Patent Application
20230235396
The present application claims the priority of the Chinese application with the application number of 202210098021.6 applied on 2022-01-26, and all the recorded contents serve as a part of the present invention
The contents of the electronic sequence listing (2023-01-19-SequenceListing.xml; Size: 165,952 bytes; and Date of Creation: Jan. 9, 2023) is herein incorporated by reference in its entirety.
The present invention relates to the field of biomedicine, in particular to a mass spectrometry-based method and kit for erythrocyte blood group genotyping.
Blood transfusion has a wide range of application in the medical field and is one of the effective life-saving support measures. However, currently, 43 blood group systems and more than 350 blood group antigens have been reported for erythrocytes, but in China, only D antigens of ABO blood group and Rh blood group systems are routinely detected before erythrocyte transfusion. Therefore, if there are incompatible blood group antigens between blood transfusion donors and recipients, it is possible to produce antibodies through iso-immunization, and re-transfusion of incompatible erythrocyte products may cause hemolytic transfusion reaction, etc., and may endanger life in severe cases. Especially for patients who need long-term erythrocyte transfusion, the probability of producing single or various antibodies is further increased, and it is difficult to find compatible blood products. According to statistics, the probability of erythrocyte sensitization caused by single transfusion is about 3%, and this number may be as high as 60% in patients with long-term blood transfusion. From 2013 to 2017, 17% of blood transfusion deaths reported by the US FDA were caused by iso-immunization-induced hemolytic transfusion reaction. In addition, erythrocyte antibodies produced by immunization are also associated with diseases such as hemolytic disease of the newborn. Therefore, clinically significant comprehensive identification of erythrocyte blood group antigens for blood transfusion patients, blood donors, pregnant and lying-in women, etc. is an effective way to solve the problem of difficult blood groups and to improve the efficacy of blood transfusion. Through rapid and high-throughput blood group screening and identification, rare blood group donors can also be screened and reserved in advance to deal with emergencies, etc.
At present, serological methods are routinely used in identification of erythrocyte blood group antigens in China. However, commercial serological detection reagents are not available for most blood group antigens, or the reagents are too expensive to routinely perform serological detection. Therefore, genotyping methods complement and replace the serological methods. Current erythrocyte blood group antigen genotyping kits in China are mainly based on low-throughput technologies, such as PCR-SSP. Some laboratories also use self-built methods for detection, such as PCR-RFLP, sequencing, etc. Internationally, there have been some blood group genotyping products based on medium and high-throughput technologies, such as gene chip technology, suspension array technology, mass spectrometry technology and so on. However, existing medium and high-throughput blood group genotyping products are mainly aimed at Caucasian populations and blacks, etc., and are not suitable for Chinese population due to differences in genetic backgrounds of different populations. At present, in China, there is still a large gap in medium and high-throughput methods and kits for blood group genotyping with independent intellectual property rights. Therefore, in order to improve the accuracy and breadth of blood group antigen genetic diagnosis and improve the detection throughput, it is necessary to develop a high-throughput blood group genotyping method suitable for the Chinese population. A nucleic acid mass spectrometry technology has the characteristics of being accurate, rapid and capable of detecting common mutation types such as SNP and In/Del, and is suitable for genotyping of blood group antigens.
CN110079590A provides a detection method for genotyping of rare erythrocyte antigens, but it can only detect 29 SNP sites, and does not specify blood group antigens, genotypes and phenotypes corresponding to the detected sites, so blood group genotyping that can be used for clinical practice cannot be proved. Blood group genotypes of erythrocytes are very complex. There are many blood groups in different site combinations of different antigens. The same blood group also has multiple genotypes. Therefore, it is necessary to detect more sites simultaneously in order to achieve higher-throughput blood group screening and identification, and it is urgent to find detection methods and products that can detect more erythrocyte blood groups simultaneously.
For the problems in the prior art, the present invention provides a mass spectrometry-based method and kit for erythrocyte blood group genotyping. By designing primer combinations and improving amplification reaction conditions, 61 blood group genetic sites in 21 erythrocyte blood group systems can be simultaneously detected in one reaction, rapid typing of the 21 erythrocyte blood group systems can be realized, and identified phenotypes are all clinically significant erythrocyte antigen phenotypes. The present invention has the characteristics of high sensitivity, strong specificity, simple operation, and rapid and high throughput. The present invention can be applied to difficult blood group identification, blood matching, rare blood group screening, scientific research, routine business development and the like in clinical practice.
Blood group genotypes of erythrocytes are very complex. There are many blood groups in different site combinations of different antigens. The same blood group also has multiple genotypes. Therefore, it is necessary to detect more sites simultaneously in order to achieve higher-throughput blood group screening and identification. However, the more sites are detected simultaneously, the low conversion rate of PCR multiplex reaction is likely to occur. Moreover, due to the problems that genes of erythrocyte antigens have genes with very high homology and sequences where some SNP sites are located are rich in GC, etc., and genes where some SNP sites are located have highly homologous sequences, resulting in that when the SNP sites of these genes are detected simultaneously based on mass spectrometry, the situations are prone to occurring that some sites do not have peaks and are not detected, or it is easy to amplify to homologous sequences to generate erroneous results, etc., and there is a problem that it is difficult to detect all sites one time. In the present invention, by screening a large number of primer combinations and adjusting reaction conditions, simultaneous detection of 61 blood group genetic sites in 21 erythrocyte blood group systems can be finally realized, so that rapid typing of the 21 erythrocyte blood group systems can be realized. Moreover, the present invention has high specificity and sensitivity, and rapid and high throughput.
On the one hand, the present invention provides a primer combination for erythrocyte blood group genotyping, including amplification primers and extension primers. The amplification primers include forward primers and reverse primers, and sequences of amplification primer combinations are shown in Table 1. All these amplification primers can be placed in one amplification tube to expand a target gene one time, and a difference of SNP sites can be distinguished one time. The sites distinguished are 61 different SNP sites.
Homo sapiens truncated
Further, the above primer combination is characterized in that sequences of extension primer combinations are shown in Table 2.
Blood group genotype and phenotype information of the 61 blood group genetic sites of the present invention are shown in Table 3 and Table 4, wherein for sequences in Table 4, sequences in parentheses are polymorphic sites.
Homo sapiens
GGACCTGCTGGACCTGCTGGACCTGCTGGAACA]G
AACCGCGTGCCCTGG/-]CTCTTCTTGTTCCACACGTG
CTGTGTC/-]CAGCACAGAAGAGGCCTCACGCTGCCGC
On another hand, the present invention provides a kit for genotyping, including primer combinations shown in Table 1 and Table 2.
On yet another hand, the present invention provides a mass spectrometry chip for genotyping, including primer combinations shown in Table 1 and Table 2.
On yet another hand, the present invention provides a method for genotyping by mass spectrometry detection, including the following steps:
(1) by using an amplification primer mix in primer combinations as claimed in claim 1, amplifying genes to be detected by multiplex PCR;
(2) purifying an amplification product obtained in Step (1) by an alkaline phosphatase;
(3) by using an extension primer mix in the primer combinations as claimed in claim 1, extending and amplifying a purified product in Step (2) by a single base; and
(4) conducting sample application on a single-base extended product obtained in Step (3) onto a chip for mass spectrometry detection.
Further, during multiplex PCR reaction in Step (1), a concentration of the amplification primer mix used is 0.04 to 0.4 μM (final concentration).
Further, during multiplex PCR reaction in Step (1), an amplification reaction system used is shown in Table 5.
Further, during multiplex PCR reaction in Step (1), cycle conditions of amplification reaction are as follows: 95° C., 2 minutes; 45 cycles: 95° C., 30 seconds, 56° C., 30 seconds, 72° C., 60 seconds, 72° C., 5 minutes; keeping a temperature of 4° C.
Further, the alkaline phosphatase in Step (2) is a shrimp alkaline phosphatase, and a premixed solution system for purification treatment with the alkaline phosphatase in Step (2) is shown in
Further, a single-base extension and amplification system in Step (3) is shown in Table 7.
On yet another hand, the present invention provides the primer combinations shown in Table 1 and Table 2 or the above kit or the above mass spectrometry chip for use in simultaneous detection of genotyping detection of 61 SNP sites of erythrocyte blood groups.
A mass spectrometry-based method and kit for erythrocyte blood group genotyping provided by the present invention have the following beneficial effects.
1. 61 Blood group genetic sites in 21 erythrocyte blood group systems can be simultaneously detected in two reactions.
2. Rapid typing of the 21 erythrocyte blood group systems is realized, and identified phenotypes are all clinically significant erythrocyte antigen phenotypes.
3. High sensitivity, strong specificity, simple operation, and rapid and high throughput are realized.
4. The present invention can be applied to difficult blood group identification, blood matching, rare blood group screening, scientific research, routine business development and the like in clinical practice.
The present invention will be further described in detail below in combination with embodiments. It should be pointed out that the following embodiments are intended to facilitate the understanding of the present invention, but do not have any limiting effect on it. Reagents used in the embodiments are all known products, and are obtained by purchasing commercially available products.
In this embodiment, 155 cases of blood gene DNAs are used for simultaneously detecting 61 blood group genetic sites in 21 erythrocyte blood group systems, so as to perform rapid blood group genotyping.
Genotyping detection of this embodiment includes the following steps.
1. Sample Preparation:
Genes (DNA) of 155 cases of blood samples are extracted, and concentrations thereof are normalized to 5 to 20 ng/μL for subsequent detection experiments.
2. Primer Design
In this embodiment, PCR amplification primers and single-base extension probes are designed for clinically significant blood group antigens, especially difficult blood groups that may appear in clinical practice in China, in combination with their genetic backgrounds in the Chinese population. Primer sequences are shown in Table 8.
3. Detection Steps
1) PCR Amplification
By using all amplification primer combinations (including forward primers and reverse primers) shown in Table 8, samples to be detected obtained in Step 1 are amplified by multiplex PCR to obtain target sequence amplification products of the samples to be detected. Reagents in Table 9 and All primers in Table 8 are placed in one amplification tube (the amplification tube may be replaced with 96-well plates, each well corresponds to one sample, the reagents in each well are the same, and the conditions are the same) for amplification, and each amplification tube corresponds to one sample. In this embodiment, there are 155 amplification tubes for simultaneous amplification.
A PCR amplification reaction system is shown in Table 9.
Cycle conditions of PCR amplification reaction are as follows: 95° C., 2 minutes; 45 cycles: 95° C., 30 seconds, 56° C., 30 seconds, 72° C., 60 seconds, 72° C., 5 minutes; keeping a temperature of 4° C.
2) Treatment with a Shrimp Alkaline Phosphatase (SAP)
After amplification, remaining dNTPs are treated by the shrimp alkaline phosphatase (SAP) to prevent interference with subsequent base extension. An SAP premixed solution system is shown in Table 10.
In Step 1), 2 μl of an SAP premixed solution is added to each amplification tube after PCR amplification, a total volume after the mixed solution is added is 7 and then SAP reaction is conducted in an amplification instrument. Reaction programs are as follows: 37° C., 40 minutes; 85° C., 5 minutes; keeping a temperature of 4° C.
3) Base Extension
By using all extension primer combinations shown in Table 8, purified products in Step 2) are amplified by single-base extension. Through this amplification, a sequence-specific single base is extended at a 3′ end of an extension probe as a molecular weight marker. A single base extension premixed solution system is shown in Table 11.
In Step 2), 2 μl of an extension premixed solution is added to each amplification tube after treatment with the shrimp alkaline phosphatase (SAP), a total volume after the mixed solution is added is 9 and then extension reaction is conducted in an amplification instrument.
Single-base extension reaction programs are as follows: 95° C., 30 seconds; (95° C., 5 seconds; (52° C., 5 seconds, 80° C., 5 seconds; 5 cycles) 40 cycles); 72° C., 3 minutes; keeping a temperature of 4° C.
4) Desalination with Resin
41 μl of HPLC water is added to each amplification tube, resin is used for sample desalination, and extension reaction products are purified.
5) Mass spectrometry detection Samples are subjected to sample application onto a chip (Manufacturer: Agena Bioscience, Model: SpectroCHiP CPM96). Molecular weight detection is performed by a mass spectrometer to determine the species of specific bases and the type of samples to be detected.
6) Result Analysis
Mass spectrometry detection is performed on the 155 cases of samples, and all sites have good results in all the samples (mass spectrometry software is rated A (Conservative) or B (Mordarate)). An obtained representative detection mass spectrogram is shown in
Embodiment 2 Exploration of detection methods of blood group C site In this embodiment, an initially designed detection target for a blood group C/c is rs676785. During preliminary verification, it is found that rs676785 cannot get detection results very well. The reason may be that there are highly homologous sequences in a DNA region where the rs676785 site is located. After incorporation into an RBC panel (erythrocyte gene combination), while mass spectrometry-based detection is performed on rs676785, the situations are prone to occurring that some sites do not have peaks and are not detected, or it is easy to amplify to homologous sequences of the DNA region where the rs676785 site is located to generate erroneous results, etc., After a lot of experimental screening, rs586178 is finally selected as a detection target.
Initial amplification and extension primers for rs676785:
rs676785 is amplified and extended by using the primers. Through mass spectrometry detection, results are shown in
Amplification and extension primers after replacement with rs586178:
rs586178 is amplified and extended by using the primers. Through mass spectrometry detection, results are shown in
It can be seen from
In this embodiment, an RBC panel is designed on the basis of detection by using the rs586178 site for the blood group C/c determined in Embodiment 2, and 62 sites are initially designed to be detected (in addition to 61 sites listed in the specification, rs75731670 is also included). Results show that after replacement with rs586178, detection of a blood group Lu(a-b-) is affected, making KLF1_19-12996560-T-TG and rs483352838 unstable peak appearance, and meanwhile, detection of an rs75731670 site is also affected. In this embodiment, concentrations of amplification primers of these three sites are adjusted (concentrations of the primers before adjustment are 0.04 to 0.4 μM (final concentration)). It is found that when a concentration of amplification primers of KLF1_19-12996560-T-TG is adjusted to 3 times its original concentration (0.04 to 0.4 μM), and a concentration of rs483352838 is adjusted to 2 times its original concentration (0.04 to 0.4 μM), detection results can be obtained. However, after a concentration of primers of rs75731670 is adjusted many times, stable detection results cannot be obtained. Therefore, the detection of rs75731670 is removed from a system, making the RBC panel become 61 sites.
Detection spectrograms of KLF1_19-12996560-T-TG before and after replacement with rs586178 are shown in
Detection spectrograms of rs483352838 before and after replacement with rs586178 are shown in
On the basis of Embodiment 3, the RBC panel continues to be optimized. In a follow-up verification process, it is found that in detection results of an rs7683365 site of a blood group S/s, two peak values of heterozygous peaks are quite different, which easily leads to misjudgment. Multiple research experiments are performed on amplification primers, and the amplification primers are then replaced with a group of more appropriate primers:
Initial amplification primers for rs7683365:
Finally replaced with:
Stable results can be obtained after replacement. Detection spectrograms are shown in
On the basis of Embodiment 4, accuracy of the system is further verified, the RBC panel continues to be designed, and it is found that detection results of an rs778387354 site of a blood group Pk+/p cannot be displayed correctly. From analysis of the detection results, it is found that extension primers of rs778387354 are prone to errors in existing RBC panels used. After multiple primer adjustments, the extension primers of rs778387354 are replaced.
Initial extension primers for rs778387354:
Finally replaced with:
Through verification, correct results can be obtained. Detection results are shown in
Embodiment 6 Detection methods and primer selection of rs483352838 site On the basis of Embodiment 5, the accuracy of the system is further verified, and the RBC panel continues to be optimized After an rs483352838 site of a blood group Lu(a-b-) is analyzed, it is found that this detection site is a region rich in GC and containing repetitive sequences, as a result, UEP extension primers targeting this site will bind to sequences other than SNP sites to be detected. Subsequently, multiple UEPs are tried to detect this site, and it is found that all primers cannot show stable results.
UEP (Extension Primer) sequences of rs483352838:
When four extension primers are respectively used for single-base extension, obtained detection spectrograms are shown in
It can be seen from
Although the present invention is disclosed above, the present invention is not limited thereto. Any person skilled in the art can make various changes and amendments without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be based on the scope defined by the claims.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202210098021.6 | Jan 2022 | CN | national |
