT ATT GAC TGG TTT GCT CTG CTC TCA GCA GGT AAT AGT CCG CTT 2064His Ala Ile Asp Trp Phe Ala Leu Leu Ser Ala Gly Asn Ser Pro Leu 675 680 685ATC GAT AAG GTT GGT CTG GTG ACT GAT GCT GGC ATA CAA AGT GTT ATA 2112Ile Asp Lys Val Gly Leu Val Thr Asp Ala Gly Ile Gln Ser Val Ile 690 695 700GCA ACG GTG GTC AAT ACA CAA AGC TTA TCT GAT GAA GAT AAG AAG CTG 2160Ala Thr Val Val Asn Thr Gln Ser Leu Ser Asp Glu Asp Lys Lys Leu705 710 715 720GCA ATC ACT ACT CTG ACT AAT ACG TTG AAT CAG GTA CAG AAA ACT CAA 2208Ala Ile Thr Thr Leu Thr Asn Thr Leu Asn Gln Val Gln Lys Thr Gln 725 730 735CAG GGC GTG GCC GTC AGT CTG TTG GCG CAG ACT CTG AAC GTG AGT CAG 2256Gln Gly Val Ala Val Ser Leu Leu Ala Gln Thr Leu Asn Val Ser Gln 740 745 750TCA CTG CCT GCG TTA TTG TTG CGC TGG AGT GGA CAA ACA ACC TAC CAG 2304Ser Leu Pro Ala Leu Leu Leu Arg Trp Ser Gly Gln Thr Thr Tyr Gln 755 760 765TGG TTG AGT GCG ACT TGG GCA TTG AAG GAT GCC GTT AAG ACT GCC GCC 2352Trp Leu Ser Ala Thr Trp Ala Leu Lys Asp Ala Val Lys Thr Ala Ala 770 775 780GAT ATT CCC GCT GAC TAT CTG CGT CAA TTA CGT GAA GTG GTA CGC CGC 2400Asp Ile Pro Ala Asp Tyr Leu Arg Gln Leu Arg Glu Val Val Arg Arg785 790 795 800TCC TTG TTG ACC CAA CAA TTC ACG CTG AGT CCT GCA ATG GTG CAA ACC 2448Ser Leu Leu Thr Gln Gln Phe Thr Leu Ser Pro Ala Met Val Gln Thr 805 810 815TTG CTG GAC TAT CCA GCC TAT TTT GGC GCT TCC GCA GAA ACA GTG ACC 2496Leu Leu Asp Tyr Pro Ala Tyr Phe Gly Ala Ser Ala Glu Thr Val Thr 820 825 830GAT ATC AGT TTG TGG ATG CTT TAT ACC CTG AGC TGT TAT AGC GAT TTA 2544Asp Ile Ser Leu Trp Met Leu Tyr Thr Leu Ser Cys Tyr Ser Asp Leu 835 840 845TTG CTC CAA ATG GGT GAA GCT GGT GGT ACC GAA GAT GAT GTA CTG GCC 2592Leu Leu Gln Met Gly Glu Ala Gly Gly Thr Glu Asp Asp Val Leu Ala 850 855 860TAC TTA CGC ACA GCT AAT GCT ACC ACA CCG TTG AGC CAA TCT GAT GCT 2640Tyr Leu Arg Thr Ala Asn Ala Thr Thr Pro Leu Ser Gln Ser Asp Ala865 870 875 880GCA CAG ACG TTG GCA ACG CTA TTG GGT TGG GAG GTT AAC GAG TTG CAA 2688Ala Gln Thr Leu Ala Thr Leu Leu Gly Trp Glu Val Asn Glu Leu Gln 885 890 895GCC GCT TGG TCG GTA TTG GGC GGG ATT GCC AAA ACC ACA CCG CAA CTG 2736Ala Ala Trp Ser Val Leu Gly Gly Ile Ala Lys Thr Thr Pro Gln Leu 900 905 910GAT GCG CTT CTG CGT TTG CAA CAG GCA CAG AAC CAA ACT GGT CTT GGC 2784Asp Ala Leu Leu Arg Leu Gln Gln Ala Gln Asn Gln Thr Gly Leu Gly 915 920 925GTT ACA CAG CAA CAG CAA GGC TAT CTC CTG AGT CGT GAC AGT GAT TAT 2832Val Thr Gln Gln Gln Gln Gly Tyr Leu Leu Ser Arg Asp Ser Asp Tyr 930 935 940ACC CTT TGG CAA AGC ACC GGT CAG GCG CTG GTG GCT GGC GTA TCC CAT 2880Thr Leu Trp Gln Ser Thr Gly Gln Ala Leu Val Ala Gly Val Ser His945 950 955 960GTC AAG GGC AGT AAC TGA GCATGGCAGA GCTCACTACC TGAGTGGATT TGATTT 2934Val Lys Gly Ser Asn 965TTCCGTATGG CCTAATGAGG CTATTTCTAA ACCGCCATTT AAGTAAGGCA GATAATTATG 2994 965 amino acids amino acid linear protein 57Met Asn Gln Leu Ala Ser Pro Leu Ile Ser Arg Thr Glu Glu Ile His1 5 10 15Asn Leu Pro Gly Lys Leu Thr Asp Leu Gly Tyr Thr Ser Val Phe Asp 20 25 30Val Val Arg Met Pro Arg Glu Arg Phe Ile Arg Glu His Arg Ala Asp 35 40 45Leu Gly Arg Ser Ala Glu Lys Met Tyr Asp Leu Ala Val Gly Tyr Ala 50 55 60His Gln Val Leu His His Phe Arg Arg Asn Ser Leu Ser Glu Ala Val65 70 75 80Gln Phe Gly Leu Arg Ser Pro Phe Ser Val Ser Gly Pro Asp Tyr Ala 85 90 95Asn Gln Phe Leu Asp Ala Asn Thr Gly Trp Lys Asp Lys Ala Pro Ser 100 105 110Gly Ser Pro Glu Ala Asn Asp Ala Pro Val Ala Tyr Leu Thr His Ile 115 120 125Tyr Gln Leu Ala Leu Glu Gln Glu Lys Asn Gly Ala Thr Thr Ile Met 130 135 140Asn Thr Leu Ala Glu Arg Arg Pro Asp Leu Gly Ala Leu Leu Ile Asn145 150 155 160Asp Lys Ala Ile Asn Glu Val Ile Pro Gln Leu Gln Leu Val Asn Glu 165 170 175Ile Leu Ser Lys Ala Ile Gln Lys Lys Leu Ser Leu Thr Asp Leu Glu 180 185 190Ala Val Asn Ala Arg Leu Ser Thr Thr Arg Tyr Pro Asn Asn Leu Pro 195 200 205Tyr His Tyr Gly His Gln Gln Ile Gln Thr Ala Gln Ser Val Leu Gly 210 215 220Thr Thr Leu Gln Asp Ile Thr Leu Pro Gln Thr Leu Asp Leu Pro Gln225 230 235 240Asn Phe Trp Ala Thr Ala Lys Gly Lys Leu Ser Asp Thr Thr Ala Ser 245 250 255Ala Leu Thr Arg Leu Gln Ile Met Ala Ser Gln Phe Ser Pro Glu Gln 260 265 270Gln Lys Ile Ile Thr Glu Thr Val Gly Gln Asp Phe Tyr Gln Leu Asn 275 280 286Tyr Gly Asp Ser Ser Leu Thr Val Asn Ser Phe Ser Asp Met Thr Ile 290 295 300Met Thr Asp Arg Thr Ser Leu Thr Val Pro Gln Val Glu Leu Met Leu305 310 315 320Cys Ser Thr Val Gly Gly Ser Thr Val Val Lys Ser Asp Asn Val Ser 325 330 335Ser Gly Asp Thr Thr Ala Thr Pro Phe Ala Tyr Gly Ala Arg Phe Ile 340 345 350His Ala Gly Lys Pro Glu Ala Ile Thr Leu Ser Arg Ser Gly Ala Glu 355 360 365Ala His Phe Ala Leu Thr Val Asn Asn Leu Thr Asp Asp Lys Leu Asp 370 375 380Arg Ile Asn Arg Thr Val Arg Leu Gln Lys Trp Leu Asn Leu Pro Tyr385 390 395 400Glu Asp Ile Asp Leu Leu Val Thr Ser Ala Met Asp Ala Glu Thr Gly 405 410 415Asn Thr Ala Leu Ser Met Asn Asp Asn Thr Leu Arg Met Leu Gly Val 420 425 430Phe Lys His Tyr Gln Ala Lys Tyr Gly Val Ser Ala Lys Gln Phe Ala 435 440 445Gly Trp Leu Arg Val Val Ala Pro Phe Ala Ile Thr Pro Ala Thr Pro 450 455 460Phe Leu Asp Gln Val Phe Asn Ser Val Gly Thr Phe Asp Thr Pro Phe465 470 475 480Val Ile Asp Asn Gln Asp Phe Val Tyr Thr Leu Thr Thr Gly Gly Asp 485 490 495Gly Ala Arg Val Lys His Ile Ser Thr Ala Leu Gly Leu Asn His Arg 500 505 510Gln Phe Leu Leu Leu Ala Asp Asn Ile Ala Arg Gln Gln Gly Asn Val 515 520 525Thr Gln Ser Thr Leu Asn Cys Asn Leu Phe Val Val Ser Ala Phe Tyr 530 535 540Arg Leu Ala Asn Leu Ala Arg Thr Leu Gly Ile Asn Pro Glu Ser Phe545 550 555 560Cys Ala Leu Val Asp Arg Leu Asp Ala Gly Thr Gly Ile Val Trp Gln 565 570 575Gln Leu Ala Gly Lys Pro Thr Ile Thr Val Pro Gln Lys Asp Ser Pro 580 585 590Leu Ala Ala Asp Ile Leu Ser Leu Leu Gln Ala Leu Ser Ala Ile Ala 595 600 605Gln Trp Gln Gln Gln His Asp Leu Glu Phe Ser Ala Leu Leu Leu Leu 610 615 620Leu Ser Asp Asn Pro Ile Ser Thr Ser Gln Gly Thr Asp Asp Gln Leu625 630 635 640Asn Phe Ile Arg Gln Val Trp Gln Asn Leu Gly Ser Thr Phe Val Gly 645 650 655Ala Thr Leu Leu Ser Arg Ser Gly Ala Pro Leu Val Asp Thr Asn Gly 660 665 670His Ala Ile Asp Trp Phe Ala Leu Leu Ser Ala Gly Asn Ser Pro Leu 675 680 685Ile Asp Lys Val Gly Leu Val Thr Asp Ala Gly Ile Gln Ser Val Ile 690 695 700Ala Thr Val Val Asn Thr Gln Ser Leu Ser Asp Glu Asp Lys Lys Leu705 710 715 720Ala Ile Thr Thr Leu Thr Asn Thr Leu Asn Gln Val Gln Lys Thr Gln 725 730 735Gln Gly Val Ala Val Ser Leu Leu Ala Gln Thr Leu Asn Val Ser Gln 740 745 750Ser Leu Pro Ala Leu Leu Leu Arg Trp Ser Gly Gln Thr Thr Tyr Gln 755 760 765Trp Leu Ser Ala Thr Trp Ala Leu Lys Asp Ala Val Lys Thr Ala Ala 770 775 780Asp Ile Pro Ala Asp Tyr Leu Arg Gln Leu Arg Glu Val Val Arg Arg785 790 795 800Ser Leu Leu Thr Gln Gln Phe Thr Leu Ser Pro Ala Met Val Gln Thr 805 810 815Leu Leu Asp Tyr Pro Ala Tyr Phe Gly Ala Ser Ala Glu Thr Val Thr 820 825 830Asp Ile Ser Leu Trp Met Leu Tyr Thr Leu Ser Cys Tyr Ser Asp Leu 835 840 845Leu Leu Gln Met Gly Glu Ala Gly Gly Thr Glu Asp Asp Val Leu Ala 850 855 860Tyr Leu Arg Thr Ala Asn Ala Thr Thr Pro Leu Ser Gln Ser Asp Ala865 870 875 880Ala Gln Thr Leu Ala Thr Leu Leu Gly Trp Glu Val Asn Glu Leu Gln 885 890 895Ala Ala Trp Ser Val Leu Gly Gly Ile Ala Lys Thr Thr Pro Gln Leu 900 905 910Asp Ala Leu Leu Arg Leu Gln Gln Ala Gln Asn Gln Thr Gly Leu Gly 915 920 925Val Thr Gln Gln Gln Gln Gly Tyr Leu Leu Ser Arg Asp Ser Asp Tyr 930 935 940Thr Leu Trp Gln Ser Thr Gly Gln Ala Leu Val Ala Gly Val Ser His945 950 955 960Val Lys Gly Ser Asn 965 4832 base pairs nucleic acid double linear DNA (genomic) 58ATG TTA TCG ACA ATG GAA AAA CAA CTG AAT GAA TCC CAG CGT GAT GCG 48Met Leu Ser Thr Met Glu Lys Gln Leu Asn Glu Ser Gln Arg Asp Ala1 5 10 15TTG GTG ACT GGC TAT ATG AAT TTT GTG GCG CCG ACG TTG AAA GGC GTC 96Leu Val Thr Gly Tyr Met Asn Phe Val Ala Pro Thr Leu Lys Gly Val 20 25 30AGT GGT CAG CCG GTG ACG GTG GAA GAT TTA TAC GAA TAT TTG CTG ATT 144Ser Gly Gln Pro Val Thr Val Glu Asp Leu Tyr Glu Tyr Leu Leu Ile 35 40 45GAC CCG GAA GTG GCT GAT GAG GTT GAG ACG AGT CGG GTA GCA CAA GCG 192Asp Pro Glu Val Ala Asp Glu Val Glu Thr Ser Arg Val Ala Gln Ala 50 55 60ATT GCC AGC ATA CAG CAA TAT ATG ACT CGT CTG GTC AAC GGC TCT GAA 240Ile Ala Ser Ile Gln Gln Tyr Met Thr Arg Leu Val Asn Gly Ser Glu65 70 75 80CCG GGG CGT CAG GCG ATG GAG CCT TCT ACA GCT AAC GAA TGG CGT GAT 288Pro Gly Arg Gln Ala Met Glu Pro Ser Thr Ala Asn Glu Trp Arg Asp 85 90 95AAT GAT AAC CAA TAT GCT ATC TGG GCT GCG GGG GCT GAG GTT CGA AAT 336Asn Asp Asn Gln Tyr Ala Ile Trp Ala Ala Gly Ala Glu Val Arg Asn 100 105 110TAC GCT GAA AAC TAT ATT TCA CCC ATC ACC CGG CAG GAA AAA AGC CAT 384Tyr Ala Glu Asn Tyr Ile Ser Pro Ile Thr Arg Gln Glu Lys Ser His 115 120 125TAT TTC TCG GAG CTG GAG ACG ACT TTA AAT CAG AAT CGA CTC GAT CCG 432Tyr Phe Ser Glu Leu Glu Thr Thr Leu Asn Gln Asn Arg Leu Asp Pro 130 135 140GAT CGT GTG CAG GAT GCT GTT TTG GCG TAT CTC AAT GAG TTT GAG GCA 480Asp Arg Val Gln Asp Ala Val Leu Ala Tyr Leu Asn Glu Phe Glu Ala145 150 155 160GTG AGT AAT CTA TAT GTG CTC AGT GGT TAT ATT AAT CAG GAT AAA TTT 528Val Ser Asn Leu Tyr Val Leu Ser Gly Tyr Ile Asn Gln Asp Lys Phe 165 170 175GAC CAA GCT ATC TAC TAC TTT ATT GGT CGC ACT ACC ACT AAA CCG TAT 576Asp Gln Ala Ile Tyr Tyr Phe Ile Gly Arg Thr Thr Thr Lys Pro Tyr 180 185 190CGC TAC TAC TGG CGT CAG ATG GAT TTG AGT AAG AAC CGT CAA GAT CCG 624Arg Tyr Tyr Trp Arg Gln Met Asp Leu Ser Lys Asn Arg Gln Asp Pro 195 200 205GCA GGG AAT CCG GTG ACG CCA AAT TGC TGG AAT GAT TGG CAG GAA ATC 672Ala Gly Asn Pro Val Thr Pro Asn Cys Trp Asn Asp Trp Gln Glu Ile 210 215 220ACT TTG CCG CTG TCT GGT GAT ACG GTG CTG GAG CAT ACA GTT CGC CCG 720Thr Leu Pro Leu Ser Gly Asp Thr Val Leu Glu His Thr Val Arg Pro225 230 235 240GTA TTT TAT AAT GAT CGA CTA TAT GTG GCT TGG GTT GAG CGT GAC CCG 768Val Phe Tyr Asn Asp Arg Leu Tyr Val Ala Trp Val Glu Arg Asp Pro 245 250 255GCA GTA CAG AAG GAT GCT GAC GGT AAA AAC ATC GGT AAA ACC CAT GCC 816Ala Val Gln Lys Asp Ala Asp Gly Lys Asn Ile Gly Lys Thr His Ala 260 265 270TAC AAC ATA AAG TTT GGT TAT AAA CGT TAT GAT GAT ACT TGG ACA GCG 864Tyr Asn Ile Lys Phe Gly Tyr Lys Arg Tyr Asp Asp Thr Trp Thr Ala 275 280 285CCG AAT ACG ACC ACG TTA ATG ACA CAA CAA GCA GGG GAA AGT TCA GAA 912Pro Asn Thr Thr Thr Leu Met Thr Gln Gln Ala Gly Glu Ser Ser Glu 290 295 300ACA CAG CGA TCC AGC CTG CTG ATT GAT GAA TCT AGC ACC ACA TTG CGC 960Thr Gln Arg Ser Ser Leu Leu Ile Asp Glu Ser Ser Thr Thr Leu Arg305 310 315 320CAA GTT AAT CTG TTG GCT ACC ACC GAT TTT AGT ATC GAT CCG ACG GAG 1008Gln Val Asn Leu Leu Ala Thr Thr Asp Phe Ser Ile Asp Pro Thr Glu 325 330 335GAA ACG GAC AGT AAC CCG TAT GGC CGC CTA ATG TTG GGG GTG TTT GTC 1056Glu Thr Asp Ser Asn Pro Tyr Gly Arg Leu Met Leu Gly Val Phe Val 340 345 350CGT CAA TTT GAA GGT GAT GGG GCC AAT AGA AAA AAT AAA CCC GTT GTT 1104Arg Gln Phe Glu Gly Asp Gly Ala Asn Arg Lys Asn Lys Pro Val Val 355 360 365TAT GGT TAT CTC TAT TGT GAC TCA GCT TTC AAT CGT CAT GTT CTC AGG 1152Tyr Gly Tyr Leu Tyr Cys Asp Ser Ala Phe Asn Arg His Val Leu Arg 370 375 380CCG TTA AGT AAG AAC TTT TTG TTC AGT ACT TAC CGT GAT GAA ACG GAT 1200Pro Leu Ser Lys Asn Phe Leu Phe Ser Thr Tyr Arg Asp Glu Thr Asp385 390 395 400GGT CAA AAC AGC TTG CAA TTT GCG GTA TAC GAT AAA AAG TAT GTA ATT 1248Gly Gln Asn Ser Leu Gln Phe Ala Val Tyr Asp Lys Lys Tyr Val Ile 405 410 415ACT AAG GTT GTT ACA GGT GCA ACG GAA GAT CCC GAA AAT ACA GGA TGG 1296Thr Lys Val Val Thr Gly Ala Thr Glu Asp Pro Glu Asn Thr Gly Trp 420 425 430GTA AGT AAA GTT GAT GAC TTG AAA CAA GGC ACT ACT GGG GCC TAT GTG 1344Val Ser Lys Val Asp Asp Leu Lys Gln Gly Thr Thr Gly Ala Tyr Val 435 440 445TAT ATC GAT CAA GAT GGC CTG ACG CTT CAT ATA CAA ACC ACA ACT AAT 1392Tyr Ile Asp Gln Asp Gly Leu Thr Leu His Ile Gln Thr Thr Thr Asn 450 455 460GGG GAT TTT ATT AAC CGT CAT ACG TTT GGA TAT AAC GAT CTT GTA TAT 1440Gly Asp Phe Ile Asn Arg His Thr Phe Gly Tyr Asn Asp Leu Val Tyr465 470 475 480GAT TCT AAG TCT GGT TAT GGT TTC ACG TGG TCA GGA AAT GAA GGT TTT 1488Asp Ser Lys Ser Gly Tyr Gly Phe Thr Trp Ser Gly Asn Glu Gly Phe 485 490 495TAT CTG GAT TAC CAT GAT GGA AAT TAT TAC ACC TTT CAT AAT GCA ATA 1536Tyr Leu Asp Tyr His Asp Gly Asn Tyr Tyr Thr Phe His Asn Ala Ile 500 505 510ATC AAC TAC TAT CCG TCT GGA TAT GGT GGT GGA TCT GTT CCT AAT GGA 1584Ile Asn Tyr Tyr Pro Ser Gly Tyr Gly Gly Gly Ser Val Pro Asn Gly 515 520 525ACG TGG GCG TTA GAG CAA AGG ATT AAT GAG GGA TGG GCT ATT GCT CCC 1632Thr Trp Ala Leu Glu Gln Arg Ile Asn Glu Gly Trp Ala Ile Ala Pro 530 535 540CTG CTT GAT ACT CTC CAT ACT GTT ACT GTG AAG GGC AGT TAT ATC GCT 1680Leu Leu Asp Thr Leu His Thr Val Thr Val Lys Gly Ser Tyr Ile Ala545 550 555 560TGG GAA GGG GAA ACA CCT ACC GGT TAT AAT CTG TAT ATT CCA GAT GGT 1728Trp Glu Gly Glu Thr Pro Thr Gly Tyr Asn Leu Tyr Ile Pro Asp Gly 565 570 575ACC GTG TTG CTA GAT TGG TTT GAT AAA ATA AAT TTT GCT ATT GGT CTT 1776Thr Val Leu Leu Asp Trp Phe Asp Lys Ile Asn Phe Ala Ile Gly Leu 580 585 590AAT AAG CTT GAG TCT GTA TTT ACG TCG CCA GAT TGG CCA ACA CTA ACC 1824Asn Lys Leu Glu Ser Val Phe Thr Ser Pro Asp Trp Pro Thr Leu Thr 595 600 605ACT ATC AAA AAT TTC AGT AAA ATC GCC GAT AAC CGC AAA TTC TAT CAG 1872Thr Ile Lys Asn Phe Ser Lys Ile Ala Asp Asn Arg Lys Phe Tyr Gln 610 615 620GAA ATC AAT GCT GAG ACG GCG GAT GGA CGC AAC CTG TTT AAA CGT TAC 1920Glu Ile Asn Ala Glu Thr Ala Asp Gly Arg Asn Leu Phe Lys Arg Tyr625 630 635 640AGT ACT CAA ACT TTC GGA CTT ACC AGC GGT GCG ACT TAT TCT ACA ACT 1968Ser Thr Gln Thr Phe Gly Leu Thr Ser Gly Ala Thr Tyr Ser Thr Thr 645 650 655TAT ACT TTG TCT GAG GCG GAT TTC TCC ACT GAT CCG GAC AAA AAC TAC 2016Tyr Thr Leu Ser Glu Ala Asp Phe Ser Thr Asp Pro Asp Lys Asn Tyr 660 665 670CTA CAG GTT TGT TTG AAT GTC GTG TGG GAT CAT TAT GAC CGC CCG TCA 2064Leu Gln Val Cys Leu Asn Val Val Trp Asp His Tyr Asp Arg Pro Ser 675 680 685GGG AAA AAA GGG GCT TAT TCT TGG GTC AGT AAG TGG TTT AAC GTC TAT 2112Gly Lys Lys Gly Ala Tyr Ser Trp Val Ser Lys Trp Phe Asn Val Tyr 690 695 700GTT GCG TTG CAA GAT AGC AAA GCT CCG GAT GCC ATT CCT CGA TTA GTT 2160Val Ala Leu Gln Asp Ser Lys Ala Pro Asp Ala Ile Pro Arg Leu Val705 710 715 720TCC CGT TAC GAT AGT AAA CGT GGT CTG GTG CAA TAT CTG GAC TTC TGG 2208Ser Arg Tyr Asp Ser Lys Arg Gly Leu Val Gln Tyr Leu Asp Phe Trp 725 730 735ACC TCA TCA TTA CCC GCG AAA ACC CGT CTT AAC ACC ACC TTT GTG CGT 2256Thr Ser Ser Leu Pro Ala Lys Thr Arg Leu Asn Thr Thr Phe Val Arg 740 745 750ACT TTG ATT GAG AAG GCT AAT CTG GGG CTG GAT AGT TTG CTG GAT TAC 2304Thr Leu Ile Glu Lys Ala Asn Leu Gly Leu Asp Ser Leu Leu Asp Tyr 755 760 765ACC TTG CAG GCA GAT CCT TCT CTG GAA GCA GAT TTA GTG ACT GAC GGC 2352Thr Leu Gln Ala Asp Pro Ser Leu Glu Ala Asp Leu Val Thr Asp Gly 770 775 780AAA AGC GAA CCA ATG GAC TTT AAT GGT TCA AAC GGT CTC TAT TTC TGG 2400Lys Ser Glu Pro Met Asp Phe Asn Gly Ser Asn Gly Leu Tyr Phe Trp785 790 795 800GAA TTG TTC TTT CAC CTG CCG TTT TTG GTT GCT ACA CGC TTT GCC AAC 2448Glu Leu Phe Phe His Leu Pro Phe Leu Val Ala Thr Arg Phe Ala Asn 805 810 815GAA CAG CAA TTT TCG CCG GCA CAA AAG AGT TTG CAT TAC ATC TTT GAC 2496Glu Gln Gln Phe Ser Pro Ala Gln Lys Ser Leu His Tyr Ile Phe Asp 820 825 830CCG GCG ATG AAA AAC AAG CCA CAC AAT GCC CCG GCT TAT TGG AAT GTA 2544Pro Ala Met Lys Asn Lys Pro His Asn Ala Pro Ala Tyr Trp Asn Val 835 840 845CGT CCG TTG GTT GAA GGA AAC AGC GAT TTG TCA CGT CAT TTG GAC GAT 2592Arg Pro Leu Val Glu Gly Asn Ser Asp Leu Ser Arg His Leu Asp Asp 850 855 860TCT ATA GAC CCA GAT ACT CAA GCT TAT GCT CAT CCG GTG ATA TAC CAG 2640Ser Ile Asp Pro Asp Thr Gln Ala Tyr Ala His Pro Val Ile Tyr Gln865 870 875 880AAA GCG GTG TTT ATT GCC TAT GTC AGT AAC CTG ATT GCT CAG GGA GAT 2688Lys Ala Val Phe Ile Ala Tyr Val Ser Asn Leu Ile Ala Gln Gly Asp 885 890 895ATG TGG TAT CGC CAA TTG ACT CGT GAC GGT CTG ACT CAG GCC CGT GTC 2736Met Trp Tyr Arg Gln Leu Thr Arg Asp Gly Leu Thr Gln Ala Arg Val 900 905 910TAT TAC AAT CTG GCC GCT GAA TTG CTA GGG CCT CGT CCG GAT GTA TCG 2784Tyr Tyr Asn Leu Ala Ala Glu Leu Leu Gly Pro Arg Pro Asp Val Ser 915 920 925CTG AGT AGC ATT TGG ACG CCG CAA ACC CTG GAT ACC TTA GCA GCC GGG 2832Leu Ser Ser Ile Trp Thr Pro Gln Thr Leu Asp Thr Leu Ala Ala Gly 930 935 940CAA AAA GCG GTT TTA CGT GAT TTT GAG CAC CAG TTG GCT AAT AGT GAT 2880Gln Lys Ala Val Leu Arg Asp Phe Glu His Gln Leu Ala Asn Ser Asp945 950 955 960ACC GCT TTA CCC GCA TTG CCG GGC CGC AAT GTC AGC TAC TTG AAA CTG 2928Thr Ala Leu Pro Ala Leu Pro Gly Arg Asn Val Ser Tyr Leu Lys Leu 965 970 975GCA GAT AAT GGC TAC TTT AAT GAA CCG CTC AAT GTT CTG ATG TTG TCT 2976Ala Asp Asn Gly Tyr Phe Asn Glu Pro Leu Asn Val Leu Met Leu Ser 980 985 990CAC TGG GAT ACG TTG GAT GCA CGG TTA TAC AAT CTG CGT CAT AAC CTG 3024His Trp Asp Thr Leu Asp Ala Arg Leu Tyr Asn Leu Arg His Asn Leu 995 1000 1005ACC GTT GAT GGC AAG CCG CTT TCG CTG CCG CTG TAT GCT GCG CCT GTT 3072Thr Val Asp Gly Lys Pro Leu Ser Leu Pro Leu Tyr Ala Ala Pro Val 1010 1015 1020GAT CCG GTA GCG TTG TTG GCT CAG CGT GCT CAG TCC GGC ACG TTG ACG 3120Asp Pro Val Ala Leu Leu Ala Gln Arg Ala Gln Ser Gly Thr Leu Thr1025 1030 1035 1040AAT GGC GTC AGT GGC GCC ATG TTG ACG GTG CCG CCA TAC CGT TTC AGC 3168Asn Gly Val Ser Gly Ala Met Leu Thr Val Pro Pro Tyr Arg Phe Ser 1045 1050 1055GCT ATG TTG CCG CGA GCT TAC AGC GCC GTG GGT ACG TTG ACC AGT TTT 3216Ala Met Leu Pro Arg Ala Tyr Ser Ala Val Gly Thr Leu Thr Ser Phe 1060 1065 1070GGT CAG AAC CTG CTT AGT TTG TTG GAA CGT AGC GAA CGA GCC TGT CAA 3264Gly Gln Asn Leu Leu Ser Leu Leu Glu Arg Ser Glu Arg Ala Cys Gln 1075 1080 1085GAA GAG TTG GCG CAA CAG CAA CTG TTG GAT ATG TCC AGC TAT GCC ATC 3312Glu Glu Leu Ala Gln Gln Gln Leu Leu Asp Met Ser Ser Tyr Ala Ile 1090 1095 1100ACG TTG CAA CAA CAG GCG CTG GAT GGA TTG GCG GCA GAT CGT CTG GCG 3360Thr Leu Gln Gln Gln Ala Leu Asp Gly Leu Ala Ala Asp Arg Leu Ala1105 1110 1115 1120CTG CTA GCT AGT CAG GCT ACG GCA CAA CAG CGT CAT GAC CAT TAT TAC 3408Leu Leu Ala Ser Gln Ala Thr Ala Gln Gln Arg His Asp His Tyr Tyr 1125 1130 1135ACT CTG TAT CAG AAC AAC ATC TCC AGT GCG GAA CAA CTG GTG ATG GAC 3456Thr Leu Tyr Gln Asn Asn Ile Ser Ser Ala Glu Gln Leu Val Met Asp 1140 1145 1150ACC CAA ACG TCA GCA CAA TCC CTG ATT TCT TCT TCC ACT GGT GTA CAA 3504Thr Gln Thr Ser Ala Gln Ser Leu Ile Ser Ser Ser Thr Gly Val Gln 1155 1160 1165ACT GCC AGT GGG GCA CTG AAA GTG ATC CCG AAT ATC TTT GGT TTG GCT 3552Thr Ala Ser Gly Ala Leu Lys Val Ile Pro Asn Ile Phe Gly Leu Ala 1170 1175 1180GAT GGC GGC TCG CGC TAT GAA GGA GTA ACG GAA GCG ATT GCC ATC GGG 3600Asp Gly Gly Ser Arg Tyr Glu Gly Val Thr Glu Ala Ile Ala Ile Gly1185 1190 1195 1200TTA ATG GCT GCC GGA CAA GCC ACC AGC GTG GTG GCC GAG CGT CTG GCA 3648Leu Met Ala Ala Gly Gln Ala Thr Ser Val Val Ala Glu Arg Leu Ala 1205 1210 1215ACC ACG GAG AAT TAC CGC CGC CGC CGT GAA GAG TGG CAA ATC CAA TAC 3696Thr Thr Glu Asn Tyr Arg Arg Arg Arg Glu Glu Trp Gln Ile Gln Tyr 1220 1225 1230CAG CAG GCA CAG TCT GAG GTC GAC GCA TTA CAG AAA CAG TTG GAT GCG 3744Gln Gln Ala Gln Ser Glu Val Asp Ala Leu Gln Lys Gln Leu Asp Ala 1235 1240 1245CTG GCA GTG CGC GAG AAA GCA GCT CAA ACT TCC CTG CAA CAG GCG AAG 3792Leu Ala Val Arg Glu Lys Ala Ala Gln Thr Ser Leu Gln Gln Ala Lys 1250 1255 1260GCA CAG CAG GTA CAA ATT CGG ACC ATG CTG ACT TAC TTA ACT ACT CGT 3840Ala Gln Gln Val Gln Ile Arg Thr Met Leu Thr Tyr Leu Thr Thr Arg1265 1270 1275 1280TTC ACC CAG GCG ACT CTG TAC CAG TGG CTG AGT GGT CAA TTA TCC GCG 3888Phe Thr Gln Ala Thr Leu Tyr Gln Trp Leu Ser Gly Gln Leu Ser Ala 1285 1290 1295TTG TAT TAT CAA GCG TAT GAT GCC GTG GTT GCT CTC TGC CTC TCC GCC 3936Leu Tyr Tyr Gln Ala Tyr Asp Ala Val Val Ala Leu Cys Leu Ser Ala 1300 1305 1310CAA GCT TGC TGG CAG TAT GAA TTG GGT GAT TAC GCT ACC ACT TTT ATC 3984Gln Ala Cys Trp Gln Tyr Glu Leu Gly Asp Tyr Ala Thr Thr Phe Ile 1315 1320 1325CAG ACC GGT ACC TGG AAC GAC CAT TAC CGT GGT TTG CAA GTG GGG GAG 4032Gln Thr Gly Thr Trp Asn Asp His Tyr Arg Gly Leu Gln Val Gly Glu 1330 1335 1340ACA CTG CAA CTC AAT TTG CAT CAG ATG GAA GCG GCC TAT TTA GTT CGT 4080Thr Leu Gln Leu Asn Leu His Gln Met Glu Ala Ala Tyr Leu Val Arg1345 1350 1355 1360CAC GAA CGC CGT CTT AAT GTG ATC CGT ACT GTG TCG CTC AAA AGC CTA 4128His Glu Arg Arg Leu Asn Val Ile Arg Thr Val Ser Leu Lys Ser Leu 1365 1370 1375TTG GGT GAT GAT GGT TTT GGT AAG TTA AAA ACC GAA GGC AAA GTC GAC 4176Leu Gly Asp Asp Gly Phe Gly Lys Leu Lys Thr Glu Gly Lys Val Asp 1380 1385 1390TTT CCA TTA AGC GAA AAG CTG TTT GAC AAC GAC TAT CCG GGG CAC TAT 4224Phe Pro Leu Ser Glu Lys Leu Phe Asp Asn Asp Tyr Pro Gly His Tyr 1395 1400 1405TTG CGC CAG ATT AAA ACT GTG TCA GTG ACG TTG CCG ACG TTA GTC GGG 4272Leu Arg Gln Ile Lys Thr Val Ser Val Thr Leu Pro Thr Leu Val Gly 1410 1415 1420CCG TAT CAA AAC GTG AAG GCA ACG CTC ACT CAG ACC AGC AGC AGT ATA 4320Pro Tyr Gln Asn Val Lys Ala Thr Leu Thr Gln Thr Ser Ser Ser Ile1425 1430 1435 1440TTG TTA GCA GCA GAT ATC AAT GGT GTT AAA CGT CTC AAT GAT CCG ACA 4368Leu Leu Ala Ala Asp Ile Asn Gly Val Lys Arg Leu Asn Asp Pro Thr 1445 1450 1455GGT AAA GAG GGT GAT GCG ACG CAT ATT GTC ACC AAT CTG CGT GCC AGC 4416Gly Lys Glu Gly Asp Ala Thr His Ile Val Thr Asn Leu Arg Ala Ser 1460 1465 1470CAG CAG GTG GCG CTC TCT TCT GGC ATT AAT GAT GCC GGT AGC TTT GAG 4464Gln Gln Val Ala Leu Ser Ser Gly Ile Asn Asp Ala Gly Ser Phe Glu 1475 1480 1485TTG CGT TTG GAA GAT GAG CGC TAT CTA TCA TTT GAG GGG ACT GGA GCT 4512Leu Arg Leu Glu Asp Glu Arg Tyr Leu Ser Phe Glu Gly Thr Gly Ala 1490 1495 1500GTT TCC AAA TGG ACT CTT AAC TTC CCG CGT TCT GTG GAT GAG CAT ATT 4560Val Ser Lys Trp Thr Leu Asn Phe Pro Arg Ser Val Asp Glu His Ile1505 1510 1515 1520GAC GAT AAG ACA TTG AAA GCG GAT GAG ATG CAG GCC GCA CTG TTG GCG 4608Asp Asp Lys Thr Leu Lys Ala Asp Glu Met Gln Ala Ala Leu Leu Ala 1525 1530 1535AAT ATG GAT GAT GTG CTG GTG CAG GTG CAT TAT ACC GCC TGC GAC GGC 4656Asn Met Asp Asp Val Leu Val Gln Val His Tyr Thr Ala Cys Asp Gly 1540 1545 1550GGC GCC AGT TTC GCA AAC CAG GTC AAG AAA ACA CTC TCT TAA 4698Gly Ala Ser Phe Ala Asn Gln Val Lys Lys Thr Leu Ser 1555 1560 1565CATTAACTTT TAACTAATCC CTCCCACTCT GTTCGCCAGA GTGGGAGAAG GTTTGTCATA 4758TCTAAAATCA ATCTTGCGAT CTTTCTCCAT TTCATTGGAA GGGAAGCTGT AAAACAAATA 4818AGGAATATGA TATG 4832 1565 amino acids amino acid linear protein 59Met Leu Ser Thr Met Glu Lys Gln Leu Asn Glu Ser Gln Arg Asp Ala1 5 10 15Leu Val Thr Gly Tyr Met Asn Phe Val Ala Pro Thr Leu Lys Gly Val 20 25 30Ser Gly Gln Pro Val Thr Val Glu Asp Leu Tyr Glu Tyr Leu Leu Ile 35 40 45Asp Pro Glu Val Ala Asp Glu Val Glu Thr Ser Arg Val Ala Gln Ala 50 55 60Ile Ala Ser Ile Gln Gln Tyr Met Thr Arg Leu Val Asn Gly Ser Glu65 70 75 80Pro Gly Arg Gln Ala Met Glu Pro Ser Thr Ala Asn Glu Trp Arg Asp 85 90 95Asn Asp Asn Gln Tyr Ala Ile Trp Ala Ala Gly Ala Glu Val Arg Asn 100 105 110Tyr Ala Glu Asn Tyr Ile Ser Pro Ile Thr Arg Gln Glu Lys Ser His 115 120 125Tyr Phe Ser Glu Leu Glu Thr Thr Leu Asn Gln Asn Arg Leu Asp Pro 130 135 140Asp Arg Val Gln Asp Ala Val Leu Ala Tyr Leu Asn Glu Phe Glu Ala145 150 155 160Val Ser Asn Leu Tyr Val Leu Ser Gly Tyr Ile Asn Gln Asp Lys Phe 165 170 175Asp Gln Ala Ile Tyr Tyr Phe Ile Gly Arg Thr Thr Thr Lys Pro Tyr 180 185 190Arg Tyr Tyr Trp Arg Gln Met Asp Leu Ser Lys Asn Arg Gln Asp Pro 195 200 205Ala Gly Asn Pro Val Thr Pro Asn Cys Trp Asn Asp Trp Gln Glu Ile 210 215 220Thr Leu Pro Leu Ser Gly Asp Thr Val Leu Glu His Thr Val Arg Pro225 230 235 240Val Phe Tyr Asn Asp Arg Leu Tyr Val Ala Trp Val Glu Arg Asp Pro 245 250 255Ala Val Gln Lys Asp Ala Asp Gly Lys Asn Ile Gly Lys Thr His Ala 260 265 270Tyr Asn Ile Lys Phe Gly Tyr Lys Arg Tyr Asp Asp Thr Trp Thr Ala 275 280 285Pro Asn Thr Thr Thr Leu Met Thr Gln Gln Ala Gly Glu Ser Ser Glu 290 295 300Thr Gln Arg Ser Ser Leu Leu Ile Asp Glu Ser Ser Thr Thr Leu Arg305 310 315 320Gln Val Asn Leu Leu Ala Thr Thr Asp Phe Ser Ile Asp Pro Thr Glu 325 330 335Glu Thr Asp Ser Asn Pro Tyr Gly Arg Leu Met Leu Gly Val Phe Val 340 345 350Arg Gln Phe Glu Gly Asp Gly Ala Asn Arg Lys Asn Lys Pro Val Val 355 360 365Tyr Gly Tyr Leu Tyr Cys Asp Ser Ala Phe Asn Arg His Val Leu Arg 370 375 380Pro Leu Ser Lys Asn Phe Leu Phe Ser Thr Tyr Arg Asp Glu Thr Asp385 390 395 400Gly Gln Asn Ser Leu Gln Phe Ala Val Tyr Asp Lys Lys Tyr Val Ile 405 410 415Thr Lys Val Val Thr Gly Ala Thr Glu Asp Pro Glu Asn Thr Gly Trp 420 425 430Val Ser Lys Val Asp Asp Leu Lys Gln Gly Thr Thr Gly Ala Tyr Val 435 440 445Tyr Ile Asp Gln Asp Gly Leu Thr Leu His Ile Gln Thr Thr Thr Asn 450 455 460Gly Asp Phe Ile Asn Arg His Thr Phe Gly Tyr Asn Asp Leu Val Tyr465 470 475 480Asp Ser Lys Ser Gly Tyr Gly Phe Thr Trp Ser Gly Asn Glu Gly Phe 485 490 495Tyr Leu Asp Tyr His Asp Gly Asn Tyr Tyr Thr Phe His Asn Ala Ile 500 505 510Ile Asn Tyr Tyr Pro Ser Gly Tyr Gly Gly Gly Ser Val Pro Asn Gly 515 520 525Thr Trp Ala Leu Glu Gln Arg Ile Asn Glu Gly Trp Ala Ile Ala Pro 530 535 540Leu Leu Asp Thr Leu His Thr Val Thr Val Lys Gly Ser Tyr Ile Ala545 550 555 560Trp Glu Gly Glu Thr Pro Thr Gly Tyr Asn Leu Tyr Ile Pro Asp Gly 565 570 575Thr Val Leu Leu Asp Trp Phe Asp Lys Ile Asn Phe Ala Ile Gly Leu 580 585 590Asn Lys Leu Glu Ser Val Phe Thr Ser Pro Asp Trp Pro Thr Leu Thr 595 600 605Thr Ile Lys Asn Phe Ser Lys Ile Ala Asp Asn Arg Lys Phe Tyr Gln 610 615 620Glu Ile Asn Ala Glu Thr Ala Asp Gly Arg Asn Leu Phe Lys Arg Tyr625 630 635 640Ser Thr Gln Thr Phe Gly Leu Thr Ser Gly Ala Thr Tyr Ser Thr Thr 645 650 655Tyr Thr Leu Ser Glu Ala Asp Phe Ser Thr Asp Pro Asp Lys Asn Tyr 660 665 670Leu Gln Val Cys Leu Asn Val Val Trp Asp His Tyr Asp Arg Pro Ser 675 680 685Gly Lys Lys Gly Ala Tyr Ser Trp Val Ser Lys Trp Phe Asn Val Tyr 690 695 700Val Ala Leu Gln Asp Ser Lys Ala Pro Asp Ala Ile Pro Arg Leu Val705 710 715 720Ser Arg Tyr Asp Ser Lys Arg Gly Leu Val Gln Tyr Leu Asp Phe Trp 725 730 735Thr Ser Ser Leu Pro Ala Lys Thr Arg Leu Asn Thr Thr Phe Val Arg 740 745 750Thr Leu Ile Glu Lys Ala Asn Leu Gly Leu Asp Ser Leu Leu Asp Tyr 755 760 765Thr Leu Gln Ala Asp Pro Ser Leu Glu Ala Asp Leu Val Thr Asp Gly 770 775 780Lys Ser Glu Pro Met Asp Phe Asn Gly Ser Asn Gly Leu Tyr Phe Trp785 790 795 800Glu Leu Phe Phe His Leu Pro Phe Leu Val Ala Thr Arg Phe Ala Asn 805 810 815Glu Gln Gln Phe Ser Pro Ala Gln Lys Ser Leu His Tyr Ile Phe Asp 820 825 830Pro Ala Met Lys Asn Lys Pro His Asn Ala Pro Ala Tyr Trp Asn Val 835 840 845Arg Pro Leu Val Glu Gly Asn Ser Asp Leu Ser Arg His Leu Asp Asp 850 855 860Ser Ile Asp Pro Asp Thr Gln Ala Tyr Ala His Pro Val Ile Tyr Gln865 870 875 880Lys Ala Val Phe Ile Ala Tyr Val Ser Asn Leu Ile Ala Gln Gly Asp 885 890 895Met Trp Tyr Arg Gln Leu Thr Arg Asp Gly Leu Thr Gln Ala Arg Val 900 905 910Tyr Tyr Asn Leu Ala Ala Glu Leu Leu Gly Pro Arg Pro Asp Val Ser 915 920 925Leu Ser Ser Ile Trp Thr Pro Gln Thr Leu Asp Thr Leu Ala Ala Gly 930 935 940Gln Lys Ala Val Leu Arg Asp Phe Glu His Gln Leu Ala Asn Ser Asp945 950 955 960Thr Ala Leu Pro Ala Leu Pro Gly Arg Asn Val Ser Tyr Leu Lys Leu 965 970 975Ala Asp Asn Gly Tyr Phe Asn Glu Pro Leu Asn Val Leu Met Leu Ser 980 985 990His Trp Asp Thr Leu Asp Ala Arg Leu Tyr Asn Leu Arg His Asn Leu 995 1000 1005Thr Val Asp Gly Lys Pro Leu Ser Leu Pro Leu Tyr Ala Ala Pro Val 1010 1015 1020Asp Pro Val Ala Leu Leu Ala Gln Arg Ala Gln Ser Gly Thr Leu Thr1025 1030 1035 1040Asn Gly Val Ser Gly Ala Met Leu Thr Val Pro Pro Tyr Arg Phe Ser 1045 1050 1055Ala Met Leu Pro Arg Ala Tyr Ser Ala Val Gly Thr Leu Thr Ser Phe 1060 1065 1070Gly Gln Asn Leu Leu Ser Leu Leu Glu Arg Ser Glu Arg Ala Cys Gln 1075 1080 1085Glu Glu Leu Ala Gln Gln Gln Leu Leu Asp Met Ser Ser Tyr Ala Ile 1090 1095 1100Thr Leu Gln Gln Gln Ala Leu Asp Gly Leu Ala Ala Asp Arg Leu Ala1105 1110 1115 1120Leu Leu Ala Ser Gln Ala Thr Ala Gln Gln Arg His Asp His Tyr Tyr 1125 1130 1135Thr Leu Tyr Gln Asn Asn Ile Ser Ser Ala Glu Gln Leu Val Met Asp 1140 1145 1150Thr Gln Thr Ser Ala Gln Ser Leu Ile Ser Ser Ser Thr Gly Val Gln 1155 1160 1165Thr Ala Ser Gly Ala Leu Lys Val Ile Pro Asn Ile Phe Gly Leu Ala 1170 1175 1180Asp Gly Gly Ser Arg Tyr Glu Gly Val Thr Glu Ala Ile Ala Ile Gly1185 1190 1195 1200Leu Met Ala Ala Gly Gln Ala Thr Ser Val Val Ala Glu Arg Leu Ala 1205 1210 1215Thr Thr Glu Asn Tyr Arg Arg Arg Arg Glu Glu Trp Gln Ile Gln Tyr 1220 1225 1230Gln Gln Ala Gln Ser Glu Val Asp Ala Leu Gln Lys Gln Leu Asp Ala 1235 1240 1245Leu Ala Val Arg Glu Lys Ala Ala Gln Thr Ser Leu Gln Gln Ala Lys 1250 1255 1260Ala Gln Gln Val Gln Ile Arg Thr Met Leu Thr Tyr Leu Thr Thr Arg1265 1270 1275 1280Phe Thr Gln Ala Thr Leu Tyr Gln Trp Leu Ser Gly Gln Leu Ser Ala 1285 1290 1295Leu Tyr Tyr Gln Ala Tyr Asp Ala Val Val Ala Leu Cys Leu Ser Ala 1300 1305 1310Gln Ala Cys Trp Gln Tyr Glu Leu Gly Asp Tyr Ala Thr Thr Phe Ile 1315 1320 1325Gln Thr Gly Thr Trp Asn Asp His Tyr Arg Gly Leu Gln Val Gly Glu 1330 1335 1340Thr Leu Gln Leu Asn Leu His Gln Met Glu Ala Ala Tyr Leu Val Arg1345 1350 1355 1360His Glu Arg Arg Leu Asn Val Ile Arg Thr Val Ser Leu Lys Ser Leu 1365 1370 1375Leu Gly Asp Asp Gly Phe Gly Lys Leu Lys Thr Glu Gly Lys Val Asp 1380 1385 1390Phe Pro Leu Ser Glu Lys Leu Phe Asp Asn Asp Tyr Pro Gly His Tyr 1395 1400 1405Leu Arg Gln Ile Lys Thr Val Ser Val Thr Leu Pro Thr Leu Val Gly 1410 1415 1420Pro Tyr Gln Asn Val Lys Ala Thr Leu Thr Gln Thr Ser Ser Ser Ile1425 1430 1435 1440Leu Leu Ala Ala Asp Ile Asn Gly Val Lys Arg Leu Asn Asp Pro Thr 1445 1450 1455Gly Lys Glu Gly Asp Ala Thr His Ile Val Thr Asn Leu Arg Ala Ser 1460 1465 1470Gln Gln Val Ala Leu Ser Ser Gly Ile Asn Asp Ala Gly Ser Phe Glu 1475 1480 1485Leu Arg Leu Glu Asp Glu Arg Tyr Leu Ser Phe Glu Gly Thr Gly Ala 1490 1495 1500Val Ser Lys Trp Thr Leu Asn Phe Pro Arg Ser Val Asp Glu His Ile1505 1510 1515 1520Asp Asp Lys Thr Leu Lys Ala Asp Glu Met Gln Ala Ala Leu Leu Ala 1525 1530 1535Asn Met Asp Asp Val Leu Val Gln Val His Tyr Thr Ala Cys Asp Gly 1540 1545 1550Gly Ala Ser Phe Ala Asn Gln Val Lys Lys Thr Leu Ser 1555 1560 1565 3132 base pairs nucleic acid double linear DNA (genomic) 60ATG AGT CCG TCT GAG ACT ACT CTT TAT ACT CAA ACC CCA ACA GTC AGC 48Met Ser Pro Ser Glu Thr Thr Leu Tyr Thr Gln Thr Pro Thr Val Ser1 5 10 15GTG TTA GAT AAT CGC GGT CTG TCC ATT CGT GAT ATT GGT TTT CAC CGT 96Val Leu Asp Asn Arg Gly Leu Ser Ile Arg Asp Ile Gly Phe His Arg 20 25 30ATT GTA ATC GGG GGG GAT ACT GAC ACC CGC GTC ACC CGT CAC CAG TAT 144Ile Val Ile Gly Gly Asp Thr Asp Thr Arg Val Thr Arg His Gln Tyr 35 40 45GAT GCC CGT GGA CAC CTG AAC TAC AGT ATT GAC CCA CGC TTG TAT GAT 192Asp Ala Arg Gly His Leu Asn Tyr Ser Ile Asp Pro Arg Leu Tyr Asp 50 55 60GCA AAG CAG GCT GAT AAC TCA GTA AAG CCT AAT TTT GTC TGG CAG CAT 240Ala Lys Gln Ala Asp Asn Ser Val Lys Pro Asn Phe Val Trp Gln His65 70 75 80GAT CTG GCC GGT CAT GCC CTG CGG ACA GAG AGT GTC GAT GCT GGT CGT 288Asp Leu Ala Gly His Ala Leu Arg Thr Glu Ser Val Asp Ala Gly Arg 85 90 95ACT GTT GCA TTG AAT GAT ATT GAA GGT CGT TCG GTA ATG ACA ATG AAT 336Thr Val Ala Leu Asn Asp Ile Glu Gly Arg Ser Val Met Thr Met Asn 100 105 110GCG ACC GGT GTT CGT CAG ACC CGT CGC TAT GAA GGC AAC ACC TTG CCC 384Ala Thr Gly Val Arg Gln Thr Arg Arg Tyr Glu Gly Asn Thr Leu Pro 115 120 125GGT CGC TTG TTA TCT GTG AGC GAG CAA GTT TTC AAC CAA GAG AGT GCT 432Gly Arg Leu Leu Ser Val Ser Glu Gln Val Phe Asn Gln Glu Ser Ala 130 135 140AAA GTG ACA GAG CGC TTT ATC TGG GCT GGG AAT ACA ACC TCG GAG AAA 480Lys Val Thr Glu Arg Phe Ile Trp Ala Gly Asn Thr Thr Ser Glu Lys145 150 155 160GAG TAT AAC CTC TCC GGT CTG TGT ATA CGC CAC TAC GAC ACA GCG GGA 528Glu Tyr Asn Leu Ser Gly Leu Cys Ile Arg His Tyr Asp Thr Ala Gly 165 170 175GTG ACC CGG TTG ATG AGT CAG TCA CTG GCG GGC GCC ATG CTA TCC CAA 576Val Thr Arg Leu Met Ser Gln Ser Leu Ala Gly Ala Met Leu Ser Gln 180 185 190TCT CAC CAA TTG CTG GCG GAA GGG CAG GAG GCT AAC TGG AGC GGT GAC 624Ser His Gln Leu Leu Ala Glu Gly Gln Glu Ala Asn Trp Ser Gly Asp 195 200 205GAC GAA ACT GTC TGG CAG GGA ATG CTG GCA AGT GAG GTC TAT ACG ACA 672Asp Glu Thr Val Trp Gln Gly Met Leu Ala Ser Glu Val Tyr Thr Thr 210 215 220CAA AGT ACC ACT AAT GCC ATC GGG GCT TTA CTG ACC CAA ACC GAT GCG 720Gln Ser Thr Thr Asn Ala Ile Gly Ala Leu Leu Thr Gln Thr Asp Ala225 230 235 240AAA GGC AAT ATT CAG CGT CTG GCT TAT GAC ATT GCC GGT CAG TTA AAA 768Lys Gly Asn Ile Gln Arg Leu Ala Tyr Asp Ile Ala Gly Gln Leu Lys 245 250 255GGG AGT TGG TTG ACG GTG AAA GGC CAG AGT GAA CAG GTG ATT GTT AAG 816Gly Ser Trp Leu Thr Val Lys Gly Gln Ser Glu Gln Val Ile Val Lys 260 265 270TCC CTG AGC TGG TCA GCC GCA GGT CAT AAA TTG CGT GAA GAG CAC GGT 864Ser Leu Ser Trp Ser Ala Ala Gly His Lys Leu Arg Glu Glu His Gly 275 280 285AAC GGC GTG GTT ACG GAG TAC AGT TAT GAG CCG GAA ACT CAA CGT CTG 912Asn Gly Val Val Thr Glu Tyr Ser Tyr Glu Pro Glu Thr Gln Arg Leu 290 295 300ATA GGT ATC ACC ACC CGG CGT GCC GAA GGG AGT CAA TCA GGA GCC AGA 960Ile Gly Ile Thr Thr Arg Arg Ala Glu Gly Ser Gln Ser Gly Ala Arg305 310 315 320GTA TTG CAG GAT CTA CGC TAT AAG TAT GAT CCG GTG GGG AAT GTT ATC 1008Val Leu Gln Asp Leu Arg Tyr Lys Tyr Asp Pro Val Gly Asn Val Ile 325 330 335AGT ATC CAT AAT GAT GCC GAA GCT ACC CGC TTT TGG CGT AAT CAG AAA 1056Ser Ile His Asn Asp Ala Glu Ala Thr Arg Phe Trp Arg Asn Gln Lys 340 345 350GTG GAG CCG GAG AAT CGC TAT GTT TAT GAT TCT CTG TAT CAG CTT ATG 1104Val Glu Pro Glu Asn Arg Tyr Val Tyr Asp Ser Leu Tyr Gln Leu Met 355 360 365AGT GCG ACA GGG CGT GAA ATG GCT AAT ATC GGT CAG CAA AGC AAC CAA 1152Ser Ala Thr Gly Arg Glu Met Ala Asn Ile Gly Gln Gln Ser Asn Gln 370 375 380CTT CCC TCA CCC GTT ATA CCT GTT CCT ACT GAC GAC AGC ACT TAT ACC 1200Leu Pro Ser Pro Val Ile Pro Val Pro Thr Asp Asp Ser Thr Tyr Thr385 390 395 400AAT TAC CTT CGT ACC TAT ACT TAT GAC CGT GGC GGT AAT TTG GTT CAA 1248Asn Tyr Leu Arg Thr Tyr Thr Tyr Asp Arg Gly Gly Asn Leu Val Gln 405 410 415ATC CGA CAC AGT TCA CCC GCG ACT CAA AAT AGT TAC ACC ACA GAT ATC 1296Ile Arg His Ser Ser Pro Ala Thr Gln Asn Ser Tyr Thr Thr Asp Ile 420 425 430ACC GTT TCA AGC CGC AGT AAC CGG GCG GTA TTG AGT ACA TTA ACG ACA 1344Thr Val Ser Ser Arg Ser Asn Arg Ala Val Leu Ser Thr Leu Thr Thr 435 440 445GAT CCA ACC CGA GTG GAT GCG CTA TTT GAT TCC GGC GGT CAT CAG AAG 1392Asp Pro Thr Arg Val Asp Ala Leu Phe Asp Ser Gly Gly His Gln Lys 450 455 460ATG TTA ATA CCG GGG CAA AAT CTG GAT TGG AAT ATT CGG GGT GAA TTG 1440Met Leu Ile Pro Gly Gln Asn Leu Asp Trp Asn Ile Arg Gly Glu Leu465 470 475 480CAA CGA GTC ACA CCG GTG AGC CGT GAA AAT AGC AGT GAC AGT GAA TGG 1488Gln Arg Val Thr Pro Val Ser Arg Glu Asn Ser Ser Asp Ser Glu Trp 485 490 495TAT CGC TAT AGC AGT GAT GGC ATG CGG CTG CTA AAA GTG AGT GAA CAG 1536Tyr Arg Tyr Ser Ser Asp Gly Met Arg Leu Leu Lys Val Ser Glu Gln 500 505 510CAG ACG GGC AAC AGT ACT CAA GTA CAA CGG GTG ACT TAT CTG CCG GGA 1584Gln Thr Gly Asn Ser Thr Gln Val Gln Arg Val Thr Tyr Leu Pro Gly 515 520 525TTA GAG CTA CGG ACA ACT GGG GTT GCA GAT AAA ACA ACC GAA GAT TTG 1632Leu Glu Leu Arg Thr Thr Gly Val Ala Asp Lys Thr Thr Glu Asp Leu 530 535 540CAG GTG ATT ACG GTA GGT GAA GCG GGT CGC GCA CAG GTA AGG GTA TTG 1680Gln Val Ile Thr Val Gly Glu Ala Gly Arg Ala Gln Val Arg Val Leu545 550 555 560CAC TGG GAA AGT GGT AAG CCG ACA GAT ATT GAC AAC AAT CAG GTG CGC 1728His Trp Glu Ser Gly Lys Pro Thr Asp Ile Asp Asn Asn Gln Val Arg 565 570 575TAC AGC TAC GAT AAT CTG CTT GGC TCC AGC CAG CTT GAA CTG GAT AGC 1776Tyr Ser Tyr Asp Asn Leu Leu Gly Ser Ser Gln Leu Glu Leu Asp Ser 580 585 590GAA GGG CAG ATT CTC AGT CAG GAA GAG TAT TAT CCG TAT GGC GGT ACG 1824Glu Gly Gln Ile Leu Ser Gln Glu Glu Tyr Tyr Pro Tyr Gly Gly Thr 595 600 605GCG ATA TGG GCG GCG AGA AAT CAG ACA GAA GCC AGC TAC AAA TTT ATT 1872Ala Ile Trp Ala Ala Arg Asn Gln Thr Glu Ala Ser Tyr Lys Phe Ile 610 615 620CGT TAC TCC GGT AAA GAG CGG GAT GCC ACT GGA TTG TAT TAT TAC GGC 1920Arg Tyr Ser Gly Lys Glu Arg Asp Ala Thr Gly Leu Tyr Tyr Tyr Gly625 630 635 640TAC CGT TAT TAT CAA CCT TGG GTG GGT CGA TGG TTG AGT GCT GAT CCG 1968Tyr Arg Tyr Tyr Gln Pro Trp Val Gly Arg Trp Leu Ser Ala Asp Pro 645 650 655GCG GGA ACC GTG GAT GGG CTG AAT TTG TAC CGA ATG GTG AGG AAT AAC 2016Ala Gly Thr Val Asp Gly Leu Asn Leu Tyr Arg Met Val Arg Asn Asn 660 665 670CCC ATC ACA TTG ACT GAC CAT GAC GGA TTA GCA CCG TCT CCA AAT AGA 2064Pro Ile Thr Leu Thr Asp His Asp Gly Leu Ala Pro Ser Pro Asn Arg 675 680 685AAT CGA AAT ACA TTT TGG TTT GCT TCA TTT TTG TTT CGT AAA CCT GAT 2112Asn Arg Asn Thr Phe Trp Phe Ala Ser Phe Leu Phe Arg Lys Pro Asp 690 695 700GAG GGA ATG TCC GCG TCA ATG AGA CGG GGA CAA AAA ATT GGC AGA GCC 2160Glu Gly Met Ser Ala Ser Met Arg Arg Gly Gln Lys Ile Gly Arg Ala705 710 715 720ATT GCC GGC GGG ATT GCG ATT GGC GGT CTT GCG GCT ACC ATT GCC GCT 2208Ile Ala Gly Gly Ile Ala Ile Gly Gly Leu Ala Ala Thr Ile Ala Ala 725 730 735ACG GCT GGC GCG GCT ATC CCC GTC ATT CTG GGG GTT GCG GCC GTA GGC 2256Thr Ala Gly Ala Ala Ile Pro Val Ile Leu Gly Val Ala Ala Val Gly 740 745 750GCG GGG ATT GGC GCG TTG ATG GGA TAT AAC GTC GGT AGC CTG CTG GAA 2304Ala Gly Ile Gly Ala Leu Met Gly Tyr Asn Val Gly Ser Leu Leu Glu 755 760 765AAA GGC GGG GCA TTA CTT GCT CGA CTC GTA CAG GGG AAA TCG ACG TTA 2352Lys Gly Gly Ala Leu Leu Ala Arg Leu Val Gln Gly Lys Ser Thr Leu 770 775 780GTA CAG TCG GCG GCT GGC GCG GCT GCC GGA GCG AGT TCA GCC GCG GCT 2400Val Gln Ser Ala Ala Gly Ala Ala Ala Gly Ala Ser Ser Ala Ala Ala785 790 795 800TAT GGC GCA CGG GCA CAA GGT GTC GGT GTT GCA TCA GCC GCC GGG GCG 2448Tyr Gly Ala Arg Ala Gln Gly Val Gly Val Ala Ser Ala Ala Gly Ala 805 810 815GTA ACA GGG GCT GTG GGA TCA TGG ATA AAT AAT GCT GAT CGG GGG ATT 2496Val Thr Gly Ala Val Gly Ser Trp Ile Asn Asn Ala Asp Arg Gly Ile 820 825 830GGC GGC GCT ATT GGG GCC GGG AGT GCG GTA GGC ACC ATT GAT ACT ATG 2544Gly Gly Ala Ile Gly Ala Gly Ser Ala Val Gly Thr Ile Asp Thr Met 835 840 845TTA GGG ACT GCC TCT ACC CTT ACC CAT GAA GTC GGG GCA GCG GCG GGT 2592Leu Gly Thr Ala Ser Thr Leu Thr His Glu Val Gly Ala Ala Ala Gly 850 855 860GGG GCG GCG GGT GGG ATG ATC ACC GGT ACG CAA GGG AGT ACT CGG GCA 2640Gly Ala Ala Gly Gly Met Ile Thr Gly Thr Gln Gly Ser Thr Arg Ala865 870 875 880GGT ATC CAT GCC GGT ATT GGC ACC TAT TAT GGC TCC TGG ATT GGT TTT 2688Gly Ile His Ala Gly Ile Gly Thr Tyr Tyr Gly Ser Trp Ile Gly Phe 885 890 895GGT TTA GAT GTC GCT AGT AAC CCC GCC GGA CAT TTA GCG AAT TAC GCA 2736Gly Leu Asp Val Ala Ser Asn Pro Ala Gly His Leu Ala Asn Tyr Ala 900 905 910GTG GGT TAT GCC GCT GGT TTG GGT GCT GAA ATG GCT GTC AAC AGA ATA 2784Val Gly Tyr Ala Ala Gly Leu Gly Ala Glu Met Ala Val Asn Arg Ile 915 920 925ATG GGT GGT GGA TTT TTG AGT AGG CTC TTA GGC CGG GTT GTC AGC CCA 2832Met Gly Gly Gly Phe Leu Ser Arg Leu Leu Gly Arg Val Val Ser Pro 930 935 940TAT GCC GCC GGT TTA GCC AGA CAA TTA GTA CAT TTC AGT GTC GCC AGA 2880Tyr Ala Ala Gly Leu Ala Arg Gln Leu Val His Phe Ser Val Ala Arg945 950 955 960CCT GTC TTT GAG CCG ATA TTT AGT GTT CTC GGC GGG CTT GTC GGT GGT 2928Pro Val Phe Glu Pro Ile Phe Ser Val Leu Gly Gly Leu Val Gly Gly 965 970 975ATT GGA ACT GGC CTG CAC AGA GTG ATG GGA AGA GAG AGT TGG ATT TCC 2976Ile Gly Thr Gly Leu His Arg Val Met Gly Arg Glu Ser Trp Ile Ser 980 985 990AGA GCG TTA AGT GCT GCC GGT AGT GGT ATA GAT CAT GTC GCT GGC ATG 3024Arg Ala Leu Ser Ala Ala Gly Ser Gly Ile Asp His Val Ala Gly Met 995 1000 1005ATT GGT AAT CAG ATC AGA GGC AGG GTC TTG ACC ACA ACC GGG ATC GCT 3072Ile Gly Asn Gln Ile Arg Gly Arg Val Leu Thr Thr Thr Gly Ile Ala 1010 1015 1020AAT GCG ATA GAC TAT GGC ACC AGT GCT GTG GGA GCC GCA CGA CGA GTT 3120Asn Ala Ile Asp Tyr Gly Thr Ser Ala Val Gly Ala Ala Arg Arg Val1025 1030 1035 1040TTT TCT TTG TAA 3132Phe Ser Leu 1043 amino acids amino acid linear protein 61Met Ser Pro Ser Glu Thr Thr Leu Tyr Thr Gln Thr Pro Thr Val Ser1 5 10 15Val Leu Asp Asn Arg Gly Leu Ser Ile Arg Asp Ile Gly Phe His Arg 20 25 30Ile Val Ile Gly Gly Asp Thr Asp Thr Arg Val Thr Arg His Gln Tyr 35 40 45Asp Ala Arg Gly His Leu Asn Tyr Ser Ile Asp Pro Arg Leu Tyr Asp 50 55 60Ala Lys Gln Ala Asp Asn Ser Val Lys Pro Asn Phe Val Trp Gln His65 70 75 80Asp Leu Ala Gly His Ala Leu Arg Thr Glu Ser Val Asp Ala Gly Arg 85 90 95Thr Val Ala Leu Asn Asp Ile Glu Gly Arg Ser Val Met Thr Met Asn 100 105 110Ala Thr Gly Val Arg Gln Thr Arg Arg Tyr Glu Gly Asn Thr Leu Pro 115 120 125Gly Arg Leu Leu Ser Val Ser Glu Gln Val Phe Asn Gln Glu Ser Ala 130 135 140Lys Val Thr Glu Arg Phe Ile Trp Ala Gly Asn Thr Thr Ser Glu Lys145 150 155 160Glu Tyr Asn Leu Ser Gly Leu Cys Ile Arg His Tyr Asp Thr Ala Gly 165 170 175Val Thr Arg Leu Met Ser Gln Ser Leu Ala Gly Ala Met Leu Ser Gln 180 185 190Ser His Gln Leu Leu Ala Glu Gly Gln Glu Ala Asn Trp Ser Gly Asp 195 200 205Asp Glu Thr Val Trp Gln Gly Met Leu Ala Ser Glu Val Tyr Thr Thr 210 215 220Gln Ser Thr Thr Asn Ala Ile Gly Ala Leu Leu Thr Gln Thr Asp Ala225 230 235 240Lys Gly Asn Ile Gln Arg Leu Ala Tyr Asp Ile Ala Gly Gln Leu Lys 245 250 255Gly Ser Trp Leu Thr Val Lys Gly Gln Ser Glu Gln Val Ile Val Lys 260 265 270Ser Leu Ser Trp Ser Ala Ala Gly His Lys Leu Arg Glu Glu His Gly 275 280 285Asn Gly Val Val Thr Glu Tyr Ser Tyr Glu Pro Glu Thr Gln Arg Leu 290 295 300Ile Gly Ile Thr Thr Arg Arg Ala Glu Gly Ser Gln Ser Gly Ala Arg305 310 315 320Val Leu Gln Asp Leu Arg Tyr Lys Tyr Asp Pro Val Gly Asn Val Ile 325 330 335Ser Ile His Asn Asp Ala Glu Ala Thr Arg Phe Trp Arg Asn Gln Lys 340 345 350Val Glu Pro Glu Asn Arg Tyr Val Tyr Asp Ser Leu Tyr Gln Leu Met 355 360 365Ser Ala Thr Gly Arg Glu Met Ala Asn Ile Gly Gln Gln Ser Asn Gln 370 375 380Leu Pro Ser Pro Val Ile Pro Val Pro Thr Asp Asp Ser Thr Tyr Thr385 390 395 400Asn Tyr Leu Arg Thr Tyr Thr Tyr Asp Arg Gly Gly Asn Leu Val Gln 405 410 415Ile Arg His Ser Ser Pro Ala Thr Gln Asn Ser Tyr Thr Thr Asp Ile 420 425 430Thr Val Ser Ser Arg Ser Asn Arg Ala Val Leu Ser Thr Leu Thr Thr 435 440 445Asp Pro Thr Arg Val Asp Ala Leu Phe Asp Ser Gly Gly His Gln Lys 450 455 460Met Leu Ile Pro Gly Gln Asn Leu Asp Trp Asn Ile Arg Gly Glu Leu465 470 475 480Gln Arg Val Thr Pro Val Ser Arg Glu Asn Ser Ser Asp Ser Glu Trp 485 490 495Tyr Arg Tyr Ser Ser Asp Gly Met Arg Leu Leu Lys Val Ser Glu Gln 500 505 510Gln Thr Gly Asn Ser Thr Gln Val Gln Arg Val Thr Tyr Leu Pro Gly 515 520 525Leu Glu Leu Arg Thr Thr Gly Val Ala Asp Lys Thr Thr Glu Asp Leu 530 535 540Gln Val Ile Thr Val Gly Glu Ala Gly Arg Ala Gln Val Arg Val Leu545 550 555 560His Trp Glu Ser Gly Lys Pro Thr Asp Ile Asp Asn Asn Gln Val Arg 565 570 575Tyr Ser Tyr Asp Asn Leu Leu Gly Ser Ser Gln Leu Glu Leu Asp Ser 580 585 590Glu Gly Gln Ile Leu Ser Gln Glu Glu Tyr Tyr Pro Tyr Gly Gly Thr 595 600 605Ala Ile Trp Ala Ala Arg Asn Gln Thr Glu Ala Ser Tyr Lys Phe Ile 610 615 620Arg Tyr Ser Gly Lys Glu Arg Asp Ala Thr Gly Leu Tyr Tyr Tyr Gly625 630 635 640Tyr Arg Tyr Tyr Gln Pro Trp Val Gly Arg Trp Leu Ser Ala Asp Pro 645 650 655Ala Gly Thr Val Asp Gly Leu Asn Leu Tyr Arg Met Val Arg Asn Asn 660 665 670Pro Ile Thr Leu Thr Asp His Asp Gly Leu Ala Pro Ser Pro Asn Arg 675 680 685Asn Arg Asn Thr Phe Trp Phe Ala Ser Phe Leu Phe Arg Lys Pro Asp 690 695 700Glu Gly Met Ser Ala Ser Met Arg Arg Gly Gln Lys Ile Gly Arg Ala705 710 715 720Ile Ala Gly Gly Ile Ala Ile Gly Gly Leu Ala Ala Thr Ile Ala Ala 725 730 735Thr Ala Gly Ala Ala Ile Pro Val Ile Leu Gly Val Ala Ala Val Gly 740 745 750Ala Gly Ile Gly Ala Leu Met Gly Tyr Asn Val Gly Ser Leu Leu Glu 755 760 765Lys Gly Gly Ala Leu Leu Ala Arg Leu Val Gln Gly Lys Ser Thr Leu 770 775 780Val Gln Ser Ala Ala Gly Ala Ala Ala Gly Ala Ser Ser Ala Ala Ala785 790 795 800Tyr Gly Ala Arg Ala Gln Gly Val Gly Val Ala Ser Ala Ala Gly Ala 805 810 815Val Thr Gly Ala Val Gly Ser Trp Ile Asn Asn Ala Asp Arg Gly Ile 820 825 830Gly Gly Ala Ile Gly Ala Gly Ser Ala Val Gly Thr Ile Asp Thr Met 835 840 845Leu Gly Thr Ala Ser Thr Leu Thr His Glu Val Gly Ala Ala Ala Gly 850 855 860Gly Ala Ala Gly Gly Met Ile Thr Gly Thr Gln Gly Ser Thr Arg Ala865 870 875 880Gly Ile His Ala Gly Ile Gly Thr Tyr Tyr Gly Ser Trp Ile Gly Phe 885 890 895Gly Leu Asp Val Ala Ser Asn Pro Ala Gly His Leu Ala Asn Tyr Ala 900 905 910Val Gly Tyr Ala Ala Gly Leu Gly Ala Glu Met Ala Val Asn Arg Ile 915 920 925Met Gly Gly Gly Phe Leu Ser Arg Leu Leu Gly Arg Val Val Ser Pro 930 935 940Tyr Ala Ala Gly Leu Ala Arg Gln Leu Val His Phe Ser Val Ala Arg945 950 955 960Pro Val Phe Glu Pro Ile Phe Ser Val Leu Gly Gly Leu Val Gly Gly 965 970 975Ile Gly Thr Gly Leu His Arg Val Met Gly Arg Glu Ser Trp Ile Ser 980 985 990Arg Ala Leu Ser Ala Ala Gly Ser Gly Ile Asp His Val Ala Gly Met 995 1000 1005Ile Gly Asn Gln Ile Arg Gly Arg Val Leu Thr Thr Thr Gly Ile Ala 1010 1015 1020Asn Ala Ile Asp Tyr Gly Thr Ser Ala Val Gly Ala Ala Arg Arg Val1025 1030 1035 1040Phe Ser Leu 5 amino acids amino acid linear protein internal 62Asn Ile Gly Gly Asp1 5 20 amino acids amino acid linear protein internal 63Cys Leu Arg Gly Asn Ser Pro Thr Asn Pro Asp Lys Asp Gly Ile1 5 10 15Phe Ala Gln Val Ala20 20 amino acids amino acid linear protein Internal 64Cys Tyr Thr Pro Asp Gln Thr Pro Ser Phe Tyr Glu Thr Ala Phe1 5 10 15Arg Ser Ala Asp Gly20 19 amino acids amino acid linear protein Internal 65His Gly Gln Ser Tyr Asn Asp Asn Asn Tyr Cys Asn Phe Thr Leu1 5 10 15Ser Ile Asn Thr 20 amino acids amino acid linear protein internal 66Cys Val Asp Pro Lys Thr Leu Gln Arg Gln Gln Ala Gly Gly Asp1 5 10 15Gly Thr Gly Ser Ser20 20 amino acids amino acid linear protein internal 67Cys Tyr Lys Ala Pro Gln Arg Gln Glu Asp Gly Asp Ser Asn Ala1 5 10 15Val Thr Tyr Asp Lys20 20 amino acids amino acid linear protein internal 68Cys Tyr Asn Glu Asn Pro Ser Ser Glu Asp Lys Lys Trp Tyr Phe1 5 10 15Ser Ser Lys Asp Asp20 20 amino acids amino acid linear protein internal 69Cys Phe Asp Ser Tyr Ser Gln Leu Tyr Glu Glu Asn Ile Asn Ala1 5 10 15Gly Glu Gln Arg Ala20 22 amino acids amino acid linear protein internal 70Cys Asn Pro Asn Asn Ser Ser Asn Lys Leu Met Phe Tyr Pro Val1 5 10 15Tyr Gln Tyr Ser Gly Asn Thr20 20 amino acids amino acid linear protein internal 71Val Ser Gln Gly Ser Gly Ser Ala Gly Ser Gly Asn Asn Asn Leu1 5 10 15Ala Phe Gly Ala Gly20 12 amino acids amino acid linear protein N-terminal 72Met Gln Asp Ser Pro Glu Val Ala Ile Thr Thr Leu1 5 10 8 amino acids amino acid linear protein N-terminal 73Met Gln Arg Ser Ser Glu Val Ser1 5 10 amino acids amino acid linear protein N-terminal 74Met Gln Asp Ile Pro Glu Val Gln Leu Asn1 5 10 12 amino acids amino acid linear protein N-terminal 75Met Gln Asp Ser Pro Glu Val Ser Val Thr Gln Asn1 5 10 15 amino acids amino acid linear protein N-terminal 76Ser Glu Ser Leu Phe Thr Gln Ser Leu Lys Glu Ala Arg Arg Asp1 5 10 15 14 amino acids amino acid linear protein N-terminal 77Met Asn Leu Ile Glu Ala Lys Leu Gln Glu Asn Arg Asp Ala1 5 10 15 amino acids amino acid linear protein N-terminal 78Met Leu Ser Thr Met Glu Lys Gln Leu Asn Glu Ser Gln Arg Asp1 5 10 15 15 amino acids amino acid linear protein N-terminal 79Met Leu Asp Ile Met Glu Lys Gln Leu Asn Glu Ser Glu Arg Asp1 5 10 15 8 amino acids amino acid linear protein N-terminal 80Met Gln Asp Ser Arg Glu Val Ser1 5 12 amino acids amino acid linear protein N-terminal 81Leu Arg Ser Ala Xaa Ser Ala Leu Thr Thr Leu Leu1 5 10 15 amino acids amino acid linear protein N-terminal 82Leu Lys Leu Ala Asp Asn Gly Tyr Phe Asn Glu Pro Leu Asn Val1 5 10 15 14 amino acids amino acid linear protein N-terminal 83Leu Lys Leu Ala Asp Asn Ser Tyr Phe Asn Glu Pro Leu Asn1 5 10 15 amino acids amino acid linear protein N-terminal 84Ser Lys Asp Glu Ser Lys Ala Asp Ser Gln Leu Val Tyr His Thr1 5 10 15 14 amino acids amino acid linear protein N-terminal 85Met Lys Lys Arg Gly Leu Thr Thr Asn Ala Gly Ala Pro Val1 5 10 15 amino acids amino acid linear protein N-terminal 86Met Leu Asn Pro Ile Val Arg Lys Phe Glu Tyr Gly Glu His Thr1 5 10 15 15 amino acids amino acid linear protein N-terminal 87Ala Glu Ile Tyr Asn Lys Asp Gly Asn Lys Leu Asp Leu Tyr Gly1 5 10 15 14 amino acids amino acid linear protein N-terminal 88Asn Leu Ile Glu Ala Thr Leu Glu Gln Asn Leu Arg Asp Ala1 5 10

Claims

1. A purified protein comprising an amino acid sequence of SEQ ID NO:12.

2. A method of protecting a plant from an insect which comprises spraying on the plant a toxin comprising the amino acid sequence of SEQ ID NO:12.