MESSENGER RNA COMPRISING FUNCTIONAL RNA ELEMENTS AND USES THEREOF

BACKGROUND

Administration of a synthetic and/or in vitro-generated mRNA that structurally resembles natural mRNA can result in the controlled production of therapeutic proteins or peptides via the endogenous and constitutively-active translation machinery (e.g. ribosomes) that exists within a patient's own cells. In recent years, the development and use of mRNA as a therapeutic agent has demonstrated potential for treatment of numerous diseases and for the development of novel approaches in regenerative medicine and vaccination (Stanton et al (2017) Messenger RNA as a Novel Therapeutic Approach. In: Garnder A. (eds) RNA Therapeutics. Topics in Medicinal Chemistry, vol 27 Springer, Cham; Sabnis et al. (2018) Mol Ther 26:1509-1519; Hassett et al. (2019) Mol Ther Nucleic Acids 15:P1-11).

In eukaryotic cells, the amount of expressed protein is often only weakly correlated with the amount of the corresponding mRNA that is transcribed. Instead, the level of protein expression is strongly dependent upon post-transcriptional steps, including processes that regulate mRNA stability, localization and translation. Functional RNA elements contained in an mRNA, including specific RNA sequences or RNA structural motifs that are located in the untranslated regions (e.g., the 5′ or 3′ UTRs) and/or coding regions of the mRNA, can affect its stability, translation and sequestration to certain cellular compartments.

It is recognized that the control and regulation of mRNA stability, cellular localization, and translation is an important development component in order for mRNA drugs to achieve a desired therapeutic effect. There exists a need to develop mRNAs with improved therapeutic effect.

SUMMARY OF THE INVENTION

Improving the expression level and/or activity of a therapeutic polypeptide encoded by an mRNA is a desirable outcome in the development of mRNA therapeutics. The present disclosure is based, at least in part, on the discovery of chemical and/or structural modifications that provide increased mRNA expression level and/or activity of an encoded translation product (e.g., an encoded polypeptide of interest). These include RNA elements (e.g., specific RNA sequences or RNA structural motifs) that regulate the post-transcriptional stability, localization, and/or translation of an mRNA, thereby yielding improved mRNA expression and/or activity of an encoded polypeptide of interest. Without being bound by theory, RNA elements of the disclosure are expected to increase mRNA expression level and/or activity by regulating the post-transcriptional stability of an mRNA and increasing mRNA half-life, for example, by protecting the mRNA from degradation. Additionally, in some embodiments, RNA elements of the disclosure are expected to direct localization of the mRNA to certain subcellular compartments, thus improving mRNA expression and/or activity by localizing the mRNA to regions of the cell that promote translation (e.g., by localization to membrane-associated ribosomes of the mitochondria and/or the endoplasmic reticulum) and/or regions that promote increased mRNA half-life (e.g., localization to regions with reduced exposure to endogenous exonuclease and/or endonuclease activity). While, in some embodiments, RNA elements of the disclosure yield increased mRNA expression level and/or activity by performing one or more desired translational regulatory activities that modulate (e.g., control) translation of an mRNA to produce a desired translational product, for example by promoting translation of only one open reading frame (ORF) encoding a desired polypeptide of interest.

Thus, in some aspects, the mRNAs of the disclosure comprise certain RNA elements that regulate post-transcriptional mRNA stability, localization or perform a desired translational regulatory activity, thereby resulting in increased mRNA expression level and/or activity of an encoded polypeptide. In some aspects, the RNA elements are located in the 5′ untranslated region (UTR) and/or the 3′UTR of the mRNA.

In some aspects, one or more RNA elements in the 5′UTR perform a desired translational regulatory activity that modulates (e.g., controls) the translation of an mRNA to produce a desired translational product. In some embodiments, one or more RNA elements in the 5′UTR reduces, inhibits or eliminates the failure to initiate translation of the therapeutic protein or peptide at the desired initiator codon, which otherwise may occur as a consequence of leaky scanning or other mechanisms. Leaky scanning can result in the bypass of the desired initiation codon that begins the ORF encoding a polypeptide of interest or a translation product. This bypass can further result in the initiation of polypeptide synthesis from an alternate or alternative initiation codon, and thereby promote the translation of partial, aberrant, or otherwise undesirable open reading frames within the mRNA. The negative impact caused by the failure to initiate translation of the therapeutic protein or peptide at the desired initiator codon, as a consequence of leaky scanning or other mechanisms, poses a challenge in the development of mRNA therapeutics.

In one aspect, the present disclosure is based, at least in part, on the discovery that mRNAs having a 5′UTR that comprises one or more functional RNA elements (e.g., an RNAse P stem loop derived from the RNAse P ribonucleoprotein), gives rise to initiation at a first AUG codon that begins an ORF encoding a desired polypeptide of interest. When incorporated into the 5′UTR of an mRNA, an RNAse P stem loop results in up to 85% reduction in leaky scanning relative to an mRNA lacking the RNAse P stem loop. Additionally, it was discovered that mRNA encoding a cellular enzyme having a 5′UTR comprising an RNAse P stem loop gives increased expression and activity of the encoded polypeptide relative to an mRNA lacking the RNAse P stem loop. Accordingly, the present disclosure provides mRNAs having a 5′UTR comprising an RNAse P stem loop which provides a desired translational regulatory activity and results in increased mRNA expression and activity of an encoded polypeptide of interest.

In another aspect, the present disclosure is based, at least in part, on the discovery that mRNAs having a 3′UTR that is derived from an mRNA encoding a nuclear encoded mitochondrial protein (NEMP) gives increased mRNA expression and/or activity of an encoded polypeptide relative to mRNAs that do not have such 3′UTRs both in vitro and in vivo. Without being bound by theory, it is believed that 3′UTRs derived from naturally-occurring mRNAs that encoded NEMPs, such as those described herein, comprise RNA elements that regulate the stability, localization, and translation of the mRNA. Further, and without being bound by theory, it is believed that various proteins within the cell are able to recognize these RNA elements and function to sort the mRNA to certain subcellular compartments, promote the stability of the mRNA, and/or promote the translation of the mRNA.

Surprisingly, it was discovered that delivery of a lipid nanoparticle comprising a modified mRNA encoding a cellular enzyme and comprising a heterologous 3′UTR having a nucleotide sequence that is substantially identical to the nucleotide sequence of a 3′UTR from an mRNA encoding a NEMP (e.g., a NEMP-derived 3′UTR) resulted in higher expression and activity of the encoded protein in vivo relative to an mRNA that did not comprise the 3′UTR. It was further discovered that the treatment, when administered to mice deficient in the cellular enzyme, resulted in a decrease in biomarkers that are abnormally high under conditions of enzyme-deficiency.

Additionally, it was discovered that modified mRNAs comprising a combination of a heterologous NEMP-derived 3′UTR and a 5′UTR comprising functional RNA elements (e.g., an RNAse P stem loop) resulted in increased expression level of an encoded polypeptide in vitro. The increased expression of an encoded polypeptide as a result of combining a NEMP-derived 3′UTR and a 5′UTR comprising functional RNA elements (e.g., an RNAse P stem loop) was consistent for mRNAs encoding a cellular enzyme, an intracellular protein, or a secreted protein. Furthermore, treatment with a lipid nanoparticle comprising a modified mRNA encoding a cellular enzyme and combining a NEMP-derived 3′UTR and a 5′UTR comprising functional RNA elements (e.g., an RNAse P stem loop) resulted in increased expression and enzymatic activity of the encoded cellular enzyme when administered in vivo. Without being bound by theory, it is believed that enhanced expression and activity of the encoded protein in vivo occurs due to post-transcriptional regulation of mRNA stability, localization, and/or translation efficiency resulting from chemical and/or structural modification of the mRNA.

In some aspects, the present disclosure provides a messenger RNA (mRNA), wherein the mRNA comprises: a 5′ cap, a 5′ untranslated region (UTR) comprising a structural RNA element comprising a stem-loop, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises a sequence of linked nucleotides, wherein each nucleotide comprises a nucleobase selected from the group consisting of: adenine, guanine, thymine, uracil, and cytosine, or derivatives or analogs thereof, and wherein the structural RNA element provides a translational regulatory activity selected from:

- a. increasing residence time of a 43S pre-initiation complex (PIC) or ribosome at, or proximal to, the initiation codon;
- b. increasing initiation of polypeptide synthesis at or from the initiation codon;
- c. increasing an amount of polypeptide translated from the full open reading frame;
- d. increasing fidelity of initiation codon decoding by the PIC or ribosome;
- e. inhibiting or reducing leaky scanning by the PIC or ribosome;
- f. decreasing a rate of decoding the initiation codon by the PIC or ribosome;
- g. inhibiting or reducing initiation of polypeptide synthesis at any codon within the mRNA other than the initiation codon;
- h. inhibiting or reducing the amount of polypeptide translated from any open reading frame within the mRNA other than the full open reading frame;
- i. inhibiting or reducing the production of aberrant translation products;
- j. increasing ribosomal density on the mRNA; and
- k. a combination of any of (a)-(j).

In any of the foregoing aspects, the structural RNA element comprises a nucleotide sequence of about 10-30 nucleotides, about 15-25 nucleotides, or about 20-25 nucleotides. In some aspects, the structural RNA element comprises a nucleotide sequence of about 15-25 nucleotides.

In any of the foregoing aspects, the structural RNA element comprises a nucleotide sequence of about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, or about 10 nucleotides in length.

In any of the foregoing aspects, the structural RNA element comprises a double-stranded stem comprising about 3-8 base pairs, about 4-7 base pairs, about 5-6 base pairs, or about 3, 4, 5, 6, 7, or 8 base pairs. In some aspects, the double-stranded stem comprises about 4-7 base pairs. In some aspects, the double-stranded stem comprises at least 50% G/C base pairs. In some aspects, the double-stranded stem comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C base pairs. In some aspects, the double-stranded stem comprises 30% or less A/U base pairs.

In any of the foregoing aspects, the structural RNA element comprises a stem-loop comprising a single-stranded loop of about 3-8 nucleotides, about 4-7 nucleotides, about 5-6 nucleotides, about 3, 4, 5, 6, 7, or 8 nucleotides in length. In some aspects, the single-stranded loop is about 4-7 nucleotides in length.

In any of the foregoing aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases. In some aspects, the structural RNA element comprises at least 60% G/C bases. In some aspects, the structural RNA element comprises 40% or less A/U bases.

In any of the foregoing aspects, the mRNA comprises a structural RNA element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 6. In some aspects, the mRNA comprises a structural RNA element comprising a nucleotide sequence which differs from SEQ ID NO: 6 by substitution, deletion, or insertion of 1, 2, 3, 4, or 5 nucleotides. In some aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases.

In any of the foregoing aspects, the mRNA comprises a structural RNA element that comprises a double-stranded stem of about 4-7 base pairs and a nucleotide sequence which differs from SEQ ID NO: 6 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides. In some aspects, the mRNA comprises a structural RNA element that comprises a single-stranded loop of about 4-7 bases and a nucleotide sequence which differs from SEQ ID NO: 6 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides. In some aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases.

In any of the foregoing aspects, the mRNA comprises a structural RNA element that comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 47. In some aspects, the mRNA comprises a structural RNA element that comprises a nucleotide sequence which differs from SEQ ID NO: 47 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides. In some aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases.

In any of the foregoing aspects, the mRNA comprises a structural RNA element that comprises a double-stranded stem of about 4-7 base pairs and a nucleotide sequence which differs from SEQ ID NO: 47 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides. In some aspects, the mRNA comprises a structural RNA element that comprises single-stranded loop of about 4-7 bases and a nucleotide sequence which differs from SEQ ID NO: 47 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides. In some aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases.

In any of the foregoing aspects, the mRNA comprises a structural RNA element has a deltaG (ΔG) of about −20 to −30 kcal/mol, about −20 to −25 kcal/mol, about −15 to −20 kcal/mol, about −10 to −15 kcal/mol, or about −5 to −10 kcal/mol.

In some aspects, the present disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises a sequence of 15-25 linked nucleotides, wherein each nucleotide comprises a nucleobase selected from the group consisting of: adenine, guanine, thymine, uracil, and cytosine, or derivatives or analogs thereof, and wherein the structural RNA element comprises (i) a double-stranded stem of about 4-7 base pairs comprising at least 50% G/C base pairs; (ii) a single-stranded loop of about 3-8 nucleotides; and (iii) a deltaG (ΔG) about −10 to −15 kcal/mol. In some aspects, the double-stranded stem comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C base pairs. In some aspects, the double-stranded stem comprises 30% or less A/U base pairs. In some aspects, the single-stranded loop is about 4-7 nucleotides in length. In some aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases. In some aspects, the structural RNA element comprises at least 60% G/C bases. In some aspects, the structural RNA element comprises 40% or less A/U bases.

In some aspects, the present disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises a sequence of 15-25 linked nucleotides, wherein each nucleotide comprises a nucleobase selected from the group consisting of: adenine, guanine, thymine, uracil, and cytosine, or derivatives or analogs thereof, and wherein the structural RNA element comprises (i) a double-stranded stem of about 4-7 base pairs; (ii) a single-stranded loop of about 3-8 nucleotides; (iii) a nucleotide sequence which differs from SEQ ID NO: 6 or SEQ ID NO: 47 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides; and (iv) a deltaG (ΔG) about −10 to −15 kcal/mol. In some aspects, the double-stranded stem comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C base pairs. In some aspects, the double-stranded stem comprises 30% or less A/U base pairs. In some aspects, the single-stranded loop is about 4-7 nucleotides in length. In some aspects, the structural RNA element comprises at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% G/C bases. In some aspects, the structural RNA element comprises at least 60% G/C bases. In some aspects, the structural RNA element comprises 40% or less A/U bases.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises (i) a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 6 or the nucleotide sequence of SEQ ID NO: 47.

In any of the foregoing aspects, the mRNA comprises a structural RNA element comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 6. In some aspects, the structural RNA element has a deltaG (ΔG) of about −20 to −25 kcal/mol, about −15 to −20 kcal/mol, or about −10 to −15 kcal/mol. In some aspects, the structural RNA element has a deltaG (ΔG) about −10 to −15 kcal/mol.

In any of the foregoing aspects, the mRNA comprises a structural RNA element comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 47. In some aspects, the structural RNA element has a deltaG (ΔG) of about −20 to −25 kcal/mol, about −15 to −20 kcal/mol, or about −10 to −15 kcal/mol. In some aspects, the structural RNA element has a deltaG (ΔG) about −10 to −15 kcal/mol.

In any of the foregoing aspects, the mRNA comprises a structural RNA element, wherein the structural RNA element provides a translational regulatory activity comprising increasing an amount of polypeptide translated from the full open reading frame.

In any of the foregoing aspects, the 5′ UTR comprises a Kozak-like sequence upstream of the initiation codon and the structural RNA element is located upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the 5′UTR comprises a structural RNA element that is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the structural RNA element is located about 40-45 nucleotides upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the structural RNA element is located about 10-15 nucleotides upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the structural RNA element is located about 6-10 nucleotides upstream of the Kozak-like sequence in the 5′ UTR.

In any of the foregoing aspects, the structural RNA element is located downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the structural RNA element is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 5-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the structural RNA element is located about 40-45 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the structural RNA element is located about 20-25 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the structural RNA element is located about 5-10 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR.

In any of the foregoing aspects, the mRNA comprises a Kozak-like sequence in the 5′UTR, wherein the 5′UTR comprises a GC-rich RNA element comprising a sequence of about 20-30, about 10-20, about 10-15, about 5-15, or about 3-15 nucleotides, or derivatives or analogs thereof, wherein the sequence is at least about 50% cytosine, and wherein the GC-rich RNA element is located upstream of the Kozak-like in the 5′ UTR. In some aspects, the GC-rich RNA element comprises a sequence of about 3-15, about 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides, or derivatives or analogs thereof, wherein the sequence is about 50%-60% cytosine, about 60%-70% cytosine, or about 70%-80% cytosine. In some aspects, the GC-rich RNA element comprises a sequence of cytosine and guanine. In some aspects, the GC-rich RNA element comprises a sequence of about 3-30 guanine and cytosine nucleotides, or derivatives or analogues thereof, wherein the sequence comprises a repeating GC-motif, wherein the repeating GC-motif is [CCG]_nor [GCC]_n, wherein n=1 to 10, 1-5, 3, 2 or 1. In some aspects, the sequence of the GC-rich RNA element is selected from (i) the sequence of EK1 [CCCGCC] set forth in SEQ ID NO: 3; (ii) the sequence of EK2 [GCCGCC] set forth in SEQ ID NO: 18; and (iii) the sequence of EK3 [CCGCCG] set forth in SEQ ID NO: 19. In some aspects, the sequence of the GC-rich RNA element comprises the sequence of V1 [CCCCGGCGCC] set forth in SEQ ID NO: 1. In some aspects, the sequence of the GC-rich RNA element comprises the sequence of V2 [CCCCGGC] set forth in SEQ ID NO: 2. In some aspects, the sequence of the GC-rich RNA element comprises the sequence of CG1 [GCGCCCCGCGGCGCCCCGCG] set forth in SEQ ID NO: 20. In some aspects, the sequence of the GC-rich RNA element comprises the sequence of CG2 [CCCGCCCGCCCCGCCCCGCC] set forth in SEQ ID NO: 21.

In any of the foregoing aspects, the mRNA comprises a GC-rich RNA element that is located about 20-30, about 15-20, about 10-15, about 5-10, or about 1-5 nucleotides upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the GC-rich RNA element is located about 5, about 4, about 3, about 2, or 1 nucleotide(s) upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the GC-rich RNA element is upstream of and immediately adjacent to the Kozak-like sequence in the 5′ UTR. In some aspects, the Kozak-like sequence comprises the sequence [5′-GCCACC-′3] set forth in SEQ ID NO: 17 or [5′-GCCGCC-′3] set forth in SEQ ID NO: 48.

In some aspects, the mRNA comprises a GC-rich RNA element that comprises a stable RNA secondary structure located downstream of the initiation codon. In some aspects, the stable RNA secondary structure is a hairpin or a stem-loop. In some aspects, the stable RNA secondary structure has a deltaG of about −20 to −30 kcal/mol, about −10 to −20 kcal/mol, or about −5 to −10 kcal/mol. In some aspects, the GC-rich RNA element comprises a stable RNA secondary structure selected from (i) the sequence of SL1 [CCGCGGCGCCCCGCGG] as set forth in SEQ ID NO: 24; (ii) the sequence of SL2 [GCGCGCAUAUAGCGCGC] as set forth in SEQ ID NO: 25; (iii) the sequence of SL3 [CAUGGUGGCGGCCCGCCGCCACCAUG] as set forth in SEQ ID NO: 49; (iv) the sequence of SL4 [CAUGGUGGCCCGCCGCCACCAUG] as set forth in SEQ ID NO: 50; and (v) the sequence of SL5 [CAUGGUGCCCGCCGCCACCAUG] as set forth in SEQ ID NO: 51.

In any of the foregoing aspects, an mRNA comprises a GC-rich RNA element that is located about 20-30, about 10-20, about 15-20, about 10-15, about 5-10, or about 1-5 nucleotides downstream of the initiation codon.

In any of the foregoing aspects, an mRNA comprises a C-rich RNA element that is located proximal to the 5′ cap, wherein the C-rich RNA element comprises a sequence of about 3-20 nucleotides, wherein the sequence comprises about 50-55%, 55-60%, 60-65%, 70-75%, 75-80%, 80-85%, 85-90% or 90-95%, or about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, or about 50% cytosine nucleobases or derivatives or analogs thereof.

In some aspects, the C-rich RNA element comprises a sequence of about 3-20 nucleotides, about 4-18 nucleotides, about 6-16 nucleotides, about 6-14 nucleotides, about 6-12 nucleotides, about 6-10 nucleotides, or about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides. In some aspects, the C-rich RNA element comprises a sequence of about 6-12 nucleotides, wherein the sequence comprises 70-75%, 75-80%, 80-85%, 85-90% or 90-95% cytosine nucleobases, or derivatives or analogs thereof, optionally wherein the sequence is less than about 30-25%, 25-20%, 20-15%, 15-10%, or 10-5% adenosine and/or guanosine nucleobases, or derivatives or analogs thereof.

In any of the foregoing aspects, an mRNA comprises a C-rich RNA element comprising a sequence of linked nucleotides comprising the formula: 5′-[C1]_v-[N1]_w-[N2]_x-[N3]_y-[C2]_z-3′, wherein C1 and C2 are nucleotides comprising cytidine, or a derivative or analogue thereof, wherein N1, and N2 and N3 if present, are each a nucleotide comprising a nucleobase selected from the group consisting of: adenine, guanine, thymine, uracil, and cytosine, and derivatives or analogues thereof, wherein v, w, x, y and z are integers whose value indicates the number of nucleotides comprising the C-rich RNA element, wherein v=2-15 nucleotides, wherein w=1-5 nucleotides, wherein x=0-5 nucleotides, wherein y=0-5 nucleotides, and wherein z=2-10 nucleotides. In some aspects, v=3-12 nucleotides, 5-10 nucleotides, 6-8 nucleotides, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides. In some aspects, z=2-7 nucleotides, 3-5 nucleotides, 2, 3, 4, 5, 6, or 7 nucleotides. In some aspects, w=1-3 nucleotides, 1, 2, or 3 nucleotide(s). In some aspects, x=0-3 nucleotides, 0, 1, 2, or 3 nucleotide(s). In some aspects, y=0-3 nucleotides, 0, 1, 2, or 3 nucleotide(s). In some aspects, N1 comprises adenosine, or derivative or analogue thereof; w=1 or 2; x=0, 1, 2, or 3; and y=0, 1, 2, or 3. In some aspects, N1 comprises adenosine, or derivative or analogue thereof; w=1 or 2; x=0; and y=0. In some aspects, N1 comprises uracil, or derivative or analogue thereof; w=1 or 2; N2 comprises adenosine, or derivative or analogue thereof; x=1, 2, or 3; N3 is guanosine, or derivative or analogue thereof; and y=1 or 2. In some aspects, N1 comprises uracil, or derivative or analogue thereof; w=1; N2 comprises adenosine, or derivative or analogue thereof; x=2; N3 is guanosine, or derivative or analogue thereof; and y=1.

In any of the foregoing aspects, an mRNA comprises a 5′UTR comprising a C-rich RNA element comprising the formula 5′-[C1]_v-[N1]_w-[N2]_x-[N3]_y-[C2]_z-3′, wherein C1 and C2 are nucleotides comprising cytidine, or a derivative or analogue thereof, wherein N1, and N2 and N3 if present, are each a nucleotide comprising a nucleobase selected from the group consisting of: adenine, guanine, and uracil, and derivatives or analogues thereof, wherein v, w, x, y and z are integers whose value indicates the number of nucleotides comprising the C-rich RNA element, wherein v=4-10 nucleotides, wherein w=1-3 nucleotides, wherein x=0-3 nucleotides, wherein y=0-3 nucleotides, and wherein z=2-6 nucleotides. In some aspects, v=6-8 nucleotides, 6, 7, or 8 nucleotides. In some aspects, z=2-5 nucleotides, 2, 3, 4, or 5 nucleotides. In some aspects, w=1 or 2 nucleotide(s). In some aspects, x=0, 1 or 2 nucleotide(s). In some aspects, y=0 or 1 nucleotide(s). In some aspects, N1 comprises adenosine, or derivative or analogue thereof; w=1; x=0; and y=0. In some aspects, N1 comprises adenosine, or derivative or analogue thereof; w=2; x=0; and y=0. In some aspects, N1 comprises uracil, or derivative or analogue thereof; w=1 or 2; N2 comprises adenosine, or derivative or analogue thereof; x=1, 2, or 3; N3 is guanosine, or derivative or analogue thereof; and y=1 or 2. In some aspects, N1 comprises uracil, or derivative or analogue thereof; w=1; N2 comprises adenosine, or derivative or analogue thereof; x=2; N3 is guanosine, or derivative or analogue thereof; and y=1. In some aspects, wherein v=6-8; N1 comprises adenosine, or derivative or analogue thereof; w=1 or 2; x=0; y=0; and z=2-5. In some aspects, wherein v=6-8; N1 comprises uracil, or derivative or analogue thereof; w=1; N2 comprises adenosine, or derivative or analogue thereof; x=2; N3 is guanosine, or derivative or analogue thereof; y=1; and z=2-5.

In any of the foregoing aspects, the C-rich RNA element comprises the nucleotide sequence [5′-CCCCCCCCAACC-3′] set forth in SEQ ID NO 30 or comprises the nucleotide sequence [5′-CCCCCCCAACCC-3′] set forth in SEQ ID NO: 29.

In any of the foregoing aspects, the C-rich RNA element comprises the nucleotide sequence [5′-CCCCCCACCCCC-3′] set forth in SEQ ID NO: 31.

In any of the foregoing aspects, the C-rich RNA element comprises the nucleotide sequence [5′-CCCCCCUAAGCC-3′] set forth in SEQ ID NO: 32.

In any of the foregoing aspects, the C-rich RNA element comprises the nucleotide sequence [5′-CCCCACAACC-3′] set forth in SEQ ID NO: 33, or the nucleotide sequence [5′-CCCCCACAACC-3′] set forth in SEQ ID NO: 34.

In any of the foregoing aspects, the mRNA comprises a C-rich RNA element that is located about 40-50, about 30-40, about 20-30, about 10-20 or about 5-10 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 15-20, about 10-15, about 5-10 nucleotides, about 1-5 nucleotides, or about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 5-10 nucleotides downstream of the 5′ cap or 5′end of the mRNA in the 5′ UTR.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 5′UTR comprises: (i) a structural RNA element comprising a stem loop comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 6 or the nucleotide sequence of SEQ ID NO: 47; and (ii) a GC-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 49, SEQ ID NO: 50 and SEQ ID NO: 51.

In any of the foregoing aspects, the structural RNA element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 6. In some aspects, the structural RNA element has a deltaG (ΔG) of about −20 to −25 kcal/mol, about −15 to −20 kcal/mol, or about −10 to −15 kcal/mol. In some aspects, the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 6.

In any of the foregoing aspects, the structural RNA element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 47. In some aspects, the structural RNA element has a deltaG (ΔG) of about −20 to −25 kcal/mol, about −15 to −20 kcal/mol, or about −10 to −15 kcal/mol. In some aspects, the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 47.

In any of the foregoing aspects, the mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 5′UTR comprises: (i) a structural RNA element comprising a stem loop comprising a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 6 or the nucleotide sequence of SEQ ID NO: 47; and (ii) a GC-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 23. In some aspects, the GC-rich RNA element comprises the nucleotide sequence of SEQ ID NO: 1.

In any of the foregoing aspects, the mRNA comprises a Kozak-like sequence, and wherein the GC-rich RNA element is located about 1-20 nucleotides upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the GC-rich RNA element is located about 5, about 4, about 3, about 2, or 1 nucleotide upstream of the Kozak-like sequence in the 5′ UTR. In some aspects, the GC-rich RNA element is upstream of and immediately adjacent to the Kozak-like sequence in the 5′ UTR.

In any of the foregoing aspects, the mRNA comprises a structural RNA element that is upstream of the GC-rich RNA element in the 5′UTR. In some aspects, the structural RNA element is about 1-5, 5-10, 10-20, 20-30, 30-40, or 40-50 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the GC-rich RNA element in the 5′UTR. In some aspects, the structural RNA element is 1-5 nucleotides upstream of the GC-rich RNA element in the 5′UTR. In some aspects, the structural RNA element is 10-20 nucleotides upstream of the GC-rich RNA element in the 5′UTR. In some aspects, the structural RNA element is 30-40 nucleotides upstream of the GC-rich RNA element in the 5′UTR. In some aspects, the structural RNA element is upstream of and immediately adjacent to the GC-rich RNA element in the 5′UTR.

In any of the foregoing aspects, the mRNA comprises the Kozak-like sequence comprises the nucleotide sequence [5′-GCCACC-3′] set forth in SEQ ID NO: 17 or the nucleotide sequence [5′-GCCGCC-3′] set forth in SEQ ID NO: 48.

In any of the foregoing aspects, the mRNA comprises a 5′UTR wherein the 5′UTR comprises a C-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34. In some aspects, the C-rich RNA element is proximal to the 5′ cap or 5′ end of the mRNA and upstream of each of the structural RNA element and the GC-rich RNA element in the 5′UTR. In some aspects, the C-rich RNA element is about 1-5, 5-10, 10-20, 20-30, 30-40, or 40-50 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the structural RNA element in the 5′UTR. In some aspects, the C-rich RNA element is 20-30 nucleotides upstream of the structural RNA element in the 5′UTR. In some aspects, the C-rich RNA element is 30-40 nucleotides upstream of the structural RNA element in the 5′UTR. In some aspects, the C-rich RNA element is 40-50 nucleotides upstream of the structural RNA element in the 5′UTR. In some aspects, the C-rich RNA element is located downstream of the 5′ cap or 5′ end of the mRNA and upstream of each of the structural RNA element and the GC-rich RNA element in the 5′UTR. In some aspects, the C-rich RNA element is located about 20-25, about 15-20, about 10-15, about 5-10 nucleotides, about 1-10, about 1-8, about 1-6, or about 1-3 nucleotide(s), or about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 1-10 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 5-10 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 1-6 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR.

In any of the foregoing aspects, the mRNA comprises a 5′UTR wherein the 5′UTR comprises a C-rich RNA element, wherein the C-rich RNA element is downstream of immediately adjacent to a transcription start site element and upstream of each of the structural RNA element and the GC-rich RNA element in the 5′UTR. In some aspects, the transcription start site element comprises the nucleotide sequence [5′-GGGAAA-3′] set forth in SEQ ID NO: 53 or the nucleotide sequence [5′-AGGAAA-3′] set forth in SEQ ID NO: 54.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprising a 5′ cap, a 5′ UTR comprising a Kozak-like sequence upstream of an initiation codon, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises from 5′ to 3′: (i) a C-rich RNA element located proximal to the 5′ cap, wherein the C-rich RNA element comprises a nucleotide sequence selected from selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33; (ii) a structural RNA element comprising a stem loop located downstream of the C-rich RNA element, wherein the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 6 or the nucleotide sequence of SEQ ID NO: 47; and (iii) a GC-rich RNA element located downstream of the structural RNA element and proximal to the Kozak-like sequence, wherein the GC-rich RNA element comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 23.

In any of the foregoing aspects, the mRNA comprises a 5′ cap, a 5′ UTR comprising a Kozak-like sequence upstream of an initiation codon, an ORF encoding a polypeptide, and a 3′ UTR, wherein (i) the C-rich RNA element comprises the nucleotide sequence set forth in SEQ ID NO: 31; (ii) the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 6; and (iii) the GC-rich RNA element comprises the nucleotide sequence set forth in SEQ ID NO: 1.

In any of the foregoing aspects, the mRNA comprises a 5′ cap, a 5′ UTR comprising a Kozak-like sequence upstream of an initiation codon, an ORF encoding a polypeptide, and a 3′ UTR, wherein (i) the C-rich RNA element comprises the nucleotide sequence set forth in SEQ ID NO: 33; (ii) the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 6; and (iii) the GC-rich RNA element comprises the nucleotide sequence set forth in SEQ ID NO: 1.

In any of the foregoing aspects, the mRNA comprises a 5′ cap, a 5′ UTR comprising a Kozak-like sequence upstream of an initiation codon, an ORF encoding a polypeptide, and a 3′ UTR, wherein (i) the C-rich RNA element comprises the nucleotide sequence set forth in SEQ ID NO: 32; (ii) the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 6; and (iii) the GC-rich RNA element comprises the nucleotide sequence set forth in SEQ ID NO: 23.

In any of the foregoing aspects, the C-rich RNA element is located about 10-15, about 5-10 nucleotides, about 1-10, about 1-8, about 1-6, or about 1-3 nucleotide(s), or about 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 1-10 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 5-10 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is located about 1-6 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some aspects, the C-rich RNA element is downstream of immediately adjacent to a transcription start site element, wherein the transcription start site element comprises the nucleotide sequence [5′-GGGAAA-3′] set forth in SEQ ID NO: 53 or the nucleotide sequence [5′-AGGAAA-3′] set forth in SEQ ID NO: 54.

In any of the foregoing aspects, the mRNA comprises a structural RNA element, wherein the structural RNA element is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 5-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the C-rich RNA element in the 5′ UTR. In some aspects, the structural RNA element is located about 40-45 nucleotides downstream of the C-rich RNA element in the 5′ UTR. In some aspects, the structural RNA element is located about 35-40 nucleotides downstream of the C-rich RNA element in the 5′ UTR. In some aspects, the structural RNA element is located about 30-35 nucleotides downstream of the C-rich RNA element in the 5′ UTR.

In any of the foregoing aspects, the mRNA comprises a GC-rich RNA element, wherein the GC-rich RNA element is located about 10-15, about 5-10, or about 1-5 nucleotides downstream of the structural RNA element in the 5′ UTR. In some aspects, the GC-rich RNA element is located about 5, about 4, about 3, about 2, or 1 nucleotide downstream of the structural RNA element in the 5′ UTR. In some aspects, the GC-rich RNA element is upstream of and immediately adjacent to the Kozak-like sequence in the 5′ UTR.

In any of the foregoing aspects, an mRNA comprises a 5′UTR, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4, wherein a structural RNA element comprising a stem-loop is inserted, optionally wherein a GC-rich RNA element is inserted, optionally wherein a C-rich RNA element is inserted.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 6, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 60 comprising a GC-rich RNA element comprising the sequence CCCCGGCGCC (SEQ ID NO: 1), and wherein the structural RNA element is inserted upstream of the GC-rich RNA element in the 5′ UTR.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises a sequence of 15-25 linked nucleotides comprising at least 60% G/C bases, wherein the structural RNA element comprises (i) a double-stranded stem of about 4-7 base pairs; (ii) a single-stranded loop of about 4-7 nucleotides; (iii) a nucleotide sequence which differs from SEQ ID NO: 6 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides; and (iv) a delta G (ΔG) of about −10 to −15 kcal/mol, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 60 comprising a GC-rich RNA element comprising the sequence CCCCGGCGCC (SEQ ID NO: 1), and wherein the structural RNA element is inserted upstream of the GC-rich RNA element in the 5′ UTR.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide, and a 3′ UTR, wherein the structural RNA element comprises the nucleotide sequence of SEQ ID NO: 6, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 60 comprising a GC-rich RNA element comprising the sequence CCCCGGCGCC (SEQ ID NO: 1), and wherein the structural RNA element is inserted upstream of the GC-rich RNA element in the 5′ UTR.

In any of the foregoing aspects, the mRNA comprises a structural RNA element, wherein the structural RNA element is inserted about 1-5, 5-10, 10-20, 20-30, or 30-40 nucleotides, or about 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted 1-5 nucleotides upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted 10-20 nucleotides upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted 30-40 nucleotides upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted upstream of and immediately adjacent to the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60.

In any of the foregoing aspects, the mRNA comprises a C-rich RNA element inserted proximal to the 5′ cap of the mRNA in SEQ ID NO: 4 or SEQ ID NO: 60, wherein the C-rich RNA element comprises a nucleotide sequence selected from selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33. In some aspects, the C-rich RNA element comprises the nucleotide sequence of SEQ ID NO: 31. In some aspects, the C-rich RNA element is inserted about 1-10 nucleotides downstream of the 5′ cap in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element is inserted about 5-10 nucleotides downstream of the 5′ cap in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element is inserted about 1-6 nucleotides downstream of the 5′ cap of in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element is downstream of and immediately adjacent to a transcription start site element in the 5′UTR, wherein the transcription start site element comprises the nucleotide sequence [5′-GGGAAA-3′] in SEQ ID NO: 4 or the nucleotide sequence [5′-AGGAAA-3′] in SEQ ID NO: 60.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: (i) the nucleotide sequence of SEQ ID NO: 116, (ii)

- the nucleotide sequence of SEQ ID NO: 120, (iii) the nucleotide sequence of SEQ ID NO: 124, (iv) the nucleotide sequence of SEQ ID NO: 128, and (v) the nucleotide sequence of SEQ ID NO: 41.

In any of the foregoing aspects, an mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 3′UTR comprises a nucleotide sequence of a 3′UTR of a nuclear-encoded mitochondrially derived protein (NEMP). In some aspects, binding of the 3′UTR to one or more RNA-binding proteins promotes the stabilization, localization, and/or translation of the mRNA. In some aspects, the NEMP is selected from the group consisting of: human OXAL1, human MRPS12, and mouse Sod2. In some aspects, the nucleotide sequence of the 3′UTR is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of the NEMP 3′UTR. In some aspects, the 3′UTR differs from the nucleotide sequence of the NEMP 3′UTR by 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or about 50 or more nucleotides.

In any of the foregoing aspects, an mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′UTR of a nuclear-encoded mitochondrially derived protein (NEMP), wherein the 3′UTR is about 50-100 nucleotides, about 100-200 nucleotides, about 200-300 nucleotides, about 300-400 nucleotides, about 400-500 nucleotides, about 500-600, about 600-700 nucleotides, about 700-800 nucleotides, about 800-900 nucleotides, about 900-1000 nucleotides, about 1000-1100 nucleotides, about 1100-1200 nucleotides, about 1200-1300 nucleotides, about 1300-1400 nucleotides, or about 1400-1500 nucleotides in length.

In any of the foregoing aspects, the 3′ UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72, SEQ ID NO: 74; SEQ ID NO: 76; and SEQ ID NO: 78. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 72. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 74. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 76. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 78.

In any of the foregoing aspects, the 3′UTR differs from the NEMP 3′UTR by about 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or about 50-100 nucleotides, wherein the NEMP 3′UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72, SEQ ID NO: 74; SEQ ID NO: 76; and SEQ ID NO: 78. In some aspects, the 3′UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72, SEQ ID NO: 74; SEQ ID NO: 76; and SEQ ID NO: 78. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 72. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 74. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 76. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 78.

In any of the foregoing aspects, the 3′ UTR comprises one or more microRNA (miRNA) binding sites. In some aspects, the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding site(s). In some aspects, the 3′UTR comprises 1, 2, 3 or 4 miRNA binding sites. In some aspects, the miRNA binding site is targeted by miR-142-3p or miR-142-5p. In some aspects, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 179 or SEQ ID NO: 181. In some aspects, the miRNA binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the miRNA binding site comprises the nucleotide sequence of SEQ ID NO: 181.

In any of the foregoing aspects, an mRNA comprises a 3′UTR, wherein the 3′UTR comprises one or more stop codons at the 5′end of the 3′UTR, and wherein the 3′UTR comprises 1, 2, 3, or 4 miRNA binding sites located proximal to the one or more stop codons. In some aspects, the miRNA binding site(s) are located downstream of and immediately adjacent to the one or more stop codons at the 5′end of the 3′UTR. In some aspects, the miRNA binding sites are located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR.

In some aspects, the miRNA binding sites are located about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR.

In any of the foregoing aspects, an mRNA comprises a 3′UTR, wherein the 3′UTR comprises 1, 2, 3, or 4 miRNA binding sites located proximal to the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located upstream of and immediately adjacent to the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located about 1-5, about 6-10, about 10-15, about 15-20, about 20-25, about 25-30, about 30-35, about 35-40, about 40-45, or about 45-50 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotide(s) upstream of the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located about 1, about 2, about 3, about 4, or about 5, about 6, about 7, about 8, about 9 or about 10 nucleotide(s) upstream of the 3′end of the 3′UTR.

In any of the foregoing aspects, an mRNA comprises a 3′UTR, wherein the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, wherein an upstream miRNA binding site is located directly adjacent to one or more downstream miRNA binding site(s). In some aspects, an upstream miRNA binding site is separated from a downstream miRNA binding site by about 1-5, about 1-10, about 5-10, about 5-15, about 10-20, about 15-20, about 15-30, or about 20-30 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide(s). In some aspects, an upstream miRNA binding site is separated from a downstream miRNA binding site by about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9 or about 10 nucleotide(s).

In any of the foregoing aspects, an mRNA comprises a 3′UTR, wherein the 3′ UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 78, wherein the 3′UTR comprises 1, 2, 3, or 4 miR-142-3p binding sites, and wherein the miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the 3′end or the 3′UTR. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 170.

In any of the foregoing aspects, an mRNA comprises a 3′UTR, wherein the 3′UTR comprises one or more stop codons at the 5′end and wherein the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the one or more stop codons. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 172.

In any of the foregoing aspects, an mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′UTR, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 76, wherein the 3′UTR comprises 1, 2, 3, or 4 miR-142-3p binding sites, and wherein the miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the 3′end or the 3′UTR. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 174. In some aspects, the 3′UTR comprises one or more stop codons at the 5′end and wherein the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the one or more stop codons. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 176.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR, wherein the 3′UTR comprises a nucleotide sequence of a 3′UTR of a NEMP. In some aspects, binding of the 3′UTR to one or more RNA-binding proteins promotes the stabilization, localization, and/or translation of the mRNA. In some aspects, the NEMP is selected from the group consisting of: human OXAL1, human MRPS12, and mouse Sod2. In some aspects, the nucleotide sequence of the 3′UTR is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of the NEMP 3′UTR. In some aspects, the 3′UTR differs from the nucleotide sequence of the NEMP 3′UTR by 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or about 50 or more nucleotides. In some aspects, the 3′UTR is about 50-100 nucleotides, about 100-200 nucleotides, about 200-300 nucleotides, about 300-400 nucleotides, about 400-500 nucleotides, about 500-600, about 600-700 nucleotides, about 700-800 nucleotides, about 800-900 nucleotides, about 900-1000 nucleotides, about 1000-1100 nucleotides, about 1100-1200 nucleotides, about 1200-1300 nucleotides, about 1300-1400 nucleotides, or about 1400-1500 nucleotides in length.

In any of the foregoing aspects, the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72; SEQ ID NO: 74; SEQ ID NO: 76; and SEQ ID NO: 78. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 72. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 74. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 76. In some aspects, the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 78.

In any of the foregoing aspects, the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR, wherein the 3′UTR differs from the NEMP 3′UTR by about 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or about 50-100 nucleotides, wherein the NEMP 3′UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72; SEQ ID NO: 74; SEQ ID NO: 76; and SEQ ID NO: 78.

In any of the foregoing aspects, the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR, wherein the 3′UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72; SEQ ID NO: 74; SEQ ID NO: 76; and SEQ ID NO: 78. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 72. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 74. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 76. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 78.

In some aspects, the 3′UTR comprises 1, 2, 3 or 4 miRNA binding sites. In some aspects, the miRNA binding site is targeted by miR-142-3p or miR-142-5p. In some aspects, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 179 or SEQ ID NO: 181. In some aspects, the miRNA binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the miRNA binding site comprises the nucleotide sequence of SEQ ID NO: 181.

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′UTR comprises one or more stop codons at the 5′end of the 3′UTR, and wherein the 3′UTR comprises 1, 2, 3, or 4 miRNA binding sites located proximal to the one or more stop codons. In some aspects, the miRNA binding site(s) are located downstream of and immediately adjacent to the one or more stop codons at the 5′end of the 3′UTR. In some aspects, the miRNA binding sites are located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR. In some aspects, the miRNA binding sites are located about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR.

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′UTR comprises 1, 2, 3, or 4 miRNA binding sites located proximal to the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located upstream of and immediately adjacent to the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located about 1-5, about 6-10, about 10-15, about 15-20, about 20-25, about 25-30, about 30-35, about 35-40, about 40-45, or about 45-50 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotide(s) upstream of the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located about 1, about 2, about 3, about 4, or about 5, about 6, about 7, about 8, about 9 or about 10 nucleotide(s) upstream of the 3′end of the 3′UTR.

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, wherein an upstream miRNA binding site is located directly adjacent to one or more downstream miRNA binding site(s).

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, wherein an upstream miRNA binding site is separated from a downstream miRNA binding site by about 1-5, about 1-10, about 5-10, about 5-15, about 10-20, about 15-20, about 15-30, or about 20-30 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide(s).

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, wherein an upstream miRNA binding site is separated from a downstream miRNA binding site by about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9 or about 10 nucleotide(s).

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′ UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 78, wherein the 3′UTR comprises 1, 2, 3, or 4 miR-142-3p binding sites, and wherein the miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the 3′end or the 3′UTR. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 170. In some aspects, the 3′UTR comprises one or more stop codons at the 5′end and wherein the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the one or more stop codons. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 172.

In any of the foregoing aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′UTR, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence of a 3′UTR of a NEMP, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 76, wherein the 3′UTR comprises 1, 2, 3, or 4 miR-142-3p binding sites, and wherein the miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the 3′end or the 3′UTR. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 174. In some aspects, the 3′UTR comprises one or more stop codons at the 5′end and wherein the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the one or more stop codons. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 176.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop, wherein the structural RNA element comprises a nucleotide sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleotide sequence of SEQ ID NO: 6, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 60 comprising a GC-rich RNA element comprising the sequence CCCCGGCGCC (SEQ ID NO: 1), and wherein the structural RNA element is inserted upstream of the GC-rich RNA element in the 5′ UTR. In some aspects, the structural RNA element is inserted about 1-5, 5-10, 10-20, 20-30, or 30-40 nucleotides, or about 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising a stem-loop wherein the structural RNA element comprises a sequence of 15-25 linked nucleotides comprising at least 60% G/C bases, wherein the structural RNA element comprises (i) a double-stranded stem of about 4-7 base pairs; (ii) a single-stranded loop of about 4-7 nucleotides; (iii) a nucleotide sequence which differs from SEQ ID NO: 6 by substitution, deletion or insertion of 1, 2, 3, 4, or 5 nucleotides; and (iv) a delta G (ΔG) of about −10 to −15 kcal/mol, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 60 comprising a GC-rich RNA element comprising the sequence CCCCGGCGCC (SEQ ID NO: 1), and wherein the structural RNA element is inserted upstream of the GC-rich RNA element in the 5′ UTR. In some aspects, the structural RNA element is inserted about 1-5, 5-10, 10-20, 20-30, or 30-40 nucleotides, or about 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR comprising a structural RNA element comprising the nucleotide sequence of SEQ ID NO: 6, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the 5′ UTR comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 60 comprising a GC-rich RNA element comprising the sequence CCCCGGCGCC (SEQ ID NO: 1), and wherein the structural RNA element is inserted upstream of the GC-rich RNA element in the 5′ UTR. In some aspects, the structural RNA element is inserted about 1-5, 5-10, 10-20, 20-30, or 30-40 nucleotides, or about 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted 1-5 nucleotides upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted 10-20 nucleotides upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the structural RNA element is inserted 30-40 nucleotides upstream of the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′ UTR comprising a structural RNA element, an ORF encoding a polypeptide, and a 3′ UTR comprising a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the structural RNA element is inserted upstream of and immediately adjacent to the GC-rich RNA element in SEQ ID NO: 4 or SEQ ID NO: 60.

In any of the foregoing aspects, an mRNA comprises a 5′UTR comprising a C-rich RNA element that is inserted proximal to the 5′ cap of the mRNA in SEQ ID NO: 4 or SEQ ID NO: 60, wherein the C-rich RNA element comprises a nucleotide sequence selected from selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33. In some aspects, the C-rich RNA element comprises the nucleotide sequence of SEQ ID NO: 31. In some aspects, the C-rich RNA element is inserted about 1-10 nucleotides downstream of the 5′ cap in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element comprises the nucleotide sequence of SEQ ID NO: 31. In some aspects, the C-rich RNA element is inserted about 1-10 nucleotides downstream of the 5′ cap in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element is inserted about 5-10 nucleotides downstream of the 5′ cap in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element is inserted about 1-6 nucleotides downstream of the 5′ cap of in SEQ ID NO: 4 or SEQ ID NO: 60. In some aspects, the C-rich RNA element is downstream of and immediately adjacent to a transcription start site element in the 5′UTR, wherein the transcription start site element comprises the nucleotide sequence [5′-GGGAAA-3′] in SEQ ID NO: 4 or the nucleotide sequence [5′-AGGAAA-3′] in SEQ ID NO: 60.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116; SEQ ID NO: 120; SEQ ID NO: 124; SEQ ID NO: 41; and SEQ ID NO: 128, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 3′UTR comprises a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78. In some aspects, the 3′UTR comprises one or more microRNA (miRNA) binding sites. In some aspects, the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding site(s). In some aspects, the 3′UTR comprises 1, 2, 3 or 4 miRNA binding sites. In some aspects, the miRNA binding site is targeted by miR-142-3p or miR-142-5p. In some aspects, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 179 or SEQ ID NO: 181. In some aspects, the miRNA binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the miRNA binding site comprises the nucleotide sequence of SEQ ID NO: 181.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116; SEQ ID NO: 120; SEQ ID NO: 124; SEQ ID NO: 41; and SEQ ID NO: 128, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the 3′UTR comprises one or more stop codons at the 5′end of the 3′UTR, and wherein the 3′UTR comprises 1, 2, 3, or 4 miRNA binding sites located proximal to the one or more stop codons. In some aspects, the miRNA binding site(s) are located downstream of and immediately adjacent to the one or more stop codons at the 5′end of the 3′UTR. In some aspects, the miRNA binding sites are located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR. In some aspects, the miRNA binding sites are located about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116; SEQ ID NO: 120; SEQ ID NO: 124; SEQ ID NO: 41; and SEQ ID NO: 128, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the 3′UTR comprises 1, 2, 3, or 4 miRNA binding sites located proximal to the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located upstream of and immediately adjacent to the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located about 1-5, about 6-10, about 10-15, about 15-20, about 20-25, about 25-30, about 30-35, about 35-40, about 40-45, or about 45-50 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotide(s) upstream of the 3′end of the 3′UTR. In some aspects, the miRNA binding site(s) are located about 1, about 2, about 3, about 4, or about 5, about 6, about 7, about 8, about 9 or about 10 nucleotide(s) upstream of the 3′end of the 3′UTR.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116; SEQ ID NO: 120; SEQ ID NO: 124; SEQ ID NO: 41; and SEQ ID NO: 128, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76 or SEQ ID NO: 78, wherein the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. In some aspects, the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, wherein an upstream miRNA binding site is located directly adjacent to one or more downstream miRNA binding site(s). In some aspects, the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, wherein an upstream miRNA binding site is separated from a downstream miRNA binding site by about 1-5, about 1-10, about 5-10, about 5-15, about 10-20, about 15-20, about 15-30, or about 20-30 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide(s). In some aspects, the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites, an upstream miRNA binding site is separated from a downstream miRNA binding site by about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9 or about 10 nucleotide(s).

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116; SEQ ID NO: 120; SEQ ID NO: 124; SEQ ID NO: 41; and SEQ ID NO: 128, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 78, wherein the 3′UTR comprises 1, 2, 3, or 4 miR-142-3p binding sites, and wherein the miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the 3′end or the 3′UTR. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 170. In some aspects, the 3′UTR comprises one or more stop codons at the 5′end and wherein the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the one or more stop codons. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 172.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′ UTR, wherein the 5′ UTR comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116; SEQ ID NO: 120; SEQ ID NO: 124; SEQ ID NO: 41; and SEQ ID NO: 128, an ORF encoding a polypeptide, and a 3′UTR comprising a nucleotide sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical or 100% identical to a nucleotide sequence of SEQ ID NO: 76, wherein the 3′UTR comprises 1, 2, 3, or 4 miR-142-3p binding sites, and wherein the miR-142-3p binding site comprises the nucleotide sequence of SEQ ID NO: 179. In some aspects, the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the 3′end or the 3′UTR. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 174. In some aspects, the 3′UTR comprises one or more stop codons at the 5′end and wherein the 1, 2, 3, or 4 miR-142-3p binding sites are located proximal to the one or more stop codons. In some aspects, the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 176.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ UTR, an ORF encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR and 3′ UTR are selected from the group consisting of: the nucleotide sequence of SEQ ID NO: 120 and the nucleotide sequence of SEQ ID NO: 170; the nucleotide sequence of SEQ ID NO: 120 and the nucleotide sequence of SEQ ID NO: 172; the nucleotide sequence of SEQ ID NO: 120 and the nucleotide sequence of SEQ ID NO: 174; the nucleotide sequence of SEQ ID NO: 120 and the nucleotide sequence of SEQ ID NO: 176; the nucleotide sequence of SEQ ID NO: 41 and the nucleotide sequence of SEQ ID NO: 170; the nucleotide sequence of SEQ ID NO: 41 and the nucleotide sequence of SEQ ID NO: 172; the nucleotide sequence of SEQ ID NO: 41 and the nucleotide sequence of SEQ ID NO: 174; the nucleotide sequence of SEQ ID NO: 41 and the nucleotide sequence of SEQ ID NO: 176; the nucleotide sequence of SEQ ID NO: 128 and the nucleotide sequence of SEQ ID NO: 170; the nucleotide sequence of SEQ ID NO: 128 and the nucleotide sequence of SEQ ID NO: 172; the nucleotide sequence of SEQ ID NO: 128 and the nucleotide sequence of SEQ ID NO: 174; and the nucleotide sequence of SEQ ID NO: 128 and the nucleotide sequence of SEQ ID NO: 176. In some aspects, the 5′ UTR and 3′ UTR are selected from the group consisting of: the nucleotide sequence of SEQ ID NO: 120 and the nucleotide sequence of SEQ ID NO: 170, the nucleotide sequence of SEQ ID NO: 120 and the nucleotide sequence of SEQ ID NO: 172.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′UTR, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the mRNA comprises at least one chemically modified nucleoside. In some aspects, the at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2′-O-methyl uridine. In some aspects, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or about 100% of the nucleosides comprising the mRNA comprise the at least one chemically modified nucleoside. In some aspects, the at least one chemically modified nucleoside is N1-methylpseudouridine, and wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% of the uracil nucleotides are N1-methylpseudouridine. In some aspects, the mRNA is fully modified with N1-methylpseudouridine. In some aspects, the at least one modified nucleoside is 5-methoxyuridine. In some aspects, at least 95% of uracil nucleotides comprising the ORF comprise 5-methoxyuridine, and wherein the uracil content in the ORF is between about 100% and about 150% of the theoretical minimum. In some aspects, the mRNA is fully modified with 5-methoxyuridine.

In any of the foregoing aspects, an mRNA comprises a 5′ cap, a 5′UTR, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein an expression level and/or an activity of the polypeptide translated from the mRNA is increased relative to an mRNA that does not comprise the 5′ UTR, 3′ UTR, or a combination thereof.

In some aspects, the disclosure provides a pharmaceutical composition comprising an mRNA of the disclosure and a pharmaceutically acceptable carrier.

In some aspects, the disclosure provides a lipid nanoparticle comprising an mRNA of the disclosure. In some aspects, the lipid nanoparticle comprises an ionizable lipid, a sterol, a phospholipid, and a polyethylene glycol lipid.

In some aspects, the disclosure provides a pharmaceutical composition comprising a lipid nanoparticle comprising an mRNA of the disclosure and a pharmaceutically acceptable carrier.

In any of the foregoing aspects, a pharmaceutical composition of the disclosure or lipid nanoparticle of the disclosure is used in treating or delaying progression of a disease or disorder in a subject in need thereof.

In any of the foregoing aspects, a pharmaceutical composition of the disclosure or lipid nanoparticle of the disclosure is used in the manufacture of a medicament for treating or delaying progression of a disease or disorder in a subject in need thereof.

In some aspects, the disclosure provides a kit comprising a container comprising an mRNA of the disclosure, a pharmaceutical composition of the disclosure or lipid nanoparticle of the disclosure and a package insert comprising instructions for administration of the mRNA, the pharmaceutical composition of lipid nanoparticle, for treating or delaying progression of a disease or disorder in a subject.

In some aspects, the disclosure provides a method of treating or delaying progression of a disease or disorder in a subject in need thereof, the method comprising administering an mRNA of the disclosure, a pharmaceutical composition of the disclosure, or a lipid nanoparticle of the disclosure, thereby treating or delaying progression of the disease or disorder in the subject.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1B provide bar graphs showing the expression level (FIG. 1A) and activity (FIG. 1B) of a cellular enzyme (enzyme_A) in hepatocytes harvested from mice deficient in enzyme_A and transfected in vitro with enzyme_A-encoding mRNA constructs comprising a 5′UTR encoding an RNAse P stem loop.

FIGS. 2A-2B provides dot plots showing leaky scanning plotted against the level of mRNA expression for reporter mRNA transfected in HeLa cells (FIG. 2A) and AML12 cells (FIG. 2B). mRNAs comprised different length 5′UTRs (i.e., white points are short 5′UTRs and black points are long 5′UTRs). Those identified by name have 5′UTRs that comprised multiple RNA elements, including an RNAse P stem loop (F593, F153, RNAse P_p1, 5′v1.1).

FIGS. 3A-3B provide bar graphs showing the expression level (FIG. 3A) and activity (FIG. 3B) of a cellular enzyme (enzyme_A) in hepatocytes harvested from mice deficient in enzyme_A and transfected in vitro with enzyme_A-encoding mRNA constructs comprising a 3′UTR derived from the human MRPS12 gene (rps12 3′UTR), from the mouse Sod2 gene (sod2 3′UTR), or the human OXA1L gene (oxal 3′UTR).

FIGS. 4A-4B provide graphs showing the expression level (FIG. 4A) and activity (FIG. 4B) of a cellular enzyme (enzyme_B) in hepatocytes harvested from mice deficient in enzyme_B following treatment with enzyme_B-encoding mRNA constructs comprising varied 3′UTRs. Shown in FIG. 4B is the enzymatic activity of enzyme_B in mouse liver lysates harvested on day 15, which was 24 hours post 2^nddose of mRNA (mice were dosed on day 0 and day 14).

FIGS. 5A-5D provide graphs showing the plasma concentration of a biomarker of enzyme_B enzymatic activity (enzyme_B-BM1) in enzyme_B deficient mice following treatment with mRNA encoding enzyme_B and comprising varied 3′UTRs (3′v1.1, 3′rps12, 3′sod2). mRNA was administered on day 0 and day 14. Plasma concentration of enzyme_B-BM1 was determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in samples isolated on day 1 (FIG. 5A), day 7 (FIG. 5B), day 14 (FIG. 5C) and day 15 (FIG. 5D) post-mRNA administration. FIG. 5E provides a graph showing the mean concentration of plasma enzyme_B-BM1 for each treatment group over time, as indicated.

FIGS. 6A-6E provide graphs showing the concentration of enzyme_B-BM2 (a second biomarker of enzyme_B enzymatic activity) as determined by LC-MS/MS in plasma from mice as treated in FIGS. 5A-5E.

FIG. 7 provides a graph showing the level of luciferin expression in wild type mice measured by bioluminescence imaging (BLI) following treatment with mRNA encoding luciferin.

FIG. 8 provides a graph showing expression of erythropoietin (EPO) in wild type mice measured following treatment with mRNA encoding EPO.

FIGS. 9A-9C provide graphs showing weight loss in enzyme_A-deficient mice following treatment with enzyme_A-encoding mRNA constructs. mRNA was administered on day 0 and day 31.

FIGS. 9A-9C show percent change in body weight on days 14, 21, and 28 post-mRNA administration respectively. FIG. 9D provides a graph showing the average percent change in body weight over time.

FIGS. 10A-10C provide graphs showing the plasma concentration of a biomarker of enzyme_A activity (i.e., enzyme_A-BM2) in mice treated as in FIGS. 9A-9D. Shown in FIGS. 10A-10C is the plasma concentration of enzyme_A-BM2 on day 16, 21, and 28 respectively.

FIGS. 11A-11C provide graphs showing the amount of enzyme_A protein (FIG. 11A), enzyme_A activity (FIG. 11B), and enzyme_A-encoding mRNA (FIG. 11C) in liver lysates isolated on day 32, corresponding to 24 h after the 2^nddose from mice treated as in FIGS. 9A-9C.

FIGS. 12A-12B provides graphs showing expression level of enzyme_B (FIG. 12A) and enzyme_B activity (FIG. 12B) in liver lysates harvested from wild type mice following administration of mRNAs encoding enzyme_B.

FIG. 13A provides an image of an immunoblot prepared from liver lysates harvested from enzyme_B deficient mice following administration of mRNAs encoding enzyme_B in different lipid nanoparticle formulations with staining for enzyme_B protein and an endogenous control protein. FIG. 13B-13C provide graphs showing enzyme_B protein expression level in liver lysates harvested from enzyme_B deficient mice following administration of mRNAs encoding enzyme_B in different lipid nanoparticle formulations measured by quantitative immunoblot (FIG. 13B) and LC-MS (FIG. 13C).

FIG. 14A provides a graph showing relative enzyme_B protein expression level and activity measured in liver lysates harvested from enzyme_B deficient mice following administration of mRNAs encoding enzyme_B in different lipid nanoparticle formulations. FIG. 14B provides the activity of enzyme_B in liver lysates as in FIG. 14A, with activity provided in units of nmol/min/mg protein.

FIG. 15A-15B provides graphs showing levels of enzyme_B-BM1 in plasma (FIG. 15A) and in tissue lysates of liver, kidney and heart (FIG. 15B) collected at one day following administration of mRNA in different lipid nanoparticle formulations to enzyme_B-deficient mice.

DETAILED DESCRIPTION

Treatment with an mRNA encoding a therapeutic polypeptide of interest has numerous clinical, prophylactic, and therapeutic applications for treating or delaying progression of a disease or disorder in an individual. Improving the expression level and/or the activity of an encoded therapeutic polypeptide is desirable for use of therapeutic mRNAs in such applications. Without being bound by theory, it is believed that certain mRNA chemical and/or structural modifications that function to regulate the post-transcriptional stability, localization, and/or translation of the mRNA can yield increased expression and/or activity of an encoded polypeptide of interest.

Accordingly, the present disclosure provides mRNAs (e.g., modified mRNAs) encoding a polypeptide of interest and comprising a heterologous NEMP-derived 3′UTR, a 5′UTR comprising one or more functional RNA elements (e.g., an RNAse P stem loop), or a combination thereof that enhance protein expression and/or activity, as well as compositions (e.g., lipid nanoparticles) and methods thereof (e.g., methods for treating a mitochondrial disease). In some embodiments, the 3′UTR is derived from a naturally-occurring RNA. In some embodiments, the 3′UTR comprises a nucleotide sequence that is substantially identical (e.g., about 50%, 60%, 70%, 80%, 90% or about 100% identical) to the nucleotide sequence of a 3′UTR of an mRNA encoding a NEMP. In some embodiments, the functional RNA element comprises a nucleotide sequence that is substantially identical (e.g., about 50%, 60%, 70%, 80%, 90% or about 100% identical) to the nucleotide sequence of a stem-loop that comprises the RNA component of the nuclear RNAse P (RNAse P) ribonucleoprotein complex or the mitochondrial RNAse P (MRP) ribonucleoprotein complex.

In some embodiments, an mRNA of the disclosure comprises a 5′UTR comprising one or more functional RNA elements (e.g., an RNAse P stem-loop), optionally in combination with a NEMP-derived 3′UTR described herein. In some embodiments, the mRNAs of the disclosure comprise both a NEMP-derived 3′UTR and a 5′UTR comprising one or more functional RNA elements (e.g., an RNAse P stem-loop). In some embodiments, the mRNA of the disclosure comprises an ORF which encodes a mitochondrial-targeting sequence (MTS). In some embodiments, the mRNAs of the disclosure comprise a lipid nanoparticle.

In some embodiments, the NEMP-derived 3′UTR and/or 5′UTR comprising one or more functional RNA elements (e.g., an RNAse P stem-loop) function to regulate mRNA stability (e.g., increase mRNA half-life), to regulate mRNA cellular localization, to provide a desired translational regulatory activity, or any combination thereof. In some embodiments, the NEMP-derived 3′UTR and/or 5′UTR comprising one or more functional RNA elements (e.g., an RNAse P stem-loop) function to enhance the expression and/or activity of a polypeptide of interest encoded by the mRNA.

Polynucleotides Comprising Functional RNA Elements in the 5′UTR

The present disclosure provides synthetic polynucleotides comprising a modification (e.g., an RNA element), wherein the modification provides a desired translational regulatory activity. In some embodiments, the disclosure provides a polynucleotide comprising a 5′ untranslated region (UTR), an initiation codon, a full open reading frame encoding a polypeptide, a 3′ UTR, and at least one modification, wherein the at least one modification provides a desired translational regulatory activity, for example, a modification that promotes and/or enhances the translational fidelity of mRNA translation. In some embodiments, the disclosure provides a polynucleotide comprising a 5′cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, a 3′ UTR, and at least one modification, wherein the at least one modification provides a desired translational regulatory activity, for example, a modification that promotes and/or enhances the translational fidelity of mRNA translation.

In some embodiments, the desired translational regulatory activity is a cis-acting regulatory activity. In some embodiments, the desired translational regulatory activity is an increase in the residence time of the 43S pre-initiation complex (PIC) or ribosome at, or proximal to, the initiation codon. In some embodiments, the desired translational regulatory activity is an increase in the initiation of polypeptide synthesis at or from the initiation codon. In some embodiments, the desired translational regulatory activity is an increase in the amount of polypeptide translated from the full open reading frame. In some embodiments, the desired translational regulatory activity is an increase in the fidelity of initiation codon decoding by the PIC or ribosome. In some embodiments, the desired translational regulatory activity is inhibition or reduction of leaky scanning by the PIC or ribosome. In some embodiments, the desired translational regulatory activity is a decrease in the rate of decoding the initiation codon by the PIC or ribosome. In some embodiments, the desired translational regulatory activity is inhibition or reduction in the initiation of polypeptide synthesis at any codon within the mRNA other than the initiation codon. In some embodiments, the desired translational regulatory activity is inhibition or reduction of the amount of polypeptide translated from any open reading frame within the mRNA other than the full open reading frame. In some embodiments, the desired translational regulatory activity is inhibition or reduction in the production of aberrant translation products. In some embodiments, the desired translational regulatory activity is an increase in ribosomal density on the mRNA. In some embodiments, the desired translational regulatory activity is a combination of one or more of the foregoing translational regulatory activities.

Accordingly, the present disclosure provides a polynucleotide, e.g., an mRNA, comprising an RNA element that comprises a sequence and/or an RNA secondary structure(s) that provides a desired translational regulatory activity as described herein. In some aspects, the mRNA comprises an RNA element that comprises a sequence and/or an RNA secondary structure(s) that promotes and/or enhances the translational fidelity of mRNA translation. In some aspects, the mRNA comprises an RNA element that comprises a sequence and/or an RNA secondary structure(s) that provides a desired translational regulatory activity, such as inhibiting and/or reducing leaky scanning. In some aspects, the disclosure provides an mRNA that comprises an RNA element that comprises a sequence and/or an RNA secondary structure(s) that inhibits and/or reduces leaky scanning thereby promoting the translational fidelity of the mRNA.

In some embodiments, the RNA element comprises natural and/or modified nucleotides. In some embodiments, the RNA element comprises of a sequence of linked nucleotides, or derivatives or analogs thereof, that provides a desired translational regulatory activity as described herein. In some embodiments, the RNA element comprises a sequence of linked nucleotides, or derivatives or analogs thereof, that forms or folds into a stable RNA secondary structure, wherein the RNA secondary structure provides a desired translational regulatory activity as described herein. RNA elements can be identified and/or characterized based on the primary sequence of the element (e.g., GC-rich element and/or C-rich element), by RNA secondary structure formed by the element (e.g. stem-loop), by the location of the element within the RNA molecule (e.g., located within the 5′ UTR of an mRNA), by the biological function and/or activity of the element (e.g., “translational enhancer element”), and any combination thereof.

Structural RNA Elements

In some aspects, the disclosure provides an mRNA comprising at least one or more structural RNA element(s) comprising a sequence of linked ribonucleotides that folds into a hairpin or stem-loop structure that provides a translational regulatory activity as described herein. As described in the Examples, a structural RNA element derived from human H1 RNA comprising a nucleotide sequence of 20 nucleotides in length and forming a stem-loop was unexpectedly shown to promote and/or enhance the translational fidelity of polypeptides encoded by mRNAs with 5′ UTRs comprising the element.

Accordingly, in some aspects the disclosure provides mRNAs comprising a 5′ UTR comprising at least one or more structural RNA element(s) comprising a stem-loop. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence of about 10-30 nucleotides, about 15-25 nucleotides, about 20-25 nucleotides, about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, or about 10 nucleotides in length. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence of about 20 nucleotides.

In some embodiments, the structural RNA element comprises a stem-loop comprising a double-stranded stem comprising about 3-8 base pairs, about 4-7 base pairs, about 5-6 base pairs, about 3, 4, 5, 6, 7, 8 base pairs. In some embodiments, the double-stranded stem comprises about 4-7 base pairs. In some embodiments, the double-stranded stem comprises about 4 base pairs. In some embodiments, the double-stranded stem comprises about 7 base pairs.

In some embodiments, the structural RNA element comprises a stem-loop comprising a single-stranded loop of about 3-8 nucleotides, about 4-7 nucleotides, about 5-6 nucleotides, about 3, 4, 5, 6, 7, or 8 nucleotides in length. In some embodiments, the single-stranded loop is about 5 nucleotides in length.

In some embodiments, the structural RNA element comprises a stem-loop, wherein the stem-loop has a deltaG (ΔG) of about −30 kcal/mol, about −20 to −30 kcal/mol, about −20 kcal/mol, about −10 to −20 kcal/mol, about −10 kcal/mol, or about −5 to −10 kcal/mol.

In some embodiments, the structural RNA element comprising a stem-loop is located upstream of a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located upstream of and immediately adjacent to a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10 or about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located 10 nucleotides upstream of a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located 45 nucleotides upstream of a Kozak-like sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located 28 nucleotides upstream of a Kozak-like sequence in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem-loop is located downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located downstream of and immediately adjacent to the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10 or about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located 41 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located 6 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem-loop is located 23 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR.

Stem-loop structures that function as structural RNA elements have been identified for human H1 RNA and MRP ribonucleoprotein as described by Wang, G. et al (2010) Cell 142:456-467, which is incorporated herein in its entirety. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence comprising a human H1 RNA stem-loop structure. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence comprising a stem-loop structure of the RNA component of the MRP ribonucleoprotein complex.

In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 6 and SEQ ID NO: 47. In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 47.

In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 6 and SEQ ID NO: 47. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the nucleotide sequence of SEQ ID NO: 47.

In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) that is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the deltaG (ΔG) of the stem-loop identified by SEQ ID NO: 6. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −30 kcal/mol, about −20 to −30 kcal/mol, about −20 kcal/mol, about −10 to −20 kcal/mol, about −10 to −15 kcal/mol, about −12 kcal/mol, about −10 kcal/mol, or about −5 to −10 kcal/mol. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −10 kcal/mol. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −11 kcal/mol. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −12 kcal/mol. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −13 kcal/mol. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −14 kcal/mol. In some embodiments, the structural RNA element comprising a stem-loop comprises a nucleotide sequence that is about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a nucleotide sequence identified by SEQ ID NO: 6, wherein the stem-loop has a deltaG (ΔG) of about −15 kcal/mol.

In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6, wherein the structural RNA element comprising a stem-loop is located 10 nucleotides upstream of a Kozak-like sequence in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6, wherein the structural RNA element comprising a stem-loop is located 45 nucleotides upstream of a Kozak-like sequence in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6, wherein the structural RNA element comprising a stem-loop is located 28 nucleotides upstream of a Kozak-like sequence in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6, wherein the structural RNA element comprising a stem-loop is located 41 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6, wherein the structural RNA element comprising a stem-loop is located 6 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem-loop comprises the nucleotide sequence of SEQ ID NO: 6, wherein the structural RNA element comprising a stem-loop is located 23 nucleotides downstream of the 5′ cap or 5′ end of the mRNA in the 5′ UTR.

In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a structural RNA element comprising a stem-loop of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR without the structural RNA element comprising a stem-loop. In some embodiments, the leaky scanning of an mRNA comprising a structural RNA element comprising a stem-loop is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% relative to the leaky scanning of an mRNA without the structural RNA element comprising a stem-loop.

TABLE 1

Exemplary Structural RNA Elements

Comprising a Stem-Loop

SEQ ID

5′ UTRs
Sequence
NO

RNAse P stem
TCTCCCTGAGCTTCAGGGAG
5

loop (DNA)

RNAse P stem
UCUCCCUGAGCUUCAGGGAG
6

loop (RNA)

MRP stem loop
AGAAGCGTATCCCGCTGAGC
7

(DNA)

MRP stem loop
AGAAGCGUAUCCCGCUGAGC
47

(RNA)

In some embodiments, the structural RNA element comprising a stem-loop comprises one or more nucleotide substitutions. In some embodiments, the structural RNA element comprising a stem-loop comprises one or more (e.g., 1, 2, 3 or 4) different modified nucleobases, nucleosides, or nucleotides, such as those described herein. In some embodiments, the mRNAs provided by the disclosure comprise a structural RNA element comprising a stem-loop which differs from a naturally-occurring structural RNA element comprising a stem-loop by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides. In some embodiments, the mRNAs provided by the disclosure comprise a structural RNA element comprising a stem-loop which differs from a naturally-occurring structural RNA element comprising a stem-loop by 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or about 50 or more nucleotides. In some embodiments, an mRNA provided by the disclosure comprises a structural RNA element comprising a stem-loop comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116, SEQ ID NO: 120, and SEQ ID NO: 124.

In some embodiments, an mRNA provided by the disclosure comprises a structural RNA element comprising a stem-loop comprising a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 116, SEQ ID NO: 120, and SEQ ID NO: 124.

In some embodiments, the structural RNA element comprising a stem-loop increases an expression level of a polypeptide translated from the mRNA relative to an mRNA that does not comprise the structural RNA element comprising a stem-loop. In some embodiments, the structural RNA element comprising a stem-loop increases an activity of a polypeptide translated from the mRNA relative to an mRNA that does not comprise the structural RNA element comprising a stem-loop. In some embodiments, the structural RNA element comprising a stem-loop increases an expression level and an activity of a polypeptide translated from the mRNA relative to an mRNA that does not comprise the structural RNA element comprising a stem-loop. In some embodiments, the expression level and/or activity is increased by at least about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold or more. In some embodiments, the expression level and/or activity is increased by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15% about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.

GC-Rich Elements

In some aspects, the disclosure provides an mRNA having one or more structural modifications that inhibits leaky scanning and/or promotes the translational fidelity of mRNA translation, wherein at least one of the structural modifications is a GC-rich RNA element. In some aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5′ UTR of the mRNA. In one embodiment, the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5′ UTR of the mRNA. In another embodiment, the GC-rich RNA element is located 15-30, 15-20, 15-25, 10-15, or 5-10 nucleotides upstream of a Kozak consensus sequence. In another embodiment, the GC-rich RNA element is located immediately adjacent to a Kozak consensus sequence in the 5′ UTR of the mRNA.

In any of the foregoing or related aspects, the disclosure provides a GC-rich RNA element which comprises a sequence of 3-30, 5-25, 10-20, 15-20, about 20, about 15, about 12, about 10, about 7, about 6 or about 3 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is 70-80% cytosine, 60-70% cytosine, 50%-60% cytosine, 40-50% cytosine, 30-40% cytosine bases. In any of the foregoing or related aspects, the disclosure provides a GC-rich RNA element which comprises a sequence of 3-30, 5-25, 10-20, 15-20, about 20, about 15, about 12, about 10, about 7, about 6 or about 3 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 80% cytosine, about 70% cytosine, about 60% cytosine, about 50% cytosine, about 40% cytosine, or about 30% cytosine.

In any of the foregoing or related aspects, the disclosure provides a GC-rich RNA element which comprises a sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides, or derivatives or analogs thereof, linked in any order, wherein the sequence composition is 70-80% cytosine, 60-70% cytosine, 50%-60% cytosine, 40-50% cytosine, or 30-40% cytosine. In any of the foregoing or related aspects, the disclosure provides a GC-rich RNA element which comprises a sequence of 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 nucleotides, or derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 80% cytosine, about 70% cytosine, about 60% cytosine, about 50% cytosine, about 40% cytosine, or about 30% cytosine.

In some embodiments, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5′ UTR of the mRNA, wherein the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5′ UTR of the mRNA, and wherein the GC-rich RNA element comprises a sequence of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, or derivatives or analogs thereof, linked in any order, wherein the sequence composition is >50% cytosine. In some embodiments, the sequence composition is >55% cytosine, >60% cytosine, >65% cytosine, >70% cytosine, >75% cytosine, >80% cytosine, >85% cytosine, or >90% cytosine.

In other aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5′ UTR of the mRNA, wherein the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5′ UTR of the mRNA, and wherein the GC-rich RNA element comprises a sequence of about 3-30, 5-25, 10-20, 15-20 or about 20, about 15, about 12, about 10, about 6 or about 3 nucleotides, or derivatives or analogues thereof, wherein the sequence comprises a repeating GC-motif, wherein the repeating GC-motif is [CCG]n (SEQ ID NO: 22), wherein n=1 to 10, n=2 to 8, n=3 to 6, or n=4 to 5. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=1, 2, 3, 4 or 5. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=1, 2, or 3. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=1. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=2. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=3. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=4. In some embodiments, the sequence comprises a repeating GC-motif [CCG]n (SEQ ID NO: 22), wherein n=5.

In another aspect, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, preceding a Kozak consensus sequence in a 5′ UTR of the mRNA, wherein the GC-rich RNA element comprises any one of the sequences set forth in Table 2. In one embodiment, the GC-rich RNA element is located about 30, about 25, about 20, about 15, about 10, about 5, about 4, about 3, about 2, or about 1 nucleotide(s) upstream of a Kozak consensus sequence in the 5′ UTR of the mRNA. In another embodiment, the GC-rich RNA element is located about 15-30, 15-20, 15-25, 10-15, or 5-10 nucleotides upstream of a Kozak consensus sequence. In another embodiment, the GC-rich RNA element is located immediately adjacent to a Kozak consensus sequence in the 5′ UTR of the mRNA.

In other aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence V1 [CCCCGGCGCC] (SEQ ID NO: 1), or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5′ UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence V1 as set forth in Table 2 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence V1 as set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA. In other embodiments, the GC-rich element comprises the sequence V1 as set forth in Table 2 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA.

In other aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence V2 [CCCCGGC](SEQ ID NO: 2), or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5′ UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence V2 as set forth in Table 2 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence V2 as set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA. In other embodiments, the GC-rich element comprises the sequence V2 as set forth in Table 2 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA.

In other aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence EK2 [GCCGCC](SEQ ID NO: 18), or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5′ UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence EK2 as set forth in Table 2 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA. In some embodiments, the GC-rich element comprises the sequence EK2 as set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA. In other embodiments, the GC-rich element comprises the sequence EK2 as set forth in Table 2 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA.

In yet other aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising the sequence V1 [CCCCGGCGCC] (SEQ ID NO: 1), or derivatives or analogs thereof, preceding a Kozak consensus sequence in the 5′ UTR of the mRNA, wherein the 5′ UTR comprises the following sequence:

GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA (SEQ ID NO: 56).

In some embodiments, the GC-rich element comprises the sequence V1 as set forth in Table 2 located immediately adjacent to and upstream of the Kozak consensus sequence in the 5′ UTR sequence shown in Table 2 (SEQ ID NOs: 17 or 48). In some embodiments, the GC-rich element comprises the sequence V1 as set forth in Table 2 located 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA, wherein the 5′ UTR comprises the following sequence:

GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA (SEQ ID NO: 56)

In other embodiments, the GC-rich element comprises the sequence V1 as set forth in Table 2 located 1-3, 3-5, 5-7, 7-9, 9-12, or 12-15 bases upstream of the Kozak consensus sequence in the 5′ UTR of the mRNA, wherein the 5′ UTR comprises the following sequence:

(SEQ ID NO: 56)

GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA.

In some embodiments, the 5′ UTR comprises the following sequence:

(5′v1.1, SEQ ID NO: 4)

GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA

CCCCGGCGCCGCCACC

In another aspect, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a GC-rich RNA element comprising a stable RNA secondary structure comprising a sequence of nucleotides, or derivatives or analogs thereof, linked in an order which forms a hairpin or a stem-loop. In one embodiment, the stable RNA secondary structure is upstream or downstream of the initiation codon. In another embodiment, the stable RNA secondary structure is located about 30, about 25, about 20, about 15, about 10, or about 5 nucleotides upstream or downstream of the initiation codon. In another embodiment, the stable RNA secondary structure is located about 20, about 15, about 10 or about 5 nucleotides upstream or downstream of the initiation codon. In another embodiment, the stable RNA secondary structure is located about 5, about 4, about 3, about 2, about 1 nucleotides upstream or downstream of the initiation codon. In another embodiment, the stable RNA secondary structure is located about 15-30, about 15-20, about 15-25, about 10-15, or about 5-10 nucleotides upstream or downstream of the initiation codon. In another embodiment, the stable RNA secondary structure is located 12-15 nucleotides upstream and downstream of the initiation codon. In another embodiment, the stable RNA secondary structure comprises the initiation codon. In another embodiment, the stable RNA secondary structure has a deltaG of about −30 kcal/mol, about −20 to −30 kcal/mol, about −20 kcal/mol, about −10 to −20 kcal/mol, about −10 kcal/mol, about −5 to −10 kcal/mol.

In another embodiment, the modification is operably linked to an open reading frame encoding a polypeptide and wherein the modification and the open reading frame are heterologous.

In another embodiment, the sequence of the GC-rich RNA element is comprised exclusively of guanine (G) and cytosine (C) nucleobases.

Exemplary GC-rich RNA elements useful in the mRNAs provided by the disclosure are provided in Table 2.

TABLE 2

Exemplary GC-Rich RNA Elements

SEQ

ID

Sequence
NO

GC-Rich RNA Elements

K0 (Traditional
[GCCACC]
17

Kozak consensus)

Kozak-like sequence
[GCCGCC]
48

EK1
[CCCGCC]
3

EK2
[GCCGCC]
18

EK3
[CCGCCG]
19

V1
[CCCCGGCGCC]
1

V2
[CCCCGGC]
2

CG1
[GCGCCCCGCGGCGCCCCGCG]
20

CG2
[CCCGCCCGCCCCGCCCCGCC]
21

(CCG)_n n= 1-10
[CCG]_n
22

(GCC)_n, n = 1-10
[GCC]_n
23

Stable RNA Secondary

Structures

SL1
CCGCGGCGCCCCGCGG
24

(−9.90 kcal/mol)

SL2

GCGCGCAUAUAGCGCGC
25

(−10.90 kcal/mol)

SL3

CAUGGUGGCGGCCCGCCGCCACC
49

AUG (−22.10 kcal/mol)

SL4

CAUGGUGGCCCGCCGCCACCAUG
50

(−14.90 kcal/mol)

SL5

CAUGGUGCCCGCCGCCACCAUG
51

(−8.00 kcal/mol)

C-Rich Elements

In some aspects, the disclosure provides an mRNA having one or more structural modifications that inhibit leaky scanning and/or promote the translational fidelity of mRNA translation, wherein at least one of the structural modifications is a C-rich RNA element. In some aspects, the disclosure provides an mRNA comprising at least one modification, wherein at least one modification is a C-rich RNA element comprising a sequence of linked nucleotides, or derivatives or analogs thereof, located proximal to the 5′ cap or 5′ end of the mRNA, wherein the C-rich element comprises a sequence of linked nucleotides, or derivatives or analogs thereof, in a 5′ UTR of the mRNA. In one embodiment, the C-rich RNA element is located about 45-50, about 40-45, about 35-40, about 30-35 about 25-30, about 20-25, about 15-20, about 10-15, about 6-10, about 1-5 nucleotides, or about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ cap or 5′ end of the mRNA. In some embodiments, the C-rich element is located about 1-20, about 2-15, about 3-10, about 4-8 or about 6 nucleotides downstream of the 5′ cap or 5′ end of the mRNA. In some embodiments, the C-rich element is located downstream of the 5′ cap or 5′ end of the mRNA with a transcription start site located between the 5′ cap or 5′end of the mRNA and the C-rich element

In some embodiments, the C-rich RNA element comprises a sequence of about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, or greater than 50% cytosine nucleobases or derivatives or analogs thereof. In some embodiments, the C-rich RNA element comprises a sequence of less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5% guanosine nucleobases, or derivatives or analogs thereof. In some embodiments, the C-rich RNA element comprises a sequence of less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, or less than about 5% guanosine nucleobases, or derivatives or analogs thereof. In some embodiments, the C-rich RNA element comprises a sequence of less than about 25% guanosine nucleobases, or derivatives or analogs thereof.

In some embodiments, the C-rich RNA element is located upstream of a Kozak-like sequence in the 5′UTR. In some embodiments, the C-rich RNA element is located about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10 or about 5 nucleotides upstream of a Kozak-like sequence in the 5′UTR. In some embodiments, the C-rich RNA element is located about 5, about 4, about 3, about 2 or about 1 nucleotide upstream of a Kozak-like sequence in the 5′UTR. In some embodiments, the C-rich RNA element is located about 15-50, about 15-40, about 15-30, about 15-20, about 10-15 or about 5-10 nucleotides upstream of a Kozak-like sequence in the 5′UTR. In some embodiments, the C-rich RNA element is located upstream of and immediately adjacent to a Kozak-like sequence in the 5′UTR.

In some embodiments, the C-rich RNA element comprises a sequence of about 3-20, about 4-18, about 6-16, about 6-14, about 6-12, about 6-10, about 8-14, about 8-12, about 8-10, about 10-12, about 10-14, about 14, about 12, about 11, about 10 or about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4 or 3 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 14 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 14 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is greater than about 90% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 13 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 13 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is greater than about 90% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 12 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 12 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is greater than about 90% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 11 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 11 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is greater than about 90% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 10 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases. In some embodiments, the C-rich RNA element comprises a sequence of about 10 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is greater than about 90% cytosine bases.

In some embodiments, the C-rich RNA element is depleted of guanosine. In some embodiments, the C-rich element comprises a sequence of less than about 25%, less than about 20%, less than about 15%, less than about 10% or less than about 5% guanosine bases.

In some embodiments, the C-rich RNA element comprises a sequence of about 14 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases, wherein the sequence is located upstream of a Kozak-like sequence in the 5′UTR, and wherein the sequence is located downstream of the 5′cap or 5′end of the mRNA. In some embodiments, the C-rich RNA element comprises a sequence of about 13 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases, wherein the sequence is located upstream of a Kozak-like sequence in the 5′UTR, and wherein the sequence is located downstream of the 5′cap or 5′end of the mRNA. In some embodiments, the C-rich RNA element comprises a sequence of about 12 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases, wherein the sequence is located upstream of a Kozak-like sequence in the 5′UTR, and wherein the sequence is located downstream of the 5′cap or 5′end of the mRNA. In some embodiments, the C-rich RNA element comprises a sequence of about 11 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases, wherein the sequence is located upstream of a Kozak-like sequence in the 5′UTR, and wherein the sequence is located downstream of the 5′cap or 5′end of the mRNA. In some embodiments, the C-rich RNA element comprises a sequence of about 10 nucleotides, derivatives or analogs thereof, linked in any order, wherein the sequence composition is about 100%, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55% or about 50% cytosine bases, wherein the sequence is located upstream of a Kozak-like sequence in the 5′UTR, and wherein the sequence is located downstream of the 5′cap or 5′end of the mRNA.

In some embodiments, the C-rich RNA element comprises a sequence comprising the formula 5′-[C1]_v-[N1]_w-[N2]_x-[N3]_y-[C2]_z-3′, wherein C1 and C2 are nucleotides comprising cytidine, or a derivative or analogue thereof, wherein N1, and N2 and N3 if present, are each a nucleotide comprising a nucleobase selected from the group consisting of: adenine, guanine, thymine, uracil, and cytosine, and derivatives or analogues thereof (e.g., pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine), wherein v, w, x, y and z are integers whose value indicates the number of nucleotides comprising the C-rich RNA element.

In some embodiments, v=12-15 nucleotides, 3-12 nucleotides, 5-10 nucleotides, 6-8 nucleotides, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides. In some embodiments, z=2-10 nucleotides, 2-7 nucleotides, 3-5 nucleotides, 2, 3, 4, 5, 6, or 7 nucleotides. In some embodiments, w-1-5 nucleotides, 1-3 nucleotides, 1, 2, or 3 nucleotide(s). In some embodiments, x=0-5 nucleotides, 0-3 nucleotides, 0, 1, 2, or 3 nucleotide(s). In some embodiments, y=0-5 nucleotides, 0-3 nucleotides, 0, 1, 2, or 3 nucleotide(s).

In some embodiments, N1 comprises adenosine, or derivative or analogue thereof; w=1 or 2; x=0, 1, 2, or 3; and y=0, 1, 2, or 3. In some embodiments, N1 comprises adenosine, or derivative or analogue thereof; w=1 or 2; x=0; and y=0. In some embodiments, N1 comprises uracil, or derivative or analogue thereof (e.g., pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine); w=1 or 2; N2 comprises adenosine, or derivative or analogue thereof; x=1, 2, or 3; N3 is guanosine, or derivative or analogue thereof; and y=1 or 2. In some embodiments, N1 comprises uracil, or derivative or analogue thereof (e.g., pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine); w=1; N2 comprises adenosine, or derivative or analogue thereof; x=2; N3 is guanosine, or derivative or analogue thereof; and y=1.

In some embodiments, the C-rich RNA element comprises the formula

5′-[C1]_v-[N1]_w-[N2]_x-[N3]_y,-[C2]_z-3′,

wherein C1 and C2 are nucleotides comprising cytidine, or a derivative or analogue thereof, wherein N1, and N2 and N3 if present, are each a nucleotide comprising a nucleobase selected from the group consisting of: adenine, guanine, and uracil, and derivatives or analogues thereof, (e.g., pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine), wherein v, w, x, y and z are integers whose value indicates the number of nucleotides comprising the C-rich RNA element. In some embodiments, v=4-10 nucleotides, 6-8 nucleotides, 6, 7, or 8 nucleotides. In some embodiments, w=1-3 nucleotides, 1 or 2 nucleotide(s). In some embodiments, x=0-3 nucleotides, 0, 1 or 2 nucleotide(s). In some embodiments, y=0-3 nucleotides, 0 or 1 nucleotide(s). In some embodiments, z=2-6 nucleotides, 2-5 nucleotides, 2, 3, 4, or 5 nucleotides. In some embodiments, N1 comprises adenosine, or derivative or analogue thereof; w=1; x=0; and y=0. In some embodiments, N1 comprises adenosine, or derivative or analogue thereof; w=2; x=0; and y=0. In some embodiments, N1 comprises uracil, or derivative or analogue thereof (e.g., pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine); w=1 or 2; N2 comprises adenosine, or derivative or analogue thereof; x=1, 2, or 3; N3 is guanosine, or derivative or analogue thereof; and y=1 or 2. In some embodiments, N1 comprises uracil, or derivative or analogue thereof (e.g., pseudouridine, N1-methyl pseudouridine, 5-methoxyuridine); w=1; N2 comprises adenosine, or derivative or analogue thereof; x=2; N3 is guanosine, or derivative or analogue thereof; and y=1.

In some embodiments, the C-rich RNA element comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34. In some embodiments, the C-rich RNA element comprises the nucleotide sequence 5′-CCCCCCCAACCC-3′ (SEQ ID NO: 29). In some embodiments, the C-rich RNA element comprises the nucleotide sequence 5′-CCCCCCCCAACC-3′ (SEQ ID NO: 30). In some embodiments, the C-rich RNA element comprises the nucleotide sequence 5′-CCCCCCACCCCC-3′ (SEQ ID NO: 31). In some embodiments, the C-rich RNA element comprises the nucleotide sequence 5′-CCCCCCUAAGCC-3′ (SEQ ID NO: 32). In some embodiments, the C-rich RNA element comprises the nucleotide sequence 5′-CCCCACAACC-3′ (SEQ ID NO: 33). In some embodiments, the C-rich RNA element comprises the nucleotide sequence 5′-CCCCCACAACC-3′ (SEQ ID NO: 34)

Exemplary C-rich elements provided by the disclosure are set forth in Table 3. These C-rich elements and 5′UTR are useful in the mRNAs of the disclosure.

TABLE 3

C-Rich RNA Elements

C-Rich RNA Element
Sequence
SEQ ID NO

CR1
CCCCCCCCAACC
30

CR2
CCCCCCCAACCC
29

CR3
CCCCCCACCCCC
31

CR4
CCCCCCUAAGCC
32

CR5
CCCCACAACC
33

CR6
CCCCCACAACC
34

Combination of RNA Elements

In some aspects, the disclosure provides an mRNA comprising a 5′UTR comprising both a C-rich RNA element and a GC-rich RNA element, such as those described herein. In some embodiments, the amount or extent of leaky scanning from the mRNA is additively or synergistically decreased by a combination of a C-rich RNA element and the GC-rich RNA element of the disclosure. In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a GC-rich RNA element of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element alone or an mRNA comprising a 5′UTR comprising a GC-rich RNA element alone. In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a GC-rich RNA element of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR without a C-rich RNA element or a GC-rich RNA element. In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a GC-rich RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element alone or an mRNA comprising a 5′UTR comprising a GC-rich RNA element alone. In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a GC-rich RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising without a C-rich RNA element or a GC-rich RNA element. In some embodiments, the leaky scanning of an mRNA comprising a C-rich RNA element and a GC-rich RNA element is abolished or undetectable.

In some aspects, the disclosure provides an mRNA comprising one or more C-rich RNA elements (e.g., 2, 3, 4) and one or more GC-rich RNA elements (e.g., 2, 3, 4).

In some embodiments, the disclosure provides an mRNA having a GC-rich RNA element and a C-rich RNA element as described herein, wherein the C-rich RNA element and the GC-rich RNA element precede a Kozak-like sequence or Kozak consensus sequence, in the 5′ UTR. In some embodiments, the C-rich RNA element is upstream the GC-rich RNA element in the 5′UTR. In some embodiments, the C-rich RNA element is proximal to the 5′ end or 5′ cap of the mRNA relative to the location of the GC-rich RNA element in the 5′ UTR. In some embodiments, the C-rich RNA element is located adjacent to or within about 1-6, or about 1-10 nucleotides of the 5′end or 5′ cap of the mRNA and the GC-rich RNA element is located proximal to the Kozak-like sequence or Kozak consensus sequence in the 5′ UTR. In some embodiments, the C-rich RNA element is located adjacent to or within about 1-6, or about 1-10 nucleotides of the 5′end or 5′ cap of the mRNA and the GC-rich RNA element is located adjacent to or within about 1-6 or about 1-10 nucleotides of the Kozak-like sequence or Kozak consensus sequence in the 5′ UTR.

In some embodiments, a 5′ UTR comprising both a GC-rich RNA element and a C-rich RNA element provides enhanced translational regulatory activity compared to a 5′UTR comprising a GC-rich RNA element or a C-rich RNA element.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a C-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, and comprises a GC-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 49, SEQ ID NO: 50 and SEQ ID NO: 51.

In some embodiments, the C-rich RNA element comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 33, and the GC-rich RNA element comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 23.

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises a 5′ UTR comprising a C-rich RNA element and a GC-rich RNA element, wherein the 5′UTR comprises the nucleotide sequence set forth in SEQ ID NO: 35.

GC-Rich RNA Element+Structural RNA Element

In some aspects, the disclosure provides an mRNA comprising a 5′ UTR comprising at least one or more GC-rich RNA element(s) described herein and at least one or more structural RNA element(s) comprising a stem-loop as described herein. In some embodiments, a 5′ UTR comprising at least one or more GC-rich RNA element(s) and at least one or more structural RNA element(s) described herein provides an enhanced translational regulatory activity compared to a 5′ UTR comprising only the at least one or more GC-rich RNA element(s) or only the at least one or more structural RNA element(s). In some embodiments, the amount or extent of leaky scanning of an mRNA comprising a 5′ UTR comprising at least one or more GC-rich RNA element(s) and at least one or more structural RNA element(s) of the disclosure is additively or synergistically reduced or decreased.

In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element and a structural RNA element of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element alone or an mRNA comprising a 5′UTR comprising a structural RNA element alone. In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element and a structural RNA element of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR without a GC-rich RNA element or a structural RNA element. In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element and a structural RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element alone or an mRNA comprising a 5′UTR comprising a structural RNA element alone. In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element and a structural RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising without a GC-rich RNA element or a structural RNA element. In some embodiments, the leaky scanning of an mRNA comprising a GC-rich RNA element and a structural RNA element is abolished or undetectable.

In some aspects, the disclosure provides an mRNA comprising one or more GC-rich RNA elements (e.g., 2, 3, 4) and one or more structural RNA elements (e.g., 2, 3, 4).

In some embodiments, the disclosure provides an mRNA having a GC-rich RNA element and a structural RNA element as described herein, wherein the GC-rich RNA element and the structural RNA element precede a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR. In some embodiments, the disclosure provides an mRNA having a GC-rich RNA element and a structural RNA element as described herein, wherein the GC-rich RNA element and the structural RNA element are located upstream of a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR.

In some embodiments, the GC-rich RNA element is upstream of the structural RNA element in the 5′UTR. In some embodiments, the GC-rich RNA element is downstream of the structural RNA element in the 5′UTR. In some embodiments, the GC-rich RNA element is proximal to the 5′ end or 5′ cap of the mRNA relative to the location of the structural RNA element in the 5′ UTR. In some embodiments, the GC-rich RNA element is proximal to a Kozak-like sequence or Kozak consensus sequence relative to the location of the structural RNA element in the 5′ UTR.

In some embodiments, the GC-rich RNA element is located upstream and adjacent to or upstream and within about 1-6, or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element is located upstream of the GC-rich RNA element in the 5′ UTR. In some embodiments, the GC-rich RNA element is located upstream and adjacent to or upstream and within about 1-6, or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element is located upstream and adjacent to the GC-rich RNA element in the 5′ UTR. In some embodiments, the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element comprising a stem-loop is located upstream and adjacent to the GC-rich RNA element in the 5′ UTR.

In some embodiments, the GC-rich RNA element is located upstream and adjacent to or within about 1-6, or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element comprising a stem loop is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of the GC-rich RNA element in the 5′ UTR.

In some embodiments, the GC-rich RNA element is located upstream and adjacent to or within about 1-6, or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element comprising a stem loop is located 35 nucleotides upstream of the GC-rich RNA element. In some embodiments, the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element comprising a stem loop is located 35 nucleotides upstream of the GC-rich RNA element.

In some embodiments, the GC-rich RNA element is located upstream and adjacent to or within about 1-6, or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element comprising a stem loop is located 18 nucleotides upstream of the GC-rich RNA element. In some embodiments, the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence of the mRNA and the structural RNA element comprising a stem loop is located 18 nucleotides upstream of the GC-rich RNA element.

In some embodiments, the structural RNA element comprising a stem loop is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ end or 5′ cap of the mRNA and the GC-rich RNA element is located upstream and adjacent to or within about 1-6 or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR.

In some embodiments, the structural RNA element comprising a stem loop is located 41 nucleotides downstream of the 5′ end or 5′ cap of the mRNA and the GC-rich element is located upstream and adjacent to or within about 1-6 or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem loop is located 41 nucleotides downstream of the 5′ end or 5′ cap of the mRNA and the GC-rich element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem loop is located 6 nucleotides downstream of the 5′ end or 5′ cap of the mRNA and the GC-rich element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR. In some embodiments, the structural RNA element comprising a stem loop is located 23 nucleotides downstream of the 5′ end or 5′ cap of the mRNA and the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a GC-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28, and wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprises a nucleotide sequence selected from the group consisting of: SEQ ID NO: 6 and SEQ ID NO: 47.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a GC-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23, and wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a GC-rich RNA element comprising a nucleotide sequence of SEQ ID NO: 1, wherein the GC-rich RNA element is located upstream and adjacent to or within about 1-6 or about 1-10 nucleotides of a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR, and wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6.

In some embodiments, the structural RNA element comprising a stem loop comprises the nucleotide sequence of SEQ ID NO: 6, where the structure RNA element is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) upstream of, or is upstream and adjacent to the GC-rich RNA element comprising the nucleotide sequence of SEQ ID NO: 1 in the 5′ UTR.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a GC-rich RNA element comprising a nucleotide sequence of SEQ ID NO: 1, wherein the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR, wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6, and wherein the structural RNA element is located upstream and adjacent to the GC-rich RNA element.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a GC-rich RNA element comprising a nucleotide sequence of SEQ ID NO: 1, wherein the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR, wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6, and wherein the structural RNA element is located 35 nucleotides upstream of the GC-rich RNA element.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a GC-rich RNA element comprising a nucleotide sequence of SEQ ID NO: 1, wherein the GC-rich RNA element is located upstream and adjacent to a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR, wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6, and wherein the structural RNA element is located 18 nucleotides upstream of the GC-rich RNA element.

C-Rich RNA Element+Structural RNA Element

In some aspects, the disclosure provides an mRNA comprising a 5′ UTR comprising both a C-rich RNA element and a structural RNA element comprising a stem loop, such as those described herein. In some embodiments, a 5′ UTR comprising both a C-rich RNA element and a structural RNA element comprising a stem loop provides an enhanced translational regulatory activity compared to a 5′ UTR comprising a C-rich RNA element or a structural RNA element alone. In some embodiments, the amount or extent of leaky scanning of an mRNA comprising a 5′ UTR comprising both a C-rich RNA element and a structural RNA element of the disclosure is additively or synergistically decreased.

In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a structural RNA element comprising a stem loop of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element alone or an mRNA comprising a 5′UTR comprising a structural RNA element alone. In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a structural RNA element of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR without a C-rich RNA element or a structural RNA element. In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a structural RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element alone or an mRNA comprising a 5′UTR comprising a structural RNA element alone. In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a C-rich RNA element and a structural RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR without a C-rich RNA element or a structural RNA element. In some embodiments, the leaky scanning of an mRNA comprising a C-rich RNA element and a structural RNA element is abolished or undetectable.

In some aspects, the disclosure provides an mRNA comprising one or more C-rich RNA elements (e.g., 2, 3, 4) and one or more structural RNA elements comprising a stem loop (e.g., 2, 3, 4).

In some embodiments, the disclosure provides an mRNA having a C-rich RNA element and a structural RNA element comprising a stem loop as described herein, wherein the C-rich RNA element and the structural RNA element precede a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR. In some embodiments, the disclosure provides an mRNA having a C-rich RNA element and a structural RNA element comprising a stem loop as described herein, wherein the C-rich RNA element and the structural RNA element are located upstream of a Kozak-like sequence or Kozak consensus sequence in the 5′ UTR.

In some embodiments, the C-rich RNA element is upstream the structural RNA element in the 5′UTR. In some embodiments, the C-rich RNA element is downstream of the structural RNA element in the 5′UTR. In some embodiments, the C-rich RNA element is proximal to the 5′ end or 5′ cap of the mRNA relative to the location of the structural RNA element in the 5′ UTR. In some embodiments, the C-rich RNA element is proximal to a Kozak-like sequence or Kozak consensus sequence relative to the location of the structural RNA element in the 5′ UTR.

In some embodiments, the C-rich RNA element is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the 5′ end or 5′ cap of the mRNA and the structural RNA element is located downstream of the C-rich RNA element in the 5′ UTR.

In some embodiments, the C-rich RNA element is located adjacent to the 5′ end or 5′ cap of the mRNA and the structural RNA element comprising a stem loop is located downstream of the C-rich RNA element in the 5′ UTR. In some embodiments, the C-rich RNA element is located 6 nucleotides downstream of the 5′ end or 5′ cap of the mRNA and the structural RNA element is located downstream of the C-rich RNA element.

In some aspects, the disclosure provides an mRNA comprising: a 5′ cap, a 5′ untranslated region (UTR), a Kozak-like sequence, an initiation codon, a full open reading frame encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a C-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, and wherein the 5′ UTR comprises a structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6.

In some embodiments, the C-rich RNA element comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34 is located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotides, or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of, or is downstream and adjacent to the 5′ end or 5′ cap of the mRNA and the structural RNA element comprising a stem loop comprising the nucleotide sequence of SEQ ID NO: 6 is located downstream of the C-rich RNA element in the 5′ UTR.

GC-Rich RNA Element+C-Rich RNA Element+Structural RNA Element

In some aspects, the disclosure provides an mRNA comprising a 5′ UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element comprising a stem loop, as described herein. In some embodiments, a 5′ UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element comprising a stem loop provides an enhanced translational regulatory activity compared to a 5′ UTR comprising a GC-rich RNA element, or a C-rich RNA element, or a structural RNA element, or compared to a 5′ UTR comprising a combination of a GC-rich RNA element and a C-rich RNA element, or a combination of a GC-rich RNA element and a structural RNA element, or a combination of a C-rich RNA element and a structural RNA element. In some embodiments, the amount or extent of leaky scanning of an mRNA comprising a 5′ UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element of the disclosure is additively or synergistically decreased.

In some embodiments, leaky scanning of an mRNA comprising a 5′UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element of the disclosure is reduced by about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, or about 10-fold relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element alone, or a C-rich RNA element alone, or a structural RNA element alone, or of an mRNA comprising a comprising a 5′ UTR comprising a combination of a combination of a GC-rich RNA element and a C-rich RNA element, or a combination of a GC-rich RNA element and a structural RNA element, or a combination of a C-rich RNA element and a structural RNA element.

In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising a GC-rich RNA element alone, or a C-rich RNA element alone, or a structural RNA element alone, or of an mRNA comprising a 5′ UTR comprising a combination of a GC-rich RNA element and a C-rich RNA element, or a combination of a GC-rich RNA element and a structural RNA element, or a combination of a C-rich RNA element and a structural RNA element.

In some embodiments, the leaky scanning of an mRNA comprising a 5′UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element is reduced by about 5%, about 10%, about 15%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% relative to the leaky scanning of an mRNA comprising a 5′UTR comprising without a GC-rich RNA element, a C-rich RNA element, or a structural RNA element. In some embodiments, the leaky scanning of an mRNA comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element is abolished or undetectable.

In some aspects, the disclosure provides an mRNA comprising one or more GC-rich RNA elements (e.g., 2, 3, 4), one or more C-rich RNA element (e.g., 2, 3, 4), and one or more structural RNA elements comprising a stem loop (e.g., 2, 3, 4).

In some aspects, the disclosure provides an mRNA, wherein the mRNA comprises a 5′ UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element comprising a stem loop, wherein the 5′UTR comprises the nucleotide sequence set forth in SEQ ID NO: 128.

In some embodiments, the disclosure provides an mRNA, wherein the mRNA comprises a mRNA comprises a 5′ UTR comprising a combination of a GC-rich RNA element, a C-rich RNA element, and a structural RNA element comprising a stem loop, wherein the 5′UTR comprises the nucleotide sequence set forth in SEQ ID NO: 132.

TABLE 4

Exemplary 5′ UTRs with GC-Rich RNA Elements, C-Rich RNA

Elements, and Structural RNA Elements

SEQ ID

5′ UTRs
Sequence
NO

F593
GGGAAACCCCCCACCCCCGUAAGAGAGAAAAGAAGAGUA
128

AGAAGAAAUAUAAGAUCUCCCUGAGCUUCAGGGAGCCC

CGGCGCC[GCCACC]

combo1_P2_p2
GGGAAACCCCCCACCCCCGUCUCCCUGAGCUUCAGGGAG
132

UAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCC

GGCGCC[GCCACC]

combo1_P2_p3
GGGAAACCCCCCACCCCCGUAAGAGAGAAAAGAAGAUCU
136

CCCUGAGCUUCAGGGAGGUAAGAAGAAAUAUAAGACCC

CGGCGCC[GCCACC]

combo2_P2_p2
GGGAAAUCCCCACAACCGUCUCCCUGAGCUUCAGGGAG
140

UAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCC

GGCGCC[GCCACC]

combo2_P2_p3
GGGAAAUCCCCACAACCGUAAGAGAGAAAAGAAGAUCUC
144

CCUGAGCUUCAGGGAGGUAAGAAGAAAUAUAAGACCCC

GGCGCC[GCCACC]

(C-rich RNA Element underlined; Structural RNA Element bold; GC-rich RNA Element italicized, Kozak sequence [bracket])

5′ UTRs Comprising C-Rich and/or GC-Rich RNA Elements

In some aspects, the disclosure provides mRNAs having RNA elements (e.g., C-rich, GC-rich RNA, structural RNA elements and combinations thereof) which provide a desired translational regulatory activity to the mRNA. In one aspect, the mRNAs of the disclosure comprise a 5′ UTR comprising a C-rich RNA element, a GC-rich RNA element, or a combination thereof, as described herein, wherein the addition of the C-rich RNA element, the GC-rich RNA element, or the combination thereof, provides one or more translational regulatory activities described herein (e.g. inhibition of leaky scanning). In some embodiments, an mRNA provided by the disclosure comprises a 5′ UTR comprising a C-rich RNA element described herein, wherein the C-rich RNA element provides one or more translational regulatory activities described herein (e.g., inhibition of leaky scanning). In some embodiments, an mRNA provided by the disclosure comprises a 5′ UTR comprising a C-rich RNA element and a GC-rich RNA element of the disclosure, wherein the C-rich RNA element and GC-rich RNA element provide one or more translational regulatory activities described herein (e.g., inhibition of leaky scanning). Translational regulatory activities provided by the C-rich RNA element, GC-rich RNA element, or combination thereof, includes promoting translation of only one open reading frame encoding a desired polypeptide or translation product, or reducing, inhibiting or eliminating the failure to initiate translation of the therapeutic protein or peptide at a desired initiator codon, as a consequence of leaky scanning or other mechanisms.

In some embodiments, the mRNAs of the disclosure comprise a 5′ UTR to which a C-rich RNA element, a GC-rich RNA element, or a combination thereof, described herein, is added or inserted, thereby reducing leaky scanning of the 5′ UTR by the cellular translation machinery. In some embodiments, the mRNAs provided by the disclosure comprise a core 5′ UTR nucleotide sequence to which a C-rich RNA element, a GC-rich RNA element, or a combination thereof, described herein is added, thereby reducing leaky scanning of the 5′ UTR by the cellular translation machinery. In some embodiments, the core 5′ UTR comprises the nucleotide sequence set forth in SEQ ID NO: 45. In some embodiments, the core 5′ UTR comprises the nucleotide sequence set forth in SEQ ID NO: 46.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 4 in which a C-rich RNA element and a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 62 in which a C-rich RNA element and a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide selected from SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 in which a C-rich RNA element and a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 43 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 45 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 8 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 46 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 42 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 39 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

Exemplary 5′ UTRs comprising C-rich RNA elements, GC-rich elements, and combinations thereof provided by the disclosure are set forth in Table 5. These 5′ UTRs are useful in the mRNAs of the disclosure.

TABLE 5

Exemplary 5′UTRs and 5′UTRs with GC-Rich RNA Elements

(GC-Rich Elements italicized)

SEQ ID

5′ UTRs
Sequence
NO

5′v1.0 (DNA)
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA
58

GAGCCACC

5′v1.0 (RNA)
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUA
45

AGAGCCACC

5′v1.0 Core (DNA)
TAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGA
55

5′v1.0 Core (RNA)
UAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGA
8

5′v1.1 (DNA)
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA
9

GACCCCGGCGCCGCCACC

5′v1.1
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUA
4

(RNA)
AGACCCCGGCGCCGCCACC

V2-5′UTR (DNA)
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA
10

GACCCCGGCGCCACC

V2-5′UTR (RNA)
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUA
62

AGACCCCGGCGCCACC

CG1-5′UTR
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA
11

(DNA)
GAGCGCCCCGCGGCGCCCCGCGGCCACC

CG1-5′UTR
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUA
65

(RNA)
AGAGCGCCCCGCGGCGCCCCGCGGCCACC

CG2-5′UTR
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAA
12

(DNA)
GACCCGCCCGCCCCGCCCCGCCGCCACC

CG2-5′UTR
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUA
68

(RNA)
AGACCCGCCCGCCCCGCCCCGCCGCCACC

KT1-UTR
GGGCCCGCCGCCAAC
13

KT2-UTR
GGGCCCGCCGCCACC
14

KT3-UTR
GGGCCCGCCGCCGAC
15

KT4-UTR
GGGCCCGCCGCCGCC
16

GCC3-ExtKozak
GGGAAAGCCGCCGCCGCCACC
43

(Ref)

S065 core (DNA)
CCTCATATCCAGGCTCAAGAATAGAGCTCAGTGTTTTGTTG
87

TTTAATCATTCCGACGTGTTTTGCGATATTCGCGCAAAGCA

GCCAGTCGCGCGCTTGCTTTTAAGTAGAGTTGTTTTTCCAC

CCGTTTGCCAGGCATCTTTAATTTAACATATTTTTATTTTTC

AGGCTAACCTA

S065 core (RNA)
CCUCAUAUCCAGGCUCAAGAAUAGAGCUCAGUGUUUUGU
46

UGUUUAAUCAUUCCGACGUGUUUUGCGAUAUUCGCGCAA

AGCAGCCAGUCGCGCGCUUGCUUUUAAGUAGAGUUGUUU

UUCCACCCGUUUGCCAGGCAUCUUUAAUUUAACAUAUUU

UUAUUUUUCAGGCUAACCUA

S065 (DNA)
GGGAGACCTCATATCCAGGCTCAAGAATAGAGCTCAGTGT
88

TTTGTTGTTTAATCATTCCGACGTGTTTTGCGATATTCGCG

CAAAGCAGCCAGTCGCGCGCTTGCTTTTAAGTAGAGTTGT

TTTTCCACCCGTTTGCCAGGCATCTTTAATTTAACATATTTT

TATTTTTCAGGCTAACCTAAAGCAGAGAA

S065 (RNA)
GGGAGACCUCAUAUCCAGGCUCAAGAAUAGAGCUCAGUG
42

UUUUGUUGUUUAAUCAUUCCGACGUGUUUUGCGAUAUU

CGCGCAAAGCAGCCAGUCGCGCGCUUGCUUUUAAGUAGA

GUUGUUUUUCCACCCGUUUGCCAGGCAUCUUUAAUUUAA

CAUAUUUUUAUUUUUCAGGCUAACCUAAAGCAGAGAA

combo3_S065
GGGAGACCTCATATCCAGGCTCAAGAATAGAGCTCAGTGT
91

(S065 core
TTTGTTGTTTAATCATTCCGACGTGTTTTGCGATATTCGCG

extended Kozak)
CAAAGCAGCCAGTCGCGCGCTTGCTTTTAAGTAGAGTTGT

(DNA)
TTTTCCACCCGTTTGCCAGGCATCTTTAATTTAACATATTTT

TATTTTTCAGGCTAACCTACGCCGCCACC

combo3_S065
GGGAGACCUCAUAUCCAGGCUCAAGAAUAGAGCUCAGUG
39

(S065 core
UUUUGUUGUUUAAUCAUUCCGACGUGUUUUGCGAUAUU

extended Kozak)
CGCGCAAAGCAGCCAGUCGCGCGCUUGCUUUUAAGUAGA

(RNA)
GUUGUUUUUCCACCCGUUUGCCAGGCAUCUUUAAUUUAA

CAUAUUUUUAUUUUUCAGGCUAACCUACGCCGCCACC

In other aspects, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 37 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 38 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 40 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 41 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

Exemplary 5′ UTRs comprising C-rich RNA elements, and combinations with GC-rich elements, provided by the disclosure are set forth in Table 6. These 5′ UTRs are useful in the mRNAs of the disclosure.

TABLE 6

Exemplary 5′ UTRs with C-Rich RNA Elements

(C-rich RNA element in underlined; Kozak

bracketed)

SEQ

ID

5′UTR
Sequence
NO

combo1_S065
GGGAAACCCCCCACCCCCGCCUCAUAUCCAGGCUC
37

AAGAAUAGAGCUCAGUGUUUUGUUGUUUAAUCA

UUCCGACGUGUUUUGCGAUAUUCGCGCAAAGCAG

CCAGUCGCGCGCUUGCUUUUAAGUAGAGUUGUUU

UUCCACCCGUUUGCCAGGCAUCUUUAAUUUAACA

UAUUUUUAUUUUUCAGGCUAACCUAAAGCAGAGA

A

combo2_S065
GGGAAAUCCCCACAACCGCCUCAUAUCCAGGCUC
38

AAGAAUAGAGCUCAGUGUUUUGUUGUUUAAUCA

UUCCGACGUGUUUUGCGAUAUUCGCGCAAAGCAG

CCAGUCGCGCGCUUGCUUUUAAGUAGAGUUGUUU

UUCCACCCGUUUGCCAGGCAUCUUUAAUUUAACA

UAUUUUUAUUUUUCAGGCUAACCUAAAGCAGAGA

A

combo4_S065
GGGAAACCCCCCACCCCCGCCUCAUAUCCAGGCUC
40

AAGAAUAGAGCUCAGUGUUUUGUUGUUUAAUCA

UUCCGACGUGUUUUGCGAUAUUCGCGCAAAGCAG

CCAGUCGCGCGCUUGCUUUUAAGUAGAGUUGUUU

UUCCACCCGUUUGCCAGGCAUCUUUAAUUUAACA

UAUUUUUAUUUUUCAGGCUAACCUACGCC[GCCAC

C]

combo5_S065
GGGAAAUCCCCACAACCGCCUCAUAUCCAGGCUC
41

AAGAAUAGAGCUCAGUGUUUUGUUGUUUAAUCA

UUCCGACGUGUUUUGCGAUAUUCGCGCAAAGCAG

CCAGUCGCGCGCUUGCUUUUAAGUAGAGUUGUUU

UUCCACCCGUUUGCCAGGCAUCUUUAAUUUAACA

UAUUUUUAUUUUUCAGGCUAACCUACGCC[GCCAC

C]

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 35 in which a C-rich RNA element and a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 36 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

In one aspect, the mRNA of the disclosure comprises a 5′ UTRs comprising the nucleotide set forth in SEQ ID NO: 44 in which a C-rich RNA element and, optionally, a GC-rich RNA element is inserted.

Exemplary 5′ UTRs comprising C-rich RNA elements, and combinations with GC-rich elements, provided by the disclosure are set forth in Table 7. These 5′ UTRs are useful in the mRNAs of the disclosure.

TABLE 7

Exemplary 5′ UTRs with C-Rich RNA Elements and GC-Rich RNA Elements

(GC-Rich Elements italicized; C-rich RNA element in underlined;

Kozak bracketed)

SEQ ID

5′UTR
Sequence
NO

combo1_V1.1
GGGAAACCCCCCACCCCCGGGGAAAUAAGAGAGAA
35

AAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCC

[GCCACC]

combo2_V1.1
GGGAAAUCCCCACAACCGGGGAAAUAAGAGAGAAA
36

AGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCC

[GCCACC]

CrichCR4 + GCC3-
GGGAAACCCCCCUAAGCCGCCGCCGCC[GCCACC]
44

ExtKozak

5′ UTRs Comprising Combinations of RNA Elements

In some aspects, the disclosure provides mRNAs having RNA elements (e.g., C-rich RNA elements, GC-rich RNA elements, and/or structural RNA elements) which provide a desired translational regulatory activity to the mRNA. In one aspect, the mRNAs of the disclosure comprise a 5′ UTR described herein to which a C-rich RNA element, a GC-rich RNA element, a structural RNA element, or a combination thereof, described herein is added or inserted, wherein the addition of the C-rich RNA element, the GC-rich RNA element, the structural RNA element, or the combination thereof, provides one or more translational regulatory activities described herein (e.g., inhibition of leaky scanning).

In some embodiments, an mRNA provided by the disclosure comprises a 5′ UTR comprising a C-rich RNA element described herein, wherein the C-rich RNA element provides one or more translational regulatory activities described herein (e.g., inhibition of leaky scanning). In some embodiments, an mRNA provided by the disclosure comprises a 5′ UTR comprising a C-rich RNA element and a GC-rich RNA element of the disclosure, wherein the C-rich RNA element and GC-rich RNA element provide one or more translational regulatory activities described herein (e.g., inhibition of leaky scanning). In some embodiments, an mRNA provided by the disclosure comprises a 5′ UTR comprising a combination of a C-rich RNA element, a GC-rich RNA element, and a structural RNA element comprising a stem loop of the disclosure, wherein the combination provides one or more translational regulatory activities described herein (e.g., inhibition of leaky scanning).

Translational regulatory activities provided by the C-rich RNA element, the GC-rich RNA element, the structural RNA element, or combination thereof, includes promoting translation of only one open reading frame encoding a desired polypeptide or translation product, or reducing, inhibiting or eliminating the failure to initiate translation of the therapeutic protein or peptide at a desired initiator codon, as a consequence of leaky scanning or other mechanisms.

In some embodiments, the mRNAs of the disclosure comprise a 5′ UTR to which a C-rich RNA element, a GC-rich RNA element, a structural RNA element, or a combination thereof, described herein, is added or inserted, thereby reducing leaky scanning of the 5′ UTR by the cellular translation machinery. In some embodiments, the mRNAs provided by the disclosure comprise a core 5′ UTR nucleotide sequence to which a C-rich RNA element, a GC-rich RNA element, a structural RNA element, or a combination thereof, described herein is added, thereby reducing leaky scanning of the 5′ UTR by the cellular translation machinery. In some embodiments, the core 5′ UTR comprises the nucleotide sequence set forth in SEQ ID NO: 45. In some embodiments, the core 5′ UTR comprises the nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the core 5′ UTR comprises the nucleotide sequence set forth in SEQ ID NO: 46.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide set forth in SEQ ID NO: 8 in which a GC-rich RNA element and a structural RNA element described herein are inserted. In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide set forth in SEQ ID NO: 45 in which a GC-rich RNA element and a structural RNA element described herein are inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 46 in which a GC-rich RNA element and a structural RNA element described herein are inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 42 in which a GC-rich RNA element and a structural RNA element described herein are inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 39 in which a GC-rich RNA element and a structural RNA element described herein are inserted.

In one aspect, an mRNA of the disclosure comprises: a 5′ cap, a 5′ untranslated region (5′ UTR), a Kozak-like sequence, an initiation codon, a full open reading frame (ORF) encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a structural RNA element described herein and a GC-rich RNA element described herein inserted within the 5′ UTR comprising the nucleotide sequence of SEQ ID NO: 45.

In one aspect, an mRNA of the disclosure comprises: a 5′ cap, a 5′ untranslated region (5′ UTR), a Kozak-like sequence, an initiation codon, a full open reading frame (ORF) encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a structural RNA element comprising the nucleotide sequence of SEQ ID NO: 6 and a GC-rich RNA element comprising the nucleotide sequence of SEQ ID NO: 1 inserted within the 5′ UTR comprising the nucleotide sequence of SEQ ID NO: 45.

In one aspect, an mRNA of the disclosure comprises: a 5′ cap, a 5′ untranslated region (5′ UTR), a Kozak-like sequence, an initiation codon, a full open reading frame (ORF) encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a structural RNA element described herein, a GC-rich RNA element described herein, and a C-rich RNA element described herein inserted within the 5′ UTR comprising the nucleotide sequence of SEQ ID NO: 45.

In one aspect, the disclosure provides an mRNA comprising a 5′ cap, a 5′ untranslated region (5′ UTR), a Kozak-like sequence, an initiation codon, a full open reading frame (ORF) encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a structural RNA element comprising the nucleotide sequence of SEQ ID NO: 6, a GC-rich RNA element comprising the nucleotide sequence of SEQ ID NO: 1, and a C-rich RNA element comprising the nucleotide sequence selected from the group consisting of: SEQ ID NO: 31 and SEQ ID NO: 33 inserted within the 5′ UTR comprising the nucleotide sequence of SEQ ID NO: 45.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 4 in which a structural RNA element described herein is inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 62 in which a structural RNA element described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising a nucleotide sequence selected from SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 in which a structural RNA element described herein is inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 43 in which a structural RNA element described herein is inserted.

In another aspect, the disclosure provides an mRNA comprising a 5′ cap, a 5′ untranslated region (5′ UTR), a Kozak-like sequence, an initiation codon, a full open reading frame (ORF) encoding a polypeptide, and a 3′ UTR, wherein the 5′ UTR comprises a structural RNA element comprising the nucleotide sequence of SEQ ID NO: 6 inserted within the 5′ UTR comprising the nucleotide sequence of SEQ ID NO: 4

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide set forth in SEQ ID NO: 8 in which a C-rich RNA element and a structural RNA element described herein are inserted. In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide set forth in SEQ ID NO: 45 in which a C-rich RNA element and a structural RNA element described herein are inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 46 in which a C-rich RNA element and a structural RNA element described herein are inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 42 in which a C-rich RNA element and a structural RNA element described herein are inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 39 in which a C-rich RNA element and a structural RNA element described herein are inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 37 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 38 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 40 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 41 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide set forth in SEQ ID NO: 8 in which a GC-rich RNA element, a C-rich RNA element, and a structural RNA element described herein are inserted. In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide set forth in SEQ ID NO: 45 in which a GC-rich RNA element, a C-rich RNA element, and a structural RNA element described herein are inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 46 in which a GC-rich RNA element, a C-rich RNA element, and a structural RNA element described herein are inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 42 in which a GC-rich RNA element, a C-rich RNA element, and a structural RNA element described herein are inserted.

In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 39 in which a GC-rich RNA element, a C-rich RNA element, and a structural RNA element described herein are inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 4 in which a C-rich RNA element and a structural RNA element described herein is inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 62 in which a C-rich RNA element and a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising a nucleotide sequence selected from SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16 in which a C-rich RNA element and a structural RNA element described herein is inserted. In another aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 43 in which a C-rich RNA element and a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 37 in which a GC-rich RNA element and a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 38 in which a GC-rich RNA element and a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 40 in which a GC-rich RNA element and a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 41 in which a GC-rich RNA element and a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 35 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 36 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 44 in which a structural RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 116 in which a C-rich RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 120 in which a C-rich RNA element comprising a stem loop described herein is inserted.

In one aspect, an mRNA of the disclosure comprises a 5′ UTR comprising the nucleotide sequence set forth in SEQ ID NO: 124 in which a C-rich RNA element comprising a stem loop described herein is inserted.

Exemplary 5′ UTRs comprising GC-rich RNA elements, and combinations with structural RNA elements, provided by the disclosure are set forth in Table 8. These 5′ UTRs are useful in the mRNAs of the disclosure.

TABLE 8

Exemplary 5′UTRs with GC-Rich RNA Elements and Structural RNA Elements

SEQ

5′ UTRs
Sequence
ID NO

F856,
GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGA
115

RNAseP_p1

TCTCCCTGAGCTTCAGGGAG
CCCCGGCGCCGCCACC

(DNA)

F856,
GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAG
116

RNAseP_p1
AUCUCCCUGAGCUUCAGGGAGCCCCGGCGCCGCCACC

(RNA)

RNAseP_p2
GGGAAATCTCCCTGAGCTTCAGGGAGTAAGAGAGAAAAGA
119

(DNA)
AGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC

RNAseP_p2
GGGAAAUCUCCCUGAGCUUCAGGGAGUAAGAGAGAAAAGA
120

(RNA)
AGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC

RNAseP_p3
GGGAAATAAGAGAGAAAAGAAGATCTCCCTGAGCTTCAGG
123

(DNA)

GAGGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC

RNAseP_p3
GGGAAAUAAGAGAGAAAAGAAGAUCUCCCUGAGCUUCAGG
124

(RNA)

GA
GGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC

(GC-rich RNA Elements italicized; Structural RNA Elements bold)

Polynucleotides Comprising Functional RNA Elements in the 3′UTR

In some aspects, the present disclosure provides mRNAs comprising a 3′UTR that comprises a nucleotide sequence that is substantially identical (e.g., about 50%, 60%, 70%, 80%, 90% or about 100% identical) to a 3′UTR of a naturally-occurring mRNA, or a fragment or a variant thereof. In some embodiments, the naturally-occurring mRNA encodes a nuclear encoded mitochondrial protein (NEMP). A 3′UTR comprising a nucleotide sequence that is substantially identical (e.g., about 50%, 60%, 70%, 80%, 90% or about 100% identical) to a 3′UTR of a naturally-occurring mRNA that encodes NEMP, or a fragment or variant thereof, is referred to herein as a “NEMP-derived 3′UTR”.

Mitochondria are sub-cellular organelles that play a central role in many metabolic pathways and are essential for energy production. Nearly all mitochondrial proteins are NEMPs (e.g., mitochondrial proteins encoded by nuclear genes). Most are synthesized on cytosolic ribosomes as precursor polypeptides and are subsequently transported into the mitochondria. NEMPs that are imported into the mitochondria following translation comprise a short N-terminal extensions known as a “mitochondrial targeting sequence” (MTS) that mediates recognition and import of the protein into the mitochondria. Sorting of mRNAs encoding mitochondrial proteins to the mitochondria facilitates the expression and/or functionality of mitochondrial proteins inside the mitochondria.

However, some NEMPs (e.g., Sod2, fumarase) are translated on polysomes bound to the mitochondria and are imported co-translationally (Corral-Debrinski et al., (2000) Mol Cell Biol 20(21):7881-7892; Luk et al., (2005) J Biol Chem 280:22715-22720; Yogev et al., (2007) J Biol Chem 282:29222-29229). Specific signals within the NEMP 3′ untranslated region (UTR) are thought to target the mRNAs to the mitochondria for translation by mitochondria-bound polysomes (Margeout et al (2005) Gene 354:64-71; Corral-Debrinski et al (2000) Mol Cell Biol. 20:7881-7892; Margeot et al (2002) EMBO J 21:6893-6904). While in no way bound by theory, signals in NEMP-derived 3′UTRs that mediate import to the mitochondria are thought to comprise RNA elements, for example an RNA element that is a specific sequence of the 3′UTR or specific structural element of the 3′UTR. Such RNA elements are thought improve mRNA expression level and activity of encoded protein by regulating the stabilization, localization and/or translation of an mRNA comprising the NEMP-derived 3′UTR.

In some embodiments, an mRNA of the disclosure comprises a NEMP-derived 3′UTR wherein the 3′UTR comprises one or more RNA elements that regulates the stabilization of an mRNA. In some embodiments, an RNA element of the NEMP-derived 3′UTR binds to one or more RNA-binding proteins, wherein binding of a 3′UTR to one or more RNA-binding proteins promotes the stabilization, localization, or translation of an mRNA comprising the NEMP-derived 3′UTR. In some embodiments, an RNA element of the NEMP-derived 3′UTR blocks an interaction with one or more RNA-binding proteins, wherein blocking an interaction of the 3′UTR with one or more RNA-binding proteins promotes the stabilization, localization, or translation of an mRNA comprising the NEMP-derived 3′UTR.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR comprises one or more RNA elements that regulates the localization of the mRNA. In a non-limiting example, the one or more RNA elements binds to an RNA-binding protein of the cytoskeleton, thereby mediating trafficking of the mRNA to a subcellular location. In another non-limiting example, the one or more RNA elements binds to an RNA-binding protein that is a cellular membrane protein, thereby mediating retention of the mRNA at a subcellular location.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR comprises one or more RNA elements that regulates the translation of the mRNA. In a non-limiting example, the one or more RNA elements binds to an RNA-binding protein of the translational machinery (e.g., a 43S pre-initiation complex, a ribosome, a polysome), thereby facilitating translation of the mRNA.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR comprises one or more RNA elements that regulates the stability of the mRNA. In a non-limiting example, the one or more RNA elements binds to an RNA-binding protein that prevents mRNA degradation, thereby increasing stability of the mRNA transcript. In another non-limiting example, the one or more RNA elements blocks an interaction with an RNA-binding protein that functions in a pathway to promote mRNA degradation, thereby increasing stability of the mRNA transcript.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR comprises one or more RNA elements that binds to an RNA-binding protein of known function (e.g., identified by a public database such as one described by Berglund et al. (2008) Nucleic Acids Res 36:D263-266). In some embodiments, the RNA-binding protein is known to promote mRNA localization (e.g., a cytoskeletal RNA-binding protein, a membrane-bound RNA-binding protein). In some embodiments, the RNA-binding protein is known to promote mRNA stability. In some embodiments, the RNA-binding protein is known to promote mRNA translation (e.g., a RNA-binding protein of the translational machinery). Methods of identifying interactions between an RNA element and an RNA-binding protein are known in the art. In some embodiments, a method of identifying an interaction comprises first immobilizing a polynucleotide (e.g., an RNA, an mRNA, an mRNA UTR) comprising the RNA element and subsequently incubating the immobilized polynucleotide with cellular extracts. Following incubation, proteins bound to the immobilized polynucleotide are characterized by a method of quantitative mass-spectrometry as described by Butter, et al (2009) Proc Natl Acad Sci USA 106:10626-10631 and Tsvetanova, et al (2010) PLos ONE 5:e12671, incorporated herein by reference. In some embodiments, a method of identifying an interaction comprises preparation of an array of RNA-binding proteins and subsequently incubating the array with a fluorescently tagged polynucleotide (e.g., an RNA, an mRNA, an mRNA UTR). The fluorescent intensity of each individual protein spot is used to quantify binding affinity of each protein in the array for the fluorescently tagged polynucleotide as described by Scherrer, et al (2010) PLoS ONE 5:e15499, incorporated herein by reference.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP that regulates the localization of the mRNA, whereby regulation of mRNA localization increases or enhances expression and/or activity of a protein encoded by the mRNA. In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP that promotes stability of the mRNA, whereby increased mRNA stability increases or enhances expression and/or activity of a protein encoded by the mRNA. In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP that promotes translation of the mRNA, whereby increased mRNA translation increases or enhances expression and/or activity of a protein encoded by the mRNA.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR wherein the nucleotide sequence of the 3′UTR is substantially identical to the nucleotide sequence of a 3′ UTR derived from an mRNA encoding a NEMP. In some embodiments, an mRNA of the disclosure comprises a 3′ UTR wherein the nucleotide sequence of the 3′UTR is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of a 3′ UTR derived from an mRNA encoding a NEMP.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from a naturally-occurring mRNA encoding a NEMP, wherein the 3′UTR differs from the naturally-occurring 3′UTR by one or more nucleotide substitutions. In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from a naturally-occurring mRNA encoding a NEMP, wherein the 3′UTR differs from the naturally-occurring 3′UTR by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides. In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from a naturally-occurring mRNA encoding a NEMP, wherein the 3′UTR differs from the naturally-occurring 3′UTR by 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 or about 50 or more nucleotides.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR is about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 300 nucleotides, about 500 nucleotides, about 1000 nucleotides, about 1500 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 100-200 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 100 nucleotides, about 105 nucleotides, about 110 nucleotides, about 115 nucleotides, about 120 nucleotides, about 125 nucleotides, about 130 nucleotides, about 135 nucleotides, about 140 nucleotides, about 145 nucleotides, about 150 nucleotides, about 155 nucleotides, about 160 nucleotides, about 165 nucleotides, about 170 nucleotides, about 175 nucleotides, about 180 nucleotides, about 185 nucleotides, about 190 nucleotides, about 195 nucleotides, or about 200 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 200-400 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 200 nucleotides, about 220 nucleotides, about 240 nucleotides, about 260 nucleotides, about 280 nucleotides, about 300 nucleotides, about 320 nucleotides, about 340 nucleotides, about 360 nucleotides, about 380 nucleotides, or about 400 nucleotides in length. In some embodiments, the mitochondrial targeting 3′ UTR is about 400-1000 nucleotides in length. In some embodiments, the mitochondrial targeting 3′ UTR is about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, about 900 nucleotides, or about 1000 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 1000-1500 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 1100 nucleotides, about 1200 nucleotides, about 1300 nucleotides, about 1400 nucleotides, or about 1500 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 138 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 166 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 167 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 233 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 371 nucleotides in length. In some embodiments the NEMP-derived 3′ UTR is about 1155 nucleotides in length. In some embodiments, the NEMP-derived 3′ UTR is about 1371 nucleotides in length.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR is encoded by a gene encoding a NEMP and wherein the gene is selected from the group consisting of: human OXAL1, human MRPS12, and mouse Sod2.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR comprising a nucleotide sequence that is substantially identical to a 3′UTR of an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′UTR comprises a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 72.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein the 3′ UTR comprises one or more miRNA binding sites, such as those described herein. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p.

In some embodiments, the miRNA binding site that binds to miR-142-3p comprises a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 179. In some embodiments, the miRNA binding site that binds to miR-142-3p comprises a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 181.

In some embodiments, an mRNA of the disclosure comprises a 3′UTR derived from an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises one or more miRNA binding sites at any location in the 3′UTR. In some embodiments, the one or more miRNA binding sites are located proximal to the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located downstream of and immediately adjacent to the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located about 45-50, about 40-45, about 35-40, about 30-35, about 25-30, about 20-25, about 15-20, about 10-15, about 6-10 nucleotides, about 1-5 nucleotide(s), or about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 15, about 10 or about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located about 5, about 4, about 3, about 2, or about 1 nucleotide(s) downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 5 nucleotides downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 6 nucleotides downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 7 nucleotides downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 8 nucleotides downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 9 nucleotides downstream of the one or more stop codons at the 5′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 10 nucleotides downstream of the one or more stop codons at the 5′end of the 3′UTR.

In some embodiments, the one or more miRNA binding sites are located proximal the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located upstream of and immediately adjacent to the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located about 1-5, about 6-10, about 10-15, about 15-20, about 20-25, about 25-30, about 30-35, about 35-40, about 40-45, or about 45-50 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotide(s) upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located about 1, about 2, about 3, about 4, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 nucleotide(s) upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located about 1, about 2, about 3, about 4, or about 5 nucleotide(s) upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 6 nucleotides upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 7 nucleotides upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 8 nucleotides upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 9 nucleotides upstream of the 3′end of the 3′UTR. In some embodiments, the one or more miRNA binding sites are located 10 nucleotides upstream of the 3′end of the 3′UTR.

In some embodiments, an mRNA of the disclosure comprises a 3′UTR derived from an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miRNA binding site(s). In some embodiments, the NEMP-derived 3′UTR comprises one miRNA binding site. In some embodiments, the NEMP-derived 3′UTR comprises two miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises three miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises four miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises five miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises six miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises seven miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises eight miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises nine miRNA binding sites. In some embodiments, the NEMP-derived 3′UTR comprises ten miRNA binding sites.

In some embodiments, an mRNA of the disclosure comprises a 3′UTR derived from an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) miRNA binding sites that bind to a miRNA selected from a group consisting of: miR-142-3p, miR-142-5p, miR-122-3p, or miR-122-5p. In some embodiments, the one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) miRNA binding site(s) bind to miR-142-3p. In some embodiments, the 3′UTR comprises one miRNA binding site that binds to miR-142-3p. In some embodiments, the 3′UTR comprises two miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises three miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises four miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises five miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises six miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises seven miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises eight miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises nine miRNA binding sites that bind to miR-142-3p. In some embodiments, the 3′UTR comprises ten miRNA binding sites that bind to miR-142-3p.

In some embodiments, an mRNA of the disclosure comprises a 3′UTR derived from an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) miRNA binding sites, wherein an upstream miRNA binding site is located directly adjacent to one or more downstream miRNA binding site(s). In some embodiments, the more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) miRNA binding sites comprise intervening nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 1-5, about 1-10, about 5-10, about 5-15, about 10-20, about 15-20, about 15-30, or about 20-30 nucleotide(s) or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide(s). In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 1, about 2, about 3, about 4, about 5, about 10, about 15, about 20, about 25, or about 30 nucleotide(s). In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 3 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 4 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 5 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 6 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 7 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 8 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 9 nucleotides. In some embodiments, an upstream miRNA binding site is separate from a downstream miRNA binding site by about 10 nucleotides.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 78 and wherein the 3′UTR comprises one or more miRNA binding sites (e.g., a miR-142-3p binding site). In some embodiments, the 3′UTR comprises one or more miRNA binding sites (e.g., a miR-142-3p binding site) proximal to the 3′end, wherein the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 170. In some embodiments, the 3′UTR comprises one or more miRNA binding sites (e.g., a miR-142-3p binding site) proximal to one or more stop codons at the 5′end, wherein the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 172.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, or a fragment or variant thereof, wherein the 3′UTR comprises a nucleotide sequence at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 76 and wherein the 3′UTR comprises one or more miRNA binding sites (e.g., a miR-142-3p binding site). In some embodiments, the 3′UTR comprises one or more miRNA binding sites (e.g., a miR-142-3p binding site) proximal to the 3′end, wherein the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 174. In some embodiments, the 3′UTR comprises one or more miRNA binding sites (e.g., a miR-142-3p binding site) proximal to one or more stop codons at the 5′end, wherein the 3′UTR comprises the nucleotide sequence of SEQ ID NO: 176.

In some embodiments, the NEMP-derived 3′ UTR comprises one or more (e.g., 1, 2, 3 or 4) different modified nucleobases, nucleosides, or nucleotides, such as those described herein.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein expression of a polypeptide encoded by the mRNA is increased relative to an equivalent mRNA comprising a 3′UTR with a nucleotide sequence identified by SEQ ID NO: 150 or SEQ ID NO: 70. In some embodiments, the expression level is increased by at least about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold or more. In some embodiments, activity is increased by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15% about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.

In some embodiments, an mRNA of the disclosure comprises a 3′ UTR derived from an mRNA encoding a NEMP, wherein activity of a polypeptide encoded by the mRNA is increased relative to an equivalent mRNA comprising a 3′UTR with a nucleotide sequence identified by SEQ ID NO: 150 or SEQ ID NO: 70. In some embodiments, activity is increased by at least about 1-fold, about 2-fold, about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold or more. In some embodiments, activity is increased by about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15% about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%.

Exemplary mRNAs Comprising Functional RNA Elements

In some embodiments, the disclosure provides an mRNA comprising one or more mitochondrial targeting elements, wherein the mRNA comprises a 5′ untranslated region (5′UTR), an open reading frame (ORF) encoding a polypeptide of interest, and a 3′UTR, wherein the 5′UTR comprises one or more RNA elements of the disclosure and/or wherein the 3′UTR comprises the nucleotide sequence of a 3′UTR of a naturally-occurring mRNA encoding a nuclear encoded mitochondrial protein (NEMP), or a fragment or variant thereof. In some embodiments, the 5′UTR comprises one or more structural RNA elements comprising a stem-loop (e.g., an RNAse P stem loop). In some embodiments, the 3′ UTR comprises the nucleotide sequence of a 3′UTR derived from a naturally-occurring mRNA encoding a NEMP, or a fragment or variant thereof. In some embodiments, the 5′UTR comprises one or more structural RNA elements comprising a stem-loop (e.g., an RNAse P stem loop), and the 3′UTR comprises the nucleotide sequence of a 3′UTR derived from a naturally-occurring mRNA encoding a NEMP, or a fragment or variant thereof.