Patent Application
20210000124
This application claims priority from South African provisional patent application number 2018/01488 filed on 5 Mar. 2018.
The present invention relates to methods for controlling pest infestation using a siRNA molecule. The invention provides methods for making transgenic plants that express the siRNA molecule, as well as pesticidal agents and commodity products produced by the plants.
Insect pests are one of the largest causes of crop losses in the agricultural sector. The emergence of host plant resistance is a natural way in which crop losses due to insect pests are sometimes limited, but unfortunately this is often counteracted by the rapid emergence of new insect biotypes that are virulent to the now previously resistant cultivar.
The Russian wheat aphid (RWA) (Diuraphis noxia, Kurdjomov) is one such example. This aphid has a narrow host range, consisting mainly of wheat, barley and other grasses and is found in all the major wheat producing countries. Of the 14 resistance genes in wheat, only Dn7 and Dn2401 remain effective to existing D. noxia biotypes in the USA. The same is true in South Africa, where only Dn7 confers effective resistance against the four biotypes present (Dn2401 is yet to be screened against South African biotypes).
Chemical insecticides can also be used to control some insect pests, but this is not always desirable, as the insecticides may be harmful to the environment.
There is therefore a need to develop agricultural crops which have durable resistance to insect pests.
According to a first embodiment of the invention, there is provided an siRNA molecule targeting the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8.
The region targeted by the siRNA molecule may be a contiguous sequence of from 19 to 25 nucleotides.
The siRNA molecule may target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 485 and 720 of SEQ ID NO: 23, such as nucleotides 486-508, between about nucleotides 509 and 720 or between about nucleotides 464 and 774.
The siRNA molecule may comprise a polynucleotide which has at least 80%, 85%, 90%, 95% or 100% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80%, 85%, 90%, 95% or 100% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2).
The siRNA molecule may consist of the duplex:
The siRNA molecule may comprise a deoxyribonucleotide and/or a modification.
According to a second embodiment of the invention, there is provided a composition comprising an siRNA molecule as described above and a carrier and/or excipient.
According to a third embodiment of the invention, there is provided an isolated polynucleotide or set of polynucleotides encoding an siRNA molecule as described above.
The isolated polynucleotide may have a sequence which is at least 80% identical to SEQ ID NO: 3.
According to a fourth embodiment of the invention, there is provided a vector encoding the siRNA molecule as described above.
The vector may comprise a polynucleotide having a sequence which is at least 80% identical to SEQ ID NO: 3.
According to a fifth embodiment of the invention, there is provided a plant or plant part which has been transformed to express an siRNA molecule as described above.
According to a further embodiment of the invention, there is provided the use of an siRNA molecule or a composition as described above for inhibiting the biological activity of a pest.
According to a further embodiment of the invention, there is provided a method for controlling pest infestation, the method comprising providing a pest with an siRNA molecule as described above.
According to a further embodiment of the invention, there is provided a method for controlling pest infestation, the method comprising:
According to a further embodiment of the invention, there is provided a method for improving crop yield, the method comprising:
The plant may be selected from the group consisting of wheat, barley, sugarcane, maize, rice, rye, sorghum, soya, palm, potato, cassava, sugar beet, banana, citrus, grapes, apple, watermelon, mango, cucumber, tomato, brassica species like rapeseed, tea, coffee, tobacco, cannabis, cotton and ornamental plants such as roses. More particularly, the plant is wheat.
The pest may be an insect, including aphids (e.g. Diuraphis noxia, Myzus persicae, Aphis fabae, Aphis glycines, Brevicoryne brassicae, Aphis gossypii, Macrosiphum euphorbiae, Acyrthosiphon pisum, Dysaphis plantaginea, Aphis craccivora, Schizaphis graminum, Rhopalosiphum padi, Rhopalosiphum maidis, Sitobion avenae), whitefly, Thrips, Lepidoptera larva, Diptera larva, Coleoptera larva, Tetranychidae, Gryllidae or Caelifera. More particularly, the insect is Diuraphis noxia.
, alfa helix;
, beta strand;
, turn;
coil.
D. noxia biotype SAM was allowed to feed on wheat cultivar Gamtoos-R injected with Dnc002-siRNA, Dncprr1-8-siRNA or buffer (control, no siRNA). D. noxia biotype SAM was also allowed to feed on wheat cultivar Gamtoos-R and Gamtoos-S that was not injected (control). Relative expression of D. noxia biotype SAM c002 (A) cprrl (B) was determined with qPCR while SAM fed on wheat injected with siRNA. , Gamtoos-S, No injection;
, Gamtoos-R, No injection;
, Gamtoos-R, Buffer injection;
, Gamtoos-R, c002-siRNA injection;
, Gamtoos-R, cprr1-8-siRNA injection. qPCR was also used to determine the c002-siRNA (C) or cprr1-8-siRNA (D) concentration in the injected wheat leaf on which D. noxia biotype SAM fed. Error bars represent SEM.
GamS, D. noxia susceptible wheat cultivar ‘Gamtoos-S’;
GamR, D. noxia resistant wheat cultivar ‘Gamtoos-R’;
No injection, wheat leaves without injection; Buffer, 10 mM Tris (pH 7);
c002-siRNA, siRNA targeting c002 dissolved in 10 mM Tris (pH 7);
cprr1-8-siRNA, siRNA targeting cprr1-8 dissolved in 10 mM Tris (pH 7).
siRNA molecules and their uses for controlling pest infestation are described herein. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between about nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. The siRNA molecules are effective in suppressing the D. noxia cprr1-8 gene or an ortholog thereof, and ingestion of the siRNA molecules by a pest with this protein inhibits the biological activity of the pest. The use of the siRNA molecule is a natural and environmentally friendly method for controlling insect pests.
The region targeted by the siRNA molecule is generally a contiguous sequence of at least 19 nucleotides and up to about 25 nucleotides.
More particularly, the targeted region is between nucleotides 485 and 720 of SEQ ID NO: 23, and in one embodiment the target region is from nucleotides 486 to 508. In another embodiment the target region is between about nucleotides 509 and 720 and in yet another embodiment the target region is between about nucleotides 464 and 774.
A siRNA molecule according to the present invention will preferably comprise a double stranded RNA molecule, whose antisense strand will comprise an RNA sequence substantially complementary to the target region, and whose sense strand will comprise an RNA sequence complementary to the antisense strand, wherein both strands are hybridised by standard base pairing between nucleotides.
Within the meaning of the present invention, “substantially complementary” to a target mRNA sequence may also be understood as “substantially identical” to the target sequence. “Identity” as is known by one of ordinary skill in the art, is the degree of sequence relatedness between nucleotide sequences as determined by matching the order and identity of nucleotides between sequences. In one embodiment the antisense strand of an siRNA having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementarity to the target mRNA sequence is considered substantially complementary and may be used in the present invention. The percentage of complementarity describes the percentage of contiguous nucleotides in a first nucleic acid molecule that can base pair in the Watson-Crick sense with a set of contiguous nucleotides in a second nucleic acid molecule. In one embodiment, the antisense siRNA strand is 100% complementary to the target mRNA sequence, and the sense strand is 100% complementary to the antisense strand over the double stranded portion of the siRNA.
In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80%, 85%, 90%, 95% or 100% sequence identity to the sequence 5′ UAAACAAUCGCAAGAAGCUGA 3′ (SEQ ID NO: 1) and a polynucleotide which has at least 80%, 85%, 90%, 95% or 100% sequence identity to the sequence 5′ AGCUUCUUGCGAUUGUUUAAG 3′ (SEQ ID NO: 2).
The siRNA molecule can consist of the duplex:
Isolated polynucleotides or sets of polynucleotides encoding an siRNA molecule as described above are also provided in this invention. One example is a polynucleotide comprising a sequence which has at least 80% identity to SEQ ID NO: 3. More particularly, the polynucleotide may have at least 85% identity to SEQ ID NO: 3, at least 90% identity to SEQ ID NO: 3 or at least 95% identity to SEQ ID NO: 3. In one embodiment, the polynucleotide is identical to SEQ ID NO: 3.
In the context of the present invention, the expression “at least 80% identity” refers to a sequence identity of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% to the respective reference polynucleotide. Preferably, the polynucleotide in question and the reference polynucleotide exhibit the indicated sequence identity over a continuous stretch of 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200 or more nucleotides.
A vector encoding the siRNA molecule as described above is further provided. The vector can include a polynucleotide as described above.
Methods are known in the art for administering the siRNA molecule to pests. For example, the siRNA molecule can be injected into or caused to be ingested by the pest. Ingestion can occur by feeding the pest with an artificial food containing the siRNA molecule, by causing a plant to transiently or stably express the siRNA molecule, by injecting a plant with the siRNA, or by applying the siRNA molecule to a surface of the plant, such as by spraying the siRNA molecule onto the plant. In one embodiment of the invention, plants or plant cells are transformed with a polynucleotide or set of polynucleotides encoding the siRNA molecule, so as to produce a transgenic plant which expresses the siRNA molecule. In another embodiment, a composition comprising the siRNA molecule is sprayed onto the plant. The composition can be a pesticide.
Vectors comprising a polynucleotide which can cause a transformed host to express RNA which subsequently becomes the siRNA molecule are also provided, as are plants and plant cells transformed with a polynucleotide encoding the siRNA molecule.
The siRNA molecule can be used to control pest infestation, improve crop yield or produce a commodity product.
When the siRNA molecule is ingested by a pest which feeds on the crop, or when the siRNA molecule is otherwise administered to the pest, the biological activity of the pest may be altered, and in particular the fitness or virulence of the pest may be reduced. For example, the survival rate of the pest may be decreased or its reproduction abilities may be reduced. This may be as a result of a target gene in the pest being suppressed. For example, the target gene can be the cprr1-8 gene.
In one embodiment, the siRNA molecule of the invention is used to control Diuraphis noxia. However, a person skilled in the art will understand that the siRNA molecule could also be used to control other crop pests, such as other aphid species (e.g. Aphis fabae, Aphis glycines, Brevicoryne brassicae, Aphis gossypii, Macrosiphum euphorbiae, Acyrthosiphon pisum, Dysaphis plantaginea, Aphis craccivora, Myzus persicae, Schizaphis graminum, Rhopalosiphum padi, Rhopalosiphum maidis, Sitobion avenae), other Hemipteran (e.g. whitefly) or other insects (e.g. Thrips, Lepidoptera larva, Diptera larva, Coleoptera larva, Tetranychidae, Gryllidae and Caelifera).
Means to identify orthologous genes and target sequences are available to a person of skill in the art and comprise the use of BLAST searches and database mining of databases such as the EMBL, NCBI and other databases comprising polynucleotides and amino acid sequences.
The Myzus persicae larval cuticle protein cprr1-8 ortholog is one example. In a study conducted by the inventors, siRNA molecules targeting the nucleotides CAGAAACCAGAAGACUCCAAAAA (SEQ ID NO: 43) of the M. persicae larval cuticle protein cprr1-8 were synthesized. The siRNA molecule comprised polyribonucleotide strands GAAACCAGAAGACUCCAAAAA (SEQ ID NO: 44) and UUUGGAGUCUUCUGGUUUCUG (SEQ ID NO: 45). When ingested by M. persicae, this siRNA caused a significant reduction in nymph production (data not shown).
In one embodiment of the invention, the plants which are injected or sprayed with the siRNA molecules, or transformed to express the siRNA molecules, are wheat plants. A person skilled in the art, however, will understand that the invention is not intended to be limited to the introduction of the siRNA molecule into wheat plants, and that other plants could also be transformed with the siRNA. For example, other suitable plants include crop plants such as barley, sugarcane, maize, rice, rye, sorghum, soya, palm, potato, cassava, sugar beet, banana, citrus, grapes, apple, watermelon, mango, cucumber, tomato, brassica species like rapeseed, other vegetables, tea, coffee, tobacco, cannabis, cotton and ornamental plants such as roses.
In the context of the present invention, the term “virulence” refers to the ability of an insect to feed and proliferate on a particular plant.
In higher organisms, reactive oxygen species (ROS) are regularly generated by mitochondrial electron transport, when partially reduced and highly reactive metabolites of O2 such as superoxide anion (O2) and hydrogen peroxide (H2O2) are formed during cellular respiration. Excessive release of ROS damages lipids, proteins, and DNA, which leads to oxidative stress, loss of cell function, and programmed cell death. ROS are also actively released by hosts, in response to cellular invasion by pathogens as first line of defense, and occur in all eukaryotic cells. To regulate oxidative stress, the eukaryotic cell produces different ROS-scavenging enzymes, such as superoxide dismutase (which reduces O2−. to H2O2), glutathione peroxidase and catalase (which reduces H2O2 to H2O).
This happens in both the host plant and insect species. An increase in peroxidase activity also occurs in wheat after D. noxia infestation, which is indicative of the activation of systemic acquired resistance (SAR), albeit the induction is delayed in susceptible varieties.
The most virulent South African biotype of D. noxia is SAM (South African Mutant). This biotype was developed from biotype SA1 (the least virulent SA biotype, only virulent to dn3) by feeding it aphid-resistant wheat cultivars, thus placing it under continuous selection pressure. As a result, SAM has been shown to express virulence against all described Dn genes found in wheat (SAM avoids detection by its host plant during feeding and a limited increase in peroxidase activity and SAR is measured). This characteristic makes biotype SAM a useful model in studies to elucidate the mechanism of virulence against resistance genes.
Arthropod cuticle is a composite, bipartite system, made of chitin filaments embedded in a proteinaceous matrix, which serves as a protective barrier, and provide structural and mechanical support. The physical properties of cuticle are determined by the structure and the interactions of its two major components, which are cuticular proteins (CPs) and chitin. The proteinaceous matrix consists mainly of structural CPs, while the majority of these belonging to the CPR family, containing a conserved R&R region (Rebers and Riddiford Consensus). Two major subfamilies of the CPR family (i.e. RR-1 and RR-2) have been identified from conservation at sequence level and some correlation with the cuticle type.
The RR1 protein, which can be isolated from the salivary gland, is unique to the biotype SAM. It is encoded by the cprr1-8 gene. The function of RR1 during aphid feeding was investigated to determine whether this protein is associated with the virulence of SAM. This was done using RNA interference (RNAi)-mediated gene silencing or knockdown.
The RNAi process relies on double-stranded RNA (dsRNA) precursors, specifically lowering transcript abundance of a target gene when introduced into cells. The process involves the cleavage of the dsRNA precursors into siRNA (-21-23 nucleotides in size) by the enzyme Dicer-2 (Dcr-2). The resulting siRNAs are then incorporated into an RNA-induced silencing complex (RISC). Argonaute-2 (Ago-2), the catalytic component of RISC, uses one of the siRNA strands as a template to recognize and degrade the complementary mRNA.
Although the siRNA molecules in one embodiment contain nucleotide sequences that are fully complementary to nucleotides CUUAAACAAUCGCAAGAAGCUGA of the mature D. noxia larval cuticle protein cprr1-8 (SEQ ID NO: 23,
In some embodiments, siRNAs have 5′-phosphate and 3′-hydroxyl groups.
An important issue with siRNA molecules is their instability in biological fluids due to the ubiquitous nature of RNAses. Consequently, the use of many different chemical modifications to nucleotides has been described with the purpose of enhancing compound stability.
Thus, in an embodiment of the invention, the siRNA further comprises at least one nucleotide with a chemical modification. Preferred chemical modifications which enhance stability and reduce immunogenic effects include 2′-O-methyl nucleotides, 2′-fluoro nucleotides, 2′-amino nucleotides, 2′-deoxy nucleotides, or nucleotides containing 2′-O or 4′-C methylene bridges. Others preferred chemical modifications for exonuclease protection include ExoEndoLight (EEL): modification of all pyrimidines in the sense strand to 2′-O-methyl residues, and modifications of all pyrimidines in a 5′-UA-3′ or 5′-CA-3′ motif in the antisense strand. In addition, position 1 of the sense strand can also be changed to 2′-O-methyl, preventing 5′-phosphorylation of the sense strand and thus increasing specificity of the siRNA by further inactivating the sense strand. In addition, the sense strand can also include a 2′-O-methyl modification in position 14, because 2′-O-Me at this position further inactivates the sense strand and therefore increases specificity of the siRNAs. Other preferred chemical modifications for exonuclease protection include Methyl-Fluoro (MEF): exo protection alternating 2′-fluoro and 2′-O-methyl modifications starting (5′-end) with a 2′-F on the sense strand and starting with 2′-O-Me on the antisense strand. In addition, position 1 of the sense strand can also be changed to 2′-O-Me and position 1 of the antisense strand to 2′-F (as this can efficiently be 5′-phosphorylated). Also, modification of the ribonucleotide backbone connecting adjacent nucleotides can be made by the introduction of phosphorothioate modified nucleotides. A further preferred chemical modification within the meaning of the present invention relates to the substitution of uracyl ribonucleotides with deoxythymidine (deoxyribonucleotides). In another embodiment of the present invention, at least one chemically modified nucleotide is on the sense strand, on the antisense strand or on both strands of the siRNA.
siRNA molecules of the invention can be synthesized by standard methods known in the art, e.g. by use of an automated synthesizer. RNAs produced by such methodologies tend to be highly pure and to anneal efficiently to form siRNA duplexes. Following chemical synthesis, single stranded RNA molecules are deprotected, annealed to form siRNAs, and purified (e.g. by gel electrophoresis or HPLC). Alternatively, standard procedures may be used for in vitro transcription of RNA from DNA templates carrying RNA polymerase promoter sequences. The sense and antisense transcripts may be synthesized in two independent reactions and annealed later, or may be synthesized simultaneously in a single reaction.
Three siRNA delivery techniques were attempted and compared: direct injection of dsRNA or siRNA into aphid haemolymph; feeding of dsRNA from an artificial diet; and plant-mediated RNAi to initiate down-regulation of gene targets. However, because aphids are so small (>3 mm in size), microinjection requires specialized equipment. Wheat also has a large genome (17 000 MB) and unlike Arabidopsis, can be cumbersome to transform. Thus, alternative strategies to achieve RNAi-mediated gene silencing in D. noxia were required for the experimental purposes of this invention, and a novel siRNA delivery method was developed—the siRNA was injected into leaves of wheat plants and aphids were subsequently fed on these wheat plants. This method allows observation of the interaction of plant and aphid during a gene silencing experiment, while this is not the case for siRNA/dsRNA delivery through artificial media. It is also not invasive like direct injection of siRNA or dsRNA into the aphid hemolymph and is less laborious than plant transformation if elucidating gene function is the immediate goal.
The siRNA of the present invention was shown to decrease foundress survival by approximately 50% and affected nymph production significantly during in planta feeding experiments. The present study also demonstrated transgenerational knockdown, in that expression of the Dncprr1-8 gene in the newly born embryos was decreased, making this method highly useful and feasible.
siRNA molecules may also be formed within a cell by transcription of RNA from an expression construct introduced into the cell. The expression constructs for in vivo production of siRNA molecules comprise siRNA encoding sequences operably linked to elements necessary for the proper transcription of the siRNA encoding sequence(s), including promoter elements and transcription termination signals. The siRNA expression constructs can further comprise vector sequences that facilitate the cloning of the expression constructs.
For example, in order to deliver siRNA to insect pests in a field scenario, crop plants will be transformed with a plant RNA interference vector containing cprr1-8 mRNA sequence. In particular, a cprr1-8 fragment of 301 bp in length (SEQ ID NO: 3,
Alternatively, the siRNA can be formulated into a suitable composition for use on plants. The composition can be suitably formulated to improve activity, stability and/or bio-availability and/or to limit toxicity. Formulations can contain biological salts, lipids or lipid derivatives, polysaccharides or polysaccharide derivatives, sugars or sugar derivatives, bio-friendly or approved GRAS additives.
The composition can be formulated in various types of formulations, such as solutions, wettable powders, soluble powders, tablets and water-soluble or dispersible granules. The composition can also be formulated as a concentrated stock (which is diluted in an aqueous solution prior to conventional spray application) or as a ready to use product.
A surfactant can be used as a wetting, solubilizing and penetrating agent. Suitable surfactants include peptide derived surfactants (i.e. surfactin and iturin), non-ionic surfactants, anionic surfactants and amphoteric surfactants, such as cholic acids, alkyl sulfate salts, alkylsulfonic acid salts, alkylarylsulfonic acid salts, alkyl aryl ethers and their polyoxyethylene derivatives, polyethylene glycol ethers, polyol esters and sugar alcohol derivatives.
Other components of the formulation can include additional surface active agents, solvents, cosolvents, dyes, U.V. (ultra-violet) protectants, antioxidants, antifoams, stickers, spreaders, anti-foaming agents, preservatives, humectants, buffers, carriers, emulsifiers, wetting agents, dispersants, fixing agents, disintegrators, acid solubilisers or other components which facilitate product handling and application. These carriers, diluents, auxiliary agents and so forth are preferably selected to optimize the antifungal action on plants or plant material.
Solid carriers can include, for example, the following materials in fine powder or granular form: agarose/agar containing cell culture media or dried cell culture media; organic-type fertilisers; clays (e.g. kaolinite, diatomaceous earth, synthetic hydrated silicon oxide, Fubasami clay, bentonite, acid clay); talc and other inorganic minerals (e.g. sericite, quartz powder, sulfur powder, activated carbon, calcium carbonate); and chemical fertilizers (e.g. ammonium sulfate, ammonium phosphate, ammonium nitrate, ammonium chloride, urea). Liquid carriers can include, for example, cell culture media, water; alcohols (e.g. methanol, ethanol, isopropanol); ketones (e.g. acetone, methyl ethyl ketone, cyclohexanone); esters (e.g. ethyl acetate, butyl acetate); nitriles (e.g. acetonitrile, isobutyronitrile); and acid amides (e.g. dimethylformamide, dimethylacetamide), as well as dilute bases (e.g. sodium hydroxide, potassium hydroxide and amines).
Other auxiliary agents can include, for example, adhesive agents and dispersing agents, such as casein, gelatin, polysaccharides (e.g. powdered starch, gum arabic, cellulose derivatives, alginic acid, chitin), lignin derivatives and synthetic water-soluble polymers (e.g. polyvinyl alcohol, polyvinyl pyrrolidone, polyacrylic acid); salts (eg. citrate, chloride, sulphate, acetate, ammonium, bicarbonate, phosphate salts and like) and stabilizers such as PAP (isopropyl acid phosphate), BHT (2,6-di-tert-butyl-4-methylphenol), BHA (2-/3-tert-butyl-4-methyoxyphenol), vegetable oils, mineral oils, phospholipids, waxes, fatty acids and fatty acid esters.
One or more plant growth regulators, herbicides, fungicides, bactericides, insecticides, nematicides, acaricides, biochemical pesticides, plant produced pesticides (botanicals), antimicrobials, antifungals, plant nutrients and so forth can also be incorporated into the composition of the present invention.
The composition may be diluted in water, water organic mixture or with liquid carrier and sprayed or applied in controlled environments on the plant or plant material to be treated or used to wash plant materials or environment/systems/equipment or mixed with cell culture media or plant propagation media. Alternatively, the composition may be directly applied to the soil (in which the plant will be grown or is growing) with or without granular fertilizers or organic-type fertilisers for propagation of cultured plants or the improved growth of plants.
In accordance with the present invention, there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989 (herein “Sambrook et al., 1989”); DNA Cloning: A Practical Approach, Volumes I and II (Glover ed. 1985); Oligonucleotide Synthesis (Gait ed. 1984); Nucleic Acid Hybridization (Hames and Higgins eds. 1985); Transcription And Translation (Hames and Higgins eds. 1984); Animal Cell Culture (Freshney ed. 1986); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); Ausubel et al. eds., Current Protocols in Molecular Biology, John Wiley and Sons, Inc. 1994; among others.
Throughout the specification and claims, unless the contents requires otherwise, the word “comprise” or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
The invention is described in more detail below in the following non-limiting examples.
Aphid populations
Colonies of parthenogenetic (apterous) female aphids of South African D. noxia biotypes SA1 and SAM, expressing different levels of virulence, were separately established in BugDorm cages (MegaView Science Education Services Co. Ltd., Taiwan) in an insectary with the following conditions: 22.5±2.5° C., 40% relative humidity, and continuous artificial lighting from high pressure sodium lamps.
The aphid colonies were maintained on near isogenic wheat lines. SA1 was maintained on Tugela (D. noxia susceptible, biotype SA1), while SAM was maintained on TugelaDn 1, a wheat cultivar containing the Dn1 resistance gene. All cultivars were planted in sand-filled pots and watered daily with a fertilizer that consisted of 2 g Microplex (Ocean Agriculture (Pty) Ltd, South Africa), 164 g Sol-u-fert (Kynoch Fertilizers (Pty) Ltd, South Africa) and 77 ml potassium nitrate per 100 liters of water.
The c002 gene from D. noxia was used as reference in the present study.
Near isogenic wheat lines (NiLs), GamtoosR (GamR, resistant) and GamtoosS (GamS, susceptible) were grown under greenhouse conditions using natural lighting and kept at a temperature of 25° C.±2° C. The resistance in GamR was obtained after a 1RS/1BL translocation from rye (Secale cereale L.), and is denoted Dn7. GamR is known to express antixenosis and antibiosis against aphids during feeding. Antibiosis is observed when the plant reduces the reproductive fitness of aphids feeding on it, while antixenosis is the non-preference of a cultivar as host. Seeds were planted in pots filled with crusher dust and watered twice daily using drip irrigation. These plants were used for siRNA injection experiments. Plants used to maintain aphid colonies were grown under King Plus 800W LED lights for a 12 h photoperiod and at a temperature of 20° C.±1° C.
For RNA extraction of both aphid and plant material, samples were immediately flash-frozen in liquid nitrogen and ground in 1.5 ml Eppendorf tubes using a micropestle. RNA from aphids was extracted using an RNeasy Mini Kit (Qiagen) and on-column DNase I treatment (Qiagen) following the manufacturer's protocol. RNA from wheat was extracted by adding 600 pl TRI Reagent® (Zymo Research) to the ground material, after which the Direct-zol™ RNA MiniPrep Plus kit (Zymo Research) was used by following the manufacturer's protocol and stored at −80° C. until further use.
Complementary DNA (cDNA) synthesis was conducted using an iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer's protocol. The quantity of the cDNA was assessed through Qubit analysis (Thermo Fisher Scientific; Central Analytical Services, CAF, Stellenbosch University), whereafter the cDNA was stored at -80° C. until further use.
Sequence Characterization of Gene Dncprr1-8 that Encodes the Protein RR1 from Diuraphis noxia
PCR primers were designed to amplify the transcript and genic area of Dncprr1-8 (Table 1). Synthesized cDNA was used as template for the amplification of transcript sequence and extracted DNA as template for the amplification of genes. The PCR products were purified using the MinElute Reaction Cleanup Kit (Qiagen) and Sanger sequenced at Central Analytical Services (CAF), Stellenbosch University. The PCR products of primers cprr1-8_gene_2 F and cprr1-8_gene_2 R (Table 1) were cloned before plasmids were Sanger sequenced.
Both ends of the raw reads were then trimmed in Geneious 9.1.8 (Biomatters, New Zealand) using the Trim Ends function which trims vector sequence (not required in the case of direct sequencing of PCR products), primer sequence and low quality sequence (error probability set 0.01). The Geneious assembler was used to assemble the trimed reads de novo at the highest sensitivity, after which it was aligned to the next-generation sequencing (NGS) reference genome sequence of biotype SAM using MUSCLE 3.8 (Edgar 2004).
The obtained sequences were submitted to the basic local alignment search tool (BLASTn and BLASTx) at the National Centre for Biotechnology Information (NCBI) (//blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the identity of genes Dncprr1-8 (
Design of siRNA
Once the sequence identities of the respective genes were confirmed, siRNAs targeting the Dncprr1-8 and Dnc002 were designed. (Table 2) These siRNAs have a 19 nt duplex region and a 2 nt 3′-overhang. The synthesized siRNA was obtained from IDT (https://www.idtdna.com/).
Aphid Feeding on siRNA-Containing Artificial Media
An artificial feeding media developed specifically for D. noxia was used for aphid feeding. It was modified to contain the following: 0.10 g L-methionine (Merck), 0.20 g L-leucine (Sigma-Aldrich), 0.10 g L-tryptophan (Merck), 20.00 g sucrose (Merck), 0.20 g MgCl2.6H2O (Merck), and 0.25 g K2HPO4 (Sigma-Aldrich). The pH was adjusted to 7.0 using KOH (Merck) and ddH2O was added to a final volume of 100 ml. The media was then filter sterilized (0.2 μm pore size) and stored at 4° C.
Adult D. noxia of between 350 μm and 500 μm in size were placed individually inside a glass test tube with a 14 mm outside diameter. Parafilm M (Bemis, Oshkosh, Wis., USA) was stretched close to its maximum capacity and placed over the opening. One microliter of siRNA (25 μg/μl) dissolved in RNase-free water (Ambion), or water for the control, was added to 24 μl artificial feeding media and placed on the stretched Parafilm M. Another layer of Parafilm M was then placed over the artificial media, spreading the media between the two layers. The test tubes were placed vertically in a stand with the open end at the bottom. Yellow tape was placed below the test tubes to encourage the aphids to feed. The experiment was repeated ten times (n=10) for each siRNA (i.e., Dnc002 and Dncprr1-8) and control (only media). The survival rate and the number of nymphs produced by each foundress were determined daily for four days.
Aphid Feeding on siRNA-Injected Wheat
The leaves of 30-day-old wheat plants were injected with 1 μl of 1 pg/pl siRNA dissolved in 10 mM Tris (Sigma-Aldrich) pH 7.0, at two locations in the midvein±5 mm apart, resulting in a total of 2 μg siRNA injected into each leaf. 10 mM Tris (Sigma-Aldrich) at pH 7.0 was injected as a control. A 10 μl, model 1701 Hamilton syringe with a 25.4 mm needle of 34 gauge, and 45° tip (Hamilton) was used for the injections. To contain aphids at the injection site, 15 ml polypropylene tubes (Greiner) were cut 45 mm from the opening, after which the closed end of the bottom tube was also removed to produce two tubes of ±45 mm in length. After 15 adult aphids were placed on the leaf between the injection sites, the leaf was threaded though the modified polypropylene tube, which was then held in place by cotton wool inserted at the top and bottom of the leaf at each end of the tube. The cotton wool was adjusted to allow aphids to move around freely within a ±25 mm2 area centered around the injection sites. The cages were supported by wire wrapped around the tubes, and anchored to a wooden rod. The foundress aphids were then allowed to feed for a period of 6 h or 48 h before the survivors were counted and sampled for further analysis. Leaf samples were taken at the same time points (6 h and 48 h), as well as directly after injection (Oh). The experiment was performed in triplicate for every time point, and repeated twice over time (n=18).
Aphid reproductive measurements were taken. Directly after injection of siRNA, the aphids (n=15) (biotype: SAM) were caged on the emerged third leaf of each plant, with each plant considered a biological repeat, with thee biological repeats per treatment (n=3). As the siRNA titer only lasts for a limited time period, the mothers were considered the foundress, and her nymph production recorded from the second day of settlement (24 h). Aphid nymph numbers were measured daily and the mean total number of nymphs was calculated as a measure of fertility (n=15).
Gene Expression Analysis in Aphids Using qPCR
Silencing/knockdown of candidate genes was confirmed via qPCR. Primers were all designed to be 20 bp in length, to amplify a product of 123 bp in size and bind to the coding domain sequences of the Dnc002 and Dncprr1-8 genes. cDNA was synthesized as described, of which 0.5 ng was subsequently used for qPCR analysis. The qPCR setup comprised 5 μl SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad) and one of the following primer sets: 0.5 μM of both the forward and reverse sets specific to Dnc002 or Dncprr1-8, 0.4 μM forward and 0.6 μM reverse specific to L32 or 0.6 μM of both the forward and reverse specific to L27 in 10 μl total volume reactions. The PCR cycling profile consisted of two initial steps of 50° C. for 1 min and 95° C. for 5 min, followed by 40 cycles at 95° C. for 10 s, 20 s at annealing temp specified in Table 1 and 72° C. for 20 s. A melt curve was also performed at 0.5° C. increments every 5 s from 65° C. to 95° C. Relative expression was calculated using untreated aphids sampled at day 0 as the calibrator and normalized to ribosomal proteins L27 and L32.
siRNA Concentration in Wheat
A section of leaf material 10 mm in length, which included the two injection sites in the middle, was used for RNA extraction as described above. Stemloop primers specific to the synthetic siRNAs were designed. Each 20 μl cDNA synthesis reaction contained 3 mM MgCl2, 0.5 mM of each dNTP, 30 μM random hexamer primers, 0.5 μM specific stemloop primer, 150 ng RNA template, 1 μl ImProm-II™ Reverse Transcriptase (Promega) and 4 μl ImProm-II™ 5X Reaction Buffer (Promega). 5 ng of the cDNA was used in each 10 pl qPCR reaction as well as 5 μl SsoAdvanced universal SYBR® Green supermix (Bio-Rad), 1 μM universal stemloop reverse primer and 1 μM specific forward primer (DnC002-siRNA F or RR1-siRNA F, Table 3). Thermal cycling was used to perform the reactions. 18S expression levels for each sample were determined in a 10 μl qPCR reaction consisting of 0.2 ng cDNA, 5 μl SsoAdvanced Universal SYBR® Green Supermix and 0.4 μM of both the forward and reverse primers. After an initial 3 min step at 95° C., 40 cycles of 95° C. for 10 s, 54° C. for 30 s and 72° C. for 30 s were followed to amplify the product. The concentration of the siRNAs was calculated relative to 18S expression.
Aphids were ground in ice-cold 50 mM phosphate buffer (pH of 7.5), 1 mM phenylmethylsulfonyl fluoride and 1 mM dithiothreitol. The extract was centrifuged at 4° C. for 15 min at 17 200 rpm. The supernatant was removed and kept on ice until protein assays were performed.
Catalase activity was determined colometrically by adding an aliquot of protein extract to 0.2 M phosphate buffer (pH 6.5) and 100 μM H2O2 and the degradation of H2O2 was observed at 260 nm. Enzyme activity was expressed as pmol H2O2.mg protein−1.min−1.
Peroxidase activity was measured by adding an aliquot of protein extract to 0.2 M phosphate buffer (pH 5.0), 100 mM H2O2 and 30 mM guaiacol. The formation of tetraguaiacol was a linear function of enzyme concentration and peroxidase activity was expressed as mmol tetraguaiacol min−1. mg−1 protein.
Liquid N2 was used to freeze wheat leaf material while it was ground. To this, 100 mM potassium phosphate (pH 7.5), 1 mM ethylenediaminetetraacetic acid and 1% polyvinylpyrrolidone was added to further homogenize the leaf material using a micropestle. The supernatant was collected after centrifugation at 4° C. for 15 min at 17 200 rpm.
Peroxidase activity was determined using horse radish peroxidase (BioLabs, Inqaba, Pretoria, ZA) as a standard. Hydrogen peroxide (0.06%) was added into a mixture containing 2 μg of leaf extract, 6 mM guaiacol, 25 mM potassium phosphate buffer (pH 6.0) and 24% distilled water. The formation of tetraguaiacol was a linear function of enzyme concentration and peroxidase activity was expressed as mmol tetraguaiacol min-1. mg-1 protein.
All protein concentrations were determined using bovine serum albumin (Bio-Rad, USA) as standard and a Glomax spectrophotometer (Promega, USA) was used for this purpose.
The DNA methylation state of D. noxia biotype SA1 and SAM was determined through whole genome bisulfite sequencing. DNA was extracted from at least 150 D. noxia biotype SA1 and SAM, respectively. The quality of DNA was assessed through Qubit 2.0 (Thermo Fisher Scientific) and a 2% (m/v) TAE agarose gel. The DNA samples were sent to Macrogen (South Korea) where the library preparation and sequencing was performed. After trimming and filtering the HiSeq X (Illumina, USA) reads obtained, Bismark was used to determine the methylation status of SA1 and SAM using the SAM genome as reference (GenBank assembly accession: GCA_001465515.1). For every cytosine in the reference genome Bismark outputs the amount of times it was methylated or unmethylated based on the bisulfite reads mapped to that position. It also distinguishes between the different contexts of cytosine (CpG, CHG and CHH) and the DNA strand that was methylated. In the present study this data set was manipulated to determine the proportion of methylation at every cytosine present in Dncprr1-8 which was then used to determine the total methylation in this gene and to graph the proportion of methylation at every site using Microsoft Excel (Microsoft).
All sequence analysis was conducted utilizing the BLASTn and BLASTx tools and SWISSPROT with E-values lower than 1e-10 considered as significant. CutProtFam-Pred: Detection and classification of putative structural cuticular proteins from sequence alone, based on profile Hidden Markov Models was applied to confirm the RR1 protein identity (http://bioinformatics.biol.uoa.gr/CutProtFam-Pred) (loannidou et al., 2014) All statistical analyses were conducted by using GraphPad PRISM 7 Software Tools (www.graphpad.com/guides/prism/7/statistics/index.htm?usingstatistical analysis step by s.htm) with significance set at α=0.05. Aphid fertility measurements were calculated using the mean total number of nymphs born per day.
Sequence characterization of D. noxia Dncprr1-8
After obtaining the in silico predicted sequence for cuticle protein (RR-1) from the available SAM genome sequence (g3915.t2), 1663 bp of biotype SA1 and 1689 bp of biotype SAM were Sanger sequenced (SEQ ID Nos: 4 and 6, respectively). The initial Sanger reads of Dncprr1-8, generated using primers cprr1-8 gene_1 F and cprr1-8 gene_1 R, did not align properly to the reference SAM genome sequence (SEQ ID NO: 5) as there was a sequence gap in this reference sequence (
The Sanger sequencing reads of biotype SA1 and SAM Dncprr1-8 transcripts (cDNA) almost covered the entire CDS. From the 826 bp in silico predicted Dncprr1-8 transcript, 718 bp from biotype SA1 and 730 bp from biotype SAM were Sanger sequenced directly form PCR products (
Assessing the Relative Expression of Dnc002 and Dncprr1-8 in D. noxia Biotypes SA1 and SAM
In order to assess whether there is any difference in the inherent expression of Dncprr1-8 and Dnc002 in biotypes SA1 and SAM when feeding on resistant (GamR) and susceptible (GamS) NiLs, the biotypes were fed on these lines for 10 days. After feeding for 10 days, qPCR expression analyses were conducted for Dncprr1-8 and Dnc002 and relative expression was calculated (
Optimizing siRNA of Dnc002 and Dncprr1-8
After determining that the relative expression of these genes didn't differ significantly in biotype SAM irrespective of its host, different siRNA delivery systems were compared. Firstly, siRNA was delivered through direct injection in the insect haemolymph. This technique proved impossible due to the size of the aphids. All the aphids died shortly after injection, irrespective of being injected with no fluid, buffer or siRNA (data not shown).
Delivery of the siRNA was then conducted using feeding on artificial media (Shakesby et al., 2009; Whyard et al., 2009) or in planta (feeding on siRNA injected plants (Lapitan et al. 2007)), whereafter reproduction and foundress survival (
In the artificial feeding experiment, although not statistically significant, more nymphs were produced by foundresses feeding on artificial media containing Dncprr1-8-siRNA, than on just artificial medium or medium containing Dnc002-siRNA (
siRNA of Dnc002 and Dncprr1-8
To investigate the functions of Dnc002-siRNA and Dncprr1-8 in the salivary glands of virulent biotype SAM while feeding on one of the most RWA resistant wheat varieties, GamR (containing Dn7), biotype SAM was allowed to feed on uninjected, buffer injected and plants injected with either 2 μg Dnc002-siRNA (
At 6 h after aphid introduction, Dncprr1-8 expression measured in SAM differed according to the plants they fed on and was in the following order (from highest): uninjected GamR >buffer injected GamR>Dncprr1-8-siRNA>GamS. However, the Dncprr1-8 expression differed only statistically between aphids that fed on GamS, GamR and buffer injected plants (P≤0.05). At 48 hpi the expression of Dncprr1-8 in aphids feeding on GamS was significantly lower than that measured after 6 hpi, and also lower than in aphids feeding on Dncprr1-8-siRNA injected GamR plants. In fact, the levels of Dncprr1-8 of the latter aphids were comparable to those feeding on GamS and much lower than those feeding on uninjected GamR plants.
At 48 hpi the expression of Dncprr1-8 was the lowest in aphids feeding on Dncprr1-8-siRNA followed by GamS, buffer injected GamR and the highest expression was observed in aphids feeding on GamR. Although not significant, Dncprr1-8 expression was lower in both aphids that fed on Dncprr1-8-siRNA injected GamR and GamS at 48 hpi compared to 6 hpi. Between the same time points Dncprr1-8 expression of aphids that fed on buffer injected GamR also decreased, but not to the same extend as Dncprr1-8-siRNA injected plants and GamS. When feeding on GamR, Dncprr1-8 expression stayed roughly the same.
To validate that the response measured in the feeding aphids can be directly correlated to siRNA present in the plants, the levels of Dncprr1-8-siRNA and Dnc002-siRNA were quantified using stemloop primers and qPCR analyses to reveal the siRNA concentration relative to wheat 18S expression (
Transgenerational Effect of siRNA
To validate whether the interference also affects the unborn embryos of the feeding foundresses, newly born nymphs were sampled on 0, 96 and 144 hpi and assayed for the expression of Dncprr1-8 (
D. noxia-Host Interaction
To elucidate the functions of Dnc002 and Dncprr1-8 in the salivary glands of virulent biotype SAM during feeding on GamR (a wheat expressing antibiosis and antixenosis, biotype SAM was allowed to feed on uninjected, buffer injected and plants injected with either 2 pg Dnc002-siRNA or 2 μg Dncprr1-8-siRNA, whereafter the activities of reactive oxygen species (ROS) were assayed in the feeding aphids and host (
As peroxidase (PDX) is a ROS enzyme and a marker of the oxidative burst during the host defense throughout the interaction of wheat and Diuraphis noxia, it was assayed at 0, 6 and 48 hpi (
Although aphid survival rate was still unaffected 6 h after feeding on siRNA (
In order to determine if DNA methylation is involved in the differential expression of Dncprr1-8 between biotype SAM and SA1, whole genome sequence data of bisulfite treated DNA from at least one hundred aphids from each biotype was analyzed. In doing so the proportion of DNA methylation at every cytosine of Dncprr1-8 was determined for the two biotypes. Methylation was observed at more sites and at a higher frequency in SAM compared to SA1 in the CpG, CHG and CHH contexts (Table 4).
Methylation was mainly observed in the exonic areas of Dncprr1-8 (
| Number | Date | Country | Kind |
|---|---|---|---|
| 2018/01488 | Mar 2018 | ZA | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2019/051768 | 3/5/2019 | WO | 00 |
