Isolated nucleic acid molecule coding for fibroblast activation protein alpha and uses thereof

FIELD OF THE INVENTION
This invention relates to certain molecules associated with cancer cells and reactive with tumor stromal cells. More particularly, it relates to fibroblast activation protein alpha ("FAP.alpha." hereafter). The molecule has previously been identified immunologically, but nucleic acid molecules coding for it had not been isolated or cloned. This, inter alia, is the subject of the invention. The protein has a molecular weight of from about 88 to about 95 kilodaltons as determined by SDS-PAGE. This molecule is characterized by a number of features and properties which are shared by and characteristic of membrane bound enzymes, suggesting very strongly that it, too, is a membrane bound enzyme. The nucleic acid molecules, which are a key part of the invention, are useful both as probes for cells expressing FAP.alpha., and as starting materials for recombinant production of the protein. The recombinant protein can then be used to produce monoclonal antibodies specific for the protein, and are these useful diagnostic agents themselves.
BACKGROUND AND PRIOR ART
The invasive growth of epithelial cancers is associated with characteristic cellular and molecular changes in the supporting stroma. For example, epithelial cancers induce the formation of tumor blood vessels, the recruitment of reactive tumor stromal fibroblasts, lymphoid and phagocytic infiltrates, the release of peptide mediators and proteolytic enzymes, and the production of an altered extracellular matrix (ECM). See, e.g., Folkman, Adv. Cancer Res. 43: 175-203 (1985); Basset et al., Nature 348: 699-704 (1990); Denekamp et al., Cancer Metastasis Rev. 9: 267-282 (1990); Cullen et al., Cancer Res. 51:4978-4985 (1991); Dvorak et al., Cancer Cells 3:77-85 (1991); Liotta et al., Cancer Res. 51: 5054s-5059s (1991); Garin-Chesa et al., J. Histochem. Cytochem. 37:1767-1776 (1989). A highly consistent molecular trait of the stroma in several common histologic types of epithelial cancers is induction of the fibroblast activation protein (FAP.alpha.), a cell surface glycoprotein with an observed M.sub.r of 95,000 originally discovered with a monoclonal antibody, mAb F19, raised against proliferating cultured fibroblasts. See Rettig et al., Cancer Res. 46:6406-6412 (1986); Rettig et al., Proc. Natl. Acad. Sci. USA 85: 3110-3114 (1988); Garin-Chesa et al., Proc. Natl. Acad. USA 87: 7235-7239 (1990); Rettig et al., Cancer Res. 53:3327-3335 (1993). Each of these four papers is incorporated by reference in its entirety.
Immunohistochemical studies such as those cited supra have shown that FAP.alpha. is transiently expressed in certain normal fetal mesenchymal tissues but that normal adult tissues are generally FAP.alpha..sup.-. Similarly, malignant epithelial, neural and hematopoietic cells are FAP.alpha..sup.-. However, most of the common types of epithelial cancers, including >90% of breast, lung, skin, pancreas, and colorectal carcinomas, contain abundant FAP.alpha..sup.+ reactive stromal fibroblasts. Garin-Chesa et al., Proc. Natl. Acad. Sci. USA 87: 7235-7239 (1990). The FAP.alpha..sup.+ tumor stromal fibroblasts almost invariably accompany newly-formed tumor blood vessels, forming a distinct cellular compartment interposed between the tumor capillary endothelium and the basal aspect of malignant epithelial cell clusters. While FAP.alpha..sup.+ stromal fibroblasts are found in both primary and metastatic carcinomas, benign and premalignant epithelial lesions, such as fibroadenomas of the breast and colorectal adenomas only rarely contain FAP.alpha..sup.+ stromal cells. In contrast to the stroma-specific localization of FAP.alpha..sup.+ in epithelial neoplasms, FAP.alpha. is expressed in the malignant cells of a large proportion of bone and soft tissue sarcomas. Rettig et al., Proc. Natl. Acad. Sci. USA 85: 3110-3114 (1988). Finally, FAP.alpha..sup.+ fibroblasts have been detected in the granulation tissue of healing wounds (Garin-Chesa et al., Supra). Based on the restricted distribution pattern of FAP.alpha. in normal tissues and its uniform expression in the supporting stroma of many epithelial cancers, clinical trials with .sup.131 I-labeled mAb F19 have been initiated in patients with metastatic colon cancer (Welt et al., Proc. Am. Assoc. Cancer Res. 33:319 (1992)) to explore the concept of "tumor stromal targeting" for immunodetection and immunotherapy of epithelial cancers.
The induction of FAP.alpha..sup.+ fibroblasts at times and sites of tissue remodeling during fetal development, tissue repair, and carcinogenesis is consistent with a fundamental role for this molecule in normal fibroblast physiology. Thus, it is of interest and value to isolate and to clone nucleic acid molecules which code for this molecule. This is one aspect of the invention, which is described in detail together with other features of the invention, in the disclosure which follows.

BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows results obtained from immunoprecipitation studies carried out on detergent extracts of Trans .sup.35 S-labeled cells. The study was designed to immunoprecipitate FAP.alpha. and CD26. Cell types were SW872, which is a human sarcoma cell line, COS-FAP, which is a cell line transfected with a vector coding for FAP.alpha., i.e., pFAP-38, described in the application, and COS-CD26, which is a COS cell line transfected with a CD26 coding plasmid. Extracts were precipitated with anti-FAP.alpha. monoclonal antibody F19, anti-CD26 mAb EF-1, or a negative control mouse Ig.
FIG. 2A presents Northern blot analysis of FAP.alpha. expression in a cell line (ovarian cancer SK-OV6), which has FAP.alpha..sup.- /CD26.sup.+ phenotype), as well as two cell lines (fibroblasts WI-38 and GM 05389), which have FAP.alpha..sup.+ /CD26.sup.+ phenotype.
FIG. 2B shows .gamma.-actin expression for the cell lines of FIG. 2A.
FIG. 3 compares the deduced amino acid sequence for FAP.alpha., and the known sequence of CD26. The alignment has been optimized.
FIG. 4 depicts heterodimer formation between FAP.alpha. and CD26 in COS-1 transfectants.
FIGS. 5A-5H, inclusive, display immunohistochemical detection of FAP.alpha. and CD26 in various cancers. In FIGS. 5A and 5B, breast cancer is studied, for FAP.alpha. (FIG. 5A), and CD26 (FIG. 5B). In FIGS. 5C and 5D, malignant fibrous histiocytomas are studied, for FAP.alpha. (FIG. 5C), and CD26 (FIG. 5D). Dermal scar tissue is examined in FIGS. 5E (FAP.alpha.), and 5F (CD26). Renal cell carcinoma is studied in FIG. 5G (FAP.alpha.), and 5H (CD26).

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
EXAMPLE 1
Fibroblast cell line WI-38 had been observed, previously, to react with mAb F19 (Rettig et al., Canc. Res. 46:6406-6412 (1986); Rettig et al., Proc. Natl. Acad. USA 85: 3110-3114 (1988); Garin-Chesa et al., Proc. Natl. Acad. Sci. USA 87: 7235-7239 (1990); Rettig et al., Canc. Res. 53: 3327-3335 (1993)). It was used in the experiments which follow.
A cDNA library was prepared from WI-38, using well known techniques and commercially available materials. Specifically, the library was constructed in expression vector pCDNAI, using the Fast Track mRNA isolation kit, and Librarium cDNA phagemid system. Once the library was prepared, the vectors were electroporated into cell line E. coli MC 1061/P3. The pCDNAI expression vector contains an antibiotic resistance gene, so the E. coli were selected via antibiotic resistance. The colonies which were resistant were then used in further experiments. The plasmid DNA from the colonies was obtained via alkaline lysis and purification on CsCl.sub.2, in accordance with Sambrook et al, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab, Cold Spring Harbor, N.Y. 2d Ed. 1989). The technique is well known to the art, but is incorporated by reference herein.
Once the plasmid DNA was isolated, it was used to transfect COS-1 cells, which were then cultured for forty-eight hours, after which these were tested with antibody coated dishes. The mAbs used included F19, as described by Rettig et al., (1986), supra, which is incorporated by reference in its entirety. As COS-1 cells are normally FAP.alpha..sup.-, any positive results indicated the presence of the coding sequence. The immunoselection protocol was that of Aruffo et al., Proc. Natl. Acad. Sci USA 84: 3365-3369 (1987), incorporated by reference herein.
Plasmid DNA from positive clones was recovered, in accordance with Hirt, J. Mol. Biol. 26: 365-369 (1967), reintroduced into E. coli MC 1061/P3, and reselected into COS-1 cells.
The protocol presented herein was followed for four rounds. After this, the plasmid DNA of 50 isolated bacterial colonies was purified, using the Qiagen plasmid kit. Of the colonies, 27 clones were found to contain identical 2.8 kb inserts, as determined by EcoRI restriction enzyme mapping. Several of these were found to contain FAP.alpha.-specific cDNA, via transient expression in COS-1 cells and direct immunofluorescence staining. One of these clones, i.e., "pFAP.38" was selected for further study, as elaborated upon infra.
EXAMPLE 2
Once pFAP.38 had been identified, it was tested together with a vector coding for known cell surface marker CD26 ("pCD26"), as well as with control vector pCDNA I.
In these experiments, COS-1 cells were transfected with one of pFAP.38, pCD26, or pCDNAI. After forty-eight hours, the transfectants were tested, using the well known MHA rosetting assay for cell surface antigen expression. In these experiments, mAb F19, which is FAP.alpha. specific, was used, together with mAb EF-1, which is CD26 specific. Also used were four other FAP.alpha. specific mAbs, i.e., FB23, FB52, FB58 and C48. Also tested were two cancer cell lines, which are known to react with mAb F19 (SW872 liposarcoma), or EF-1 (SK-OV6 ovarian cancer). The results are set forth in Table 1, which follows.
TABLE 1__________________________________________________________________________Cell surface expression of multiple FAP.alpha. epitopes and CD26in human cells and COS-1 cell transfectants. Cell surface antigen expresionTarget cell F19 FB23 FB52 FB58 C48 EF-1__________________________________________________________________________Human cellsSW872 liposarcoma >95% >95% >95% >95% >95% --SK-OV6 ovarian cancer -- -- -- -- -- >95%COS.1 transfectantsCOS.pCDNAI control -- -- -- -- -- --COS.pFAP38 40% 30% 40% 20% 20% --COS.pCD26 -- -- -- -- -- 40%__________________________________________________________________________
EXAMPLE 3
Immunoprecipitation studies were then carried out to identify the antigen being targeted by the antibodies.
Cells were metabolically labelled with Trans .sup.35 S-label, (ICN), extracted with lysis buffer (0.01M Tris-HCl/0.15M NaCl/0.01M MgCl.sub.2 /0.5% Nonidet P-40/aprotinin (20 ug/ml)/2 mM phenylmethylsulfonyl fluoride), and then immunoprecipitated. The protocols used are all well known, as will be seen by reference to Rettig et al., Canc. Res. 53:3327-3335 (1993); and Fellinger et al., Canc. Res. 51: 336-340 (1991), the disclosures of which are all incorporated by reference in their entirety. Precipitating mAbs were negative control mouse Ig, mAb F19, or EF-1. Control tests were carried out with mock transfected COS-1 cells. Following immunoprecipitation, the immunoprecipitates were separated on NaDOdSO.sub.4 /PAGE, under reducing conditions. In some experiments, an additional test was carried out to determine whether or not the immunoprecipitated material was glycosylated. In these experiments, cell extracts were fractionated with Con A-SEPHAROSE prior to immunoprecipitation. Following immunoprecipitation, but prior to fractionation on NaDodSO.sub.4 /PAGE, these precipitates were digested with N-Glycanase.
The results are shown in FIG. 1. In COS-1 cells, pFAP.38 directs expression of an 88 kd protein species (as determined via SDS-PAGE), which is slightly smaller than the 95 kd FAP.alpha. species produced by SW872, or cultured fibroblasts. Digestion with N-Glycanase produced peptides of comparable size (i.e., 74 kd versus 75 kd), showing that the glycosylation of the FAP.alpha. protein in COS-1 cells is different than in the human cell lines.
EXAMPLE 4
Classic Northern blot analysis was then carried out, using the mRNA from FAP.alpha..sup.+ fibroblast cell lines WI-38 and GM 05389, and FAP.alpha..sup.- ovarian cancer cell line SK-OV6. Using the procedures of Sambrook et al., supra, five micrograms of mRNA from each cell line were tested. The probes used were .sup.32 p labelled, and were prepared from a 2.3 kb EcoRI fragment of pFAP.38, a 2.4 kb Hind III fragment of CD26, and a 1.8 kb BamHI fragment of .gamma.-actin cDNA. These fragments had been purified from 1% agarose gels.
FIG. 2 presents these results. The extracts of FAP.alpha..sup.+ fibroblast strains show a 2.8 kb FAP mRNA species, but extracts of SK-OV6 do not. A .gamma.-actin mRNA species (1.8 kb), is seen in all species.
EXAMPLE 5
The cDNA identified as coding for FAP.alpha. was subjected to more detailed analysis, starting with sequencing. The classic Sanger methodology, as set forth in Proc. Natl. Acad. Sci. USA 74: 5463-5467 (1977), was used to sequence both strands of the cDNA. Once this was secured, an amino acid sequence was deduced therefrom. This information is presented in SEQ ID NO: 1. The sequence was then compared to the known amino acid sequence of CD26 (Morimoto et al., J. Immunol. 143:3430-3437 (1989)). FIG. 3 presents the comparison, using optimized sequence alignment. Any gaps in the comparison are indicated by asterisks, while identical amino acids are shown by dashes in the CD26 sequence. A hydrophobic, putative transmembrane sequence is double underlined, while potential N-glycosylation sites are single underlined.
The sequence analysis shows a 2815 base pair insert, wherein 2280 base pairs constitute the open reading frame. This ORF extends from start codon ATG at nucleotide 209, to stop codon TAA at 2486.
The deduced peptide is 760 amino acids long, and has a molecular weight of 87,800. In contrast, N-Glycanase digested, immunopurified FAP.alpha. was reported to have an estimated M.sub.r of 75,000 on NaDodSO.sub.4 /PAGE (Rettig et al., Canc. Res. 53:3327-3335 (1993)). A TATA box is found 83 base pairs upstream of the start codon. A polyadenylation signal and a poly-A tail were found in the 5'-untranslated region of the insert.
A GenBank data base search was then carried out. The most closely related genes found were those encoding dipeptidyl peptidase IV homologues (DPPIV; EC 3.4.14.5), with human DPPIV (also known as T-cell activation antigen CD26), showing 51% nucleotide sequence identity, and 52% amino acid sequence identity.
The second set of related genes are human, rat, and bovine homologues of DPPX, a gene of unknown function widely expressed in brain and other normal tissues. The predicted human DPPX gene product shows about 30% amino acid sequence identity with FAP.alpha. and CD26. The FAP.alpha. molecule exhibits structural features typical of type II integral membrane proteins, including a large COOH-terminal extracellular domain, a hydrophobic transmembrane segment, and a short cytoplasmic tail. The putative extracellular domain contains five potential N-glycosylation sites, 12 cysteine residues (9 of which are conserved between FAP.alpha. and CD26), and three segments corresponding to highly conserved catalytic domains characteristic of serine proteases, such as DPPIV. These conserved sequences are presented in Table 2, which follows. Comparisons to DPPIV and DPPX were made via Morimoto et al., supra; Wada et al., Proc. Natl. Acad. Sci. USA 89: 197-201 (1992); Yokotani et al., Human Mol. Genet. 2: 1037-1039 (1993).
TABLE 2______________________________________Putative catalytic domains of FAP.alpha., DPPIV and DPPX. 625 701 733______________________________________Human FAP.alpha. WGWSYEI GTADDNV DQNHGLSHuman DPPIV WGWSYGG GTADDNV DEDHGIAMouse DPPIV WGWSYGG GTADDNV DEDHGIARat DPPIV WGWSYGG GTADDNV DEDHGIAYeast DPPIV FGWSYGG GTGDDNV DSDHSIRHuman DPPX FGKDYGG PTADEKI DESHYFTRat DPPX FGKDYGG ATADEKI DESHYFIIBovine DPPX FGKDYGG ATADEKI DESHYFS______________________________________
EXAMPLE 6
An additional set of experiments were carried out to determine whether FAP.alpha. related sequences are present in non-human species. To do so, human, mouse, and Chinese hamster genomic DNA was digested using restriction enzymes, and tested, via Southern blotting, using the 2.3 kb fragment labelled with .sup.32 p describes supra. Hybridization was carried out using stringent washing conditions (0.1.times.SSC, 0.1% NaDodSO.sub.4, 68.degree. C.). Cross-hybridization was readily observed with both the mouse and hamster DNA, suggesting the existence of highly conserved FAP.alpha. homologues. In control experiments using the CD26 cDNA fragment described supra, no evidence of cross hybridization was observed.
EXAMPLE 7
The CD26 molecule shares a number of biochemical and serological properties with FAP.beta., which is a previously described, FAP.alpha. associated molecule having a molecular weight of 105 kd, and found on cultured fibroblasts and melanocytes (Rettig et al., Canc. Res. 53: 3327-3335 (1993)). Cotransfection experiments were carried out to determine whether FAP.beta. is a CD26 gene product. To test this, the same protocols were used which were used for transfection with pFAP.38 or pCD26, as described Supra, but using the two vectors. The results presented supra showed that cotransfection efficiency was about 40% for each vector, so about 10-20% of cell should be cotransfected.
Following cotransfection, the COS-1 cells were Trans .sup.35 S-labeled, as described supra, then lysed, also as described supra.
The resulting cell extracts were separated on Con A SEPHAROSE, and the antigen (FAP.alpha. and/or CD26) were recovered in the Con A-bound fraction. The bound fraction was eluted with 0.25M .alpha.-D-mannopyranoside. Immunoprecipitation was then carried out, as described supra, and the precipitates were separated on NaDodSO.sub.4 /PAGE, also as discussed supra.
FIG. 4 shows these results, together with results from single transfection experiments. Those cells transfected only with pFAP.38 produce FAP.alpha., but not FAP.beta. (determined from mAb F19 immunoprecipitates). They also produce no CD26 antigen (tested with EF-1). Those cells transfected with pCD26 alone produce CD26 but no FAP.alpha.. Cotransfectants produce CD26 and FAB.alpha./FAP.beta. heteromers, as determined in the mAb F19 precipitates. This result provides direct evidence that FAP.beta. is a CD26 gene product.
EXAMPLE 8
It has been observed previously that some cultured human cell types coexpress FAP.alpha. and CD26, and show FAP.alpha./CD26 heteromer formation. In vivo distribution patterns of FAP.alpha. and CD26, however, as determined in previous immunohistochemical studies, appeared to be non-overlapping. (See Rettig et al., Proc. Natl. Acad. Sci. USA 85: 3110-3114 (1988); Garin-Chesa et al., Proc. Natl. Acad. Sci. USA 87: 7235-7329 (1990); Rettig et al., Canc. Res. 53: 3327-3335 (1993); Stein et al., in Knapp et al., eds. Leukocyte typing IV-white cell differentiation antigens, pp 412-415 (Oxford University Press, N.Y. 1989), pp. 412-415; Mobious et al., J. Exp. Immunol. 74: 431-437 (1988)). In view of the potential significance of FAP.alpha./CD26 coassociation, tissue distribution was reexamined, via side by side immunohistochemical staining of normal tissues and lesional tissues known to contain FAP.alpha..sup.+ fibroblasts or FAP.alpha..sup.+ malignant cells.
To test the samples, they were embedded in OCT compound, frozen in isopentane precooled in liquid nitrogen, and stored at -70.degree. C. until used. Five micrometer thick sections were cut, mounted on poly-L-lysine coated slides, air dried, and fixed in cold acetone (4.degree. C., for 10 minutes). The sections were then tested with mAbs (10-20 ug/ml), using the well known avidin-biotin immmunoperoxidase method, as described by, e.g., Garin-Chesa et al., J. Histochem. Cytochem. 37: 1767-1776 (1989); Garin-Chesa et al., Proc. Natl. Acad. Sci. USA 87: 7235-7239 (1990); Rettig et al., Canc. Res. 53:3327-3335 (1993); Garin-Chesa et al., Am. J. Pathol. 142: 557-567.
The results are shown in FIG. 5. Breast, colorectal, pancreas and lung carcinomas showed strong expression of FAP.alpha. and not CD26 was found (see FIGS. 5A and 5B). Five FAP.alpha..sup.+ sarcomas, including malignant fibrous histocytoma (FIGS. 5C and 5D), were tested, and there was no expression of CD26. Examination of reactive fibroblasts of healing dermal wounds (FIGS. 5E, 5F), showed abundant expression of both FAP.alpha. and CD26. The three renal carcinomas tested (FIGS. 5G, 5H), showed expression of CD26 in malignant epithelium. FAP.alpha. was absent from malignant epithelial cells, and showed low expression in the stroma of these carcinomas.
The foregoing examples describe an isolated nucleic acid molecule which codes for fibroblast activating protein alpha ("FAP.alpha."). The expression product of the sequence is a protein which, on SDS-PAGE, shows a molecular weight of about 75 kd. Deduced amino acid sequence, as provided in SEQ ID NO: 1, for one form of the molecule, yields a molecular weight of about 88 kd. It is to be understood that, as described, FAP.alpha. may be glycosylated, with the type and amount of glycosylation varying, depending upon the type of cell expressing the molecule. The experiment described herein shows this.
The invention also comprehends the production of expression vectors useful in producing the FAP.alpha. molecule. In their broadest aspect, these vectors comprise a FAP.alpha. coding sequence, operably linked to a promoter. Additional elements may be a part of the expression vector, such as genes which confer antibiotic resistance, amplifiable genes, and so forth.
The coding sequences and vectors may also be used to prepare cell lines, wherein the coding sequence or expression vector is used to transfect or to transform a recipient host. The type of cell used maybe prokaryotic, such as E. coli, or eukaryotes, such as yeast, CHO, COS, or other cell types.
The identification of nucleic acid molecules such as that set forth in SEQ ID NO: 1 also enables the artisan to identify and to isolate those nucleic acid molecules which hybridize to it under stringent conditions. "Stringent condition" as used herein, refers to those parameters set forth supra, whereby both murine and hamster sequences were also identified. It will be recognized by the skilled artisan that these conditions afford a degree of stringency which can be achieved using parameters which vary from those recited. Such variance is apprehended by the expression "stringent conditions".
The ability of nucleic acid molecules to hybridize to complementary molecules also enables the artisan to identify cells which express FAP.alpha., via the use of a nucleic acid hybridization assay. One may use the sequences described in the invention to hybridize to complementary sequences, and thus identify them. In this way, one can target mRNA, e.g., which is present in any cell expressing the FAP.alpha. molecule.
It is of course understood that the nucleic acid molecules of the invention are also useful in the production of recombinant FAP.alpha.. The recombinant protein may be used, e.g., as a source of an immunogen for generation of antibodies akin to known mAb F19, and with the same uses. Similarly, the recombinant protein, and/or cells which express the molecule on its surface, may be used in assays to determine antagonists, agonists, or other molecules which interact with the FAP.alpha. molecule. Such molecules may be, but are not necessarily limited to, substrates, inhibiting molecules, antibodies, and so forth. This last feature of the invention should be considered in light of the observed structural resemblances to membrane bound enzymes. This type of molecule is associated with certain properties which need not be described in detail here. It will suffice to say that inhibition or potentiation of these properties as associated with FAP.alpha. is a feature of this invention. For example, one may identify substrates or the substrate for the FAP.alpha. molecule, via the use of recombinant cells or recombinant FAP.alpha. per se. The substrates can be modified to improve their effect, to lessen their effect, or simply to label them with detectable signals so that they can be used, e.g., to identify cells which express FAP.alpha.. Study of the interaction of substrate and FAP.alpha., as well as that between FAP.alpha. and any molecule whatsoever, can be used to develop and/or to identify agonists and antagonists of the FAP.alpha. molecule.
Other aspects of the invention will be clear to the skilled artisan, and need not be set forth here.
The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, it being recognized that various modifications are possible within the scope of the invention.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 10(2) INFORMATION FOR SEQ ID NO: 1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2815 Base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:AAGAACGCCCCCAAAATCTGTTTCTAATTTTACAGAAATCTTTTGAAACTTGGCACGGTA60TTCAAAAGTCCGTGGAAAGAAAAAAACCTTGTCCTGGCTTCAGCTTCCAACTACAAAGAC120AGACTTGGTCCTTTTCAACGGTTTTCACAGATCCAGTGACCCACGCTCTGAAGACAGAAT180TAGCTAACTTTCAAAAACATCTGGAAAAATGAAGACTTGGGTAAAAATCGTATTTGGAGT240TGCCACCTCTGCTGTGCTTGCCTTATTGGTGATGTGCATTGTCTTACGCCCTTCAAGAGT300TCATAACTCTGAAGAAAATACAATGAGAGCACTCACACTGAAGGATATTTTAAATGGAAC360ATTTTCTTATAAAACATTTTTTCCAAACTGGATTTCAGGACAAGAATATCTTCATCAATC420TGCAGATAACAATATAGTACTTTATAATATTGAAACAGGACAATCATATACCATTTTGAG480TAATAGAACCATGAAAAGTGTGAATGCTTCAAATTACGGCTTATCACCTGATCGGCAATT540TGTATATCTAGAAAGTGATTATTCAAAGCTTTGGAGATACTCTTACACAGCAACATATTA600CATCTATGACCTTAGCAATGGAGAATTTGTAAGAGGAAATGAGCTTCCTCGTCCAATTCA660GTATTTATGCTGGTCGCCTGTTGGGAGTAAATTAGCATATGTCTATCAAAACAATATCTA720TTTGAAACAAAGACCAGGAGATCCACCTTTTCAAATAACATTTAATGGAAGAGAAAATAA780AATATTTAATGGAATCCCAGACTGGGTTTATGAAGAGGAAATGCTTCCTACAAAATATGC840TCTCTGGTGGTCTCCTAATGGAAAATTTTTGGCATATGCGGAATTTAATGATAAGGATAT900ACCAGTTATTGCCTATTCCTATTATGGCGATGAACAATATCCTAGAACAATAAATATTCC960ATACCCAAAGGCTGGAGCTAAGAATCCCGTTGTTCGGATATTTATTATCGATACCACTTA1020CCCTGCGTATGTAGGTCCCCAGGAAGTGCCTGTTCCAGCAATGATAGCCTCAAGTGATTA1080TTATTTCAGTTGGCTCACGTGGGTTACTGATGAACGAGTATGTTTGCAGTGGCTAAAAAG1140AGTCCAGAATGTTTCGGTCCTGTCTATATGTGACTTCAGGGAAGACTGGCAGACATGGGA1200TTGTCCAAAGACCCAGGAGCATATAGAAGAAAGCAGAACTGGATGGGCTGGTGGATTCTT1260TGTTTCAAGACCAGTTTTCAGCTATGATGCCATTTCGTACTACAAAATATTTAGTGACAA1320GGATGGCTACAAACATATTCACTATATCAAAGACACTGTGGAAAATGCTATTCAAATTAC1380AAGTGGCAAGTGGGAGGCCATAAATATATTCAGAGTAACACAGGATTCACTGTTTTATTC1440TAGCAATGAATTTGAAGAATACCCTGGAAGAAGAAACATCTACAGAATTAGCATTGGAAG1500CTATCCTCCAAGCAAGAAGTGTGTTACTTGCCATCTAAGGAAAGAAAGGTGCCAATATTA1560CACAGCAAGTTTCAGCGACTACGCCAAGTACTATGCACTTGTCTGCTACGGCCCAGGCAT1620CCCCATTTCCACCCTTCATGATGGACGCACTGATCAAGAAATTAAAATCCTGGAAGAAAA1680CAAGGAATTGGAAAATGCTTTGAAAAATATCCAGCTGCCTAAAGAGGAAATTAAGAAACT1740TGAAGTAGATGAAATTACTTTATGGTACAAGATGATTCTTCCTCCTCAATTTGACAGATC1800AAAGAAGTATCCCTTGCTAATTCAAGTGTATGGTGGTCCCTGCAGTCAGAGTGTAAGGTC1860TGTATTTGCTGTTAATTGGATATCTTATCTTGCAAGTAAGGAAGGGATGGTCATTGCCTT1920GGTGGATGGTCGAGGAACAGCTTTCCAAGGTGACAAACTCCTCTATGCAGTGTATCGAAA1980GCTGGGTGTTTATGAAGTTGAAGACCAGATTACAGCTGTCAGAAAATTCATAGAAATGGG2040TTTCATTGATGAAAAAAGAATAGCCATATGGGGCTGGTCCTATGGAGGATACGTTTCATC2100ACTGGCCCTTGCATCTGGAACTGGTCTTTTCAAATGTGGTATAGCAGTGGCTCCAGTCTC2160CAGCTGGGAATATTACGCGTCTGTCTACACAGAGAGATTCATGGGTCTCCCAACAAAGGA2220TGATAATCTTGAGCACTATAAGAATTCAACTGTGATGGCAAGAGCAGAATATTTCAGAAA2280TGTAGACTATCTTCTCATCCACGGAACAGCAGATGATAATGTGCACTTTCAAAACTCAGC2340ACAGATTGCTAAAGCTCTGGTTAATGCACAAGTGGATTTCCAGGCAATGTGGTACTCTGA2400CCAGAACCACGGCTTATCCGGCCTGTCCACGAACCACTTATACACCCACATGACCCACTT2460CCTAAAGCAGTGTTTCTCTTTGTCAGACTAAAAACGATGCAGATGCAAGCCTGTATCAGA2520ATCTGAAAACCTTATATAAACCCCTCAGACAGTTTGCTTATTTTATTTTTTATGTTGTAA2580AATGCTAGTATAAACAAACAAATTAATGTTGTTCTAAAGGCTGTTAAAAAAAAGATGAGG2640ACTCAGAAGTTCAAGCTAAATATTGTTTACATTTTCTGGTACTCTGTGAAAGAAGAGAAA2700AGGGAGTCATGCATTTTGCTTTGGACACAGTGTTTTATCACCTGTTCATTTGAAGAAAAA2760TAATAAAGTCAGAAGTTCAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCCGCTCGA2815(2) INFORMATION FOR SEQ ID NO: 2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 760 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:MetLysThrTrpValLysIleValPheGlyValAlaThrSerAlaVal51015LeuAlaLeuLeuValMetCysIleValLeuArgProSerArgValHis202530AsnSerGluGluAsnThrMetArgAlaLeuThrLeuLysAspIleLeu354045AsnGlyThrPheSerTyrLysThrPhePheProAsnTrpIleSerGly505560GlnGluTyrLeuHisGlnSerAlaAspAsnAsnIleValLeuTyrAsn65707580IleGluThrGlyGlnSerTyrThrIleLeuSerAsnArgThrMetLys859095SerValAsnAlaSerAsnTyrGlyLeuSerProAspArgGlnPheVal100105110TyrLeuGluSerAspTyrSerLysLeuTrpArgTyrSerTyrThrAla115120125ThrTyrTyrIleTyrAspLeuSerAsnGlyGluPheValArgGlyAsn130135140GluLeuProArgProIleGlnTyrLeuCysTrpSerProValGlySer145150155160LysLeuAlaTyrValTyrGlnAsnAsnIleTyrLeuLysGlnArgPro165170175GlyAspProProPheGlnIleThrPheAsnGlyArgGluAsnLysIle180185190PheAsnGlyIleProAspTrpValTyrGluGluGluMetLeuProThr195200205LysTyrAlaLeuTrpTrpSerProAsnGlyLysPheLeuAlaTyrAla210215220GluPheAsnAspLysAspIleProValIleAlaTyrSerTyrTyrGly225230235240AspGluGlnTyrProArgThrIleAsnIleProTyrProLysAlaGly245250255AlaLysAsnProValValArgIlePheIleIleAspThrThrTyrPro260265270AlaTyrValGlyProGlnGluValProValProAlaMetIleAlaSer275280285SerAspTyrTyrPheSerTrpLeuThrTrpValThrAspGluArgVal290295300CysLeuGlnTrpLeuLysArgValGlnAsnValSerValLeuSerIle305310315320CysAspPheArgGluAspTrpGlnThrTrpAspCysProLysThrGln325330335GluHisIleGluGluSerArgThrGlyTrpAlaGlyGlyPhePheVal340345350SerArgProValPheSerTyrAspAlaIleSerTyrTyrLysIlePhe355360365SerAspLysAspGlyTyrLysHisIleHisTyrIleLysAspThrVal370375380GluAsnAlaIleGlnIleThrSerGlyLysTrpGluAlaIleAsnIle385390395400PheArgValThrGlnAspSerLeuPheTyrSerSerAsnGluPheGlu405410415GluTyrProGlyArgArgAsnIleTyrArgIleSerIleGlySerTyr420425430ProProSerLysLysCysValThrCysHisLeuArgLysGluArgCys435440445GlnTyrTyrThrAlaSerPheSerAspTyrAlaLysTyrTyrAlaLeu450455460ValCysTyrGlyProGlyIleProIleSerThrLeuHisAspGlyArg465470475480ThrAspGlnGluIleLysIleLeuGluGluAsnLysGluLeuGluAsn485490495AlaLeuLysAsnIleGlnLeuProLysGluGluIleLysLysLeuGlu500505510ValAspGluIleThrLeuTrpTyrLysMetIleLeuProProGlnPhe515520525AspArgSerLysLysTyrProLeuLeuIleGlnValTyrGlyGlyPro530535540CysSerGlnSerValArgSerValPheAlaValAsnTrpIleSerTyr545550555560LeuAlaSerLysGluGlyMetValIleAlaLeuValAspGlyArgGly565570575ThrAlaPheGlnGlyAspLysLeuLeuTyrAlaValTyrArgLysLeu580585590GlyValTyrGluValGluAspGlnIleThrAlaValArgLysPheIle595600605GluMetGlyPheIleAspGluLysArgIleAlaIleTrpGlyTrpSer610615620TyrGlyGlyTyrValSerSerLeuAlaLeuAlaSerGlyThrGlyLeu625630635640PheLysCysGlyIleAlaValAlaProValSerSerTrpGluTyrTyr645650655AlaSerValTyrThrGluArgPheMetGlyLeuProThrLysAspAsp660665670AsnLeuGluHisTyrLysAsnSerThrValMetAlaArgAlaGluTyr675680685PheArgAsnValAspTyrLeuLeuIleHisGlyThrAlaAspAspAsn690695700ValHisPheGlnAsnSerAlaGlnIleAlaLysAlaLeuValAsnAla705710715720GlnValAspPheGlnAlaMetTrpTyrSerAspGlnAsnHisGlyLeu725730735SerGlyLeuSerThrAsnHisLeuTyrThrHisMetThrHisPheLeu740745750LysGlnCysPheSerLeuSerAsp755760(2) INFORMATION FOR SEQ ID NO: 3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 766 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:MetLysThrProTrpLysValLeuLeuGlyLeuLeuGlyAlaAlaAla51015LeuValThrIleIleThrValProValValLeuLeuAsnLysGlyThr202530AspAspAlaThrAlaAspSerArgLysThrTyrThrLeuThrAspTyr354045LeuLysAsnThrTyrArgLeuLysLeuTyrSerLeuArgTrpIleSer505560AspHisGluTyrLeuTyrLysGlnGluAsnAsnIleLeuValPheAsn65707580AlaGluTyrGlyAsnSerSerValPheLeuGluAsnSerThrPheAsp859095GluPheGlyHisSerIleAsnAspTyrSerIleSerProAspGlyGln100105110PheIleLeuLeuGluTyrAsnTyrValLysGlnTrpArgHisSerTyr115120125ThrAlaSerTyrAspIleTyrAspLeuAsnLysArgGlnLeuIleThr130135140GluGluArgIleProAsnAsnThrGlnTrpValThrTrpSerProVal145150155165GlyHisLysLeuAlaTyrValTrpAsnAsnAspIleTyrValLysIle170175180GluProAsnLeuProSerTyrArgIleThrTrpThrGlyLysGluAsp185190195IleIleTyrAsnGlyIleThrAspTrpValTyrGluGluGluValPhe200205210SerAlaTyrSerAlaLeuTrpTrpSerProAsnGlyThrPheLeuAla215220225TyrAlaGlnPheAsnAspThrGluValProLeuIleGluTyrSerPhe230235240245TyrSerAspGluSerLeuGlnTyrProLysThrValArgValProTyr250255260ProLysAlaGlyAlaValAsnProThrValLysPhePheValValAsn265270275ThrAspSerLeuSerSerValThrAsnAlaThrSerIleGlnIleThr280285290AlaProAlaSerMetLeuIleGlyAspHisTyrLeuCysAspValThr295300305TrpAlaThrGlnGluArgIleSerLeuGlnTrpLeuArgArgIleGln310315320325AsnTyrSerValMetAspIleCysAspTyrAspGluSerSerGlyArg330335340TrpAsnCysLeuValAlaArgGlnHisIleGluMetSerThrThrGly345350355TrpValGlyArgPheArgProSerGluProHisPheThrLeuAspGly360365370AsnSerPheTyrLysIleIleSerAsnGluGluGlyTyrArgHisIle375380385CysTyrPheGlnIleAspLysLysAspCysThrPheIleThrLysGly390395400405ThrTrpGluValIleGlyIleGluAlaLeuThrSerAspTyrLeuTyr410415420TyrIleSerAsnGluTyrLysGlyMetProGlyGlyArgAsnLeuTyr425430435LysIleGlnLeuSerAspTyrThrLysValThrCysLeuSerCysGlu440445450LeuAsnProGluArgCysGlnTyrTyrSerValSerPheSerLysGlu455460460AlaLysTyrTyrGlnLeuArgCysSerGlyProGlyLeuProLeuTyr465470475480ThrLeuHisSerSerValAsnAspLysGlyLeuArgValLeuGluAsp485490495AsnSerAlaLeuAspLysMetLeuGlnAsnValGlnMetProSerLys500505510LysLeuAspPheIleIleLeuAsnGluThrLysPheTrpTyrGlnMet515520525IleLeuProProHisPheAspLysSerLysLysTyrProLeuLeuLeu530535540AspValTyrAlaGlyProCysSerGlnLysAlaAspThrValPheArg545550555560LeuAsnTrpAlaThrTyrLeuAlaSerThrGluAsnIleIleValAla565570575SerPheAspGlyArgGlySerGlyTyrGlnGlyAspLysIleMetHis580585590AlaIleAsnArgArgLeuGlyThrPheGluValGluAspGlnIleGlu595600605AlaAlaArgGlnPheSerLysMetGlyPheValAspAsnLysArgIle610615620AlaIleTrpGlyTrpSerTyrGlyGlyTyrValThrSerMetValLeu625630635640GlySerGlySerGlyValPheLysCysGlyIleAlaValAlaProVal645650655SerArgTrpGluTyrTyrAspSerValTyrThrGluArgTyrMetGly660665670LeuProThrProGluAspAsnLeuAspHisTyrArgAsnSerThrVal675680685MetSerArgAlaGluAsnPheLysGlnValGluTyrLeuLeuIleHis690695700GlyThrAlaAspAspAsnValHisPheGlnGlnSerAlaGlnIleSer705710715720LysAlaLeuValAspValGlyValAspPheGlnAlaMetTrpTyrThr725730735AspGluAspHisGlyIleAlaSerSerThrAlaHisGlnHisIleTyr740745750ThrHisMetSerHisPheIleLysGlnCysPheSerLeuPro755760765(2) INFORMATION FOR SEQ ID NO: 4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ix) FEATURE:(D) OTHER INFORMATION: The first Xaa is either Trp or Phe.When the first Xaa is Trp, the second and third Xaa maybe Glu Ile or Gly Gly. When the first Xaa is Phe, thesecond and third Xaa must be Gly Gly(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:XaaGlyTrpSerTyrXaaXaa(2) INFORMATION FOR SEQ ID NO: 5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:PheGlyLysAspTyrGlyGly5(2) INFORMATION FOR SEQ ID NO: 6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ix) FEATURE:(D) OTHER INFORMATION: Xaa is either Ala or Gly(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:GlyThrXaaAspAspAsnVal5(2) INFORMATION FOR SEQ ID NO: 7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:AlaGlnAsnHisGlyLeuSer5(2) INFORMATION FOR SEQ ID NO: 8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ix) FEATURE:(D) OTHER INFORMATION:The first Xaa is Glu or Ser. When the first Xaa is Glu,the second Xaa is Gly and the third is Ala. When thefirst Xaa is Ser, the second Xaa is Ser, and the thirdXaa is Arg.(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:AspXaaAspHisXaaIleXaa5(2) INFORMATION FOR SEQ ID NO: 9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ix) FEATURE:(D) OTHER INFORMATION:Xaa is Pro or Ala.(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:XaaThrAlaAspGluLysIle5(2) INFORMATION FOR SEQ ID NO: 10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 7 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ix) FEATURE:(D) OTHER INFORMATION:Xaa is Thr, His or Ser.(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:AspGluSerHisTyrPheXaa5__________________________________________________________________________

Isolated nucleic acid molecule coding for fibroblast activation protein alpha and uses thereof

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Non-Patent Literature Citations (3)

Entry
Rettig, W., et al., Cancer Research, 53:3327-3335, 1993.
Rettig, W. et al., PNAS, 85:3110-3114, 1988.
Aruffo, A. et al., PNAS, 84:8573-8577, 1987.