Patent Application
20240002958
The present application is based upon and claims priority to Chinese Patent Application No. 202210644033.4, filed on Jun. 9, 2022, the entire content thereof is incorporated herein by reference.
The instant application contains a Sequence Listing which has been submitted in XML format via USPTO Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on Oct. 12, 2022, is named SIAT-0902 US Sequence_listing.xml.xml and is 15,100 bytes in size.
The present disclosure belongs to the technical field of biological detection, and relates to a detection method and detection kit for detecting pathogenic mutants.
Pathogens of infectious diseases, especially viruses, are easily mutated during the propagation due to their lacks of replication inspection and damage repair mechanisms. By taking novel coronavirus as an example, since November 2020, the World Health Organization has issued 5 widely prevalent SARS-CoV-2 variants, namely Alpha, Beta, Gamma, Delta and Omicron (Munnink B B O, Sikkema R S, Nieuwenhuijse D F, Molenaar R J, Munger E, Molenkamp R, et al. Transmission of SARS-CoV-2 on mink farms between humans and mink and back to humans. Science. 2021; 371(6525): 172-7), which are designated as “closely watched mutants”.
Nucleic acid-based pathogen detection has become a gold standard for diagnosing pathogen infection. Reverse transcription real-time quantitative PCR (RT-qPCR), as a typical nucleic acid detection technology, transforms a target virus RNA into cDNA through reverse transcription, and then cDNA is subjected to PCR amplification in combination with real-time fluorescence detection, so as to sensitively and accurately quantify RNA viruses in a sample (Feng W, Newbigging A M Le C, Pang B, Peng H Y, Cao Y R, et al. Molecular Diagnosis of COVID-19: Challenges and Research Needs. Anal Chem. 2020; 92(15): 10196-209). However, since RT-qPCR is an amplicon-based detection method, it is not applicable to genetic typing of SARS-CoV-2 mutants. A recent study shows that multiplex qPCR can be used to distinguish some SARS-CoV-2 mutants by targeting specific small deletions (Chung H Y, Jian M J, Chang C K, Lin J C, Yeh K M, Chen C W, et al. Emergency SARS-CoV-2 variants of Concern: Novel Multiplex Real-Time RT-PCR Assay for Rapid Detection and Surveillance. Microbiol Spectr. 2022; 10(1)). However, such the method is not sensitive to unit point mutation of SARS-CoV-2. At present, detection methods of SARS-CoV-2 mutants mainly based on whole genome sequencing. However, whole genome sequencing not only depends on lots of instruments and well-trained personnel, but also is time-consuming and relatively high in cost (Arena F, Pollini S, Rossolini G M, Margaglione M. Summary of the Available Molecular Methods for Detection of SARS-CoV-2 during the Ongoing Pandemic. Int J Mol Sci. 2021; 22(3). Epub 2021/02/03).
Therefore, there are different drawbacks (low applicability, low sensitivity, long time consumption, high cost, dependence on equipment and instruments, etc.) for the current detection methods of pathogenic mutants. Hence, there is a lack of a rapid, sensitive and accurate detection method for pathogenic mutants.
In view of the problems of low applicability, low sensitivity, long time consumption, high cost, dependence on equipment and instruments and the like existing in the current detection methods of pathogenic mutants, the present disclosure provides an instant nucleic acid detection method and detection kit for pathogenic mutants, so as to achieve the purpose of rapidly, sensitively and accurately detecting pathogenic mutants.
The present disclosure provides an instant nucleic acid detection method for pathogenic mutants, comprising the following steps:
The CRISPR process is an efficient gene editing tool. crRNA (guide RNA) is a guide RNA, which is capable of guiding the Cas protein specifically binding to a target DNA fragment (the nucleic acid obtained by Step 1)). When the target DNA fragment binds to the Cas protein and crRNA in a CRISPR system to form a ternary complex, the trans-cleavage activity of the Cas protein is activated; when there is no target DNA fragment, the ternary complex cannot be formed, thereby not able to activate the trans-cleavage activity of the Cas protein. Based on the above difference, recognition of mutation points of pathogens is realized, and then pathogenic mutants are detected by combining with the colloidal gold test paper method or fluorescence signal detection method. The CRISPR process provides starting detection samples for subsequent detection using the colloidal gold test paper method or fluorescence signal detection method after specifically amplifying conventional detected signals, can accurately distinguish negative samples from positive samples and greatly increase the sensitivity of the detection method. Meanwhile, by integrating the instant and rapid advantages of the colloidal gold test paper method or fluorescence signal detection method, a purpose of rapidly, sensitively and accurately detecting the pathogenic mutants is realized.
Further, the method for extracting sample nucleic acids in Step 1) is to use a sample lysate, and specifically comprises the following steps: lysing the sample in the sample lysate to directly release nucleic acid without extraction and purification of the sample nucleic acid, thereby greatly simplifying the step of extracting nucleic acid, shortening the time of the whole detection and improving the detection efficiency, which is more conducive to rapid detection.
Further, when the sample nucleic acid extracted in Step 1) is RNA, extracted RNA undergoes RT reaction to obtain DNA; when the sample nucleic acid extracted in Step 1) is DNA, DNA is directly used for subsequent steps, as such, this detection method is applicable to pathogens of different nucleic acids, thereby improving the applicability of this detection method.
Further, this detection method also comprises Step 11). The Step 11) is to amplify obtained DNA by RPA reaction or LAMP reaction to realize signal enlargement, recombinase polymerase (RPA) or LAMP (loop-mediated isothermal amplification) can increase the amount of trace nucleic acid extracted from the sample, thereby increasing the sensitivity of this detection method.
Further, the Cas protein used in the CRISPR process is Cas12a nuclease, which has higher site recognition specificity relative to Cas9 nuclease or Cas13 nuclease to further improve the specificity of this detection method, thereby further improving the accuracy of the detection result.
Further, the crRNA designed in Step 2) includes crRNA_wild type and crRNA_mutant type, the crRNA_wild type is for unmutated pathogens and binds to unmutated sample nucleic acid, the crRNA mutation type is for mutated pathogens and binds to mutated sample nucleic acid, and the target DNA is respectively detected through the crRNA_wild type and the crRNA_mutant type so as to distinguish whether pathogens are mutant strains.
The present disclosure also provides an instant nucleic acid detection kit of pathogenic mutants, comprising a Cas protein, colloidal gold test paper and a colloidal gold probe, wherein the colloidal gold test paper includes a C tape and a T tape, the colloidal gold probe includes a first probe sequence as well as a conjugate A and a conjugate B that are respectively connected with two ends of the first probe sequence, the C tape is provided with an antibody A binding to the conjugate A, and the T tape is provided with an antibody B binding to the conjugate B. The colloidal gold probe is used for combining the CRISPR process with the colloidal gold test paper method to detecting the sample nucleic acids in the abovementioned instant nucleic acid detection method of the pathogenic mutants;
And/or, the instant nucleic acid detection kit includes the Cas protein and a fluorescent probe, the fluorescent probe includes a second probe sequence as well as a fluorophore and a quenching group that are respectively labeled at two ends of the second probe sequence, and is used for combining with the CRISPR process to detecting the sample nucleic acids in the abovementioned instant nucleic acid detection method of the pathogenic mutants, in like manner, if the target DNA fragment is present, the second probe sequence is correspondingly cleaved to emit light, otherwise, light is not emitted. The fluorescent value is detected using ELIASA, so as to correspondingly realize the purpose of detecting the pathogenic mutants.
Further, the conjugate A is biotin which is conjugated with streptavidin, the conjugate B is fluorescein isothiocyanate, the antibody A is an anti-streptavidin antibody, the antibody B is an anti-fluorescein isothiocyanate antibody, and the first probe sequence is cleaved. When the colloidal gold probe flows to the C tape, streptavidin conjugated with biotin binds to the anti-streptavidin antibody and is color developed on the C tape; when the colloidal gold probe flows to the T tape, the fluorescein isothiocyanate binds to the anti-fluorescein isothiocyanate antibody to produce color, and the result is positive; the first probe sequence is not cleaved, the colloidal gold probe can only flow to the C tape to produce color but cannot flow to the T tape and cannot be color developed on the T tape, and the result is negative; if no color developing on the C tape, it indicates that the test paper itself has a quality problem, as such, the purposes of rapid detection and visual reading of the detection result are realized.
Further, when the pathogen is novel coronavirus, the novel coronavirus includes E gene, S gene 501 site, S gene 478 site and S gene H69-V70 site, the first probe sequence is as shown in SEQ ID NO. 9, the second probe sequence is as shown in SEQ ID NO. 10, the kit also includes a forward RT-RPA primer and a reverse RT-RPA primer, the sequence of the forward RT-RPA primer is as shown in SEQ ID NO. 1, and the sequence of the reverse RT-RPA primer is as shown in SEQ ID NO. 2 and used for detecting the E gene;
Further, the kit also includes a crRNA sequence which is crRNA-E for E gene, and the sequence of crRNA-E is as shown in SEQ ID NO. 11;
By selecting the above detection sites and correspondingly designing crRNA, the purpose of detecting the novel coronavirus (SARS-CoV-2) mutant can be realized.
Compared with the related art, the present disclosure has the beneficial effects:
For a better understanding of the aforementioned embodiments of the invention as well as additional embodiments thereof, reference should be made to the Description of Embodiments below, in conjunction with the following drawings in which like reference numerals refer to corresponding parts throughout the figures.
For more clearly understanding the technical problem, technical solution and beneficial effects of the present disclosure, the present disclosure will be further described in detail in combination with drawings and examples. It should be understood that specific embodiments described herein are only for explaining the present disclosure but not limiting the present disclosure.
The embodiments of the present disclosure provides an instant nucleic acid detection method for pathogenic mutants, comprising the following steps:
The CRISPR process is an efficient gene editing tool, crRNA (guide RNA) is a guide RNA which is capable of guiding the Cas protein specifically binding to a target DNA fragment (the nucleic acid obtained by Step 1)). When target DNA binds to the Cas protein and crRNA in a CRISPR system to form a ternary complex, the trans-cleavage activity of the Cas protein is activated; when there is no target DNA fragment, the ternary complex cannot be formed, thereby not able to activate the trans-cleavage activity of the Cas protein. Based on the above difference, recognition of mutation points of pathogens is realized, and then pathogenic mutants are detected by combining with the colloidal gold test paper method or fluorescence signal detection method. The CRISPR process provides starting detection samples for the subsequent detection using the colloidal gold test paper method or fluorescence signal detection method after amplifying specifically conventional detected signals, and can accurately distinguish negative samples from positive samples so as to greatly increase the sensitivity of the detection method. Meanwhile, by integrating the instant and rapid advantages of the colloidal gold test paper method or the fluorescence signal detection method, a purpose of rapidly, sensitively and accurately detecting the pathogenic mutants is realized.
Specifically, the method for extracting sample nucleic acid in Step 1) is to use a sample lysate, and specifically comprises the following steps: lysing the sample in the sample lysate to directly release nucleic acid without extraction and purification of sample nucleic acid, thereby greatly simplifying the step of extracting nucleic acid, shortening the time of the whole detection and improving the detection efficiency, which is more conducive to rapid detection.
Specifically, when the sample nucleic acid extracted in Step 1) is RNA, extracted RNA undergoes RT reaction to obtain DNA; when the sample nucleic acid extracted in Step 1) is DNA, DNA is directly used for subsequent steps, as such, this detection method is applicable to pathogens of different nucleic acids, thereby improving the applicability of this detection method.
Specifically, this detection method also comprises Step 11). The Step 11) is to amplify obtained DNA by RPA reaction or LAMP reaction to realize signal enlargement, recombinase polymerase (RPA) or LAMP (loop-mediated isothermal amplification) can increase the amount of trace nucleic acid extracted from the sample, thereby increasing the sensitivity of this detection method.
Specifically, the Cas protein used in the CRISPR process is Cas12a nuclease, which has higher site recognition specificity relative to Cas9 nuclease or Cas13 nuclease to further improve the specificity of this detection method, thereby further improving the accuracy of the detection result.
Specifically, crRNA designed in Step 2) includes crRNA_wild type and crRNA_mutant type, the crRNA_wild type is for unmutated pathogens and binds to unmutated sample nucleic acid, the crRNA mutation type is for mutated pathogens and binds to mutated sample nucleic acid, the target DNA is respectively detected through the crRNA_wild type and the crRNA_mutant type so as to distinguish whether pathogens are mutant strains.
The embodiments of the present disclosure also provide an instant nucleic acid detection kit of pathogenic mutants, comprising a Cas protein, colloidal gold test paper and a colloidal gold probe, wherein the colloidal gold test paper includes a C tape and a T tape, the colloidal gold probe includes a first probe sequence as well as a conjugate A and a conjugate B that are respectively connected with two ends of the first probe sequence, the C tape is provided with an antibody A binding to the conjugate A, and the T tape is provided with an antibody B binding to the conjugate B. The colloidal gold probe is used for combining the CRISPR process with the colloidal gold test paper method to detecting the sample nucleic acids in the abovementioned instant nucleic acid detection method of the pathogenic mutants;
And/or, the instant nucleic acid detection kit includes a Cas protein and a fluorescent probe, the fluorescent probe includes a second probe sequence as well as a fluorophore and a quenching group that are respectively labeled at two ends of the second probe sequence, and is used for combining with the CRISPR process to detecting the sample nucleic acids in the abovementioned instant nucleic acid detection method of the pathogenic mutants, in like manner, if the target DNA fragment is present, the second probe sequence is correspondingly cleaved to emit light, otherwise, light is not emitted. The fluorescent value is detected using ELIASA, so as to correspondingly realize the purpose of detecting the pathogenic mutants.
Specifically, the conjugate A is biotin which is conjugated with streptavidin, the conjugate B is fluorescein isothiocyanate, the antibody A is an anti-streptavidin antibody, the antibody B is an anti-fluorescein isothiocyanate antibody, and the first probe sequence is cleaved. When the colloidal gold probe flows to the C tape, streptavidin conjugated with biotin binds to the anti-streptavidin antibody and is color developed on the C tape; when the colloidal gold probe flows to the T tape, the fluorescein isothiocyanate binds to the anti-fluorescein isothiocyanate antibody to produce color, thus the result is positive; the first probe sequence is not cleaved, the colloidal gold probe can only flow to the C tape to produce color but cannot flow to the T tape and cannot be color developed on the T tape, thus the result is negative; if the colloidal gold probe is not color developed on the C tape, it indicates that the test paper itself has a quality problem, as such, the purposes of rapid detection and visual reading of the detection result are realized.
Specifically, when the pathogen is novel coronavirus, the novel coronavirus includes E gene, S gene 501 site, S gene 478 site and S gene H69-V70 site, the first probe sequence is as shown in SEQ ID NO. 9, the second probe sequence is as shown in SEQ ID NO. 10, the kit also includes a forward RT-RPA primer and a reverse RT-RPA primer, the sequence of the forward RT-RPA primer is as shown in SEQ ID NO. 1, and the sequence of the reverse RT-RPA primer is as shown in SEQ ID NO. 2 and used for detecting the E gene;
Specifically, the kit also includes a crRNA sequence which is crRNA-E for E gene, and the sequence of crRNA-E is as shown in SEQ ID NO. 11;
By selecting the above detection sites and correspondingly designing crRNA, the purpose of detecting the novel coronavirus (SARS-CoV-2) mutants can be realized.
The technical solution of the present disclosure will be further illustrated in combination with specific examples.
By taking the detection of novel coronavirus (SARS-CoV-2) mutants as examples, a detection technical routine is seen in
1) Cleavage and Release of Pathogenic Nucleic Acid
Samples collected from nasopharyngeal swabs or other collected samples were put into a sample lysate to be lysed for 5 min at 37° C., and then RNA in the samples was lysed and released to enter the next RT reaction. The sample lysate was purchased from Shengxiang Biotechnology Co., Ltd.
2) Design and Screening of Optimal RT-RPA Primer Applied to Mutant Detection
The SARS-CoV-2 genome is composed of about 29903 nucleotides, encodes 12 open reading frames, and includes structural protein coding genes such as spike (S), nucleocapsid (N), membrane (M) and envelope (E). This example selected E gene and S gene in the SARS-CoV-2 genome as detection sites, wherein the E gene was used as a universal detection target of SARS-CoV-2. The SARS-CoV-2 genome was significantly mutated for several times during the propagation, and the key amino acid mutation in S gene was generally used for genetic typing of SARS-CoV-2 mutant strains. Therefore, 501 and 478 sites of S gene were selected as SARS-CoV-2 mutants for detection (
3) Recombinase Polymerase Amplification Technology (RT-RPA)
First, RNA extracted from the sample was added into 20 μL of premix solution to be incubated for 15 min at 37° C. to complete reverse transcription reaction (RT reaction), so that RNA extracted from the example was converted into cDNA. Where, the formula of the premix solution is seen in Table 1.
After reverse transcription reaction was completed, cDNA was amplified by recombinase polymerase (RPA). Specific steps were as follows: cDNA was added into a RPA amplification reaction system to be incubated for 15 min at 37° C. to complete RPA reaction, so as to realize amplification and enlargement of signals. The formula of the above system is seen in Table 2.
Reverse transcription kit RNase H and T4 gene 32 protein were purchased from New England Biolabs™, and RevertAid Reverse Transcriptase™ was purchased from Thermo Scientific. RPA kit TwistAmp Basic Kit was purchased from TwistDX™.
3) Combined Detection of CRISPR-Cas12a Process and Colloidal Gold Test Paper Method
A colloidal gold reaction system based on CRISPR-Cas12a process was prepared according to Table 3, evenly mixed and then incubated for 30 min at 37° C. 10 μL of prepared colloidal gold reaction system was applied to a sample pad of a colloidal gold test paper strip, the test paper strip was quickly immersed into a tube containing 80 μL of test paper strip buffer solution, and results were read after developing for 2-3 min. a colloidal gold probe was purchased from Nanjing Zhongding Biotechnology Co., Ltd, and the colloidal gold test paper strip was purchased from Milenia Biotec.
The difference from example 1 is that 3), a fluorescence detection system based on CRISPR-Cas12a process was prepared, as shown in Table 4, the system was sufficiently and evenly mixed and then added into a 96-well plate and placed in a ELIASA for constant-temperature reaction at 37° C., and the fluorescence value was measured every 30 s for 60 min. Exciting light and emitting light from ELIASA were respectively 480 nm and 520 nm. EnGen® Lba Cas12a (Cpf1) and buffer liquid system were purchased from New England Biolabs® to be used for CRISPR-Cas12a reaction in this example of the present disclosure. crRNA was obtained by in-vitro transcription.
I. Estimation of Specificity of this Method for Detection of SARS-CoV-2 Mutants
To detect the specificity of this method on SARS-CoV-2 mutants, crRNAs including crRNA-N501 (SEQ ID NO. 12: aauuucuacu guuguagaucaacccacuaauggugu) and crRNA-Y501 (SEQ ID NO. 13: aauuucuacu guuguagau caacccacuuauggugu) for SARS-CoV-2 S gene 501 site, crRNA-H69-V70 (SEQ ID NO. 14: aauuucuacu guuguagau cuauacaugucucuggg) and crRNA-ΔH69-V70 (SEQ ID NO. 15: aauuucuacu guuguagau cuaucucugggaccaau) for SARS-CoV-2 S gene H69-V70 site and crRNA-T478 (SEQ ID NO. 16: aauuucuacu guuguagau ugugguaauguuccaca) and crRNA-K478 (SEQ ID NO. 17: aauuucuacu guuguagau ugugguaauguuccaaa) for SARS-CoV-2 S gene 478 site, and primers for SARS-CoV-2 S gene H69-V70 site being S697ORPAF (SEQ ID NO. 7: tttccaatgttacttggttccatgtttactat)/S6970RPAR (SEQ ID NO. 8: ttaacaataagtagggactgggtcttcgaatc) were designed, SARS-CoV-2 pseudovirus and mutated pseudoviruses such as A H69-V70, N501Y and T478K contained in SARS-CoV-2 were respectively measured by the designed crRNA and utilizing the above screened RT-RPA primer, double-stranded dsDNA of the above viruses from the above genes were incubated respectively with Cas12a nuclease, a FQ fluorescence probe and separate crRNA at 37° C., and fluorescence values were measured in 30 min. The results are respectively seen in
II. Estimation of Sensitivity of this Method for Detection of SARS-CoV-2 Mutants
The sensitivity of T478, K478, N501 and Y501 of E gene and S gene of SARS-CoV-2 were respectively detected by using 107, 106, 105, 104, 103, 102, 10 and 5 pseudovirus copy number gradients, the designed crRNA for SARS-CoV-2 E gene was crRNA-E (SEQ ID NO. 11: aauuucuacuguuguagaucaagacucacguuaacaa). Double-stranded dsDNA from the above gene in pseudoviruses together with Cas12a, probes and crRNA was incubated at 37° C. The results are respectively shown in
Based on fluorescence reads, the results show that the detection lines of all the target regions (E gene, N501, Y501, T478 and K478) are about 10 copies, which is equivalent to a fact that the Ct value of RT-qPCR is 35. The fluorescence result in 30 min shows the detection sensitivity of N501 is slightly higher than that of Y501 (
III. Estimation of Detection Ability of this Method on Clinical Sample Mutants
To estimate the detection performance of this method in the aspect of recognizing SARS-CoV-2 mutants, the 501 and 478 sites of S gene were detected. N501Y was used as common mutation sites of Alpha, Beta, Gamma, Omicron and other mutants, and 68 clinical samples were collected and underwent mutant detection. The results are seen in
The results show that all the mutants can be distinguished from samples of Ct<32 through colloidal gold reads or fluorescence reads (
The S gene 478 site can be used as an important target for identifying Delta and Omicron pedigrees, 40 clinical positive samples are totally collected and undergo mutant detection, results are seen in
The above descriptions are only preferred embodiments of the present disclosure but not used for limiting the present disclosure. Any amendments, equivalent replacements and improvements made within the principle of the present disclosure should be included within the protective scope of the present disclosure.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202210644033.4 | Jun 2022 | CN | national |
