1. Field of the Invention
A method for identifying a molecules which modulates the activity of Nod pattern recognition molecules, especially which modulates Nod1 activity in subjects having an Nod2 mutation, such as Nod2fs, which reduce or eliminate Nod1 activity. The method is useful for identifying agents which modulate or restore Nod activity and thus would be useful pharmaceutical agents for treating diseases, such as Crohn's Disease associated with deficits or disruptions of Nod activity.
2. Description of the Related Art
Nod2 (also known as CARD15) is a member of the Nod family of pattern recognition molecules (PRMs) involved in peptidoglycan sensing (1, 2). While Nod2 detects a muramyl dipeptide (MDP) motif found in peptidoglycans from all classes of bacteria (3-5), Nod1 detects a diaminopimelic acid (DAP)-containing muramyl tripeptide (M-TriDAP) found primarily in Gram-negative bacterial peptidoglycan (4, 6, 7). In addition to its role as an intracellular PRM, genetic evidence has identified Nod2 as the first susceptibility gene for Crohn's disease (8, 9). Crohn's disease is an inflammatory disorder affecting the digestive tract, the etiology of which remains largely unknown. However, the recent association between the disease and Nod2 on the one hand, and between Nod2 and bacterial sensing on the other, suggests that Crohn's disease is likely a consequence of a breakdown in the tolerance to the intestinal bacterial flora. Still, it remains unclear why Nod2 dysfunction is a risk factor favoring the onset of Crohn's disease. Indeed, while Nod2fs is fully defective for peptidoglycan sensing, other Nod2 mutant proteins found in Crohn's disease patients display only minor differences in peptidoglycan detection (10, 11).
Through the identification of new important functions of Nod2, substantial progress has been made over the past few years towards understanding the link between Nod2 mutations and Crohn's disease (1, 2, 12). For example, Nod2 function has been shown to be related to intracellular bacterial killing (13), defensin activity due to its expression in Paneth cells (14, 15) as well as the induction of the anti-inflammatory cytokine IL-10 (16). Also Nod2−/− mice display an increased TH1 profile of cytokine responses following stimulation with Toll-like receptors (TLRs) agonists (17), which is compatible with some features of Crohn's disease.
Maeda et al. (31) describe the Nod2 mutation in Crohn's Disease and Kobayashi et al. (32) describe Nod2-dependent regulation of innate and adaptive immunity. The DNA sequences of Nod1, Nod2 and Nod2 mutants have been described. Nod1 sequences are described by J. Bertin (30); Nod2 sequences by Y. Ogura et al. (27) and those of some Nod2 mutants by J. P. Hugot et al. (8) and Y. Ogura et al. (9). Said sequences are hereby incorporated by reference.
The inventors have discovered the existence of an unexpected cross-talk between the Nod1 and Nod2 signaling pathways. That is, a mutation in the Nod2 gene, such as the Nod2fs mutation, also causes a defect in Nod1 function. Nod2fs is a mutation of the Nod2 gene and is associated with susceptibility to Crohn's Disease. While Nod2fs has been associated with Crohn's Disease, the resulting functional deficiency of Nod1 activity associated with the Nod2fs mutation may operate to cause or aggravate disease. Based on this discovery, methods for identifying molecules which restore Nod function, such as restoring a functional Nod1 pathway in Nod2fs patients, are disclosed.
The inventors investigated the response of primary mononuclear cells isolated from Crohn's disease patients not only to MDP, but also to several muramyl peptides or peptidoglycan agonists. Using this approach, they identified M-TriLYs and M-TetraLYS, two MDP-related muramyl peptides, as Nod2 agonists. In addition, they show that the whole peptidoglycan polymers extracted from Staphylococcus aureus and Streptococcus pneumoniae fails to induce cytokine response in PBMCs from Nod2fs patients. Zouali et al. (29) argued against a major role of Nod1 in inflammatory bowel disease (including Crohn's disease) genetic susceptibility. Thus, surprisingly it was found that M-TriDAP, the specific agonist of Nod1, also failed to induce cytokine response in PBMCs from Nod2fs patients, while it efficiently stimulated cells from either healthy donors or non Nod2 Crohn's disease patients. The importance of these discoveries is further reinforced by the observation that cells from Nod2fs patients were totally unresponsive to peptidoglycan from Helicobacter pylori, which is an efficient activator of both Nod1 and Nod2 signaling pathways. Muramyl peptides are known to induce cytokine secretion in synergy with TLR ligands.
The inventor's show that the blockage of Nod1 function is only partially overcome in PBMCs stimulated with M-TriDAP in combination with either LPS or LTA. These discoveries now provide the foundation for design of novel diagnostic methods for Crohn's disease based on detection of defects in Nod1 function and therapeutic approaches for treatment of Crohn's disease which establish functional Nod1 pathway in Nod2fs subjects.
Results and Discussion
In search for MDP-derived muramyl peptides that could stimulate the Nod2 signaling pathway, the inventors generated several molecules differing in the length of their peptidic moiety, including M-TriLys and M-TetraLys (
One goal was to use MDP-derived muramyl peptides to stimulate primary human peripheral blood mononuclear cells (PBMCs) (see below). Thus, the inventors searched for other MDP-derived molecules that could represent the optimal negative controls for M-TriLys and M-TetraLys agonists.
By taking advantage of a previous observation that the sugar moiety of muramyl peptides also plays a key role for optimal activation of Nod2 (4), modified forms of M-TriLys and M-TetraLys were generated in which the MurNAc moiety is dehydrated to form anhydro-muramyl peptides (see
The six muramyl peptides characterized above (MDP, M-TriLys, M-TetraLys, anhydro-M-TriLys, anhydro-M-TetraLys and M-TriDAP) were used to stimulate PBMCs obtained from human blood. PBMCs from three groups of individuals were collected: healthy donors (CTR), Crohn's disease patients without Nod2 mutations (Crohn) and Crohn's disease patients carrying homozygous Nod2fs frameshift mutation (Nod2fs). Muramyl peptides were directly added to the culture medium at a final concentration of 50 nM, and supernatants were collected following overnight stimulation. IL-1β, IL-10 and TNFα were measured in the supernatant, while intracellular IL-1α was measured from cell lysates (
In addition, it was observed that M-TetraLys was a poor inducer of Nod2 in vitro was reinforced by findings that this agonist only marginally induced cytokine secretion from human PBMCs, and that this effect was further blunted in cells from Nod2fs patients (
Second, the conclusion that sensing of M-TriLys and M-TetraLys in PBMCs from healthy donors and non-Nod2 Crohn's disease patients depends on Nod2 is reinforced by the observation that anhydro-M-TriLys and anhydro-M-TetraLys failed to stimulate these cells, which is in agreement with the results obtained in HEK293T cells (see
This result was unexpected since M-TriDAP is a specific activator of Nod1, but not of Nod2. This lack of response to M-TriDAP was found for all the cytokines that were tested, suggesting that the defect must lie far upstream in the Nod1-dependent signaling pathway, likely at the level of the detection by the Nod1 sensing system. Therefore, these results identify an unexpected link between Nod2 mutations and the Nod1 signaling pathway.
Muramyl peptides are naturally occurring degradation products of peptidoglycan which are useful tools to study precisely the involvement of signaling pathways dependent upon the specific activation of Nod1 or Nod2. However, in physiological situations, macrophages would likely encounter the presence of both intact peptidoglycan polymers together with muramyl peptides. Therefore, the inventors aimed to investigate the response of PBMCs from the same individuals to peptidoglycans from H. pylori, S. pneumoniae and S. aureus.
The inventors decided to use peptidoglycan from H. pylori since it is the prototype of Gram-negative bacterial peptidoglycan (DAP-type peptidoglycan) and it is relatively easy to purify. Similarly, peptidoglycan from S. pneumoniae was chosen since it represents a classical peptidoglycan (Lys-type peptidoglycan) from Gram-positive bacteria. Finally, peptidoglycan from S. aureus was also included in this study since it is widely studied; however, because of the extremely high degree of peptidic cross-linking found in this peptidoglycan, its structure is less representative of Gram-positive bacterial peptidoglycan than that of S. pneumoniae.
For such studies, the level of purification of the peptidoglycan polymer is a crucial feature. Several quality control tests were performed along the purification steps to ensure that other cell wall contaminants are excluded, such as lipopolysaccharide (LPS), lipoproteins or lipoteichoic acid (LTA). To this end, the absence of LPS contamination was assessed by the Limulus Amoebocyte Lysate test, showing that purified peptidoglycans contained less than 4 pg LPS/ml sample. To address the difficult question of contamination by lipoproteins or LTA, the inventors took advantage of their recent observation that contaminant-free peptidoglycans fail to stimulate thioglycholate-induced peritoneal macrophages from mice (19). The inventors' purified peptidoglycans failed to induce the secretion of TNFA or IL-6 from peritoneal mouse macrophages, showing that only traces amounts, if any, of lipoproteins or LTA contaminants were present in their peptidoglycan preparations. These peptidoglycan preparations were then added (each at 10 μg/ml) to the human PBMCs from the same individuals as described above, and cytokines were measured after over-night stimulation (
The observation that PBMCs from Nod2fs patients are unresponsive to Gram-positive bacterial peptidoglycans allows one to draw some important conclusions. First, this result shows that Nod2 is key sensor of Gram-positive bacterial peptidoglycan. Second, this observation suggests that, within the peptidoglycan polymer, the MDP and M-TriLys, motifs are the key structures that drive the host's response through their detection by Nod2. Third, the inventors' assumption that these peptidoglycans are free of bacterial contaminants is reinforced by this result, since unpurified peptidoglycans would have induced a TLR-driven response. In the case of the Gram-negative bacterial peptidoglycan, it was anticipated that, in the macrophages from Nod2fs patients, the defective Nod2 sensing could be compensated by the activation of the Nod1 signaling pathway. Indeed, unlike Gram-positive bacterial peptidoglycan, Gram-negative bacterial peptidoglycan is able to stimulate both Nod1 and Nod2. The lack of Nod1-dependent signalization in Nod2fs cells (
In an attempt to better understand the origin of the defective Nod1-dependent signaling in cells from Nod2fs patients, the inventors first investigated if Nod1 expression was decreased in Nod2fs PBMCs. Nod1 expression was analyzed by real-tin PCR on 13 individuals (6 “CTR”, 3 “Crohn's” and 4 “Nod2fs”). Even though expression of Nod1 was found quite variable among individuals, no correlation could be observed between expression levels of Nod1 and the three groups analyzed (
These results clearly demonstrate that PBMCs from Nod2fs patients are unable to induce cytokine secretion following stimulation with M-TriDAP, the specific agonist of Nod1. The molecular basis of this defect, however, remains unclear. In light of the inventors' experiments, it can be excluded that the defective Nod1-dependent signaling pathway arises from an altered expression of Nod1 itself (see
The results presented here can be applied to the design of new therapeutic treatments for Crohn's disease. Nod2 1007fs mutation represents one third to half of the Nod2 mutations found in Crohn's disease patients. Thus, in this group of patients, a therapeutic approach that restores a functional Nod1 signaling would reverse underlying defects caused by the Nod2 mutation. Indeed, up until now, the idea of targeting Nod1 pathway in Crohn's disease patients was not envisioned in this way, since it was assumed that Nod1 remained fully functional. Restoring a functional Nod1 pathway in Nod2fs cells would have the important advantage to restore partial homeostasis of the intestinal mucosa vis-à-vis the microbial environment. Therefore, since Crohn's disease can be associated with a breakdown in the tolerance to the intestinal bacterial flora, such tolerance could be restored through the Nod1-dependent sensing of Gram-negative bacterial components of the microbial environment. Because such therapy would rely on a fine balance defined by the host itself, it would be less aggressive than other treatments, such as those acting to reduce the inflammation induced by the disease.
Experimental Procedures
Preparation of Highly Purified Peptidoglycans from Gram-Negative and Gram-Positive Bacteria
Bacterial strains used to prepare PGN are the following: Helicobacter pylori 26695; Staphylococcus aureus COL (from Olivier Chesneau, Institut Pasteur); Streptococcus pneumoniae R800. The PGN purification procedures were exactly as previously described (6, 19). Purity of samples was assessed by HPLC amino acid and saccharide analysis after HCl hydrolysis. Also, each PGN preparation was tested or the absence of LPS contamination using the Limulus Ameobocyte Lysate assay as previously described (19). The absence of TLR2-detected contaminants (lipoproteins or lipoteichoic acids) was tested on thioglycholate elicited mouse peritoneal macrophages from either C57B16 or TLR2% mice as previously described (19).
Preparation of Muropeptides
DAP- and Lys-containing UDP-MurNAc-peptides were prepared as described previously (4 22). M-TetraLys, M-TriLys and M-TriDAP were generated by mild acid hydrolysis (0.1 M HCl, 10 min at 100° C.) of the corresponding UDP-MurNAc-peptides. Replacement of meso-DAP by L-Lys in the peptidoglycan of E. coli was obtained by overexpression in the latter species of the murE gene from Staphylococcus aureus encoding UDP-MurNAc-L-Ala-L-D-GIu; L-Lys adding enzyme (23). Cells were harvested before cell lysis occurs and their peptidoglycan was extracted and purified as previously described (24). In these conditions, about 50% of the DAP residues at the third position of the peptides were shown to be replaced by L-Lys. This peptidoglycan preparation was digested by SltY lytic transglycosylase in a reaction mature (1 ml) consisting in 300 mM sodium acetate buffer, pH 4.5, 1 mg of PG (briefly sonicated for homogenization), and 100 μg purified SltY enzyme (25). After overnight incubation at 37° C., the reaction was stopped by adding 500 μl of 50 mM sodium phosphate buffer, pH 4.45 (HPLC eluent A) and 2 μl phosphoric acid. The two main monomer products, Anh-GM-TetraDAP and Anh-GM TetraLys, were purified by HPLC on a column of nucleosyl 5C18 (4,6×250 mm, Alltech). Elution was performed at 0.6 ml/min with buffer A, using a gradient of methanol from 0 to 25% in 180 min. Detection was at 215 nm. The retention times of these two compounds were 67 min and 80 min, respectively. They were further purified and desalted using a second HPLC step on the same column using this time 0.1% trifluoroacetic acid and a gradient of methanol for elution. Their purity and composition was confirmed by amino acid and hexosamine analysis after acid hydrolysis of samples (6 M HCl, 16 h at 95° C.), using a Hitachi L8800 analyzer, as well as by MALDI-TOF mass spectrometry. Anh-M-TetraLys was obtained by treatment of Anh-GM-TetraLys with E. coli NagZ β N-acetylglucosaminidase. The reaction mixture (200 μl) contained 20 mM HEPES buffer, pH 7.4, 50 mM NaCl, 0.5 mM substrate, and 20 hg of purified NagZ enzyme (25), Anh-GM-TriLys and Anh-M-TriLys were generated by treatment of the corresponding tetrapeptide compounds with E. coli LdcA L,D-carboxypeptidase. The reaction mixture (200 μl) contained 50 mM Tris-HCl buffer, pH 8.0, 0.5 mM substrate, and 20 μg purified LdcA enzyme (25). In all cases, incubation was for overnight at 37° C. and products were purified by HPLC and their identity confirmed by the above described procedures.
Cell Lines and Reagents
HEK293T cells were cultured in DMEM containing 10% fetal calf serum. Prior to transfection, HEK293T cells were seeded into 24 well plates at a density of 1×105 cells/ml as described previously (26), MDP LD was from Calbiochem and reported to be 98% pure by TLC.
Expression Plasmids and Transient Transfections
The expression plasmid for Nod2 has been previously described (27). The NF-κB luciferase reporter plasmid was from Stratagene. Transfections were carried out in BEK293T cells as previously described (26).
NF-κB Activation Essays
Studies examining the synergistic activation of NF-κB by muramyl peptides in cells over expressing Nod2 were carried out as originally described by Inohara et al. (28). Briefly, HEK293T cells were transfected overnight with 10 ng of Nod2 plus 75 ng of NF-κB luciferase reporter plasmid. At the same time, muramyl peptides were added to cell culture medium and the synergistic NF-κB-dependent luciferase activation was then measured following 24 h of co-incubation. NF-κB-dependent luciferase assays were performed in duplicate and data represent at least 3 independent experiments. Data show mean±SEM.
Genotyping of NOD2 Variants
Blood was collected from 74 patients with Crohn's disease and 10 healthy volunteers, PCR amplification of NOD2 gene fragments containing the polymorphic site 3020insC was performed in 50 μl reaction volumes containing 100-200 ng genomic DNA, as previously described (16). The 3020insC polymorphism was analyzed by Genescan analysis on an ABI Prism 3100 Genetic Analyzer according to the protocol of the manufacturer (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands).
Four patients with Crohn's disease were found homozygous for the 3020insC mutation, and they were further investigated in the cytokine studies. As control groups, five patients with Crohn's disease heterozygous for the 3020 insC NOD2 mutation, five patients with Crohn's disease bearing the wild type allele, and five healthy volunteers homozygous for the wild-type NOD2 allele were included. The cells isolated from the four groups of patients were isolated and tested at two separate occasions. The study was approved b the Ethical Committee of the Radboud University, Nijmegen, the Netherlands.
Isolation of Mononuclear Cells and Stimulation of Cytokine Production
After informed consent, venous blood was drawn from the cubital vein of patients and healthy volunteers into three 10 ml EDTA tubes (Monoject, s-Hertogenbosch, The Netherlands). The PBMCs fraction was obtained by density centrifugation of blood diluted 1:1 in pyrogen-free saline over Ficoll-Paque (Pharmacia Biotech AB, Uppsala, Sweden). Cells were washed twice in saline and suspended in culture medium (RPMI 1640 M) supplemented with gentamicin 10 mg/ml, L-glutamine 10 mM and pyruvate 10 mM. The cells were counted in a Coulter counter (Coulter Electronics, Mijdrecht, The Netherlands) and the number was adjusted to 5×106 cells/ml. 5×105 PBMC in a 100 μl volume were added to round-bottom 96-wells plates (Greiner, Alphen a/d Rijn, The Netherlands) and incubated with either 100 μl of culture medium (negative control), or the various stimuli: 50 nM of the various muropeptide preparations, 10 μg/ml of the purified peptidoglycans 1 ng/ml highly purified E. coli LPS (strain 055 :B5), 5 μg/ml of artificially-synthesized LTA (kindly provided by dr. Corinna Hermann, Konstanz University, Germany), or a combination of stimuli as described in the Results section.
Cytokine Measurements
For detection of cytokine concentrations in the supernatants, BioPlex 100 system (BIO-RAD, Hercules, Calif., U.S.A.) was used. The kits were used as indicated by manufacturer and the sensitivity for all cytokines was <20 pg/ml.
Quantification of Nod 1 mRNA using Real-Time PCR
Total RNA was isolated from cells using Rneasy kits (Macherey Nagel, Hoerdt, France) according to the manufacturer's instructions. RNA quantification was performed using spectrophotometry. After treatment at 37° C. for 30 min with 20-50 units of RNase-free DNase I (Roche Diagnostics Corporation, Indianapolis, USA) were used to synthesize single-stranded cDNA. Nod1 mRNA was quantified using SYBR green Master Mix (Applera, Courtaboeuf, France) with specific human oligonucleotides (sense: GTAAAGGTGCTA AGCGAAGA, anti-sense; TCTGATTCTGGATAAGCCAT) in a GeneAmp Abiprism 7000 (Applera, Courtaboeuf, France). In each assay, calibrated and no-template controls were included. Each sample was run in duplicate, SYBR green dye intensity was analyzed using the Abiprism 7000 SDS software (Applera, Courtaboeuf, France). All results were normalized to the β-actin, an unaffected housekeeping gene.
Statistical Analysis
The human experiments were performed in triplicate with blood obtained from patients and volunteers. The differences between groups were analyzed by Mann-Whitney U test, and where appropriate by Kruskal-Wallis ANOVA test. The level of significance between groups was set at p<0.05. The data are given as means±SD.
Isolation of PBMCs:
Human PBMCs (peripheral blood mononuclear cells) from a Nod2fs patient are isolated. 10-20 ml of blood from these subjects is obtained and yields about 5-7×106 PBMCs. Cells are isolated and seeded in 96 well plates at 105 cells/well. From a single subject an average of 60 wells can be obtained.
Stimulation of PBMCs.
The objective of the screening method is to identify a compound which allows Nod2fs cells to detect a Nod1 specific agonist such as M-TriDAP, the specific ligand of Nod 1. Thus, in each well cells are incubated overnight with 100 nM M-TriDAP or with a control without M-TriDAP. The following day, the amount of stimulation induced by exposure to M-TriDAP is determined by measuring cytokine secretion in the cell supernatants obtained from the overnight incubations. Levels of different cytokines may be measured, including IL-1β, IL-10 and/or TNFα Cytokine levels are determined by conventional ELISA procedures. In addition to M-TriDAP each individual well is stimulated with a candidate molecule of interest or with an appropriate control. Conventional methods for detecting or measuring cytokines are known. Some of those methods are described by Example 1 above.
Technical Aspects of the Test.
The screening method is based on a gain-of-function (i.e., restoring the sensitivity of the Nod2fs macrophages to the Nod1 specific ligand) rather than a loss-of-function. Thus, it is not necessary to investigate the possible toxicity of each test compound at this stage of the screening. Moreover, the gain-of-function approach allows the assay to test hundreds of test molecules at a single experimental point. For example, to screen a bank of 100,000 different test molecules, the molecules may be pooled in to groups of 170 molecules, in which case the blood obtained from about 10 patients would be adequate to screen the bank (170×60×10). Then, using a dichotomic approach, a group of interest (170 molecules) can be redivided to identify one or a smaller group of candidate molecules.
Modifications and Other Embodiments
Various modifications and variations of the described methods and products as well as the concept of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention is not intended to be limited to such specific embodiments. Various modifications of the described modes for carrying out the invention which are obvious to those skilled in the immunological, microbiological, molecular biological, medical, biological, chemical or pharmacological arts or related fields are intended to be within the scope of the following claims.
The documents cited above in conjunction with the description of particular methods or products are incorporated by reference for the purpose of describing these particular methods or products.
| Number | Date | Country | |
|---|---|---|---|
| 60670674 | Apr 2005 | US |