FIGS. 1 to 3 show the schematic course of different embodiments of the method of the invention for the synthesis of nucleic acids;
FIGS. 4 to 38 show schematic courses of different embodiments of the method of the present invention for the selection of a target molecule binding nucleic acid using the method of the invention for the synthesis of nucleic acids;
FIG. 39 shows schematically the performance of an amplification cycle using the method of the invention for the synthesis of nucleic acids and the result of an analysis of the method by means of PAGE;
FIG. 40 shows the result of a PAGE analysis on the stability of enzymatically prepared combinatorial FNA and DNA libraries;
FIG. 41 shows the result of a PAGE analysis on the stability of enzymatically prepared combinatorial FNA and 2′-F-pyrimidine RNA libraries compared to RNase T1 and RNase I;
FIG. 42 shows the result of a PAGE analysis on the stability of enzymatically prepared combinatorial FNA and RNA libraries in human serum; and
FIG. 43 shows the selection course of the in vitro selection described in example 1.
FIG. 1 shows the basic course of a synthesis of nucleic acids, in particular FNA, using a reverse transcriptase. More specifically, starting from a template strand of RNA, a primer is annealed or hybridized to the 3′ end of the template strand consisting of RNA, such that a free 3′ OH end is available which is extended under the influence of the reverse transcriptase and the 2′-F-NTPs used in the particular example, and the addition of an appropriate buffer to the 5′ end of the template strand, accordingly. The primer is in the present case a FNA. The double-stranded nucleic acid molecule obtained in this way is subsequently further treated to remove the template strand. Such treatment can be a cleavage under alkaline conditions and heat (300 mM sodium hydroxide solution, 10 min at 95° C.) which results in digestion of the RNA constituents of the double-stranded nucleic acid and only leaves the synthetic nucleic acid strand which, in the present case, consists completely of FNTP.
FIG. 2 shows an alternative method of FIG. 1 for the synthesis of a nucleic acid, in particular of FNA. In this embodiment a primer consisting of RNA is used. The template sequence consisting of RNA must in this case be extended at its 3′ end by further nucleotides so as to allow for the RNA primer to hybridize thereto. Preferably this extension comprises a stretch of 10 to 25 nucleotides. After reverse transcription by means of a reverse transcriptase, the template strand and the RNA primer present at the synthesized nucleic acid strand are removed, for example by alkaline hydrolysis or an RNase digestion.
FIG. 3 shows a further embodiment of the method of the invention for the synthesis of a nucleic acid as depicted in FIG. 1. Similar to the method described in FIG. 2 a primer is used which is different from an FNA primer. Specifically, a DNA primer having at least one ribonucleotide is used. The DNA primer can additionally contain further ribonucleotides, whereby, however, it is essential that a ribonucleotide is present at the 3′ end of the DNA primer. Also in this case the template strand consisting of RNA comprises a further sequence at its 3′ end which allows for the hybridization of the primer thereto. The RNA template strand is removed by the methods and measures described in connection with FIGS. 1 and 2. The primer is removed from the newly synthesized FNA strand by means of alkaline hydrolysis of the ribonucleotide attached to the 3′ end, and can be subsequently removed, for example, by gel purification, molecular sieve or gel filtration.
FIG. 4 shows a schematic for the performing of an in vitro selection process which integrates the method of the invention for the synthesis of a nucleic acid. After the selection of suitable FNA species these are transcribed into complementary DNA (cDNA) by reverse transcription using dNTPs. For the amplification of the sequences a PCR and an in vitro transcription are performed next. Prior to the subsequent FNA synthesis the dNTPs, NTPs and primers are removed which originate from the PCR and in vitro transcription and which interfere with FNA synthesis. After the FNA synthesis the FNA is purified by, for example, denaturing PAGE or alkaline hydrolysis of the template strand. During the alkaline hydrolysis of the template strand, the forward synthesis primer can be cleaved off from the FNA at the same time, provided that it does not also consist of FNA.
FIGS. 5 to 8 show the course of an amplification method with a transcription step as, for example, can be used in an in vitro selection process as depicted in FIG. 4.
In particular FIG. 5 shows the synthesis of cDNA by means of reverse transcriptase such as, for example, Superscript II (Invitrogen) starting from the selected 2′-F oligonucleotides. These 2′-F oligonucleotides may represent the heterogeneous population of nucleic acids as used in an in vitro selection process. The oligonucleotides which are also referred to herein as starting nucleic acid, have a first constant sequence at the 5′ end and a second constant sequence at the 3′ end flanking the randomized region or the randomized sequence. The first constant sequence of the nucleic acid comprises a forward primer sequence and the second constant sequence comprises a reverse primer binding site. It is preferred that the first constant sequence is the forward primer sequence and the second constant sequence is the reverse primer sequence. The reverse primer composed of DNA consists of two partial regions. The first partial region contains or comprises the sequence binding to the reverse primer binding site, and the second partial region contains or comprises a promoter for an RNA polymerase. In a reaction comprising the reverse primer, buffer as well as dNTPs and a reverse transcriptase, a cDNA strand is thus formed and the starting strand, i.e. the fluoro strand is extended by dNTPs.
FIG. 6 shows the course of a second strand synthesis step which is embodied as a polymerase chain reaction. In connection therewith there is an amplification of the cDNA and in particular also an amplification of the reverse transcription product which is referred to in FIG. 5 also as “R” strand. Apart from the reverse primer additionally a forward primer and a DNA polymerase, preferably a thermostable DNA polymerase, are used. The F-primer binds to the F-primer binding site of the reverse transcription product and allows the synthesis of the second strand starting therefrom.
FIG. 7 shows an in vitro transcription of the reverse strand of the PCR product as RNA the synthesis of which is described in FIG. 6. As a template for this transcription the forward strand of the PCR product referred to as “F” is used. The RNA polymerase promoter region, in the particular region a T7 promoter, is not transcribed. As a result, a ribonucleic acid is obtained which is complementary to the used nucleic acid as depicted in partial step (l) of FIG. 5, i.e. the starting nucleic acid.
FIG. 8 finally shows the FNA synthesis using an FNA primer which is referred to herein as FS primer. The reaction contains, apart from the FS primer, 2′-F-NTPs as well as a reverse transcriptase such as, for example, Superscript II of Invitrogen. The forward synthesis primer hybridizes to the forward primer binding site of the transcription product consisting of RNA and which also serves as template strand (FIG. 7) and which allows the synthesis of an FNA nucleic acid strand which is essentially complementary to the sequence of the reverse transcription product which has been amplified in the meantime. The template strand is, in the present case, removed by alkaline hydrolysis or an RNase digestion. Optionally, FNA purification as well as labeling and optionally a further selection round follow.
FIGS. 9 to 12 show a method for a possible amplification with a transcription step, whereby an RNA or RNA-DNA primer is used instead of a primer consisting of FNA. The reaction course is essentially identical to the reaction course depicted in FIGS. 5 to 8, whereby, however, there are some differences as presented in the following.
FIG. 9 shows a reverse transcription of the selected FNA molecule, i.e. the starting nucleic acid, which is performed under the same conditions as the reaction shown in FIG. 5.
FIG. 10 shows the PCR amplification of the cDNA with the reverse primer and a forward primer which, first, comprises a sequence at the 3′ end which is essentially complementary to the forward primer binding site of the reverse transcript, and additionally comprises a further partial region at the 5′ end, whereby this further partial region corresponds to the sequence of the forward synthesis primer as used for the reverse transcription in connection with the FNA synthesis.
FIG. 11 shows the in vitro transcription of the PCR product counterstrand. The (F) strand is used as a template. A suitable RNA polymerase such as, for example, T7-RNA polymerase, and NTPs are added to the reaction and a transcription product is obtained which comprises in 3′→5′ direction a forward primer binding site, the region complementary to the randomized region as well as a reverse primer sequence. As a result this strand is extended on the one hand at its 3′ end compared to the complementary strand of the nucleic acid used in FIG. 9 (step (l), (F)) by the region which is complementary to the further region of the forward primer and, on the other hand, the region of the reverse primer which, at the 5′ end, extends beyond the region complementary to the reverse primer binding site, is not contained in the molecule.
FIG. 12 shows the FNA synthesis with a reverse transcriptase such as, for example, Superscript II (Invitrogen) and 2′-F-NTPs. A ribonucleotide or a deoxyribonucleotide having at least one 3′ terminal ribonucleotide is used as a primer the sequence of which is identical to the sequence of the 5′ overhanging region of the forward primer, i.e. the further partial region of the forward primer. The template strand and the primer are separated from the FNA by alkaline hydrolysis. This single-stranded FNA nucleic acid can then be used in further selection rounds.
FIGS. 13 to 18 show the procedure for amplification of FNAs in a selection scheme, where the starting nucleic acid, apart from the randomized region, comprises only comparatively short regions flanking the randomized region, which is advantageous in the selection and allows in particular the truncation of the target molecule binding nucleic acids primarily obtained in a selection. This special embodiment of the selection method is also referred to herein as primer ligation (STAR-FNA selection 1).
FIG. 13 shows an overview of a cyclic process consisting of selection, primer ligation, amplification, FNA synthesis and FNA purification.
FIG. 14 shows in (l) the nucleic acid typically used as starting material in a selection process. The nucleic acid, in the present case, consists of FNA and has, apart from the randomized region at the 5′ end, a partial region which comprises a first constant sequence and at the 3′ end a further partial region containing a second constant sequence. The lengths of these sequences are in principle not limited in the methods described herein. However, a length of 4, 5 or 6 nucleotides is preferred, whereby more preferably the lengths of both constant sequences are identical; in principle, however, they may also be different. The nucleic acids forming the heterogeneous population differ in the randomized sequence. The nucleic acid may comprise at its 5′ end an OH group or a phosphate. The phosphate is of critical importance for the subsequent steps and is typically introduced at the 5′ end of the nucleic acid after the selection step by phosphorylation. The 5′ phosphorylation occurs in a suitable ligation buffer upon addition of ATP and, for example, a T4 polynucleotide kinase, whereby also other enzymes are suitable for such kinase reaction. In order to obtain in the subsequent steps a yield as high as possible, a kinase reaction as complete as possible is desired.
The nucleic acid having at its 5′ end a phosphate group, is subsequently modified. This modification uses two adapter molecules. The first adapter molecule consists of a double-stranded nucleic acid of a first and a second nucleic acid strand, whereby the first strands of the first and of the second adapter molecules are DNA, RNA or FNA, preferably DNA, the second nucleic acid strand is a deoxyribonucleic acid and the 5′ end of the second nucleic acid strand provides for an overhang, whereby the overhang is at least partially complementary to the first constant partial sequence of the nucleic acid of step (a) and/or (d), i.e. the starting nucleic acid. The second adapter molecule also consists of a double-stranded nucleic acid and also comprises a first and a second nucleic acid strand, whereby the first nucleic acid strand carries a 5′ phosphate and the second nucleic acid strand is a deoxyribonucleic acid and the 3′ end of the second nucleic acid strand provides for an overhang which is at least partially complementary to the second constant partial sequence of the starting nucleic acid shown in FIG. 14 (1) and FIG. 14 (2), respectively. Preferably both the first as well as the second nucleic acid strand of both the first and the second adapter molecule are made of deoxyribonucleic acid.
FIG. 15 shows the ligation of the first and the second adapter molecule to the nucleic acid which is used in the selection process as starting nucleic acid. The first nucleic acid strand of the first and the second adapter molecule is ligated to the starting nucleic acid by using a ligase. A suitable ligase is, for example, the T4-DNA ligase (MBI Fermentas). The thus obtained ligation product consists of the starting nucleic acid to the 5′ end of which the first nucleic acid strand of the first adapter molecule, also referred to herein as forward primer, is covalently bound and to the 3′ end of which the first nucleic acid strand of the second adapter molecule, also referred to herein as reverse ligate, is bound. The respective second nucleic acid strands of the first and of the second adapter molecule are, in accordance with their complementarity, hybridized to the corresponding first nucleic acid strand of the first and the second adapter molecule and with their corresponding overhangs to the corresponding first and second partial sequence of the starting nucleic acid. The reverse primer contains a promoter for an RNA polymerase which is located 5′ to the overhanging sequence comprising in the present case four nucleotides.
FIG. 16 shows the reverse transcription of the (F)-strand, i.e. the starting nucleic acid extended by the respective first nucleic acid strand of the first and the second adapter. All reverse transcriptases as described herein may be used as reverse transcriptases for such purpose, for example, Superscript II (Invitrogen). The synthesis of the starting nucleic acid which is extended by the two respective first nucleic acid strands, starts from the 3′ end of the reverse primer. The second nucleic acid strand of the first adapter molecule dissociates during reverse transcription. Subsequently, and upon addition of a suitable buffer as well as dNTPs, an amplification reaction such as a polymerase chain reaction is performed using suitable DNA polymerases. Thermostable DNA polymerases such as, for example, the Taq-DNA polymerase (Roche), are particularly preferred for such purpose. This amplification reaction results in an amplification of both the extended starting nucleic acid as well as, due to the reverse transcription, the nucleic acid strand complementary thereto. Both strands are preferably hybridized.
The reverse strand of the double-stranded amplification product is, as depicted in FIG. 17, subject to an in vitro transcription. The extended starting nucleic acid serves as a template for the transcription which is performed upon addition of suitable buffers, NTPs as well as an RNA polymerase. At the end, a transcription product is obtained which comprises in 3′→5′ direction a sequence which is complementary to the first strand of the first adapter molecule, a sequence which is complementary to the first constant partial sequence of the starting nucleic acid, a sequence which is complementary to the randomized region of the starting nucleic acid, and a region which is complementary to the second constant partial sequence of the starting nucleic acid. This product is subsequently subjected to a nucleic acid synthesis (FIG. 18) adding a forward synthesis primer consisting of RNA, which is also referred to herein as FS primer having the sequence of the first nucleic acid strand of the first adapter molecule, modified nucleoside phosphates, in the present case 2′-F-NTPs, as well as a reverse transcriptase, whereby all reverse transcriptases disclosed herein are, in principle, suitable reverse transcriptases. At the end of the reaction a double-stranded nucleic acid is obtained, whereby one strand corresponds to the transcription product and the other is complementary thereto. The transcription product consists of ribonucleic acid, whereas the synthesis product synthesized by the reverse transcriptase consists in the region of the FS primer of RNA and the subsequent region of modified nucleoside phosphates, in particular 2′-F nucleoside phosphates. Alternatively, a primer having an identical sequence consisting of DNA and the 3′ terminal nucleotide of which is a ribonucleotide, can be used instead of the FS primer consisting of RNA. The RNA components of this double-stranded nucleic acid are digested, for example, by alkaline cleavage or RNase activity, and ultimately a single-stranded nucleic acid is obtained which corresponds to the starting nucleic acid or, due to possible incorporation errors of the used enzymes, corresponds essentially thereto. The thus obtained nucleic acid can again be introduced into the selection process and can be used as starting nucleic acid there, respectively.
FIGS. 19-25 shows an alternative approach for the amplification of FNAs using the method of the present invention for the synthesis of nucleic acids, in particular also how such method can be incorporated into an in vitro selection process. In contrast to the embodiment depicted in FIGS. 5 to 12, there is no in vitro transcription in this embodiment.
FIG. 19 shows an overview of the cyclic process comprising the following steps: selection, reverse transcription, PCR amplification, FNA synthesis and FNA isolation. FIGS. 20 to 22 show the method using a forward synthesis primer consisting of FNA, and FIGS. 23 to 25 show the method using a forward synthesis primer consisting of DNA or RNA.
In principle, it is to be acknowledged that the method is performed in a manner similar to the one described in FIGS. 5 to 12, whereby skipping the transcription step results in some changes as explained in more detail in the following.
FIG. 20 shows the synthesis of cDNA by means of reverse transcription starting from selected 2′-F-oligonucleotides, i.e. the starting nucleic acid, whereby a reverse primer is used hybridizing to the reverse primer binding site of the nucleic acid to be amplified. In contrast to the method shown in FIGS. 5 to 8, here the primer is lacking the region which acts as RNA polymerase promoter. A cDNA strand is obtained as reaction product of the reverse transcriptase which is complementary to the FNA strand used.
The polymerase chain reaction depicted in FIG. 21 which, apart from the second strand synthesis, also provides for amplification, also includes the reverse primer as well as a forward primer which is, in principle, designed similar to the one used in connection with the polymerase chain reaction of the method according to FIG. 6. The cDNA, i.e. the reaction product of the reverse transcriptase is thus amplified. The excess primer as well as nucleotides used in the PCR reaction are subsequently removed, for example by a molecular sieve. The synthesis of FNA nucleic acid is, as depicted in FIG. 22, subsequently carried out by reverse transcriptase of the (R)-strand of the PCR product consisting of DNA, whereby this R-strand is essentially complementary to the nucleic acid to be amplified and depicted in step 1 of FIG. 20, i.e. the starting nucleic acid. The R-strand of the PCR serves as template. The synthesis of the FNA occurs by means of a reverse transcriptase, an FNA primer and 2′-F-NTPs. The template strand is digested by DNase and the fragments and nucleotide, respectively, are removed. The thus obtained reaction product corresponds to the amplified nucleic acid and can be introduced into a subsequent selection round accordingly.
FIG. 23 shows the synthesis of cDNA by means of reverse transcriptase starting from the selected 2′-F-oligonucleotides, i.e. the starting nucleic acid. A cDNA strand is obtained as reaction product. In contrast to the procedure shown in FIG. 9 which still comprises a transcription step, in this embodiment of the invention it is envisaged that the reverse primer consists of the partial region only, which hybridizes to the reverse primer binding site (FIG. 14). A region which contains a promoter for a RNA polymerase, is typically absent.
Two primers are used in the following polymerase chain reaction (FIG. 24) which is for the amplification of the cDNA, namely a forward primer and the reverse primer. The forward primer has at its 5′-end a further partial region which corresponds to the forward synthesis primer which, later, is used in the synthesis step using reverse transcriptase. The excess dNTPs as well as the primer are removed following the PCR, for example by molecular sieve.
FIG. 25 finally shows the synthesis of the FNA by reverse transcription. In this embodiment, the forward synthesis primer will consist of RNA or a mixture of DNA/RNA, whereby the 3′-end of the forward synthesis primer must exhibit one ribonucleotide. The primer must, least at the 3′-end, be identical to the further partial region of the forward primer. After the reverse transcription reaction an alkaline hydrolysis or an RNase digestion is performed in order to remove the RNA components of the double-strand and to, thus, obtain the single-stranded FNA. If the forward synthesis primer consists of DNA, it is to be removed by a separate treatment, for example by DNase treatment, in order to obtain an amplification product which corresponds to the nucleic acid molecule shown in step 1 of FIG. 23 which is to be amplified.
FIG. 26 to 29 show a further amplification method for modified oligonucleotide, in particular 2′-fluoro oligonucleotides, using the method of the invention for the synthesis of nucleic acid, whereby, essentially, a reverse transcriptase activity and a thermocycling are realized.
FIG. 26 shows the reaction sequence for the amplification of 2′-fluoro oligonucleotides within an in vitro selection process. It only consists of the repeated copying of the FNA by means of reverse transcriptase, preferably a thermostable reverse transcriptase, such as, for example, the DNA polymerase of Thermus thermophilus. Alternatively, also a device can be provided, where the reverse transcriptase is immobilized, whereby the FNA strands are denatured, and which specially separates therefrom primer-dependent synthesis of new strands at low temperature. This can, for example, be realized by a system consisting of two independent incubation vessels which are linked to each other. In such system the synthesized FNA, i.e. both the product as well as the starting material, is cycled in a buffer in the presence of FNTPs and primers, namely the forward synthesis primer and the biotinylated reverse primer, and, respectively, moved between the vessels. In the first vessel the temperature of which is the reaction temperature (for example 42-51° C.) the immobilized reverse transcriptase is contained which copies the present FNA molecules. The resulting double strands are subsequently separated from each other at high temperature of 95-99° C. in the second vessel and cooled down on their way to the first reaction vessel. As an alternative to immobilization, also a molecular sieve can be mounted at the exit of the reaction vessel in which the enzyme is contained, which retains the reverse transcriptase.
FIG. 27 shows the amplification of FNA by thermocycling with FNTPs, a reverse transcriptase and a suitable forward primer consisting of FNA, and a reverse primer consisting of DNA. The reaction contains, apart from the primer, also 2′-F-NTPs as well as a reverse transcriptase such as, for example, Superscript II of Invitrogen. The reverse primer consists of DNA and can, due to its complementarity to the reverse primer binding site of the nucleic acid to be amplified, i.e. the starting nucleic acid, hybridize thereto. The reverse primer has, in the present case, a label at the 5′-end which allows immobilization to a surface. In the present case the label is biotin which may interact with streptavidine immobilized to a surface, and may thus immobilize the primer and the molecule and moiety associated therewith to the surface, respectively. A double-stranded nucleic acid molecule is the result of the reverse transcription, whereby a strand which is also referred to herein as (F)-strand, corresponds to the nucleic acid molecule to be amplified, and the second strand is complementary thereto and is referred to as (R)-strand. The FNA primer hybridizes to the forward primer binding site of the (R)-strand of the first and subsequently copied (F)-strand, respectively, which consists of FNA and acts as template strand.
The thus obtained double-stranded product is immobilized to a streptavidine comprising matrix by means of the label on the complementary strand as shown in FIG. 28. As an alternative, neutravidine can, for example, be used instead of streptavidine. Suitable surfaces are, for example, agaroses, the surface of vessels or the surface of beads, in particular magnetic beads. The non-incorporated forward primer and NTPs may thus be washed away from the reaction. For releasing the desired amplified acid molecule which corresponds to the one shown in FIG. 27, partial step (l), an elution is performed by, for example, NaOH of the desired amplification product, i.e. the strands corresponding to the nucleic acid shown in partial step (l) of FIG. 27.
FIGS. 29 to 34 show the amplification of FNA sequences having only a few, i.e. typically four to six known nucleotides at each end of the randomized region by using the STAR-technology described in FIGS. 13 to 18, and is a further embodiment thereof, whereby in this embodiment the in vitro transcription step is not performed. The particular steps consist of a kinase reaction and ligation, reverse transcription, polymerase chain reaction, alkaline cleavage of the counterstrand, synthesis of the FNA as well as DNase digestion of the counterstrand in order to obtain a nucleic acid which corresponds in its basis design to the starting nucleic acid as used in the selection.
FIG. 30 (1) shows again the design of the nucleic acids used as starting population in connection with the in vitro selection, as it is also described in FIG. 14 (1). The further shown step of a 5′-phosphorylation of this starting nucleic acid corresponds to the method described in connection with FIG. 14.
The ligation method shown in FIG. 31 shows the ligation of the first and the second adapter molecule which each consist of a first and a second nucleic acid strand. In the present case, both adapter molecules consists of DNA, whereby the second strand of the second adapter molecule comprises a cleavage site in the form of the ribonucleotide which allows for a cleavage of the nucleic acid strand using alkali and optionally heat. The design of the first and the second adapter molecule and the corresponding nucleic acid strands, respectively, otherwise corresponds to the design described in connection with FIG. 15. In a way similar to the method described in connection with FIG. 15 a DNA ligase, preferably a T4-DNA-ligase, can be used as the ligase. The nucleic acid strands are, similar to the ones of FIG. 15, preferably blocked at the 3′-end, for example by the terminal nucleotides being 2′-3′-dideoxynucleotides. The cleavage site is arranged such that it results in a dissociation of the second nucleic acid strand of the second adapter molecule at the 5′-end of that partial region of the nucleic acid strand of the second adapter molecule which hybridizes to the second constant sequence of the starting nucleic acid. The product obtained from this reaction consists, first, of the starting nucleic acid at the 5′-end of which the first nucleic acid strand of the first adapter molecule is ligated, and at the 3′-end of which the first nucleic acid strand of the second adapter molecule is ligated, whereby the second nucleic acid strand of the first adapter molecule is hybridized to the first nucleic acid strand of the first adapter molecule now ligated to the starting nucleic acid, as well as the first constant partial sequence thereof, and the second nucleic acid strand of the second adapter molecule is hybridized to the first nucleic acid strand of the second adapter molecule and the second constant partial sequence of the starting nucleic acid, whereby in this double-stranded nucleic acid the randomized region of the starting nucleic acid is not contained.
As depicted in FIG. 32, starting from the ligation product, i.e. the starting nucleic acid which is ligated with the first nucleic acid strands of the first and the second adapter molecule, a cDNA is synthesized by means as reverse transcriptase using the reverse primer. The cDNA strand comprises the cleavage site due to the use of the second nucleic acid strand of the adapter molecule. The reverse transcription is followed by an amplification reaction, in particular a polymerase chain reaction, whereby the first nucleic acid strand of the first adapter molecule as well as the second nucleic acid strand of the second adapter molecule are used as primers, whereby a suitable polymerase, in particular a DNA polymerase and more preferably a thermostable DNA polymerase is added to the reaction which subsequently incorporates the nucleotides. The second strand of the first adapter molecule is removed from the ligation product during reverse transcription. At the end of the amplification reaction a double-stranded nucleic acid is obtained, whereby such nucleic acid corresponds in its design to the ligation product and the strand complementary thereto. Subsequently, the part of the complementary strand is cleaved off by alkali treatment and heat treatment which is not complementary to the second constant sequence at the 3′-end of the starting nucleic acid. The primer as well as the dNTPs are then removed (FIG. 33).
FIG. 34 shows the FNA synthesis with a forward synthesis primer using RNA, 2′-F-NTPs and a reverse transcriptase. The single-stranded nucleic acid obtained in the preceding step serves as template strand from which the part of the second nucleic acid strand of the second adapter molecule is removed which does not hybridize with the second constant partial region. The thus synthesized strand comprises the sequence of the forward synthesis primer consisting of RNA, the first constant partial sequence, the randomized region as well as the second partial sequence of the starting nucleic acid. This strand is present as a complex with the template strand which consists of DNA and which can be removed by subsequent DNase treatment. The sequence of the forward synthesis primer is subsequently removed by treatment with RNase or alkali at increased temperature or a combination of both, in order to obtain a nucleic acid which essentially corresponds to the starting nucleic acid.
FIGS. 35 to 38 show the method of the invention for the amplification of single-stranded DNA (ssDNA), incorporated into the context of an in vitro selection. The method starts with an amplification of the ssDNA by PCR serving as starting nucleic acid whereby, under the proviso that there is enough material, it can be replaced by a second strand synthesis, followed by an amplification of the counterstrand which is effected by an in vitro transcription. The transcription product subsequently serves as template for the synthesis of the ssDNA by means of a reverse transcriptase, a DNA primer and dNTPs. The template of the reverse transcription can be disassembled in its mononucleosides (2′-3′-cyclic phosphate, 5′-OH) by alkaline hydrolysis. These mononucleosides can easily be removed from the DNA strand by, for example, filtration with a molecular sieve, alcoholic precipitation with linear polyacrylamid and ammonium acetate.
FIG. 36 shows the PCR amplification of the ssDNA to be amplified (forward strand). The reverse primer contains a 5′-overhang portion containing the T7-RNA polymerase promoter. The PCR product consists of a forward and a reverse strand.
FIG. 37 shows the in vitro transcription of the reverse strand, whereby the forward strand acts as a template for the RNA synthesis. The promoter region is not transcribed. Subsequently, the PCR product and excess primers are digested.
FIG. 38 shows the synthesis of the single-stranded DNA at the RNA template by means of a reverse transcriptase, a suitable DNA primer and dNTPs. A template is subsequently hydrolyzed by lye and heat, so that single-stranded DNA has to be purified from nucleotides only, but not from a counterstrand of similar or identical length.
FIG. 39 shows the experiment of performing an amplification cycle with the steps of FNA selection 1. The starting material was a RNA library. Such RNA library was then transcribed into an FNA library (having a DNA primer at the 5′-end) by reverse transcriptase with a DNA primer and FNTPs. After reverse transcription with dNTPs and an overhanging reverse primer (the T7-RNA-polymerase promoter region forms an overhang) a PCR was performed. The PCR product was subsequently used again as starting material for in vitro transcription. By doing so the cycle was completed. The reactions are described in more detail in example 1 under the heading “FNA library for performing the amplification cycle”.
FIG. 40 shows the DNase stability of an FNA library which was previously prepared by means of reverse transcriptase from RNA. The DNA/RNA primer was removed from the FNA by alkaline hydrolysis prior to DNase incubation. Upon incubation for the same period of time FNA is significantly more than 100× stable to DNase as a similarly long DNA which had been prepared in the same manner. The reaction is described in example 1 under the heading “Synthesis of the FNA library for stability studies” and in example 2 under the heading “DNase I stability”.
FIG. 41 shows the stability towards RNase T1 and RNase I of an FNA library prepared by reverse transcriptase, and of a 2′-F-pyrimidine RNA prepared by in vitro transcription. The reaction is described in example 3 “RNase stability”.
FIG. 42 shows the stability in human serum of the FNA library prepared by reverse transcriptase and of an RNA prepared by in vitro transcription. The reaction is described in example 4 under the heading “RNase stability”.
FIG. 43 shows the selection course of the in vitro selection described in example 1.
EXAMPLE 1
Use of FNA for the Selection of Protein-Binding Nucleic Acids for Validation of the Procedure
For the herein described experiments the itemized materials were used whereby a detailed specification of the suppliers of itemized substances, solutions and enzyme is cited in the corresponding text passage. Unless otherwise indicated the reagents were purchased from Merck (Darmstadt, Germany). In all cases LiChromosolv water from Merck (Darmstadt, Germany) was used.
The protein (basic, pI of 9; molecular mass of 9 kDa, do not bind to nucleic acids per se) used for in vitro selection was labeled according to the manufacturer's instructions with a biotin linker at least one of the accessible amino groups of the amino acids using the Biotinylation-Kit “EZ-Link Sulfo-NHS-LC-LC-Biotin” (Pierce, Rockford, USA). Thus, the separation of unbound nucleic acids using the biotin-streptavidine- or biotin-neutravidine-linkage can be realized. For this purpose the selection matrices neutravidine agarose and “UltraLink Plus” immobilized streptavidine gel (both purchased from Pierce, Rockford, USA) was used. Excess linker was removed according to the manufacturer's instructions with a molecular sieve, the filter device “YM-3” (molecular cut-off limit of MW 3000, Amicon/Milliore, Bedford, USA).
The used oligonucleotides such as primers and die initial DNA library were synthesized by standard phosphoramidite chemistry at NOXXON Pharma AG. The sequences can be found in Example 6.
Synthesis of the FNA Library
Synthesis of the Template for the FNA-Synthesis: Fill-In Reaction+In Vitro Transcription
At first 3 nmol of a synthetic DNA library BSA-1C initial library was converted into double-stranded DNA by a Fill-in-reaction using the BSA 1C-Reverse Primer T7 and the Vent-(exo−)-DNA polymerase (NEB, Frankfurt a.M., Germany). By using this reaction with the BSA 1C-Reverse Primer T7 the T7 RNA polymerase promoter was incorporated.
Fill-In-Reaction
|
Component
final concentration
|
|
10x buffer (NEB)
1x
|
Betain
0.5 M
|
dNTPs (Larova, Teltow, Germany)
0.5 mM
|
BSA-1C Reverse Primer T7
6 μM
|
BSA-1C initial library
2 μM
|
Vent-(exo−)-DNA polymerase (NEB)
10 U/l00 μlreaction volume
|
|
At first the batch without enzyme was denatured at 95° C. for 10 min. and cooled for 5 minutes on ice. Then the enzyme was added and the batch was incubated for two hours at 63° C.
Afterwards the dsDNA was desalted by ethanol precipitation (20 μg GlycoBlue (Ambion) and 2.5 vol. absolute ethanol, 30 min at −80° C.; centrifugation at 13200 rpm (16100 g) for 30 minutes at 4° C.; the pellet was once washed with 70% ethanol).
The dsDNA library was used as template for in vitro transcription.
In Vitro Transcription
|
Component
final concentration
|
|
Transcription buffer (80 mM HEPES/KOH,
1x
|
pH 7.5, 22 mM MgCl2; 1 mM Spermidin)
|
DTT
10 mM
|
NTPs (Larova, Teltow, Germany)
4.0 mM
|
RNaseOUT (Invitrogen, Carlsbad, USA)
1 μl/100 μlreaction volume
|
Fill-in reaction product
1 μM
|
T7 RNA polymerase
50 U/100 μlreaction volume
|
(Stratagene, La Jolla, USA)
|
|
Incubation: 2 to 12 hours at 37° C.
|
Subsequent to the in vitro transcription the remaining dsDNA template was digested with 20 units DNAse I (Sigma) for 20 min at 37° C. After addition of loading buffer (7M urea, xylene cyanol, bromphenol blue) the batch was denatured and gel-purified (10% denaturing polyacrylamide gel). The band of the transcript was detected by UV-Shadowing, cut off from the gel and eluted by the Crush-and-Soak method. The resultant eluate was precipitated in ethanol, the pellet washed once with ice-cold 70% ethanol and resuspended in water.
The RNA library was used as template for FNA-synthesis using a reverse transcriptase.
FNA-Synthesis and Labeling of the FNA
FNA-Synthesis
|
final
|
Component
concentration
|
|
RNA library
1 μM
|
BSA-1C FS Primer 3rG
5 μM
|
Q-solution (Qiagen, Hilden, Germany)
1x
|
5 min at 95° C., 5 min on ice
|
1st strand buffer (Invitrogen, Carlsbad, USA)
1x
|
DTT (Invitrogen, Carlsbad, USA)
10 mM
|
FNTPs (TriLink Biotech, San Diego, USA)
0.5 mM
|
|
Superscript II (Invitrogen, Carlsbad, USA)
|
Temperature program:
|
|
|
1. 51° C.
20 min
|
2. 54° C.
10 min
|
|
Subsequent to the FNA-synthesis the template-strand (RNA) was hydrolyzed under alkaline conditions.
Alkaline Hydrolysis of the Template Strand
|
Component
final concentration
|
|
Reaction product of the FNA-synthesis
total
|
NaOH
0.3 M
|
10 min at 95° C., 5 min on ice
|
NaOAc
0.1 M
|
HCl for neutralization
0.3 M
|
|
Afterwards the FNA library was desalted by ethanol precipitation (20 μg GlycoBlue (Ambion) and 2.5 Vol. absolute ethanol, 30 min at −80° C.; centrifugation at 13200 rpm (16100 g) for 30 minutes at 4° C.; the pellet was once washed with 70% ethanol). After addition of loading buffer (7M urea, xylene cyanol, bromphenol blue) the batch was denatured and gel-purified (10% denaturing polyacrylamide gel). The band of the FNA was detected by UV-Shadowing, cut off from the gel and eluted by the Crush-and-Soak method. The resultant eluate was precipitated in ethanol, the pellet washed once with ice-cold 70% ethanol and resuspended in water.
In order to detect the binding of the FNA library during the in vitro selection, the 5′-OH— group of the FNA library was radioactively labeled with 32P by performing a kinase reaction.
Labeling of the FNA
|
Component
final concentration
|
|
FNA
10 μM
|
“Forward”-buffer (Invitrogen)
1x
|
γ-32PATP
1 μl/10 μlreaction volume
|
T4 polynucleotide kinase (Invitrogen)
1 U/μreaction volume
|
|
The reaction was run at 37° C. for one hour and was stopped at 65° C. (10 min).
After addition of loading buffer (7M urea, xylene cyanol, bromphenol blue) the reaction was denatured and gel-purified (10% denaturing polyacrylamide gel). The FNA was detected by UV-Shadowing, cut off from the gel and eluted by the Crush-and-Soak method. The resultant eluate was precipitated in ethanol, the pellet washed once with ice-cold 70% ethanol and resuspended in water.
Selection Steps
Denaturation and Folding of the FNA
All non-enzymatic steps of the selection (except for the denaturation step) were carried out in selection buffer (20 mM Tris pH 7.4; 150 mM NaCl; 4 mM KCl; 1 mM MgCl2 (all from Ambion, Austin, USA); 1 mM CaCl2 (Merck, Darmstadt, Germany) and 0.1% Tween-20 (Roche Diagnostics, Mannheim, Germany). The denaturation step was carried out for five minutes at 95° C. in selection buffer. Subsequent to the denaturation step the FNA was cooled down to 37° C. for 15 minutes at 37° C.
Binding Reaction
Subsequent to the folding, the FNA was at first incubated with the selection matrix (either with neutravidine agarose or with “UltraLink Plus” immobilized streptavidin, both from Pierce, USA) without protein at 37° C. for 30 minutes. This so-called “pre-selection” was done in order to remove potentially matrix binding molecules. After this incubation step the selection matrix was sedimented and the non-bound FNA in the supernatant was separated. An aliquot of the FNA was incubated with the biotinylated protein for one hour at 37° C. The other aliquot of the FNA was incubated without protein for one hour at 37° C. Subsequently, the biotin-binding selection matrix was added to the binding reaction. After incubation for 30 min at 37° C. the selection matrix including the complexes of protein and FNA bound thereto, was separated from the solution by centrifugation and washed with selection buffer.
Elution of Bound FNA Molecules
The FNA which remained on the selection matrix after the washing step was eluted twice from the matrix material with 200 μl 8 M urea/10 mM EDTA (both from Ambion, Austin, USA), respectively. The first elution step was carried out for 15 minutes at 65° C., the second elution was done at 95° C. To the eluted FNA 400 μl of a mixture of phenol/(chloroform/isoamylalcohol) (1:(1:1/24)) (Applichem, Darmstadt, Germany) was added, the mixture was centrifuged for 5 min at 13000 rpm at room temperature. The aqueous phase (supernatent) was recovered, the phenolic phase was once re-extracted with 100 μl water, the aqueous phases were combined and shaken with 500 μl of a mixture of chloroform and isoamylyalcohol (24:1) (Applichem, Darmstadt, Germany), centrifuged for 5 min at 13000 rpm room temperature and the upper aqueous phase was separated.
Thereupon the aqueous phase was ethanol-precipitated (2.5 fold volume of absolute ethanol (Merck, Darmstadt, Germany), 0.3 M sodium acetate, pH 5.5 (Ambion, Austin, USA) and 1 μl glycogen (Roche Diagnostics, Mannheim, Germany)) for 30 min at −80° C. and centrifuged for 30 min at 14000 rpm (4° C.). The pellet was washed once with ice-cold 70% ethanol (Merck, Darmstadt, Germany).
Amplification
Synthesis of the cDNA
In order to amplify the FNA library via a PCR reaction the FNA was transcribed into DNA.
cDNA-Synthesis
|
final
|
Component
concentration
|
|
FNA resulting of selection
max. 0.5 μM
|
BSA-1C Reverse Primer T7
2.5 μM
|
Q-solution (Qiagen, Hilden, Germany)
1x
|
5 min at 95° C., 5 min on ice
|
1st strand buffer (Invitrogen, Carlsbad, USA)
1x
|
DTT
10 mM
|
dNTPs (Larova, Teltow, Germany)
0.5 mM
|
Superscript II (Invitrogen, Carlsbad, USA)
20 U/μl
|
|
|
Temperature program:
|
|
|
1. 51° C.
20 min
|
2. 54° C.
10 min
|
3. 4° C.
infinite
|
|
PCR
|
Component
final concentration
|
|
PCR buffer (NEB)
1x
|
BSA-1C Forward-Primer
5 μM
|
BSA-1C Reverse Primer T7
5 μM
|
dNTPs (Larova, Teltow, Germany)
0.2 mM
|
vent-(exo−)-DNA polymerase (NEB)
0.05 U/μl
|
cDNA
0.1-0.5 μM
|
|
|
Temperature program:
|
|
|
1. 95° C.
4 min
|
2. 95° C.
1 min
|
3. 68° C.
1 min
|
4. 72° C.
1 min
|
5. Go to 2
11x
|
6. 72° C.
6 min
|
7. 4° C.
until stop
|
|
In order to prepare the dsDNA for the following in vitro transcription, the DNA was ethanol-precipitated.
Subsequently, the RNA that had been synthesized by in vitro transcription, was transcribed into FNA. The RNA that was used as template and the BSA-1C FS-Primer 3rG were fragmented by alkaline hydrolysis and removed using a molecular sieve (YM-filter units, Amicon/Millipore, Bedford, USA). The FNA was radioactively labeled (as described). The thus enriched FNA library was used in the next selection round.
The products of the amplification steps to be performed during one selection round are depicted in FIG. 39. For this purpose aliquots of the products of the respective reactions were separated by denaturing polyacrylamide gel electrophoresis (10% polyacrylamide, 39:1 bis-acrylamide 7 M urea, 1×TBE) and visualized by UV-transillumination after incubation with ethidium bromide. 5 pmole of the RNA template and one aliquot of the FNA-synthesis after alkaline hydrolysis of the template strand (that in case of 100% conversion correspond to 5 pmole) were loaded on the gel. Furthermore approximately 5 pmole of the PCR-reaction and 0.5 μl of the final transcription were loaded onto the gel (FIG. 39).
Course of Selection
During selection radioactively labeled FNA was used and the binding was calculated as percentage based on the utilized amount of FNA. The radioactivity was determined with a scintillation counter (Beckman, Fullerton, USA). The course of selection is depicted in FIG. 43. After four rounds of selection, a target-specific enrichment (0.89% in the presence of the protein) with a factor of 1.85 compared to the control (0.48% in the absence of protein) could be detected for the first time.
EXAMPLE 2
Synthesis of a FNA, DNA, 2′-F-Pyrimidine RNA and RNA Library for Stability Studies
FNA Library/DNA Library
At first the synthetic DNA library BSA-1A initial library was converted into double-stranded DNA by a Fill-in-reaction using the BSA 1A-Reverse Primer 77. Then the dsDNA was used in the in vitro transcription. BSA-1A FS-Primer 3rG+15 was used as a primer for the FNA synthesis of the FNA library. Subsequent to the FNA synthesis the RNA template strand and the primer were removed by alkaline hydrolysis which led to an FNA library consisting of 63 nucleotides including 40 randomized nucleotides at its 5′-end ((N)40-CACGAGTGAAGTCTGAGCTCC-3′). Finally the sample was precipitated with ethanol for de-salting the sample. The components and reaction conditions correspond to the previous described protocols for FNA-synthesis, alkaline hydrolysis and ethanol precipitation.
For comparison DNA was synthesized in parallel. Instead of the FNA-synthesis a DNA-synthesis according to protocol of the FNA-synthesis was carried out, whereby the FNTPs were substituted for dNTPs (for protocols of all reactions using the herein specified oligonucleotides, see Example 1)
RNA/2′-F-Pyrimidine RNA Library
As additional controls libraries consisting of RNA and 2′-F-pyrimidine RNA were used. The libraries were synthesized by in vitro transcription. Starting from the BSA-1A initial library a PCR reaction using the BSA-1 FS-Primer 3′G and the BSA1 Reverse Primer T7 was carried out (protocol, see Example 1) and the PCR-product was subjected to an alkaline hydrolysis (in a manner analogous to the description in Example 1 for the alkaline hydrolysis subsequent to the FNA-synthesis) and an in vitro transcription was carried out for the synthesis of the RNA library (protocol, see Example 1) and for the synthesis of a 2′-F-pyrimidine library (protocol, see in the following) (length of the libraries: 63 nucleotides). To avoid any undesired inhibition of the RNases by the RNase-inhibitor “RNaseOut” (Invitrogen), the RNase inhibitor was removed by phenol chloroform extraction and subsequent ethanol precipitation.
Die 2′-F-pyrimidine synthesis was carried out as follows:
|
Component
final concentration
|
|
Txn-buffer with 6 mM MgCl2 (Epicentre, Madison,
1x
|
USA)
|
DTT (Merck, Darmstadt, Germany)
10 mM
|
MgCl2 (Ambion, Austin, USA)
5 mM
|
ATP (Larova, Teltow, Germany)
1.5 mM
|
GTP (Larova, Teltow, Germany)
1.5 mM
|
2′-F-CTP (TriLink Biotech, San Diego, USA)
1.5 mM
|
2′-F-UTP (Noxxon Pharma AG, Berlin, Germany)
1.5 mM
|
PCR-product BSA-1A Pool
1 μM
|
T7 R&DNA-polymerase (Epicentre, Madison, USA)
1.5 U/μl
|
|
Incubation: 4 to 12 hours at 37° C.
|
EXAMPLE 3
DNase I Stability
Each 4 pmole of the FNA library and likewise synthesized DNA library (see Example 2) were incubated for 5 min at 37° C. in 10 μl of a buffer (100 mM NaOAc, 5 mM MgCl2) including different amounts of DNase I (Sigma) according to the manufacturer's instructions. The dilutions of DNase I were prepared in the same buffer immediately prior to their use.
The DNase digestion was stopped by addition of 6 M urea/15 mM EDTA and by a denaturation step (10 min at 95° C.).
The samples were separated on a 10% denaturing polyacrylamide gel and visualized by a UV-transilluminator upon staining with ethidium bromide (FIG. 40). It was shown that FNA is at least 100 fold more stable against DNase I-digestion than DNA.
EXAMPLE 4
RNase Stability
For further characterization of the FNA the RNase stability of the enzymatically synthesized FNA library was determined and compared to RNA and to 2′-F-pyrimidine RNA (synthesis, see Example 2). Each 4 pmole of the FNA library, RNA or 2′-pyrimidine RNA library were incubated according to the manufacturer's instructions for 30 min at 37° C. in 10 μl of a buffer including different amounts of RNase T1 (1-1000 units) and RNase I (0.1-100 units). The RNase T1 originates from Aspergillus oryzae and cleaves after Gs. RNase I originates from E. coli and cleaves RNA in an unspecific manner. Both RNases were recombinantly produced in E. coli by Ambion (Austin, Tex., USA). RNase T1 buffer: 10 mM Tris, pH 8, 100 mM NaCl; RNase I buffer: 50 mM Tris, pH 7.5, 1 mM EDTA.
The reaction was stopped by addition of 20 μl STOP-solution (2% SDS, 50 mM EDTA, 6 M urea) and quick-freeze in a mixture of dry ice and ethanol. In the following the samples were stored on ice until denaturation (5 min at 95° C.), were quickly cooled on ice after denaturation and loaded onto an analytical denaturing 10% polyacrylamide gel.
After separation by gel electrophoresis the bands were stained with ethidium bromide and visualized under UV light on a UV-transilluminator (FIG. 41). In contrast to 2′-F-pyrimidine RNA and RNA (not shown) FNA was not cleaved by the specified RNases under the chosen reaction conditions.
EXAMPLE 5
Stability of FNA in Serum
The stability of FNA and RNA (for the synthesis, see Example 2) to serum nucleases was tested in human serum. In order to minimize pH-shifts in the course of the experiment (4 days) 50 mM sodium phosphate buffer was added to the serum. Each 4 pmole of nucleic acid were incubated in 20 μl batches with 14 μl human serum (70% serum) at 37° C. for a length of time as depicted in FIG. 42. After expiration of the reaction time 20 μl STOP-solution (2% SDS, 50 mM EDTA, 6 M urea) were added, the samples were quick-freezed in a bath of ethanol and dry ice and stored at −80° C. until the end of the experiment. In the course of the 96 hours experiment the pH-value of the buffered serum shifted from pH 7.4 to pH 8.5. On the last day of the experiment the samples were extracted with phenol chloroform. All work steps were carried out on ice or in a cooled centrifuge (4° C.). The samples were denatured for 5 min. at 95° C., cooled down on ice and loaded on a 10% denaturing polyacrylamide gel. After separation by gel electrophoresis the bands were stained with ethidium bromide and visualized by UV-light. As depicted in FIG. 42. in contrast to RNA, FNA is not affected by nucleases in the serum under the chosen reaction conditions.
EXAMPLE 6
Oligonucleotides as Used
For the different reactions as they were used in the examples the following oligonucleotides were used.
FNA-Selection 1
FNA-Selection 1 with FS Primer Consisting of FNA (A)
underlined: T7 RNA polymerase promoter or SP6 RNA polymerase promoter
NOH: Ribo-nucleotide
BSA-1A FNA-Pool (FNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
BSA-1A initial Library (DNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTG-N40CACGAGTGAAGTCTGAGCTCC
|
|
BSA-1A Forward Primer (DNA, 20 nt)
|
GTG GAA CCG ACA GTG GTA CG
|
|
BSA-1A FS-Primer (FNA, for FNA-synthesis, 20 nt)
|
GTG GAA CCG ACA GTG GTA CG
|
|
BSA1 Reverse Primer T7 (DNA, 38 nt)
|
TCT AAT ACG ACT CAC TAT AGG AGC TCA GAC TTC ACT CG
|
used for different tests:
BSA1 FS-Primer 3′rG (DNA, 15 nt)
|
5′-ACC GAC AGT GGT ACGOH-3′
|
|
BSA1 FS Primer 3rG + 15 (DNA, 35 nt)
|
GTC CTA CCGOH TCA GAT GOHTG GAA CCGOH ACA GTGOH
|
|
GTA CGOH
|
FNA Selection 1 (B and C) with FS Primer Consisting of RNA or DNA
(using two overlapping primers and a Forward Synthesis Primer consisting of RNA or of DNA with a 3′-terminal ribo-nucleotide)
underlined: T7 RNA polymerase promoter or SP6 RNA polymerase promoter
NOH: ribo-nucleotide
BSA-1B FNA-Pool (FNA, 74 nt)
|
ACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
BSA-1B initial Library (DNA, 87 nt)
|
TGATGTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGC
|
|
TCC
|
|
BSA-1B Forward Primer (DNA, 24 nt)
|
TGA TGT GGA ACC GAC AGT GGT ACG TG
|
|
BSA-1B Reverse Primer T7 (DNA, 38 nt)
|
TCT AAT ACG ACT CAC TAT AGG AGC TCA GAC TTC ACT CG
|
|
BSA-1B FS-Primer (RNA, 13 nt)
|
UGA UGU GGA ACC G
|
|
BSA-1B FS-Primer (DNA with ribo-nucleotides,
|
13 nt)
|
TGA TG UOH GGA ACC GOH
|
|
BSA-1C FNA-Pool (FNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTGN40CACGAGTGAAGTCTGAGCTCC
|
|
BSA-1C initial Library (DNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTGN40CACGAGTGAAGTCTGAGCTCC
|
|
BSA-1C Forward Primer (DNA, 40 nt)
|
AAT TGT CCT ACT CGT CAG ATG TGG AAC CGA CAG TGG
|
|
TAC G
|
|
BSA-1C Reverse Primer T7 (DNA, 38 nt)
|
TCT AAT ACG ACT CAC TAT AGG AGC TCA GAC TTC ACT CG
|
|
BSA-1C FS Primer 3′-rG (DNA with ribo-nucleotides,
|
21 nt)
|
AAT TGT CCT ACT CGT CAG ATGOH
|
|
BSA-1C FS-Primer 3′-rG (DNA with ribo-nucleotides,
|
21 nt)
|
AAT TGOHT CCT ACT CGOHT CAG ATGOH
|
FNA Selection 1 Using the STAR-Technology
(using two overlapping primers and a Forward Synthesis Primer consisting of RNA or of DNA including a 3′-terminal ribo-nucleotide)
in italics: Nucleotides of the libraries and of the ligation matrices that hybridize with each other
underlined: T7 RNA-polymerase-promoter or SP6-RNA-polymerase-promoter
NOH: ribo-nucleotide
pN: 5′-phosphate of a nucleotide
3′dN: 2′-3′-dideoxy-nucleotide
BSA-1 STAR strand during ligation
|
GCGAGTTCCTCTCAGCGT′![]()
-(dN)40-![]()
′TATAGTGAGTCGTATTAGTAG TCGC
|
GGAGAGTCGCA.CCCT CAGG.ATATCACTCAGCATAATCATC AGCG
|
|
BSA-1 STAR Library (FNA, 48 nt)
|
GGGA-(dN)40—GTCC
|
|
BSA-1 STAR Forward Primer (DNA, 18 nt)
|
GCG AGT TCC TCT CAG CGT
|
|
BSA-1 STAR Reverse Primer (DNA, including a T7 RNA polymerase
|
promoter, 29 nt)
|
GCG ACT ACT AAT ACG ACT CAC TAT AGG AC
|
|
BSA-1 STAR Forward Template (DNA, 15 nt)
|
TCC CAC GCT GAG AG 3′dG
|
|
BSA-1 STAR Reverse Ligate (DNA, 25 nt)
|
pTAT AGT GAG TCG TAT TAG TAG TCG 3′dC
|
|
BSA-1 STAR DNA FS Primer (DNA with ribo-nucleotides, 18 nt)
|
GCG AGT UOH CC TCT CAG CG UOH
|
|
BSA-1 STAR RNA FS Primer (RNA, 18 nt)
|
GCG AGU UCC UCU CAG CGU
|
FNA-Selection 2
FNA Selection 2 with FS Primer Consisting of FNA (A)
(using a Forward Synthesis Primer consisting of FNA)
BSA-2A FNA Pool (FNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
BSA-2A initial Library (DNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
BSA-2A Forward Primer (DNA, 20 nt)
|
GTG GAA CCG ACA GTG GTA CG
|
|
BSA-2A FS-Primer (FNA for FNA-synthesis, 20 nt)
|
GTG GAA CCG ACA GTG GTA CG
|
|
BSA-2A Reverse Primer (DNA, 19 nt)
|
GG AGC TCA GAC TTC ACT CG
|
FNA Selection 2 with FS-Primer Consisting of DNA or RNA (B)
(using one overlapping primer consisting of RNA or of DNA with a 3′-terminal ribo-nucleotide)
NOH: ribo-nucleotide
BSA-2B FNA-Pool (FNA, 74 nt)
|
ACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
BSA-2B initial Library (DNA, 87 nt)
|
TGATGTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAG
|
|
CTCC
|
|
BSA-2B Forward Primer (DNA, 24 nt)
|
TGA TGT GGA ACC GAC AGT GGT ACG TG
|
|
BSA-2B Reverse Primer (DNA, 19 nt)
|
GG AGC TCA GAC TTC ACT CG
|
|
BSA-2B RNA FS-Primer (RNA, 13 nt)
|
UGA UGU GGA ACC G
|
|
BSA-2B DNA FS-Primer (DNA with ribo-nucleotides,
|
13 nt)
|
TGA TG UOH GGA ACC GOH
|
FNA Selection 2 Using the STAR-Technology
(using one overlapping primer consisting of RNA or of DNA with a 3′-terminal ribo-nucleotide)
in italics: Nucleotides of the libraries and of the ligation templates that hybridize with each other
NOH: Ribo-nucleotides
pN: 5′-Phosphate of a nucleotide
3′dN: 2′-3′-dideoxy-nucleotide
BSA-2 STAR Strand during ligation
|
GCGAGTTCCTCTCAGCGT′![]()
-(dN)40-![]()
′TATAGTGAGTCGTATTAGTAGTCGC
|
GGAGAGTCGCA.CCCT CAGG.ATATCACTCAGCATAATCATCAGCG
|
|
BSA-2 STAR Library (FNA, 48 nt)
|
GGGA-(dN)40-GTCC
|
|
BSA-2 STAR Forward Primer (DNA, 18 nt)
|
GCG AGT TCC TCT CAG CGT
|
|
BSA-2 STAR Reverse Primer (DNA with ribo-nucleotides, 29 nt)
|
GCG ACT ACT AAUOH ACG ACT CAC TAT IOH GG AC
|
|
BSA-2 STAR Forward Template (DNA, 15 nt)
|
TCC CAC GCT GAG AG 3′dG
|
|
BSA-2 STAR Reverse Ligate (DNA, 25 nt)
|
pTAT AGT GAG TCG TAT TAG TAG TCG 3′dC
|
|
BSA-2 STAR RNA FS Primer (RNA, 18 nt)
|
GCG AGU UCC UCU CAG CGU
|
|
BSA-2 STAR DNA FS Primer (DNA with ribo-nucleotides, 18 nt)
|
GCG AGT UOHCC TCT CAG CGUOH
|
|
FNA Selektion 3
|
BSA-3 FNA Pool (FNA, 83 nt)
|
5′-GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC-3′
|
|
BSA-3 initial Library (DNA, 83 nt)
|
5′-GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC-3′
|
|
BSA-3 Forward Primer (FNA, 20 nt)
|
5′-GTG GAA CCG ACA GTG GTA CG-3′
|
|
BSA-3 Reverse Primer (DNA, 19 nt)
|
5′Biotin-GG AGC TCA GAC TTC ACT CG-3′
|
|
BSA-3 Forward Sequencing Primer (DNA, 20 nt)
|
5′-GTG GAA CCG ACA GTG GTA CG-3′
|
|
BSA-3 Reverse Sequencing Primer (DNA, 19 nt)
|
5′-GG AGC TCA GAC TTC ACT CG-3′
|
DNA Selection with FS Primer Consisting of DNA
underlined: T7 RNA polymerase promoter or SP6 RNA polymerase promoter
DNA-Pool (DNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
DNA initial Library (DNA, 83 nt)
|
GTGGAACCGACAGTGGTACGTG-N40-CACGAGTGAAGTCTGAGCTCC
|
|
DNA Forward Primer (DNA, 20 nt)
|
GTG GAA CCG ACA GTG GTA CG
|
|
DNA Reverse Primer T7 (DNA, 38 nt)
|
TCT AAT ACG ACT CAC TAT AGG AGC TCA GAC TTC ACT CG
|
LITERATURE
The various references which are contained herein read completely as follows and their disclosure is incorporated herein by reference.
- Aurup, H., Williams, D. M. and Eckstein, F. (1992) 2′-Fluoro- and 2′-amino-2′-deoxynucleoside 5′-triphosphates as substrates for T7 RNA polymerase. Biochemistry, 31, 9636-9641.
- Bell, C., Lynam, E., Landfair, D. J., Janjic, N. and Wiles, M. E. (1999) Oligonucleotide NX1838 inhibits VEGF165-mediated cellular responses in vitro. In Vitro Cell Dev Biol Anim, 35, 533-542.
- Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H. and Toole, J. J. (1992) Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature, 355, 564-566.
- Chiu, Y. L. and Rana, T. M. (2003) siRNA function in RNAi: A chemical modification analysis. Rna, 9, 1034-1048.
- Cummins, L. L., Owens, S. R., Risen, L. M., Lesnik, E. A., Freier, S. M., McGee, D., Guinosso, C. J. and Cook, P. D. (1995) Characterization of fully 2′-modified oligoribonucleotide hetero- and homoduplex hybridization and nuclease sensitivity. Nucleic Acids Res, 23, 2019-2024.
- Eaton, B. E. and Pieken, W. A. (1995) Ribonucleosides and RNA. Annu Rev Biochem, 64, 837-863.
- Green, L. S., Jellinek, D., Bell, C., Beebe, L. A., Feistner, B. D., Gill, S. C., Jucker, F. M. and Janjic, N. (1995) Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial factor. Chem Biol, 2, 683-695.
- Green, L. S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C. H. and Janjic, N. (1996) Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry, 35, 14413-14424.
- Griffin, L. C., Tidmarsh, G. F., Bock, L. C., Toole, J. J. and Leung, L. L. (1993) In vivo anticoagulant properties of a novel nucleotide-based thrombin inhibitor and demonstration of regional anticoagulation in extracorporeal circuits. Blood, 81, 3271-3276.
- Henry, S. P., Geary, R. S., Yu, R. and Levin, A. A. (2001) Drug properties of second-generation antisense oligonucleotides: how do they measure up to their predecessors? Curr Opin Investig Drugs, 2, 1444-1449.
- Jellinek, D., Green, L. S., Bell, C., Lynott, C. K., Gill, N., Vargeese, C., Kirschenheuter, G., McGee, D. P. C., Abesinghe, P., Pieken, W. A., Shapiro, R., Rifkin, D. B., Moscatelli, D. and Janjic, N. (1995) Potent 2′-amino-2′deoxypyrimidine RNA inhibitors of basic fibroblast growth factor. Biochemistry, 34, 11363-11372.
- Jhaveri, S., Olwin, B. and Ellington, A. D. (1998) In vitro selection of phosphorothiolated aptamers. Bioorg Med Chem Lett, 8, 2285-2290.
- King, D. J., Bassett, S. E., Li, X., Fennewald, S. A., Herzog, N. K., Luxon, B. A., Shope, R. and Gorenstein, D. G. (2002) Combinatorial selection and binding of phosphorothioate aptamers targeting human NF-kappa B RelA(p65) and p50. Biochemistry, 41, 9696-9706.
- Kujau, M. J., Siebert, A. and Wolfi, S. (1997) Design of leader sequences that improve the efficiency of the enzymatic synthesis of 2′-amino-pyrimidine RNA for in vitro selection. J Biochem Biophys Methods, 35, 141-151.
- Kusser, W. (2000) Chemically modified nucleic acid aptamers for in vitro selections: evolving evolution. J Biotechnol, 74, 27-38.
- Leva, S., Lichte, A., Burmeister, J., Muhn, P., Jahnke, B., Fesser, D., Erfurth, J., Burgstaller, P. and Klussmann, S. (2002) GnRH binding RNA and DNA Spiegelmers: a novel approach toward GnRH antagonism. Chem Biol, 9, 351-359.
- Lin, Y., Qiu, Q., Gill, S. C. and Jayasena, S. D. (1994) Modified RNA sequence pools for in vitro selection. Nucleic Acids Research, 22, 5229-5234.
- Manoharan, M. (1999) 2′-carbohydrate modifications in antisense oligonucleotide therapy: importance of conformation, configuration and conjugation. Biochim Biophys Acta, 1489, 117-130.
- Meador, J. W., 3rd, McElroy, H. E., Pasloske, B. L., Milburn, S. C. and Winkler, M. M. (1995) pTRIPLEscript: a novel cloning vector for generating in vitro transcripts from tandem promoters for SP6, T7 and T3 RNA polymerase. Biotechniques, 18, 152-157.
- Milligan, J. F. and Uhlenbeck, O. C. (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol, 180, 51-62.
- Murphy, M. B., Fuller, S. T., Richardson, P. M. and Doyle, S. A. (2003) An improved method for the in vitro evolution of aptamers and applications in protein detection and purification. Nucleic Acids Res, 31, el 10.
- Ono, T., Scalf, M. and Smith, L. M. (1997) 2′-Fluoro modified nucleic acids: polymerase-directed synthesis, properties and stability to analysis by matrix-assisted laser desorption/ionization mass spectrometry. Nucleic Acids Res, 25, 4581-4588.
- Padilla, R. and Sousa, R. (1999) Efficient synthesis of nucleic acids heavily modified with non-canonical ribose 2′-groups using a mutantT7 RNA polymerase (RNAP). Nucleic Acids Res, 27, 1561-1563.
- Padilla, R. and Sousa, R. (2002) A Y639F/H784A T7 RNA polymerase double mutant displays superior properties for synthesizing RNAs with non-canonical NTPs. Nucleic Acids Res, 30, e138.
- Richardson, F. C., Kuchta, R. D., Mazurkiewicz, A. and Richardson, K. A. (2000) Polymerization of 2′-fluoro- and 2′-O-methyl-dNTPs by human DNA polymerase alpha, polymerase gamma, and primase. Biochem Pharmacol, 59, 1045-1052.
- Stryer, L. (1995) Biochemistry. W. H. Freeman and Company, New York.
- Williams, K. P., Liu, X. H., Schumacher, T. N., Lin, H. Y., Ausiello, D. A., Kim, P. S, and Bartel, D. P. (1997) Bioactive and nuclease-resistant L-DNA ligand of vasopressin. Proc Natl Acad Sci USA, 94, 11285-11290.
- Xu, Y., Zhang, H. Y., Thormeyer, D., Larsson, O., Du, Q., Elmen, J., Wahlestedt, C. and Liang, Z. (2003) Effective small interfering RNAs and phosphorothioate antisense DNAs have different preferences for target sites in the luciferase mRNAs. Biochem Biophys Res Commun, 306, 712-717.
- Zhang, H. Y., Mao, J., Zhou, D., Xu, Y., Thonberg, H., Liang, Z. and Wahlestedt, C. (2003) mRNA accessible site tagging (MAST): a novel high throughput method for selecting effective antisense oligonucleotides. Nucleic Acids Res, 31, e72.
The features of the invention disclosed in the preceding description, the claims and the figures can be essential for the practice of the invention either alone or in any combination.
Patent Application
20080070238
