Patent Application
20220112504
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jul. 29, 2020, is named 167705_011501 PCT_SL.txt and is 98,534 bytes in size.
Most dominant human mutations associated with disease are single nucleotide substitutions. While gene editing strategies (e.g., CRISPR/Cas) are being developed to correct such mutations, single nucleotide discrimination and editing can be difficult to achieve for several reasons. For example, commonly used endonucleases, such as Streptococcus pyogenes Cas9 (SpCas9), can tolerate up to seven mismatches between a guide RNA (gRNA) and a nucleic acid molecule. Furthermore, the protospacer-adjacent motif (PAM) in some Cas9 enzymes can tolerate mismatches with the target DNA. There is a need for improved gene editing compositions capable of selectively and efficiently targeting a mutant allele, but not targeting a wild-type allele.
As described below, the present invention features a Cas9 variant capable of selectively targeting a mutant allele without disrupting the wildtype allele, and methods of using such Cas9 variants to disrupt the mutant allele. In particular embodiments, the invention provides for the disruption of dominant mutations associated with single nucleotide substitutions. The invention further provides methods and compositions for treating a disease or condition or symptoms thereof associated with a dominant mutation (e.g., DFN36).
In one aspect, a method is provided for allele specific gene editing, the method includes contacting a double stranded polynucleotide having a mutant allele with a guide RNA that binds the mutant allele and a Cas9 polypeptide with a PAM site selective for the mutant allele, such that indels are selectively induced in the mutant target allele.
Another aspect of the invention provides a method for the allele-specific disruption of a dominant mutation, the method comprising contacting a double stranded polynucleotide comprising a mutant allele with a guide RNA that binds the mutant allele and a Cas9 nuclease with a PAM site selective for the mutant allele, such that indels are selectively induced in the mutant allele.
In one embodiment of the methods described above, the double stranded polynucleotide is DNA. In an embodiment, the DNA is genomic DNA. In another embodiment, the polynucleotide is present in a cell. In another embodiment, the cell is a cell in vivo or in vitro.
In another aspect, a method is provided for the treatment of a disorder associated with a dominant mutant allele in a target gene, the method includes contacting a cell heterozygous for the dominant mutant allele in a target gene with a guide RNA that binds the target mutant allele and a Cas9 nuclease with a PAM site selective for the mutant allele and selectively inducing an indel in the mutant target allele.
Another aspect provides a method of treating progressive hearing loss in a subject, the method includes contacting a cell of a subject heterozygous for a p.M418K mutation in TMC1 with a SaCas9-KKH and a guide RNA that targets TMC1 and inducing indels in the TMC1 allele having the p.M418K mutation, thereby treating hearing loss in the subject
Another aspect of the present disclosure includes a vector having a polynucleotide encoding a SaCas9-KKH polypeptide, or a fragment thereof, and a gRNA having a nucleic acid sequence complementary to a nucleic acid sequence comprising a mutation associated with DFNA36. In one embodiment, the vector is included in a pharmaceutical composition.
In various embodiments of any of the above aspects, the cell is a cell of the inner ear In various embodiments of any of the above aspects, the cell is an inner or outer hair cell. In various embodiments of any of the above aspects, the administering improves or maintains auditory function in the subject. In various embodiments of any of the above aspects, an improvement in auditory function is associated with preservation of hair bundle morphology and/or restoration of mechanotransduction. In various embodiments of any of the above aspects, the guide RNA and the Cas9 polypeptide are encoded in a single vector. In various embodiments of any of the above aspects, the vector is an adeno-associated virus vector or a lentivirus vector. In various embodiments of any of the above aspects, the contacting includes transfecting cells in the subject with a guide RNA and a polynucleotide encoding a Cas9 protein. In various embodiments of any of the above aspects, the guide RNA and the Cas9 polypeptide are administered simultaneously.
Other features and advantages of the invention will be apparent from the detailed description and from the claims.
Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.
By “AAV9-php.b vector” is meant a viral vector comprising an AAV9-php.b polynucleotide or fragment thereof that transfects a cell of the inner ear. In one embodiment, the AAV9-php.b vector transfects at least 70% of inner hair cells and 70% of outer hair cells following administration to the inner ear of a subject or contact with a cell derived from an inner ear in vitro. In other embodiments, at least 85%, 90%, 95% or virtually 100% of inner hair cells and/or 85%, 90%, 95% or virtually 100% of outer hair cells are transfected. The transfection efficiency may be assessed using a gene encoding GFP in a mouse model. The sequence of an exemplary AAV9-php.b vector is provided below.
By “administer” is meant providing one or more compositions described herein to a subject. By way of example and without limitation, composition administration can be performed by injection, for example, into the cochlea. Other routes that deliver the composition to cells affected by a mutation can be employed. Administration can be, for example, by bolus injection or by gradual perfusion over time.
By “agent” is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.
By “alteration” is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein. As used herein, an alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.
By “ameliorate” is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease. Exemplary diseases include any disease associated with a dominant mutation. In one embodiment, the disease is hearing loss associated with a dominant mutation, for example, Deafness, Deafness, Autosomal Dominant 3B, Deafness, Autosomal Dominant 9, Autosomal Dominant 11, Deafness, Autosomal Dominant 12, Deafness, Autosomal Dominant 13, Deafness, Autosomal Dominant17, Deafness, Autosomal Dominant 20, Deafness, Autosomal Dominant 22, Deafness, Autosomal Dominant 25, Deafness, Autosomal Dominant 36, Deafness, Autosomal Dominant 41, Deafness, Autosomal Dominant 66, Deafness, Autosomal Dominant 68, Deafness, and Autosomal Dominant Nonsyndromic Sensorineural 39, with Dentinogenesis Imperfecta 1.
By “Anc80 polypeptide” is meant a capsid polypeptide having at least about 85% amino acid identity to the following polypeptide sequence:
By “Anc80 polynucleotide” is meant a nucleic acid molecule encoding a Anc80 polypeptide.
By “Cas9 (CRISPR associated protein 9)” is meant a polypeptide or fragment thereof having at least about 85% amino acid identity to NCBI Accession No. NP_269215 and having RNA binding activity, DNA binding activity, and/or DNA cleavage activity (e.g., endonuclease or nickase activity). An exemplary Cas9 polypeptide sequence is provided below.
By “Cas 9 nucleic acid molecule” is meant a polynucleotide encoding a Cas9 polypeptide or fragment thereof. An exemplary Cas9 nucleic acid molecule sequence is provided at NCBI Accession No. NC_002737 and is shown below.
Kleinstiver et al. (Nat Biotechnol. 2015 December; 33(12):1293-1298. doi: 10.1038/nbt.3404. Epub 2015 Nov. 2) describes SaCas9-KKH.
“Detect” refers to identifying the presence, absence or amount of the analyte to be detected.
By “detectable label” is meant a composition that when linked to a molecule of interest renders the latter detectable, via spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radioactive isotopes, magnetic beads, metallic beads, colloidal particles, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin, or haptens.
By “disease” is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. Examples of diseases include any pathology, such as a hearing disorder, associated with a dominant mutation.
By “effective amount” is meant the amount of an agent required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an “effective” amount.
By “fragment” is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides or amino acids.
“Hybridization” means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.
By “identity” is meant the amino acid or nucleic acid sequence identity between a sequence of interest and a reference sequence. Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e−3 and e−100 indicating a closely related sequence.
By “identity” is meant the amino acid or nucleic acid sequence identity between a sequence of interest and a reference sequence. Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e−3 and e−100 indicating a closely related sequence.
The term “indel” refers to the insertion or deletion of at least one nucleotide at a locus in a nucleic acid molecule. An indel present in the coding region of a gene may result in a frameshift mutation resulting in a premature stop codon or other signal for the expressed protein to be degraded.
The terms “isolated,” “purified,” or “biologically pure” refer to material that is free to varying degrees from components which normally accompany it as found in its native state. “Isolate” denotes a degree of separation from original source or surroundings. “Purify” denotes a degree of separation that is higher than isolation. A “purified” or “biologically pure” protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term “purified” can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
By “isolated polynucleotide” is meant a nucleic acid (e.g., a DNA) that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid molecule of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.
By an “isolated polypeptide” is meant a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention. An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.
By “marker” is meant any protein or polynucleotide having an alteration in expression level or activity that is associated with a disease or disorder.
By “mechanosensation” is meant a response to a mechanical stimulus. Touch, hearing, and balance of examples of the conversion of a mechanical stimulus into a neuronal signal. Mechanosensory input is converted into a response to a mechanical stimulus through a process termed “mechanotransduction.”
As used herein, “obtaining” as in “obtaining an agent” includes synthesizing, purchasing, or otherwise acquiring the agent.
As used herein, the terms “prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
By “promoter” is meant a polynucleotide sufficient to direct transcription of a downstream polynucleotide.
By “Espin promoter” is meant a regulatory polynucleotide sequence derived from NCBI Reference Sequence: NG_015866.1 that is sufficient to direct expression of a downstream polynucleotide in an outer or inner hair cell, vestibular hair cell, a spiral ganglion, or a vestibular ganglion. In one embodiment, the Espin promoter comprises or consists of at least about 350, 500, 1000, 2000, 3000, 4000, 5000, or more base pairs upstream of an Espin coding sequence.
By “protocadherin related 15 (PCDH15) promoter” is meant a regulatory polynucleotide sequence derived from NCBI Reference Sequence: NG_009191 that is sufficient to direct expression of a downstream polynucleotide in an outer or inner hair cell, vestibular hair cell, a spiral ganglion, or a vestibular ganglion. In one embodiment, the PCDH15 promoter comprises at least about 350, 500, 1000, 2000, 3000, 4000, 5000, or more base pairs upstream of an PCDH15 coding sequence. In some embodiments, the PCDH15 promoter comprises or consists of a nucleic acid sequence having at least about 85% sequence identity to the following nucleotide sequence:
By “protein tyrosine phosphatase, receptor type Q (PTPRQ) promoter” is meant a regulatory polynucleotide sequence derived from GeneID: 374462 that is sufficient to direct expression of a downstream polynucleotide in an outer or inner hair cell, vestibular hair cell, a spiral ganglion, or a vestibular ganglion. In one embodiment, the PTPRQ promoter comprises at least about 350, 500, 1000, 2000, 3000, 4000, 5000, or more base pairs upstream of an PTPRQ coding sequence. In some embodiments, the PTPRQ promoter comprises or consists of a nucleic acid sequence having at least about 85% sequence identity to the following nucleotide sequence:
By “lipoma HMGIC fusion partner-like 5 (LHFPL5) promoter” also termed “TMHS promoter” is meant a regulatory polynucleotide sequence derived from NCBI Reference Sequence: GeneID: 222662 that is sufficient to direct expression of a downstream polynucleotide in an outer or inner hair cell, vestibular hair cell, a spiral ganglion, or a vestibular ganglion. In one embodiment, the TMHS promoter comprises at least about 350, 500, 1000, 2000, 3000, 4000, 5000, or more base pairs upstream of an PCDH15 coding sequence. In some embodiments, the TMHS promoter comprises or consists of a nucleic acid sequence having at least about 85% sequence identity to the following nucleotide sequence:
By “synapsin promoter” also termed “Syn promoter” is meant a regulatory polynucleotide sequence comprising or consisting of a nucleic acid sequence sufficient to direct expression of a downstream polynucleotide in an outer or inner hair cell, a vestibular hair cell, a spiral ganglion, or a vestibular ganglion and having at least about 85% sequence identity to the following nucleotide sequence:
By “reduces” is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%.
By “reference” is meant a standard or control condition.
A “reference sequence” is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset of or the entirety of a specified sequence; for example, a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence. For polypeptides, the length of the reference polypeptide sequence will generally be at least about 16 amino acids, preferably at least about 20 amino acids, more preferably at least about 25 amino acids, and even more preferably about 35 amino acids, about 50 amino acids, or about 100 amino acids. For nucleic acids, the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides or any integer thereabout or therebetween.
By “specifically binds” is meant a compound or antibody that recognizes and binds a polypeptide of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample, which naturally includes a polypeptide of the invention.
Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having “substantial identity” to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. By “hybridize” is meant pair to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).
For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C., more preferably of at least about 37° C., and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred: embodiment, hybridization will occur at 30° C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 pg/m1 denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C., more preferably of at least about 42° C., and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl.
Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
By “substantially identical” is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.
Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e−3 and e−100 indicating a closely related sequence.
By “subject” is meant a mammal, including, but not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, or feline.
By “TMC1 polypeptide” is meant a polypeptide having at least about 85% or greater amino acid sequence identity to NCBI Reference Sequence: NP_619636.2 or a fragment thereof having mechanotransduction channel activity. An exemplary amino acid sequence of TMC1 is provided below:
By “TMC1 polynucleotide” is meant a polynucleotide encoding a TMC1 polypeptide. The sequence of an exemplary TMC1 polynucleotide is provided at NCBI Reference
Sequence: NM 138691.2, which is reproduced below:
As used herein, the terms “treat,” “treating,” “treatment,” and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.
Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms “a”, “an”, and “the” are understood to be singular or plural.
Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.
In this disclosure, “comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including,” and the like; “consisting essentially of” or “consists essentially” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.
Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.
As described below, the present invention features a Cas9 variant capable of selectively targeting a mutant allele without disrupting the wildtype allele, and methods of using such variants for gene editing. In particular embodiments, the invention provides for the editing of dominant mutations associated with single nucleotide substitutions. The invention further provides methods and compositions for treating a disease or condition or symptoms thereof associated with a dominant mutation.
The invention is based, at least in part, on the discovery that a Cas9 variant (SaCas9-KKH) recognizes a non-canonical PAM sequence present in a TMC1 allele that carries a dominant mutation associated with progressive deafness and generates double-strand breaks in only the TMC1 alleles that carry the dominant allele. Importantly, SaCas9-KKH does not generate double strand breaks in the wild type allele lacking the PAM sequence. In an effort to identify Cas9 variants having the desired properties, 14 Cas9/gRNA combinations were screened for specific and efficient disruption of a nucleotide substitution that causes the dominant progressive hearing loss, DFNA36. As a model for DFNA36, Beethoven mice were used. Beethoven mice harbor a point mutation in Tmc1, a gene required for hearing that encodes a pore-forming subunit of mechanosensory transduction channels in inner ear hair cells. A PAM variant of Staphylococcus aureus Cas9 (SaCas9-KKH) was identified that selectively and efficiently disrupted the mutant allele, but not the wild-type Tmc1/TMC1 allele, in Beethoven mice and in a DFNA36 human cell line. AAV-mediated SaCas9-KKH delivery prevented deafness in Beethoven mice up to one year post transduction. Analysis of current ClinVar entries revealed that ˜21% of dominant human mutations could be targeted using a similar approach.
Cas9 is a nuclease, an enzyme specialized for cutting DNA, with two active cutting sites, one for each strand of the double helix. Jinek et al. (2012) combined tracrRNA and spacer RNA into a “single-guide RNA” molecule that, mixed with Cas9, could find and cut the correct DNA targets. It has been proposed that such synthetic guide RNAs might be able to be used for gene editing (Jinek et al., Science. 2012 Aug 17;337(6096):816-21).
Cas9 proteins are known in the art, such as Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), and Francisella novicida Cas9 (FnCas9). In general, Cas9 proteins preferentially interrogate and act upon DNA sequences containing a protospacer adjacent motif (PAM) sequence, and different Cas9 proteins have affinities for different PAMs. The canonical PAM sequence is 5′-NGG-3′, which is recognized by multiple Cas9 proteins, where N can be any nucleotide. For example, SpCas9 and FnCas9 recognize the canonical NGG PAM sequence. Streptococcus thermophilus Cas9 recognizes a 5′-NGA-3′ PAM sequence, and SaCas9 recognizes a 5′-NNGRR(N)-3′ PAM sequence. Additionally, Cas9 proteins can be modified to recognize PAM sequences that are distinct from the PAM sequences recognized by the unmodified Cas9 protein. For example, SaCas9-KKH recognizes a 5′-RRT-3′, where R denotes an adenosine or guanine nucleotide. The Cas9 nuclease used in the presently described methods will recognize a PAM sequence that is present only in the allele to be inactivated (i.e., the allele carrying a deleterious mutation). Thus, the nuclease activity of the Cas9 will act only upon the allele to be inactivated.
gRNA
A Cas9 protein, having an affinity for a particular PAM sequence can be directed to a particular locus in a genome by a guide RNA. In some embodiments, the guide RNA is a single guide RNA, which comprises a tracrRNA and a spacer RNA. The short spacer RNA, comprising a nucleic acid sequence that specifically binds to the target genomic locus, directs the Cas9 protein to the target, which is then cleaved by the Cas9 protein's nuclease activity. In some embodiments, synthetic gRNAs are about 18, 19, 20, 21, 22, 25, 30, 40, 50, 60, 70, 80, 90, 100, over 100 bp and comprise a nucleic acid sequence complementary to protospacer nucleotides near the PAM sequence
In some embodiments, the guide RNA will bind a nucleic acid sequence comprising a PAM sequence that is present in an allele carrying a mutation, but is not present in an allele that does not carry the mutation. In some embodiments, the guide RNA binds a nucleic acid sequence that is in close proximity to a PAM sequence that is present only in an allele to be inactivated (i.e., an allele carrying a deleterious mutation). The PAM sequence may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides upstream or downstream of the sequence to which with guide RNA binds.
The following US patents and patent publications are incorporated herein by reference in their entireties: U.S. Pat. No. 8,697,359, 20140170753, 20140179006, 20140179770, 20140186843, 20140186958, 20140189896, 20140227787, 20140242664, 20140248702, 20140256046, 20140273230, 20140273233, 20140273234, 20140295556, 20140295557, 20140310830, 20140356956, 20140356959, 20140357530, 20150020223, 20150031132, 20150031133, 20150031134, 20150044191, 20150044192, 20150045546, 20150050699, 20150056705, 20150071898, 20150071899, 20150071903, 20150079681, 20150159172, 20150165054, 20150166980, and 20150184139.
Therapeutic success in these approaches relies significantly on the safe and efficient delivery of exogenous gene constructs to the relevant therapeutic cell targets in the organ of Corti in the cochlea. The organ of Corti includes two classes of sensory hair cells: inner hair cells, which convert mechanical information carried by sound into electrical signals transmitted to neuronal structures and outer hair cells which serve to amplify and tune the cochlear response, a process required for complex hearing function.
Methods of delivering nucleic acids to cells generally are known in the art, and methods of delivering viruses (which also can be referred to as viral particles) containing a transgene to inner ear cells in vivo are described herein. As described herein, about 108 to about 1012 viral particles can be administered to a subject, and the virus can be suspended within a suitable volume (e.g., 10 μL, 50 μL, 100 μL, 500 μL, or 1000 μL) of, for example, artificial perilymph solution.
A virus containing a promoter (e.g., an Espin promoter, a PCDH15 promoter, a PTPRQ promoter, a Myo6 promoter, a KCNQ4 promoter, a Myo7a promoter, a synapsin promoter, a GFAP promoter, a CMV promoter, a CAG promoter, a CBH promoter, a CBA promoter, a U6 promoter, and a TMHS (LHFPL5) promoter) and a polynucleotide encoding a Cas9 protein (e.g., SaCas9-KKH), and in some embodiments, a guide RNA, as described herein can be delivered to inner ear cells (e.g., cells in the cochlea) using any number of means. For example, a therapeutically effective amount of a composition including virus particles containing one or more different types of transgenes as described herein can be injected through the round window or the oval window, or the utricle, typically in a relatively simple (e.g., outpatient) procedure. In some embodiments, a composition comprising a therapeutically effective number of virus particles containing a transgene (e.g., a polynucleotide encoding a transgene and a gRNA), or containing one or more sets of different virus particles, wherein each particle in a set can contain the same type of transgene, but wherein each set of particles contains a different type of transgene than in the other sets, as described herein can be delivered to the appropriate position within the ear during surgery (e.g., a cochleostomy or a canalostomy).
In addition, delivery vehicles (e.g., polymers) are available that facilitate the transfer of agents across the tympanic membrane and/or through the round window or utricle, and any such delivery vehicles can be used to deliver the viruses described herein. See, for example, Arnold et al., 2005, Audiol. Neurootol., 10:53-63.
The compositions and methods described herein enable the highly efficient delivery of nucleic acids to inner ear cells, e.g., cochlear cells. For example, a polynucleotide encoding a Cas9 protein, variant (e.g., SaCas9-KKH), or a fragment thereof, can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from a promoter specific for a target cell type of interest. Other viral vectors that can be used include, for example, a vaccinia virus, a bovine papilloma virus, or a herpes virus, such as Epstein-Barr Virus. Retroviral vectors are particularly well developed and have been used in clinical settings. In some embodiments, a viral vector is used to administer a Cas9 polynucleotide systemically. In some embodiments, a viral vector is used to administer a Cas9 polynucleotide to a particular region of the body.
For example, the compositions and methods described herein enable the delivery to, and expression of, a KKH-Cas9 polynucleotide in at least 65% (e.g., at least 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%) of inner and/or outer hair cells or delivery to, and expression in, at least 80% (e.g., at least 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99) of outer hair cells.
As demonstrated herein, expression of a KKH-Cas9 polynucleotide delivered using an AAV-vector can result in improved structure and function of inner and outer hair cells such that hearing is restored for an extended period of time (e.g., months, years, decades, a life time).
As described herein, an adeno-associated virus (AAV) are particularly efficient at delivering nucleic acids (e.g., polynucleotides encoding a Cas9 polypeptide and, in some embodiments, a gRNA) to inner ear cells. The Anc80 vector is an example of an Inner Ear Hair Cell Targeting AAV that advantageously transduced greater than about 60%, 70%, 80%, 90%, 95%, or even 100% of inner or outer hair cells. One particular ancestral capsid protein that falls within the class of Anc80 ancestral capsid protein is Anc80-0065 (SEQ ID NO:2) described in International Application No. PCT/US2018/017104, which is incorporated herein by reference in its entirety. However, WO 2015/054653, which is also incorporated herein by reference in its entirety, describes a number of additional ancestral capsid proteins that fall within the class of Anc80 ancestral capsid proteins.
In particular embodiments, the adeno-associated virus (AAV) contains an ancestral AAV capsid protein that has a natural or engineered tropism for hair cells. In some embodiments, the virus is an Inner Ear Hair Cell Targeting AAV, which delivers a transgene (e.g., a polynucleotide encoding a Cas9 polypeptide and, in some embodiments, a gRNA) to the inner ear in a subject. In some embodiments, the virus is an AAV that comprises purified capsid polypeptides. In some embodiments, the virus is artificial. In some embodiments, the virus is an AAV that has lower seroprevalence than AAV2. In some embodiments, the virus is an exome-associated AAV. In some embodiments, the virus is an exome-associated AAV1. In some embodiments, the virus comprises a capsid protein with at least 95% amino acid sequence identity or homology to Anc80 capsid proteins.
Expression of a Cas9 polynucleotide may be directed by a heterologous promoter (e.g., CMV promoter, Espin promoter, a PCDH15 promoter, a PTPRQ promoter and a TMHS (LHFPL5) promoter). As used herein, a “heterologous promoter” refers to a promoter that does not naturally direct expression of that sequence (i.e., is not found with that sequence in nature).
Methods for packaging a transgene into a virus that contains an Anc80 capsid protein are known in the art, and utilize conventional molecular biology and recombinant nucleic acid techniques. In one embodiment, a construct that includes a nucleic acid sequence encoding an Anc80 capsid protein and a construct carrying the polynucleotide encoding a Cas9 (and in some cases a Cas9 and a gRNA) flanked by suitable Inverted Terminal Repeats (ITRs) are provided, which allows for the transgene to be packaged within the Anc80 capsid protein.
The Cas9 polynucleotide (and in some embodiments, a Cas9 and a gRNA) can be packaged into an AAV containing an Anc80 capsid protein using, for example, a packaging host cell. The components of a virus particle (e.g., rep sequences, cap sequences, inverted terminal repeat (ITR) sequences) can be introduced, transiently or stably, into a packaging host cell using one or more constructs as described herein.
In some embodiments, a AAVs containing a AAV9-php.b vector is used to efficiently target inner ear cells. AAV9-php.b is described in International Application No. PCT/US2019/020794, the contents of which are incorporated herein by reference in their entirety. AAV-PHP.B encodes the 7-mer sequence TLAVPFK and efficiently delivers transgenes to the cochlea, where it showed remarkably specific and robust expression in the inner and outer hair cells. An AAV-PHP.B vector can comprise, but is not limited to, any of the promoters described herein.
Non-viral approaches can also be employed for the introduction of therapeutic to a cell of a patient requiring inactivation of an allele carrying a mutation associated with a disease or condition or symptom thereof. For example, a nucleic acid molecule can be introduced into a cell by administering the nucleic acid in the presence of lipofection.
Gene transfer can also be achieved using non-viral means involving transfection in vitro. Such methods include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes can also be potentially beneficial for delivery of DNA into a cell. Transplantation of normal genes into the affected tissues of a patient can also be accomplished by transferring a normal nucleic acid into a cultivatable cell type ex vivo (e.g., an autologous or heterologous primary cell or progeny thereof), after which the cell (or its descendants) are injected into a targeted tissue.
cDNA expression for use in polynucleotide therapy methods can be directed from any suitable promoter (e.g., the human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoters), and regulated by any appropriate mammalian regulatory element. For example, if desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of a nucleic acid. The enhancers used can include, without limitation, those that are characterized as tissue- or cell-specific enhancers. Alternatively, if a genomic clone is used as a therapeutic construct, regulation can be mediated by the cognate regulatory sequences or, if desired, by regulatory sequences derived from a heterologous source, including any of the promoters or regulatory elements described above.
Another therapeutic approach included in the invention involves administration of a recombinant therapeutic, such as a recombinant a Cas9 protein, variant, or fragment thereof, either directly to the site of a potential or actual disease-affected tissue or systemically (for example, by any conventional recombinant protein administration technique). The dosage of the administered protein depends on a number of factors, including the size and health of the individual patient. For any particular subject, the specific dosage regimes should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions.
Compositions and methods are provided herein for altering a cell to inactivate a mutant allele associated with a disease or condition using a CRISPR-Cas system. In some embodiments, a Cas9 (e.g., SaCas9-KKH), in combination with a single guide RNA is used to target an allele comprising a mutation. To selectively inactivate the allele carrying the mutation, while not inactivating the wild type or other non-deleterious forms of the allele, a Cas protein is used that recognizes a PAM sequence present in the mutant allele but not in the wild type (or other non-mutant form) allele. Upon target recognition, the Cas protein (e.g., Cas9) induces at least one double strand break in the target mutant allele. Repair of the double-strand break by non-homologous end joining (NHEJ) increases the probability of an indel at the double-strand break site. In some embodiments, an indel at the double-strand break site generates a premature stop codon in the mutant allele that inactivates the mutant allele. In some embodiments, the indel can be in a regulatory region of the allele that results in inhibited expression of the allele. In some embodiments, the indel generates a protein product that is lacks a deleterious nature (i.e., the edited allele does not interfere with the expression and function of the wildtype (or non-mutant form) allele.
The present invention provides methods of treating disease and/or disorders or symptoms thereof which comprise administering a therapeutically effective amount of a pharmaceutical composition comprising a Cas9 nuclease and a guide RNA that specifically binds a nucleic acid sequence in the genome comprising a mutation and a PAM sequence recognized by the Cas9 to a subject (e.g., a mammal such as a human), wherein the PAM sequence is not present in the allele that does not carry the mutation. Thus, one embodiment is a method of treating a subject suffering from or susceptible to a disease or disorder or symptom thereof associated with a mutation. The method includes administering to the mammal a therapeutic amount of an amount of a compound herein sufficient to treat the disease or disorder or symptom. In some embodiments, the mutation is a dominant mutation.
The therapeutic methods of the invention (which include prophylactic treatment), in general, comprise administration of a therapeutically effective amount of the compounds herein, such as a compound of the formulae herein to a subject (e.g., animal, human) in need thereof, including a mammal, particularly a human. Such treatment will be suitably administered to subjects, particularly humans, suffering from, having, susceptible to, or at risk for a disease, disorder, or symptom thereof. Determination of those subjects “at risk” can be made by any objective or subjective determination by a diagnostic test or opinion of a subject or health care provider (e.g., genetic test, enzyme or protein marker, Marker (as defined herein), family history, and the like).
Compositions are contemplated herein for the treatment of diseases or conditions associated with a mutation. For therapeutic purposes, compositions comprising a Cas9 polypeptide, or a polynucleotide encoding a Cas9 polypeptide and a guide RNA that specifically binds to a nucleic acid sequence in a genome that comprises a mutation that causes or contributes to a disease or condition (e.g., dominant progressive hearing loss) as described herein may be administered directly to a region of the body (e.g., cochlea) that is affected by the disease or condition. In some embodiments, the compositions are formulated in a pharmaceutically-acceptable buffer such as physiological saline. Non-limiting methods of administration include injecting into the cochlear duct or the perilymph-filled spaces surrounding the cochlear duct (e.g., scala tympani and scala vestibuli). Injecting into the cochlear duct, which is filled with high potassium endolymph fluid, could provide direct access to hair cells. However, alterations to this delicate fluid environment may disrupt the endocochlear potential, heightening the risk for injection-related toxicity. The perilymph-filled spaces surrounding the cochlear duct, scala tympani and scala vestibuli, can be accessed from the middle ear, either through the oval or round window membrane. The round window membrane, which is the only non-bony opening into the inner ear, is relatively easily accessible in many animal models and administration of viral vector using this route is well tolerated. In humans, cochlear implant placement routinely relies on surgical electrode insertion through the round window membrane.
Treatment of human patients or non-human animals are carried out using a therapeutically effective amount of a combination therapeutic in a physiologically-acceptable carrier. The phrase “pharmaceutically acceptable” refers to those compounds of the invention, compositions containing such compounds, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The phrase “pharmaceutically-acceptable excipient” includes pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, carrier, solvent or encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.
The compositions may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred per cent, this amount will range from about 1 per cent to about ninety-nine percent of active ingredient, preferably from about 5 per cent to about 70 per cent, most preferably from about 10 per cent to about 30 per cent.
Additional suitable carriers and their formulations are described, for example, in the most recent edition of Remington's Pharmaceutical Sciences by E. W. Martin. The amount of the therapeutic agent to be administered varies depending upon the manner and mode of administration, the age and disease status (e.g., the extent of hearing loss present prior to treatment).
Compositions are administered at a dosage that controls the clinical or physiological symptoms of the disease or condition, as may in some cases be determined by a diagnostic method known to one skilled in the art.
Therapeutic compounds and therapeutic combinations are administered in an effective amount. For example, about 108 to about 1012 viral particles can be administered to a subject, and the virus can be suspended within a suitable volume (e.g., 10 μL, 50 μL, 100 μL, 500 μL, or 1000 μL) of, for example, artificial perilymph solution.
Compositions and methods for treating dominant progressive hearing loss (e.g., Deafness, Autosomal Dominant 36, or dominant progressive deafness 36, (DFNA36)) are provided.
DFNA36 is associated with dominant mutations (acquired or inherited) in the TMC1 gene of affected individuals. To inactivate the dominant mutation in a heterozygous subject, a SaCas9-KKH protein along with a guide RNA that recognizes the genomic locus containing the TMC1 dominant mutant, is administered to a subject as described above. The SaCas9=KKH protein that recognizes the RRT PAM sequence present in the TMC1 allele carrying the dominant mutation. Mutations within the TMC1 gene can cause Deafness, Autosomal Dominant 36 (DFNA36), a dominant progressive form of deafness. The SaCas9-KKH protein binds to a cleaves the TMC1 allele carrying the dominant mutation (but not the wild type allele), which promotes indel formation at the break site during non-homologous end joining. Resulting premature stop codons generate truncated, non-functional TMC1 proteins that are not dominant to the expressed wild type protein.
In some embodiments, the SaCas9-KKH nuclease is administered to a subject by directly injecting a vector (e.g., AAV or lentiviral vector) encoding the SaCas9-KKH protein and a guide RNA into the cochlea of the subject. In some embodiments, the vector only encodes the SaCas9-KKH protein and the guide RNA is administered in the injection as RNA For therapeutic purposes, compositions comprising a Cas9 polypeptide, or a polynucleotide encoding a Cas9 polypeptide and a guide RNA that specifically binds to a nucleic acid sequence in a genome that comprises a mutation that causes or contributes to dominant progressive hearing loss as described herein may be administered directly to a region of the body (e.g., cochlea) that is affected by the disease or condition. Non-limiting methods of administration include injecting into the cochlear duct or the perilymph-filled spaces surrounding the cochlear duct (e.g., scala tympani and scala vestibuli). Injecting into the cochlear duct, which is filled with high potassium endolymph fluid, could provide direct access to hair cells. However, alterations to this delicate fluid environment may disrupt the endocochlear potential, heightening the risk for injection-related toxicity. The perilymph-filled spaces surrounding the cochlear duct, scala tympani and scala vestibuli, can be accessed from the middle ear, either through the oval or round window membrane. The round window membrane, which is the only non-bony opening into the inner ear, is relatively easily accessible in many animal models and administration of viral vector using this route is well tolerated. In humans, cochlear implant placement routinely relies on surgical electrode insertion through the round window membrane.
In some embodiments, inactivating the mutant allele that causes DFNA36 while expressing the wildtype allele can restore auditory function in a subject. In some embodiments, the auditory function restored to a subject is about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or even about 100%.
In order to develop allele specific genome editing strategies for dominant hearing loss, the Beethoven (Bth) mouse was used. The Bth mouse provides an excellent model for DFNA36 hearing loss in humans. The Bth mutation results in an amino acid substition (p.M412K, c.T1253A) in Tmc1. The mutation causes hair cell degeneration and progressive hearing loss in mice. In humans, the p.M418K substitution is identical to the Bth mutation in the orthologous position and causes DFNA36, dominant progressive hearing loss.
To selectively disrupt the Bth allele in fibroblasts from Tmc1Bth/WT mice (Tmc1WT/WT cells were used as controls), various Cas9 and gRNA combinations were screened in vitro. Plasmids encoding SpCas9-2A-GFP, along with the different gRNAs, were transfected into fibroblasts in duplicate. Four days after transfection, GFP-positive cells were sorted by fluorescence assisted cell sorting (FACS). SpCas9 in combination with 12 different gRNAs were tested, including full-length and truncated forms targeting either Tmc1Bth or Tmc1WT (
Targeted deep sequencing was performed on control (SpCas9-2A-GFP only) cells, WT gRNA and the 3 most specific gRNAs (1.1, 2.1 and 2.4) in Tmc1Bth/WT (top) Tmc1WT/WT (bottom) cells. Indels were quantified after segregating Tmc1Bth and Tmc1 WT reads by CRISPResso (only insertions and deletions were quantified, substitutions were ignored). None of the gRNAs are specific to the Tmc1Bth allele, and mediate efficient indel formation on the Tmc1WT allele as well. Sequencing was performed one time from pooled cells, transfected in triplicates. Specificity was defined as the indel percentage towards the targeted allele among total indels. The gRNA with the highest selectivity towards the Tmc1Bth allele was gRNA 2.4 (
To improve allele selectivity, high-fidelity SpCas9 enzymes were also evaluated; however, none mediated selective targeting of the Bth allele (
It was hypothesized that a Cas9 nuclease with a PAM site selective for the mutant sequence might show specific targeting of the Tmc1Bth allele. The Bth mutation is a T to A change; thus, the GGAAGT sequence present in Tmc1Bth, but not in Tmc1Bth (GGATGT), may allow the PAM site of the SaCas9-KKH variant (NNNRRT) to distinguish the Tmc1Bth from the Tmc1WT allele. Full-length and truncated gRNAs were designed (
Allele-specific indel formation in Tmc1Bth/WT cells was analyzed to avoid potential differences in transfection efficiency between Tmc1Bth/WT and Tmc1WT/WT fibroblasts. Tmc1Bth and Tmc1 WTsequencing reads were segregated using a Python script and indel percentages were analyzed for each allele. (
To assess the capability of SaCas9-KKH and gRNA 4.2 to introduce indels into the TMC1 gene, the Cas9 protein and guide RNA were packaged into Anc80L65 capsids (
SaCas9-KKH-mediated disruption of the Bth allele was evaluated using hair cell mechanosensory transduction current. Although the Bth mutation eventually causes cell death, the mutation does not cause a loss of mechanosensitivity. Single-cell electrophysiology was performed on hair cells from either Tmc1WT/WT or Tmc1Bth/Δ mouse pups on a Tmc2Δ/Δ background because Tmc2 contributes to mechanosensory currents and is expressed transiently at neonatal stages. After injection of AAV-SaCas9-KKH-gRNA-4.2 at P1, cochleas were dissected at P5-P7 and cultured 8-10 days, or the equivalent of P14-P16. Both inner and outer hair cells from injected Tmc1WT/WT mice showed normal current amplitudes (
Auditory brainstem responses (ABR) and distortion product otoacoustic emissions (DPOAE) were evaluated in Bth mice using the allele-specific SaCas9-KKH nuclease (
Since the Bth mutation causes progressive hearing loss, the time course of hearing sensitivity in Tmc1Bth/WT and Tmc1WT/WT animals was measured at 4, 8, 12 and 24 weeks after injection at frequencies from 5.6 to 32 kHz (
ABR peak 1 (P1) amplitudes were in the normal range for most of the injected Bth mice at 8 weeks, in contrast to non-injected animals, which showed small P1 amplitudes only at high sound intensities (
Whether AAV-SaCas9-KKH-gRNA-4.2 injection disrupts hearing in wild-type animals was also investigated. ABRs were performed and no ABR or DPOAE threshold shifts were observed, even 24 weeks post-injection (
In one cohort of four Bth mice, ABR thresholds were measured at 40 weeks post-injection. Thresholds (8 kHz) between 4 and 40 weeks were tracked and data from two mice with failed injections was excluded, based on histological examination (below). Thresholds were stable over time and only slightly elevated relative to WT mice (
Next, hair cell survival was evaluated in injected and non-injected Tmc1Bth/WT and Tmc1WT/WT animals. Following ABR and DPOAE evaluations, mice were sacrificed at 24 weeks of age. Surviving hair cells were identified with an antibody for MYO7A and phalloidin staining for actin. Inner and outer hair cells were present in uninjected Tmc1WT/WT mice and those injected with AAV-SaCas9-KKH-gRNA-4.2(
Hair bundle morphology was evaluated with scanning electron microscopy, in Bth and WT hair cells. In uninjected Tmc1WT/WT animals at 24 weeks of age, inner and outer hair cells showed classical staircase organization of hair bundles (
To validate the strategy for targeting the human p.M418K mutation, a haploid human cell line was generated containing the p.M418K mutation in TMC1 (c.T1253A). Tmc1DFNA36 and TMC1WT cells were transfected with SaCas9-KKH and 3 different gRNAs targeting the mutant allele (
In addition to the TMC1 p.M418K mutation (DFNA36), 15 other dominant mutations in deafness genes that are targetable with SaCas9-KKH were identified (
The results reported herein were generated using the following methods and materials.
Table 2 provides information on the specifics of the CRISPR/Cas9 plasmids used in the above examples. Table 3 shows the sequences of the gRNAs and the Cas9 plasmids used together with the gRNA vectors. 11 different gRNAs were tested with SpCas9 (
GTGGGACAGAACTTCCCCAGGAGG
GTGGTAATGTCCCTCCTGGGGAAG
GACATGGTAATGTCCCTCCTGGGGAAGT
GCATGGTAATGTCCCTCCTGGGGAAGT
GACATGGTTATGTCCCTCCTAGGGAAGT
GCATGGTTATGTCCCTCCTAGGGAAGT
For gRNAs 1.1-1.4 and 2.1-2.4, a PAM site was adjacent to the mutation. gRNA 1.1 is identical to the Tmc1-mut3 gRNA in the study of Gao et al., Nature, 553: 217-21 (2018). In the case of gRNAs 3.1-3.3, an AAG PAM site created by the mutation was used in order to specifically recognize the mutant allele, as it has been shown that SpCas9 can also cleave at
NAG PAM sites with somewhat lower efficiency. Several truncated gRNAs were also used because previous studies reported enhanced specificity (Fu, Y. et al., Nat. Biotechnol. 32: 279-84 (2014)). One gRNA specific for the Tmc1WT allele was synthesized as a control. gRNA 1.1 was used (
Mouse primary dermal fibroblasts were established from neonatal C57BL/6 Tmc1WT/WT and Tmc1Bth/WT animals. Briefly, after euthanasia, a small amount of skin was dissected into small pieces and washed with PBS. Next, cells were treated at 37° C. with 1 mg/ml collagenase I (Worthington) for 30 minutes followed by 0.05% trypsin-EDTA treatment for 15 minutes. Cells were cultured in 10% fetal bovine serum containing DMEM (Gibco) supplemented with lx penicillin/streptomycin (Gibco). Cell lines were validated by Sanger sequencing (see below). Mycoplasma screening (MycoAlert, Lonza, Basel) was performed regularly and before transfection experiments. For transfection of fibroblasts, Nucleofection (Lonza) (CZ-167 program, P2 Primary Cell 4D-Nucleofector X Kit) was used. Every transfection reaction was performed in duplicate and experiments were performed on at least two separate occasions. Four days after transfection of pX458 plasmids, cells were sorted based on GFP fluorescence using a FACS Aria Cell Sorter (BD), and genomic DNA was isolated and analyzed by Sanger sequencing and targeted deep sequencing (see below). In the case of high fidelity SpCas9s (eSpCas9(1.1), HypaCas9, SpCas9-HF1) and SaCas9-KKH transfections, cells were not sorted, but genomic DNA was isolated from all cells 4 days after transfection for deep-sequencing analysis.
Genomic DNA was isolated from fibroblasts 4 days after transfection using a Qiagen Blood and Tissue Kit (Qiagen). In the case of cochlear tissue, organs were harvested at different ages (
Sanger sequencing was performed in the MGH DNA Core. Sequence traces were analyzed by deconvolution (TIDE, Tracking Indels by Decomposition, Desktop genetics, UK). Aberrant sequences were quantified downstream of the CRISPR cut site. Analysis was performed on forward versus reverse traces and efficiency was averaged.
CRISPR-induced indels were analyzed by CRISPResso using two separate methods (
To analyze CRISPR action on both Tmc1Bth and Tmc1WT alleles, the fastq files were subjected to CRISPResso analysis without segregating them to mutant and WT reads (
Allele-Specific CRISPResso Indel Analysis
To analyze CRISPR action on Tmc1Bth and Tmc1WT alleles separately, fastq files were first split into read 1 and read 2, and then merged using flash v1.2.11, as described above. The reads from heterozygous samples were segregated based on the presence of wild-type sequence (“TGGGACAGAACA” and its reverse complement “TGTTCTGTCCCA”) and mutant sequence (“TGGGACAGAACT” and its reverse complement “AGTTCTGTCCCA”; mutation site is underlined) using a custom Python script (version 3.4.2) used previously (György, B. et al., Mol. Ther.-Nucleic Acids 11: 429-40 (2018), the contents of which are incorporated herein by reference in their entirety). Reads were segregated based on a sequence downstream of the projected CRISPR cut site so that indels have minor influence on the segregation (
For mRNA analysis, the reads were first merged with flash as described above. CRISPResso analysis was performed similarly to global indel analysis (see above). To quantify intact, non-edited reads, the following sequences were used: 5′-CATCCCCAGGAGGG-3′ and 5′-CCCTCCTGGGGATG-3′ for WT reads, and 5′-CTTCCCCAGGAGGG-3′ and 5′-CCCTCCTGGGGAAG-3′ for mutant reads.
To detect genome-wide Cas9 nuclease activity, a GUIDE-Seq assay was performed in fibroblasts. Briefly, 2 μg of Cas9-2A-GFP-U6-gRNA-2.4 or 2 μg of pAAV-CMV-SaCas9-KKH-U6-gRNA-4.2 along with 50 pmol annealed GUIDE-Seq oligo (forward:/5Phos/G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T, reverse:/5Phos/A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C, stars indicate thioate bonds) were transfected into Tmc1Bth/WT fibroblasts using electroporation (see above). Four days after transfection, genomic DNA was isolated with a Qiagen DNA Blood and Tissue kit, and a library was constructed as described previously (Tsai, S. Q. et al., Nat. Biotechnol. 33: 187-98 (2015), the contents of which are incorporated herein by reference in their entirety). Sequencing was performed on an Illumina MiSeq machine. As a control, GUIDE-Seq oligo was transfected without CRISPR/Cas9 plasmids. GUIDE-Seq data were analyzed with the guideseq pipeline v1.1b4 (github.com/aryeelab/guideseq) using mm10 as the reference mouse genome.
AAV vectors were produced by the Boston Children's Hospital Viral Core (Boston, MA, USA). Plasmid containing SaCas9-KKH and gRNA 4.2 was sequenced before packaging (MGH DNA Core, complete plasmid sequencing) into AAV2/Anc8028. Vector titer was 4.8×1014 gc/ml as determined by qPCR specific for the inverted terminal repeat of the virus.
Inner ears of Tmc1Bth/WT or Tmc1WT//WT mouse pups were injected at P1 with 1 μl of Anc80-AAV-CMV-SaCas9-KKH-U6-gRNA-4.2 virus at a rate of 60 nl/min. Pups were anesthetized using hypothermia exposure in ice water for 2-3 min. Upon anesthesia, a post-auricular incision was made to expose the otic bulla and visualize the cochlea. Injections were made manually with a glass micropipette. After injection, a suture was used to close the skin cut. Then, the injected mice were placed on a 42° C. heating pad for recovery. Pups were returned to the mother after they fully recovered within ˜10 min. Standard post-operative care was applied after surgery. Sample sizes for in vivo studies were determined on a continuing basis to optimize the sample size and decrease the variance. At P5 to P7, organs of Corti were excised from injected ears. Organ of Corti tissues were incubated at 37° C., 5% CO2 for 8-10 days, the tectorial membrane was removed immediately before electrophysiology recording.
Mechanotransduction currents were recorded from cochlear IHCs and OHCs at P14-16. Organ of Corti tissues were bathed in external solution containing: 140 mM NaCl, 5.8 mM KCl, 0.7 mM NaH2PO4, 10 mM HEPES, 1.3 mM CaCl2, 0.9 mM MgCl2, 5.6 mM glucose, and vitamins and essential amino acids (Thermo Fisher Scientific, Waltham, Mass.), adjusted to pH 7.4 with NaOH, ˜310 mmol/kg. Recording electrodes were pulled from R6 capillary glass (King Precision Glass). The intracellular solution contained: 140 mM CsCl, 5 mM EGTA, 5 mM HEPES, 2.5 mM Na2-ATP, 0.1 mM CaCl2, and 3.5 mM MgCl2, and was adjusted to pH 7.4 with CsOH, ˜285 mmol/kg. Mechanotransduction currents were recorded under whole-cell voltage-clamp configuration using an Axopatch 200B (Molecular Devices) amplifier. Cells were held at −80 mV for all electrophysiology recordings. Data were low-pass filtered at 5 kHz (Bessel filter), then sampled at 20 kHz with a 16-bit acquisition board (Digidata 1440A). Data were corrected for a −4 mV liquid junction potential in standard extracellular solutions. Cochlea IHC and OHC bundles were deflected using stiff glass probes mounted on a PICMA chip piezo actuator (Physik Instruments) driven by an LPZT amplifier (Physik Instruments) and filtered with an 8-pole Bessel filter at 40 kHz to eliminate residual pipette resonance. Fire-polished stimulus pipettes with 3-5 μm tip diameter were designed to fit into the concave aspect of hair cell bundle as previously described (Stauffer and Holt, 2007). Hair bundle deflections were monitored using a C2400 CCD camera (Hamamatsu, Japan).
ABR and DPOAE measurements were recorded using the EPL Acoustic system (Massachusetts Eye and Ear, Boston). Stimuli were generated with 24-bit digital I-O cards (National Instruments PXI-4461) in a PXI-1042Q chassis, amplified by a SA-1 speaker driver (Tucker-Davis Technologies, Inc.), and delivered from two electrostatic drivers (CUI CDMG15008-03A) in a custom acoustic system. An electret microphone (Knowles FG-23329-P07) at the end of a small probe tube was used to monitor ear-canal sound pressure. ABRs and DPOAEs were recorded from mice during the same session. Mice were anesthetized with intraperitoneal injection of xylazine (5-10 mg/kg) and ketamine (60-100 mg/kg), and the base of the pinna was trimmed away to expose the ear canal. Three subcutaneous needle electrodes were inserted into the skin, including a) dorsally between the two ears (reference electrode); b) behind the left pinna (recording electrode); and c) dorsally at the rump of the animal (ground electrode). Additional aliquots of ketamine (60-100 mg/kg i.p.) were given throughout the session to maintain anesthesia if needed. DPOAEs were recorded first. F1 and f2 primary tones (f2/f1=1.2) were presented with f2 varied between 5.6 and 32.0 kHz in half-octave steps and L1−L2=10 dB SPL. At each f2, L2 was varied between 10 and 80 dB in 10 dB increments. DPOAE threshold was defined from the average spectra as the L2-level eliciting a DPOAE of magnitude 5 dB above the noise floor. The mean noise floor level was under 0 dB across all frequencies. ABR recordings were then recorded, with stimuli of broadband “click” tones as well as the pure tones between 5.6 and 32.0 kHz in half-octave steps, all presented as 5 ms tone pips. The responses were amplified (10,000 times), filtered (0.1-3 kHz), and averaged with an analog-to-digital board in a PC based data-acquisition system (EPL, Cochlear function test suite, MEE, Boston). Across various trials, the sound level was raised in 5 to 10 dB steps from 0 to 110 dB sound pressure level (decibels SPL). At each level, 512 responses were averaged (with stimulus polarity alternated) after “artifact rejection”. Threshold was determined by visual inspection of the appearance of Peak 1 relative to background noise. Data were analyzed and plotted using Origin-2015 (OriginLab Corporation, MA). Thresholds averages±standard deviations are presented unless otherwise stated. The majority of these experiments were not performed under blind conditions.
The temporal bones of 24-week-old adult mice were harvested, cleaned, and placed in 4% PFA for 1 hour, followed by decalcification for 24 to 36 h with 120 mM EDTA (pH=7.4). The sensory epithelium was then dissected and remained in PBS until staining. Tissues were permeabilized with 0.01% Triton X-100 for one hour, blocked with 2.5% NDS and 2.5% BSA in 0.01% Triton X-100 for one hour, and then incubated with anti-MYO7A primary antibody (Proteus Biosciences) overnight (1:500 dilution). Tissues were then washed and counterstained with phalloidin for 2-3 hours. Images were acquired on a Zeiss LSM 800 laser confocal microscope. Full cochlear maps were reconstructed in Adobe Photoshop and tonotopically mapped using an ImageJ plugin.
The temporal bones of 24-week-old adult mice were harvested, and cleaned temporal bones were placed in 2.5% glutaraldehyde in 0.1 M cacodylate buffer (EMS) supplemented with 2 mM CaCl2 for 45 minutes. Whole-mount tissues were dissected in distilled water and then dehydrated over the course of 4 hours to pure ethanol. Tissues were critical-point dried (Autosamdri-815, series A, Tousimis) and mounted on carbon tape attached to SEM specimen stubs. The mounted tissues were coated with 4 nm of platinum (Leica EM ACE600) and then imaged at 5 kV with a scanning electron microscope (Hitachi S-4700 FESEM).
The ClinVar database from Apr. 25, 2019 was downloaded from ftp.ncbi.nlm.nih.gov/pub/clinvar/vcf_GRCh38/archive_2.0/2019/clinvar 20190325.vcf.gz. The database was filtered for ‘dominant’ diseases, resulting in 17,783 entries. The possibility of generating a PAM site from single nucleotide mutations was analyzed for the SaCas9 (GRRT) and SaCas9-KKH (RRT) recognition motifs. The GRCh38 human reference genome was queried for 7-nt or 5-nt sequences surrounding the site of interest, i.e., 3 (GRRT) or 2 (RRT) nucleotides on either side of the mutation. These sequences were analyzed with a sliding window of length 4 (GRRT) or 3 (RRT) nucleotides. Entries that had a putative PAM site in both the ‘variant’ nucleotide string and the ‘reference’ (i.e. wild-type) string were excluded from further analysis. The same procedure was used for the reverse complement strand. The resulting databases (all dominant entries, dominant entries with PAM site formation for SaCas9, and dominant entries with PAM site formation for SaCas9-KKH recognition) are uploaded as Supplementary Tables 3-5. All ClinVar entries were analyzed without filtering from dominant diseases. This analysis was done, as several dominant variants are not annotated as ‘dominant’ in the ClinVar database.
A human cell line carrying the equivalent of the Beethoven mutation in the human TMC1 gene (ATG to AAG mutation, encoding the M418K amino acid substitution) was engineered from the HAP1 parental cell line derived from the KBM-7 haploid cells (Horizon Genomics GmbH, Vienna, Austria)29. Briefly, a T to A point mutation was introduced in the exon 16 of the TMC1 gene (ENSG00000165091; genomic location: chr9: 72,791,914) to generate the TCCCTCCTAGGGAAGTTC sequence. For insertion of the mutation by gene editing, the HAP1 cell line was modified with the CRISPR/Cas9 nuclease using two guide RNA sequences (5′-CATCGCTTTGAAATGGCTAC-3′ and 5′-AACCATGTTCATCTACAAGG-3′) and a 1 kb donor template encompassing TMC1 exon 6 and which contained the T to A Beethoven mutation. The genetic identity of the cells was verified by Sanger sequencing of a PCR amplicon.
The parental and HAP1 cell lines were cultured as monolayer at 37° C. in a humidified atmosphere with 5% CO2, using IMDM medium plus GlutaMAX (Gibco) supplemented with 10% FBS, 100 U/ml penicilin and 100 μg/ml streptomycin. Cells were passaged every 2-3 days when reaching 70-75% confluency. For transfection, the cells were grown in 6-well plates at a 70% confluency. One day later, cells were transfected with 2.5 μg pDNA using Lipofectamine 3000 (ThermoFisher), following manufacturer's instructions. Two days after transfection, the cells were collected by trypsinization, and the pellet was stored at −20° C. Total genomic DNA was extracted from the cells with the NucleoSpin® Tissue kit (Macherey-Nagel AG, Switzerland). A PCR amplicon was amplified for next-generation sequencing, using the Phusion High-Fidelity DNA Polymerase (ThermoFisher). For TMC1DFNA36 cells, the primers used were 5′-AGCCTAGCTCAGAATCTTCCA-3′ and 5′-AAAATGCGTCCCAGTAGCCA-3′. For TMCWT cells, the 5′-AAAATGCGTCCAAGTAGCCA-3′ was used due to a point mutation in the primer binding region. The PCR protocol was based on manufacturer's instruction, with 35 cycles (5 s at 98° C.; 20 s at 59° C.; 15 s at 72° C.). The PCR product was visualized on a 2% agarose gel and purified with the PCR clean-up and gel extraction kit (Macherey-Nagel AG, Switzerland).
Next-generation sequencing was performed by the Massachusetts General Hospital DNA Core facility.
To verify transfection efficacy in each sample, TaqMan real-time PCR was used to quantify the number of plasmid copies of the sequence contained in the AAV inverted terminal repeats using the following primers: forward: 5′-GGA ACC CCT AGT GAT GGA GTT-3′; reverse: 5′-CGG CCT CAG TGA GCG A-3′; probe: 5′-FAM-CAC TCC CTC TCT GCG CGC TCG-BHQ1-3′. The amount of cellular gDNA was quantified using a set of primers specific for the human albumin gene: forward: 5′-TGA AAC ATA CGT TCC CAA AGA GTT T-3′; reverse: 5′-CTC TCC TTC TCA GAA AGT GTG CAT AT-3′; probe: 5′-FAM-TGC TGA AAC ATT CAC CTT CCA TGC AGA-BHQ1-3′. Absolute number of copies were determined according to standards and used to calculate the number of plasmid copies per cell.
GraphPad Prism 7.0 for Mac OS and OriginPro (2015) were used for statistical analysis. To compare means, an unpaired two tailed t-test (after Shapiro-Wilk normality testing) was used; to compare multiple groups, ANOVA followed by Tukey's post-hoc test (to compare every mean to every other mean) or Dunnett's test (to compare every mean to a control group mean) was used. p values <0.05 were accepted as significant.
From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.
The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.
This application is a U.S. National Stage application and a continuation pursuant to 35 U.S.C. §111 of PCT International Patent Application No.: PCT/US2020/038516, filed Jun. 18, 2020, designating the United States and published in English, which claims priority to and the benefit of U.S. Provisional Application No. 62/864,933, filed Jun. 21, 2019, the contents of each of which areincorporated herein by reference in their entirety.
This invention was made with government support under Grant Nos. DC013521 and DC005439 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 62864933 | Jun 2019 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2020/038516 | Jun 2020 | US |
| Child | 17556463 | US |
