Patent Application
20170175143
This disclosure describes, in one aspect, a method for changing a genomic nucleotide sequence. Generally, the method includes introducing a donor polynucleotide and a nucleotide that encodes an enzyme that cuts at least one strand of DNA into a cell that has a genomic sequence in need of editing, allowing the enzyme to cut at least one strand of the genomic sequence, and allowing the donor sequence to replace the genomic sequence in need of editing.
In some embodiments, the genomic sequence can include a FANCC locus with a c.456+4A>T mutation or an equivalent thereof. In these embodiments, the donor polynucleotide can include a FANCC locus with a wild-type c.456+4A or an equivalent thereof so that the edited version of the sequence in need of editing includes the FANCC locus with a wild-type c.456+4A or an equivalent thereof.
In some embodiments, the enzyme can be a nuclease or a nickase.
In some embodiments, the donor polynucleotide can further include a selectable marker.
In some embodiments, the donor polynucleotide can further include at least one silent DNA polymorphism.
In some embodiments, the donor sequence replaces the genomic sequence in need of editing by homology-directed repair. In other embodiments, the donor sequence replaces the genomic sequence in need of editing by non-homologous end-joining.
In some embodiments, the cell is a pluripotent cell, a multipotent cell, a differentiated cell, or a stem cell. In some of these embodiments, the cell is homozygous for the c.456+4A>T mutation. In other embodiments, the cell may be a CD34+ human hematopoietic stem cell.
In another aspect, this disclosure describes an isolated cell prepared by any embodiment of the method summarized above.
In another aspect, this disclosure describes a population of cells prepared by any embodiment of the method summarized above.
In another aspect, this disclosure describes an expanded population of cells that are progeny of a cell prepared by any embodiment of the method summarized above.
In another aspect, this disclosure describes a polynucleotide that includes a promoter sequence, a polynucleotide encoding a functional portion of a Cas9 nuclease operably linked to the promoter sequence, and a polyadenylation signal operably linked to the polynucleotide encoding a functional portion of a Cas9 nuclease.
In another aspect, this disclosure describes a polynucleotide that includes a promoter sequence, a polynucleotide encoding a functional portion of a Cas9 nickase operably linked to the promoter sequence, and a polyadenylation signal operably linked to the polynucleotide encoding a functional portion of a Cas9 nickase.
In another aspect, this disclosure describes a method of treating a condition in a subject caused by a genetic mutation. Generally, the method includes the method comprising obtaining a plurality of pluripotent cells from the subject, introducing into at least one cell: a polynucleotide that encodes an enzyme that cuts at least one strand of DNA and a donor polynucleotide that encodes a version of the genomic sequence edited with respect to the genetic mutation, allowing the enzyme to cut at least one strand of the genomic sequence, allowing the donor sequence to replace the genomic sequence that includes the genetic mutation with the edited version, expanding the cell having the edited genomic sequence, and introducing a plurality of the expanded cells comprising the edited genomic sequence into the subject.
In some embodiments, the condition can be Fanconi's anemia. In some of these embodiments, the genomic sequence that includes a genetic mutation can be a FANCC locus with a wild-type c.456+4A>T mutation. In some of these embodiments, the donor polynucleotide can encode a FANCC locus with a wild-type c.456+4A.
In some embodiments, introducing the plurality of expanded cells into the subject results in correction of the FANCC locus.
In some embodiments, introducing the plurality of expanded cells into the subject results in restoration of proper splicing of FANCC mRNA.
In some embodiments, introducing the plurality of expanded cells into the subject results in phenotypic rescue of the subject.
The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.
Genome engineering with designer nucleases is a rapidly progressing field, and the ability to correct human gene mutations in situ is highly desirable. Fibroblasts derived from a patient with Fanconi anemia (FA) were used as a model to test the ability and efficacy of the clustered regularly interspaced short palindromic repeats (CRISPR) Cas9 nuclease to mediate gene correction. The CRISPR/Cas9 nuclease and nickase each resulted in gene correction and, moreover, the nickase outperformed the nuclease in homology-directed repair (HDR). Homology-directed repair is a mechanism used by cells to repair double-stranded breaks in DNA using a homologous DNA sequence in the genome. Off-target effects were assessed suing, a predictive software platform to identify intragenic sequences of homology and a genome-wide screen using linear amplification mediated PCR (LAM-PCR). No off-target Cas9 activity was observed, showing that CRISPR/Cas9 candidate sites that possess sufficient sequence complexity function in a highly specific manner. These data show genome editing in FA, a DNA repair-deficient human disorder. These data are the first description of Cas9-mediated human disease gene correction.
The FANCC gene on chromosome 9 encodes a protein that is a constituent of an eight-protein Fanconi anemia core complex that functions as part of the Fanconi anemia pathway responsible for genome surveillance and repair of DNA damage. One cause of Fanconi anemia complementation group C (FA-C) is the c.456+4A>T (previously c.711+4A>T; IVS4+4A>T) point mutation that results in a cryptic splice site that causes aberrant splicing and the in-frame deletion of FANCC exon 4. The loss of exon 4 prevents FANCC participation in the formation of the core complex and results in a decrease in DNA repair ability. Typically, FA-C patients exhibit congenital skeletal abnormalities and progressive cytopenias culminating in bone marrow failure. Furthermore, FA-C patients exhibit a high incidence of hematological and solid tumors. People with Fanconi anemia who experience bone marrow failure, and for whom a suitable donor exists, are currently treated with allogeneic hematopoietic cell transplantation (HCT). However, risks associated with HCT provide an incentive to gene-correct autologous cells by gene addition or genome editing. Because of the pre-malignant phenotype Fanconi anemia patients possess, one consideration for any gene therapy is safety. The delivery of functional copies of the FANCC gene borne on integrating viral or non-viral vectors is associated with an increased risk of insertional mutagenesis. In contrast, this disclosure describes precise gene targeting achieved using genome-modifying proteins.
Efficient genome editing relies on engineered proteins that can be rapidly synthesized and targeted to a specific genomic locus. Candidates able to mediate genome modification include, for example, the zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and CRISPR/Cas9 nucleases. ZFNs and TALENs include DNA-binding elements that provide specificity and are tethered to the non-specific FokI nuclease domain. Dimerization of the complex at a genomic target site results in the generation of a double-stranded DNA break (DSB). The generation of ZFNs can be challenging and typically involves the acquisition of specialized starting materials and methodologies that somewhat limits their broader application.
In contrast, the starting materials to generate the multi-repeat TALEN complexes are publicly available, and assembly of this protein by this method is much simpler than those required for ZFNs.
The Streptococcus pyogenes CRISPR/Cas9 platform is also user-friendly and contains two components: the Cas9 nuclease and a guide RNA (gRNA). The gRNA is a short transcript that can be designed for a unique genomic locus possessing a GN20GG sequence motif and that recruits the Cas9 protein to the target site, where the Cas9 induces a double-stranded DNA break. gRNAs direct Cas9 using complementarity between the 5′-most 20 nucleotides and the target site, which must have a protospacer adjacent motif (PAM) sequence of the form NGG.
In the description that follows and as an illustrative example, TALENs and CRISPR/Cas9 were used for FANCC gene targeting by homology-directed repair. This disclosure provides using TALENs and CRISPR/Cas9 nucleases to accomplish genomic editing of a model point mutation, FANCC c.456+4A>T and its use therapeutically. The CRISPR/Cas9 nuclease platform showed a higher rate of activity and allowed for precise c.456+4A>T mutation correction, resulting in the restoration of normal splicing and the presence of donor-derived exon 4 in FANCC cDNA.
Using the TAL Effector-Nucleotide Targeter (Doyle et al., 2012, Nucleic acids research 40:W117-W122), Zinc Finger Targeter (Sander et al., 2007, Nucleic acids research 35:W599-W605; Sander et al., 2010, Nucleic acids research 38:W462-W468), and the CRISPR Design Tool (Hsu et al., 2013, Nature biotechnology 31:827-832), the FANCC gene sequence on chromosome 9 proximal to the c.456+4A>T locus was assessed for available nuclease target sites. No suitable ZFN sites were within 500 bp of the mutation, so a TALEN and CRISPR that were adjacent to one another and the c.456+4A>T site (
DNA expression constructs that included either a FANCC c.456+4A>T-specific TALEN, a FANCC c.456+4A>T-specific CRISPR nuclease, or a FANCC c.456+4A>T-specific CRISPR nickase (
Densitometry analyses showed an approximately two-fold higher activity using the CRISPR/Cas9 nuclease, approximately 7% for TALEN and approximately 15% for CRISPR/Cas9 nuclease (
To insure that this differential activity profile was not due to unequal rates of gene transfer, an mCherry reporter was included at the time of transfection and the mean fluorescence intensity for each treatment group was nearly identical (
CRISPR on-Target and Off-Target Analysis
One factor in gene editing-based correction strategies is the potential for off-target effects due to sequence homology between the target site and non-target genomic loci. Therefore, the safety profile of the CRISPR/Cas9 reagent was assessed. CRISPR Design Tool (DNA2.0, Inc., Menlo Park, Calif.) analysis software can predict off-target sites and revealed five such sites within non-target locations for our FANCC CRISPR construct (
PCR analysis using a 3′ long terminal repeat (LTR) forward primer and a FANCC reverse primer (
These analyses were biased toward specific loci predicted in silico. In order to fully evaluate the safety profile of these reagents, an unbiased, genome wide screen was performed. To identify the sites of integration of the IDLV, the samples were tested using LAM PCR and by nonrestrictive (nr)LAM PCR that is not reliant on a nearby restriction endonuclease site. The workflow and analysis is summarized in
To test the ability of CRISPR/Cas9 to mediate FANCC gene homology-directed repair (HDR), a transformed skin fibroblast culture was derived from a FA-C patient homozygous for the c.456+4A>T mutation and treated the fibroblasts with the TALENs or the CRISPR/Cas9 genome editing reagents and a donor plasmid. The donor plasmid functions as the repair template following the generation of a double-stranded DNA break and spans a region of the FANCC gene from the third exon to the fifth intron (
The result of the c.456+4A>T mutation is the skipping of exon 4 (
The positioning of our exogenous sequences (i.e., puromycin and FANCC cDNA) within the donor construct resulted in their insertion by homology-directed repair into an intronic sequence approximately 400 bp away from an exon and thus did not result in perturbation of splicing. However, to assess whether the gene correction observed at the DNA and mRNA levels extended to functional rescue, cre-recombinase was used to remove the floxed sequences (
To extend these studies to therapeutic applications, the gene editing rates of the CRISPR/Cas9 reagents in CD34+ human hematopoietic stem cells were investigated. Using a highly pure population of hematopoietic stem cells (HSCs), electroporation-based delivery of a GFP plasmid DNA species was delivered at a rate of approximately 50% (
Thus, this disclosure describes TALEN and CRISPR/Cas9 genome editing systems for the FANCC locus as an exemplary model locus, observed higher activity rates using the CRISPR/Cas9 system (
The traffic light reporter system (Certo et al., 2011, Nat. Methods 8:671-676) was used to assess the preferred pathway of DNA repair for the CRISPR/Cas9 system. Directly comparing the two version of Cas9 showed that the HDR rates for the nuclease were higher than the nickase (
One utility of the fibroblasts in the study described herein was to establish the possibility of using gene editing as a treatment option for the FA class of disorders. For many disorders, hematopoietic stem cells (HSCs) may represent a model cell type for precision gene targeting. FA may be uniquely suited to this approach, as bone marrow cells possess sensitivity to mytomycin C (MMC) where fibroblasts do not. As such, a selective advantage appears to exist in gene-corrected HSCs in FA. Thus, the this disclosure has established for the ability of CRISPR/Cas9 to mediate a gene correction event in FA can be enhanced with, for example, optimized HSC culture, expansion, and gene transfer as part of the formation of next generation therapies.
A second consideration for clinical use of gene editing reagents is a detailed analysis of off-target effects. In silico analysis identified five off-target sites within coding regions that shared significant sequence homology to the FANCC target site (
The cell type used for the off-target effects was carefully considered. 293T cells were used because their rapid proliferation would facilitate dilution of episomal IDLV, thus decreasing background and minimizing the number of ectopic IDLV integration events at genomic fragile sites. The 293T cells rapidly diluted the unintegrated IDLV (
In summary, this disclosure shows that both the CRISPR/Cas9 nuclease-mediated and nickase-mediated direct c.456+4A>T mutation repair resulted in normalization of the FANCC transcript. The nickase-mediated mutation repair, in particular, was more efficient. Further, we provide support for a favorable safety profile using these synthetic molecules for correcting genetic disease in human cells. The observation that CRISPR/Cas9 mediates homology-directed repair in Fanconi anemia establishes proof of principle for the application of genome editing for human genetic disorders, including those with defects in the DNA repair pathway.
While described above in the context of repairing the c.456+4A>T mutation associated with Fanconi anemia, the methods described herein may be used to edit genomic sequences in any suitable manner. For example, the donor sequence may be designed to repair other point mutations, addition mutations, deletion mutations, or substitution mutations associated with conditions other than Fanconi anemia. As another examples, the methods may be used to introduce a nucleotide sequence associated with a desired phenotype, regulate expression of a gene by altering epigenetic architecture or binding of activating or repressing factors in the promoter/enhancer regulatory region, and/or multiplex these functions to turn on or off coding and regulatory nucleic acids (DNA or RNA). In short, the methods may be used to deliver any desired donor polynucleotide into a genomic sequence and to enable regulation of gene expression in sequence-specific fashion.
As used herein, the term “animal” refers to living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term “mammal” includes both human and non-human mammals. Non-limiting examples of such include humans, non-human primates, dogs, cats, sheep, mice, horses, and cows. In some embodiments, the mammal is a human
The terms “subject,” “host,” “individual,” and “patient” are as used interchangeably herein to refer to human and veterinary subjects, for example, humans, animals, non-human primates, dogs, cats, sheep, mice, horses, and cows. In some embodiments, the subject is a human.
A “composition” typically intends a combination of the active agent, e.g., compound or composition, and a naturally-occurring or non-naturally-occurring carrier, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid/antibody components, which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.
As used herein, the terms “nucleic acid sequence,” “oligonucleotide,” and “polynucleotide” are used interchangeably to refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. A polynucleotide can have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide can include modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double- and single-stranded molecules. Unless otherwise specified or required, any aspect of this technology that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double-stranded form.
The term “encode” as it is applied to nucleic acid sequences refers to a polynucleotide that is said to “encode” a polypeptide if, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof. The antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
As used herein, the term “vector” refers to a nucleic acid construct deigned for transfer between different hosts, including but not limited to a plasmid, a virus, a cosmid, a phage, a BAC, a YAC, etc. In some embodiments, plasmid vectors may be prepared from commercially available vectors. In other embodiments, viral vectors may be produced from baculoviruses, retroviruses, adenoviruses, AAVs, etc. according to techniques known in the art.
An “effective amount” or “efficacious amount” refers to the amount of an agent, or combined amounts of two or more agents, that, when administered for the treatment of a mammal or other subject, is sufficient to effect such treatment for the disease. The “effective amount” will vary depending on the agent(s), the disease and its severity and the age, weight, etc., of the subject to be treated.
Unless otherwise intended, that when the present disclosure relates to a polypeptide, protein, polynucleotide or antibody, an equivalent or a biologically equivalent of such is intended within the scope of this disclosure. As used herein, the term “biological equivalent thereof” is intended to be synonymous with “equivalent thereof” when referring to a reference protein, antibody, polypeptide or nucleic acid, intends those having minimal homology while still maintaining desired structure or functionality. Unless specifically recited herein, it is contemplated that any polynucleotide, polypeptide or protein mentioned herein also includes equivalents thereof. For example, an equivalent intends at least about 70% homology or identity, or at least 80% homology or identity and alternatively, or at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively 98% percent homology or identity and exhibits substantially equivalent biological activity to the reference protein, polypeptide or nucleic acid. Alternatively, when referring to polynucleotides, an equivalent thereof is a polynucleotide that hybridizes under stringent conditions to the reference polynucleotide or its complement.
A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) having a certain percentage (for example, 80%, 85%, 90%, or 95%) of “sequence identity” to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. The alignment and the percent homology or sequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology (Ausubel et al., eds. 1987) Supplement 30, section 7.7.18, Table 7.7.1. Preferably, default parameters are used for alignment. A preferred alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the following Internet address: ncbi.nlm.nih.gov/cgi-bin/BLAST.
“Hybridization” refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex may include two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PCR reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
Examples of stringent hybridization conditions include: incubation temperatures of about 25° C. to about 37° C.; hybridization buffer concentrations of about 6×SSC to about 10×SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4×SSC to about 8×SSC. Examples of moderate hybridization conditions include: incubation temperatures of about 40° C. to about 50° C.; buffer concentrations of about 9×SSC to about 2×SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5×SSC to about 2×SSC. Examples of high stringency conditions include: incubation temperatures of about 55° C. to about 68° C.; buffer concentrations of about 1×SSC to about 0.1×SSC; formamide concentrations of about 55% to about 75%; and wash solutions of about 1×SSC, 0.1×SSC, or deionized water. In general, hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes. SSC is 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be employed.
The term “isolated” as used herein refers to molecules or biologicals or cellular materials being substantially free from other materials. In one aspect, the term “isolated” refers to nucleic acid, such as DNA or RNA, or protein or polypeptide (e.g., an antibody or derivative thereof), or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source. The term “isolated” also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an “isolated nucleic acid” is meant to include nucleic acid fragments that are not naturally occurring as fragments and would not be found in the natural state. The term “isolated” is also used herein to refer to polypeptides that are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides. The term “isolated” is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells or tissues.
As used herein, a “pluripotent cell” also termed a “stem cell” defines a cell that can give rise to at least two distinct (genotypically and/or phenotypically) differentiated progeny cells and is less differentiated than the progeny cells. In another aspect, a “pluripotent cell” includes an Induced Pluripotent Stem Cell (iPSC), which is an artificially derived stem cell from a non-pluripotent cell, typically an adult somatic cell, produced by inducing expression of one or more stem cell specific genes. Such stem cell specific genes include, but are not limited to, the family of octamer transcription factors, i.e., Oct-3/4; the family of Sox genes, i.e., Sox1, Sox2, Sox3, Sox 15 and Sox 18; the family of Klf genes, i.e., Klf1, Klf2, Klf4 and Klf5; the family of Myc genes, i.e. c-myc and L-myc; the family of Nanog genes, i.e., OCT4, NANOG and REX1; or LIN28. Examples of iPSCs are described in Takahashi et al. (2007) Cell advance online publication 20 Nov. 2007; Takahashi & Yamanaka (2006) Cell 126:663-76; Okita et al. (2007) Nature 448:260-262; Yu et al. (2007) Science advance online publication 20 Nov. 2007; and Nakagawa et al. (2007) Nat. Biotechnol. Advance online publication 30 Nov. 2007. A “multi-lineage stem cell” or “multipotent stem cell” refers to a stem cell that reproduces itself and at least two further differentiated progeny cells from distinct developmental lineages. The lineages can be from the same germ layer (i.e., mesoderm, ectoderm or endoderm), or from different germ layers. An example of two progeny cells with distinct developmental lineages from differentiation of a multilineage stem cell is a myogenic cell and an adipogenic cell (both are of mesodermal origin, yet give rise to different tissues). Another example is a neurogenic cell (of ectodermal origin) and adipogenic cell (of mesodermal origin). A “stem cell” may be categorized as somatic (adult) or embryonic. A somatic stem cell is an undifferentiated cell found in a differentiated tissue that can renew itself (i.e., is clonal) and, with certain limitations, can differentiate to yield each of the specialized cell types of the tissue from which it originated. An embryonic stem cell is a primitive (undifferentiated) cell from the embryo that has the potential to become a wide variety of specialized cell types. An embryonic stem cell is one that has been cultured under in vitro conditions that allow proliferation without differentiation for months to years. A clone is a line of cells that is genetically identical to the originating cell; in this case, a stem cell. Certain stem cells may be CD34+ stem cells. CD34 is a cell surface marker. An amino acid sequence for CD34 and a polynucleotide that encodes CD34 is reported under GenBank number M81104 (X60172).
“Differentiation” describes the process whereby an unspecialized cell acquires the features of a specialized cell such as a heart, liver, or muscle cell. “Directed differentiation” refers to the manipulation of stem cell culture conditions to induce differentiation into a particular cell type. “Dedifferentiated” defines a cell that reverts to a less committed position within the lineage of a cell. As used herein, the term “differentiates or differentiated” defines a cell that takes on a more committed (“differentiated”) position within the lineage of a cell. As used herein, “a cell that differentiates into a mesodermal (or ectodermal or endodermal) lineage” defines a cell that becomes committed to a specific mesodermal, ectodermal or endodermal lineage, respectively. Examples of cells that differentiate into a mesodermal lineage or give rise to specific mesodermal cells include, but are not limited to, cells that are adipogenic, leiomyogenic, chondrogenic, cardiogenic, dermatogenic, hematopoetic, hemangiogenic, myogenic, nephrogenic, urogenitogenic, osteogenic, pericardiogenic, or stromal.
The term “protein”, “peptide” and “polypeptide” are used interchangeably and in their broadest sense to refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another aspect, the subunit may be linked by other bonds, e.g., ester, ether, etc. A protein or peptide must contain at least two amino acids and no limitation is placed on the maximum number of amino acids in a protein peptide. As used herein the term “amino acid” refers to a natural, an unnatural amino acid or a synthetic amino acid, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
The term “expanded” refers to any proliferation or division of cells. A “cultured” cell is a cell that has been separated from its native environment and propagated under specific, pre-defined conditions. The term “culturing” refers to the in vitro propagation of cells or organisms on or in media of various kinds. The descendants of a cell grown in culture may not be completely identical (i.e., morphologically, genetically, or phenotypically) to the parent cell. The term “propagate” means to grow or alter the phenotype of a cell or population of cells. The term “growing” refers to the proliferation of cells in the presence of supporting media, nutrients, growth factors, support cells, or any chemical or biological compound necessary for obtaining the desired number of cells or cell type.
As used herein, “treating” or “treatment” of a condition in a subject refers to reducing, limiting progression, ameliorating, or resolving, to any extent, the symptoms or signs related to a condition. “Symptom” refers to any subjective evidence of disease or of a patient's condition. “Sign” or “clinical sign” refers to an objective physical finding relating to a particular condition capable of being found by one other than the patient. A “treatment” may be therapeutic or prophylactic. “Therapeutic” and variations thereof refer to a treatment that ameliorates one or more existing symptoms or clinical signs associated with a condition. “Prophylactic” and variations thereof refer to a treatment that limits, to any extent, the development and/or appearance of a symptom or clinical sign of a condition. Generally, a “therapeutic” treatment is initiated after the condition manifests in a subject, while “prophylactic” treatment is initiated before a condition manifests in a subject—e.g., to a subject “at risk” of developing the condition. A subject “at risk” for developing a specified condition is a subject that possesses one or more indicia of increased risk of having, or developing, the specified condition compared to individuals who lack the one or more indicia, regardless of the whether the subject manifests any symptom or clinical sign of having or developing the condition.
As used herein, the term “and/or” means one or all of the listed elements or a combination of any two or more of the listed elements; the terms “comprises” and variations thereof do not have a limiting meaning where these terms appear in the description and claims; unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.
For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this technology belongs. Although exemplary methods, devices and materials are described herein, any methods and materials similar or equivalent to those expressly described herein can be used in the practice or testing of the present technology. For example, the reagents described herein are merely exemplary and that equivalents of such are known in the art.
The practice of the present technology can employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Pat. No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology.
Informed consent was obtained from the parents of a child possessing the c.456+4A>T mutation and a skin punch biopsy was performed in accordance with the University of Minnesota Institutional Review Board requirements for research on human subjects. A fibroblast cell line was derived by dicing the skin tissue, covering it with a microscope slide, and adding complete DMEM (20% FBS, 100 U/mL nonessential amino acids, 0.1 mg/ml each of penicillin and streptomycin, and EGF and FGF at a concentration of 10 ng/mL) with culture under hypoxic conditions. A TERT-GFP lentiviral construct was then added to the cells.
The TALEN was constructed using the Golden Gate Assembly method and cloned into a CAGGs promoter-driven, homodimeric FokI endonuclease expression cassette (Cermak et al., 2011, Nucleic acids research 39(12):e82; Christian et al., 2010, Genetics 186(2):757-761). The Cas9 and Cas9 D10A plasmids were obtained from Addgene (Cambridge, Mass.), and the U6 promoter and FANCC-specific gRNA were synthesized as a G-block (Integrated DNA Technologies, Inc., Coralville, Iowa) and TA cloned into the pCR4 TOPO vector (Invitrogen, Carlsbad, Calif.). The right donor arm was cloned from the human genome and consisted of an 849 bp sequence. The left arm was synthesized from overlapping G-block fragments in order to introduce the corrective base and silent mutations at the TALEN and CRISPR cut sites. The donor arms flanked a floxed PGK-puromycin-T2A-FANCC cDNA selection cassette; the full donor sequence is provided as SEQ ID NO:1.
For 293 transfections, TALENs or CRISPR/Cas9 nuclease and nickase with gRNA were delivered with LIPOFECTAMINE 2000 (Invitrogen, Carlsbad, Calif.) at a concentration of 1 μg each. Fibroblast gene transfer was performed using the Neon Transfection System (Invitrogen, Carlsbad, Calif.) using: 1500 V, 20 ms pulse width, and a single pulse. Concentrations of DNA for gene correction were: Cas9 nuclease/nickase: 1 gRNA 200 ng, and 5 μg of donor. For 48 hours after gene transfer all cells were incubated at 31° C.
Genomic DNA was isolated from 293 cells at 72 hours post-TALEN or CRISPR gene transfer and was amplified for 30 cycles with FANCC Forward (5′-AGACCACCCCCATGTACAAA-3′, SEQ ID NO:2) and FANCC Reverse (5′-GGAAAACCCTTCCTGGTTTC-3′, SEQ ID NO:3). It was then subjected to SURVEYOR nuclease (Transgenomic, Inc., Omaha, Nebr.) treatment as previously described (Guschin et al., 2010, Methods in molecular biology 649:247-256). Cleavage products were subjected to 10% TBE PAGE gel resolution (Invitrogen, Carlsbad, Calif.), and Image J (Research Service Branch, National Institute of Mental Health, Bethesda, Md.) was used to perform densitometry.
Gel images were utilized to determine rates of cleavage using the following equation: % gene modification=100×(1−(1−fraction cleaved)½) (Guschin et al., 2010, Methods in Molecular Biology 649:247-256). The fraction cleaved is determined using Image J and is the densitometric value of the cleavage products divided by the total densitometric value for all of the peaks. The exposure times for the gels in
The PGE-200 pRRL TLR2.1 sEF1a Puro WPRE parental plasmid was digested with SbfI and SpeI for ligation of the following oligonucleotides that inserted the FANCC CRISPR target site into the interrupted GFP portion of the plasmid: 5′-GGCACCTATAGATTACTATCCTGGA-3′ (SEQ ID NO:21) and 5′-CTAGTCCAGGATAGTAATCTATAGGTGCCTGCA-3′ (SEQ ID NO:22). Lentiviral particles were prepared by packaging with Addgene plasmids: 12259 (pMD2.G) 12251(pMDLg/pRRE), and 12253 (pRSV-Rev) (Addgene, Cambridge, Mass.) in 293T cells transfected with LIPOFECTAMINE 2000 (Invitrogen, Carlsbad, Calif.). The cell culture volume for viral production was 20 mL and viral particles were collected for 48 hours and 20 μl of the supernatant was added to 293T cells followed by puromycin selection with 0.3 μg/mL. This reporter line was transfected with 1 μg each of the Cas9 nuclease or nickases and 1 μg of the gRNA with the indicated concentrations of the pCVL SFFV d14GFP Donor (Addgene 31475, Addgene, Cambridge, Mass.). Green or red fluorescence was analyzed 72 hours post transfection using the BD LSRFortessa™ Cell Analyzer (BD Biosciences, San Jose, Calif.).
Seven days after gene transfer, cells were selected in bulk in 0.2 mg/mL puromycin. Resistant cells were then plated at low density (˜500 cells in a 10 cm2 dish) for three days followed by silicone grease-coated cloning disk placement (Corning, Inc., Corning, N.Y.). Isolated colonies were progressively passed to larger culture vessels so that cell culture confluency was maintained between 50%-70% under hypoxic culture conditions.
Cells confirmed to have undergone HDR were seeded into 24-well plates and serially transfected with a CAGGs promoter driven Cre-recombinase (Addgene: 13775, Addgene, Cambridge, Mass.) or transduced with an adenoviral cre (Vector Biolabs, Malvern, Pa.) at an MOI of 10. Excision was confirmed using primers: FC CRP 491 F (5′-GAAACCAGGAAGGGTTTTCC-3′, SEQ ID NO:23) and FC CRP 1163R (5′-CAACCCCCATCTTCTCATGT-3′, SEQ ID NO:24).
Primer pairs were designed to amplify a junction between the donor right arm and endogenous locus using donor-specific forward: (5′-GCCACTCCCACTGTCCTTTCCT-3′, SEQ ID NO:4) and FANCC reverse (5′-ccaagtccctcagtcccaga-3′, SEQ ID NO:5). To confirm homology-directed repair on the left portion of the correction template, the FANCC genomic Forward (5′-CAGACACACCCCTGGAAGTC-3′, SEQ ID NO:6) and donor reverse (5′-CTTTTGAAGCGTGCAGAATGCC-3′, SEQ ID NO:7). For RT-PCR, total cellular RNA was isolated and reverse transcribed using SuperScript Vilo (Invitrogen, Carlsbad, Calif.) followed by amplification with: FANCC allele-specific RT forward (5′-GGTGTATTAAGCCATATTCTGAGC-3′, SEQ ID NO:8) and reverse (5′-ACAACCCGGAATATGGCAGG-3′, SEQ ID NO:9). PCR products were cloned into the pCR 4 TOPO vector (Invitrogen, Carlsbad, Calif.) for Sanger sequencing confirmation of the entire amplicon using the M13 forward and reverse primers.
H2AX staining was performed on cells seeded at a concentration of 120,000 total cells in a T25 flask in the presence of 2 mM hydroxyurea (Sigma-Aldrich, St. Louis, Mo.) for 48 hours using the H2AX phosphorylation assay kit according to the manufacturers instructions (EMD Millipore, Billerica, Mass.). Flow cytometry was performed using the BD LSRFortessa™ Cell Analyzer (BD Biosciences, San Jose, Calif.).
TALEN or CRISPR/Cas9 nuclease/nickase and gRNA plasmids (1 μg each) were delivered to 293 cells by lipofection. These cells were used for SURVEYOR analysis or gene tagging with integrase-deficient lentiviral (IDLV). The p11CMV-GFP expression vector, the pCMV-AR8.2 packaging plasmid harboring the D64V integrase mutation (Lombardo et al., 2007, Nature biotechnology 25:1298-1306), and the pMD2.VSV-G envelope-encoding plasmid (Addgene 12259, Addgene, Cambridge, Mass.) were delivered to the 293T viral producing line with LIPOFECTAMINE 2000 (Invitrogen, Carlsbad, Calif.). Addition of GFP IDLV at an MOI of 5 occurred 24 hours post-nuclease delivery.
Seven days post IDLV addition, the cells were sorted for GFP and then expanded. SURVEYOR analysis was performed with the FANCC primers listed above and OT1 (F: 5′-TGGGTGGAGGTAGTTTCCTG-3′ (SEQ ID NO:10) and R: 3′-AGTGGGAAGAGGGCTGATTT-3′ (SEQ ID NO:11)), OT2 (F: 5′-TCTGGGCATAAAGAAGGTGTG-3′ (SEQ ID NO:12) and R: 5′-ATTGACTCATCTCGGGCATT-3′ (SEQ ID NO:13)), OT3 (F: 5′-GACCTGGGCTTGAATGTGTT-3′ (SEQ ID NO:14) and R: 5′-GCAGTTGCTGTAGAATAGGCTGT-3′ (SEQ ID NO:15)), OT4 (F: 5′-CCCAGAGCAAAACCATTCAT-3′ (SEQ ID NO:16) and R: 5′-CACCTGTTGCAGACTCCTCA-3′ (SEQ ID NO:17)), and OT5 (F: 5′-AGGAGCTGGGACACTGCTAA-3′ (SEQ ID NO:18) and R: 5′-ACACATGCCTGTCCTTCTCC-3′ (SEQ ID NO:19)). These amplicons were subjected to SURVEYOR analysis as described above.
IDLV;FANCC or off-target detection PCR was performed with the LTR forward primer (5′-GTGTGACTCTGGTAACTAGAG-3′ (SEQ ID NO:20)) and the corresponding FANCC or off-target reverse primers from above. IDLV:FANCC junction amplicons were cloned and Sanger sequenced.
Duplicate samples underwent nrLAM PCR or LAM PCR with MseI or MluCI as previously described (Ramirez et al., 2012, Nucleic Acids Res. 40(12):5560-5568; Ran et al., 2013, Cell 154(6):1380-1389) except that these deep sequencing data were generated with the Illumina MiSeq platform (San Diego, Calif.). Data set analysis, vector trimming, genome alignment, and IS/CLIS identification was determined using the high-throughput insertion site analysis pipeline (Arens et al., 2012, Hum Gene Ther Methods 23(2):111-118).
Umbilical cord blood (UCB) was collected in accordance with the University of Minnesota Institutional Review Board requirements for research on human subjects. Total UCB was placed in IMDM expansion media with 100 ng/mL of IL-3, 11-6, GM-SCF, Flt-31, and stem cell factor with 1× penicillin/streptomycin and 10% human plasma and 1 μM SR1 aryl hydrocarbon receptor antagonist. CD34 cells were isolated using the EASYSEP Human CD34 Positive Selection Kit according to the manufacturer's instructions (Stemcell Technologies, Inc., Vancouver, BC) and placed back in expansion media overnight. Gene transfer was performed using the Neon Electroporator (Invitrogen, Carlsbad, Calif.) with settings of: 1400V, 10 ms pulse, with three pulses. Dose of DNA was: 1 μg GFP and 1 μg each of Cas9 (nuclease and nickases) and gRNA. 72 hours after transfection the genomic DNA was harvested for FANCC locus SURVEYOR analysis as above.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
The preceding disclosure is not limited to particular aspects or embodiments described, as such may, of course, vary. Also, the terminology used herein is for the purpose of describing particular aspects only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
The left arm is indicated in bold; the right arm is indicated in bold and underlined; the floxed PGK-puromycin-T2A-FANCC cDNA selection cassette is indicated in italics; within the selection cassette, the FANCC sequence is underlined.
CAGCCAAGCCTCTTCCCTGATGATTTACTCCCAGGATTTTCAGTTCT
CAGAGTTCTTTCTCATTCAGATACTTGAAAAATGTTCATGTTTTCTT
CTTGTGTATTATTTCATTTTTACATTTATCTCTTTGATTTACATTAA
ACTGCAGTATATTTTGATGAATAATACCCGGTGAGAATCTTTTTTTC
TTTTTACAGATAGTTTTTGAGGCACCATTTATTACATAATCTGTCCT
TTCCCTACTGATTTGTGATGTGTTCTCTATCTTATATTAAATTCTAA
TATCTGGATCCTTTTGTAGTTCATGAGCGTGATGATTGGGTGTTTCA
CGCATGTGTGTGCAATGTGCCACCCTTGAACCTTGTATGACATCGGC
ACGTTACCCATCTGACCTCAAAAAAAAAGCAAAGAAAAATTATCATC
TCTGTTAAACATATTTTACTGAGTTTAAAAACAATAAAGATTCCATT
CTTAATATAGGTAAAGCACTGCTCATTGATGATATATATTTTTGTTT
CACTGCTAATGTTTGTTTAAATTGACTTCTTTTTAATGTGTTAACTT
TAATGCTAACATTTCTCTTTTACACTTTGAATCAAAGTAAATTGGGT
ACTTTGACAAACAGATTTTTTTGTTTCATAGAGACCACCCCCATCTA
CAAATAAATTGTAGGCATTGTACATAAAAGGCACTTGCATTTACTTT
TAAAGAAGTTAACTTTTTCTGTTTATGTTTTTTAGGGTGTATTAAGC
CATATTCTGAGCGCGCTGCGCTTTGATAAAGAAGTGGCGCTGTTTAC
CCAGGGCCTGGGCTATGCGCCGATTGATTATTATCCGGGCCTGCTGA
AAAATGTGAGTATTTAAAATTTATCACTTTTGAAATGTTTAATGCTG
AATGTGCCATCAGCAAAAAGAGTAAATGGAAATATTTCAGTCCTCCA
GAAGAGATGTTTAACTTTTCTTTGTTTATCTCTTCTTACCTTGGGCA
GACTTATGGCCATGTACGGAAGAAATGTGAGATGGGAAGTTATGAGA
AAGAAGGAAACCAGGAAGGGTTTTCCTAAACCAACCAATCAGCCTCT
CTTTCTAGGGACACATCTCACTTATTCACTCAGAGATGTTTGGGAGA
AGAGCTGTTCTTAGCTATTATAAACACAGTCTTGTACTGTTGAAAGA
ATCTTGTATTTCAAATAACCTGATTGGAATTTTCTGTTAAAGCAAAA
CAGAAAATTCAGTACATAGTTTTAAATATTTACCTCTTAATATTAAA
GCATTGTTTTCTTC
ATAACTTCGTATAATGTATGCTATACGAAGTTA
TCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGGCACTTG
GCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCG
GTAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCT
TCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGC
GTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCG
TGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGG
GGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAG
GCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGG
GCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCACG
CTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC
GGGCCTTTCGACCTGCAGCCCAAGCTTACCATGACCGAGTACAAGCC
CACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCA
CCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTC
GATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTT
CCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACG
ACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCG
GGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGG
TTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGC
ACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCG
CCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGG
AGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCT
CCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTC
ACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGAC
CCGCAAGCCCGGTGCCGAGGGCAGAGGAAGTCTGCTAACATGCGGTG
ACGTCGAGGAGAATCCTGGCCCA
GCTCAAGATTCAGTAGATCTTTCT
TGTGATTATCAGTTTTGGATGCAGAAGCTTTCTGTATGGGATCAGGC
TTCCACTTTGGAAACCCAGCAAGACACCTGTCTTCACGTGGCTCAGT
TCCAGGAGTTCCTAAGGAAGATGTATGAAGCCTTGAAAGAGATGGAT
TCTAATACAGTCATTGAAAGATTCCCCACAATTGGTCAACTGTTGGC
AAAAGCTTGTTGGAATCCTTTTATTTTAGCATATGATGAAAGCCAAA
AAATTCTAATATGGTGCTTATGTTGTCTAATTAACAAAGAACCACAG
AATTCTGGACAATCAAAACTTAACTCCTGGATACAGGGTGTATTATC
TCATATACTTTCAGCACTCAGATTTGATAAAGAAGTTGCTCTTTTCA
CTCAAGGTCTTGGGTATGCACCTATAGATTACTATCCTGGTTTGCTT
AAAAATATGGTTTTATCATTAGCGTCTGAACTCAGAGAGAATCATCT
TAATGGATTTAACACTCAAAGGCGAATGGCTCCCGAGCGAGTGGCGT
CCCTGTCACGAGTTTGTGTCCCACTTATTACCCTGACAGATGTTGAC
CCCCTGGTGGAGGCTCTCCTCATCTGTCATGGACGTGAACCTCAGGA
AATCCTCCAGCCAGAGTTCTTTGAGGCTGTAAACGAGGCCATTTTGC
TGAAGAAGATTTCTCTCCCCATGTCAGCTGTAGTCTGCCTCTGGCTT
CGGCACCTTCCCAGCCTTGAAAAAGCAATGCTGCATCTTTTTGAAAA
GCTAATCTCCAGTGAGAGAAATTGTCTGAGAAGGATCGAATGCTTTA
TAAAAGATTCATCGCTGCCTCAAGCAGCCTGCCACCCTGCCATATTC
CGGGTTGTTGATGAGATGTTCAGGTGTGCACTCCTGGAAACCGATGG
GGCCCTGGAAATCATAGCCACTATTCAGGTGTTTACGCAGTGCTTTG
TAGAAGCTCTGGAGAAAGCAAGCAAGCAGCTGCGGTTTGCACTCAAG
ACCTACTTTCCTTACACTTCTCCATCTCTTGCCATGGTGCTGCTGCA
AGACCCTCAAGATATCCCTCGGGGACACTGGCTCCAGACACTGAAGC
ATATTTCTGAACTGCTCAGAGAAGCAGTTGAAGACCAGACTCATGGG
TCCTGCGGAGGTCCCTTTGAGAGCTGGTTCCTGTTCATTCACTTCGG
AGGATGGGCTGAGATGGTGGCAGAGCAATTACTGATGTCGGCAGCCG
AACCCCCCACGGCCCTGCTGTGGCTCTTGGCCTTCTACTACGGCCCC
CGTGATGGGAGGCAGCAGAGAGCACAGACTATGGTCCAGGTGAAGGC
CGTGCTGGGCCACCTCCTGGCAATGTCCAGAAGCAGCAGCCTCTCAG
CCCAGGACCTGCAGACGGTAGCAGGACAGGGCACAGACACAGACCTC
AGAGCTCCTGCACAACAGCTGATCAGGCACCTTCTCCTCAACTTCCT
GCTCTGGGCTCCTGGAGGCCACACGATCGCCTGGGATGTCATCACCC
TGATGGCTCACACTGCTGAGATAACTCACGAGATCATTGGCTTTCTT
GACCAGACCTTGTACAGATGGAATCGTCTTGGCATTGAAAGCCCTAG
ATCAGAAAAACTGGCCCGAGAGCTCCTTAAAGAGCTGCGAACTCAAG
TCTAG
CATCATCACCATCACCATTGAGTTTAAACCCGCTGATCAGCC
TCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCC
CGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCT
AATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCT
ATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGA
AGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTG
GTTAT
TGGCTTAAATTATAGCCAAATGTGAGAAATTTTAACTTACAA
ACTTGATGTAACTCTTCTAAAAAATGTTATGAGATTTTTTAATGTTT
GTTAACCATTCCGGTGTTTTGGAAGCTTTGTACAATAACAACTTTTT
TTTTTTTTTCAAATGAACTGAATTTTAAATGAAGAAGTAAACTAACT
TTTCTTTAAATGGATTTGGTTTTAATTCTTAGGAAATTAATGACCTG
TCTATTGTTCATTGCTTAAATAGGAATGCAGAATTATAGACATTAAA
CATAAAATCCCAATTATTAGTAAATGTGACATGGCACTGCTTCCTTT
TCACTCTGACAGAGTGAAACATGAGAAGATGGGGGTTGGGGGAATCT
CAACGGAAATATCACTCACACCAAGAAAAATAGAACTGATGTAATCC
TGTTTGCAGCGTGAGTTAACCTGCAACTGATTTTGTTTTACAGATGG
TTTTATCATTAGCGTCTGAACTCAGAGAGAATCATCTTAATGGATTT
AACACTCAAAGGCGGTAGGTGTTAAACTAAACATCCTTCTTCTCAGG
TTTCAAAATGTATCAGTTTGGTTATGAGAGGAAAATTTTACAATTCA
TAGGAAATGGATGTTCAGTTATGGTTGTATTTTATATAGAAAGATTA
TTTTAGTGGAATACATAGCAAATTGGTGAGTTTTTTCAAACTCTTTT
AAAAATCACTATTTTCTCAACTCTCACAGAGCAGTAAGTAAATCATA
CAATGTCTTTTGTGGGCCCATTAGGTAGAAAGCCCTACATACACAGT
AGGGAGCATAAAAGAAAGAGCAGTATTAGTTTTACCCTGGGATTGCT
CACTCTG
This application claims priority to U.S. Provisional Patent Application Ser. No. 62/000,590, filed May 20, 2014, which is incorporated herein by reference.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US15/31807 | 5/20/2015 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62000590 | May 2014 | US |
