Patent Application
20220090172
The official copy of the sequence listing is submitted electronically via EFS-Web as an ASCII-formatted sequence listing with a file named “91482_239PCT_SeqList_ST25.txt” created on Jan. 27, 2020 and having a size of 83.2 kilobyte, and is filed concurrently with the specification. The sequence listing contained in this ASCII-formatted document is part of the specification and is herein incorporated by reference in its entirety.
This invention relates to methods, primers, assays, and kits for detecting the presence of microbial pathogens in a sample.
Throughout recent history, various aggressor nation states and terrorist groups have shown the willingness and/or capability to develop and use biological weapons against war fighters and civilian populations. The ability to detect the agents being developed as well as their virulence and antibiotic resistance profiles, in environmental and clinical materials, would further our capability to detect the development of these agents and their use.
The goal of several federal biosurveillance projects has been the early detection of biothreat agents to prevent or curtail mass civilian or military casualties. These systems have relied upon real-time-PCR to give a binary answer of presence or absence of the target. One challenge has been the complexity of the environmental samples, where tens of thousands of microorganisms exists, many of which are highly similar to the target pathogens. BioWatch is an example where numerous false positive results have been generated due to poorly known near-neighbor species confusing individual assays. While our knowledge of near-neighbors and of the target Biothreat agents is rapidly increasing, it is unrealistic to ever expect complete knowledge of either. DNA sequencing offers great potential, and there is a need for primers, methods, assays, and kits with greater ability to discriminate microbial pathogens in complex environmental and clinical sample matrices.
Timely and accurate detection and characterization of bacterial biothreat agents is vital for our nation's safety. Current systems for early detection of these agents rely upon single locus Polymerase Chain Reaction (PCR) methods, giving only presence/absence results. This methodology can and has led to false positives due to limited signature validation. The Inventors have developed a multi-agent multi-locus amplicon sequencing protocol encompassing 79 targets aimed at detecting the presence or absence of 5 biothreat agents, as well as the presence and sequence of plasmids, virulence factors, antimicrobial resistance factors, and sequence variant loci for Near Neighbor species differentiation. The agents targeted are Burkholderia pseudomallei, Burkholderia mallei, Bacillus anthracis, Yersinia pestis, and Francisella tularensis.
The multi-agent assay, consisting of two multiplex amplification reactions, was validated against a diverse subset of target agent and near neighbor panels that were previously used to validate assays targeting individual agents. These panels consisted of 10-14 target agent strains and 11-48 NN strains. Sensitivity was 100% for all target agents, specificity was 91-100%. Targeted amplicon sequencing utilizing a universal amplicon indexing scheme provides a superior alternative to the current single locus PCR systems and enables the detection of multiple biothreat agents across multiple samples with a single sequencing run.
In certain aspects, the present invention provides A method of detecting Bacillus anthracis in a sample, comprising detecting at least one B. anthracis-specific amplicon in the sample using at least one primer pair selected from the group consisting of: SEQ ID NO: 1 and SEQ ID NO: 2; SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 11 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 14; SEQ ID NO: 15 and SEQ ID NO: 16; SEQ ID NO: 17 and SEQ ID NO: 18; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein the presence of the B. anthracis-specific amplicon indicates the presence of B. anthracis in the sample, and the absence of the B. anthracis-specific amplicon indicates the absence of B. anthracis from the sample.
In other aspects, the method further comprises confirming the absence of B. anthracis by detecting at least one B. anthracis Near Neighbor-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 19 and SEQ ID NO: 20; SEQ ID NO: 21 and SEQ ID NO: 22; SEQ ID NO: 23 and SEQ ID NO: 24; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the B. anthracis Near Neighbor-specific amplicon in the sample confirms the absence of B. anthracis.
In yet other aspects, the method further comprises confirming the absence of B. anthracis by detecting at least one B. anthracis Near Neighbor-specific sequence variant (SV) or single nucleotide polymorphism (SNP) using at least one primer pair selected from the group consisting of: SEQ ID NO: 25 and SEQ ID NO: 26; SEQ ID NO: 27 and SEQ ID NO: 28; SEQ ID NO: 49 and SEQ ID NO: 50; SEQ ID NO: 51 and SEQ ID NO: 52; SEQ ID NO: 53 and SEQ ID NO: 54; SEQ ID NO: 55 and SEQ ID NO: 56; SEQ ID NO: 57 and SEQ ID NO: 58; SEQ ID NO: 59 and SEQ ID NO: 60; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the B. anthracis Near Neighbor-specific SV in the sample confirms the absence of B. anthracis.
In some aspects, the method further comprises detecting a virulence locus or virulence plasmid in the sample by detecting a virulence-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 29 and SEQ ID NO: 30; SEQ ID NO: 31 and SEQ ID NO: 32; SEQ ID NO: 33 and SEQ ID NO: 34; SEQ ID NO: 35 and SEQ ID NO: 36; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein the presence of the virulence-specific amplicon indicates the presence of the virulence locus or virulence plasmid in the sample.
In other aspects, the method further comprises detecting at least one drug resistance single nucleotide polymorphism (SNP) from B. anthracis in the sample using at least one primer pair selected from the group consisting of: SEQ ID NO: 37 and SEQ ID NO: 38; SEQ ID NO: 39 and SEQ ID NO: 40; SEQ ID NO: 41 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 44; SEQ ID NO: 45 and SEQ ID NO: 46; SEQ ID NO: 47 and SEQ ID NO: 48; a pair of sequences which are at least 85% identical thereto; and RNA equivalents. In other aspects, the method further comprises detecting Burkholderia pseudomallei and/or Burkholderia mallei in the sample by detecting at least one B. pseudomallei or B. mallei-specific amplicon uses at least one primer pair selected from the group consisting of: SEQ ID NO: 61 and SEQ ID NO: 62; SEQ ID NO: 63 and SEQ ID NO: 64; SEQ ID NO: 65 and SEQ ID NO: 66; SEQ ID NO: 67 and SEQ ID NO: 68; SEQ ID NO: 69 and SEQ ID NO: 70; SEQ ID NO: 71 and SEQ ID NO: 72; SEQ ID NO: 73 and SEQ ID NO: 74; SEQ ID NO: 75 and SEQ ID NO: 76; SEQ ID NO: 77 and SEQ ID NO: 78; SEQ ID NO: 79 and SEQ ID NO: 80; SEQ ID NO: 81 and SEQ ID NO: 82; SEQ ID NO: 83 and SEQ ID NO: 84; SEQ ID NO: 85 and SEQ ID NO: 86; SEQ ID NO: 87 and SEQ ID NO: 88; SEQ ID NO: 89 and SEQ ID NO: 90; SEQ ID NO: 91 and SEQ ID NO: 92; SEQ ID NO: 93 and SEQ ID NO: 94; SEQ ID NO: 95 and SEQ ID NO: 96; SEQ ID NO: 97 and SEQ ID NO: 98; SEQ ID NO: 99 and SEQ ID NO: 100; SEQ ID NO: 101 and SEQ ID NO: 102; SEQ ID NO: 103 and SEQ ID NO: 104; SEQ ID NO: 103 and SEQ ID NO: 104; SEQ ID NO: 105 and SEQ ID NO: 106; SEQ ID NO: 107 and SEQ ID NO: 108; SEQ ID NO: 117 and SEQ ID NO: 118; SEQ ID NO: 119 and SEQ ID NO: 120; SEQ ID NO: 121 and SEQ ID NO: 122; SEQ ID NO: 123 and SEQ ID NO: 124; SEQ ID NO: 125 and SEQ ID NO: 126; a pair of sequences which are at least 85% identical thereto; and RNA equivalents wherein the presence of the B. pseudomallei or B. mallei-specific amplicon indicates the presence of B. pseudomallei and/or B. mallei in the sample, and an absence of the B. pseudomallei or B. mallei-specific amplicon indicates an absence of B. pseudomallei and B. mallei in the sample.
In certain aspects, the method further comprises confirming the absence of B. pseudomallei and B. mallei by detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 177 and SEQ ID NO: 178; SEQ ID NO: 179 and SEQ ID NO: 180; SEQ ID NO: 181 and SEQ ID NO: 182; SEQ ID NO: 183 and SEQ ID NO: 184; SEQ ID NO: 185 and SEQ ID NO: 186; SEQ ID NO: 187 and SEQ ID NO: 188; SEQ ID NO: 189 and SEQ ID NO: 190; SEQ ID NO: 191 and SEQ ID NO: 192; SEQ ID NO: 193 and SEQ ID NO: 194; SEQ ID NO: 195 and SEQ ID NO: 196; SEQ ID NO: 197 and SEQ ID NO: 198; SEQ ID NO: 199 and SEQ ID NO: 200; SEQ ID NO: 201 and SEQ ID NO: 202; SEQ ID NO: 203 and SEQ ID NO: 204; SEQ ID NO: 205 and SEQ ID NO: 206; SEQ ID NO: 207 and SEQ ID NO: 208; SEQ ID NO: 207 and SEQ ID NO: 208; SEQ ID NO: 209 and SEQ ID NO: 210; SEQ ID NO: 211 and SEQ ID NO: 212; SEQ ID NO: 213 and SEQ ID NO: 214; SEQ ID NO: 215 and SEQ ID NO: 216; SEQ ID NO: 217 and SEQ ID NO: 218; SEQ ID NO: 219 and SEQ ID NO: 220; SEQ ID NO: 221 and SEQ ID NO: 222; SEQ ID NO: 223 and SEQ ID NO: 224; SEQ ID NO: 225 and SEQ ID NO: 226; SEQ ID NO: 227 and SEQ ID NO: 228; SEQ ID NO: 229 and SEQ ID NO: 230; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the B. pseudomallei or B. mallei Near Neighbor-specific amplicon in the sample confirms the absence of B. pseudomallei and B. mallei.
In yet other aspects, the method further comprises confirming the absence of B. pseudomallei and B. mallei by detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific SNP or SV using at least one primer pair selected from the group consisting of: SEQ ID NO: 109 and SEQ ID NO: 110; SEQ ID NO: 111 and SEQ ID NO: 112; SEQ ID NO: 113 and SEQ ID NO: 114; SEQ ID NO: 115 and SEQ ID NO: 116; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the B. pseudomallei or B. mallei Near Neighbor-specific SNP or SV in the sample confirms the absence of B. pseudomallei and B. mallei.
In some aspects, the method further comprises detecting at least one drug resistance SNP or SV from Burkholderia spp. in the sample using at least one primer pair selected from the group consisting of: SEQ ID NO: 127 and SEQ ID NO: 128; SEQ ID NO: 129 and SEQ ID NO: 130; SEQ ID NO: 131 and SEQ ID NO: 132; SEQ ID NO: 133 and SEQ ID NO: 134; SEQ ID NO: 135 and SEQ ID NO: 136; SEQ ID NO: 137 and SEQ ID NO: 138; SEQ ID NO: 145 and SEQ ID NO: 146; SEQ ID NO: 147 and SEQ ID NO: 148; SEQ ID NO: 149 and SEQ ID NO: 150; SEQ ID NO: 151 and SEQ ID NO: 152; SEQ ID NO: 153 and SEQ ID NO: 154; a pair of sequences which are at least 85% identical thereto; and RNA equivalents.
In other aspects, the method further comprises detecting Francisella tularensis in the sample by detecting at least one F. tularensis-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 265 and SEQ ID NO: 266; SEQ ID NO: 267 and SEQ ID NO: 268; SEQ ID NO: 269 and SEQ ID NO: 270; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein the presence of the F. tularensis-specific amplicon indicates that F. tularensis is present in the sample, and an absence of the F. tularensis-specific amplicon indicates that F. tularensis is absent in the sample.
In yet other aspects, the method further comprises confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 285 and SEQ ID NO: 286; SEQ ID NO: 287 and SEQ ID NO: 288; SEQ ID NO: 289 and SEQ ID NO: 290; SEQ ID NO: 291 and SEQ ID NO: 292; SEQ ID NO: 293 and SEQ ID NO: 294; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the F. tularensis Near Neighbor-specific amplicon in the sample confirms the absence of F. tularensis.
In one aspect, the method further comprises confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific SNP or SV using at least one primer pair selected from the group consisting of: SEQ ID NO: 271 and SEQ ID NO: 272; SEQ ID NO: 273 and SEQ ID NO: 274; SEQ ID NO: 275 and SEQ ID NO: 276; SEQ ID NO: 277 and SEQ ID NO: 278; SEQ ID NO: 279 and SEQ ID NO: 280; SEQ ID NO: 281 and SEQ ID NO: 282; SEQ ID NO: 283 and SEQ ID NO: 284; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the F. tularensis Near Neighbor-specific SNP or SV in the sample confirms the absence of F. tularensis.
In another aspect, the method further comprises detecting Yersinia pestis in the sample by detecting at least one Y. pestis-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 231 and SEQ ID NO: 232; SEQ ID NO: 233 and SEQ ID NO: 234; SEQ ID NO: 235 and SEQ ID NO: 236; SEQ ID NO: 237 and SEQ ID NO: 238; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein the presence of the Y. pestis-specific amplicon indicates the presence of Y. pestis in the sample, and an absence of the Y. pestis-specific amplicon indicates an absence of Y. pestis in the sample.
In still another aspect, the method further comprises confirming the absence of Y. pestis by detecting at least one Y. pestis Near Neighbor-specific SNP or SV using at least one primer pair selected from the group consisting of: SEQ ID NO: 249 and SEQ ID NO: 250; SEQ ID NO: 251 and SEQ ID NO: 252; SEQ ID NO: 253 and SEQ ID NO: 254; SEQ ID NO: 255 and SEQ ID NO: 256; SEQ ID NO: 257 and SEQ ID NO: 258; SEQ ID NO: 259 and SEQ ID NO: 260; SEQ ID NO: 261 and SEQ ID NO: 262; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the Y. pestis Near Neighbor-specific SNP or SV confirms the absence of Y. pestis.
In certain aspects, the method further comprises confirming the absence of Y. pestis by detecting at least one Y. pestis Near Neighbor-specific amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 263 and SEQ ID NO: 264; a pair of sequences which are at least 85% identical thereto; and RNA equivalents; wherein detecting the Y. pestis Near Neighbor-specific amplicon confirms the absence of Y. pestis.
In other aspects, the method further comprises characterizing and/or subtyping Y. pestis in the sample by detecting at least one amplicon using at least one primer pair selected from the group consisting of: SEQ ID NO: 239 and SEQ ID NO: 240; SEQ ID NO: 241 and SEQ ID NO: 242; SEQ ID NO: 243 and SEQ ID NO: 244; SEQ ID NO: 245 and SEQ ID NO: 246; SEQ ID NO: 247 and SEQ ID NO: 248; a pair of sequences which are at least 85% identical thereto; and RNA equivalents.
In some aspects, the amplicons are generated with at least one multiplex amplification reaction. In other aspects, the amplicons are generated with at least two, at least three, at least four, or at least five multiplex amplification reactions.
In other aspects, the amplicon, SNP or SV is determined using next-generation sequencing. In one aspect, each primer in the at least one primer pair comprises a universal tail sequence. In some aspects, the universal tail sequence comprises SEQ ID NO: 301 or SEQ ID NO: 303.
In certain aspects, the amplicon is present when a locus read count of the amplicon is at least 10 sequence reads covering at least 75% of a corresponding amplicon reference sequence.
In other aspects, sequence analysis of sequence read alignments is performed to determine whether a target species, Near Neighbor species, virulence or antibiotic resistance allele is present in the sample, wherein the target species is Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, or Yersinia pestis.
In one embodiment, the sample is an environmental sample. In another embodiment, the sample is a biological sample obtained from a subject.
In certain embodiments, the method further comprises administering an effective amount of at least one antibiotic to the subject, wherein the at least one antibiotic is selected from the group consisting of a fluoroquinolone, an aminoglycoside, a glycopeptide, a lincosamide, a macrolide/ketolide, a cephalosporin, a monobactam, a nitroimidazole, a penicillin, a streptogramin, a tetracycline, and a physiologically acceptable salt, prodrug, or combination thereof.
In another embodiment, the at least one antibiotic is not a fluoroquinolone if a gyrA drug resistance SNP is detected; and/or the at least one antibiotic is not a fluoroquinolone if a parC drug resistance SNP is detected; and/or the at least one antibiotic is not a fluoroquinolone or an aminocoumarin if a gyrB drug resistance SNP is detected; and/or the at least one antibiotic is not a rifamycin if a rpoB drug resistance SNP is detected; and/or the at least one antibiotic is not a β-lactam if a penA drug resistance SNP is detected; and/or the at least one antibiotic is not a trimethoprim and sulfamethoxazole combination, co-trimoxazole, if a folM drug resistance SV is detected; and/or the at least one antibiotic is not a trimethoprim and sulfamethoxazole combination, co-trimoxazole, if a bpeT drug resistance SV is detected; and/or the at least one antibiotic is not a trimethoprim and sulfamethoxazole combination, co-trimoxazole, if a bpeS drug resistance SV is detected.
As used herein, the verb “comprise” as is used in this description and in the claims and its conjugations are used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.
As used herein, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the elements are present, unless the context clearly requires that there is one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one.”
The sample in this method is preferably a biological sample from a subject. The term “sample” or “biological sample” or “environmental sample” is used in its broadest sense. Depending upon the embodiment of the invention, for example, a sample may comprise a bodily fluid including whole blood, serum, plasma, urine, saliva, cerebral spinal fluid, semen, vaginal fluid, pulmonary fluid, tears, perspiration, mucus and the like; an extract from a cell, chromosome, organelle, or membrane isolated from a cell; a cell; genomic DNA, RNA, or cDNA, in solution or bound to a substrate; a tissue; a tissue print, or any other material isolated in whole or in part from a living subject or organism. Biological samples may also include sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes such as blood, plasma, serum, sputum, stool, tears, mucus, hair, skin, and the like. Biological samples also include explants and primary and/or transformed cell cultures derived from patient tissues. In some embodiments, sample may comprise a portion of a non-animal organism, such as a plant (e.g., castor beans or derivatives thereof). In other embodiments, the sample comprises soil, water, air or other environmental material.
In some embodiments, sample or biological sample may include a bodily tissue, fluid, or any other specimen that may be obtained from a living organism that may comprise additional living organisms. By way of example only, in some embodiments, sample or biological sample may include a specimen from a first organism (e.g., a human) that may further comprise an additional organism (e.g., bacteria, including pathogenic or non-pathogenic/commensal bacteria, viruses, parasites, fungi, including pathogenic or non-pathogenic fungi, etc.). In some embodiments, the additional organism may be separately cultured after isolation of the sample to provide additional starting materials for downstream analyses, in some embodiments, the sample or biological sample may comprise a direct portion of the additional, non-human organism and the host organism (e.g., a biopsy or sputum sample that contains human cells and bacteria).
Some embodiments of the invention may comprise a multiplex assay. As used herein, the term “multiplex” refers to the production of more than one amplicon, PCR product, PCR fragment, amplification product, etc. in a single reaction vessel. In other words, multiplex is to be construed as the amplification of more than one target-specific sequences within a PCR reaction or assay within the same PCR assay mixture (e.g., more than one amplicon is produced within a single vessel that contains all of the reagents necessary to perform a PCR reaction). In some embodiments, a step prior to performing the PCR (or RT-PCR, quantitative RT-PCR, etc.) reaction can occur such that sets of primers and/or primers and probes are designed, produced, and optimized within a given set of reaction conditions to ensure proper amplicon production during the performance of the PCR.
Currently, there are two approaches being used to identifying specimens in the environment. The first approach, metagenomics, tries to sequence “all” of the DNA in a sample and then to unravel its content computationally. Sequencing “all” of the DNA is difficult, slow, and very expensive. The computational approaches are improving but still contain many flaws that lead to false conclusions. A recent sensationalized report of DNA from anthrax and plague bacteria in the NYC subways illustrates the pitfalls of such endeavors (Mason et al., Cell Systems). Significant amounts of data are produced with metagenomics but frequently not enough for informative signatures to differentiate pathogens from near neighbors. Deep sequencing of single specimens may cost nearly $1,000 and take several weeks to generate. It is clearly not ready at this time for implementation for biosurveillance.
The second approach, amplicon sequencing, involves the deep (>5,000X) sequencing of the 16S gene PCR amplicon to identify individual components of mixed bacterial communities. While the PCR primers are not specific, the intervening sequences can be highly informative and can be used to discriminate among bacterial taxa. Unfortunately for biothreat detection, the 16S gene has insufficient discrimination power to differentiate biothreat pathogens from their near neighbors. Discrimination power is a function of gene diversity and the 16S has low or no diversity among closely related bacteria. It cannot effectively identify a biothreat agent or distinguish from near-neighbor species.
Increasing the amplicon discrimination power can be accomplished through comparative genomic analysis to identify diverse genomics regions. This is most effective when large genome databases are available and can be highly predictive of success once implemented. In clinical diagnostics, this approach is being used to identify multiple pathogens and to predict their virulence and resistance to antibiotics. PCR primers specific to a pathogen genera or species is sufficient, if there is additional DNA sequence information that can be leveraged for precise agent identification. Multiplex systems of several hundred amplicons are becoming common and provide coverage for dozens of pathogens. Sample preparation that works for real-time-PCR also works for this technology, so currently sampling schemes would adapt well to this type of assay. A multiple amplicon sequencing system would be easily adapted to changing targets with addition of new amplicons. Because of the multiplex nature of the assay, redundant amplicons can easily be included to verify the identification of a biothreat agent and even provide a differential identification of a near-neighbor species. Variation within the amplicons can be analyzed to identify drug resistance, virulence factors and subtype to the strain level.
The ideal multiple amplicon sequencing system for identifying major biothreat agents should distinguish between the biothreat agent and its near-neighbor species using both amplification positive/negative criteria and qualitative analysis of sequence within the amplicons. This latter analysis provides strain identification and drug susceptibility identification. The analytical system should be supported by an automated interpretive software that generates actionable reports. Such a system includes quality assurance data to identify sample and/or process issues rapidly, to limit the effect of QC issues on final results.
“BioThreatSeq” detects a presence, an absence, and/or a clinically important characteristic of nucleic acids from one or more microbial pathogens. BioThreatSeq is based upon very discriminating genetic regions bioinformatically identified using public and private genome sequences from microbial pathogens including but not limited to Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, Yersinia pestis and Near Neighbor (NN) species. BioThreatSeq can be used to screen environmental samples for presence of target agent DNA, as well as war fighter and civilian patients for target agent carriage in the event of suspected exposure.
In an embodiment, BioThreatSeq comprises a highly multiplexed amplicon sequencing assay. The assay is a highly informative screening tool capable of simultaneously detecting a presence of a microbial pathogen and a clinically important characteristic of the microbial pathogen without a live culturing step. Non-limiting examples of the clinically important characteristics include: virulence, or antibiotic resistance genetic signatures, etc.
The utility of this assay has been demonstrated on several complex environmental and clinical specimen types including urine, wound swabs, sputum, air, soil, water samples. The superiority of BioThreatSeq over traditional typing techniques include high sensitivity (e.g., a low limit of detection) and high specificity (e.g., discriminating among strains, detecting antimicrobial resistance, and profiling virulence signatures, etc.) in target agent detection. BioThreatSeq is also highly adaptable to new content, which allows for the flexibility to detect new biothreats agents and signatures. Thus, the assay methodology allows for the expansion of this tool to be used for several other BioThreat agents or applications.
The Inventors used comparative genomics to identify a first genomic region that differentiates a target agent from its near neighbor relatives. In the first scenario, the first genomic region is present in all known target strains, and a lack of the first genomic region indicates an absence of the target agent in the sample. In the second scenario, the first genomic region not only is present in all known target strains, but is also absent in near-neighbor species. Thus, a presence of the first genomic region indicates a presence of the target agent in the sample.
In certain non-limiting embodiments, the presence or absence of the first genomic region in the nucleic acids of the sample is determined by PCR using a first forward primer and a first reverse primer. The first forward primer and the first reverse primer amplify a Target Specific Amplicon, i.e., all strains of the threat agent, but not the near neighbors.
The Inventors also used comparative genomics to identify a second genomic region that differentiates a target agent from its near neighbor relatives. The second genomic region is present in all strains of the near-neighbor relatives, but will not be in the target. Thus, a presence of the second genomic region indicates an absence of the target agent in the sample.
In certain non-limiting embodiments, the presence or absence of the second genomic region in the nucleic acids of the sample is determined by PCR using a second forward primer and a second reverse primer. The second forward primer and second reverse primer amplify Differential Target Amplicons, i.e., all strains of the near neighbors, but not the threat agent. Differential identification assays can be included in the multiplex assay to help nullify any false positive results. This optional step offers interpretive value in complex species.
The Inventors determined the exclusivity and inclusivity of the first forward and the first reverse primers in silico across all available threat agents (Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, and Yersinia pestis) and near neighbor genomes. The in-silico validation included genomes from common contaminants such as humans. Because a large number of genomics sequences exist for both target and non-target organisms, the in-silico validation step eliminates any primers that are non-exclusive to the biothreat target. The assay primers were tested against the target and near-neighbor DNA templates to validate them under actual assay conditions.
The design of the first forward primer, the first reverse primer, the second forward primer, and the second reverse primer is consistent with a standard PCR method but is amendable to analysis using next-generation sequencing methods. This requirement includes the addition of “barcodes” to allow for indexing of samples for combining into single DNA sequencing batches. The technical details are provided in the PCT Patent Application entitled “Systems And Methods for Universal Tail-Based Indexing Strategies for Amplicon Sequencing” (International Application Number: PCT/US2014/064890; International Publication Number: WO 2015/070187 A2), the contents of which are hereby incorporated in their entirety.
The Inventors determined the exclusivity and inclusivity of the second forward and the second reverse primers in silico across all available threat agents (Bacillus anthracis, Burkholderia pseudomallei, Burkholderia mallei, Francisella tularensis, and Yersinia pestis) and near neighbor genomes. The in-silico validation included genomes from common contaminants such as humans and soil DNA. Because a large number of genomics sequences exist for both target and non-target organisms, the in-silico validation step eliminates any primers that are non-exclusive to the near-neighbor species. The assay primers were tested against the target and near-neighbor DNA templates to validate them under actual assay conditions.
In the third scenario, the first genomic region is present in all known target strains and at least one near-neighbor species. In this case, producing an exclusive amplicon is not feasible and the combination of amplification and internal sequence is needed to distinguish target from near-neighbors. In the absence of exclusive-target amplification, the amplicon sequence could provide definitive identification of the target and non-target agents.
The Inventors has defined the phylogenetic structure of the first genomic region that includes both the target agent and its near neighbors and identified a variable internal sequence region which allows for: (1) differentiation of near neighbor from target species, (2) strain identification, (3) drug susceptibility identification, and/or (4) virulence prediction.
The Inventors have developed combined multi-agent amplicon sequencing assays for 2, 3, 4, 5, 6, or 7 biothreat agents and validated them under laboratory conditions. For the combined biothreat agent assays, important test parameters such as linearity, LOD, sensitivity, specificity, quantitative performance (absolute and relative), contaminant interference, performance with environmental samples (spikes), etc. have been determined.
The Inventors have developed software that analyzes B. anthracis amplicon sequence data and provides actionable information (i.e., agent presence with confidence metrics, presence of virulence and antibiotic resistance factors, phylogenetic classification, etc.). The Inventors have also developed software that analyzes B. anthracis and other target agent (F. tularensis, Y. pestis, B. mallei, B. pseudomallei, Brucella melitensis, and B. abortus) and allow for on-site and remote reporting.
BTSeq comprises target agent and near neighbor (NN) species identification assays, antimicrobial resistance (AMR) assays, virulence gene assays, and uses TGen North's amplicon sequencing analysis pipeline (ASAP) to report results.
Use of the disclosed amplicon sequencing tool can be used to screen environmental samples for presence of target agent DNA, as well as war fighter and civilian patients for target agent carriage in the event of suspected exposure.
In some embodiments, the present invention relates to a method of detecting Bacillus anthracis in a sample, comprising detecting at least one B. anthracis-specific amplicon selected from the group consisting of: CP008853.1_5309, CP008853.1_5316, CP012725.1_3629, CP012725.1_5103, CP012725.1_5107, JSZQ01000034.1_220, JSZS01000036.1_5, LGCC01000010.1_232, and LGCC01000048.1_280 in the sample, wherein the presence of the B. anthracis-specific amplicon indicates the presence of B. anthracis in the sample, and an absence of the B. anthracis-specific amplicon indicates an absence of B. anthracis in the sample.
In other embodiments, the disclosed methods further comprise confirming the absence of B. anthracis by detecting at least one B. anthracis Near Neighbor-specific amplicon selected from the group consisting of: NN_LOMU01000090.1_49, NN_LOQC01000013.1_3, and ChimpKiller_9-159 in the sample, wherein detecting the B. anthracis Near Neighbor-specific amplicon confirms the absence of B. anthracis.
In yet other embodiments, the disclosed methods further comprise characterizing and/or subtyping B. anthracis by detecting at least one amplicon, single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: ChimpKiller_91-320, ChimpKiller_481-698, plcR, pagA, pX01, pX01, gyrA, parC, gyrB, rpoB, AA_2502, AA_2503, Ba_AmesAnc_4669915, Ba_AmesAnc_4001578, Ba_AmesAnc_1069024, Ba_AmesAnc_3668548, Ba_AmesAnc_371913, and Ba_AmesAnc_999035 in the sample.
In certain aspects, the disclosed methods further comprise characterizing and/or subtyping B. anthracis by detecting at least one amplicon, single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: ChimpKiller_91-320, ChimpKiller_481-698, plcR, pagA, pX01, pX01, gyrA, parC, gyrB, rpoB, AA_2502, AA_2503, Ba_AmesAnc_4669915, Ba_AmesAnc_4001578, Ba_AmesAnc_1069024, Ba_AmesAnc_3668548, Ba_AmesAnc_371913, and Ba_AmesAnc_999035 in the sample.
In other aspects, the present invention relates to a method of detecting Burkholderia pseudomallei and/or Burkholderia mallei in a sample by detecting at least one B. pseudomallei or B. mallei-specific amplicon selected from the group consisting of: LWWC01000187.1_18, LWWB01000125.1_17183_17602, LXAY01000367.1_0_640, LWVY01000190.1_17226_17689, and LXAD01000059.1_24760_25075, wherein the presence of the B. pseudomallei or B. mallei-specific amplicon indicates the presence of B. pseudomallei and/or B. mallei in the sample, and an absence of the B. pseudomallei or B. mallei-specific amplicon indicates an absence of B. pseudomallei and B. mallei in the sample.
In some embodiments, the present invention provides a method of detecting Burkholderia pseudomallei and/or Burkholderia mallei in the sample by detecting at least one B. pseudomallei or B. mallei-specific amplicon selected from the group consisting of: LWWC01000187.1_18, LWWB01000125.1_17183_17602, LXAY01000367.1_0_640, LWVY01000190.1_17226_17689, and LXAD01000059.1_24760_25075, wherein the presence of the B. pseudomallei or B. mallei-specific amplicon indicates the presence of B. pseudomallei and/or B. mallei in the sample, and an absence of the B. pseudomallei or B. mallei-specific amplicon indicates an absence of B. pseudomallei and B. mallei in the sample.
In other embodiments, the present invention provides a method of detecting B. pseudomallei in a sample by detecting at least one B. pseudomallei-specific amplicon selected from the group consisting of: TTS1 BPSS1407, LXCC01000141.1 39296 39817, LXBY01000087.1_75760_76751, LXCD01000002.1_99652_100245, and LXCE01000123.1_34220_34747 (, wherein the presence of the B. pseudomallei-specific amplicon indicates the presence of B. pseudomallei in the sample, and an absence of the B. pseudomallei-specific amplicon indicates an absence of B. pseudomallei in the sample.
In yet other embodiments, the present invention provides a method of detecting B. mallei in the sample by detecting at least one B. mallei-specific amplicon selected from the group consisting of: Bm 11589 and Bm 11767, wherein the presence of the B. mallei-specific amplicon indicates the presence of B. mallei in the sample, and an absence of the B. mallei-specific amplicon indicates an absence of B. mallei in the sample.
In certain aspects, the disclosed methods further comprise characterizing and/or subtyping B. pseudomallei and/or B. mallei by detecting at least one one amplicon, single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: K9penA378-529, K9penA575-761, K9penA949-1172, pbp3-1, and pbp3-2 in the sample.
In other aspects, the disclosed methods further comprise confirming the absence of B. pseudomallei and B. mallei by detecting at least one B. pseudomallei or B. mallei Near Neighbor-specific single nucleotide polymorphism (SNP) or sequence variant (SV) selected from the group consisting of: NC 006350 2289827, NC 006350 133027, NC 006350 2248145-2248193, and NC 006350 988041-988089 in the sample, wherein detecting the B. pseudomallei or B. mallei Near Neighbor-specific single nucleotide polymorphism (SNP) or sequence variant (SV) confirms the absence of B. pseudomallei and B. mallei.
In yet other aspects, the present invention provides a method of detecting Francisella tularensis in a sample by detecting at least one F. tularensis-specific amplicon selected from the group consisting of: F. tularensis_CP000915.1_1782, F. tularensis_CP000915.1-731, and Ft_dup_CP000915.1_197, wherein the presence of the F. tularensis-specific amplicon indicates that F. tularensis is present in the sample, and an absence of the F. tularensis-specific amplicon indicates that F. tularensis is absent in the sample.
In some aspects, the disclosed methods further comprise confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific amplicon selected from the group consisting of: F. tnovicida_CP009607.1, F. philom_CP009444.1_569, and F. philom_CP009444.1_285 in the sample, wherein detecting the F. tularensis Near Neighbor-specific amplicon confirms the absence of F. tularensis.
In other aspects, the disclosed methods further comprise confirming the absence of F. tularensis by detecting at least one F. tularensis Near Neighbor-specific SNP or SV selected from the group consisting of: FtA1, FtA2, FtB, FtA, FtLVS_AM233362_1646546, FtLVS_AM233362_1643765, and FtLVS_AM233362_1562618 in the sample, wherein detecting the F. tularensis Near Neighbor-specific polymorphism confirms the absence of F. tularensis.
In yet other aspects, the present invention provides a method of detecting Yersinia pestis in the sample by detecting at least one Y. pestis-specific amplicon selected from the group consisting of: Y. pestis_LPQY01000176.1_7, AGJT01000065.1_0_338, and FAUR01000053.1_96407_96884, wherein the presence of the Y. pestis-specific amplicon indicates the presence of Y. pestis in the sample, and an absence of the Y. pestis-specific amplicon indicates an absence of Y. pestis in the sample.
In one embodiment, the disclosed methods further comprise confirming the absence of Y. pestis by detecting at least one Y. pestis Near Neighbor-specific SNP or SV selected from the group consisting of: YpCO92_NC_003143_113190, YpCO92_NC_003143_161621, YpCO92_NC_003143_152213, YpCO92_NC_003143_129539, YpCO92_NC_003143_91203, YpCO92_NC_003143_121812, and Yp_AL590842.1_RX_SNP in the sample, wherein detecting the Y. pestis Near Neighbor-specific SNP or SV confirms the absence of Y. pestis.
In another embodiment, the disclosed methods further comprise characterizing and/or subtyping Y. pestis by detecting at least one amplicon selected from the group consisting of: YpPGM_AL031866.1_81, YpPGM_31-205, Yp-p1202_42780-43194, Yp-p1202_126386-126750, and Yp-p1202_156402-156711 in the sample.
In some embodiments, the presence or absence of B. anthracis in a sample is detected by identifying a specific mutation in the PlcR gene, a single base change at position 640, a nonsense mutation, which creates a dysfunctional protein. In other embodiments, the presence or absence of B. anthracis in a sample is detected by identifying the pXO1 and/or pXO2 plasmids.
PlcR is a global transcriptional regulator which controls most of the secreted virulence factors in B. cereus and B. thuringiensis. It is chromosomally encoded and is ubiquitous throughout the cell (Agaisse, H. et al. (June 1999). “PlcR is a pleiotropic regulator of extracellular virulence factor gene expression in Bacillus thuringiensis”. Molecular Microbiology. 32 (5): 1043-53). In B. anthracis, however, the plcR gene contains a single base change at position 640, a nonsense mutation, which creates a dysfunctional protein. While 1% of the B. cereus group carries an inactivated plcR gene, none of them carries the specific mutation found only in B. anthracis (Slamti, L. et al. (June 2004). “Distinct mutations in PlcR explain why some strains of the Bacillus cereus group are nonhemolytic”. Journal of Bacteriology. 186 (11): 3531-8).
The lack of PlcR in B. anthracis is a principle characteristic differentiating it from other members of the B. cereus group. While B. cereus and B. thuringiensis depend on the plcR gene for expression of their virulence factors, B. anthracis relies on the pXO1 and pXO2 plasmids for its virulence (Kolsto, A. et al. (October 2009). “What Sets Bacillus anthracis Apart from Other Bacillus Species?” Annual Review of Microbiology. 63 (1): 451-476). Bacillus cereus biovar anthracis, i.e. B. cereus with the two plasmids, is also capable of causing anthrax.
In various embodiments, the disclosed methods identify an antibiotic resistance gene selected from a beta-lactamase gene, such as bIaOXA, encoding extended spectrum OM class D beta-lactamases, blaCTX-M 82, blaCFX A4, encoding extended spectrum class A serine beta-lactamases, and AmpC, encoding the extended spectrum cephalosporin-resistant class C beta-lactamases; a multidrug efflux transporter system gene such as acrE, encoding a component of the AcrEF-ToIC multidrug efflux transporter system (Lau and Zgurskaya, 2005, J. Bacteriol. 187:7815); baeR; encoding a response regulator of the MdtABC multidrug efflux transporter system (Nagakubo et al., 2002, J. Bacteriol. 184:4161); emrY, encoding a component of the EmrKY-ToIC multidrug efflux transporter system (Tanabe et al., 1997, J. Gen. Appl. Microbiol. 43:257); mdtD, encoding a component of the MdtABC multidrug efflux transporter system (Nagakubo et al., 2002, J. Bacteriol. 184:4161); and mdtN, encoding a multidrug resistance efflux pump from the major facilitator superfamily (Sulavik et al., 2001, Antimicrob. Agents Chemother. 45:1126); pbp2, encoding penicillin binding protein 2 (Bharat et al., 2015, Antimicrob. Agents Chemother. 59:5003); pbp4, encoding penicillin binding protein 4 (Sun et al., 2014, PLoS One 9:e97202); andaminoglycoside_strA (Scholz et al., 1989, Gene 75:271) encodes an aminoglycoside phosphotransferase, and Tetracycline_tet39 (Agerso and Guardabassi, 2005, J. Antimicrob. Chemother. 55:566) encodes a component of a tetracycline efflux pump.
Other antibiotic resistance genes are provided in the Antibiotic Resistance Genes Database (ARDB), see Nucl. Acids Res. (2009) 37 (suppl 1): D443-D447, the World Wide
Web (www) at ardb.cbcb.umd.edu, Antimicrob. Agents Chemother. July 2013 vol. 57 no. 7 3348-3357, and the NCBI database (the World Wide Web (www) at ncbi.nlm.nih.gov), the entire contents of which are hereby incorporated by reference.
In various embodiments, the antibiotic resistance gene is one or more of the genes shown below:
Aminocoumarins:
Aminocournarin-resistant DNA topoisomerases
Aminocournarin-resistant GyrB, ParE, ParY
Aminoglycosides:
Aminoglycoside acetyltransferases
AAC(1), AAC(2), AAC(3), AAC(6′)
Aminoglycosi de nucleotidyltransferases
ANT(2″), ANT(3″), ANT(4), ANT(6), ANT(9)
Aminoglycoside phosphotransferases
APH(2″), APH(3″), APH(3′), APH(4), APH(6), APH(7″),
APH(9)
16S rRNA methyltransferases
ArmA, RaitA, RrntB, RrniC, Sgrn
β-Lactams:
Class A p-lactamases
AER, BLA1, CTX-M, IUPC, SFR', TEM, etc.
Class B (metallo-)β-lactamases
BlaB, CcrA, IMP, NDM, VIM, etc.
Class C β-lactamases
ACT, AmpC, CMY, LAT, PDC, etc.
Class D β-lactamases
OXA β-lactamase
mecA (methicillin-resistant PBP2)
Mutant porin proteins conferring antibiotic resistance
Antibiotic-resistant Omp36, OmpF, PIB (por)
Genes modulating β-lactam resistance:
bla (blaI, blaR1) and mec (mecI, mecR1) operons
Chloramphenicol:
Chloramphenicol acetyitransferase (CAT)
Chloramphenicol phosphotransferase
Ethambutol:
Ethambutol-resistant arabinosyltransferase (FrnbB)
Mupirocin:
Mupirocin-resistant isoleucyl-tRNA synthetases
MupA, MupB
Peptide antibiotics:
Integral membrane protein MpriF
Phenicol:
Cfr 23S rRNA methyltransferase
Rifampin:
Rifampin ADP-ribosyitransferase (Arr)
Rifampin glycosyltransferase
Rifampin monooxygenase
Rifampin phosphotransferase
Rifampin resistance RNA polymerase-binding proteins
DnaA, RbpA
Rifampin-resistant beta-subunit of RNA polymerase
(RpoB)
Streptogramins:
Cfr 23S rRNA methyltransferase
Erm 23S rRNA methyltransferases
ErmA, ErmB, Erm(31), etc.
Streptogramin resistance ATP-binding cassette (ABC)
efflux pumps
Lsa, MsrA, Vga, VgaB
Streptogramin Vgb lyase
Vat acetyltransferase
Fitioroquirmiones:
Fluoroquinolone acetyltransferase
Fluoroquinolone-resistant DNA topoisomerases
Fluoroquinolone-resistant GyrA, GyrB, ParC
Quinolone resistance protein (Qnr)
Fosfomycin:
Fosfomycin phosphotransferases
FomA, FomB, FosC
Fosfomycin thiol transferases
FosA, FosB, FosX
Glycopeptides:
VanA, VanB, VanD, VanR, VanS, etc.
Lincosamides:
Cfr 235 rRNA methyltransferase
Erm 235 rRNA methyltransferases
ErmA, ErmB, Em (31), etc.
Lincosamide nucleotidyltransferase (Lin)
Linezolid:
Cfr 235 rRNA methyltransferase
Macrolides:
Cfr 235 rRNA methyltransferase
Erm 235 rRNA methyltransferases
ErmA, ErmB, Erm(31),
Macrolide esterases
EreA, EreB
Macrolide glycosyltransferases
GimA, Mgt, Ole
Macrolide phosphotransferases (MPH)
MPH(2′)-I, MPH(2′)-II
Macrolide resistance efflux pumps
MefA, MefE, Mel
Streptothricin:
Streptothricin acetyltransferase (sat)
Sulfonamides:
Sulfonamide-resistant dihydropteroate synthases
Sul1, Sul2, Sul3, sulfonamide-resistant FolP
Tetracyclines:
Mutant porin PIB (por) with reduced permeability
Tetracycline inactivation enzyme TetX
Tetracycline resistance major facilitator supeifamily
(MFS) efflux pumps
TetA, TetB, TetC, Tet30, Tet31, etc.
Tetracycline resistance ribosomal protection proteins
TetM, TetO, TetQ, Tet32, Tet36, etc.
Efflux pumps conferring antibiotic resistance:
ABC antibiotic efflux pump
MacAR-TolC, MsbA, MsrA, VgaB, etc.
MFS antibiotic efflux pump
EmrD, EmrAB-TolC, NorB, GepA, etc.
Multidrug and toxic compound extrusion (MATE)
transporter
MepA
Resistance-nodulation-cell division (RND) efflux pump
AdeABC, AcrD, MexAB-OprM, mtrCDE, etc.
Small multidrug resistance (SMR) antibiotic efflux pump
EmrE
Genes modulating antibiotic efflux:
adeR, acrR, baeSR, mexR, phoPQ, mtrR
Multidrug resistance:
plasmid plP1202
In certain aspects, the disclosed methods the sample is obtained from a subject and the method further comprises administering at least one antibiotic to the subject.
In one aspect, the at least one antibiotic is a fluoroquinolone. Non-limiting fluoroquinolones for use as described herein include levofloxacin, ofloxacin, ciprofloxacin, enoxacin, gatifloxacin, gemifloxacin, grepafloxacin, besifloxacin, lomefloxacin, moxifloxacin, norfloxacin, ofloxacin, pefloxacin, sparfloxacin, garenoxacin, trovafloxacin, sitafloxacin, and DX-619.
In another aspect, the at least one antibiotic is an aminoglycoside such as amikacin, gentamycin, kanamycin, neomycin, netilmicin, paromomycin, streptomycin, or tobramycin.
In another aspect, the at least one antibiotic is a carbapenem such as ertapenem, imipenem, meropenem, or chloramphenicol.
In another aspect, the at least one antibiotic is a glycopeptide such as vancomycin.
In another aspect, the at least one antibiotic is a lincosamide such as clindamycin.
In another aspect, the at least one antibiotic is a macrolide/ketolide such as azithromycin, clarithromycin, dirithromycin, erythromycin, or telithromycin.
In another aspect, the at least one antibiotic is a cephalosporin such as (1st generation) cefadroxil, cefazolin, cephalexin, cephalothin, cephapirin, and cephradine; or (2nd generation) cefaclor, cefamandole, cefonicid, cefotetan, cefoxitin, cefprozil, cefuroxime, and loracarbef, or (3rd generation) cefdinir, cefditoren, cefixime, cefoperazone, cefotaxime, cefpodoxime,ceftazidime, ceftibuten, ceftizoxime, and ceftriaxone, or (4th generation) cefepime.
In another aspect, the at least one antibiotic is a monobactam such as aztreonam.
In another aspect, the at least one antibiotic is a nitroimidazole such as metronidazole.
In another aspect, the at least one antibiotic is an oxazolidinone such as linezolid.
In another aspect, the at least one antibiotic is a penicillin such as amoxicillin, amoxicillin/clavulanate, ampicillin, ampicillin/sulbactam, bacampicillin, carbenicillin, cloxacillin, dicloxacillin, methicillin, mezlocillin, nafcillin, oxacillin, penicillin G, penicillin V, piperacillin, piperacillin/tazobactam, ticarcillin, or ticarcillin/clavulanate.
In another aspect, the at least one antibiotic is a streptogramin such as quinupristin/dalfopristin.
In another aspect, the at least one antibiotic is a tetracycline such as demeclocycline, doxycycline, minocycline, or tetracycline.
In another aspect, the at least one antibiotic is a β-lactam such as a penicillin, cephalosporin, carbapenem, or monobactam.
The at least one antibiotic may be a physiologically acceptable salt, prodrug, or combination of any one of the aforementioned antibiotics.
The following examples are given for purely illustrative and non-limiting purposes of the present invention.
This protocol describes procedures for: (1) PCR amplification of multiplexed Burkholderia targets; (2) Index extension PCR to prepare amplicons for MiSeq (ILLUMINA® sequencer); (3) SequelPrep™ Normalization Plate Kit (ThermoFisher); and (4) Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter).
Universal-tailed gene-specific primers are pooled together in a “primer mix” in amounts relative to each other to help reduce PCR bias. Make the primer mixture by combining the primers and 1xTE (e.g., according to Table 8). Vortex and spin down each primer stock. The primer mixture can be stored at −20° C. Plan and arrange the layout of where the samples will go on a 96-well plate. If clinical samples are being processed, make sure to space the samples on the plate accordingly. Table 9 can be used as an example clinical plate layout. Black wells are samples. Combine the following volumes of reagents as described in Table 10, except IPSC to create the Burkholderia Multiplex Master Mix. Reagents should be thawed and mixed before use. Vortexing PCR mastermix should be avoided to prevent damaging the enzymes in the mixture.
To prepare Burkholderia Multiplex, on experimental day, thaw out an aliquot of Internal Plasmid Sequencing Control (IPSC) at 10{circumflex over ( )}6 copies per uL, dilute down to 10{circumflex over ( )}3 copies per uL by three serial dilutions of 1 to 10. Make dilutions in tubes for better vortexing & spinning. For single reaction no-template control (NTC) reaction, add 12.5 μL Q5 2x HotStart, 5μL 5M Betaine, and 4.5 μL Diluted Primer Mix. For single reaction, add 12.5 μL Q5 2x HotStart, 5 μL 5M Betaine, 1 μL IPSC 1000 copies per μL, and 4.5 μL Diluted Primer Mix. To prepare for Master Mix reaction, add 2475 μL Q5 2x HotStart, 990 μL 5M Betaine, 198 μL IPSC 1000 copies per μL, and 891 μL Diluted Primer.
Gently mix template DNA and spin down (Do not vortex genomic DNA). Add 2□L of template DNA to its appropriate well, along with 2□L H2O for IPSC, and 3□L H2O for NTC. Seal plate with a thermocycler seal. Spin down the plate. Using a heated lid, put plate on thermocycler and run the following parameters:
Spin plates (Burkholderia target plate and Bacillus, Yersinia, Francisella target plate) down once the thermocycler finishes.
Prepare AMPure Beads. Prepare 10 mM Tris-HCl 0.05% Tween-20 in H2O by adding 400 μL 10 mM Tris-HCl, 20 μL 0.05% Tween-20, and 39.580mL Molecular Grade H2O, and heat to 50° C. Equilibrate the bead to Room Temperature for 30 minutes. Add beads in a 1:1 ratio with reaction volume to each well (30 μL) and mix well by pipetting. Incubate the bead/reaction mixture for 5 minutes. Place the 96-well plate onto a magnetic stand, incubate for another 5 minutes. Aspirate supernatant out of wells without disturbing the beads. If beads were disturbed, let them incubate for another 2 minutes. Be sure to remove as much liquid as you can. Twice wash the beads by adding 80% EtOH (32 ml 100% Ethanol, and 8 ml Molecular Grade H2O) to completely cover beads (˜200 μL) and incubate for 30 seconds. Aspirate. Fully remove liquids after the wash. Move plate off magnetic stand and allow beads to dry. Be sure to keep a close watch on the beads. If the beads start to crack, the DNA will be difficult to elute out. Move plate off the magnetic stand and add 32.54 heated 10 mM Tris-HCl 0.05% Tween-20 in H2O to the wells, mix well. Incubate for 2 minutes. Move plate to magnetic stand and incubate for 2 minutes. Remove 304 of supernatant and transfer it to a new well, do not disturb or transfer any beads.
Burkholderia, Bacillus, Francisella, and Yersinia AmpSeq amplicons require two bead cleanups before Extension PCR. Repeat steps 12-21.
Detecting the Presence of Nucleic Acids from Bacillus anthracis, Yersinia, and Francisella UT-AmpSeq PCR and Bead Cleanup.
1. PCR amplification of multiplexed Bacillus, Yersinia, and Francisella targets. Universal-tailed gene-specific primers are pooled together in a “primer mix” in amounts relative to each other to help reduce PCR bias. These amounts have been previously optimized. Please follow the Primer Mix parameters to create the needed mix for the multiplex currently in use.
2. Index extension PCR to prepare amplicons for MiSeq (ILLUMINA® sequencer). Enter the total number of samples in the box below. Primer Mix Parameters, # of Samples
3. SequelPrepTm Normalization Plate Kit (ThermoFisher).
4. Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter).
1. PCR amplification of multiplexed Burkholderia targets
2. Index extension PCR to prepare amplicons for MiSeq (ILLUMINA® sequencer)
3. SequelPrep™ Normalization Plate Kit (ThermoFisher)
4. Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter)
1. Universal-tailed gene-specific primers are pooled together in a “primer mix” in amounts relative to each other to help reduce PCR bias. These amounts have been previously optimized.
Please follow the Primer Mix parameters to create the needed mix for the multiplex currently in use
2. Enter the total number of samples in the box below.
Primer Mix Parameters
# of Samples
180
ensure that all values in column K “How much starting primer conc. to add in mix stock” are above 2.0u1 and not highlighted in red
3a. Make the primer mixture by combining the following primers.
3b. Vortex and spin down each primer stock.
3c. Using the “Start (uM)” concentration primer stock of each primer, add the volume from “Amount to add (uL)” into a 1.7 mL microcentrifuge tube, unless “Total (uL)” at bottom of table is above 1200, then split volume evenly across necessary tubes. Vortex to mix and spin. (Refer to Table 8)
4a. This mixture can be stored at −20° C. for future use. To use mixture, let thaw, vortex and spin down.
4b. If using mixture previously made, write down the initials of the person who made it and when: Initials______ Date______
5. Plan and arrange the layout of where your samples will go on a 96-well plate. If you are processing clinical samples make sure to space your samples on the plate accordingly.
Use the Plate Maps sheet for convenience and record keeping.
(Refer to Table 9)
6a. Reagents should be thawed and mixed before use. Avoid vortexing PCR mastermix as this can damage the enzymes in the mixture.
6b. Combine the following volumes of reagents as described in the following table except
IPSC to create the Burkholderia Multiplex Master Mix
Burkholderia Multiplex
6c. Add 22 uL of Burkholderia Multiplex Master Mix without IPSC to any NTC reactions you are processing
7a. Thaw out an aliquot of Internal Plasmid Sequencing Control (IPSC) at 10{circumflex over ( )}6 copies per uL. Dilute this down to 10{circumflex over ( )}3 copies/uL by three serial dilutions of 1 to 10. Make dilutions in tubes for better vortexing & spinning
Make this fresh the day of.
7b. Add volume with the # of NTCs subtracted of 10{circumflex over ( )}3 copies/uL IPSC to master mix. For example, if you had 3 NTCs that you had aliquoted master mix for, and the above table indicated 9 uL of IPSC be added, you would add 6 instead.
7d. Mix well and spin down
7e. Add 23 uL of Master Mix to each appropriate well on your plate
8a. Gently mix template DNA and spin down (Do not vortex genomic DNA)
8b. Add 2 uL of template DNA to its appropriate well, along with 2 uL H2O for IPSC, and 3 uL H2O for NTC
8c. Seal plate with a thermocycler seal
8d. Spin down plate
9. Using a heated lid, put plate on thermocycler and run the following parameters
10. During this time, take out AMPure Beads to equilibrate them to Room Temperature for 30 minutes and heat some 10 mM Tris-HCl 0.05% Tween-20 in H2O to 50 C.
11. Spin plates (Burkholderia target plate and Bacillus, Yersinia, Francisella target plate) down once the thermocycler finishes
12. Combine 15 uL of Burkholderia target reaction with 15 uL of Bacillus, Yersinia, Francisella target reaction
13. Add beads in a 1:1 ratio with reaction volume to each well (30 uL) and mix well by pipette
14. Incubate the bead/reaction mixture for 5 minutes
15. Place 96-well plate onto a magnetic stand, incubate for another 5 minutes
16. Aspirate supernatant out of wells without disturbing the beads. If beads ARE disturbed, let them incubate for another 2 minutes. Be sure to remove as much liquid as you can
17a. Add 80% EtOH to completely cover beads (˜200 uL) and incubate for 30 seconds. Aspirate.
17b. Repeat 16a and remove as much liquid as you can (two washes total), following with a 20 uL pipette to ensure full removal
18. Move plate off magnetic stand and allow beads to dry. Be sure to keep a close watch on the beads. If the beads start to crack, the DNA will be harder to elute out.
19. Move plate off the magnetic stand and add 32.5 uL heated 10 mM Tris-HCl 0.05% Tween-20 in H2O to the wells, mix well
20. Incubate for 2 minutes
21. Move plate to magnetic stand and incubate for 2 minutes
22. Remove 30 uL of supernatant and transfer it to a new well, do not disturb or transfer any beads
22. Burkholderia, Bacillus, Francisella, and Yersinia AmpSeq amplicons require two bead cleanups before Extension PCR. Repeat steps 12-21
23. Store amplicons at −20 C
24. Thaw, gently mix, and spin down the following reagents in the following amounts for the Index Extension of the Target Amplicons
*Amounts are in respect to number of samples entered in Step 2
25. Combine the above volumes together, mix gently, and spin down.
26a. Each reaction will require a unique pair of index primers (UT1 and UT2), prepare a chart of what indexes will be used and where
26b. Thaw, vortex, and spin down the stock 10uM aliquots of each index that will be used for this run
26c. If some tubes appear empty, create a new 10uM aliquot of that index. Dilute in TE.
27. Once all indexes are accounted for, add 21 uL of Index Extension Master Mix to each appropriate well in a 96-well plate
28. Add luL of each 10uM index to its appropriate well
29a. After all UT1 and UT2 indexes have been added to their wells add 2 uL of CLEANED AMPLICONS
29b. The following should now be in each reaction well
30. Seal the plate with a thermocycler seal
31. Spin down plate
32a. Using a heated lid, put plate on thermocycler and run the following parameters
32b. After the PCR has completed, spin down plate
33a. Samples will be cleaned and normalized using the Invitrogen SequalPrep system
33b. In a new plate, add equal amounts of illext DNA template and SequalPrep Normalization Binding Buffer
33c. Mix completely by pipette mixing several times, take care not to etch the sides of the well with the pipette tip
33d. Incubate the plate for 1 hour at room temperature to allow binding of DNA to the plate surface (longer than lhr is acceptable but will not increase binding or final elution concentration, can be overnight)
33e. Aspirate the liquid from the wells
33f. Add 50 uL Sequal Prep Normalization Wash Buffer, mix by pipetting up and down twice
33g. Completely aspirate the buffer, a small amount of residual Wash Buffer (1-3 uL) is typical
33h. Add 20 uL SequalPrep Normalization Elution Buffer to each well of the plate, mix by pipette
33i. Incubate at room temperature for 5 minutes
33j. Transfer samples to a new plate
34a. Samples should all be normalized now so pool them together in equal volumes
34b. The final DNA concentration will be fairly low, so perform an AMPure XP bead cleanup on the pool at a 1:1 ratio of pool to beads (be sure to note total volume of pooled samples)
34c. However, when eluting the DNA off the beads with heated Tris-Tween use 1/10 the initial pool volume used
35. Store DNA at −20C
1. PCR amplification of multiplexed Bacillus, Yersinia, and Francisella targets
2. Index extension PCR to prepare amplicons for MiSeq (ILLUMINA® sequencer)
3. SequelPrep™ Normalization Plate Kit (ThermoFisher)
4. Agencourt AMPure XP bead cleanup for PCR purification (Beckman Coulter)
1. Universal-tailed gene-specific primers are pooled together in a “primer mix” in amounts relative to each other to help reduce PCR bias. These amounts have been previously optimized.
2. Enter the total number of samples in the box below.
Primer Mix Parameters
# of Samples
180
ensure that all values in column K “How much starting primer conc. to add in mix stock” are above 2.0u1 and not highlighted in red
3a. Make the primer mixture by combining the following primers.
3b. Vortex and spin down each primer stock.
3c. Using the “Start (uM)” concentration primer stock of each primer, add the volume from “Amount to add (uL)” into a 1.7 mL microcentrifuge tube, unless “Total (uL)” at bottom of table is above 1200, then split volume evenly across necessary tubes. Vortex to mix and spin. (Refer to Table 10)
4a. This mixture can be stored at −20° C. for future use. To use mixture, let thaw, vortex and spin down.
4b. If using mixture previously made, write down the initials of the person who made it and when: Initials______ Date______
5. Plan and arrange the layout of where your samples will go on a 96-well plate. If you are processing clinical samples make sure to space your samples on the plate accordingly.
6. Use the Plate Maps sheet for convenience and record keeping. (Refer to Table 9)
6a. Reagents should be thawed and mixed before use. Avoid vortexing PCR mastermix as this can damage the enzymes in the mixture.
6b. Combine the following volumes of reagents as described in the following table except IPSC to create the Bacillus, Francisella, and Yersinia Multiplex Master Mix
Bacillus, Francisella,
Yersinia Multiplex
6c. Add 22 uL of Burkholderia Multiplex Master Mix without IPSC to any NTC reactions you are processing
7a. Thaw out an aliquot of Internal Plasmid Sequencing Control (IPSC) at 10{circumflex over ( )}6 copies per uL. Dilute this down to 10{circumflex over ( )}2 copies/uL by three serial dilutions of 1 to 10. Make dilutions in tubes for better vortexing & spinning
Make this fresh the day of.
7b. Add volume with the # of NTCs subtracted of 10{circumflex over ( )}2 copies/uL IPSC to master mix. For example, if you had 3 NTCs that you had aliquoted master mix for, and the above table indicated 9 uL of IPSC be added, you would add 6 instead.
7d. Mix well and spin down
7e. Add 23 uL of Master Mix to each appropriate well on your plate
8a. Gently mix template DNA and spin down (Do not vortex genomic DNA)
8b. Add 2 uL of template DNA to its appropriate well, along with 2 uL H2O for IPSC, and 3 uL H2O for NTC
8c. Seal plate with a thermocycler seal
8d. Spin down plate
9. Using a heated lid, put plate on thermocycler and run the following parameters
10. During this time, take out AMPure Beads to equilibrate them to Room Temperature for 30 minutes and heat some 10 mM Tris-HCl 0.05% Tween-20 in H2O to 50 C
11. Spin plates (Burkholderia target plate and Bacillus, Yersinia, Francisella target plate) down once the thermocycler finishes
12. Combine 15 uL of Burkholderia target reaction with 15 uL of Bacillus, Yersinia, Francisella target reaction
13. Add beads in a 1:1 ratio with reaction volume to each well (30 uL) and mix well by pipette
14. Incubate the bead/reaction mixture for 5 minutes
15. Place 96-well plate onto a magnetic stand, incubate for another 5 minutes
16. Aspirate supernatant out of wells without disturbing the beads. If beads ARE disturbed, let them incubate for another 2 minutes. Be sure to remove as much liquid as you can
17a. Add 80% EtOH to completely cover beads (˜200 uL) and incubate for 30 seconds.
17b. Repeat 16a and remove as much liquid as you can (two washes total), following with a 20 uL pipette to ensure full removal
18. Move plate off magnetic stand and allow beads to dry. Be sure to keep a close watch on the beads. If the beads start to crack, the DNA will be harder to elute out.
19. Move plate off the magnetic stand and add 32.5 uL heated 10 mM Tris-HCl 0.05% Tween-20 in H2O to the wells, mix well
20. Incubate for 2 minutes
21. Move plate to magnetic stand and incubate for 2 minutes
22. Remove 30 uL of supernatant and transfer it to a new well, do not disturb or transfer any beads
22. Burkholderia, Bacillus, Francisella, and Yersinia AmpSeq amplicons require two bead cleanups before Extension PCR. Repeat steps 12-21
23. Store amplicons at −20 C
24. Thaw, gently mix, and spin down the following reagents in the following amounts for the Index Extension of the Target Amplicons
*Amounts are in respect to number of samples entered in Step 2
25. Combine the above volumes together, mix gently, and spin down.
26a. Each reaction will require a unique pair of index primers (UT1 and UT2), prepare a chart of what indexes will be used and where
26b. Thaw, vortex, and spin down the stock 10uM aliquots of each index that will be used for this run
26c. If some tubes appear empty, create a new 10uM aliquot of that index. Dilute in TE.
27. Once all indexes are accounted for, add 21 uL of Index Extension Master Mix to each appropriate well in a 96-well plate
28. Add luL of each 10uM index to its appropriate well
29a. After all UT1 and UT2 indexes have been added to their wells add 2 uL of CLEANED AMPLICONS
29b. The following should now be in each reaction well
30. Seal the plate with a thermocycler seal
31. Spin down plate
32. Using a heated lid, put plate on thermocycler and run the following parameters
32b. After the PCR has completed, spin down plate
33a. Samples will be cleaned and normalized using the Invitrogen SequalPrep system
33b. In a new plate, add equal amounts of illext DNA template and SequalPrep Normalization Binding Buffer
33c. Mix completely by pipette mixing several times, take care not to etch the sides of the well with the pipette tip
33d. Incubate the plate for 1 hour at room temperature to allow binding of DNA to the plate surface (longer than lhr is acceptable but will not increase binding or final elution concentration, can be overnight)
33e. Aspirate the liquid from the wells
33f. Add 50 uL Sequal Prep Normalization Wash Buffer, mix by pipetting up and down twice
33g. Completely aspirate the buffer, a small amount of residual Wash Buffer (1-3 uL) is typical
33h. Add 20 uL SequalPrep Normalization Elution Buffer to each well of the plate, mix by pipette
33i. Incubate at room temperature for 5 minutes
33j. Transfer samples to a new plate
34a. Samples should all be normalized now so pool them together in equal volumes
34b. The final DNA concentration will be fairly low, so perform an AMPure XP bead cleanup on the pool at a 1:1 ratio of pool to beads (be sure to note total volume of pooled samples)
34c. However, when eluting the DNA off the beads with heated Tris-Tween use 1/10 the initial pool volume used
35. Store DNA at −20C
B. pseudo-
B.
mallei/
F.
Y
anthracis
mallei
tularensis
pestis
B. pseudomallei
B. pseudomallei
B. pseudomallei
B. pseudomallei
B. pseudomallei
mallei
B. pseudomallei
mallei
B. pseudomallei
mallei
B. pseudomallei
mallei
B. pseudomallei
mallei
B. pseudomallei
B. cepacia complex
B. pseudomallei
B. pseudomallei
B. mallei
B. mallei
B. mallei
B. mallei
B. mallei
Y. pestis
Y. pestis
Y. pestis
Y. pestis
Virulence locus
Virulence locus
Y.
enterocoliticus
F.
tularensis
F.
tularensis
F.
tularensis
F.
tularensis
Novicida
F.
philomiragia
F.
philomiragia
F.
noatunensis
F.
noatunensis
pseudomallei
pseudomallei
pseudomallei
pseudomallei
pseudomallei
pseudomallei
pseudomallei
pseudomallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei mallei
pseudomallei complex
pseudomallei complex
cepacia complex
cepacia complex
mallei
mallei
mallei
mallei
Burkholderia primers and primers with Universal Tail (UT).
ACCCAACTGAATGGAGCTCGTCG
ACGCACTTGACTTGTCTTCGGCC
pseudomallei
ACCCAACTGAATGGAGCTCGCA
ACGCACTTGACTTGTCTTCGCCG
pseudomallei
ACCCAACTGAATGGAGCCGCGCT
ACGCACTTGACTTGTCTTCGCGC
pseudomallei
ACCCAACTGAATGGAGCAATCCA
ACGCACTTGACTTGTCTTCGCGA
pseudomallei
ACCCAACTGAATGGAGCTCGCAT
ACGCACTTGACTTGTCTTCAGTG
pseudomallei
ACCCAACTGAATGGAGCCCTTTG
mallei
ACGCACTTGACTTGTCTTCGAGC
pseudomallei
ACCCAACTGAATGGAGCCCAGTC
mallei
ACGCACTTGACTTGTCTTCGGCG
pseudomallei
ACCCAACTGAATGGAGCGCCGG
mallei
ACGCACTTGACTTGTCTTCTGGA
pseudomallei
ACCCAACTGAATGGAGCTCGATA
mallei
ACGCACTTGACTTGTCTTCATGT
pseudomallei
ACCCAACTGAATGGAGCGAAAG
mallei
ACGCACTTGACTTGTCTTCTTCGG
pseudomallei
ACCCAACTGAATGGAGCGCCAGC
ACGCACTTGACTTGTCTTCAGAG
cepacia
ACCCAACTGAATGGAGCCGCGCA
ACGCACTTGACTTGTCTTCCGAA
ACCCAACTGAATGGAGCCACGTT
ACGCACTTGACTTGTCTTCCCGTC
ACCCAACTGAATGGAGCCAGAA
ACGCACTTGACTTGTCTTCTGCC
mallei
ACCCAACTGAATGGAGCAGGGG
ACGCACTTGACTTGTCTTCAGCG
mallei
ACCCAACTGAATGGAGCACGGG
ACGCACTTGACTTGTCTTCGCGC
ACCCAACTGAATGGAGCATCCGC
ACGCACTTGACTTGTCTTCGGGT
ACCCAACTGAATGGAGCCGGTCG
ACGCACTTGACTTGTCTTCAGCG
ACGCACTTGACTTGTCTTCGCTG
ACCCAACTGAATGGAGCCGCGA
ACCCAACTGAATGGAGCGGCCGC
ACGCACTTGACTTGTCTTCGTCG
Bacillus primers and primers with Universal Tail (UT). The UT sequence is underlined.
ACCCAACTGAATGGAGCTTTTTC
ACGCACTTGACTTGTCTTCTTTGA
ACCCAACTGAATGGAGCACGTCA
ACGCACTTGACTTGTCTTCCAAC
ACCCAACTGAATGGAGCGAAGA
ACGCACTTGACTTGTCTTCGAAA
ACCCAACTGAATGGAGCCACAAT
ACGCACTTGACTTGTCTTCCACG
ACCCAACTGAATGGAGCGATATT
ACGCACTTGACTTGTCTTCTATT
ACCCAACTGAATGGAGCTATTGA
ACGCACTTGACTTGTCTTCTATTG
ACCCAACTGAATGGAGCGGTTCA
ACGCACTTGACTTGTCTTCTAACT
ACCCAACTGAATGGAGCGCGAAT
ACGCACTTGACTTGTCTTCT
ACCCAACTGAATGGAGCATT
ACGCACTTGACTTGTCTTCT
ACCCAACTGAATGGAGCACA
ACGCACTTGACTTGTCTTCT
ACCCAACTGAATGGAGCCATGGG
ACGCACTTGACTTGTCTTCTTCGT
ACCCAACTGAATGGAGCTTGGAG
ACGCACTTGACTTGTCTTCGTAA
ACCCAACTGAATGGAGCTGAGCC
ACGCACTTGACTTGTCTTCTTGG
ACCCAACTGAATGGAGCCGCCAG
ACGCACTTGACTTGTCTTCGCTA
ACCCAACTGAATGGAGCTCGGTA
ACGCACTTGACTTGTCTTCTGCTT
ACCCAACTGAATGGAGCCAGTCG
ACGCACTTGACTTGTCTTCTAACT
ACCCAACTGAATGGAGCATTGTA
ACGCACTTGACTTGTCTTCTATCA
ACCCAACTGAATGGAGCGGTTAC
ACGCACTTGACTTGTCTTCTCCCA
ACCCAACTGAATGGAGCTTCTTC
ACGCACTTGACTTGTCTTCCGGA
ACCCAACTGAATGGAGCAAGTTT
ACGCACTTGACTTGTCTTCTCGA
ACCCAACTGAATGGAGCCAAAA
ACGCACTTGACTTGTCTTCCCGA
ACCCAACTGAATGGAGCAGGAG
ACGCACTTGACTTGTCTTCACCC
ACCCAACTGAATGGAGCCGTTGC
ACGCACTTGACTTGTCTTCAGGT
ACCCAACTGAATGGAGCCGAAA
ACGCACTTGACTTGTCTTCACTG
ACCCAACTGAATGGAGCTCTCTT
ACGCACTTGACTTGTCTTCGATG
ACCCAACTGAATGGAGCGTGAA
ACGCACTTGACTTGTCTTCTCCGC
ACCCAACTGAATGGAGCATACGG
ACGCACTTGACTTGTCTTCCGTCT
ACCCAACTGAATGGAGCTTATCG
ACGCACTTGACTTGTCTTCAAAC
ACCCAACTGAATGGAGCTATGAA
ACGCACTTGACTTGTCTTCTGAA
ACCCAACTGAATGGAGCTCGAAC
ACGCACTTGACTTGTCTTCAAAG
Yersinia primers and primers with Universal Tail (UT). The UT sequence is underlined.
ACCCAACTGAATGGAGCAACAA
ACGCACTTGACTTGTCTTCATAG
ACCCAACTGAATGGAGCGAAAG
ACGCACTTGACTTGTCTTCGGCC
ACCCAACTGAATGGAGCGATGCT
ACGCACTTGACTTGTCTTCGTGT
ACCCAACTGAATGGAGCACTCGG
ACGCACTTGACTTGTCTTCCGAA
ACCCAACTGAATGGAGCCATGCG
ACGCACTTGACTTGTCTTCGCGTT
ACGCACTTGACTTGTCTTCACTC
ACCCAACTGAATGGAGCTTCACG
ACGCACTTGACTTGTCTTCTTCTG
ACCCAACTGAATGGAGCATTATC
ACGCACTTGACTTGTCTTCGGAG
ACCCAACTGAATGGAGCCCTCAC
ACGCACTTGACTTGTCTTCTTTTT
ACCCAACTGAATGGAGCAGCATG
ACGCACTTGACTTGTCTTCGGTG
ACCCAACTGAATGGAGCCAGTAC
ACGCACTTGACTTGTCTTCTTTAC
ACCCAACTGAATGGAGCGCACTA
ACGCACTTGACTTGTCTTCGTCG
ACCCAACTGAATGGAGCTTAATA
ACGCACTTGACTTGTCTTCTCCTT
ACCCAACTGAATGGAGCTTTAAT
ACGCACTTGACTTGTCTTCGTCTG
ACGCACTTGACTTGTCTTCCAGG
ACCCAACTGAATGGAGCGGGGC
ACGCACTTGACTTGTCTTCCTGG
ACCCAACTGAATGGAGCACCATC
ACGCACTTGACTTGTCTTCGAAA
ACCCAACTGAATGGAGCGGTAG
ACGCACTTGACTTGTCTTCGTCAT
ACCCAACTGAATGGAGCGAAGT
ACGCACTTGACTTGTCTTCAGCG
ACCCAACTGAATGGAGCTTTAAT
ACGCACTTGACTTGTCTTCACGA
ACCCAACTGAATGGAGCCGGTAA
ACGCACTTGACTTGTCTTCAGAG
ACCCAACTGAATGGAGCAATTCT
ACGCACTTGACTTGTCTTCTCCTA
ACCCAACTGAATGGAGCCTTATG
ACGCACTTGACTTGTCTTCATAC
ACCCAACTGAATGGAGCCTGATG
ACGCACTTGACTTGTCTTCGTAG
ACCCAACTGAATGGAGCTGTTAC
ACGCACTTGACTTGTCTTCATCAT
ACCCAACTGAATGGAGCATCAAG
ACGCACTTGACTTGTCTTCAACC
ACCCAACTGAATGGAGCTACCTC
ACGCACTTGACTTGTCTTCGGCA
ACCCAACTGAATGGAGCTCTTTG
ACGCACTTGACTTGTCTTCCAGA
ACCCAACTGAATGGAGCCATAAC
ACGCACTTGACTTGTCTTCAAAT
ACCCAACTGAATGGAGCGTGTCC
ACGCACTTGACTTGTCTTCTTTGG
ACCCAACTGAATGGAGCAAGCTT
ACGCACTTGACTTGTCTTCCGCCT
ACCCAACTGAATGGAGCGGGTG
ACGCACTTGACTTGTCTTCTACC
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials, similar or equivalent to those described herein, can be used in the practice or testing of the present invention, the preferred methods and materials are described herein. All publications, patents, and patent publications cited are incorporated by reference herein in their entirety for all purposes.
The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.
This application claims priority to U.S. Provisional Patent Application No. 62/798,463, filed on Jan. 29, 2019, the contents of which are incorporated herein by reference in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2020/015395 | 1/28/2020 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62798463 | Jan 2019 | US |
