Patent Application
20240167017
The sequence listing provided in the file entitled PUS1222087_SQL_Revised.txt, which is an ASCII text file that was created on Sep. 11, 2023, and which comprises 2,254 bytes, is hereby incorporated by reference in its entirety.
The present invention relates to the field of molecular biology, in particular to a liquid yeast one- and two-hybrid high-throughput library screening method and use thereof.
Yeast two-hybrid is an important experimental system mainly used to screen interacting proteins and verify protein interactions in molecular biology. The key element in this system is a transcription factor (such as Gal4), which contains a DNA-binding domain (DBD) and a transcriptional activation domain (AD). Protein A is fused to the DNA-binding domain (DBD) of the transcription factor (such as Gal4) as a bait, while protein B is fused to the transcriptional activation domain (AD) (called the prey) of the transcription factor (such as Gal4). Only when protein A and protein B interact, the DNA-binding domain (DBD) and the transcriptional activation domain (AD) will be tightly combined, thereby forming a complete functional transcription factor and activating the downstream reporter gene. Similarly, in the yeast one-hybrid system, by replacing a DNA-binding structural domain (e.g. Gal4) with a library protein-encoding gene, the transcriptional activation domain (AD) of a transcription factor (e.g. Gal4) activates a downstream reporter gene when the bait DNA sequence encounters a library protein that interacts with it, so that the protein specifically bound to the bait DNA sequence is recognized.
However, the above systems also have limitations. First of all, if the bait itself has self-activation, it often has the problem of self-activating the downstream reporter gene and cannot screen the interacting protein. A common way to solve this problem is to remove its activation domain by creating specific mutations in the bait sequence. However, this method may simultaneously remove the functional domains that determine the interaction. Secondly, because the bait protein or bait sequence may interact with endogenous proteins in yeast cells, it is easy to cause false positive results. At the same time, since the expression of fusion proteins in yeast cells is different from that in the plant body environment, it may interfere with the binding of interacting proteins, resulting in false negatives. Finally, the traditional yeast one- and two-hybrid system has extremely high time and labor costs, and requires a lot of plate-plating and monoclonal PCR identification.
In recent years, with the development of sequencing technology, a number of new systems for studying proteomics in yeast one- and two-hybrid have emerged, including Assay-based Y2H, Smart-pooling Y2H, Y2H-Seq, Stitch-Seq Y2H, and BFG-Y2H. These technologies expand the scope of screening by improving the library, combined with next-generation sequencing technology, and simplify the identification work to a certain extent, but they have high requirements on the quality of the library, and are expensive and cannot be applied to small-scale screening of laboratories; more importantly, the above methods have not been able to avoid the troubles caused by the cumbersome coating work and the self-activation of the bait. Therefore, there is an urgent need for a new yeast one- and two-hybrid technology that is simple, efficient, time-saving and labor-saving, and can solve the problem of self-activation, so as to provide more convenient services for the development of molecular experiments.
One object of the present invention is to provide a liquid yeast one/two-hybrid high-throughput library screening method.
The present invention provides a method for liquid yeast one/two-hybrid high-throughput library screening, that is, a liquid yeast one-hybrid high-throughput library screening method or a liquid yeast two-hybrid high-throughput library screening method. The method includes the following steps, the method here is aimed at liquid yeast one/two-hybrid high-throughput screening of interacting proteins:
In the above method, the liquid maintenance medium and the liquid screening medium are the following two combinations, and the screening pressure in the liquid screening medium is greater than that of the liquid maintenance medium:
the above requirement that the screening pressure in the liquid screening medium is greater than that in the liquid maintenance medium specifically means that the types of antibiotics in the liquid screening medium are more than those in the liquid maintenance medium or the concentration of antibiotics is higher than that in the liquid maintenance medium.
The maintenance medium of the present invention is mainly used for amplifying and propagating yeast libraries to be screened, while maintaining the diversity of the initial yeast library to the greatest extent. The maintenance medium can be any of the following medium or a combination thereof or a product added with appropriate stress reagents (including but not limited to AbA, kanamycin, ampicillin, etc.). The screening medium of the present invention is mainly used for screening yeast libraries to be screened. The screening medium is any of the following medium or a combination thereof or the product of adding appropriate stress reagents (including but not limited to AbA, kanamycin, ampicillin, etc.).
In the above method, the liquid screening medium can further include a self-activating inhibitor. In an embodiment of the present invention, the self-activating inhibitor is AbA.
In the above method, the yeast one/two-hybrid library constructed by bait sequence or bait protein and library is any of the following:
In the above method, in the step of transforming the vector containing the bait protein gene or the induction sequence into a yeast strain to obtain a bait strain, and then fusing the bait strain with the yeast library to obtain the yeast one/two-hybrid library, the following steps can further included before the fusion: detecting the self-activation of the bait sequence or the bait protein in the bait strain, and determining the inhibitor concentration for inhibiting the self-activation thereof (this step may or may not be included in the present invention).
In the above method, the following steps are further included before steps 2) and 3): extracting the plasmids of the control library and the treatment library, performing low-cycle count PCR amplification to obtain library fragments.
In the above method, the bait protein is a GmFT1a protein or a GmFT2a protein;
the method comprises the following steps:
Another object of the present invention is to provide a liquid yeast one/two-hybrid high-throughput library screening kit.
The kit provided by the present invention includes vectors and yeasts required for the yeast one/two-hybrid library, the liquid maintenance medium, the liquid screening medium, a self-activating inhibitor in the above method and instruments or reagents required for high-throughput sequencing.
In the embodiment of the present invention, the liquid yeast one- and two-hybrid high-throughput library screening technology can be based on but not limited to the Y2H Matchmaker Gold system, and the specific steps are as follows:
The liquid yeast one- and two-hybrid high-throughput library screening technology can also be any of the following schemes or a combination thereof:
The high-throughput sequencing of the present invention includes, but is not limited to, Illumina next-generation sequencing, 454 next-generation sequencing, ONT third-generation sequencing, PacBio third-generation sequencing, and the like.
The comparison analysis of the present invention can use comparison tools including but not limited to blastn, blastp, miniasm2, fasta36, hisat2, tophat, etc. to compare the sequencing results to reference gene or protein databases (including but not limited to swissprot protein database, nr protein database, nt nucleic acid database, reference genome, reference genome annotation data, etc.), and then according to the comparison results, compare the sequenced fragments of the processed library and the control library and the statistical indicators of the comparison of their corresponding genes or proteins (including but not limited to reference genes or the absolute number of sequenced data of the protein, the relative number of the sequenced data of the reference gene or protein, etc.), and screening the interacting proteins according to the difference in statistical indicators of the comparison.
The present invention aims to provide a simple and efficient liquid yeast one- and two-hybrid high-throughput library screening technology and its application in view of the high time cost and labor cost of the yeast one- and two-hybrid system for studying protein-protein interaction and DNA-protein interaction, and it is difficult to solve the problem of bait self-activation.
The following examples facilitate a better understanding of the present invention, but do not limit the present invention.
The experimental methods in the following examples are conventional methods unless otherwise specified.
The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.
Soybean variety Zigong Dongdou is recorded in the following documents: Han Tianfu, Gai Junyi, Wang Jinling, Zhou Dongxing. Discovery of soybean flowering reversal phenomenon. 1998. Acta AgronomicaSinica(02): 168-171. The soybean variety Zigong Dongdou was sensitive to photoperiod. Hereinafter, the soybean variety Zigong Dongdou is referred to as Zigong Dongdou or ZGDD.
The reagents used in this example were as follows:
The tested variety: the soybean variety used to construct the soybean yeast library was the photoperiod-sensitive variety Zigong Dongdou, which was planted in a light incubator with 12 h light/12 h dark treatment at a temperature of 25° C. and a humidity of 65%.
Preparation of AbA (AureobasidinA) aureobasidinA mother solution: 1 mg of AureobasidinAAbA (AureobasidinA) (purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630466) was dissolved in 2 mL of methanol solution to a final concentration of 500 μg/mL, the working concentration was 0.1-0.5 μg/mL.
AbA was a reporter in the Matchmaker Gold yeast system, which can effectively screen positive clones.
Preparation of X-α-gal mother solution: 100 mg of chromogenic substrate X-α-gal (purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630462) was dissolved in 5 mL of dimethyl sulfoxide solvent to a final concentration of 20 mg/mL, the working concentration was 40 μg/mL.
X-α-Gal was a chromogenic substrate of yeast galactosidase (MEL1), which can directly detect GAL4-based yeast two-hybrid interaction on agar, and the yeast clones with positive interaction were blue.
Preparation of 0.9% NaCl: 0.9 g of NaCl was weighed, dissolved in 100 mL of distilled water and filtered through a 0.2 μm filter membrane to obtain 0.9% NaCl.
The detection process of this example: after the concentration of the AbA self-activation inhibitor was determined by pGBKT7-FT1a, the library was screened according to liquid yeast one- and two-hybrid high-throughput library screening technology. This technology was mainly aimed at improving and optimizing the processing of mating products between the library and bait yeast cells. The original two-deficient solid medium and the more stringent four-deficient solid medium were changed to corresponding liquid medium. During the library screening process, after mating with yeast, the two-deficient screening medium was added for culture; then two parts were taken out for strict two-deficient and four-deficient screening respectively, and the yeast plasmid of the final culture was extracted, and the target band was amplified by PCR It was found that after the pGBKT7-FT1a bait strain was fused with the library, the yeast plasmids of the two-deficient culture and the four-deficient culture showed a diffuse band after low-cycle count PCR amplification (
The details were as follows:
I. Construction of Yeast Library to be Screened
1. Acquisition of Yeast Library
When the three compound leaves of ZigongDongdou were fully expanded, the soybean leaf tissue was taken for RNA extraction, Then the library was constructed according to the kit instructions of “Make Your Own Mate & Plate Library System”, and the initial yeast library was obtained by using the pGADT7-Rec plasmid and Y187 yeast strain in the kit. 1 mL of each was subpackaged into 2 mL centrifuge tubes and stored at −80° C.
2. Fusion of the Bait Vector and the Initial Yeast Library to Obtain a Yeast Library to be Screened
1). Acquisition of the Bait Plasmid Expressing GmFT1a and the Bait Strain
the CDS sequence (sequence 1) of GmFT1a was constructed between the EcoRI and BamHI digestion sites of the pGBKT7 vector (included in the Matchmaker® Gold Yeast Two-Hybrid System kit, Clontech, 630489) to obtain the pGBKT7-FT1a bait plasmid.
The pGBKT7-FT1a bait plasmid was transferred into Y2HGold yeast competent cells (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd, catalogue no. ZC1602) according to the kit instructions of Yeastmaker™ Yeast Transformation System 2, coated onto SD/-Trp plates and inverted cultureat 30° C. for 3 days to obtain the bait strain Y2HGold/pGBKT7-FT1a.
2) Screening of the Bait Inhibitor Concentration
The self-activation detection of the bait strain Y2HGold/pGBKT7-FT1a by different concentrations of AbA inhibitors:
Colonies of 2-3 mm in diameter were picked from the SD/-Trp culture plates of the bait strain Y2HGold/pGBKT7-FT1a obtained from 1), dissolved in 100 μL of 0.9% NaCl solution, and then 100 μL of the above solution was diluted at 1/10, 1/100, 1/1000 and coated onto nutrient-deficient plates SD/-Trp (SDO, purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630309), SD/-Trp/X-α-Gal(SDO/X was obtained by adding 20 mg/mL X-α-Gal to a final concentration of 40 μg/mL after sterilization of SDO) and SD/-Trp/X-α-Gal/AbA(SDO/X/A was obtained by adding 20 mg/mL X-α-Gal to the final concentration of 40 μg/mL after SDO sterilization, and adding 500 μg/mL AbA to the final concentration of 200 ng/ml, 300 ng/mL, 400 ng/ml, 500 ng/mL, respectively) plates containing different concentrations of AbA (AureobasidinA) respectively. The results were observed after 3 days of inverted culture at 30° C.
The results were shown in
Therefore, GmFT1a was subjected to liquid yeast two-hybrid high-throughput library screening according to the AbA concentration of 400 ng/ml. This step was to determine the lowest concentration of AbA that inhibited self-activation, and then screened the library according to this concentration.
3) Concentration of Bait Strain
A large (2-3 mm) colony was picked from the SD/-Trp culture plate of the bait strain Y2HGold/pGBKT7-FT1a obtained from 1) and inoculated into 50 mL SD/-Trp liquid medium, incubated at 30° C. with shaking (250-270 rpm) until OD600 reached 0.8 (16-20 h).
After centrifugation, the yeast cells were precipitated (1000 g, 5 min), the supernatant was discarded, and 4-5 mL SD/-Trp liquid culture solution was added to re-suspend the precipitate until the cell density>1×108/mL (cells could be counted by a blood cell counter), and the concentrated bait strain Y2HGold/pGBKT7-FT1a bacteria solution was obtained.
4) Mating and Fusion
One part (1 mL) of the initial yeast library obtained from 1) above was mixed with 5 ml of the concentrated bait strain Y2HGold/pGBKT7-FT1a bacteria solution (cell density of 1.2×109/mL) obtained from 3) above, and placed in a sterile 2 L flask. 45 mL of 2× YPDA liquid culture solution was added (purchased from Beijing Liuhetong Economic and Trade Co., Ltd, catalogue no. 630306, containing 50 ng/ml kanamycin) to the 2 L flask, the 2 mL centrifuge tube containing the initial yeast library was rinsed twice with 1 mL of 2× YPDA and the rinse solution was added to the 2 L flask.
Incubated at 30° ° C., 30-50 rpm for 20-24 hours until yeast zygotes appeared to obtain yeast mating products;
That is, the yeast mating product of the initial yeast library and the bait strain Y2HGold/pGBKT7-FT1a was obtained.
The lowest possible shaking speed was used in the above incubation steps to prevent cell sedimentation at the bottom of the flask; vigorous shaking may reduce mating efficiency, but too slow shaking would lead to cell sedimentation and reduce mating efficiency.
After 20 hours of incubation, a drop of the incubation product was dropped under the microscope. If a yeast zygote occurred, step 5 below was continued; otherwise, mating fusion continued and incubation continued for a further 4 hours. Zygotes usually had a 3-leaf structure, some may resemble clover leaves, while other zygotes may had a ‘Mickey Mouse’-like shape.
The above yeast mating products were transferred to 50 mL SD/-Trp/-Leu two-deficient culture solution (purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630316, containing 50 ng/mL kanamycin) and incubated at 30° C. on a shaker at 240 rpm for 2 days, the yeast library to be screened pGBKT7-FT1a+library containing the bait protein GmFT1a was obtained.
II. Identification of Proteins that Interact with the Bait Protein GmFT1a in a Liquid Yeast Two-Hybrid High-Throughput Screening Library
1. Control Library and Treatment Library
Control library: the yeast library to be screened pGBKT7-FT1a+library containing the bait protein GmFT1a obtained in the above “step 1” was centrifuged and enriched, resuspended in 10 mL 0.9% NaCl, and 5 mL was added to 45 mL SD/-Trp/-Leu two-deficient culture solution (containing 50 ng/mL kanamycin) for culturationand incubated at 30° C. on a shaker at 240 rpm for 2 days to obtain the control library pGBKT7-FT1a+libraryC.
Treatment library: From the enriched resuspension of the above yeast library to be screened pGBKT7-FT1a+library, the remaining 5 mL was added to 45 mL of SD/-Ade/-His/-Leu/-Trpfour-deficient culture solution containing 400 ng/ml of AbA (purchased from Beijing Liuhetong Economic and Trade Co., Ltd, catalogue no. 630322, containing 50 ng/ml of kanamycin) for culturation and incubated at 30° C. on a shaker at 240 rpm for 2 days to obtain the treatment library pGBKT7-FT1a+libraryT.
2. High-Throughput Sequencing
The plasmids extracted from the above control library and treatment library were amplified at low cycle counts using the universal primers of the pGADT7-Rec library plasmid (pre primer: TTAATACGACTCACTATAGGGCGA; post primer: AGATGGTGCACGATGCACAGTT) as PCR primers, and the PCR products were subjected to electrophoresis and high throughput sequencing after two rounds of PCR. The template of the second round was the low-cycle count amplification product of the first round.
The results were as follows:
It could be seen that the yeast plasmids of the control library and the treatment library showed diffuse bands after low-cycle count PCR amplification (
The diffuse band of the above second round PCR product was recovered by gel and sent to the company for high-throughput sequencing, and the detection level of genes in the control library and the treatment library were compared, and a total of 37 candidate proteins interacting with GmFT1a were obtained.
Table 1 showed the sequencing results of the control library and the treatment library, wherein BC02 was the control library pGBKT7-FT1a+libraryC; BC04 was the treatment library pGBKT7-FT1a+libraryT; BC03 was the control library pGBKT7-FT2a+libraryC; BC05 was the treatment library pGBKT7-FT2a+libraryT;
The specific screening results of pGBKT7-FT1a+libraryT and pGBKT7-FT1a+libraryC were shown in Table 2 below:
In the above table, +indicated the signal strength of the gene, and the more +, the stronger the signal.
It could be seen that the liquid yeast one- and two-hybrid high-throughput library screening technology had screened candidate proteins that interacted with GmFT1a.
The gene sequence number of GmLOG with the candidate gene number Glyma. 13 g140900 screened in the above Table 2 (https://www.soybase.org/sitemap.php) was cloned and its interoperability with GmFT1a was verified by yeast conversion experiments (validation of interactions in yeast according to the Matchmaker® Gold Yeast Two-Hybrid System) and bimolecular fluorescence complementation experiment (Yuan M,Xu Chunjue.2018.Tobacco Systems BiFC.Bio-101: e1010133).
The results of yeast conversion verification were shown in
The results of bimolecular fluorescence complementation experiment were shown in
GmLOG belonged to the LOG gene family and encoded 5′-ribose monophosphate hydrolase, which directly converted the precursor of cytokinin into cytokinin with physiological activity, and played an important role in the synthesis pathway of cytokinin. This showed that the liquid yeast one- and two-hybrid high-throughput library screening technology of the present invention was indeed feasible, and could screen positive interacting proteins in vitro interactions.
The reagents used in this example were as follows:
The tested variety: the soybean variety used to construct the soybean yeast library was the photoperiod-sensitive variety Zigong Dongdou, which was planted in a light incubator with 12 h light/12 h dark treatment at a temperature of 25° C. and a humidity of 65%.
Preparation of AbA (AureobasidinA) aureobasidinA mother solution: 1 mg of AureobasidinAAbA (AureobasidinA) (purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630466) was dissolved in 2 mL of methanol solution to a final concentration of 500 μg/mL, the working concentration was 0.1-0.5 μg/mL.
AbA was a reporter in the Matchmaker Gold yeast system, which can effectively screen positive clones.
Preparation of X-α-gal mother solution: 100 mg of chromogenic substrate X-α-gal (purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630462) was dissolved in 5 mL of dimethyl sulfoxide solvent to a final concentration of 20 mg/mL, the working concentration was 40 μg/mL.
X-α-Gal was a chromogenic substrate of yeast galactosidase (MEL1), which can directly detect GAL4-based yeast two-hybrid interaction on agar, and the yeast clones with positive interaction were blue.
Preparation of 0.9% NaCl: 0.9 g of NaCl was weighed, dissolved in 100 mL of distilled water and filtered through a 0.2 μm filter membrane to obtain 0.9% NaCl.
The details were as follows:
The soybean flowering key factor GmFT2a was used as the bait protein, the protein interacting with GmFT2a was obtained by screening according to the liquid yeast one- and two-hybrid high-throughput library screening technology.
I. Construction of Yeast Library Screening
1. Acquisition of Yeast Library
When the three compound leaves of Zigong Dongdou were fully expanded, the soybean leaf tissue was taken for RNA extraction, Then the library was constructed according to the kit instructions of “Make Your Own Mate & Plate Library System”, and the initial yeast library was obtained by using the pGADT7-Rec plasmid and Y187 yeast strain in the kit.
2. Construction of Yeast Library
1). Acquisition of the Bait Plasmid Expressing GmFT2a and the Bait Strain
the CDS sequence (sequence 2) of GmFT2a was constructed between the EcoRI and BamHI digestion sites of the pGBKT7 vector to obtain the pGBKT7-FT2a bait plasmid.
The pGBKT7-FT2a bait plasmid was transferred into Y2HGold yeast competent cells (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd, catalogue no. ZC1602) according to the kit instructions of Yeastmaker™ Yeast Transformation System 2, coated onto SD/-Trp plates and inverted culture at 30° C. for 3 days to obtain the bait strain Y2HGold/pGBKT7-FT2a.
2). Screening of the Bait Inhibitor Concentration
The self-activation detection of bait strain Y2HGold/pGBKT7-FT2a by different concentrations of AbA inhibitors:
Colonies of 2-3 mm in diameter were picked from the SD/-Trp culture plates of the bait strain Y2HGold/pGBKT7-FT2a obtained from 1), dissolved in 100 μL of 0.9% NaCl solution, and then 100 μL of the above solution was diluted at 1/10, 1/100, 1/1000 and coated onto nutrient-deficient plates SD/-Trp (SDO), SD/-Trp/X-α-Gal(SDO/X) and SD/-Trp/X-α-Gal/AbA (SDO/X/A)plates containing different concentrations of AbA (AureobasidinA) (AbA concentrations were set to 200 ng/mL, 300 ng/ml, 400 ng/mL and 500 ng/ml respectively) respectively. The results were observed after 3 days of inverted culture at 30° C.
The results were shown in
3). Concentration of Bait Strain
A large (2-3 mm) colony was picked from the SD/-Trp culture plate of the bait strain Y2HGold/pGBKT7-FT2a obtained from 1) and inoculated into 50 mL SD/-Trp liquid medium respectively, incubated at 30° C. with shaking (250-270 rpm) until OD600 reached 0.8 (16-20 h).
After centrifugation, the yeast cells were precipitated (1000 g, 5 min), the supernatant was discarded, and 4-5 mL SD/-Trp liquid culture solution was added to re-suspend the precipitate until the cell density>1×108/mL (cells could be counted by a blood cell counter), and the concentrated bait strain Y2HGold/pGBKT7-FT2a bacteria solution was obtained.
4) Mating and Fusion
One part (1 mL) of the initial yeast library obtained from 1) above was mixed with 5 ml of the concentrated bait strain Y2HGold/pGBKT7-FT2a bacteria solution (cell density of 1.14×109/mL) obtained from 3) above, and placed in a sterile 2 L flask. 45 mL of 2× YPDA liquid culture solution was added (purchased from Beijing Liuhetong Economic and Trade Co., Ltd, catalogue no. 630306, containing 50 ng/mL kanamycin) to the 2 L flask, the 2 mL centrifuge tube containing the initial yeast library was rinsed twice with 1 mL of 2× YPDA and the rinse solution was added to the 2 L flask.
Incubated at 30° C., 30-50 rpm for 20-24 hours until yeast zygotes appeared to obtain yeast mating products;
That is, the yeast mating product of the initial yeast library and the bait strain Y2HGold/pGBKT7-FT2a was obtained.
The lowest possible shaking speed was used in the above incubation steps to prevent cell sedimentation at the bottom of the flask; vigorous shaking may reduce mating efficiency, but too slow shaking would lead to cell sedimentation and reduce mating efficiency.
The above yeast mating products were transferred to 50 mL SD/-Trp/-Leu two-deficient culture solution (purchased from Beijing Liuhetong Economic and Trade Co., Ltd., catalog number 630316, containing 50 ng/mL kanamycin) and incubated at 30° C. on a shaker at 240 rpm for 2 days, the yeast library to be screened pGBKT7-FT2a+library containing the bait protein GmFT2a was obtained.
II. Identification of Proteins that Interact with the Bait Protein GmFT1a in a Liquid Yeast Two-Hybrid High-Throughput Screening
1. Control Library and Treatment Library
Control library: the yeast library to be screened pGBKT7-FT2a+library containing the bait protein GmFT2a obtained in the above “step 1” was centrifuged and enriched, resuspended in 10 mL 0.9% NaCl, and 5 mL was added to 45 mL SD/-Trp/-Leu two-deficient culture solution (containing 50 ng/ml kanamycin) for culturation and incubated at 30° C. on a shaker at 240 rpm for 2 days to obtain the control library pGBKT7-FT2a+libraryC.
Treatment library: From the enriched resuspension of the above yeast library to be screened pGBKT7-FT2a+library, the remaining 5 mL was added to 45 mL of SD/-Ade/-His/-Leu/-Trp four-deficient culture solution containing 400 ng/ml of AbA (containing 50 ng/ml of kanamycin) for culture and incubated at 30° C. on a shaker at 240 rpm for 2 days to obtain the treatment library pGBKT7-FT2a+libraryT.
2. High-Throughput Sequencing
The sequences from the above control library and treatment library were amplified at low cycle counts using the universal primers of the pGADT7-Rec library plasmid (pre primer: TTAATACGACTCACTATAGGGCGA(sequence 3); post primer: AGATGGTGCACGATGCACAGTT(sequence 4)) as primers, and the PCR products were subjected to electrophoresis and high throughput sequencing after two rounds of PCR.
The results were as follows:
It could be seen that, as with the results of the pGBKT7-FT1a group, the two-deficient and four-deficient cultures of pGBKT7-FT2a showed diffuse bands after low cycle count PCR amplification (
The diffuse band of the above secondary amplification was recovered by gel and sent to the company for high-throughput sequencing, and the detection level of genes in the control library and the treatment library were compared, and a total of 25 candidate proteins interacting with GmFT2a were obtained (table 3).
The specific screening results of pGBKT7-FT2a+libraryT and pGBKT7-FT2a+libraryC were shown in Table 3 below:
In the above table, +indicated the signal strength of the gene, and the more +, the stronger the signal.
It could be seen that the protein GmFBA1 (Glyma.04G008300) protein (https://www.soybase.org/sitemap.php) interacting with GmFT2a was screened by liquid yeast one- and two-hybrid high-throughput library screening technology.
Comparative example: due to the self-activation of GmFT2a, the mutant protein GmFT2a-mutant of GmFT2a (the nucleic acid-encoded protein obtained by removing the 219-240th nucleotide sequence of GmFT2a) was obtained by removing its activation domain. GmFBA2 (Glyma.12 g037400) protein was screened by Matchmaker® Gold Yeast Two-Hybrid System yeast two-hybrid system to interact with GmFT2a-mutant(
After sequence comparison, the method of the present invention screened GmFBA1 (Glyma. 04G008300) under the background of GmFT2a as the bait, which was the homologous gene of GmFBA2. Compared with the GmFBA2(Glyma.12 g037400) screened by the method of the comparative example, the similarity between the two was very high, the sequence comparison was shown in
And the results of BiFC experiments showed that there was indeed an interaction between GmFT2a-mutant and GmFBA2 (
This showed that in the case of self-activation of GmFT2a, the protein that interacted with it could still be screened by the liquid improvement method. It was further inferred that this method could avoid the problems caused by self-activation to a certain extent, and provided new ideas for the study of protein interaction, and was expected to expand the research scope of protein interaction in the future.
On the basis of the traditional yeast hybridization system, the present invention changes the screening of solid medium to liquid culture solution screening, avoiding a large number of plate coating work, and avoiding the tedious work of identifying single colonies one by one, which not only saves experiment time, but also reduces the cost and workload; at the same time, the present invention also combines high-throughput sequencing technology to improve the analysis throughput of yeast hybridization screening work, and can also improve the automation level of analysis, and can greatly reduce false negatives. More importantly, the present invention can solve the phenomenon of protein self-activation. By changing to liquid screening, known protein interaction information can be successfully obtained, which provides a new opportunity for protein-protein interaction research. In the future, this method can find more protein-protein interactions that have not been found before due to self-activation, which provides a new opportunity for the innovation of protein-protein interaction, DNA-protein interaction and other related research methods.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202110290570.9 | Mar 2021 | CN | national |
The present application is a U.S. National Phase of International Application Number PCT/CN2022/074316 filed Jan. 27, 2022, which claims priority to Chinese Application Number 202110290570.9 filed Mar. 18, 2021.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2022/074316 | 1/27/2022 | WO |
