Patent Grant
10610564
The present invention relates to the discovery that IRGM, encoded by a uniquely human gene which confers risk for inflammatory diseases, affects autoophagy through a hitherto unknown mechanism. The present invention shows that IRGM controls autophagy and that IRGM modulators, in particular, double-stranded RNA, including poly I:C, poly-UG (polyUGUGU) and polyICLC and muramyldipeptide and related analogs of same, including N-acetyl muramyl-L-alanyl-D-isoglutamine (Muramyl dipeptide or MDP) and numerous other compounds as identified herein, which may be used alone, in combination, or in combination with alternative autophagy modulators and/or additional bioactive agents to provide effective therapies for a number of diseases, including cancer, bacterial infections and inflammatory diseases, especially including tuberculosis infections and Crohn's disease, among others.
The present invention is also directed to compositions and methods for treating inflammatory or autophagy-related diseases including diseases which cause excessive inflammation in patients. The approach taken to the treatment of these disease states and conditions which cause excessive inflammation is referred to as precision autophagy. This method utilizes interferon, especially interferon-gamma (IFN-gamma), pegylated interferon (PEG-IFN) and related compounds and/or certain TRIM proteins or variants thereof having at least 90% sequence identity as described herein, in particular, TRIM1 (SEQ ID NO:1), TRIM3 (SEQ ID NO:11), TRIM8 (SEQ ID NO:36), TRIM10 (SEQ ID NO:46), TRIM13 (SEQ ID NO:56), TRIM17 (SEQ ID NO:81), TRIM19 (SEQ ID NO:91), TRIM20 (SEQ ID NO:96), TRIM21 (SEQ ID NO:101), TRIM22 (SEQ ID NO:106), TRIM38 (SEQ ID NO:172), TRIM 41 (SEQ ID NO:187), TRIM43 (SEQ ID NO:197), TRIM44 (SEQ ID NO:202), TRIM45 (SEQ ID NO:207), TRIM46 (SEQ ID NO:212), TRIM54 (SEQ ID NO:247), TRIM55 (SEQ ID NO:252), TRIM56 (SEQ ID NO:257), TRIM58 (SEQ ID NO:262), TRIM59 (SEQ ID NO:267), TRIM60 (SEQ ID NO:272), TRIM65 (SEQ ID NO:297), TRIM66 (SEQ ID NO:302), TRIM75 (SEQ ID NO:338) and mixtures thereof, preferably TRIM 1 (SEQ ID NO:1), TRIM 8 (SEQ ID NO:36), TRIM 20 (SEQ ID NO:96), TRIM 21 (SEQ ID NO:101), TRIM 22 (SEQ ID NO:106), TRIM 56 (SEQ ID NO:257), TRIM 65 (SEQ ID NO:297), and mixtures thereof to treat extreme inflammation associated with disease states that cause excessive inflammation. Methods and pharmaceutical compositions are disclosed herein.
Autophagy is a cellular homeostatic mechanism with broad roles in human health and disease (Mizushima et al., 2008). Autophagy is at the intersection of metabolic (Rabinowitz and White, 2010; Settembre and Ballabio, 2014) and antimicrobial processes (Deretic et al., 2013; Ma et al., 2013). Thus, the system responds to a range of inputs such as starvation (Chauhan et al., 2013; Efeyan et al., 2013; Mihaylova and Shaw, 2011), lysosomal disruption (Settembre and Ballabio, 2014), endogenous danger associated molecular patterns and microbial products commonly referred to as pathogen-associated molecular patterns (PAMPS) (Deretic et al., 2013; Ma et al., 2013). Autophagic responses to PAMPS lead to direct antimicrobial action through a process termed xenophagy (Gomes and Dikic, 2014; Levine, 2005) and control of inflammation and other immune processes (Deretic et al., 2013).
Among the better-established links between autophagy and human diseases are the genetic polymorphisms in ATG16L1 and IRGM conferring risk for Crohn's disease (CD), an intestinal inflammatory disorder (Consortium, 2007; Craddock et al., 2010; Murthy et al., 2014). The human population polymorphisms in IRGM have been linked to autophagy (Consortium, 2007; Craddock et al., 2010) and to its effector outputs including antimicrobial defense (Brest et al., 2011; McCarroll et al., 2008). In keeping with its autophagy-mediated antimicrobial role, IRGM is additionally a genetic risk factor for tuberculosis in different human populations (Bahari et al., 2012; Che et al., 2010; Intemann et al., 2009; King et al., 2011; Song et al., 2014) and may afford protection in leprosy (Yang et al., 2014). However, the molecular mechanism of IRGM's function in autophagy has remained a mystery.
IRGM has no homologs among the Atg genes in yeast, which makes it difficult to assign to it an autophagy-specific function; instead, IRGM has been considered to affect autophagy indirectly (Singh et al., 2006). A complicating factor in understanding the exact function of IRGM is that it is distinctly a human gene (Bekpen et al., 2010). Its orthologs are present only in African great apes and Homo sapiens but active alleles are absent in ancestral evolutionary lineages leading up to them (Bekpen et al., 2009). The mouse genome encodes a large family of immunity related GTPase (21 IRG genes) compared to a single gene (IRGM) in humans; furthermore, all murine IRGs encode ca. 40-kDa proteins that are much larger then the human IRGM (21 kDa). The prevailing view of the murine IRGs is that they have predominantly non-autophagy functions (Choi et al., 2014; Zhao et al., 2008). Thus the significant information gathered in the murine systems may have limited import on how the human IRGM works.
Given the significance of IRGM in human populations and the notoriously high prevalence of diseases such as CD and tuberculosis, it is surprising that IRGM's mechanism of action in autophagy remains unknown. Here we report that unexpectedly, IRGM physically interacts with key autophagy regulators, ULK1, Beclin 1, ATG14L and ATG16L1. We also show that, remarkably, IRGM links inputs from PAMP sensors by making molecular complexes with NOD2, another genetic risk factor in CD (Eckmann and Karin, 2005; Hugot et al., 2001; Ogura et al., 2001). The formation of NOD2-IRGM complex is stimulated in response to PAMPs, whereas increased association of NOD2 with IRGM promotes IRGMdirected assembly of autophagy regulators. IRGM undergoes post-translational modifications that stabilize components of the core autophagic machinery, and mutant IRGM protein that cannot direct these modifications is disabled for its role in autophagic defense against invasive bacteria.
Therapies to modulate autophagy are entering clinical trials but methods of monitoring whether drugs modulate autophagy in patients during such treatment are currently unavailable, but badly needed. In one aspect, the present invention addresses that need.
IRGM, encoded by a uniquely human gene conferring risk for inflammatory diseases, affects autophagy through a hitherto unknown mechanism. The present invention is directed to showing that IRGM controls autophagy. IRGM interacts with ULK1 and Beclin 1 and promotes their coassembly into molecular complexes. IRGM stabilizes ULK1 and affects the stability of Beclin 1-interactors thus governing the composition of autophagy initiation complexes. We further show that IRGM interacts with pattern recognition receptors including NOD2. IRGM, NOD2 and ATG16L1, all of which are Crohn's disease risk factors and form a molecular complex to modulate autophagic responses to microbial products. NOD2 enhances K63-linked polyubiquitination of IRGM, which is required for interactions of IRGM with the core autophagy factors and for bacterial clearance. Thus, IRGM plays a direct role in organizing the core autophagy machinery to endow it with antimicrobial functions.
In one embodiment, the present invention relates to the use of IRGM modulators for the treatment of disease, in particular, bacterial infections and inflammatory diseases, most notably tuberculosis and Crohn's disease amongst a number of others. The compounds which are useful as modulators of IRGM include the double stranded RNA compounds, including poly I:C, poly-UG (poly UGUGU) and poly ICLC, among others, and muramyl dipeptide and its analogs and derivates as otherwise disclosed herein.
In one embodiment, the present invention provides a method of modulating autophagy in a biological system, in particular a patient or subject. In this aspect of the invention, a compound identified herein as an IRGM modulator (which can be an inhibitor or agonist of IRGM and/or its pathway(s), is presented to the biological system, including administration to a patient or subject in need, in order to modulate autophagy and effect a favorable result in the biological system, often a patient or subject. The resulting modulation may be monitored or applied in the biological system to effect a favorable result, including the inhibition, treatment and/or prevention of cancer, including metastasis of cancer, or the inhibition, treatment (including the amerlioration of symptoms) and/or prevention of one or more disease states or conditions in which the modulation, especially including upregulation or inhibition of autophagy provides a favorable result in numerous disease states and/or conditions including neurodegeneration (including, for example, Alzheimer's disease, Parkinson's disease; other ataxias), chronic inflammatory diseases (including, for example, inflammatory bowel disease, including Crohn's disease, rheumatoid arthritis, lupus, multiple sclerosis, chronic obstructive pulmony disease/COPD, pulmonary fibrosis, cystic fibrosis, Sjogren's disease), diabetes and metabolic syndrome, muscle degeneration and atrophy, frailty in aging, stroke and spinal cord injury, arteriosclerosis, infectious diseases, especially bacterial infections such as tuberculosis, viral infections (HIV I and II, HBV, HCV, including secondary disease states or conditions associated with infectious diseases, including AIDS) and tuberculosis, among others. The common principle of this embodiment of the invention is that compounds which modulate IRGM, are outstanding autophagy modulators (i.e., inhibitors or activators of autophagy), depending upon the disease state, condition or symptom to be treated, may cure, prevent (including reducing the likelihood of), improve prognosis, ameliorate symptoms and/or improve the quality of the patient's or subject's life. In addition, in the therapeutic aspects of the invention, the administration of an autophagy modulator (i.e., one or more IRGM modulators alone or in combination with an additional autophagy modulator and/or an additional bioactive agent) may prolong the life of the patient, as well as improve the quality of life in the aging patient or subject.
In one embodiment the method of treating an autophagy-mediated disease state or condition comprising administering at least one dsRNA or a muramyl dipeptide analog or derivative (collective referred to as “IRGM modulators”), optionally in combination with at least one additional autophagy modulator and/or bioactive agent to a patient in need. In this method at least one IRGM modulator as described above, alone or in combination with an additional autophagy modulator, such as an autophagy modulator selected from the group consisting of flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon and nortriptyline, tetrachlorisophthalonitrile and phenylmercuric acetate, pharmaceutically acceptable salts thereof and mixtures thereof, alone, optionally in further combination with at least one additional bioactive agent, optionally in combination with a pharmaceutically acceptable carrier, additive or excipient, may be administered to a patient or subject in need to treat an autophagy-mediated disease state and/or condition. It is noted that flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon, nortriptyline and their pharmaceutically acceptable salts show activity as agonists or inducers of autophagy in the treatment of an autophagy-mediated disease, tetrachlorisophthalonitrile, phenylmercuric acetate and their pharmaceutically acceptable salts, find use as antagonists or inhibitors of autophagy. All of these compounds will find use as modulators of autophagy in the various autophagy-mediated disease states and conditions described herein, with the agonists being preferred in most disease states other than cancer and in the case of the treatment of cancer, the inhibitors described above are preferred, alone or in combination with an autophagy agonist as described above and/or an additional anticancer agent as otherwise described herein.
Pharmaceutical compositions according to the present invention comprise an effective amount of at least one IRGM modulator as described herein in combination with an autophagy modulator selected from the group consisting of flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon, nortriptyline, tetrachlorisophthalonitrile, phenylmercuric acetate and their pharmaceutically acceptable salts, optionally in combination with a pharmaceutically acceptable carrier, additive and/or excipient and further optionally, in combination with at least one additional bioactive agent (e.g., an anticancer agent, antibiotic, anti-tuberculosis agent, antiviral agent such as an anti-HIV agent, anti-HBV agent or anti-HCV agent, etc.), preferably at least one anticancer agent as otherwise disclosed herein or at least one additional autophagy modulator as otherwise described herein. In the present invention, an additional autophagy modulator (autostatin) may be selected from the group consisting of may be combined with an additional autophagy modulator selected from the group consisting of benzethonium, niclosamide, monensin, bromperidol, levobunolol, dehydroisoandosterone 3-acetate, sertraline, tamoxifen, reserpine, hexachlorophene, dipyridamole, harmaline, prazosin, lidoflazine, thiethylperazine, dextromethorphan, desipramine, mebendazole, canrenone, chlorprothixene, maprotiline, homochlorcyclizine, loperamide, nicardipine, dexfenfluramine, nilvadipine, dosulepin, biperiden, denatonium, etomidate, toremifene, tomoxetine, clorgyline, zotepine, beta-escin, tridihexethyl, ceftazidime, methoxy-6-harmalan, melengestrol, albendazole, rimantadine, chlorpromazine, pergolide, cloperastine, prednicarbate, haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil, methimazole, trimeprazine, ethoxyquin, clocortolone, doxycycline, pirlindole mesylate, doxazosin, deptropine, nocodazole, scopolamine, oxybenzone, halcinonide, oxybutynin, miconazole, clomipramine, cyproheptadine, doxepin, dyclonine, salbutamol, flavoxate, amoxapine, fenofibrate, pimethixene and mixtures thereof.
In still another embodiment, the invention provides a method of treating a subject who has been infected with tuberculosis (e.g. M. tuberculosis) or who is at risk of such infection, the method comprising administering to the subject a pharmaceutically effective amount of a IRGM modulator as described hereinafter. In another embodiment, the invention provides a method of treating Crohn's disease comprising administering to a patient in need a pharmaceutically effective amount of a IRGM modulator as described hereinafter.
The present invention provides methods of treating inflammatory or autophagy-related diseases. Autophagy is a eukaryotic intracellular pathway that carries out key aspects of cytoplasmic homeostasis. Autophagy has many biological effects that include immunological processes and inflammation, and one aspect is regulation of activation inflammasome activity. We disclose the methods to regulate disease-causing excessive inflammation by one form of selective autophagy named precision autophagy. This method provide therapeutic options for inflammatory or autophagy-related diseases by modulating precision autophagy. Several forms of precision autophagy could be induced by compounds, such as IFN-gamma, or related compounds. The present invention could be used to upregulate autophagy, for example in the case of disease states such as tuberculosis and other disease states where an upregulation of autophagy would be beneficial for disease treatment. This therapy could be effected by administering an effective amount of one or more TRIM proteins as otherwise described herein to a patient in need, the result being the upregulation of autophagy and the treatment of a disease state and/or condition which is mediated through authophagy (an autophagy-mediated disease). In other instances, the present invention could be used to regulate (i.e. down-regulate) some forms of precision autophagy, and precision autophagy in turn modulate several forms of inflammation, such as inflammasome or type I interferon response in order to bring the autophagy response back in to balance. The targeting disorders for precision autophagy down-regulation include autophagy-related diseases or inflammatory diseases, including autoimmune diseases, infectious diseases, cardiovascular diseases, and metabolic diseases including diabetes mellitus. For example, the inflammatory response is essential to human beings, however, excessive inflammatory response is a lethal condition seen in several diseases in different stages, including autoimmune diseases and acute viral/bacterial infection. The inventors have found that the excessive inflammation associated with these disease states and/or conditions could be regulated by precision autophagy, including the administration of siRNAs as described herein which specifically inhibit one or more TRIM proteins as otherwise described herein. In addition, the inventors find that certain disease states could benefit from an initial upregulation of autophagy which could benefit the disease treatment, followed by down-regulation of autophagy during the course of therapy for the disease state and/or condition in order to reduce an excessive autophagy response.
Thus, the present invention utilizes certain preferred precision autophagy modulators to treat disease states and conditions which cause excessive inflammation and particularly seen in a number of disease states, especially including inflammatory diseases as otherwise described herein, autoimmune diseases, infectious diseases (generally, after an initial period of beneficial upregulation of autophagy), cardiovascular diseases and metabolic diseases, including diabetes mellitus. These precision autophagy modulators may include interferons such as interferon gamma (IFN-gamma) and pegylated interferon (PEG-IFN), as well as the preferred TRIM (tripartite motif containing) proteins or variants exhibiting 90% sequence identity to the TRIM proteins, preferably TRIM proteins selected from at least one TRIM protein selected from the group consisting of TRIM1, TRIM3, TRIM8, TRIM10, TRIM13, TRIM17, TRIM19, TRIM20, TRIM21, TRIM22, TRIM38, TRIM 41, TRIM43, TRIM44, TRIM45, TRIM46, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM65, TRIM66 and TRIM75 with TRIM 1, TRIM 8, TRIM 20, TRIM 21, TRIM 22, TRIM 56 and TRIM 65 and mixtures thereof being preferred as autophagy upregulators.
The present invention relates to a method of treating excessive inflammation in inflammatory diseases, autoimmune diseases, infectious diseases, cardiovascular diseases and metabolic diseases in a patient in need thereof comprising administering to said patient an effective amount of a precision autophagy modulator selected from the group consisting of an interferon, including interferon gamma (IFN-gamma) and pegylated interferon (PEG-IFN) and at least one TRIM protein (including a TRIM protein variant), preferably a TRIM protein selected from the group consisting of TRIM1 (SEQ ID NO:1), TRIM3 (SEQ ID NO:11), TRIM8 (SEQ ID NO:36), TRIM10 (SEQ ID NO:46), TRIM13 (SEQ ID NO:56), TRIM17 (SEQ ID NO:81), TRIM19 (SEQ ID NO:91), TRIM20 (SEQ ID NO:96), TRIM21 (SEQ ID NO:101), TRIM22 (SEQ ID NO:106), TRIM38 (SEQ ID NO:172), TRIM 41 (SEQ ID NO:187), TRIM43 (SEQ ID NO:197), TRIM44 (SEQ ID NO:202), TRIM45 (SEQ ID NO:207), TRIM46 (SEQ ID NO:212), TRIM54 (SEQ ID NO:247), TRIM55 (SEQ ID NO:252), TRIM56 (SEQ ID NO:257), TRIM58 (SEQ ID NO:262), TRIM59 (SEQ ID NO:267), TRIM60 (SEQ ID NO:272), TRIM65 (SEQ ID NO:297), TRIM66 (SEQ ID NO:302), TRIM75 (SEQ ID NO:338) and mixtures thereof, preferably TRIM 1 (SEQ ID NO:1), TRIM 8 (SEQ ID NO:36), TRIM 20 (SEQ ID NO:96), TRIM 21 (SEQ ID NO:101), TRIM 22 (SEQ ID NO:106), TRIM 56 (SEQ ID NO:257), TRIM 65 (SEQ ID NO:297), and mixtures thereof, optionally in combination with an additional autophagy modulator (including an alternative TRIM protein) and/or an additional bioactive agent. In certain instances, it may be beneficial to down-regulate autophagy and inhibit TRIM protein response in order to reduce an excessive autophagy response through the use of one or more siRNA as described herein which specifically inhibits one or more TRIM protein. Additional autophagy modulators for use in the present invention include, for example, flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon, nortriptyline, tetrachlorisophthalonitrile and phenylmercuric acetate, benzethonium, niclosamide, monensin, bromperidol, levobunolol, dehydroisoandosterone 3-acetate, sertraline, tamoxifen, reserpine, hexachlorophene, dipyridamole, harmaline, prazosin, lidoflazine, thiethylperazine, dextromethorphan, desipramine, mebendazole, canrenone, chlorprothixene, maprotiline, homochlorcyclizine, loperamide, nicardipine, dexfenfluramine, nilvadipine, dosulepin, biperiden, denatonium, etomidate, toremifene, tomoxetine, clorgyline, zotepine, beta-escin, tridihexethyl, ceftazidime, methoxy-6-harmalan, melengestrol, albendazole, rimantadine, chlorpromazine, pergolide, cloperastine, prednicarbate, haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil, methimazole, trimeprazine, ethoxyquin, clocortolone, doxycycline, pirlindole mesylate, doxazosin, deptropine, nocodazole, scopolamine, oxybenzone, halcinonide, oxybutynin, miconazole, clomipramine, cyproheptadine, doxepin, dyclonine, salbutamol, flavoxate, amoxapine, fenofibrate, pimethixene, pharmaceutically acceptable salts thereof and mixtures thereof, alternative TRIM proteins or variants exhibiting 90% sequence identity to the TRIM proteins, including, but are not limited to, TRIM2 (SEQ ID NO:6), TRIM 4 (SEQ ID NO:16), TRIM5 (TRIM5α) (SEQ ID NO:21), TRIM6 (SEQ ID NO:26), TRIM7 (SEQ ID NO:31), TRIM9 (SEQ ID NO:41), TRIM11 (SEQ ID NO:51), TRIM14 (SEQ ID NO:61), TRIM15 (SEQ ID NO:66), TRIM16 (SEQ ID NO:71), TRIM18 (SEQ ID NO:86), TRIM23 (SEQ ID NO:111), TRIM24 (SEQ ID NO:116), TRIM25 (SEQ ID NO:121), TRIM27 (SEQ ID NO:126), TRIM28 (SEQ ID NO:131), TRIM29 (SEQ ID NO:136), TRIM30, TRIM 31 (SEQ ID NO:141), TRIM32 (SEQ ID NO:146), TRIM33 (SEQ ID NO:151), TRIM34 (SEQ ID NO:156), TRIM35 (SEQ ID NO:161), TRIM36 (SEQ ID NO:166), TRIM37 (SEQ ID NO:167), TRIM39 (SEQ ID NO:177), TRIM40 (SEQ ID NO:182), TRIM42 (SEQ ID NO:192), TRIM47 (SEQ ID NO:217), TRIM48 (SEQ ID NO:222), TRIM49 (SEQ ID NO:227), TRIM50 (SEQ ID NO:232), TRIM51 (SEQ ID NO:237), TRIM55 (SEQ ID NO:252), TRIM68 (SEQ ID NO:312), TRIM72 (SEQ ID NO:323), TRIM73 (SEQ ID NO:328), TRIM74 (SEQ ID NO:333), TRIM76 (SEQ ID NO:343), and mixtures thereof, with TRIM2 (SEQ ID NO:6), TRIM5 (SEQ ID NO:21), TRIM6 (SEQ ID NO:26), TRIM11 (SEQ ID NO:51), TRIM23 (SEQ ID NO: 111), TRIM27 (SEQ ID NO:126), TRIM28 (SEQ ID NO:131), TRIM31 (SEQ ID NO:141), TRIM 32 (SEQ ID NO:146), TRIM33 (SEQ ID NO:151), TRIM42 (SEQ ID NO:192), TRIM49 (SEQ ID NO:227), TRIM50 (SEQ ID NO:232), TRIM51 (SEQ ID NO:237), TRIM68 (SEQ ID NO:312), TRIM72 (SEQ ID NO:323), TRIM73 (SEQ ID NO:328), TRIM74 (SEQ ID NO:333) and TRIM (SEQ ID NO:343) being preferred. Neutral lipids such as lipids selected from the group consisting of triglycerides, diglycerides, monoglycerides, glycolated mono- or diacylglycerdies, dolichol, polyprenol, polyprenal or very long chain fatty acids may also be administered in combination with the precision autophagy modulators according to the present invention to increase lipid storage and enhance the therapeutic effect of autophagy modulators used to treat excessive inflammation as otherwise disclosed herein. Additional bioactive agents as otherwise described herein may be administered in combination with the one or more of the above precision autophagy modulators and optionally, additional modulators and bioactive agents as otherwise described herein.
Pharmaceutical compositions according to the present invention comprise an effective amount of interferon, including interferon gamma (IFN-gamma) and pegylated interferon (PEG-IFN) in combination with at least one TRIM protein or a variant thereof, preferably a TRIM protein selected from the group consisting of TRIM1 (SEQ ID NO:1), TRIM3 (SEQ ID NO:11), TRIM8 (SEQ ID NO:36), TRIM10 (SEQ ID NO:46), TRIM13 (SEQ ID NO:56), TRIM17 (SEQ ID NO:81), TRIM19 (SEQ ID NO:91), TRIM20 (SEQ ID NO:96), TRIM21 (SEQ ID NO:101), TRIM22 (SEQ ID NO:106), TRIM38 (SEQ ID NO:172), TRIM 41 (SEQ ID NO:187), TRIM43 (SEQ ID NO:197), TRIM44 (SEQ ID NO:202), TRIM45 (SEQ ID NO:207), TRIM46 (SEQ ID NO:212), TRIM54 (SEQ ID NO:247), TRIM55 (SEQ ID NO:252), TRIM56 (SEQ ID NO:257), TRIM58 (SEQ ID NO:262), TRIM59 (SEQ ID NO:267), TRIM60 (SEQ ID NO:272), TRIM65 (SEQ ID NO:297), TRIM66 (SEQ ID NO:302), TRIM75 (SEQ ID NO:338) and mixtures thereof, preferably TRIM 1 (SEQ ID NO:1), TRIM 8 (SEQ ID NO:36), TRIM 20 (SEQ ID NO:96), TRIM 21 (SEQ ID NO:101), TRIM 22 (SEQ ID NO:106), TRIM 56 (SEQ ID NO:257), TRIM 65 (SEQ ID NO:297) and mixtures thereof, optionally in combination with an additional autophagy modulator (including an alternative TRIM protein as otherwise described herein) and/or an additional bioactive agent as otherwise described herein in combination with a pharmaceutically acceptable carrier, additive or excipient. Compositions comprising an effective amount of at least one TRIM protein or a variant thereof, preferably a TRIM protein selected from the group consisting of TRIM1 (SEQ ID NO: 1), TRIM3 (SEQ ID NO:11), TRIM8 (SEQ ID NO:36), TRIM10 (SEQ ID NO:46), TRIM13 (SEQ ID NO:56), TRIM17 (SEQ ID NO:81), TRIM19 (SEQ ID NO:91), TRIM20 (SEQ ID NO:96), TRIM21 (SEQ ID NO:101), TRIM22 (SEQ ID NO:106), TRIM38 (SEQ ID NO:172), TRIM 41 (SEQ ID NO:187), TRIM43 (SEQ ID NO:197), TRIM44 (SEQ ID NO:202), TRIM45 (SEQ ID NO:207), TRIM46 (SEQ ID NO:212), TRIM54 (SEQ ID NO:247), TRIM55 (SEQ ID NO:252), TRIM56 (SEQ ID NO:257), TRIM58 (SEQ ID NO:262), TRIM59 (SEQ ID NO:267), TRIM60 (SEQ ID NO:272), TRIM65 (SEQ ID NO:297), TRIM66 (SEQ ID NO:302), TRIM75 (SEQ ID NO:338) and mixtures thereof, with TRIM 1 (SEQ ID NO:1), TRIM 8 (SEQ ID NO:36), TRIM 20 (SEQ ID NO:96), TRIM 21 (SEQ ID NO:101), TRIM 22 (SEQ ID NO:106), TRIM 56 (SEQ ID NO:257), TRIM 65 (SEQ ID NO:297), and mixtures thereof being preferred in combination with at least one additional bioactive agent, including an autophagy modulator as otherwise described herein including an alternative TRIM protein. In addition, neutral lipids such as lipids selected from the group consisting of triglycerides, diglycerides, monoglycerides, glycolated mono- or diacylglycerdies, dolichol, polyprenol, polyprenal or very long chain fatty acids may also be included in the pharmaceutical compositions according to the present invention in combination with the precision autophagy modulators according to the present invention to increase lipid storage and enhance the therapeutic effect of autophagy modulators used to treat excessive inflammation as otherwise disclosed herein
Methods of treating a disease state and/or condition with precision autophagy in a patient or subject in need (where upregulation of autophagy is desirable) comprise administering to said patient an effective amount of at least one compound selected from the group consisting of interferon gamma (IFN-gamma), pegylated interferon (PEG-IFN) and at least one TRIM protein or a variant thereof, preferably a TRIM protein selected from the group consisting of TRIM1 (SEQ ID NO:1), TRIM3 (SEQ ID NO: 11), TRIM8 (SEQ ID NO:36), TRIM10 (SEQ ID NO:46), TRIM13 (SEQ ID NO:56), TRIM17 (SEQ ID NO:81), TRIM19 (SEQ ID NO:91), TRIM20 (SEQ ID NO:96), TRIM21 (SEQ ID NO:101), TRIM22 (SEQ ID NO:106), TRIM38 (SEQ ID NO:172), TRIM 41 (SEQ ID NO:187), TRIM43 (SEQ ID NO:197), TRIM44 (SEQ ID NO:202), TRIM45 (SEQ ID NO:207), TRIM46 (SEQ ID NO:212), TRIM54 (SEQ ID NO:247), TRIM55 (SEQ ID NO:252), TRIM56 (SEQ ID NO:257), TRIM58 (SEQ ID NO:262), TRIM59 (SEQ ID NO:267), TRIM60 (SEQ ID NO:272), TRIM65 (SEQ ID NO:297), TRIM66 (SEQ ID NO:302), TRIM75 (SEQ ID NO:338) and mixtures thereof, preferably TRIM 1 (SEQ ID NO:1), TRIM 8 (SEQ ID NO:36), TRIM 20 (SEQ ID NO:96), TRIM 21 (SEQ ID NO:101), TRIM 22 (SEQ ID NO:106), TRIM 56 (SEQ ID NO:257), TRIM 65 (SEQ ID NO:297) and mixtures thereof, optionally in combination with an additional autophagy modulator (including an alternative TRIM protein) and/or an additional bioactive agent. In these methods, neutral lipids such as lipids selected from the group consisting of triglycerides, diglycerides, monoglycerides, glycolated mono- or diacylglycerdies, dolichol, polyprenol, polyprenal or very long chain fatty acids may also be administered in combination with the precision autophagy modulators according to the present invention to increase lipid storage and enhance the therapeutic effect of autophagy modulators used to treat excessive inflammation as otherwise disclosed herein. The present methods apply to a number of disease states and/or conditions which are mediated through autophagy and which often can result in an excessive autophagy response. In certain preferred aspects, the administration of TRIM20, alone or in combination with an additional autophagy modulator and/or bioactive agent as otherwise described herein is useful for upregulating autophagy and treating disease through modulation (up-regulation) of autophagy. This approach is especially useful in the case of certain disease states and/or conditions, especially microbial infections such as bacterial and viral infections where upregulation of TRIM proteins, especially TRIM20 is useful in inhibiting early stages of disease, especially viral and bacterial infections, including early stage tuberculosis (note that in later stage tuberculosis it may be preferable to down-regulate the autophagy response and inhibit the TRIM proteins by administering a TRIM protein inhibitor, especially including a siRNA). In this embodiment, a TRIM protein, especially including TRIM20 may be administered alone or in combination with interferon-gamma (IFN-gamma), pegylated interferon (PEG-IFN) and/or an additional autophagy modulator and/or an additional bioactive agent in order to treat a disease state and/or condition which is mediated through autophagy (an autophagy-mediated disease state and/or condition).
Methods according to the present invention also include down-regulating autophagy where an inflammatory response is elevated (in autoimmune disease, inflammatory diseases and in later stage disease states such as viral and/or bacterial infections, especially including tuberculosis, among others, the method comprising administering an inhibitor of a TRIM protein (including TRIM21) as otherwise set forth herein, especially siRNA which is an inhibitor of a TRIM protein. In preferred aspects, a siRNA inhibitor of TRIM21 is particularly useful in treating these disease states, especially including tuberculosis at any time during a tuberculosis infection. In other embodiments, a siRNA inhibitor of TRIM20 is administered at a later stage of tuberculosis in order to enhance the therapy of the disease state by reducing and/or the impact of autophagy.
It is noted that, as used in this specification and the appended claims, the singular forms “a,” “an,” and “the,” include plural referents unless expressly and unequivocally limited to one referent. Thus, for example, reference to “a compound” includes two or more different compound. As used herein, the term “include” and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or other items that can be added to the listed items.
The term “compound” or “agent”, as used herein, unless otherwise indicated, refers to any specific chemical compound disclosed herein and includes tautomers, regioisomers, geometric isomers as applicable, and also where applicable, optical isomers (e.g. enantiomers) thereof, as well as pharmaceutically acceptable salts thereof. Within its use in context, the term compound generally refers to a single compound, but also may include other compounds such as stereoisomers, regioisomers and/or optical isomers (including racemic mixtures) as well as specific enantiomers or enantiomerically enriched mixtures of disclosed compounds as well as diastereomers and epimers, where applicable in context. The term also refers, in context to prodrug forms of compounds which have been modified to facilitate the administration and delivery of compounds to a site of activity.
The term “patient” or “subject” is used throughout the specification within context to describe an animal, generally a mammal, including a domesticated mammal including a farm animal (dog, cat, horse, cow, pig, sheep, goat, etc.) and preferably a human, to whom treatment, including prophylactic treatment (prophylaxis), with the methods and compositions according to the present invention is provided. For treatment of those conditions or disease states which are specific for a specific animal such as a human patient, the term patient refers to that specific animal, often a human.
The terms “effective” or “pharmaceutically effective” are used herein, unless otherwise indicated, to describe an amount of a compound or composition which, in context, is used to produce or affect an intended result, for example the modulation of autophagy within the context of a particular treatment or alternatively, the effect of a bioactive agent which is coadministered with the autophagy modulator (autotoxin) in the treatment of disease.
The terms “treat”, “treating”, and “treatment”, etc., as used herein, refer to any action providing a benefit to a patient at risk for or afflicted by an autophagy mediated disease state or condition as otherwise described herein. The benefit may be in curing the disease state or condition, inhibition its progression, or ameliorating, lessening or suppressing one or more symptom of an autophagy mediated disease state or condition, as well as inhibiting or reducing excessive autophagy. Treatment, as used herein, encompasses both prophylactic and therapeutic treatment.
As used herein, the term “autophagy mediated disease state or condition” (which term may include the term “IRGM modulated disease” as a subset) refers to a disease state or condition that results from disruption in autophagy or cellular self-digestion and wherein IRGM or its pathway and/or the TRIM proteins and their pathways are involved in the disease state or condition. Autophagy is a cellular pathway involved in protein and organelle degradation, and has a large number of connections to human disease. Autophagic dysfunction is associated with cancer, neurodegeneration, microbial infection and ageing, among numerous other disease states and/or conditions. Although autophagy plays a principal role as a protective process for the cell, it also plays a role in cell death. Disease states and/or conditions which are mediated through autophagy (which refers to the fact that the disease state or condition may manifest itself as a function of the increase or decrease in autophagy in the patient or subject to be treated and treatment requires administration of an inhibitor or agonist of autophagy in the patient or subject) include, for example, cancer, including metastasis of cancer, lysosomal storage diseases (discussed hereinbelow), neurodegeneration (including, for example, Alzheimer's disease, Parkinson's disease, Huntington's disease; other ataxias), immune response (T cell maturation, B cell and T cell homeostasis, counters damaging inflammation) and chronic inflammatory diseases (may promote excessive cytokines when autophagy is defective), including, for example, inflammatory bowel disease, including Crohn's disease, rheumatoid arthritis, lupus, multiple sclerosis, chronic obstructive pulmony disease/COPD, pulmonary fibrosis, cystic fibrosis, Sjogren's disease; hyperglycemic disorders, diabetes (I and II), affecting lipid metabolism islet function and/or structure, excessive autophagy may lead to pancreatic β-cell death and related hyperglycemic disorders, including severe insulin resistance, hyperinsulinemia, insulin-resistant diabetes (e.g. Mendenhall's Syndrome, Werner Syndrome, leprechaunism, and lipoatrophic diabetes) and dyslipidemia (e.g. hyperlipidemia as expressed by obese subjects, elevated low-density lipoprotein (LDL), depressed high-density lipoprotein (HDL), and elevated triglycerides) and metabolic syndrome, liver disease (excessive autophagic removal of cellular entities-endoplasmic reticulum), renal disease (apoptosis in plaques, glomerular disease), cardiovascular disease (especially including ischemia, stroke, pressure overload and complications during reperfusion), muscle degeneration and atrophy, symptoms of aging (including amelioration or the delay in onset or severity or frequency of aging-related symptoms and chronic conditions including muscle atrophy, frailty, metabolic disorders, low grade inflammation, atherosclerosis and associated conditions such as cardiac and neurological both central and peripheral manifestations including stroke, age-associated dementia and sporadic form of Alzheimer's disease, pre-cancerous states, and psychiatric conditions including depression), stroke and spinal cord injury, arteriosclerosis, infectious diseases (microbial infections, removes microbes, provides a protective inflammatory response to microbial products, limits adaptation of authophagy of host by microbe for enhancement of microbial growth, regulation of innate immunity) including bacterial, especially including M. tuberculosis, fungal, cellular and viral (including secondary disease states or conditions associated with infectious diseases), including HIV I and II, hepatitis B and C, AIDS and tuberculosis, among others, development (including erythrocyte differentiation), embryogenesis/fertility/infertility (embryo implantation and neonate survival after termination of transplacental supply of nutrients, removal of dead cells during programmed cell death) and ageing (increased autophagy leads to the removal of damaged organelles or aggregated macromolecules to increase health and prolong life, but increased levels of autophagy in children/young adults may lead to muscle and organ wasting resulting in ageing/progeria).
The term “lysosomal storage disorder” refers to a disease state or condition that results from a defect in lysosomomal storage. These disease states or conditions generally occur when the lysosome malfunctions. Lysosomal storage disorders are caused by lysosomal dysfunction usually as a consequence of deficiency of a single enzyme required for the metabolism of lipids, glycoproteins or mucopolysaccharides. The incidence of lysosomal storage disorder (collectively) occurs at an incidence of about 1:5,000-1:10,000. The lysosome is commonly referred to as the cell's recycling center because it processes unwanted material into substances that the cell can utilize. Lysosomes break down this unwanted matter via high specialized enzymes. Lysosomal disorders generally are triggered when a particular enzyme exists in too small an amount or is missing altogether. When this happens, substances accumulate in the cell. In other words, when the lysosome doesn't function normally, excess products destined for breakdown and recycling are stored in the cell. Lysosomal storage disorders are genetic diseases, but these may be treated using autophagy modulators (autostatins) as described herein. All of these diseases share a common biochemical characteristic, i.e., that all lysosomal disorders originate from an abnormal accumulation of substances inside the lysosome. Lysosomal storage diseases mostly affect children who often die as a consequence at an early stage of life, many within a few months or years of birth. Many other children die of this disease following years of suffering from various symptoms of their particular disorder.
Examples of lysosomal storage diseases include, for example, activator deficiency/GM2 gangliosidosis, alpha-mannosidosis, aspartylglucoaminuria, cholesteryl ester storage disease, chronic hexosaminidase A deficiency, cystinosis, Danon disease, Fabry disease, Farber disease, fucosidosis, galactosialidosis, Gaucher Disease (Types I, II and III), GM! Ganliosidosis, including infantile, late infantile/juvenile and adult/chronic), Hunter syndrome (MPS II), I-Cell disease/Mucolipidosis II, Infantile Free Sialic Acid Storage Disease (ISSD), Juvenile Hexosaminidase A Deficiency, Krabbe disease, Lysosomal acid lipase deficiency, Metachromatic Leukodystrophy, Hurler syndrome, Scheie syndrome, Hurler-Scheie syndrome, Sanfilippo syndrome, Morquio Type A and B, Maroteaux-Lamy, Sly syndrome, mucolipidosis, multiple sulfate deficiency, Niemann-Pick disease, Neuronal ceroid lipofuscinoses, CLN6 disease, Jansky-Bielschowsky disease, Pompe disease, pycnodysostosis, Sandhoff disease, Schindler disease, Tay-Sachs and Wolman disease, among others.
The term “modulator of autophagy”, “regulator of autophagy” or “autophagy modulator” is used to refer to a compound or composition which modulates IRGM “ARGM modulator”) or its pathway or TRIM proteins and their pathways (“precision authophagy modulators” or “TRIM protein modulators”) and has an influence on treating diseases which are modulated through those mechanisms. IRGM modulators pursuant to the present invention include double stranded RNA (dsRNA), in particular poly I:C, poly U-G (UGUGU) and modified dsRNA such as poly ICLC (poly I; C modified with lysine and carboxymethyl cellulose) and muramyl peptides or muramyl dipeptides as disclosed herein. TRIM protein modulators include interferon gamma, pegylated interferon or preferably, any one or more of the TRIM proteins otherwise disclosed herein or an inhibitor of a TRIM protein such as a siRNA which specifically inhibits one or more TRIM proteins.
The term “muramyl peptide” or “muramyl dipeptide” include compounds according to the chemical structure:
wherein:
Preferred acyl groups for R1 and R2 are C1-C5 acyl groups such as acetyl; it will be appreciated that the carbon count in the acyl group does not include the carbonyl moiety. Preferred alkyl groups for R3 are C1-C4 alkyl groups such as methyl and ethyl. Preferred alkyl groups for R4 and C1-C6 alkyl groups, particularly C1-C4 alkyl groups, such as methyl or ethyl; phenyl is a preferred aryl group. R preferably represents a mono-, di- or tri-peptide, more often a dipeptide. The proximal peptide residue (or the only peptide residue, if there is only one) is preferably that of an L-amino acid.
Examples Include:
The next amino acid from the proximal end of the peptide is preferably of the D-configuration. It is preferably acidic and may be D-glutamic or D-aspartic acid or a mono-, di- or mixed C1-C22 (preferably C1-C5) alkyl ester, amide or C1-C4 alkyl amide thereof. (The expression “mixed” is illustrated when one carboxyl group is amidated and the other esterified. D-isoglutamine and D-glutamate are preferred. A third amino acid residue from the proximal end of the chain, if there is one, is preferably of the L-configuration, as indicated above in relation to the proximal amino acid residue. L-alanyl and L-lysyl are preferred.
The amino acid residue or linear peptide is optionally substituted with at least one lipophilic group. The lipophilic group may be a C10-C22 acyl group such as stearoyl or a di-(C10-C22 acyl)-sn-glycero-3′-hydroxyphospheryloxy group wherein for example each of the C10-C22 acyl groups can be a palmitoyl group. The lipophilic group may alternatively (or in addition, as more than one substitution may be present) be a C1-C10 ester group, such as a C2-C6 ester group: an acetyl group or a butyl ester are examples.
Examples of muramyl dipeptides within the scope of general formula I include: muroctasin, otherwise known as MDP-Lys (L18) (N2-(Nacetylmuramyl-L-alanyl-D-isoglutaminyl)-N6-stearoyl-L-lysine); MTP-PE (N-acetyl-muramyl-L-alanyl-D-isoglutaminyl-Lalanyl-2-(1′,2′-dipalmitoyl-sn-glycero-3′-hydroxyphosphoryloxy)ethylamide, monosodium); murabutide (N-acetylmuramyl-L-alanyl-D-glutamine-aN-butyl ester); and t-MDP (N-acetylmuramyl-L-threonyl-D-isoglutamine).
The preparation of these and other compounds pursuant to the present invention is disclosed in EPA-15 0021367, USA-4317771, EPA-0025495, Lefrancier, et al, J. Med. Chem., 25 87 (1982), as well as methods generally known in the art. Patent publications which give details of the preparations of muramyl peptide compounds generally include BEA-0834753, BEA-0834754, BEA-0847103, BEA-0849214, DEA-2710455, DEA-2922533, DEA-2747379, DE-A-2912865, FR-A-2355505, FRA-2358159, FRA-2375249, EP-A-0004512, EP-A-0002677, JP-A-54063016, JP-25 A-54073729, JPA-55019236, U.S. Pat. Nos. 4,082,735 and 4,082,736, among others. The preparation of prototype muramyl dipeptide is disclosed in DE-A-2450355 and USA-4235771.) All the documents referred to in this specification are incorporated herein by reference.
Other useful compounds are disclosed in WO96/01645 (the structures of these compounds may be found in the published PCT application and include the following compounds, among others:
The term “TRIM protein” or “tripartite motif containing protein” is used to describe a TRIM protein or variant thereof as otherwise disclosed herein which is integral to an autophagy response and may be integral as part of an upregulation of autphagy (TRIM20, etc.) or down-regulation of autophagy (TRIM21, etc.). Many TRIM proteins are induced by interferons, which are important components of resistance to pathogens and a number of TRIM proteins are known to be required for the restriction of infection by lentiviruses. In instances where a patient or subject is interferon deficient, the administration of TRIM proteins alone or in combination with interferon gamma and/or pegylated interferon may assist in treating disease, especially infections such as viral infections or bacterial infections, especially Mycobacterium infections such as M. tuberculosis infections. TRIM proteins are involved in pathogen-recognition and by regulation of transcriptional pathways in host defence. Numerous TRIM proteins may be used in the present invention as otherwise described herein. Sequences of these proteins are included as are the accession numbers for identifying these proteins. TRIM proteins are known in the art. TRIM proteins which are useful and preferred in the present invention include the human full length TRIM proteins (TRIM1-75) as otherwise described herein. The sequences of TRIM proteins 1-75 as shown as well as polypeptide variants which have at least about a 90% sequence identity, and preferably at least about 95% sequence identify (about 96%, about 97%, about 98% and about 99% sequence identify) to the wild type polypeptide sequences of homo sapien TRIM proteins 1-75 are useful in the present invention. These sequences are set forth in the attached table on pages 92-116 just before the presentation of the claims. Note that TRIM proteins or polypeptide variants thereof or a pharmaceutically acceptable salt thereof may be used in the present invention. All 75 TRIM proteins as identified herein may be used in the present invention, although the preferred TRIM proteins have been identified and are more often used to modulate autophagy (either up-regulation or down-regulation) in order to favorably effect an intended outcome. SEQ ID NOs for TRIM proteins 1-75 and siRNA TRIM protein inhibitors are set forth in the table on pages 92-116 of the present application just before the claims.
In addition to TRIM proteins which find use in the present invention (pharmaceutical compositions comprising these proteins may be administered to patients in order to regulate (up- or down-regulate autophagy), inhibitors of these proteins, especially including small inhibitory RNAs or small interfering RNAs (siRNAs) may also be used to impact autophagy and treat disease states and/or conditions which are mediated through autophagy. A number of siRNAs can be used to inhibit any one or more of the TRIM proteins pursuant to the present invention. Exemplary siRNAs are presented herein in the table just before the claims. Thus, siRNAs which can be used in the present invention include the siRNAs according to the specific sequences indicated in the attached table, as well as oligos which are plus/minus up to five nucleotide units upstream or downstream of the identified siRNAs. Additional variants of these variants include those with 90% sequence identity to the siRNAs set forth in the table on pages 92-116 or variants that exhibit polymorphism to the disclosed siRNAs. These siRNAs range in size from about 9-10 nucleotide units up to about 29-30 nucleotide units, with 19-23 nucleotide units being preferred. Preferably, these siRNAs are the specific siRNAs which are disclosed in the table on pages 92-116 hereof or siRNAs which contain up to five nucleotide units more upstream and/or downstream to the disclosed siRNAs.
The term “modulator of autophagy”, “regulator of autophagy” or “autostatin” is used to refer to a compound which functions as an agonist (inducer or up-regulator) or antagonist (inhibitor or down-regulator) of autophagy and are unrelated to the IRGM modulators, inteferons, TRIM proteins or TRIM protein inhibitors (e.g. siRNAs as disclosed herein). These modulators may be used in combination with an IRGM modulator and/or a TRIM protein, interferon or siRNA inhibitor in methods and compositions pursuant to the present invention. Depending upon the disease state or condition, autophagy may be upregulated (and require inhibition of autophagy for therapeutic intervention) or down-regulated (and require upregulation of autophagy for therapeutic intervention). In most instances, in the case of cancer treatment with a modulator of autophagy as otherwise described herein, the autophagy modulator is often an antagonist of autophagy. In the case of cancer, the antagonist (inhibitor) of autophagy may be used alone or combined with an agonist of autophagy
The following compounds have been identified as autophagy modulators according to the present invention and can be used in combination with an IRGM modulator or Trim protein as disclosed herein in the treatment of an autophagy mediated disease state or condition as otherwise described herein. It is noted that an inhibitor of autophagy is utilized where the disease state or condition is mediated through upregulation or an increase in autophagy which causes the disease state or condition and an agonist of autophagy is utilized where the disease state or condition is mediated through downregulation or a decrease in autophagy. The following compounds have been identified as autophagy modulators (autotaxins) in autophagy assays according to the present invention: flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon and nortriptyline, tetrachlorisophthalonitrile, phenylmercuric acetate and pharmaceutically acceptable salts thereof. It is noted that flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon, nortriptyline and their pharmaceutically acceptable salts show activity as agonists or inducers of autophagy in the treatment of an autophagy-mediated disease, whereas tetrachlorisophthalonitrile, phenylmercuric acetate and their pharmaceutically acceptable salts, find use as antagonists or inhibitors of autophagy. All of these compounds will find use as modulators of autophagy in the various autophagy-mediated disease states and conditions described herein, with the agonists being preferred in most disease states other than cancer (although inhibitors may also be used alone, or preferably in combination with the agonists) and in the case of the treatment of cancer, the inhibitors described above are preferred, alone or in combination with an autophagy agonist as described above and/or an additional anticancer agent as otherwise described herein.
Other compounds which may be used in combination with the IRGM modulators and/or TRIM proteins and/or siRNAs as otherwise described herein either alone or in combination with the autophagy modulators which are described above, include for example, other “additional autophagy modulators” or “additional autostatins” which are known in the art. These can be combined with one or more of the autophagy modulators which are disclosed above to provide novel pharmaceutical compositions and/or methods of treating autophagy mediated disease states and conditions which are otherwise described herein. These additional autophagy modulators including benzethonium, niclosamide, monensin, bromperidol, levobunolol, dehydroisoandosterone 3-acetate, sertraline, tamoxifen, reserpine, hexachlorophene, dipyridamole, harmaline, prazosin, lidoflazine, thiethylperazine, dextromethorphan, desipramine, mebendazole, canrenone, chlorprothixene, maprotiline, homochlorcyclizine, loperamide, nicardipine, dexfenfluramine, nilvadipine, dosulepin, biperiden, denatonium, etomidate, toremifene, tomoxetine, clorgyline, zotepine, beta-escin, tridihexethyl, ceftazidime, methoxy-6-harmalan, melengestrol, albendazole, rimantadine, chlorpromazine, pergolide, cloperastine, prednicarbate, haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil, Methimazole, Trimeprazine, Ethoxyquin, Clocortolone, Doxycycline, Pirlindole mesylate, Doxazosin, Deptropine, Nocodazole, Scopolamine, Oxybenzone, Halcinonide, Oxybutynin, Miconazole, Clomipramine, Cyproheptadine, Doxepin, Dyclonine, Salbutamol, Flavoxate, Amoxapine, Fenofibrate, Pimethixene and mixtures thereof.
The following compounds have been identified as autophagy modulators according to the present invention and can be used in the treatment of an autophagy mediated disease state or condition as otherwise described herein. These include interferon, especially interferon-gamma (IFN-gamma), pegylated interferon (PEG-IFN) and related compounds and certain TRIM proteins and variants thereof, including TRIM1, TRIM3, TRIM8, TRIM10, TRIM13, TRIM17, TRIM19, TRIM20, TRIM21, TRIM22, TRIM38, TRIM 41, TRIM43, TRIM44, TRIM45, TRIM46, TRIM54, TRIM55, TRIM56, TRIM58, TRIM59, TRIM60, TRIM65, TRIM66 and TRIM75 with TRIM 1, TRIM 8, TRIM 20, TRIM 21, TRIM 22, TRIM 56 and TRIM 65 and mixtures thereof and preferably, TRIM 1, TRIM 8, TRIM 20, TRIM 21, TRIM 22, TRIM 56, TRIM 65 and mixtures thereof. The following compounds have been identified as autophagy modulators which may be used in combination with the above-identified autophagy agents. These agents include, for example flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon and nortriptyline, tetrachlorisophthalonitrile, phenylmercuric acetate and pharmaceutically acceptable salts thereof. It is noted that flubendazole, hexachlorophene, propidium iodide, bepridil, clomiphene citrate (Z,E), GBR 12909, propafenone, metixene, dipivefrin, fluvoxamine, dicyclomine, dimethisoquin, ticlopidine, memantine, bromhexine, norcyclobenzaprine, diperodon, nortriptyline, benzethonium, niclosamide, monensin, bromperidol, levobunolol, dehydroisoandosterone 3-acetate, sertraline, tamoxifen, reserpine, hexachlorophene, dipyridamole, harmaline, prazosin, lidoflazine, thiethylperazine, dextromethorphan, desipramine, mebendazole, canrenone, chlorprothixene, maprotiline, homochlorcyclizine, loperamide, nicardipine, dexfenfluramine, nilvadipine, dosulepin, biperiden, denatonium, etomidate, toremifene, tomoxetine, clorgyline, zotepine, beta-escin, tridihexethyl, ceftazidime, methoxy-6-harmalan, melengestrol, albendazole, rimantadine, chlorpromazine, pergolide, cloperastine, prednicarbate, haloperidol, clotrimazole, nitrofural, iopanoic acid, naftopidil, Methimazole, Trimeprazine, Ethoxyquin, Clocortolone, Doxycycline, Pirlindole mesylate, Doxazosin, Deptropine, Nocodazole, Scopolamine, Oxybenzone, Halcinonide, Oxybutynin, Miconazole, Clomipramine, Cyproheptadine, Doxepin, Dyclonine, Salbutamol, Flavoxate, Amoxapine, Fenofibrate, Pimethixene, and mixtures thereof. Additional autophagy agents include alternative TRIM proteins or variants thereof, such as, but not limited to, TRIM5α, TRIM6, TRIM10, TRIM17, TRIM41, TRIM55, TRIM72, TRIM76, TRIM2, TRIM23, TRIM26, TRIM28, TRIM31, TRIM 32, TRIM33, TRIM38, TRIM42, TRIM44, TRIM45, TRIM49, TRIM50, TRIM51, TRIM58, TRIM59, TRIM68, TRIM73, TRIM74 and TRIM76 and mixtures thereof. Neutral lipids such as lipids selected from the group consisting of triglycerides, diglycerides, monoglycerides, glycolated mono- or diacylglycerdies, dolichol, polyprenol, polyprenal or very long chain fatty acids and mixtures thereof and their pharmaceutically acceptable salts may also be included for use in the present invention either alone or preferably in combination with one or more TRIM protein. All of these compounds will find use as modulators of autophagy in the various autophagy-mediated disease states and conditions described herein.
The term “co-administration” or “combination therapy” is used to describe a therapy in which at least two active compounds in effective amounts are used to treat an autophagy mediated disease state or condition as otherwise described herein, either at the same time or within dosing or administration schedules defined further herein or ascertainable by those of ordinary skill in the art. Although the term co-administration preferably includes the administration of two active compounds to the patient at the same time, it is not necessary that the compounds be administered to the patient at the same time, although effective amounts of the individual compounds will be present in the patient at the same time. In addition, in certain embodiments, co-administration will refer to the fact that two compounds are administered at significantly different times, but the effects of the two compounds are present at the same time. Thus, the term co-administration includes an administration in which one active agent (especially an autophagy modulator) is administered at approximately the same time (contemporaneously), or from about one to several minutes to about 24 hours or more than the other bioactive agent coadministered with the autophagy modulator. The additional bioactive agent may be any bioactive agent, but is generally selected from an additional autophagy mediated compound as described herein, an additional anticancer agent, or another agent, such as a mTOR inhibitor such as pp242, rapamycin, envirolimus, everolimus or cidaforollimus, among others including epigallocatechin gallate (EGCG), caffeine, curcumin or reseveratrol (which mTOR inhibitors find particular use as enhancers of autophagy using the compounds disclosed herein and in addition, in the treatment of cancer with an autophagy modulator (inhibitor) as described herein, including in combination with tetrachlorisophthalonitrile, phenylmercuric acetate and their pharmaceutically acceptable salts, which are inhibitors of autophagy. It is noted that in the case of the treatment of cancer, the use of an autophagy inhibitor is preferred, alone or in combination with an autophagy inducer (agonist) as otherwise described herein and/or a mTOR inhibitor as described above. In certain embodiments, an mTOR inhibitor selected from the group consisting of pp242, rapamycin, envirolimus, everolimus, cidaforollimus, epigallocatechin gallate (EGCG), caffeine, curcumin, reseveratrol and mixtures thereof may be combined with at least one agent selected from the group consisting of digoxin, xylazine, hexetidine and sertindole, the combination of such agents being effective as autophagy modulators in combination.
The term “cancer” is used throughout the specification to refer to the pathological process that results in the formation and growth of a cancerous or malignant neoplasm, i.e., abnormal tissue that grows by cellular proliferation, often more rapidly than normal and continues to grow after the stimuli that initiated the new growth cease. Malignant neoplasms show partial or complete lack of structural organization and functional coordination with the normal tissue and most invade surrounding tissues, metastasize to several sites, and are likely to recur after attempted removal and to cause the death of the patient unless adequately treated.
As used herein, the term neoplasia is used to describe all cancerous disease states and embraces or encompasses the pathological process associated with malignant hematogenous, ascitic and solid tumors. Representative cancers include, for example, stomach, colon, rectal, liver, pancreatic, lung, breast, cervix uteri, corpus uteri, ovary, prostate, testis, bladder, renal, brain/CNS, head and neck, throat, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, leukemia, melanoma, non-melanoma skin cancer (especially basal cell carcinoma or squamous cell carcinoma), acute lymphocytic leukemia, acute myelogenous leukemia, Ewing's sarcoma, small cell lung cancer, choriocarcinoma, rhabdomyosarcoma, Wilms' tumor, neuroblastoma, hairy cell leukemia, mouth/pharynx, oesophagus, larynx, kidney cancer and lymphoma, among others, which may be treated by one or more compounds according to the present invention. In certain aspects, the cancer which is treated is lung cancer, breast cancer, ovarian cancer and/or prostate cancer.
The term “tumor” is used to describe a malignant or benign growth or tumefacent.
The term “additional anti-cancer compound”, “additional anti-cancer drug” or “additional anti-cancer agent” is used to describe any compound (including its derivatives) which may be used to treat cancer. The “additional anti-cancer compound”, “additional anti-cancer drug” or “additional anti-cancer agent” can be an anticancer agent which is distinguishable from a CIAE-inducing anticancer ingredient such as a taxane, vinca alkaloid and/or radiation sensitizing agent otherwise used as chemotherapy/cancer therapy agents herein. In many instances, the co-administration of another anti-cancer compound according to the present invention results in a synergistic anti-cancer effect. Exemplary anti-cancer compounds for co-administration with formulations according to the present invention include anti-metabolites agents which are broadly characterized as antimetabolites, inhibitors of topoisomerase I and II, alkylating agents and microtubule inhibitors (e.g., taxol), as well as tyrosine kinase inhibitors (e.g., surafenib), EGF kinase inhibitors (e.g., tarceva or erlotinib) and tyrosine kinase inhibitors or ABL kinase inhibitors (e.g. imatinib).
Anti-cancer compounds for co-administration include, for example, Aldesleukin; Alemtuzumab; alitretinoin; allopurinol; altretamine; amifostine; anastrozole; arsenic trioxide; Asparaginase; BCG Live; bexarotene capsules; bexarotene gel; bleomycin; busulfan intravenous; busulfan oral; calusterone; capecitabine; carboplatin; carmustine; carmustine with Polifeprosan 20 Implant; celecoxib; chlorambucil; cisplatin; cladribine; cyclophosphamide; cytarabine; cytarabine liposomal; dacarbazine; dactinomycin; actinomycin D; Darbepoetin alfa; daunorubicin liposomal; daunorubicin, daunomycin; Denileukin diftitox, dexrazoxane; docetaxel; doxorubicin; doxorubicin liposomal; Dromostanolone propionate; Elliott's B Solution; epirubicin; Epoetin alfa estramustine; etoposide phosphate; etoposide (VP-16); exemestane; Filgrastim; floxuridine (intraarterial); fludarabine; fluorouracil (5-FU); fulvestrant; gemtuzumab ozogamicin; gleevec (imatinib); goserelin acetate; hydroxyurea; Ibritumomab Tiuxetan; idarubicin; ifosfamide; imatinib mesylate; Interferon alfa-2a; Interferon alfa-2b; irinotecan; letrozole; leucovorin; levamisole; lomustine (CCNU); meclorethamine (nitrogen mustard); megestrol acetate; melphalan (L-PAM); mercaptopurine (6-MP); mesna; methotrexate; methoxsalen; mitomycin C; mitotane; mitoxantrone; nandrolone phenpropionate; Nofetumomab; LOddC; Oprelvekin; oxaliplatin; paclitaxel; pamidronate; pegademase; Pegaspargase; Pegfilgrastim; pentostatin; pipobroman; plicamycin; mithramycin; porfimer sodium; procarbazine; quinacrine; Rasburicase; Rituximab; Sargramostim; streptozocin; surafenib; talbuvidine (LDT); talc; tamoxifen; tarceva (erlotinib); temozolomide; teniposide (VM-26); testolactone; thioguanine (6-TG); thiotepa; topotecan; toremifene; Tositumomab; Trastuzumab; tretinoin (ATRA); Uracil Mustard; valrubicin; valtorcitabine (monoval LDC); vinblastine; vinorelbine; zoledronate; and mixtures thereof, among others.
Co-administration of one of the formulations of the invention with another anticancer agent will often result in a synergistic enhancement of the anticancer activity of the other anticancer agent, an unexpected result. One or more of the present formulations comprising an IRGM modulator optionally in combination with an autophagy modulator (autostatin) as described herein may also be co-administered with another bioactive agent (e.g., antiviral agent, antihyperproliferative disease agent, agents which treat chronic inflammatory disease, among others as otherwise described herein).
The term “antiviral agent” refers to an agent which may be used in combination with authophagy modulators (autostatins) as otherwise described herein to treat viral infections, especially including HIV infections, HBV infections and/or HCV infections. Exemplary anti-HIV agents include, for example, nucleoside reverse transcriptase inhibitors (NRTI), non-nucloeoside reverse transcriptase inhibitors (NNRTI), protease inhibitors, fusion inhibitors, among others, exemplary compounds of which may include, for example, 3TC (Lamivudine), AZT (Zidovudine), (−)-FTC, ddl (Didanosine), ddC (zalcitabine), abacavir (ABC), tenofovir (PMPA), D-D4FC (Reverset), D4T (Stavudine), Racivir, L-FddC, L-FD4C, NVP (Nevirapine), DLV (Delavirdine), EFV (Efavirenz), SQVM (Saquinavir mesylate), RTV (Ritonavir), IDV (Indinavir), SQV (Saquinavir), NFV (Nelfinavir), APV (Amprenavir), LPV (Lopinavir), fusion inhibitors such as T20, among others, fuseon and mixtures thereof, including anti-HIV compounds presently in clinical trials or in development. Exemplary anti-HBV agents include, for example, hepsera (adefovir dipivoxil), lamivudine, entecavir, telbivudine, tenofovir, emtricitabine, clevudine, valtoricitabine, amdoxovir, pradefovir, racivir, BAM 205, nitazoxanide, UT 231-B, Bay 41-4109, EHT899, zadaxin (thymosin alpha-1) and mixtures thereof. Anti-HCV agents include, for example, interferon, pegylated intergeron, ribavirin, NM 283, VX-950 (telaprevir), SCH 50304, TMC435, VX-500, BX-813, SCH503034, R1626, ITMN-191 (R7227), R7128, PF-868554, TT033, CGH-759, GI 5005, MK-7009, SIRNA-034, MK-0608, A-837093, GS 9190, ACH-1095, GSK625433, TG4040 (MVA-HCV), A-831, F351, NS5A, NS4B, ANA598, A-689, GNI-104, IDX102, ADX184, GL59728, GL60667, PSI-7851, TLR9 Agonist, PHX1766, SP-30 and mixtures thereof.
An “inflammation-associated metabolic disorder” includes, but is not limited to, lung diseases, hyperglycemic disorders including diabetes and disorders resulting from insulin resistance, such as Type I and Type II diabetes, as well as severe insulin resistance, hyperinsulinemia, and dyslipidemia or a lipid-related metabolic disorder (e.g. hyperlipidemia (e.g., as expressed by obese subjects), elevated low-density lipoprotein (LDL), depressed high-density lipoprotein (HDL), and elevated triglycerides) and insulin-resistant diabetes, such as Mendenhall's Syndrome, Werner Syndrome, leprechaunism, and lipoatrophic diabetes, renal disorders, such as acute and chronic renal insufficiency, end-stage chronic renal failure, glomerulonephritis, interstitial nephritis, pyelonephritis, glomerulosclerosis, e.g., Kimmelstiel-Wilson in diabetic patients and kidney failure after kidney transplantation, obesity, GH-deficiency, GH resistance, Turner's syndrome, Laron's syndrome, short stature, increased fat mass-to-lean ratios, immunodeficiencies including decreased CD4+ T cell counts and decreased immune tolerance or chemotherapy-induced tissue damage, bone marrow transplantation, diseases or insufficiencies of cardiac structure or function such as heart dysfunctions and congestive heart failure, neuronal, neurological, or neuromuscular disorders, e.g., diseases of the central nervous system including Alzheimer's disease, or Parkinson's disease or multiple sclerosis, and diseases of the peripheral nervous system and musculature including peripheral neuropathy, muscular dystrophy, or myotonic dystrophy, and catabolic states, including those associated with wasting caused by any condition, including, e.g., mental health condition (e.g., anorexia nervosa), trauma or wounding or infection such as with a bacterium or human virus such as HIV, wounds, skin disorders, gut structure and function that need restoration, and so forth.
An “inflammation-associated metabolic disorder” also includes a cancer and an “infectious disease” as defined herein, as well as disorders of bone or cartilage growth in children, including short stature, and in children and adults disorders of cartilage and bone in children and adults, including arthritis and osteoporosis. An “inflammation-associated metabolic disorder” includes a combination of two or more of the above disorders (e.g., osteoporosis that is a sequela of a catabolic state). Specific disorders of particular interest targeted for treatment herein are diabetes and obesity, heart dysfunctions, kidney disorders, neurological disorders, bone disorders, whole body growth disorders, and immunological disorders.
In one embodiment, “inflammation-associated metabolic disorder” includes: central obesity, dyslipidemia including particularly hypertriglyceridemia, low HDL cholesterol, small dense LDL particles and postpranial lipemia; glucose intolerance such as impaired fasting glucose; insulin resistance and hypertension, and diabetes. The term “diabetes” is used to describe diabetes mellitus type I or type II. The present invention relates to a method for improving renal function and symptoms, conditions and disease states which occur secondary to impaired renal function in patients or subjects with diabetes as otherwise described herein. It is noted that in diabetes mellitus type I and II, renal function is impaired from collagen deposits, and not from cysts in the other disease states treated by the present invention.
Mycobacterial infections often manifest as diseases such as tuberculosis. Human infections caused by mycobacteria have been widespread since ancient times, and tuberculosis remains a leading cause of death today. Although the incidence of the disease declined, in parallel with advancing standards of living, since the mid-nineteenth century, mycobacterial diseases still constitute a leading cause of morbidity and mortality in countries with limited medical resources. Additionally, mycobacterial diseases can cause overwhelming, disseminated disease in immunocompromised patients. In spite of the efforts of numerous health organizations worldwide, the eradication of mycobacterial diseases has never been achieved, nor is eradication imminent. Nearly one third of the world's population is infected with Mycobacterium tuberculosis complex, commonly referred to as tuberculosis (TB), with approximately 8 million new cases, and two to three million deaths attributable to TB yearly. Tuberculosis (TB) is the cause of the largest number of human deaths attributable to a single etiologic agent (see Dye et al., J. Am. Med. Association, 282, 677-686, (1999); and 2000 WHO/OMS Press Release).
Mycobacteria other than M. tuberculosis are increasingly found in opportunistic infections that plague the AIDS patient. Organisms from the M. avium-intracellulare complex (MAC), especially serotypes four and eight, account for 68% of the mycobacterial isolates from AIDS patients. Enormous numbers of MAC are found (up to 1010 acid-fast bacilli per gram of tissue), and consequently, the prognosis for the infected AIDS patient is poor.
In many countries the only measure for TB control has been vaccination with M. bovis bacille Calmette-Guerin (BCG). The overall vaccine efficacy of BCG against TB, however, is about 50% with extreme variations ranging from 0% to 80% between different field trials. The widespread emergence of multiple drug-resistant M. tuberculosis strains is also a concern.
M. tuberculosis belongs to the group of intracellular bacteria that replicate within the phagosomal vacuoles of resting macrophages, thus protection against TB depends on T cell-mediated immunity. Several studies in mice and humans, however, have shown that Mycobacteria stimulate antigen-specific, major histocompatibility complex (MHC) class II- or class I-restricted CD4 and CD8 T cells, respectively. The important role of MHC class I-restricted CD8 T cells was convincingly demonstrated by the failure of β2-microglobulin) deficient mice to control experimental M. tuberculosis infection.
As used herein, the term “tuberculosis” comprises disease states usually associated with infections caused by mycobacteria species comprising M. tuberculosis complex. The term “tuberculosis” is also often associated with mycobacterial infections caused by mycobacteria other than M. tuberculosis. Other mycobacterial species include M. avium-intracellulare, M. kansarii, M. fortuitum, M. chelonae, M. leprae, M. africanum, and M. microti, M. avium paratuberculosis, M. intracellulare, M. scrofulaceum, M. xenopi, M. marinum, M. ulcerans.
An “infectious disease” includes but is limited to those caused by bacterial, mycological, parasitic, and viral agents. Examples of such infectious agents include the following: staphylococcus, streptococcaceae, neisseriaaceae, cocci, enterobacteriaceae, pseudomonadaceae, vibrionaceae, campylobacter, pasteurellaceae, bordetella, francisella, brucella, legionellaceae, bacteroidaceae, gram-negative bacilli, clostridium, corynebacterium, propionibacterium, gram-positive bacilli, anthrax, actinomyces, nocardia, mycobacterium, treponema, borrelia, leptospira, mycoplasma, ureaplasma, rickettsia, chlamydiae, systemic mycoses, opportunistic mycoses, protozoa, nematodes, trematodes, cestodes, adenoviruses, herpesviruses, poxviruses, papovaviruses, hepatitis viruses (B and C, among others), orthomyxoviruses, paramyxoviruses, coronaviruses, picornaviruses, reoviruses, togaviruses, flaviviruses, bunyaviridae, rhabdoviruses, human immunodeficiency virus (I and II) and retroviruses.
In certain embodiments, an “infectious disease” is selected from the group consisting of tuberculosis, leprosy, Crohn's Disease, acquired immunodeficiency syndrome, Lyme disease, cat-scratch disease, Rocky Mountain spotted fever and influenza or a viral infection selected from HIV (I and/or II), hepatitis B virus (HBV) or hepatitis C virus (HCV).
While not being limited by way of theory, it is believed that autophagy-mediated disease states which evidence upregulated autophagy and upregulated TRIM proteins include inflammatory disease states and autoimmune disease states as otherwise described herein. These disease states and/or conditions may benefit from the inhibition of TRIM proteins where there is evidence that autophagy is up-regulated and needs to be brought back into balance in order to facilitate healing of the disease state and/or condition. In these disease states, the inhibition of TRIM proteins, including inhibiting TRIM proteins by administration of small interfering RNAs (siRNAs) which inhibit the synthesis of the TRIM protein to be reduced in order to down regulate autophagy may be useful. This approach may provide beneficial treatment in a large number of disease states and conditions where upregulation of autophagy is responsible for the disease state and/or exacerbating the disease state. In other disease states, in particular, bacterial and viral infections, especially tuberculosis and in some instances of cancer, autophagy is often down-regulated and may benefit from the upregulation of autophagy through the administration of one or more TRIM proteins (especially TRIM20) alone or in combination with interferon-gamma, pegylated interferon and/or one more additional autophagy agents including alternative TRIM proteins as otherwise disclosed herein.
According to various embodiments, the compounds according to the present invention may be used for treatment or prevention purposes in the form of a pharmaceutical composition. This pharmaceutical composition may comprise one or more of an active ingredient as described herein.
As indicated, the pharmaceutical composition may also comprise a pharmaceutically acceptable excipient, additive or inert carrier. The pharmaceutically acceptable excipient, additive or inert carrier may be in a form chosen from a solid, semi-solid, and liquid. The pharmaceutically acceptable excipient or additive may be chosen from a starch, crystalline cellulose, sodium starch glycolate, polyvinylpyrolidone, polyvinylpolypyrolidone, sodium acetate, magnesium stearate, sodium laurylsulfate, sucrose, gelatin, silicic acid, polyethylene glycol, water, alcohol, propylene glycol, vegetable oil, corn oil, peanut oil, olive oil, surfactants, lubricants, disintegrating agents, preservative agents, flavoring agents, pigments, and other conventional additives. The pharmaceutical composition may be formulated by admixing the active with a pharmaceutically acceptable excipient or additive.
The pharmaceutical composition may be in a form chosen from sterile isotonic aqueous solutions, pills, drops, pastes, cream, spray (including aerosols), capsules, tablets, sugar coating tablets, granules, suppositories, liquid, lotion, suspension, emulsion, ointment, gel, and the like. Administration route may be chosen from subcutaneous, intravenous, intestinal, parenteral, oral, buccal, sublingual, nasal, intramuscular, transcutaneous, transdermal, intranasal, intratracheal, intrathecal, pulmonary, intraperitoneal, and topical, among others. The pharmaceutical compositions may be immediate release, sustained/controlled release, or a combination of immediate release and sustained/controlled release depending upon the compound(s) to be delivered, the compound(s), if any, to be coadministered, as well as the disease state and/or condition to be treated with the pharmaceutical composition. A pharmaceutical composition may be formulated with differing compartments or layers in order to facilitate effective administration of any variety consistent with good pharmaceutical practice.
The subject or patient may be chosen from, for example, a human, a mammal such as domesticated animal, or other animal. The subject may have one or more of the disease states, conditions or symptoms associated with autophagy as otherwise described herein.
The compounds according to the present invention may be administered in an effective amount to treat or reduce the likelihood of an autophagy-mediated disease and/or condition as well one or more symptoms associated with the disease state or condition. One of ordinary skill in the art would be readily able to determine an effective amount of active ingredient by taking into consideration several variables including, but not limited to, the animal subject, age, sex, weight, site of the disease state or condition in the patient, previous medical history, other medications, etc.
For example, the dose of an active ingredient which is useful in the treatment of an autophagy mediated disease state, condition and/or symptom for a human patient is that which is an effective amount and may range from as little as 100 μg or even less to at least about 500 mg up to a gram or more, which may be administered in a manner consistent with the delivery of the drug and the disease state or condition to be treated. In the case of oral administration, active is generally administered from one to four times or more daily. Transdermal patches or other topical administration may administer drugs continuously, one or more times a day or less frequently than daily, depending upon the absorptivity of the active and delivery to the patient's skin. Of course, in certain instances where parenteral administration represents a favorable treatment option, intramuscular administration or slow IV drip may be used to administer active. The amount of active ingredient which is administered to a human patient preferably ranges from about 0.05 mg/kg to about 10 mg/kg, about 0.1 mg/kg to about 7.5 mg/kg, about 0.25 mg/kg to about 6 mg/kg., about 1.25 to about 5.7 mg/kg.
The dose of a compound according to the present invention may be administered at the first signs of the onset of an autophagy mediated disease state, condition or symptom. For example, the dose may be administered for the purpose of lung or heart function and/or treating or reducing the likelihood of any one or more of the disease states or conditions which become manifest during an inflammation-associated metabolic disorder or tuberculosis or associated disease states or conditions, including pain, high blood pressure, renal failure, or lung failure. The dose of active ingredient may be administered at the first sign of relevant symptoms prior to diagnosis, but in anticipation of the disease or disorder or in anticipation of decreased bodily function or any one or more of the other symptoms or secondary disease states or conditions associated with an autophagy mediated disorder to condition.
Synthesis of TRIM proteins according to the present invention may be performed by the routineer skilled in the art and may be provided by engineering polynucleotide sequences corresponding to the amino acid sequences of the TRIM proteins into plasmids for expression, transfecting the plasmids into both eukaryotic and/or prokaryotic cells and accumulating protein from the growth of the cells containing the plasmids. Alternatively, the proteins may be readily synthesized by standard, well-known peptide synthesis methods, including solid phase synthesis.
The following examples are provided to further describe the present invention. The examples, while descriptive of the present invention, are not to be construed as limiting the present invention.
Antibodies, Plasmids, and siRNA
Antibodies were from Cell Signaling (AMPK, AMPK Thr-172, ULK, ULK1 p-Ser 317, p-Ser 757, p-Ser555, NOD2, Beclin 1 p-Ser-93/96 and ATG5), MBL international corp. (ATG16L1, ATG14L, Rubicon and UVRAG), Abcam (GFP, IRGM, LPS, TRAF6 and BCL2), Sigma (LC3B, Flag), Millipore (V5 tag and HA tag), Abbiotec (Beclin 1 p-Ser15) and Novus biological (AMBRA1). GFP-tagged IRGM expression plasmid (GFP-IRGMd) was described previously (Singh et al., 2010). GFP-IRGM-Kmut was generated from GFP-IRGMd plasmid by replacing wild type IRGMd gene with synthetic mutated IRGMd gene (GeneScript) with all lysine residues mutated to arginine. Flag-IRGM and IRGM-V5 were generated by Gateway cloning (Life technologies). HA-UbiquitinC, HA-UbiquitinC-K63 (all lysine mutated except K63, Plasmid 17606), HA-UbiquitinC-K48 (all lysine mutated except K48, Plasmid 17605), Flag-TLR3 (Plasmid 13084) and YFP-TLR4 (Plasmid 13018) were from Addgene. Flag-NOD2 and variants were from Dr. Thomas Kufer (University of Cologne, Germany). Flag-ATG16L1 and variants were from Dr. Ramnik Xavier (Massachusetts General Hospital, Boston). Flag-TRAF6 was from Dr. Edward Harhaj (Johns Hopkins School of Medicine, US). IRGM siRNA, TRAF6 siRNA, AMPKα2 siRNA were from Dharmacon (siGENOME SMART pool).
Autophagy Induction
U937 cells were treated with LPS (500 ng/ml) for 4 h or by transfecting MDP (5 g/ml) with calcium phosphate for 8 h. For induction of autophagy by starvation, cells were cultured in EBSS.
Protein Interactions Analyses
For co-immunoprecipitation assays, the cells were lysed using NP-40 buffer containing protease inhibitor cocktail and PMSF. Lysates were incubated with antibody for 2 h followed by incubation with proteinG Dynabeads (Life technologies) for 2 h. Beads were washed for four times with 1×PBS and then boiled with SDS-PAGE buffer for analysis of interacting protein by Immunoblotting. Immunoblots were quantified using Image J software.
Microscopy Analyses and Quantification
Immunofluorescence was performed as described earlier (Kyei et al., 2009). For quantification of puncta, images from different fields were captured and analyzed. For quantification of total cell fluorescence, image J was used as described previously (Chauhan et al., 2013).
Gene Expression Analysis
Total RNA was isolated from cell culture using Trizol as per the manufacturer's instruction (Invitrogen). For quantitative real-time PCR: TURBO DNA-free kit (Ambion) was used to remove contaminating residual DNA; cDNA was prepared using the high capacity cDNA reverse transcription kit as per the manufacturer's instruction (Applied Biosytem). Taqman probes (Applied Biosystem) and realtime PCR master mixes (Applied Biosystem) were used for real-time PCR as per the manufacturer's instruction. Data were normalized using GAPDH.
Bacterial Survival Analyses
AIEC LF82 survival assay was performed as described previously (Lapaquette et al., 2009). HEK293T cells were infected with AIEC LF82 of MOI of 1:20 for 3 h. Cells were treated with gentamycin (100 μg/ml) for 1 h followed by incubation in fresh media for 2 h. Cells were lysed and surviving bacteria quantified by plating and determining colony forming units.
Cytokine and NF-kB Responses
For NFkB-p65 nuclear localization assay, HeLa cells were platted on cover slips a day before infection. Cells were infected with AIEC LF82 strain at MOI of 1:20 for 2 h followed by washings with PBS and fixing the cells with 4% paraformaldehyde. Immunofluorescence imaging was performed as described earlier (Kyei et al., 2009). Cells were visualized using a laser confocal microscope and images were captured using LSM510 software. For IL-1β measurement, IL-1β transcription was determined using qRT-PCR in THP-1 cells.
Results (IRGM Examples)
IRGM Activates the Core Regulators of Autophagy
Prior work has indicated that IRGM affects autophagy through processes influencing mitochondrial function, including mitochondrial fission and membrane potential collapse (Singh et al., 2010). Similar changes in mitochondrial function often lead to AMPK activation (Romanello et al., 2010; Turkieh et al., 2014). Thus, we tested the activation status of AMPK. A knockdown of IRGM reduced the total amounts of AMPK in both control or starved cells (
AMPK has been previously shown to induce autophagy by directly phosphorylating ULK1 (Egan et al., 2011; Kim et al., 2011) and Beclin 1 (Kim et al., 2013). When we tested the phosphorylation status of ULK1 and Beclin 1, we observed that the expression of IRGM, which caused induction of autophagy (
IRGM Assembles the Core Regulatory Machinery for Autophagy
The entire signaling cascade described above could explain how IRGM induces autophagy, e.g. by its effects on AMPK and activation of downstream autophagy regulators. However, IRGM showed a further, more direct role by interacting with the key regulators of autophagy. We found that IRGM co-immunoprecipitated and co-localized with both endogenous and overexpressed ULK1 and Beclin 1 (
IRGM Determines the Composition of the Beclin 1 Complex
We found that IRGM complexes also included autophagy-enhancing Beclin1 interactors, AMBRA1 (
Incidentally, two Beclin1 negative regulators Bcl-2 and Rubicon bind respectively to the regions spanning Beclin 1's BH3 domain and Beclin 1's CCD and ECD domains, whereas ATG14L, a factor enabling Beclin 1 to activate the initiation complex (Kim et al., 2013), binds to the CCD domain of Beclin 1 (Sun et al., 2008). This domain occupancy on Beclin1 is compatible with simultaneous binding of IRGM and ATG14L and exclusion of autophagy negative regulators. When IRGM was overexpressed, it dis-enriched Rubicon and Bcl-2 from Beclin 1 and enriched ATG14L in Beclin 1 complexes (
The above data indicate that IRGM forms protein complexes with the central regulators of autophagy and activates Beclin 1 by displacing its negative regulators (
IRGM Affects Levels of Autophagy Regulators
As observed with AMPK (
Expression of IRGM and its Assembly with Autophagy Factors Responds to Microbial Signals
Infection with CD-associated adhesive invasive Escherichia coli (AIEC) LF82 (Lapaquette et al., 2010) or treatment with LPS or muramyl dipeptide (MDP) induced IRGM expression in U937 cells (
In experiments with endogenous proteins, we could not detect interactions of IRGM with ULK1 and ATG16L1 under basal conditions. However, when a monocytic cell line (THP-1) was infected with E. coli LF82, immunoprecipitates of endogenous IRGM contained ULK1 and ATG16L1. Similar effects were observed with MDP and LPS. Of note, MDP (a NOD2-cogante ligand) was a stronger promoter of these effects than LPS. In contrast to ULK1 and ATG16L1, which showed interactions with endogenous IRGM only in samples from cells infected or treated with MDP or LPS, AMBRA1 showed association with endogenous IRGM even under basal conditions. Thus, exposure of cells to microbes or their products affects IRGM expression and also influences interactions with the autophagic apparatus.
Three Crohn's Disease Risk Factors, NOD2, IRGM, and ATG16L1 Interact
A known receptor for MDP is NOD2, a risk factor for familial CD (Ogura et al., 2001). Furthermore, ATG16L1, harboring an important CD-associated polymorphism (Consortium, 2007), interacts with NOD2 (Cooney et al., 2010; Travassos et al., 2010). Hence, we wondered whether IRGM, a third genetic CD risk factor (incidentally co-discovered with ATG16L1) (Consortium, 2007), is a part of this complex. Endogenous and overexpressed IRGM immunoprecipitates contained both NOD2 and ATG16L1 (
All three factors, IRGM, ATG16L1, and NOD2 co-localized in co-transfected cells (
Fluorescently labeled MDP co-localized with NOD2 and IRGM in the cells (
NOD2 Enhances IRGM Interactions with ULK1 and Beclin 1
NOD2 affected IRGM quaternary structure. Co-expression of NOD2 and IRGM induced IRGM oligomerization within protein complexes (
Polyubiquitination of IRGM Promotes its Assembly with ULK1 and Beclin 1
In the co-immunoprecipitation experiments of NOD2 with IRGM, we observed the presence of multiple GFP-IRGM bands (
Mutation of either individual or small clusters of K (Lys) residues in IRGM did not prevent K-63 linkage ubiquitination of IRGM in the presence of NOD2 (
Polyubiquitinated IRGM Inversely Controls NOD2 and ULK1 Protein Levels
We observed that co-expression of GFP-IRGM had an effect on NOD2 protein amount, by diminishing its levels relative to control (
IRGM Affects Antimicrobial and Inflammatory Outputs and Interfaces with Several Innate Immunity Systems
IRGM has been shown to control intracellular bacteria (Brest et al., 2011; McCarroll et al., 2008] (Singh et al., 2006). Using a model system of transfected epithelial cells previously developed by others (Brest et al., 2011; Lapaquette et al., 2010) for monitoring autophagic handling of invasive bacteria, we tested how IRGM-Kmut, the mutant form of IRGM disabled for ubiquitination and examined for its effects in molecular relationships above, affected a subset of IRGM's immune outputs. Co-expression of NOD2 with IRGM-Kmut resulted in increased NF-kB p65 nuclear translocation in response to E. coli LF82 (a CD isolate of adherent invasive E. coli) (Lapaquette et al., 2010) relative to NOD2 co-expression with IRGM wild type (
The inventors also tested localization of IRGM relative to the CD isolate E. coli LF82 (Lapaquette et al., 2010). We observed that without the co-expression of NOD2, IRGM had a diffuse cytosolic localization even when the cells were infected with bacteria (
Discussion (IRGM Examples)
In these examples, the inventors have shown that human IRGM, hitherto believed to have indirect effects on autophagy, directly governs the assembly of the principal autophagy regulators. Furthermore, it physically links the microbial sensors, including NOD2, to the core autophagic apparatus. This solves the long-standing puzzle regarding how IRGM works, and places it mechanistically at the center of action in autophagic responses to microbes. IRGM assembles ULK1 and Beclin 1 in their activated forms to promote autophagy. Of relevance for how these proteins become activated is that IRGM also stimulates AMPK by stabilizing it in its Thr-172 phosphorylated form, which is required for AMPK activation (Mihaylova and Shaw, 2011). This is likely due to effects of IRGM on mitochondria (Singh et al., 2010), which activates AMPK (Romanello et al., 2010; Turkieh et al., 2014), and may involve specific kinases upstream of AMPK including TAK1 (Criollo et al., 2011) and CAMKKβ (Hoyer-Hansen et al., 2007) that have been shown to phosphorylate AMPK at Thr-172 (Mihaylova and Shaw, 2011) and activate autophagy (Criollo et al., 2011; Hoyer-Hansen et al., 2007). The stabilization of phospho-Thr-172 AMPK likely contributes to AMPK-dependent phosphorylation and activation of ULK1 (Egan et al., 2011; Kim et al., 2011) and Beclin 1 (Kim et al., 2013). Consistent with this, IRGM increases total activated ULK1 phosphorylated at Ser-317 and Ser-555 by AMPK (Egan et al., 2011; Kim et al., 2011), and the activated form of Beclin 1 that is phosphorylated at Ser-15 by ULK1 (Kim et al., 2013) and at Ser-93 and Ser-96 by AMPK (Kim et al., 2013). IRGM has a second effect on autophagic regulators by assembling the activated ULK1 with Beclin 1. Thus, IRGM promotes phosphorylation cascade of key autophagy regulators and assembles them into autophagy initiation complexes (
Of interest is that IRGM increases levels of a number of autophagy regulators (ULK1, ATG14L, AMBRA1, and ATGL1) but does not affect the stability of others (Beclin 1 and the ATG5-ATG12 complex). The apparent absence of effects on Beclin 1 stability may be explained by the bulk of Beclin 1 being predominantly in non-autophagy related hVPS34 complexes whereas ATG14L-associated Beclin 1 represents a minority of Beclin 1 species in the cell (Kim et al., 2013). IRGM also has an effect on NOD2 levels. However, IRGM reduces NOD2 levels, in contrast to IRGM-dependent stabilization of autophagy regulators. We interpret this dichotomy as a part of the well tuned circuitry in response to microbial challenge: whereas autophagy is activated as an antimicrobial effector mechanism, the stimulatory inputs into the system mediated by NOD2 are downregulated lest the system overcommits, which in turn may result in detrimental consequences for the host. PAMP (e.g. MDP) tolerance is an important mechanism to avoid septic shock, which is in part achieved by NOD2 degradation (Zurek et al., 2012).
It has been previously shown that ATG16L1 and NOD2 interact (Cooney et al., 2010; Travassos et al., 2010). This has placed two of the Crohn's disease-genetic risk factors together, but has left the role of IRGM unexplained. The data presented here show that IRGM is in complexes with ATG16L1 and NOD2 and that IRGM enhances assembly of Atg16L1 with NOD2. Moreover, IRGM affects the stability of each of the components of this complex. Although bringing ATG16L1 to the bacterial entry site marked by NOD2 is a previously known important step (Travassos et al., 2010), how this links up with the core autophagy regulators including ULK1 and Beclin 1 has not been addressed in prior studies. In this work we show that IRGM plays that bridging role by stimulating phosphorylation and activation of key autophagy regulators and placing them together with ATG16L1 (
Ubiquitination has been implicated in autophagy in several ways primarily in targeting of substrates for autophagic elimination (Stolz et al., 2014). However, the role of K63-linked polyubiquitination has also begun to be appreciated as a mechanism for stabilization of large autophagy-initiating complexes (Nazio et al., 2013; Shi and Kehrl, 2010). Polyubiquitination of IRGM and its role in autophagy (
IRGM gene expression is cell-type dependent and responds to both starvation and microbial products. IRGM is particularly inducible in cells (intestinal epithelial cells and macrophages) derived from tissues affected in diseases where IRGM has been implicated as a genetic risk factor: CD and tuberculosis (Consortium, 2007; Craddock et al., 2010; Intemann et al., 2009). PAMPs induce autophagy in macrophages through IRGM linking the PAMP detection by NOD2 with the autophagic machinery activation (
Material and Methods
Cells, Plasmids, siRNA, and Transfection
THP-1, HeLa and HEK293T cells were from ATCC. Human peripheral blood monocytes were from StemCell Technologies or from healthy individual donors, and cultured as described previously (Gutierrez et al., 2004). THP-1 cells were differentiated with PMA (50 nM) for overnight before use. Full-length human TRIM20 was synthesized and TRIM21 was purchased from DNASU, and both were cloned by PCR into pDONR221. The TRIMs mutants were generated by site-directed mutagenesis and confirmed by sequencing. pENTR or pDONR221 vectors were generated by BP cloning and expression vectors were made by the LR reaction (Gateway; Invitrogen). Other plasmids used were Beclin 1 and its deletion mutants (from B. Levine), ULK1 (from S. Tooze), ATG16L1 and its deletion mutants (from R. Xavier), pCI-Caspase 1 (from K. Fitzgerald), IRF3 (DNASU), pUNO1-hNLRP3a and pUNO1-hNLRP1 (Invivogen). siRNAs were from Dharmacon, and were delivered to cells by either RNAiMax (Lifetechnologies) or nucleoporation (Amaxa). Plasmid transfections were performed by either calcium phosphate or nucleoporation (Amaxa). Herring testis (HT)-DNA (Sigma) was transfected as described previously (Gao et al., 2013).
Bacterial and Viral Infection
For infection studies, Escherichia coli strain LF82 (Lapaquette et al., 2010) was infected at MOI of 1:20. Single-cycle infection HIV-1 viruses were generated as previously described (Mandell et al., 2014), were infected to undifferentiated THP-1 cells (Gao et al., 2013).
Antibodies and Reagents
Antibodies used were: Flag (Sigma), HA (Roche), LC3 (Sigma), AMPK, ULK1 p-Ser 317 and p-Ser 555 (Cell signalling), NLRP1 (Cell signaling), NLRP3 (Adipogen), Caspase-1 and ULK1 (Santa Cruz), and GFP, IRF3, Myc and Actin (Abcam). To determine autophagic activity by immunoblotting, cells were cultured in the presence of bafilomycin A1, and lysates were subjected to immunoblotting as described previously (Mizushima et al., 2010). The reagents used were Ultrapure LPS (Invivogen), IFN-γ (PeproTech), Cytotoxic LDH assay (Promega), TO-PRO-3 Iodide (lifetechnologies). Immunoblotting, immunostaining were conducted as described (Kyei et al., 2009). FAM-YVAD-FMK stainings (FLICA, ImmunoChemistry Technologies) were performed according to the manufacture's instruction.
IL-1β Measurement
For IL-1β secretion, THP-1 cells that had been subjected to the differentiation with PMA (50 nM) for overnight, were treated with 2.5 μg/mL LPS for 2 h, and then treated with nigericin (20 μM) for 30 min. IL-1β measurements were performed using HEK-Blue IL-1β Cells (Invivogen).
TRIM Family Screen
THP-1 cells were cultured in 96-well plates containing SMARTpool siRNA (Dharmacon), RNAiMax (Lifetechnologies), and PMA. Culture media were changed after overnight incubation, and forty-eight hours after plating, cells were treated with IFN-γ or vehicle for 4 hr, and then fixed and stained to detect endogeneous LC3 (Alexa Fluor 488 as a flurochrome) and nuclei (Hoechst 33342). Plates with cells were subjected to high content analysis for image acquisition and data processing. Two separate siRNA screen for induced autophagy were carried out with the cutoff (>3 SDs change relative to the mean of stimulated control) for hits.
High Content Image Analysis
High content imaging and analysis was performed using a Cellomics VTI HCS scanner and iDEV software (ThermoScientific). Automated epifluorescence image collection was carried out until a minimum of 500 cells per well per siRNA knockdown per plate was acquired. Epifluorescnece images were machine analyzed using present scanning parameters and object mask definitions. Hoechst 33342 staining were used to automatically detect cellular outlines based on background staining of the cytoplasm, and the mean count of LC3 puncta per cell was determined. Autophagy induction with IFN-γ resulted in a Z′ value of 0.87.
High Content Analysis of Puncta in Subpopulations of Transfected Cells
HeLa and THP-1 cells were transfected with plasmids or siRNA, and cultured in full media for overnight (plasmids) or 48 h (siRNA). Cells were then fixed and stained to detect, LC3 (Alexa Fluor 488 or 568 as fluorochromes), GFP, and nuclei. High content imaging and analysis was performed using a Cellomics VTI HCS scanner and iDEV software (ThermoScientific). >200 cells were analyzed in more than quadruplicate manner using a 20× objective at room temperature. Hoechst 33342 staining were used to automatically detect cellular outlines based on background Hoechst staining, and the mean total count or area of punctate of LC3, or TRIM20 per cell was determined. For sub-population analyses, cells that have above the threshold of the background fluorescence were gated as successfully transfected ones.
Fluorescence Confocal Microscope Image Acquisition
Fluorescence confocal microscopy was carried out as described previously (Kyei et al., 2009). In brief, Images were acquired using a Zeiss META microscope equipped with a 63×/1.4 NA oil objective, LSM META camera and AIM software (Zeiss) at room temperature. Fluorochromes associated with secondary antibodies were Alexa Fluor 488, 568, or 647. The images were adjusted for brightness and contrast using ImageJ.
IRF3 Dimerization Assay and Quantitative RT-PCR.
Detection of IRF3 dimerization was performed by native polyacrylamide gel electrophoresis (PAGE) as previously described (Takahasi et al., 2003). Quantitative RT-PCR was performed as previously described (Kimura et al., 2013) using the following primer sets: ULK1, (AGATGTTCCAGCACCGTGAG, AATGCACAGCTTGCACTTGG); BECN1, (GGAGAACCTCAGCCGAAGAC, ACGTTGAGCTGAGTGTCCAG); ACTIN, (GGGCATGGGTCAGAAGGATT, TCGATGGGGTACTTCAGGGT); TRIM1, (AAGAATGTGACGAGTTGGTAGAG, ATGAGGACTGTTGACCGTTC); TRIM5, (CATGCCTCACTGCAAACCAC, GGTAACTGATCCGGCACACA); TRIM8, (ATCCTGATGGACAGGACCCA, CTCCTTCTTGGCCACTTCGT); TRIM16, (GTAAGCCCACGAACACAAATG, TCCAGCCCTGAAACTTCTATTC); TRIM20, (CTGAGTCAGGAGCACCAAGG, GCTGCTCCTCCCCTGATTTT); TRIM21, (CAGTCTCGGAAACACCGTGA, AATGCCACCTGGAGCTTCTC); TRIM22, (CTCGACCTGCTTATCCGTATTT, CTCAGCACAAGGGCTACTATG); TRIM28, (CCATACTGTGCGCTCTACTG, GGTTCATGCTTGTGTACGTTG); TRIM56, (TTCTTCGTCAATGGGCTGCT, AAGTCATCGGCACAGTCCAG); and TRIM65, (GATCTACCTGAACTTGCCTCTG, GAGGAGGGAGGAATCTGTCT). For IFN-β and GAPDH, Taqman probes and real-time PCR master mixes were used.
Co-Immunoprecipitation and GST Pull-Down
Co-immunoprecipitations were performed as previously described (Kyei et al., 2009) with slight modification. In brief, cells were lysed with NP-40 buffer (lifetechnologies) containing 1 mM PMSF and protease inhibitor cocktail (Roche) for 45 min, followed by centrifugation. Supernatants were incubated for 2 h with antibodies at 4° C. The immune complexes were captured with Dynabeads (lifetechnologies). Immunoprecipitates were washed three times with PBS, eluted with Laemmli SDS-PAGE sample buffer, and subjected to immunoblots analysis.
GST and GST-tagged proteins were expressed in Escherichia coli BL21 (DE3) or SoluBL21 (Amsbio). GST and GST-fusion proteins were purified and immobilized on glutathione-coupled sepharose beads (Amersham Bioscience, Glutathione-sepharose 4 Fast Flow) and pull-down assays with in vitro translated [35S]-labeled proteins were done as described previously (Pankiv et al., 2007). The [35S] labeled proteins were produced using the TNT T7 Quick Coupled Transcription/Translation System (Promega) in the presence of [35 S] L-methionine. The proteins were eluted from washed beads by boiling for 5 min in SDS-PAGE gel loading buffer, separated by SDS-PAGE, and radiolabeled proteins detected in a Fujifilm bioimaging analyzer BAS-5000 (Fuji).
Peptide Array Overlay Assay
Peptide arrays were synthesized on cellulose membrane using a MultiPep automated peptide synthesizer (INTAVIS Bioanalytical Instruments AG, Germany) as described previously (Kramer et al., 1996). Interaction analyses between peptide and recombinant protein were probed by overlaying the membranes with recombinant protein, and bound proteins were detected with HRP-conjugated anti-GST antibody (clone RPN1236; GE Healthcare).
Statistical Analyses
Either a two-tailed Student's t test or ANOVA were used. Statistical significance was defined as P<0.05.
Cell Culture
Cell lines were maintained and primary human peripheral blood-monocyte-derived macrophages were isolated and maintained as described (Gutierrez et al., 2004).
Transfections
Plasmid transfections in HEK293T were performed using ProFection Mammalian Transfection System from Promega; siRNAs were delivered to cells by nucleoporation (Amaxa).
Microscopy Analyses and Quantification
Immunofluorescence was performed as described earlier (Kyei et al., 2009). For quantification of puncta, images from different fields were captured and analyzed. For quantification of total cell fluorescence, image J was used as described previously (Chauhan et al., 2013).
Gene Expression Analysis
Total RNA was isolated from cell culture using Trizol as per the manufacturer's instruction (Invitrogen). For quantitative real-time PCR: TURBO DNA-free kit (Ambion) was used to remove contaminating residual DNA; cDNA was prepared using the high capacity cDNA reverse transcription kit as per the manufacturer's instruction (Applied Biosytem). Taqman probes (Applied Biosystem) and real-time PCR master mixes (Applied Biosystem) were used for real-time PCR as per the manufacturer's instruction. Data were normalized using GAPDH.
Cytokine and NF-kB Responses
For NFkB-p65 nuclear localization assay, HeLa cells were platted on cover slips a day before infection. Cells were infected with AIEC LF82 strain at MOI of 1:20 for 2 h followed by washings with PBS and fixing the cells with 4% paraformaldehyde. Cells were visualized using a laser confocal microscope and images were captured using LSM510 software. For IL-1β measurement, IL-1β transcription was determined using qRT-PCR in THP-1 cells.
Bacterial Survival Analyses
AIEC LF82 survival assay was performed as described previously (Lapaquette et al., 2010). HEK293T cells were infected with AIEC LF82 of MOI of 1:20 for 3 h. Cells were treated with gentamycin (100 μg/ml) for 1 h followed by incubation in fresh media for 2 h. Cells were lysed and surviving bacteria quantified by plating and determining colony forming units.
Proximity Ligation Assay (PLA)
HEK293T cells transiently expressing the plasmid constructs were fixed and PLA (Soderberg et al., 2006) performed according to the manufacturer's protocol (Olink Bioscience). Samples were then imaged and analyzed by high content microscopy using a CellomicsArrayScan (Thermo Scientific) with images analyzed using pre-set parameters for cell and PLA puncta identification within iDev software (Thermo Scientific). The average total area of red PLA puncta was determined per cell for a minimum of 500 GFP-IRGM positive cells.
Flag Pull-Down Assay
Lysates of HEK293T cells transiently expressing the Flag-NOD2 constructs were incubated with anti-Flag magnetic beads (Sigma) for 2 h. Beads were washed thoroughly (5×) to remove unbound contaminants. The collected beads were incubated with purified recombinant proteins (GST or GST-IRGMd (Singh et al., 2010)) for 2 h and then washed again (5×). The beads were boiled in SDS-PAGE buffer and subjected to Western blotting
IFN-γ induces autophagy (Fabri et al., 2011; Gutierrez et al., 2004; Inbal et al., 2002) and influences cytokine networks and polarization of immune systems (Ghezzi and Dinarello, 1988; Mishra et al., 2013; Schroder and Tschopp, 2010), whereas TRIMs are involved in immune responses (Kawai and Akira, 2011) and, through an assortment of proposed mechanisms affect autophagy (Barde et al., 2013; Khan et al., 2014; Mandell et al., 2014; Niida et al., 2010; Pineda et al., 2015; Pizon et al., 2013; Tomar et al., 2012; Yang et al., 2013). IFN-γ can induce expression of a subset of TRIMs (Carthagena et al., 2009). We wondered whether TRIMs might be contributing mediators to autophagy induction by IFN-γ. We employed an image-based high content (HC) analysis of LC3 puncta (
TRIM20 Induces Autophagy
The inventors focused on TRIM20 as a TRIM strongly induced by IFN-γ (Carthagena et al., 2009; Chae et al., 2011). We confirmed that TRIM20 expression was responsive to IFN-γ in our system and tested its kinetics and dose-response (
TRIM20 Interacts with ULK1, Beclin 1 and ATL16L1
The inventors next examined how TRIM20 induced autophagy. Autophagy requires ULK1 and Beclin 1, both of which play pivotal roles in autophagy initiation in mammalian cells (He and Levine, 2010; Mizushima et al., 2011). We detected GFP-TRIM20 in immunoprecipitates with co-expressed Myc-ULK1 and Flag-Beclin 1 (
Beclin 1 showed a more complex domain-requirement for inclusion in TRIM20 complexes, with either the middle portion (including B-box and CCD) or the C-terminal region (PRY/SPRY) displaying an independent capacity to bring down Beclin 1 in immunoprecipitates (
The inventors also found that TRIM20 co-immunoprecipitated with ATG16L1 (
TRIM20 Interacts with a Subset of Mammalian Atg8 Paralogs
The inventors examined whether TRIM20 possessed the ability to interact with mammalian Atg8 paralogs (mAtg8s), factors required for autophagosomal membrane formation (Mizushima et al., 2011). Although no binding was detected with LC3B, the commonly used marker for autophagic membrane (Kabeya et al., 2000), GST pull-down experiments revealed interactions of TRIM20 with GABARAP and GABARAPL1, and to a lesser extent with LC3A, LC3C, and GABARAPL2 (
TRIM20 is a Receptor for Selective Autophagy of Inflammasome Components
TRIM20, encoded by the MEFV gene, is a risk locus for familial Mediterranean fever (FMF) French FMF Consortium, 1997, The International FMF Consortium, 1997. TRIM20 has 305 FMF-associated variants website fmf.igh.cnrs.fr/ISSAID/infevers/, with frequent mutations in its PRY/SPRY domain (Masters et al., 2009). The PYD domain of TRIM20 has been the primary focus of interest in inflammasome regulation due to its potential to bind the cognate PYD domain of ASC (Schroder and Tschopp, 2010). However, it has been reported that the PRY/SPRY domain, located at the other end of TRIM20, recognizes and binds to NLRP3 (Papin et al., 2007). The latter relationship has remained obscure despite the frequency of mutations in the PRY/SPRY domain (Masters et al., 2009). We explored the significance of the interactions between the TRIM20 PRY/SPRY domain and NLRP3 in the context of the above recognized function of TRIM20 in autophagy. The full length TRIM20 and a TRIM20 construct containing only the PRY/SPRY domain both interacted with NLRP3 (
Degradation of NLRP3 depended on ULK1 and Beclin 1, establishing that disposal of NLRP3 was through autophagy (
In addition to NLRP3, other inflammasome components, pro-caspase 1 (Chae et al., 2006; Papin et al., 2007) and NLRP1 (Papin et al., 2007), have been previously shown to interact with the PRY/SPRY domain of TRIM20. When pro-caspase 1 and NLRP1 were co-expressed with TRIM20, they too were subject to degradation inhabitable by bafilomycin A1 (
Presence of Target Substrate Potentiates Assembly of Activated Autophagic Components on the TRIM20 Platform
The inventors tested whether the availability of substrate, NLRP3, influenced TRIM20 assembly with ULK. Although ULK1 was enriched in NLRP3 immunoprecipitates when cells expressed TRIM20 (
Disease-Associated Mutations in TRIM20 Diminish its Autophagic Potency
A physiologically relevant consequence of TRIM20 mutations in FMF is excessive IL-1β production (Chae et al., 2011; Meinzer et al., 2011; Omenetti et al., 2014). In patients (Omenetti et al., 2014), albeit not in murine systems (Chae et al., 2011), this is dependent on NLRP3 in the context of TRIM20 mutations. A knockdown of ULK1 or TRIM20 elevated IL-1β responses (
TRIM21 Interacts with Autophagy Factors
The IFN-γ screen with TRIM family of proteins yielded additional hits beside TRIM20 (
TRIM21 is a Regulator-Receptor for Autophagic Degradation of Activated IRF3
TRIM21 is known to interact with the transcription factor IRF3 through its SPRY domain (Higgs et al., 2008). It has been proposed that TRIM21 can suppress type I IFN response (Espinosa et al., 2009; Higgs et al., 2008; Yoshimi et al., 2009; Zhang et al., 2013), albeit an activation effect (McEwan et al., 2013) has also been reported. The proposed mechanism for negative regulation of IRF3 is mainly focused on proteasomal degradation of IRF3 (Higgs et al., 2008; Saitoh et al., 2006). However, autophagy is also known to play a suppressive role on type I IFN (Deretic et al., 2015; Jounai et al., 2007; Mathew et al., 2014; Saitoh et al., 2009). We thus wondered if TRIM21 could cause autophagic degradation of IRF3, analogous to what we observed with TRIM20 and NLRP3. IRF3 colocalized with TRIM21 in LC3-positive dots (
Cytosolic DNA (during viral infection, e.g. with HIV) induces type I interferon response through endogenous second messenger (cyclic GMP-AMP) by utilizing its adaptor protein STING that results in IRF3 dimerization/activation (Gao et al., 2013). It is the dimerized form of IRF3 that activates type I IFN responses (Takahasi et al., 2003). A knockdown of TRIM21 increased levels of IRF3 dimers in IFN-γ-treated cells stimulated with double stranded DNA (HT-DNA) transfected into the cells (
Collectively, the present findings show that multiple TRIMs participate in autophagic response to IFN-γ. Specifically, TRIM20 and TRIM21 organize autophagic apparatus to degrade their cognate targets and downregulate responses via inflammasome/IL-1β and IRF3/type I IFN (
Discussion Precision Autophagy
The inventors' findings show that a subset of TRIMs act as receptors and regulators for selective autophagy targeting components of the inflammasome and type I interferon response systems. TRIM20 recognizes the inflammasome components, NLRP1, NLRP3, and pro-caspase 1, and leads to their autophagic degradation. A similar principle is at work with TRIM21, which targets activated (dimerized) IRF3 for autophagy. Not only do TRIM20 and TRIM21 directly bind their respective cargo, but they also recruit autophagic machinery thus coordinating target recognition with assembly of the autophagic apparatus and initiation of autophagy. These studies increase the repertoire of currently known autophagic receptors (Birgisdottir et al., 2013; Johansen and Lamark, 2011), and expand the target-receptor role of TRIMs in autophagy, previously indicted only for TRIM5α (Mandell et al., 2014). Thus, direct target recognition and assembly of autophagic machinery to conduct a process referred to as precision autophagy (Deretic et al., 2015) is a more general feature of the TRIM family of proteins.
The recognition of cognate targets by TRIM20 and TRIM21 is reminiscent of direct retroviral capsid recognition by TRIM5α (Stremlau et al., 2006) (Stremlau et al, 2006), which, as recently shown (Mandell et al., 2014) leads to autophagic degradation of HIV. The principles of precision autophagy (Deretic et al., 2015) may differ fundamentally from targeting of a variety of ubiquitinated cargo earmarked for autophagy by ubiquitin-binding receptors (Stolz et al., 2014). Incidentally, TRIM20 does not possess the RING E3 ubiquitin ligase domain, and does not bind p62 (Mandell et al., 2014). The absence of a RING domain and absence of binding to p62 underscores the ubiquitin-independent nature of target recognition by TRIM20. However, engagement of other Sequestosome 1-like receptors, a class (Deretic et al., 2013) of ubiquitin and galectin recognizing receptors (Gomes and Dikic, 2014; Randow and Youle, 2014) may not be ruled out, as well as a non-targeting role for ubiquitination in stabilizing autophagy initiation complexes (Chauhan et al., 2015; Nazio et al., 2013; Shi and Kehrl, 2010). Furthermore, inclusion of additional cytoplasmic material along with specific targets during TRIM-directed autophagy may not be ruled out.
Importantly, these findings indicate that substrate recognition by TRIM20 also directs precision autophagy machinery assembled by TRIM20. Thus, in their role in autophagy, TRIM20 and TRIM21 act not only as receptors for autophagy but also as platforms for assembly of regulators (ULK1, Beclin 1) and effectors (mAtg8s; p62 in the case of TRIM21), into initiation complexes. The presence in TRIM20 complexes of ATG16L1 may reflect direct association or reinforcement of indirect links between ULK1 and ATG16L1 (Gammoh et al., 2013; Nishimura et al., 2013). Other TRIMs may function similarly, as observed with TRIM5α and preliminarily with TRIM6, TRIM17, TRIM22, TRIM49, and TRIM55 (Mandell et al., 2014). The concept of platforms for assembly of autophagic machinery in mammalian cells also extends to generic, starvation induced autophagy, which utilizes exocyst components specifically endowed with Exo84 (Bodemann et al., 2011). However, TRIM engagement with autophagy may entail other mechanisms, as for example TRIM28 has multiple (both positive and negative) proposed mechanisms of action (Barde et al., 2013; Pineda et al., 2015; Yang et al., 2013), whereas the mechanism of autophagy induction for TRIM13 in response to the ER stress has not been fully delineated (Tomar et al., 2012) although it shows a relationship with p62 and DFCP, an ER-derived autophagy precursor compartment termed omegasome (Axe et al., 2008).
A further major biological finding reported here is that TRIMs are mediators of IFN-γ induced autophagy. The engagement of multiple TRIMs reveled in our screen should not be surprising, as multiple systems can trigger INF-γ-induced autophagy, such as the previously described DAPK phosphorylation of Beclin 1 (Inbal et al., 2002; Zalckvar et al., 2009) and immunity related GTPases (IRG)-dependent induction of autophagy (Gutierrez et al., 2004), which has recently been shown to act through a co-assembly of ULK1 and Beclin 1 (Chauhan et al., 2015). Additional upstream mechanisms may be controlled by TRIMs detected in our screen, as in the case of TRIM8, which is known to be inducible by IFN-γ (Toniato et al., 2002). TRIM8 activates TAK1 (Li et al., 2011), which is proposed to occur through K63 polyubiquitination. TAK1, in turn, activates AMPK-dependent autophagy (Criollo et al., 2011; Herrero-Martin et al., 2009; Kanayama et al., 2004) by phosphorylating AMPK (Xie et al., 2006). Hence, TRIM8 affects upstream pathways known to activate autophagy. This may explain why TRIM8 was identified as a hit in our IFN-γ-dependent autophagy induction screen. Furthermore, it is likely that TRIMs, known to hetero-oligomerize (Bell et al., 2012) as supported by our observations with TRIM20 and TRIM21, cooperate in IFN-γ induction of autophagy.
The finding that TRIM20 is a mediator of IFN-γ suppression of inflammasome activation provides a mechanism for this important IFN-γ effect in prevention of excessive inflammasome activation and associated pathology in infectious and autoimmune diseases (Minguela et al., 2007; Nandi and Behar, 2011), for which a satisfactory definition has been lacking albeit indirect mechanisms have been proposed (Mishra et al., 2013). The TRIM20-dependent direct recognition and autophagic degradation of the inflamamsome components NLRP3, pro-caspase 1, and NLRP1, differs form the previous reports of indirect effect on inflammasome activation via mitophagy (Nakahira et al., 2011; Zhou et al., 2011), and is more akin to the proposed autophagic degradation of AIM2, a sensory component of the DNA-reactive specialized inflamamsome, albeit AIM2 has been proposed to be eliminated by ubiquitin-tag recognizing receptor (Shi et al., 2012). We furthermore demonstrated that FMF disease-associated mutations in the PRY/SPRY domain of TRIM20 (Masters et al., 2009), alter the capacity of TRIM20 to direct autophagic degradation of inflammasome components. These mutations reduced the binding of ULK1, thus explaining in part how the common mutations associated with FMF work. We propose that IFN-γ-TRIM20-autophagy axis normally suppress excessive inflammasome and IL-1β activation, and that this ability is blunted by common disease-associated TRIM20 polymorphisms occurring in FMF.
The reported TRIM21-dependent suppression of type I IFN activation by autophagic degradation of IRF3 dimers mirrors the action of TRIM20 in suppressing inflamamsome activation. TRIM21, an autoantigen associated with Sjögren syndrome and systemic lupus erythematosus, suppresses type I IFN response (Espinosa et al., 2009; Higgs et al., 2008; Yoshimi et al., 2009; Zhang et al., 2013), albeit this has been ascribed to proteasomal degradation of IRF3 (Higgs et al., 2008) and IRF7 (Higgs et al., 2010). Nevertheless, type I IFN can also be activated by NF-kB, and autophagy has been implicated in degradation of the upstream NF-kB activating kinase, IKKβ (Niida et al., 2010). The TRIM21-directed autophagic degradation of activated IRF3 shown here complements the action of TRIM21 on NF-kB (Niida et al., 2010). Although the mechanism is not fully known, activation of type I IFN system is one major feature of Sjögren syndrome and systemic lupus erythematosus (Banchereau and Pascual, 2006). We thus raise the possibility that perturbations of IFN-γ-TRIM21-autophagy axis may cause activation of type I IFN in autoimmune diseases. The inventors' findings reported here broaden the concept of TRIMs acting as autophagic receptors and as platforms for assembly of autophagy initiation complexes. Our findings also link cargo recognition by a TRIM, acting as an autophagic receptor, with the function of the same TRIM in the assembly of autophagic machinery triggering the execution of autophagy of a very specific cytoplasmic targets. This brand of autophagy, termed precision autophagy, is guided by TRIMs and has important biological functions. For example, the TRIM20- and TRIM21-precision autophagy uncovered here balances key innate immunity responses, potentially serving as a guardian against excessive inflammation, which in turn may cause pathology during autoimmune processes or in infections causing cytokine storms. We propose that the large family of TRIMs with 70 members in humans endows cells with a precision in deploying autophagy.
This application is a United States national phase patent application based upon international patent application no. PCT/US2016/019599 filed Feb. 25, 2016, entitled “IRGM and Precision Autophagy Controls for Antimicrobial and Inflammatory Disease States and Methods of Detection of Autophagy”, which claims the benefit of priority of provisional applications U.S. 62/121,232, filed 26 Feb. 2015, entitled “IRGM Controls the Core Autophagy Machinery to Conduct Antimicrobial Defense and Modulate Inflammatory Disease States” and U.S. 62/165,357, filed May 22, 2015, entitled “Methods for Regulating Inflammation By Precision Autophagy”, the entire contents of each of these applications is incorporated by reference in its entirety herein.
This invention was made with government support under grant nos. AI04229 and AI111935, awarded by National Institutes of Health and grant no. ULTR000041, awarded by the National Center for Advancing Translation Sciences. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2016/019599 | 2/25/2016 | WO | 00 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2016/138286 | 9/1/2016 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 4082735 | Jones et al. | Apr 1978 | A |
| 4082736 | Jones et al. | Apr 1978 | A |
| 4101536 | Yamamura et al. | Jul 1978 | A |
| 4101649 | Anvar | Jul 1978 | A |
| 4153684 | Anvar | May 1979 | A |
| 4158052 | Anvar | Jun 1979 | A |
| 4185089 | Anvar | Jan 1980 | A |
| 4186184 | Anvar | Jan 1980 | A |
| 4220637 | Anvar | Sep 1980 | A |
| 4235771 | Adam et al. | Nov 1980 | A |
| 4317771 | Shiba et al. | Mar 1982 | A |
| 4396607 | Anvar | Aug 1983 | A |
| 4406890 | Tarcsay et al. | Sep 1983 | A |
| 4430265 | Yuichi et al. | Feb 1984 | A |
| 4461761 | Anvar | Jul 1984 | A |
| Number | Date | Country |
|---|---|---|
| 2355505 | Jan 1978 | FR |
| 2020665 | Nov 1979 | GB |
| 1570625 | Jul 1980 | GB |
| 9601645 | Jan 1996 | WO |
| 2011133879 | Oct 2011 | WO |
| 2014200705 | Dec 2014 | WO |
| WO 201420075 | Dec 2014 | WO |
| Entry |
|---|
| Nys et al. “Autophagy: a new target or an old strategy for the treatment of Crohn's disease?” Nat. Rev. Gastroenterol. Hepatol. 10, 395-401 (2013) (Year: 2013). |
| Rubino et al. “Identification of a synthetic muramyl peptide derivative with enhanced Nod2 stimulatory capacity,” Innate Immunity, 19(5) 493-503 (2013) (Year: 2013). |
| Jounai, N., F. Takeshita, K. Kobiyama, A. Sawano, A. Miyawaki, K.Q. Xin, K.J. Ishii, T. Kawai, S. Akira, K Suzuki, and K. Okuda. 2007. The Atg5 Atg12 conjugate associates with innate antiviral immune responses. Proc Natl Acad Sci U S A. 104:14050-14055. |
| Kabeya, Y., N. Mizushima, T. Ueno, A. Yamamoto, T. Kirisako, T. Noda, E. Kominami, Y. Ohsumi, and T. Yoshimori. 2000. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. The EMBO journal. 19:5720-5728. |
| Kanayama, A., R.B. Seth, L. Sun, C.K. Ea, M. Hong, A. Shaito, Y.H. Chiu, L. Deng, and Z.J. Chen. 2004. TAB2 and TAB3 activate the NF-kappaB pathway through binding to polyubiquitin chains. Molecular cell. 15:535-548. |
| Kawai, T., and S. Akira. 2011. Regulation of innate immune signalling pathways by the tripartite motif (TRIM) family proteins. EMBO molecular medicine. 3:513-527. |
| Kenific, C.M., and J. Debnath. 2015. Cellular and metabolic functions for autophagy in cancer cells. Trends Cell Biol. 25:37-45. |
| Khan, M.M., S. Strack, F. Wild, A. Hanashima, A. Gasch, K. Brohm, M. Reischl, S. Carnio, D. Labeit, M. Sandri, S. Labeit, and R. Rudolf. 2014. Role of autophagy, SQSTMI, SH3GLB1, and TRIM63 in the turnover of nicotinic acetylcholine receptors. Autophagy. 10:123-136. |
| Kim, J., Kim, Y.C., Fang, C., Russell, R.C., Kim, J.H., Fan, W., Liu, R., Zhong, Q., and Guan, K.L. (2013). Differential regulation of distinct Vps34 complexes by AMPK in nutrient stress and autophagy. Cell 152, 290-303. |
| Kim, J., Kundu, M., Viollet, B., and Guan, K.L. (2011). AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nature cell biology 13, 132-141. |
| Kimura, T., A. Takahashi, Y. Takabatake, T. Namba, T. Yamamoto, J.Y. Kaimori, I. Matsui, H. Kitamura, F. Niimura, T. Matsusaka, T. Soga, H. Rakugi, and Y. Isaka. 2013. Autophagy protects kidney proximal tubule epithelial cells from mitochondrial metabolic stress. Autophagy. 9:1876-1886. |
| Konno, H., K. Konno, and G.N. Barber. 2013. Cyclic Dinucleotides Trigger ULK1 (ATG1) Phosphorylation of STING to Prevent Sustained Innate Immune Signaling. Cell. |
| Kramer, R.M., E.F. Roberts, S.L. Um, A.G. Borsch-Haubold, S.P. Watson, M.J. Fisher, and J.A. Jakubowski. 1996. p38 mitogen-activated protein kinase phosphorylates cytosolic phospholipase A2 (cPLA2) in thrombin-stimulated platelets. Evidence that proline-directed phosphorylation is not required for mobilization of arachidonic acid by cPLA2. J Biol Chem. 271:27723-27729. |
| Kroemer, G. 2015. Autophagy: a druggable process that is deregulated in aging and human disease. The Journal of Clinical Investigation. 125:1-4. |
| Kyei, G.B., C. Dinkins, A.S. Davis, E. Roberts, S.B. Singh, C. Dong, L. Wu, E. Kominami, T. Ueno, A. Yamamoto, M. Federico, A. Panganiban, I. Vergne, and V. Deretic. 2009. Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J Cell Biol. 186:255-268. |
| Lapaquette, P., A.L. Glasser, A. Huett, R.J. Xavier, and A. Darfeuille-Michaud. 2010. Crohn's disease-associated adherent-invasive E. coli are selectively favoured by impaired autophagy to replicate intracellularly. Cellular microbiology. 12:99-113. |
| Levine, B., Mizushima, N., and Virgin, H.W. (2011). Autophagy in immunity and inflammation. Nature 469, 323-335. |
| Li, Q., J. Yan, A.P. Mao, C. Li, Y. Ran, H.B. Shu, and Y.Y. Wang. 2011. Tripartite motif 8 (TRIM8) modulates TNFalpha- and IL-1beta-triggered NF-kappaB activation by targeting TAK1 for K63-linked polyubiquitination. Proc Natl Acad Sci U S A. 108:19341-19346. |
| Liang, Q., G.J. Seo, Y.J. Choi, M.J. Kwak, J. Ge, M.A. Rodgers, M. Shi, B.J. Leslie, K.P. Hopfner, T. Ha, B.H. Oh, and J.U. Jung. 2014. Crosstalk between the cGAS DNA sensor and Beclin-1 autophagy protein shapes innate antimicrobial immune responses. Cell Host Microbe. 15:228-238. |
| Liang, X.H., S. Jackson, M. Seaman, K. Brown, B. Kempkes, H. Hibshoosh, and B. Levine. 1999. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature. 402:672-676. |
| Ma, Y., L Galluzzi, L. Zitvogel, and G. Kroemer. 2013. Autophagy and cellular immune responses. Immunity. 39:211-227. |
| Maejima, I., A. Takahashi, H. Omori, T. Kimura, Y. Takabatake, T. Saitoh, A. Yamamoto, M. Hamasaki, T. Noda, Y. Isaka, and T. Yoshimori. 2013. Autophagy sequesters damaged lysosomes to control lysosomal biogenesis and kidney injury. The Embo journal. 32:2336-2347. |
| Mandell, M.A., A. Jain, J. Arko-Mensah, S. Chauhan, T. Kimura, C. Dinkins, G. Silvestri, J. Munch, F. Kirchhoff, A. Simonsen, Y. Wei, B. Levine, T. Johansen, and V. Deretic. 2014. TRIM proteins regulate autophagy and can target autophagic substrates by direct recognition. Dev Cell. 30:394-409. |
| Masters, S.L., A. Simon, I. Aksentijevich, and D.L. Kastner. 2009. Horror autoinflammaticus: the molecular pathophysiology of autoinflammatory disease. Annual review of immunology. 27:621-668. |
| Mathew, R., S. Khor, S.R. Hackett, J.D. Rabinowitz, D.H. Perlman, and E. White. 2014. Functional Role of Autophagy-Mediated Proteome Remodeling in Cell Survival Signaling and Innate Immunity. Molecular cell. |
| Matsunaga, K., Saitoh, T., Tabata, K., Omori, H., Satoh, T., Kurotori, N., Maejima, I., Shirahama-Noda, K, Ichimura, T., Isobe, T., et al. (2009). Two Beclin 1-binding proteins, Atg14L and Rubicon, reciprocally regulate autophagy at different stages. Nat Cell Biol 11, 385-396. |
| McCarroll, S.A., Huett, A., Kuballa, P., Chilewski, S.D., Landry, A., Goyette, P., Zody, M.C., Hall, J.L., Brant, S.R., Cho, J.H., et al. (2008). Deletion polymorphism upstream of IRGM associated with altered IRGM expression and Crohn's disease. Nat Genet 40, 1107-1112. |
| McEwan, W.A., J.C. Tam, R.E. Watkinson, S.R. Bidgood, D.L Mallery, and L.C. James. 2013. Intracellular antibody-bound pathogens stimulate immune signaling via the Fc receptor TRIM21. Nature immunology. 14:327-336. |
| Meinzer, U., P. Quartier, J.F. Alexandra, V. Hentgen, F. Retornaz, and I. Kone-Paut. 2011. Interleukin-1 targeting drugs in familial Mediterranean fever: a case series and a review of the literature. Seminars in arthritis and rheumatism. 41:265-271. |
| Mihaylova, M.M., and Shaw, R.J. (2011). The AMPK signalling pathway coordinates cell growth, autophagy and metabolism. Nature cell biology 13, 1016-1023. |
| Minguela, A., S. Pastor, W. Mi, J.A. Richardson, and E.S. Ward. 2007. Feedback regulation of murine autoimmunity via dominant anti-inflammatory effects of interferon gamma. J Immunol. 178:134-144. |
| Mishra, B.B., V.A. Rathinam, G.W. Martens, A.J. Martinot, H. Komfeld, K.A. Fitzgerald, and C.M. Sassetti. 2013. Nitric oxide controls the immunopathology of tuberculosis by inhibiting NLRP3 inflammasome-dependent processing of IL-1beta. Nature immunology. 14:52-60. |
| Mizushima, N., A. Kuma, Y. Kobayashi, A. Yamamoto, M. Matsubae, T. Takao, T. Natsume, Y. Ohsumi, and T. Yoshimori. 2003. Mouse Apg16L, a novel WD-repeat protein, targets to the autophagic isolation membrane with the Apg12-Apg5 conjugate. Journal of cell science. 116:1679-1688. |
| Mizushima, N., Levine, B., Cuervo, A.M., and Klionsky, D.J. (2008). Autophagy fights disease through cellular self-digestion. Nature 451, 1069-1075. |
| Mizushima, N., T. Yoshimori, and B. Levine. 2010. Methods in mammalian autophagy research. Cell. 140:313-326. |
| Mizushima, N., T. Yoshimori, and Y. Ohsumi. 2011. The role of atg proteins in autophagosome formation. Annual review of cell and developmental biology. 27:107-132. |
| Nakahira, K., J.A. Haspel, V.A. Rathinam, S.J. Lee, T. Dolinay, H.C. Lam, J.A. Englert, M. Rabinovitch, M. Cernadas, H.P. Kim, K.A. Fitzgerald, S.W. Ryter, and A.M. Choi. 2011. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasone. Nature immunology. 12:222-230. |
| Nandi, B., and S.M. Behar. 2011. Regulation of neutrophils by interferon-gamma limits lung inflammation during tuberculosis infection. J Exp Med. 208:2251-2262. |
| Nazio, F., F. Strappazzon, M. Antonioli, P. Bielli, V. Cianfanelli, M. Bordi, C. Gretzmeier, J. Dengjel, M. Piacentini, G.M. Fimia, and F. Cecconi. 2013. mTOR inhibits autophagy by controlling ULK1 ubiquitylation, self-association and function through AMBRA1 and TRAF6. Nat Cell Biol. 15:406-416. |
| Niida, M., M. Tanaka, and T. Kamitani. 2010. Downregulation of active IKK beta by Ro52-mediated autophagy. Mol Immunol. 47:2378-2387. |
| Nishimura, T., T. Kaizuka, K. Cadwell, M.H. Sahani, T. Saitoh, S. Akira, H.W. Virgin, and N. Mizushima. 2013. FIP200 regulates targeting of Atg16L1 to the isolation membrane. EMBO Rep. 14:284-291. |
| Ogura, Y., Bonen, D.K., Inohara, N., Nicolae, D.L, Chen, F.F., Ramos, R., Britton, H., Moran, T., Karaliuskas, R., Duerr, R.H., et al. (2001). A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature 411, 603-606. |
| Omenetti, A., S. Carta, L. Delfino, A. Martini, M. Gattorno, and A. Rubartelli. 2014. Increased NLRP3-dependent interleukin 1beta secretion in patients with familial Mediterranean fever: correlation with MEFV genotype. Annals of the rheumatic diseases. 73:462-469. |
| Pankiv, S., T.H. Clausen, T. Lamark, A. Brech, J.A. Bruun, H. Outzen, A. Overvatn, G. Bjorkoy, and T. Johansen. 2007. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem. 282:24131-24145. |
| Papin, S., S. Cuenin, L. Agostini, F. Martinon, S. Werner, H.D. Beer, C. Gruffer, M. Gruffer, and J. Tschopp. 2007. The SPRY domain of Pyrin, mutated in familial Mediterranean fever patients, interacts with inflammasome components and inhibits proIL-1beta processing. Cell Death Differ. 14:1457-1466. |
| Pineda, C.T., S. Ramanathan, K. Fon Tacer, J.L. Weon, M.B. Potts, Y.H. Ou, M.A. White, and P.R. Potts. 2015. Degradation of AMPK by a Cancer-Specific Ubiquitin Ligase. Cell. 160:715-728. |
| Pizon, V., S. Rybina, F. Gerbal, F. Delort, P. Vicart, G. Baldacci, and E. Karsenti. 2013. MURF2B, a novel LC3-binding protein, participates with MURF2A in the switch between autophagy and ubiquitin proteasome system during differentiation of C2C12 muscle cells. PLoS One. 8:e76140. |
| Rabinowitz, J.D., and E. White. 2010. Autophagy and metabolism. Science. 330:1344-1348. |
| Randow, F., and R.J. Youle. 2014. Self and Nonself: How Autophagy Targets Mitochondria and Bacteria. Cell Host Microbe. 15:403-411. |
| Reymond, A., G. Meroni, A. Fantozzi, G. Merla, S. Cairo, L. Luzi, D. Riganelli, E. Zanaria, S. Messali, S. Cainarca, A. Guffanti, S. Minucci, P.G. Pelicci, and A. Ballabio. 2001. The tripartite motif family identifies cell compartments. The EMBO journal. 20:2140-2151. |
| Rogov, V., V. Dotsch, T. Johansen, and V. Kirkin. 2014. Interactions between autophagy receptors and ubiquitin-like proteins form the molecular basis for selective autophagy. Molecular cell. 53:167-178. |
| Romanello, V., Guadagnin, E., Gomes, L., Roder, I., Sandri, C., Petersen, Y., Milan, G., Masiero, E, Del Piccolo, P., Foretz, M., et al. (2010). Mitochondrial fission and remodelling contributes to muscle atrophy. EMBO J 29, 1774-1785. |
| Abbott, D.W., Yang, Y., Huh, J.E., Madhavarapu, S., Kelliher, M.A., and Cantley, L.C. (2007). Coordinated regulation of Toll-like receptor and NOD2 signaling by K63-linked polyubiquitin chains. Mol Cell Biol 27, 6012-6025. |
| Axe, E.L., S.A. Walker, M. Manifava, P. Chandra, H.L. Roderick, A. Habermann, G. Griffiths, and N.T. Ktistakis. 2008. Autophagosome formation from membrane compartments enriched in phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum. J Cell Biol. 182:685-701. |
| Banchereau, J., and V. Pascual. 2006. Type I interferon in systemic lupus erythematosus and other autoimmune diseases. Immunity. 25:383-392. |
| Barde, I., B. Rauwel, R.M. Marin-Florez, A. Corsinotti, E. Laurenti, S. Verp, S. Offner, J. Marquis, A. Kapopoulou, J. Vanicek, and D. Trono. 2013. A KRAB/KAP1-miRNA cascade regulates erythropoiesis through stage-specific control of mitophagy. Science. 340:350-353. |
| Bauemfeind, F.G., G. Horvath, A. Stutz, E.S. Alnemri, K. MacDonald, D. Speert, T. Fernandes-Alnemri, J. Wu, B.G. Monks, K.A. Fitzgerald, V. Hornung, and E. Latz. 2009. Cutting edge: NF-kappaB activating pattern recognition and cytokine receptors license NLRP3 inflammasome activation by regulating NLRP3 expression. J Immunol. 183:787-791. |
| Bekpen, C., Marques-Bonet, T., Alkan, C., Antonacci, F., Leogrande, M.B., Ventura, M., Kidd, J.M., Siswara, P., Howard, J.C., and Eichler, E.E. (2009). Death and resurrection of the human IRGM gene. PLoS Genet 5, e1000403. |
| Bell, J.L., A. Malyukova, J.K. Holien, J. Koach, M.W. Parker, M. Kavallaris, G.M. Marshall, and B.B. Cheung. 2012. TRIM16 acts as an E3 ubiquitin ligase and can heterodimerize with other TRIM family members. PLoS One. 7:e37470. |
| Birgisdottir, A.B., T. Lamark, and T. Johansen. 2013. The LIR motif—crucial for selective autophagy. Journal of cell science. 126:3237-3247. |
| Bodemann, B.O., A. Orvedahl, T. Cheng, R.R. Ram, Y.H. Ou, E. Formstecher, M. Maiti, C.C. Hazelett, E.M. Wauson, M. Balakireva, J.H. Camonis, C. Yeaman, B. Levine, and M.A. White. 2011. RalB and the Exocyst Mediate the Cellular Starvation Response by Direct Activation of Autophagosome Assembly. Cell. 144:253-267. |
| Brest, P., Lapaquette, P., Souidi, M., Lebrigand, K., Cesaro, A., Vouret-Craviari, V., Mari, B., Barbry, P., Mosnier, J.F., Hebuterne, X., et al. (2011). A synonymous variant in IRGM alters a binding site for miR-196 and causes deregulation of IRGM-dependent xenophagy in Crohn's disease. Nat Genet 43, 242-245. |
| Broz, P., J. von Moltke, J.W. Jones, R.E. Vance, and D.M. Monack. 2010. Differential requirement for Caspase-1 autoproteolysis in pathogen-induced cell death and cytokine processing. Cell Host Microbe. 8:471-483. |
| Carthagena, L., A. Bergamaschi, J.M. Luna, A. David, P.D. Uchil, F. Margottin-Goguet, W. Mothes, U. Hazan, C. Transy, G. Pancino, and S. Nisole. 2009. Human TRIM gene expression in response to interferons. PLoS One. 4: e4894. |
| Chae, J.J., G. Wood, S.L. Masters, K. Richard, G. Park, B.J. Smith, and D.L. Kastner. 2006. The B30.2 domain of pyrin, the familial Mediterranean fever protein, interacts directly with caspase-1 to modulate IL-1beta production. Proc Natl Acad Sci U S A. 103:9982-9987. |
| Chae, J.J., Y.H. Cho, G.S. Lee, J. Cheng, P.P. Liu, L. Feigenbaum, S.I. Katz, and D.L Kastner. 2011. Gain-of-function Pyrin mutations induce NLRP3 protein-independent interleukin-1beta activation and severe autoinflammation in mice. Immunity. 34:755-768. |
| Chan, E.Y., and S.A. Tooze. 2009. Evolution of Atg1 function and regulation. Autophagy. 5:758-765. |
| Chan, W.M., Mak, M.C., Fung, T.K, Lau, A., Siu, W.Y., and Poon, R.Y. (2006). Ubiquitination of p53 at multiple sites in the DNA-binding domain. Mol Cancer Res 4, 15-25. |
| Chauhan, S., Goodwin, J.G., Manyam, G., Wang, J., Kamat, A.M., and Boyd, D.D. (2013). ZKSCAN3 is a master transcriptional repressor of autophagy. Molecular cell 50, 16-28. |
| Chauhan, S., M.A. Mandell, and V. Deretic. 2015. IRGM Governs the Core Autophagy Machinery to Conduct Antimicrobial Defense. Molecular cell. 58:507-521. |
| Choi, J., Park, S., Biering, S.B., Selleck, E, Liu, C.Y., Zhang, X., Fujita, N., Saitoh, T., Akira, S., Yoshimori, T., et al. (2014). The parasitophorous vacuole membrane of Toxoplasma gondii is targeted for disruption by ubiquitin-like conjugation systems of autophagy. Immunity 40, 924-935. |
| Consortium (2007). Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. Nature 447, 661-678. |
| Cooney, R., Baker, J., Brain, O., Danis, B., Pichulik, T., Allan, P., Ferguson, D.J., Campbell, B.J., Jewell, D., and Simmons, A. (2010). NOD2 stimulation induces autophagy in dendritic cells influencing bacterial handling and antigen presentation. Nat Med 16, 90-97. |
| Craddock, N., Hurles, M.E, Cardin, N., Pearson, R.D., Plagnol, V., Robson, S., Vukcevic, D., Barnes, C., Conrad, D. F., Giannoulatou, E., et al. (2010). Genome-wide association study of CNVs in 16,000 cases of eight common Diseases and 3,000 shared controls. Nature 464, 713-720. |
| Criollo, A., M. Niso-Santano, S.A. Malik, M. Michaud, E. Morselli, G. Marino, S. Lachkar, A.V. Arkhipenko, F. Harper, G. Pierron, J.C. Rain, J. Ninomiya-Tsuji, J.M. Fuentes, S. Lavandero, L. Galluzzi, M.C. Maiuri, and G. Kroemer. 2011. Inhibition of autophagy by TAB2 and TAB3. The EMBO journal. 30:4908-4920. |
| Deretic, V., Kimura, T., Timmins, G., Moseley, P., Chauhan, S., and Mandell, M. (2015). Immunologic manifestations of autophagy. The Journal of Clinical Investigation 125, 75-84. |
| Deretic, V., T. Saitoh, and S. Akira. 2013. Autophagy in infection, inflammation and immunity. Nat Rev Immunol. 13:722-737. |
| Dooley, H.C., Razi, M., Poison, H.E., Girardin, S.E., Wilson, M.I., and Tooze, S.A. (2014). WIPI2 Links LC3 Conjugation with Pl3P, Autophagosome Formation, and Pathogen Clearance by Recruiting Atg12-5-16L1. Molecular cell 55, 238-252. |
| Egan, D.F., D.B. Shackelford, M.M. Mihaylova, S. Gelino, R.A. Kohnz, W. Mair, D.S. Vasquez, A. Joshi, D.M. Gwinn, R. Taylor, J.M. Asara, J. Fitzpatrick, A. Dillin, B. Viollet, M. Kundu, M. Hansen, and R.J. Shaw. 2011. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science. 331:456-461. |
| Espinosa, A., V. Dardalhon, S. Brauner, A. Ambrosi, R. Higgs, F.J. Quintana, M. Sjostrand, M.L. Eloranta, J. Ni Gabhann, O. Winqvist, B. Sundelin, C.A. Jefferies, B. Rozell, V.K. Kuchroo, and M. Wahren-Herleni. 2009. Loss of the lupus autoantigen Ro52/Trim21 induces tissue inflammation and systemic autoimmunity by disregulating the IL-23-Th17 pathway. J Exp Med. 206:1661-1671. |
| Fabri, M., S. Stenger, D.M. Shin, J.M. Yuk, P.T. Liu, S. Realegeno, H.M. Lee, S.R. Krutzik, M. Schenk, P.A. Sieling, R. Teles, D. Montoya, S.S. Iyer, H. Bruns, D.M. Lewinsohn, B.W. Hollis, M. Hewison, J.S. Adams, a. Steinmeyer, U. lugel, G. Cheng, E.K. Jo, B.R. Bloom, and R.L. Modlin. 2011. Vitamin D is required for IFN-gamma-mediated antimicrobial activity of human macrophages. Science translational medicine. 3:104ra102. |
| Fimia, G.M., Stoykova, A., Romagnoli, A., Giunta, L., Di Bartolomeo, S., Nardacci, R., Corazzari, M., Fuoco, C., Ucar, A., Schwartz, R, et al. (2007). Ambra1 regulates autophagy and development of the nervous system. Nature 447, 1121-1125. |
| Frake, R.A., T. Ricketts, F.M. Menzies, and D.C. Rubinsztein. 2015. Autophagy and neurodegeneration. The Journal of Clinical Investigation. 125:65-74. |
| French_FMF_Consortium. 1997. A candidate gene for familial Mediterranean fever. Nature genetics. 17:25-31. |
| Fung, T.K., Yam, C.H., and Poon, R.Y. (2005). The N-terminal regulatory domain of cyclin A contains redundant ubiquitination targeting sequences and acceptor sites. Cell Cycle 4, 1411-1420. |
| Gammoh, N., Florey, O., Overholtzer, M., and Jiang, X. (2013). Interaction between FIP200 and ATG16L1 distinguishes ULK1 complex-dependent and -independent autophagy. Nat Struct Mol Biol 20, 144-149. |
| Gao, D., J. Wu, Y.T. Wu, F. Du, C. Aroh, N. Yan, L. Sun, and Z.J. Chen. 2013. Cyclic GMP-AMP synthase is an innate Immune sensor of HIV and other retroviruses. Science. 341:903-906. |
| Ghezzi, P., and C.A. Dinarello. 1988. IL-1 induces IL-1. III. Specific inhibition of IL-1 production by IFN-gamma. J Immunol. 140:4238-4244. |
| Gomes, L.C., and I. Dikic. 2014. Autophagy in antimicrobial immunity. Molecular cell. 54:224-233. |
| Gregoire, I.P., Richetta, C., Meyniel-Schicklin, L., Borel, S., Pradezynski, F., Diaz, O., Deloire, A., Azocar, O., Baguet, J., Le Breton, M., et al. (2011). IRGM is a common target of RNA viruses that subvert the autophagy network. PLoS pathogens 7, e1002422. |
| Gutierrez, M.G., Master, S.S., Singh, S.B., Taylor, G.A., Colombo, M.I., and Deretic, V. (2004). Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell 119, 753-766. |
| Hasegawa, M., Fujimoto, Y., Lucas, P.C., Nakano, H., Fukase, K., Nunez, G., and Inohara, N. (2008). A critical role of RICK/RIP2 polyubiquitination in Nod-induced NF-kappaB activation. EMBO J 27, 373-383. |
| He, C., and B. Levine. 2010. The Beclin 1 interactome. Current opinion in cell biology. 22:140-149. |
| Herrero-Martin, G., M. Hoyer-Hansen, C. Garcia-Garcia, C. Fumarola, T. Farkas, A. Lopez-Rivas, and M. Jaattela. 2009. TAK1 activates AMPK-dependent cytoprotective autophagy in TRAIL-treated epithelial cells. The EMBO journal. 28:677-685. |
| Higgs, R., E. Lazzari, C. Wynne, J. Ni Gabhann, A. Espinosa, M. Wahren-Herlenius, and C.A. Jefferies. 2010. Self Protection from anti-viral responses—Ro52 promotes degradation of the transcription factor IRF7 downstream of the rival Toll-Like receptors. PLoS One. 5:e11776. |
| Higgs, R., J. Ni Gabhann, N. Ben Larbi, E.P. Breen, K.A. Fitzgerald, and C.A. Jefferies. 2008. The E3 ubiquitin ligase Ro52 negatively regulates IFN-beta production post-pathogen recognition by polyubiquitin-mediated degradation of RF3. J Immunol. 181:1780-1786. |
| Hoyer-Hansen, M., Bastholm, L., Szyniarowski, P., Campanella, M., Szabadkai, G., Farkas, T., Bianchi, K., Fehrenbacher, N., Elling, F., Rizzuto, R., et al. (2007). Control of macroautophagy by calcium, calmodulin-dependent kinase kinase-beta, and Bcl-2. Molecular cell 25, 193-205. |
| Hugot, J.P., Chamaillard, M., Zouali, H., Lesage, S., Cezard, J.P., Belaiche, J., Almer, S., Tysk, C., O'Morain, C.A., Gassull, M., et al. (2001). Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature 411, 599-603. |
| Inbal, B., S. Bialik, I. Sabanay, G. Shani, and A. Kimchi. 2002. DAP kinase and DRP-1 mediate membrane blebbing and the formation of autophagic vesicles during programmed cell death. J Cell Biol. 157:455-468. |
| Intemann, C.D., Thye, T., Niemann, S., Browne, E.N., Amanua Chinbuah, M., Enimil, A., Gyapong, J., Osei, I., Owusu-Dabo, E., Helm, S., et al. (2009). Autophagy gene variant IRGM -261T contributes to protection from tuberculosis caused by Mycobacterium tuberculosis but not by M. africanum strains. PLoS Pathog 5, e1000577. |
| Itakura, E., Kishi, C., Inoue, K., and Mizushima, N. (2008). Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Mol Biol Cell 19, 5360-5372. |
| Johansen, T., and T. Lamark. 2011. Selective autophagy mediated by autophagic adapter proteins. Autophagy. 7:279-296. |
| Lu X.C. et al.; “Association between variants of the autophagy related gene-IRGM and susceptibility to Crohn's disease and ulcerative colitis: a meta-analysis” PLOS ONE, Nov. 13, 2013; vol. 8, No. 11:e80602, p. 1-13. doi: 10.1371/journal.pone.0080602. |
| Mandell M.A. et al.; “TRIM proteins regulate autophagy: TRIM5 is a selective autophagy receptor mediating HIV-1 restriction”; Autophagy, 2014; 10(12):2387-2388 . doi: 10.4161/15548627.2014.984278. |
| Mandell M.A. et al.; “TRIM proteins regulate autophagy and can target autophagic substrates by direct recognition”, Dev. Cell. Aug. 25, 2014; 30(4):394-409. doi: 10.1016/j devcel.2014.06.013, pp. 1-13. |
| Number | Date | Country | |
|---|---|---|---|
| 20180236024 A1 | Aug 2018 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62121232 | Feb 2015 | US | |
| 62165357 | May 2015 | US |
