Patent Application
20160208316
The present invention relates to a method for the in vitro detection of strains of Legionella pneumophila that are resistant to antibiotics, in particular to the fluoroquinolones. The invention also relates to nucleotide probes and a kit of reagents allowing the detection of Legionella pneumophila bacterial strains that are resistant to antibiotics, in particular of the fluoroquinolone type.
The invention finally relates to a real-time PCR technique for implementing the abovementioned method for the in vitro detection of antibiotic-resistant strains of Legionella pneumophila.
Legionella pneumophila, a Gram-negative bacterium, is the main etiological agent of legionnaires' disease, a pneumonia potentially serious in humans. The fluoroquinolones and the macrolides are first-line antibiotics in the treatment of legionnaires' disease. However, therapeutic failures are frequent and mortality remains high, on average 10 to 15%, and more than 30% in immunosuppressed patients.
To date, these therapeutic failures have never been associated with acquired antibiotic-resistance in L. pneumophila. In fact, numerous studies carried out in vitro have not made it possible to show acquired resistance to fluoroquinolones or macrolides in the natural strains of L. pneumophila isolated in humans or isolated from the environment (Baltch A L et al., Antimicrob. Agents Chemother., 1998, 42(12):3153-6; Baltch A L et al., Antimicrob. Agents Chemother., 1995, 39(8):1661-6; Garcia M T et al., Antimicrob. Agents Chemother., 2000; 44(8): 2176-8; Higa F. et al., J. Antimicrob. Chemother. 2005; 56(6):1053-7; Jonas D. et al., J. Antimicrob. Chemother., 2001; 47(2):147-52; Onody C. et al., J. Antimicrob. Chemother., 1997; 39(6):815-6).
Several authors consider that the acquisition of resistance to antibiotics, in particular to the fluoroquinolones, in L. pneumophila is a non-existent phenomenon (Roig J. and Rello J., J. Antimicrob. Chemother., 2003; 51(5):1119-29 and Fields B S. et al., Clin. Microbiol. Rev. 2002; 15(3): 506-26).
The macrolides and fluoroquinolones are therefore considered as reliable antibiotics in the treatment of legionnaires' disease (Roig J. and Rello J., J. Antimicrob. Chemother., 2003; 51(5):1119-29 and Fields B S. et al., Clin. Microbiol. Rev. 2002; 15(3): 506-26).
Only rifampicin is advised against in monotherapy due to the very high risk of selecting resistant mutants in most bacteria.
The fluoroquinolones, broad-spectrum antibiotics, form part of the large family of the quinolones, synthetic antibiotics. The fluoroquinolones are so-called second-generation quinolones, in which fluorine has been added in order to increase the penetration of the molecules of quinolones into the cells (up to 200 times greater). The quinolones and fluoroquinolones target type II bacterial topoisomerases: the DNA gyrase constituted by the GyrA and GyrB proteins, and topoisomerase IV constituted by the parC and parE proteins. Certain mutations affecting the genes encoding these type II topoisomerases are known to induce resistance to the quinolones and fluoroquinolones in the bacteria. In Gram-negative species, in particular in Escherichia coli, these fluoroquinolone-resistance mutations mainly affect the gyrA gene encoding the GyrA protein of the DNA gyrase. The substitutions of amino acids which result therefrom are situated in the QRDR region (Quinolone Resistance Determining Region) of GyrA, comprising the amino acids at position 67 to 106 [Soussy C. J. Quinolones and gram-negative bacteria. In Antibiogram. Courvalin P, Leclercq R, and Rice L. B. Eds. ESKA Publishing, ASM Press, 2010, p261-274]. The level of sensitivity to the fluoroquinolones varies in the same bacterium depending on the amino acid or acids situated at these positions. However, the most frequent mutations responsible for fluoroquinolone resistance are those leading to a substitution at the amino acids at positions 83, 87 or more rarely 84 of the GyrA protein (according to the numbering adopted in the case of Escherichia coli), constituting DNA gyrase subunit A. The mutations gyrA83 and gyrA87 are frequently observed in vivo [Jacoby G A. Mechanisms of resistance to quinolones. Clin Infect Dis. 2005; 41 Suppl 2:S120-6], and have been reproduced in vitro [Barnard F M, Maxwell A. Interaction between DNA gyrase and quinolones: effects of alanine mutations at GyrA subunit residues Ser(83) and Asp(87). Antimicrob Agents Chemother. 2001; 45(7):1994-2000]. These positions are identical on the gyrA gene of L. pneumophila strain Paris (NC 006368.1). The inventors have previously shown [Almahmoud I, Kay E, Schneider D, Maurin M. Mutational paths towards increased fluoroquinolone resistance in Legionella pneumophila. J Antimicrob Chemother. 2009; 64(2):284-93] by in vitro selection of fluoroquinolone-resistant mutants, that the key positions for fluoroquinolone resistance in L. pneumophila strain Paris also correspond to amino acids 83 and 87 of the GyrA protein.
The strain Paris of L. pneumophila (CIP 107629T) is one of the reference strains known to be sensitive to the fluoroquinolones [Roch N, Maurin M. Antibiotic susceptibilities of Legionella pneumophila strain Paris in THP-1 cells as determined by real-time PCR assay. J Antimicrob Chemother. 2005; 55(6):866-71]. Other strains sensitive to fluoroquinolones are described, such as L. pneumophila Philadelphia (ATCC 33152), L. pneumophila Lens (CIP 108286) and L. pneumophila Lorraine (CIP 108729).
Moreover, the inventors have already described fluoroquinolone-resistant mutant strains selected beforehand in vitro and having one or more of the gyrA83 and gyrA87 mutations [Almahmoud I, Kay E, Schneider D, Maurin M. Mutational paths towards increased fluoroquinolone resistance in Legionella pneumophila. J Antimicrob Chemother. 2009; 64(2):284-93]. These are L. pneumophila 1 LPPI1 (CIP107629T, namely the strain Paris mutated at position 83 (T83I) of the gyrA gene), L. pneumophila 1 LPPI4 (CIP107629T, namely the strain Paris mutated at position 83 (T83I) and at position 87 (D87N) of the gyrA gene) and the strain L. pneumophila 1 LPPI5 (CIP107629T, namely the strain Paris mutated at position 83 (T83I) and at position 87 (D87H) of the gyrA gene).
However, it is currently accepted by the scientific community that L. pneumophila cannot acquire resistance to antibiotics, in particular to the fluoroquinolones used in clinical practice, in vivo. Several factors are usually mentioned in order to explain this finding in L. pneumophila (Fields B S. et al., Clin Microbiol Rev. 2002; 15(3):506-26):
The sensitivity of the bacteria to the antibiotics can be assessed by phenotypic methods, such as the production of an antibiogram and the determination of the minimum inhibitory concentrations (MICs) of the antibiotics. These methods are not carried out routinely for bacteria with fastidious growth requirements such as L. pneumophila, due to the impossibility of isolating the bacterial strain in question in most infected patients. In the last few years, molecular methods based on the PCR and real-time PCR techniques have been developed in order to detect the antibiotic resistance mutations on the basis of isolated strains or directly in specimens (clinical or from various environments) containing the mutant strains.
All of the data currently available indicate the non-existence in vivo of antibiotic-resistant strains of L. pneumophila in patients suffering from legionnaires' disease and treated with these antibiotics.
Unlike the hypotheses formulated by the scientific community, the Inventors have demonstrated that the acquisition of fluoroquinolone resistance in L. pneumophila is possible in vivo, in patients infected with this pathogen.
One of the aspects of the invention is a method for detecting antibiotic-resistant strains of L. pneumophila.
One of the other aspects of the invention is the development of nucleotide sequences of primers and probes (probes in tandem) making it possible to amplify and specifically detect the mutations involved in antibiotic resistance in the species L. pneumophila.
One of the other aspects of the invention is a real-time PCR technique making it possible to determine specific mutations responsible for resistance.
One of the other aspects of the invention is a kit for detecting the fluoroquinolone resistance of the L. pneumophila strains, making it possible to avoid therapeutic failures and high mortality in patients suffering from legionnaires' disease.
The present invention is based on an in vitro method allowing the demonstration of at least one bacterial strain of Legionella pneumophila that is resistant to antibiotics, in particular of the fluoroquinolone type, in a biological sample, by detecting:
SEQ ID NO: 1 shows the sequence of the wild-type GyrA protein of L. Pneumophila (GyrA protein of L. pneumophila strain Paris, accession number: YP 123696.1), encoded by nucleotide sequence SEQ ID NO: 13.
By biological sample is meant, any specimen taken from tissues, cells, organs, fluids, secretions or blood, originating from the human or animal body, and derivatives thereof.
Within the meaning of the present application, antibiotic resistance is defined as the ability of a microorganism to resist the effects of the antibiotics, in vitro and in vivo.
This resistance is usually defined by measuring the minimum inhibitory concentration (MIC) of an antibiotic vis-à-vis a given bacterium, according to a method validated by a reference body, such as the European Committee on Antimicrobial Susceptibility Testing (EUCAST) in Europe [E. Matuschek, D. F. J. Brown and G. Kahlmeter. Development of the EUCAST disk diffusion antimicrobial susceptibility testing method and its implementation in routine microbiology laboratories. Clin Microbiol Infect 2014; 20: 0255-0266], or the Clinical and Laboratory standard Institute (CLSI) in the United States [CLSI. M07-A9: Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard—Ninth Edition. Vol. 32 No 2]. A strain is said to be resistant to an antibiotic if the MIC of this antibiotic vis-à-vis the strain considered is greater than a critical value defined by this same reference body.
Within the meaning of the present Application, the term “equivalent position” means a nucleotide of the gyrA gene or an amino acid of the GyrA protein of the same nature and function as that described in E. coli for a given position, although the numbering of this position can be different in the species considered with respect to E. coli due to a different number of nucleotides (gyrA) or of amino acids (GyrA) between the two species. By “identity”, is also meant the number of identical nucleotides between two sequences of the same length, determined for each position in the sequences.
In the wild-type strains of L. pneumophila, position 83 of the GyrA protein is occupied by a threonine (T), position 84 is occupied by an alanine (A) and position 87 is occupied by an aspartic acid (D).
A bacterial strain of L. pneumophila according to the invention, is referred to as mutated when position 83 of the GyrA protein is no longer occupied by a threonine (T), and/or when position 84 is no longer occupied by an alanine (A), and/or when as position 87 is no longer occupied by an aspartic acid (D).
A particular embodiment of the invention relates to an in vitro method allowing the demonstration of at least one bacterial strain of Legionella pneumophila that is resistant to antibiotics, in particular of the fluoroquinolone type, in a biological sample, a method in which the mutated GyrA protein is such that:
The expression “the amino acids at positions 84 and 87 (or 83 and 87) or (83 and 84) can correspond to any amino acid” means that said amino acids can equally well be the amino acid present in a wild-type strain as any other amino acid. In the latter case, the amino acid considered therefore constitutes a mutation.
A bacterial strain of L. pneumophila according to the invention having a mutated GyrA protein, can therefore contain a single mutation, a double mutation or a triple mutation.
The strains comprising a single mutation are therefore mutated at position 83 or at position 84 or at position 87. The strains comprising a double mutation are therefore mutated either at positions 83 and 84, or at positions 84 and 87, or at positions 83 and 87.
The strains comprising a triple mutation are therefore mutated at the three positions 83; 84 and 87 concomitantly.
According to another embodiment of the invention, the in vitro method allowing the demonstration of at least one bacterial strain of Legionella pneumophila that is resistant to antibiotics, in particular of the fluoroquinolone type, is applied when the mutated GyrA protein is such that:
When the amino acid at position 83 is mutated, the amino acids at position 84 and 87 can be the amino acids of the wild-type protein, i.e. A (alanine) and D (aspartic acid) respectively or any other amino acid, i.e. the amino acids at position 84 and 87 can also be mutated.
When the amino acid at position 84 is mutated, the amino acids at position 83 and 87 can be the amino acids of the wild-type protein, i.e. T (threonine) and D (aspartic acid) respectively or any other amino acid, i.e. the amino acids at position 83 and 87 can also be mutated.
When the amino acid at position 87 is mutated, the amino acids at position 83 and 84 can be the amino acids of the wild-type protein, i.e. T (Threonine) and A (Alanine) respectively or any other amino acid, i.e. the amino acids at position 83 and 84 can also be mutated.
According to another advantageous embodiment of the invention, said in vitro method allowing the demonstration of at least one bacterial strain of Legionella pneumophila that is resistant to antibiotics, in particular of the fluoroquinolone type, is applied when the mutated GyrA protein is such that:
The table below shows all of the possible amino-acid mutations, at each of the three positions 83, 84 and 87 and the corresponding codons.
The method according to the invention allows the detection of a mutated GyrA protein which comprises the following consensus sequence:
in which: X1, X2 and X3 correspond to the amino acids mutated at positions 83, 84 and 87 respectively, and
According to a particular embodiment of the present invention, in the mutated GyrA protein, the amino acid corresponding to X1, different from T, can be an isoleucine (I), a leucine (L), a tryptophane (W), an alanine (A) or a valine (V), and X2 and X3 correspond to any amino acid, or
According to a particular embodiment of the present invention, the method of the invention allows the detection of a mutated GyrA protein which comprises the consensus sequence GDX1X2VYX3T in which:
According to a particular embodiment of the present invention, the method allows the detection of the sequence of the gene encoding said mutated GyrA protein. This sequence has at least one nucleotide substitution with respect to SEQ ID NO: 3 (GGGGATACAGCTGTTTATGACAC), at a position equivalent to position 7, 8, 10, 11, 19, 20 or 21 with respect to SEQ ID NO: 3, where the nucleotides at positions 7 and 8 correspond to the first two nucleotides of the codon encoding the amino acid at position 83 of the GyrA protein of Legionella pneumophila, the nucleotides at positions 10 and 11 correspond to the first two nucleotides of the codon encoding the amino acid at position 84, and the nucleotides at positions 19, 20 and 21 correspond to the three nucleotides of the codon encoding the amino acid at position 87.
According to another embodiment of the present invention, the sequence of the nucleic acid encoding said mutated GyrA protein comprises a sequence chosen from:
In the context of the present invention, the detection of the presence of said mutated GyrA protein or of the target nucleic acid encoding said mutated GyrA protein, including the detection of the mRNA encoded by the mutated gene, is carried out by a technique chosen from: western blot, northern blot, southern blot, PCR (Polymerase Chain Reaction), real-time PCR, hybridization PCR, array PCR, TMA (Transcription Mediated Amplification), NASBA (Nucleic Acid Sequence Based Amplification), LCR (Ligase Chain Reaction), the DNA/RNA hybridization, DNA chip, DNA/RNA sequencing, dot-blot, the RFLP (Restriction Fragment Length Polymorphism) technique.
In an advantageous embodiment, the detection of the presence of said nucleic acid encoding said mutated GyrA protein is carried out by real-time PCR.
Real-time PCR uses the basic principle of standard PCR (cyclic amplification of a DNA fragment, based on an enzymological reaction) the difference being an amplification measured not at the end but throughout the reaction, therefore in real time.
At each amplification cycle, the quantity of DNA is measured by means of a fluorescent label the emission of which is directly proportional to the quantity of amplicons produced. This makes it possible to obtain reaction kinetics and therefore DNA quantification whereas the standard PCR gives only the final measurement.
The detection or the quantification of the fluorescent signal in real time can be carried out using intercalating agents or probes.
The intercalating agent most used at present is SYBR® Green (Roche, Meylan, France). As regards the probes, there are 4 different technologies, allowing the measurement of a fluorescent signal: “Taqman” or hydrolysis probes, “HybProbe” (FRET) or hybridization of 2 probes, “Molecular Beacons” and “Scorpion” primers.
In the context of the invention, real-time PCR is used for the detection of the gyrA83, 84 and/or 87 mutations, by using for example, two probes in tandem: a so-called anchoring probe and a so-called detection probe. In the context of the present invention, the fluorophore situated on the anchoring probe is for example LCRed-640 (Roche Diagnostic), and the fluorophore situated on the emission probe is for example fluorescein.
The binding of these two probes to the target DNA first leads to the excitation of the fluorophore situated on the anchoring probe, then a FRET “fluorescence resonance energy transfer” phenomenon occurs, between this fluorophore and the fluorescein situated on the detection probe. The fluorescein then emits fluorescence measured in real time by the device, the intensity of which is proportional to the quantity of DNA amplified.
A melting point curve, established at the end of amplification, makes it possible to determine a melting point characteristic of the size and content of amplicon bases (amplified DNA).
A mutation affecting this fragment leads to a downward shift of the melting point. The fragment tested here is delimited from base 241 to base 263 of gyrA of the strain L. pneumophila Paris [GGGGATACAGCTGTTTATGACAC], i.e. from amino acid 81 to amino acid 88 of GyrA of said strain [GDTAVYDT]. It therefore includes the positions T83, A84 and D87, which are linked to fluoroquinolone resistance in L. pneumophila.
This technique shows a change in the melting point in case of alteration of this DNA fragment, irrespective of the mutation and its position. Because of natural variations of L. pneumophila in the nucleotide sequence, which can lead to other mutations, the results obtained by the method according to the invention can be confirmed by a complementary technique such as for example the sequencing of the amplified DNA.
It is however easy to envisage, from the state of the art, other techniques making it possible to overcome variations of DNA sequences at the anchoring probe and/or to specifically target the mutations of interest without requiring an additional stage.
For example, the use of a detection probe of the hydrolysis probe or “Taqman”, “beacon” or “scorpion” type could make it possible to target the same region of gyrA where the mutations responsible for the substitutions at positions 83, 84 and 87 are produced, without the use of an anchoring probe. Examples of this type of technique are presented in the literature, relating to the detection of fluoroquinolone resistance in Mycobacterium tuberculosis (Chakravorty S. et al., J Clin Microbiol. 2011; 49(3):932-40) or in Staphylococcus aureus (Lapierre P. et al., J Clin Microbiol. 2003; 41(7):3246-51).
It is also possible to specifically detect expected mutations on specific nucleotides by other techniques so as to eliminate false positive results linked to the mutations not associated with antibiotic resistance. This can be achieved in particular by the use of multiple probes, “in tandem” (Page S. et al., Antimicrob. Agents Chemother., 2008; 52(11): 4155-8 and Glocker E. et al., J. Clin. Microbiol. 2004; 42(5): 2241-6), to hydrolysis or “Taqman” (Ben Shabat M. et al., J. Clin. Microbiol., 2010; 48(8):2909-15 and Wilson D L et al., J. Clin. Microbiol., 2000; 38(11):3971-8), of the “locked nucleic acid probe” type (van Doom H R. et al., Intl. Tuberc. Lung Dis., 2008; 12(7):736-42). The PCR-hybridization technique (Cambau E. et al., PLoS Negl. Trop. Dis. 2012; 6(7):1739) or the use of DNA microchips (Matsuoka M. et al., J. Med. Microbiol. 2008; 57:1213-1219) also allow the specific detection of resistance mutations. These different techniques make it possible to detect SNP (single nucleotide polymorphism) at specific DNA fragments, and would therefore make it possible to detect, in targeted manner, the mutations responsible for fluoroquinolone resistance in L. pneumophila. Certain of these techniques are already marketed such as for example the Xpert TB/RIF® test (Cepheid) which detects, using a “Beacon” probe, rifampicin resistance in Mycobacterium tuberculosis.
The method for detecting the presence of the target nucleic acid encoding said mutated GyrA protein, according to the invention comprising the steps of:
When a nucleic acid encoding said mutated GyrA protein is detected, this indicates the presence of at least one antibiotic-resistant bacterial strain of Legionella pneumophila in the sample.
According to the method of the present invention, the amplification product obtained in step b) is an amplicon of 259 nucleotides. This amplicon of 259 nucleotides corresponds to SEQ ID NO: 57 or to any sequence having a percentage identity equal to at least 90% with sequence SEQ ID NO: 57.
By “amplicon” is meant any DNA fragment amplified by PCR, by means of two primers. In a particular embodiment of the invention, step b) of said method for detecting a target nucleic acid encoding said mutated GyrA protein is carried out using a primer having at least 90% identity with sequence SEQ ID NO: 58, and/or a primer having at least 90% identity with sequence SEQ ID NO: 59.
By “primer” is meant a DNA fragment the size of which is generally comprised between 15 nucleotides and 25 nucleotides, capable of hybridizing with a strand of DNA serving as matrix, with a given melting point, so as to allow the duplication of this strand of DNA.
The primers used in the method according to the invention are represented by the sequences SEQ ID NO: 58 (sense primer, named LpgyrALSFw and corresponding to the following nucleic acid sequence: CCTGATGTACGTGATGGTTTAA) and SEQ ID NO: 59 (anti-sense primer, named LpgyrALSRv and corresponding to the following nucleic acid sequence: GCATGGCAGCTGGAGCATCTCC), or any other nucleic acid sequence having at least 90% identity with said sequences SEQ ID NO: 58 and SEQ ID NO: 59.
Furthermore, step b) of said method for detecting a target nucleic acid encoding said mutated GyrA protein, can be carried out using at least one nucleotide probe capable of hybridizing with the target nucleic acid.
In another particular embodiment of the invention, the detection method requires the use of probes.
In the real-time PCR system developed by the inventors, a so-called detection probe and a so-called anchoring probe are necessary.
The detection probe that can be used in the context of the present invention is a nucleic acid sequence represented by sequence SEQ ID NO: 3 or by any other nucleotide sequence having at least 90% identity with sequence SEQ ID NO: 3 (named LpgyrALSP1). This detection probe is covalently bonded to at least one marker molecule allowing its detection by a suitable device.
The marker molecule is chosen from a fluorochrome or a radioactive isotope. A fluorochrome is a chemical substance capable of emitting fluorescent light after excitation. A fluorochrome that is useful in the context of the invention can be chosen from: fluorescein, Cy2, Cy3, Cy5, Cy7, Red613, Red640, Rhodamine, Texas red, TRITC, Alexa Fluorine, this list not being exhaustive. Preferably, the fluorochrome linked to the detection probe in the context of the invention is fluorescein bonded to the 3′ end of said probe.
The detection method according to the invention can also comprise an anchoring probe, which, coupled with the detection probe, allows the detection of the amplification product obtained in step b). The anchoring probe according to the invention is a nucleic acid sequence represented by sequence SEQ ID NO: 60 (named LpgyrALSP3) or by any other nucleotide sequence having at least 90% identity with sequence SEQ ID NO: 60.
This anchoring probe is covalently bonded to at least one marker molecule allowing its detection by a suitable device. In the context of the present invention, the 5′ end of the anchoring probe is bonded to an acceptor fluorochrome. The acceptor fluorochrome can be chosen from fluorescein, Cy2, Cy3, Cy5, Cy7, Red613, Red640, Rhodamine, Texas red, TRITC, Alexa Fluorine, this list not being exhaustive. More particularly, the acceptor fluorochrome can be the product LightCycler® Red 640 (Roche Diagnostic).
The anchoring probe has at its 3′ end, a phosphorylation denoted “P”, preventing its elongation by the DNA polymerase. The anchoring probe is therefore present in the form 5′-LCRed640-TTGTTCGTATGGCTCAGCCTTTTTC-P-3′ The detection probe must be close to the anchoring probe for transmission of the fluorescence signal to be able to take place. In fact, when the two probes are separated, the donor fluorochrome situated on the detection probe only emits fluorescence background noise whereas when they are hybridized with distances of less than 10 nucleotides (=distance in nucleotides between the detection probe and the anchoring probe), the proximity of the 2 fluorochromes allows the transfer of energy from the donor fluorochrome to the acceptor fluorochrome causing fluorescent emission from the latter (FRET: Fluorescent Resonance Energy Transfer) According to a particular embodiment of the invention, a melting point curve of the amplification product is generated after step c).
The present invention also aims to protect a pair of primers allowing the amplification of a fragment of the gyrA gene of Legionella pneumophila, comprising a primer having at least 90% identity with sequence SEQ ID NO: 58 (LpgyrALSFw), and a primer having at least 90% identity with sequence SEQ ID NO: 59 (LpgyrALSRv).
These pairs of primers make it possible to amplify a fragment comprising 259 nucleotides.
The method according to the invention and quite particularly the step of amplification of a fragment of the gyrA gene can be carried out with a sense primer corresponding to sequence SEQ ID NO:58 and an anti-sense primer chosen from all the nucleic acid sequences having at least 90% identity with sequence SEQ ID NO: 59 or with a sense primer corresponding to one of the sequences chosen from the group comprising all the nucleic acid sequences having at least 90% identity with sequence SEQ ID NO: 58 and an anti-sense primer corresponding to sequence SEQ ID NO: 59 or also with a sense primer corresponding to one of the sequences chosen from the group comprising all the nucleic acid sequences having at least 90% identity with sequence SEQ ID NO: 58 and an anti-sense primer corresponding to one of the sequences chosen from the group comprising all the nucleic acid sequences having at least 90% identity with sequence SEQ ID NO: 59. The present invention also aims to protect a kit of reagents allowing the detection of bacterial strains Legionella pneumophila that are resistant to antibiotics, in particular of the fluoroquinolone type, comprising at least one pair of primers allowing the amplification of the fragment of interest, namely the amplicon of 259 nucleotides corresponding to sequence SEQ ID NO:59 and at least one probe chosen from those represented by the sequences SEQ ID NO: 3 and SEQ ID NO: 60, that are the detection and anchoring probes.
The detection method according to the invention can be used for diagnosing an infection with a Legionella pneumophila bacterium that is resistant to antibiotics, in particular of the fluoroquinolone type, in a patient.
For this, on the basis of a specimen taken from a patient likely to have antibiotic-resistant strains of L. pneumophila, the method for detecting the mutated gyrA gene by real-time PCR is implemented. Such a specimen can in particular be a specimen taken from secretions of the respiratory tract, but also blood, serum, plasma, urine, tissue biopsies (examples: pulmonary or pleural biopsies), different puncture fluids (examples: cerebrospinal fluid, joint fluid, pleural fluid) and various suppurations (example: pulmonary abscess).
The detection method according to the invention can be used for determining or predicting the efficacy of a treatment with fluoroquinolones in a patient infected with the Legionella pneumophila bacterium.
In fact, when faced with any therapeutic failure in patients suffering from legionnaires' disease, the detection method according to the invention can be implemented in order to ensure that the patient exhibits no resistance to antibiotics of the fluoroquinolone types, so as to modify the treatment schedule if required.
FIG. 5:
The primers described below make it possible to amplify and detect a fragment of the gyrA gene of L. pneumophila (gyrA gene: SEQ ID NO: 1).
The detection method is based on real-time PCR, using the so-called FRET (Fluorescence Resonance Energy Transfer) technique. In this system, 2 probes are used, one of which bears, at the 3′ end, an emitter fluorochrome and the other, at the 5′ end, an acceptor fluorochrome. The probes are chosen so as to hybridize with their target sequences while being spaced from 1 to 5 nucleotides apart from each other. When the two probes are separated, the donor fluorochrome only emits fluorescence background noise whereas when they are hybridized with less than 10 nucleotides of distance, the closeness of the two fluorochromes allows the transfer of energy from the donor fluorochrome to the acceptor fluorochrome causing the fluorescent emission of the latter (FRET: Fluorescent Resonance Energy Transfer). The fluorescence acquisition is then measured, which is proportional to the quantity of DNA synthesized, at the time of hybridization.
The anchoring probe contains the fluorophore LCRed-640 (Sigma Aldrich, L'Isle d'Abeau Chesnes 38297 Saint-Quentin Fallavier, France) at the 5′ end. The detection probe contains fluorescein at the 3′ end. The emission of fluorescence is detected in real time by the amplification device. A melting point curve is established at the end of amplification and makes it possible to determine a melting point characteristic of the size and content of bases of the amplicon. A mutation affecting this fragment results in a downward shift of the melting point. The fragment tested here goes from the nucleotide situated at position 241 to the nucleotide situated at position 263 of gyrA of L. pneumophila Paris [GGGGATACAGCTGTTTATGACAC], i.e. from amino acid 81 to amino acid 88 of GyrA of L. pneumophila Paris [GDTAVYDT]. It therefore includes the positions T83, A84 and D87, which are linked to fluoroquinolone resistance in L. pneumophila.
The primers used make it possible to obtain an amplicon of 259 bp (SEQ ID No 57).
The amplification is carried out under the conditions below, with a Light-Cycler type device (Roche Diagnostics, Meylan, France).
The results are given in
The sensitivity and the specificity of the RT-PCR test on LP-gyrA were assessed on a large number of strains.
Legionella pneumophila
Legionella pneumophila
Legionella pneumophila
Legionella pneumophila
Legionella pneumophila 1
Legionella pneumophila 1
Legionella pneumophila 1
Legionella parisiensis
Legionella parisiensis
Legionella longbeachae
Legionella longbeachae
Legionella bozemanii
Legionella bozemanii
Legionella jordanis
Legionella jordanis
Legionella tucsonensis
Legionella gormanii
Legionella maceachernii
Legionella anisa
Legionella lansingensis
Legionella dumoffi
Legionella oakridgensis
Legionella oakridgensis
Legionella wadsworthii
Legionella mackelia
Legionella birmingham
Legionella hackeliae
Legionella birmingham
Legionella micdadei
Legionella donaldsonii
Legionella feeleii sg1
Legionella feeleii sg2
Legionella feeleii
Staphylococcus aureus
Staphylococcus aureus
Staphylococcus epidermidis
Enterococcus faecium
Corynebacterium jeikeium
Streptococcus pyogenes
Streptococcus mitis
Streptococcus pneumoniae
Streptococcus pneumoniae
Bacillus subtilis
Escherichia coli
Escherichia coli
Serratia marcescens
Citrobacter koseri
Klebsiella pneumoniae
Pseudomonas aeruginosa
Acinetobacter baumanii
Similarly,
The analytical sensitivity of the RT-PCR test on LPgyrA was tested on a series of 10-fold dilutions of DNA from L. pneumophila Paris, starting with a bacterial inoculum of 8.6×107 bacteria. Table 1 shows the results of this analysis. A suspension containing 9 genome/test copies allows reproducible amplification.
Based on analysis of the expectorations of 82 patients suffering from legionnaires' disease, it was possible to detect the presence of resistant mutated gyrA83 L. pneumophila.
In order to confirm the results obtained for these two patients, the QRDR of the gyrA gene of the infecting strain of L. pneumophila, was amplified and sequenced directly from a clinical specimen due to the impossibility of isolating this strain in culture. Two DNA sequencing methods were used: the standard Sanger method and a high-throughput sequencing method making it possible to measure the percentage of mutants with respect to the non-mutated population in the clinical specimen from each of the two patients.
In patient 1, the sequence 1-1 obtained from a clinical specimen collected before treatment with a fluoroquinolone, exhibits no mutation with respect to the strain Paris. After treatment with fluoroquinolone, a mixture of DNA sequences (ACA/ATC, Y=C or T) (sequence 1-2) is noted, which evidences the simultaneous presence of bacteria sensitive to, and bacteria resistant to, fluoroquinolones by a Thr83Ile substitution at position 83 of the GyrA protein.
For patient 2, the DNA sequence before treatment with fluoroquinolone (sequence 2-1) is wild-type (non-mutated). In this patient, it was possible to isolate a strain of L. pneumophila in culture from this same clinical specimen. The fact that this strain was very sensitive to the fluoroquinolones was confirmed, phenotypically (antibiogram) and due to the absence of a gyrA mutation after amplification and sequencing of this gene from the strain. By contrast, at different times during the treatment with a fluoroquinolone in this patient 2, the occurrence of a mutated gyrA sequence (ATA instead of ACA) (sequences 2-2, 2-3, 2-4) was demonstrated on three successive specimens leading to the same Thr83Ile substitution responsible for fluoroquinolone resistance in L. pneumophila.
The high-throughput sequencing data have confirmed the in vivo selection of gyrA83 mutants of L. pneumophila in these two patients during treatment with a fluoroquinolone.
All of these data confirm the possibility of selection of fluoroquinolone-resistant strains of L. pneumophila in patients infected with this pathogen and treated with one of these antibiotics. They also make it possible to validate the relevance of the RT-PCR test on LP-gyrA, developed in order to detect these resistances on the basis of an isolated strain or directly from clinical specimens.
| Number | Date | Country | Kind |
|---|---|---|---|
| 13/56225 | Jun 2013 | FR | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/FR2014/051488 | 6/17/2014 | WO | 00 |
