The HIV type 1 (HIV-1) reverse transcriptase (RT) is required for the conversion of genomic RNA into double-stranded proviral DNA, catalyzed by the RNA-dependent DNA polymerase and ribonuclease H activities of the enzyme. HIV-1 RT is an asymmetric dimer formed by the association of p66 and p51 polypeptides, which are cleaved from a large Pr160GagPol precursor by the viral protease during virion assembly. p51 contains identical N-terminal sequences as p66, but lacks the C-terminal ribonuclease H (RNase H) domain (di Marzo et al. Science 231, 1289-1291, 1986). The structure of HIV-1 RT has been elucidated by x-ray crystallography in a variety of configurations, including unliganded (Rodgers et al. Proc. Natl. Acad. Sci. USA 92, 1222-1226, 1995), complexed to nonnucleoside RT inhibitors (Ren, et al. Nat. Struct. Biol. 2, 293-302, 1995), or complexed with double-stranded DNA either with (Huang et al. Science 282, 1669-1675, 1998) or without deoxynucleotide triphosphate (Jacobo-Molinaet al. Proc. Natl. Acad. Sci. USA 90, 6320-6324, 1993; Kohlstaedt et al. Science 256, 1783-1790, 1992). Such analyses have shown that p66 can be divided structurally into the polymerase and RNase H domains, with the polymerase domain further divided into the fingers, palm, thumb and connections subdomains. Although p51 has the same polymerase domains as p66, the relative orientations of these individual domains differ markedly, resulting in p51 assuming a closed structure.
The RT heterodimer represents the biologically relevant form of the enzyme; the monomeric subunits have only low catalytic activity (Restle, et al. J. Biol. Chem. 265, 8986-8988, 1990). Structural analysis reveals three major contacts between p66 and p51, with most of the interaction surfaces being largely hydrophobic (Becerra et al Biochemistry 30, 11707-11719, 1991; Wang et al. Proc. Natl. Acad. Sci. USA 91, 7242-7246, 1994). The three contacts comprise an extensive dimer interface that includes the fingers subdomain of p51 with the palm of p66, the connection subdomains of both subunits, and the thumb subdomain of p51 with the RNase H domain of p66.
Several single amino acid substitutions in HIV-1 RT have been shown to inhibit heterodimer association (Ghosh et al. Biochemistry 35, 8553-8562 1996; Wohrl et al. J. Biol. Chem. 272, 17581-17587, 1997; Goel et al. Biochemistry 32, 13012-13018, 1993). These include the mutations L234A, G231A and W229A, all located in the primer grip region of the p66 subunit, and L289K in the thumb subdomain. These mutations are not located at the dimer interface and probably mediate their effects indirectly through conformational changes in the p66 subunit.
Several biochemical assays have been used previously to specifically measure RT dimerization. Some are based on the physical separation of monomers and dimers as determined by analytical ultracentrifugation and gel filtration. Other assays include intrinsic tryptophan fluorescence (Divita et al. FEBS Lett. 324, 153-158, 1993), chemical crosslinking (Debyseret al. Protein Sci. 5, 278-286, 1996), the use of affinity tags (Jacques et al J. Biol. Chem. 269, 1388-1393, 1994) and polymerase activity itself. Although these methods detect dimerization, they either lack specificity or are not easy to perform. Moreover, these assays do not facilitate the rapid genetic analysis of protein-protein interactions under physiological conditions nor are they suitable for high throughput screening for RT dimerization inhibitors.
Understanding the role of the individual RT subunits in RNA-dependent DNA synthesis has been the focus of several studies. These used in vitro biochemical methods to analyze the enzymatic activity of purified recombinant HIV-1 RT heterodimers wherein either the p51 or p66 subunit was selectively mutated (Boyer et al., 1994; Hostomsky et al., 1992; Le Grice et al., 1991). There remains a need in the art, however, for in vivo methods and compositions for identifying compounds that inhibit HIV-1 subunit-specific reverse transcriptase.
In accordance with the purpose(s) of this invention, as embodied and broadly described herein, this invention, in one aspect, relates to a cell comprising a vector wherein the vector expresses a fusion protein comprising a p66 subunit, a p51 subunit, and Vpr, and a reverse transcriptase deficient proviral DNA.
In another aspect, the invention relates to a method of screening for a compound that inhibits viral reverse transcriptase.
This invention also relates to a method of screening for a compound that inhibits or enhances dimerization of a p66 subunit polypeptide of reverse transcriptase and a p51 subunit polypeptide of reverse transcriptase.
hi another aspect, this invention relates to a method of making a pharmaceutical composition and compounds identified by the methods described herein.
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principles of the invention.
The present invention may be understood more readily by reference to the following detailed description of preferred embodiments of the invention and the Examples included therein and to the Figures and their previous and following description.
Definitions
As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a small molecule” includes mixtures of one or more small molecules, and the like.
Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, this includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
The terms “higher,” “increases,” “elevates,”, “enhances” or “elevation” refer to increases above basal levels, or as compared to a control. The terms “low,” “lower,” “reduces,” “inhibits” “decreases” or “reduction” refer to decreases below basal levels, or as compared to a control. For example, basal levels are normal in vivo levels prior to, or in the absence of, the vector, or addition of an agent such as or another small molecule or ligand.
The term “test compound” is defined, as any compound to be tested for its ability to interact with a selected cell.
The terms “control levels” or “control cells” are defined as the standard by which a change is measured, for example, the controls are not subjected to variables, but are instead subjected to a defined set of parameters in the absence of variables, or the controls are based on pre- or post-variable levels.
The terms “polypeptide,” “peptide,” and “protein” are used interchangeably throughout and are defined as sequences containing amino acids.
General
The biologically relevant, catalytically active form of human immunodeficiency virus type-1 (HIV-1) reverse transcriptase (RT) is a heterodimer consisting of a 51 kDa subunit and a 66 kDa subunit. Since p51 and p66 are derived from the same coding region, subunit-specific structure/function studies of RT have not been possible in vivo. RT has both DNA polymerase and RNase H activities that are required to convert the single-stranded RNA viral genome into double-stranded DNA upon entry of the virus into host cells.
RT is translated and assembled into virions as part of a larger Gag-Pol polyprotein precursor (Pr160Gag-Pol). Proteolytic processing of Pr160Gag-Pol by the pol-encoded protease (PR) generates the mature heterodimeric form (p51/p66) of the RT enzyme (Freed and Martin, 2001; Telesnitsky and Goff, 1997). The N-terminal 440 amino acids of p51 and p66 are collinear. The p66 subunit contains the DNA polymerase and RNase H domains, while the p51 subunit lacks the RNase H domain (Hizi et al., 1988; Larder et al., 1987a; Prasad and Goff, 1989). Elucidation of the HIV-1 RT structure has shown that the polymerase domain of p51 and p66 can be further divided into the fingers, palm, thumb, and connection subdomains (Kohlstaedt et al., 1992). Although both p51 and p66 contain each of these subdomains, their relative arrangements differ markedly between the two subunits. Since these subunits are derived from the same coding region, a mutation in the polymerase coding region generates a heterodimer that contains a mutation in each subunit. However, as their structures are different in the heterodimer, the effect of these mutations on RT subunit structure/function is not equivalent (Arnold et al., 1992; Kohlstaedt et al., 1992). Thus, the heterodimeric nature of RT has previously had limited detailed molecular genetic analyses of the p51 and p66 subunit function.
Viral and foreign proteins can be incorporated into virions by exploiting viral accessory proteins, such as HIV/SIV proteins Vpr or Vpx, as targeting vehicles. By expressing the desired protein in trans as a fusion with Vpr or Vpx, its incorporation is brought about through an interaction between Vpr/Vpx and the p6 domain of the cognate Gag precursor polyprotein (Lu et al., 1993; Paxton et al., 1993; Wu et al., 1994). Using this approach, it has been shown that HIV-1 RT and IN functions can be provided when expressed in trans as Vpr fusion proteins, independently of Pr160Gag-Pol (Liu et al., 1997; Wu et al., 1999; Wu et al., 1997).
Herein described is a trans-complementation approach that enables the function of the individual RT subunits to be analyzed in the context of an infectious virus. For example, by cotransfecting cells with RT-defective proviral DNA and an LTR-vpr-p51-IRES-p66 expression cassette, it was demonstrated that Vpr-p51 interacts with p66 and mediates virion incorporation of a Vpr-p51/p66 heterodimeric complex. The p51 subunit was expressed as a Vpr-p51 fusion protein that incorporates into HIV-1 virions through an interaction between Vpr and the Gag precursor polyprotein. When coexpressed, p66 is specifically and selectively packaged as a Vpr-p51/p66 complex. Processing by the viral protease liberates Vpr and generates functional heterodimeric RT (p51/p66) that supports HIV-1 reverse transcription and virus infection (Example 1).
This approach was used to demonstrate that the YMDD aspartates of p66 are both required and sufficient for RT polymerase function, and that the p51 YMDD aspartates play a structural role that is required for viral cDNA synthesis in infected cells. By mutating D185 and D186 of either p51 or p66, the role of these residues, for the first time, in the context of an infectious virus, were studied. The results corroborate earlier findings that the aspartates of p66 (YMDD) are required and sufficient for polymerase function of the RT heterodimer. Decreased viral DNA synthesis and infectivity was observed with certain p51 aspartate mutations (YMDD), indicating that both the occupancy and charge of these residues are important for RT function in vivo. These findings demonstrate detailed molecular genetic and biologic analyses of the RT subunits in vivo.
Furthermore, disclosed herein is a subunit-specific mutagenesis approach that enables precise molecular analysis of the heterodimer in the context of infectious HIV-1 particles (Example 4). The contributions of amino acids comprising the Trp-motif to RT subunit interaction and function were analyzed. The results revealed important inter- and intra-subunit interactions of residues in the Trp motif. A tryptophan cluster in p51 (W398, W402, W406, W414), proximal to the interface, was found to be important for p51/p66 interaction and stability. At the dimer internee, residues W401, Y405 and N363 in p51 and W410 in p66 mediate inter-subunit interactions. The W401 residue is critical for RT dimerization (and therefore viral infectivity), exerting distinct effects in p51 and p66. The analysis of the RT heterodimerization enhancing non-nucleoside RT inhibitor (NNRTI), efavirenz, indicates that the effects of drugs on RT dimer stability can be examined in human cells. Thus, subunit-specific molecular interactions that affect RT heterodimer function and virus infection in vivo, have been elucidated Moreover, the ability to assess the effects of RT inhibitors on subunit interactions in a physiologically relevant context was demonstrated.
The first step in RT dimerization apparently involves interactions between hydrophobic residues in the connection subdomains of p51 and p66. This includes residues W401-W410 of p66 and residues P392-W401 of p51 (Rodriguez-Barrios et al. (2001); Morris et al. J. Biol. Chem. 274:24941-6 (1999); Tachedjian et al. J. Mol. Biol. 326:381-96 (2003)). The connection subdomain is distinctive in having six tryptophans and a tyrosine between amino acids 398-414. This motif is well conserved among the primate lentiviruses, and has been appropriately dubbed the tryptophan-repeat motif (Trp-motif). In a yeast two-hybrid approach to analyze Trp-motif mutations, residues p66W401 and p66W414 were shown to be involved in RT dimerization (Tachedjian et al., 2003). Mutagenesis of other aromatic amino acids that lie between these two residues did not affect subunit interaction. Since p66W401 and p66W414 are not located at the dimmer interface, it appears that respositioning of structural elements between these residues accounted for their results.
Synthetic peptides corresponding to the connection subdomain (Trp-motif) have been reported to disrupt dimerization (Morris et al. (1999); Divita et al. (1994); Divita et al. J. Biol. Chem. 270:28642-6 (1995)). For example, a short peptide matching RT residues 395-404 was shown to inhibit heterodimerization in vitro and virus replication in cell culture (Morris et al. (1999)). Recent studies of nonnucleoside reverse transcriptase inhibitors (NNRTI) have heightened interest in compounds that interfere with RT conformational flexibility as a novel drug design concept (Sarafianos et al. Chem. Biol. 6:R137-46 (1999); Hughes et al. Proc. Natl. Acad Sci. USA 98:6991-2 (2001)). NNRTI are a group of small hydrophobic compounds with diverse structures that inhibit HIV-1 RT (see Balzarini et al. Curr. Top. Meal Chem. 4:921-44 (2004) for review). NNRTIs interact with HIV-1 RT by binding to a site on the p66 subunit of the heterodimer. This results in both short-range and long-range distortions of the RT structure. NNRTIs have been shown to interfere directly with the global hinge-bending mechanism that controls the cooperative motions of the p66 fingers and thumb subdomains required for RT function (Temiz et al. Proteins 49:61-70 (2002); Madrid et al. Proteins 45:176-82 (2001)). In yeast, several NNRTIs were shown to enhance p51/p66 subunit association as a result of a specific interaction of drug with p66 (Tachedjian et al. Proc. Natl. Acad. Sci. USA 98: 7188-93 (2001)).
The contribution of amino acid residues comprising the Trp-motif to RT subunit interaction and virus infection has been determined. Inter-subunit interactions between the connection subdomains include W401, Y405 and N363 in p51 and W410 in p66, and mutation of these residues impairs RT function and virus infectivity. The W401 residue of the Trp-motif was found to be of central importance. Mutation of this amino acid simultaneously in both subunits is deleterious to RT dimerization and virus infection. The RT heterodimerization enhancing drug, efavirenz (EFV), rescued this dimerization defect in a dose-dependent manner. Additionally, it was demonstrated that intra-subunit interactions between tryptophans comprising a hydrophobic cluster (W398, W402, W406, W414) proximal to the connection subdomain interface are important for p51/p66 subunit interaction and stability.
Compositions
Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular plasmid is disclosed and discussed and a number of modifications that can be made to a number of molecules included in the plasmid are discussed, specifically contemplated is each and every combination and permutation of those molecules and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
Disclosed herein are plasmids comprising a fusion protein comprising a p51-containing DNA fragment fused in frame and a viral accessory protein, such as vpr. By expressing the desired protein in trans as a fusion with Vpr, for example, its incorporation is brought about through an interaction between Vpr and the p6 domain of the cognate Gag, precursor polyprotein. The Vpr-p51 fusion includes the natural PR-RT cleavage site (PC), allowing processing by the viral protease and liberation of Vpr (Wu et al., 1997). Also disclosed herein is an expression cassette comprising LTR-vpr-p51-IRES-p66, wherein the nucleic acid comprises SEQ ID NO: 1.
Also disclosed herein are vectors comprising a p66 subunit, a p51 subunit, and Vpr, wherein Vpr and p51 are expressed as a fusion protein. The p66 and p51 subunits can be expressed on the same, or on different, mRNAs.
Optionally, an internal ribosome entry site (IRES) can be placed downstream of vpr-p51, followed by the p66 coding sequence. IRES are cis-acting RNA sequences able to mediate internal entry of a sequence on some eukaryotic and viral messenger RNAs upstream of a translation initiation codon. Examples of useful IRES can be found at http://ifr31w3.toulouse.inserm.fr/IRESdatabase, herein incorporated by reference in its entirety for the disclosure of various IRES.
Transcription of vpr-p51/p66 can then be placed under the control of a long terminal repeat (LTR), for example. LTRs are responsible for integration of the sequence into the host genome, initiation and enhancement of retroviral transcription, as well as transcriptional termination, and modulation of retroviral replication levels. Examples of LTRs useful with the plasmids described herein include SIV-LTR, HIV-1 LTR, and HIV-2 LTR, for example.
The plasmid can be incorporated into proviral clones that contain a deletion in RT. For example, the proviral clone pSG3FN (
An expression plasmid including IN, such as vpr-IN, can also be included in conjunction with the plasmid disclosed herein. The M7 clone (pSG3FN) does not express the IN protein, and integration of the nascent viral cDNA is required to detect infection. Moreover, IN is also required for efficient initiation of reverse transcription (Wu et al., 1999).
Effective trans-complementation requires expression of the two subunits (Vpr-p51 and p66), dimerization, and stable association of the p51 (Vpr-p51) and p66 subunits within the cytosol of the cell, specific interaction of Vpr with Pr55Gag, incorporation of the Vpr-p51/p66 heterodimeric complex into virions, proteolytic cleavage to liberate Vpr from p51/p66, and proper interaction of RT with the template-primer.
Also disclosed herein are cells comprising: (i) a vector comprising a p66 subunit, a p51 subunit, and Vpr, wherein Vpr and p51 are expressed as a fusion protein; (ii) and a reverse transcriptase deficient proviral DNA. One example of a cell that can be used is the 293T cell.
Also disclosed are cell lines stably transformed with the plasmid described herein. For example, the cell line can comprise an exogenous nucleic acid, the nucleic acid comprising vpr-p51/66. The cell line can express viral nucleic acids as well, and can be induced to express viral nucleic acids by contacting the cell with a stimulus. An example of such a stimulus includes, but is not limited to, tetracycline. Also disclosed are transgenic animals expressing vpr-p51/66.
Homology/Identity
It is understood that one way to define any known variants and derivatives or those that might arise, of the disclosed genes and proteins herein is through defining the variants and derivatives in terms of homology to specific known sequences. For example SEQ ID NO: 1 sets forth a particular nucleic acid sequence encoding an expression protein and SEQ ID NO 2 sets forth a particular sequence of the protein encoded by vpr. Specifically disclosed are variants of these and other genes and proteins herein disclosed which have at least, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins or nucleic acids, such as genes. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level. Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection.
The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
Nucleic Acids
There are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acids of the plasmid disclosed herein, as well as those that encode the proteins disclosed herein, as well as various functional nucleic acids. The disclosed nucleic acids are made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U. Likewise, it is understood that if, for example, an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantagous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.
Nucleotides and Related Molecules
A nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage. The base moiety of a nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The sugar moiety of a nucleotide is a ribose or a deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. An non-limiting example of a nucleotide would be 3′-AMP (3′-adenosine monophosphate) or 5′-GMP (5′-guanosine monophosphate).
A nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to nucleotides are well known in the art and would include for example, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, and 2-aminoadenine as well as modifications at the sugar or phosphate moieties.
Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance for example, cellular uptake. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety. (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556),
A Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute. The Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, N1, and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.
A Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA. The Hoogsteen face includes the N7 position and reactive groups (NH2 or O) at the C6 position of purine nucleotides.
Sequences
There are a variety of sequences related to, for example, the plasmid described herein, as well as any other protein disclosed herein that are disclosed on Genbank, and these sequences and others are herein incorporated by reference in their entireties as well as for individual subsequences contained therein.
A variety of sequences are provided herein and these and others can be found in Genbank, at www.pubmed.gov. Those of skill in the art understand how to resolve sequence discrepancies and differences and to adjust the compositions and methods relating to a particular sequence to other related sequences.
Peptides
As discussed herein there are numerous variants of the vectors disclosed herein that are known and herein contemplated. In addition to the known functional variants there are derivatives of the proteins disclosed herein, such as Vpr, p51, or p66, which also function in the disclosed methods and compositions. Protein variants and derivatives are well understood to those of skill in the art and in can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis and PCR mutagenesis.
Specifically, mutations can occur in p51, p66, Vpr, IRES, or any of the nucleic acids encoding these peptides. Mutations can also occur in the env gene of HIV, for example, which can optionally affect the infectivity of the virus. These mutations can be deletions, substitutions, or insertion mutations. The mutations can occur in RT and/or in IN. The mutations can also be point mutations.
Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions.
Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine, in this case, (e) by increasing the number of sites for sulfation and/or glycosylation.
For example, the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another. The substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gln; Ser, Thr; Lys, Arg; and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
Substitutional or deletional mutagenesis can be employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr). Deletions of cysteine or other labile residues also may be desirable. Deletions or substitutions of potential proteolysis sites, e.g. Arg, is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o-amino groups of lysine, arginine, and histidine side chains (T. E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C-terminal carboxyl.
It is understood that one way to define the variants and derivatives of the disclosed proteins herein is through defining the variants and derivatives in terms of homology/identity to specific known sequences. For example, SEQ ID NO: 1 sets forth a particular nucleic acid sequence of a vector described herein, which encodes the Vpr and p51 subunits; and SEQ ID NO: 2 sets forth a particular sequence of a Vpr protein. Specifically disclosed are variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection.
The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
It is understood that the description of conservative mutations and homology can be combined together in any combination, such as embodiments that have at least 70% homology to a particular sequence wherein the variants are conservative mutations.
As this specification discusses various proteins and protein sequences it is understood that the nucleic acids that can encode those protein sequences are also disclosed. This would include all degenerate sequences related to a specific protein sequence, i.e. all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence.
It is understood that there are numerous amino acid and peptide analogs which can be incorporated into the disclosed compositions. For example, there are numerous D amino acids or amino acids which have a different functional substituent then the amino acids shown in Table 1 and Table 2. The opposite stereo isomers of naturally occurring peptides are disclosed, as well as the stereo isomers of peptide analogs. These amino acids can readily be incorporated into polypeptide chains by charging tRNA molecules with the amino acid of choice and engineering genetic constructs that utilize, for example, amber codons, to insert the analog amino acid into a peptide chain in a site specific way (Thorson et al., Methods in Molec. Biol. 77:43-73 (1991), Zoller, Current Opinion in Biotechnology, 3:348-354 (1992); Ibba, Biotechnology & Genetic Enginerring Reviews 13:197-216 (1995), Cahill et al., FIBS, 14(10):400-403 (1989); Benner, TIB Tech, 12:158-163 (1994); Ibba and Hennecke, Bio/technology, 12:678-682 (1994) all of which are herein incorporated by reference at least for material related to amino acid analogs).
Molecules can be produced that resemble peptides, but which are not connected via a natural peptide linkage. For example, linkages for amino acids or amino acid analogs can include CH2NH—, —CH2S—, —CH2—CH2—, —CH═CH— (cis and trans), —COCH2—, —CH(OH)CH2—, and —CHH2SO—(These and others can be found in Spatola, A. F. in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3, Peptide Backbone Modifications (general review); Morley, Trends Pharm Sci (1980) pp. 463-468; Hudson, D. et al., Int J Pept Prot Res 14:177-185 (1979) (—CH2NH—, CH2CH2—); Spatola et al. Life Sci 38:1243-1249 (1986) (—CHH2—S); Hann J. Chem. Soc Perkin Trans. I 307-314 (1982) (—CH—CH—, cis and trans); Almquist et al. J. Med. Chem. 23:1392-1398 (1980) (—COCH2—); Jennings-White et al. Tetrahedron Lett 23:2533 (1982) (—COCH2—); Szelke et al. European Appln, EP 45665 CA (1982): 97:39405 (1982) (—CH(OH)CH2—); Holladay et al. Tetrahedron. Lett 24:4401-4404 (1983) (—C(OH)CH2—); and Hruby Life Sci 31:189-199 (1982) (—CH2—S—); each of which is incorporated herein by reference. A particularly preferred non-peptide linkage is —CH2NH—. It is understood that peptide analogs can have more than one atom between the bond atoms, such as b-alanine, g-aminobutyric acid, and the like.
Amino acid analogs and analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, and others.
D-amino acids can be used to generate more stable peptides, because D amino acids are not recognized by peptidases and such. Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L-lysine) can be used to generate more stable peptides. Cysteine residues can be used to cyclize or attach two or more peptides together. This can be beneficial to constrain peptides into particular conformations. (Rizo and Gierasch Arm. Rev. Biochem. 61:387 (1992), incorporated herein by reference).
Functional Nucleic Acids
Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction. The compositions and methods described herein can be used with any functional nucleic acid. Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting. For example, functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences. The functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules.
Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains. Thus, functional nucleic acids can interact with the mRNA of HIV or the genomic DNA of the subject, or they can interact with the polypeptide of the compositions disclosed herein. Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule. In other situations, the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather is based on the formation of tertiary structure that allows specific recognition to take place.
Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation. Alternatively the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC. It is preferred that antisense molecules bind the target molecule with a dissociation constant (kd) less than or equal to 10−6, 10−8, 10−10, or 10−12. A representative sample of methods and techniques which aid in the design and use of antisense molecules can be found in the following non-limiting list of U.S. Pat. Nos. 5,135,917, 5,294,533, 5,627,158, 5,641,754, 5,691,317, 5,780,607, 5,786,138, 5,849,903, 5,856,103, 5,919,772, 5,955,590, 5,990,088, 5,994,320, 5,998,602, 6,005,095, 6,007,995, 6,013,522, 6,017,898, 6,018,042, 6,025,198, 6,033,910, 6,040,296, 6,046,004, 6,046,319, and 6,057,437.
Aptamers are molecules that interact with a target molecule, preferably in a specific way. Typically aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets. Aptamers can bind small molecules, such as ATP (U.S. Pat. No. 5,631,146) and theophiline (U.S. Pat. No. 5,580,737), as well as large molecules, such as reverse transcriptase (U.S. Pat. No. 5,786,462) and thrombin (U.S. Pat. No. 5,543,293). Aptamers can bind very tightly with kds from the target molecule of less than 10−12 M. It is preferred that the aptamers bind the target molecule with a kd less than 10−6, 10−8, 10−10, or 10−12. Aptamers can bind the target molecule with a very high degree of specificity. For example, aptamers have been isolated that have greater than a 10000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule (U.S. Pat. No. 5,543,293). It is preferred that the aptamer have a kd with the target molecule at least 10, 100, 1000, 10,000, or 100,000 fold lower than the kd with a background binding molecule. It is preferred when doing the comparison for a polypeptide for example, that the background molecule be a different polypeptide Representative examples of how to make and use aptamers to bind a variety of different target molecules can be found in the following non-limiting list of U.S. Pat. Nos. 5,476,766, 5,503,978, 5,631,146, 5,731,424, 5,780,228, 5,792,613, 5,795,721, 5,846,713, 5,858,660, 5,861,254, 5,864,026, 5,869,641, 5,958,691, 6,001,988, 6,011,020, 6,013,443, 6,020,130, 6,028,186, 6,030,776, and 6,051,698.
Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. Ribozymes are thus catalytic nucleic acid. It is preferred that the ribozymes catalyze intermolecular reactions. There are a number of different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as hammerhead ribozymes, (for example, but not limited to the following U.S. Pat. Nos. 5,334,711, 5,436,330, 5,616,466, 5,633,133, 5,646,020, 5,652,094, 5,712,384, 5,770,715, 5,856,463, 5,861,288, 5,891,683, 5,891,684, 5,985,621, 5,989,908, 5,998,193, 5,998,203, WO 9858058 by Ludwig and Sproat, WO 9858057 by Ludwig and Sproat, and WO 9718312 by Ludwig and Sproat) hairpin ribozymes (for example, but not limited to the following U.S. Pat. Nos. 5,631,115, 5,646,031, 5,683,902, 5,712,384, 5,856,188, 5,866,701, 5,869,339, and 6,022,962), and tetrahymena ribozymes (for example, but not limited to the following U.S. Pat. Nos. 5,595,873 and 5,652,107). There are also a number of ribozymes that are not found in natural systems, but which have been engineered to catalyze specific reactions de novo (for example, but not limited to the following. U.S. Pat. Nos. 5,580,967, 5,688,670, 5,807,718, and 5,910,408). Preferred ribozymes cleave RNA or DNA substrates, and more preferably cleave RNA substrates. Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non-canonical base pair interactions. This property makes ribozymes particularly good candidates for target specific cleavage of nucleic acids because recognition of the target substrate is based on the target substrates sequence. Representative examples of how to make and use ribozymes to catalyze a variety of different reactions can be found in the following non-limiting list of U.S. Pat. Nos. 5,646,042, 5,693,535, 5,731,295, 5,811,300, 5,837,855, 5,869,253, 5,877,021, 5,877,022, 5,972,699, 5,972,704, 5,989,906, and 6,017,756.
Triplex forming functional nucleic acid molecules are molecules that can interact with either double-stranded or single-stranded nucleic acid. When triplex molecules interact with a target region, a structure called a triplex is formed, in which there are three strands of DNA forming a complex dependant on both Watson-Crick and Hoogsteen base-pairing. Triplex molecules are preferred because they can bind target regions with high affinity and specificity. It is preferred that the triplex forming molecules bind the target molecule with a kd less than 10−6, 10−8, 10−10, or 10−12. Representative examples of how to make and use triplex forming molecules to bind a variety of different target molecules can be found in the following non-limiting list of U.S. Pat. Nos. 5,176,996, 5,645,985, 5,650,316, 5,683,874, 5,693,773, 5,834,185, 5,869,246, 5,874,566, and 5,962,426.
External guide sequences (EGSs) are molecules that bind a target nucleic acid molecule forming a complex, and this complex is recognized by RNase P, which cleaves the target molecule. EGSs can be designed to specifically target a RNA molecule of choice. RNAse P aids in processing transfer RNA (tRNA) within a cell. Bacterial RNAse P can be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate. (WO 92/03566 by Yale, and Forster and Altman, Science 238:407-409 (1990)).
Similarly, eukaryotic EGS/RNAse P-directed cleavage of RNA can be utilized to cleave desired targets within eukarotic cells. (Yuan et al., Proc. Natl. Acad. Sci. USA 89:8006-8010 (1992); WO 93/22434 by Yale; WO 95/24489 by Yale; Yuan and Altman, EMBO J 14:159-168 (1995), and Carrara et al., Proc. Natl. Acad. Sci. (USA) 92:2627-2631 (1995)). Representative examples of how to make and use EGS molecules to facilitate cleavage of a variety of different target molecules be found in the following non-limiting list of U.S. Pat. Nos. 5,168,053, 5,624,824, 5,683,873, 5,728,521, 5,869,248, and 5,877,162.
Methods
Also disclosed herein are methods of screening for a compound that inhibits viral reverse transcriptase comprising: a) contacting a cell comprising (i) a plasmid which expresses a fusion protein comprising a p66 subunit, a p51 subunit, and Vpr, (ii) and a reverse transcriptase deficient proviral DNA with the compound, and b) comparing the level of viral infectivity in the presence of the compound with the level of viral infectivity in the absence of the compound, wherein a decreased level of infectivity in the presence of the compound indicates that the compound inhibits reverse transcriptase.
The compositions and methods described herein can be used to treat retroviruses, and in particular lentiviruses. Lentiviruses share several molecular and pathogenic features that set them apart from other retroviruses. These include virus encoded regulatory proteins to stimulate viral gene expression, synthesis of multiply spliced mRNAs and chronic infection associated with slow development of disease. Lentiviruses include, but are not limited to, HIV-1, HIV-2 and SIV. In the methods described therein, the HIV or SIV particles can be derived by genes expressed in the cell, wherein the genes contain one or more nucleotide mutations. Examples of these specific mutations can be found in Example 1.
The p51 and p66 subunits can be expressed on the same or on different messenger RNAs. Furthermore, expression of Vpr-p51 can incorporate the p66 protein into viral particles. The plasmid can also express an internal ribosome entry site (IRES), as described above.
Also disclosed are methods of screening for a compound that inhibits dimerization of a p66 subunit polypeptide of reverse transcriptase and a p51 subunit polypeptide of reverse transcriptase comprising: a) contacting a cell comprising (i) a plasmid which expresses a fusion protein comprising a p66 subunit, a p51 subunit, and Vpr, (ii) and a reverse transcriptase deficient proviral DNA with the compound, and b) comparing the level of complex formation in the presence of the compound with the level of complex formation in the absence of the compound, a lower level of complex formation indicating that the compound inhibits dimerization of the p66 subunit and a p51 subunit.
Also disclosed are methods of screening for a compound that enhances dimerization of a p66 subunit polypeptide of reverse transcriptase and a p51 subunit polypeptide of reverse transcriptase comprising: a) contacting a cell comprising (i) a plasmid which expresses a fusion protein comprising a p66 subunit, a p51 subunit, and Vpr, (ii) and a reverse transcriptase deficient proviral DNA with the compound, and b) comparing the level of complex formation in the presence of the compound with the level of complex formation in the absence of the compound, a lower level of complex formation indicating that the compound enhances dimerization of the p66 subunit and a p51 subunit. Examples of compounds that inhibit reverse transcriptase by enhancing subunit dimerization include, but are not limited to, NNRTI.
Also disclosed is a method of inhibiting viral reverse transcriptase comprising contacting (1) the p51 subunit polypeptide, (2) the p66 subunit polypeptide, or (3) both the p51 subunit polypeptide and the p66 subunit polypeptide, with an effective amount of the compound identified by the method described above, thereby inhibiting viral reverse transcriptase.
Also disclosed is a method of inhibiting dimerization of a p51 subunit polypeptide of HIV-1 reverse transcriptase and a p66 subunit polypeptide of HIV-1 reverse transcriptase, which comprises contacting either (1) the p51 subunit polypeptide, (2) the p66 subunit polypeptide, or (3) both the p51 subunit polypeptide and the p66 subunit polypeptide, with an effective amount of the compound identified by the method described above, thereby inhibiting dimerization of the p51 subunit polypeptide of HIV-1 reverse transcriptase and a p66 subunit polypeptide of HIV-1 reverse transcriptase.
Also disclosed is a method of enhancing dimerization of a p51 subunit polypeptide of HIV-1 reverse transcriptase and a p66 subunit polypeptide of HIV-1 reverse transcriptase, which comprises contacting either (1) the p51 subunit polypeptide, (2) the p66 subunit polypeptide, or (3) both the p51 subunit polypeptide and the p66 subunit polypeptide, with an effective amount of the compound identified by the method described above, thereby enhancing dimerization of the p51 subunit polypeptide of HIV-1 reverse transcriptase and a p66 subunit polypeptide of HIV-1 reverse transcriptase.
In the methods described above, HIV-1 reverse transcriptase can be present in a subject, a eukaryotic cell, or a prokaryotic cell, for example.
The compounds disclosed herein can be NNRTIs. NNRTIs are a chemically diverse group of largely hydrophobic compounds that inhibit HIV-1 RT by binding in a hydrophobic pocket near the polymerase active site in the p66 subunit. NNRTIs have been described that can either stabilize or destabilize the RT heterodimer. Various NNRTIs have also been found to induce increased β-gal activity in the yeast two-hybrid system, due to enhanced RT subunit association 30. In particular, efavirenz binding to the NNRTI hydrophobic pocket enhanced RT heterodimerization, including RT with p51/p66 W401 mutations. Additionally, both the 2′,5′-bis-O-(tert-butyldimethylsilyl)-beta-D-ribofuranosyl 3′-spiro-5″-(4″-amino-1″,2″-oxathiole 2″,2″-dioxide) (TSAO) thymine derivatives and the N-acylhydrazones are classes of compounds that show inhibition characteristics similar to NNRTIs. Although these drugs may not bind to the well-defined NNRTI binding pocket of HIV-1 RT, they bind to a region of RT close to and partially overlapping this site. Furthermore, in the presence of a denaturant like urea these compounds have been shown to destabilize HIV-1 RT heterodimerization. Results show a dose-dependent enhancement of dimerization of the p51W401A/p66W401A RT mutant in the presence of efavirenz. (Example 4).
As used throughout, by a “subject” is meant an individual. Thus, the “subject” can include domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.) and birds. Preferably, the subject is a mammal such as a primate, and, more preferably, a human.
The methods of screening described herein are useful with high throughput screening methods. Screening optionally takes place in multi-well plates. Multi-well plates are standard in the art and come in a variety of sizes and shapes. For example, the multi-well plate can be 24, 48, or 96 well plates. Such screening assays can be automated or further modified for high throughput analysis. For high throughput screening, each well can include numerous test components. Ha positive reaction is detected in a well, the screening is repeated with one of the test compounds contained in a single well.
Optionally, reverse transcriptase containing (vpr-p51/p66) virus particles can be made that either lack Env or contain either autologous or heterologous Env derived by pseudotyping. Wei shows this with autologous Env, (Wei, X., J. M. Decker, H. Liu, Z. Zhang, R. B. Arani, J. M. Kilby, M. S. Saag, X. Wu, G. M. Shaw, and J. C. Kappes. 2002. Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy. Antimicrob Agents Chemother 46:1896-905; Wei, X., J. M. Decker, S. Wang, H. Hui, J. C. Kappes, X. Wu, J. F. Salazar-Gonzalez, M. G. Salazar, J. M. Kilby, M. S. Saag, N. L. Komarova, M. A. Nowak, B. H. Hahn, P. D. Kwong, and G. M. Shaw. 2003. Antibody neutralization and escape by HIV-1. Nature 422:307-12; both herein incorporated in their entireties for the teaching of autologous Env); while Wu shows this with the VSV-G Env (Wu, X., J. K. Wakefield, H. Liu, H. Xiao, R. Kralovics, J. T. Prchal, and J. C. Kappes. 2000. Development of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2:47-55, herein incorporated by reference in its entirety for its teaching of VSV-G Env). The Wei citations describe how env minus or env mutant virus can be rendered infectious by providing an envelope glycoprotein in trans.
Compounds and Methods of Making
Also disclosed herein are methods of making a pharmaceutical composition which comprises: a) determining whether a compound inhibits reverse transcriptase by the methods described herein; and b) admixing the compound with a pharmaceutically acceptable carrier.
Also disclosed are compounds identified by the methods described herein, as well as compositions comprising the compounds identified by the methods described herein. Such compositions can also comprise a carrier. The compound can be capable of inhibiting HIV-1. Optionally, the compound can be a nonnucleoside reverse transcriptase inhibitor, or a nucleoside reverse transcriptase inhibitor. These compounds are known to those of ordinary skill in the art.
The compositions of the invention can be administered in vivo in a pharmaceutically acceptable carrier. By “pharmaceutically acceptable” is meant a material that is not biologically or otherwise undesirable. Thus, the material may be administered to a subject, without causing undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
The compositions identified by the methods disclosed herein can be administered orally, parenterally (e.g., intravenously), by intramuscular injection, intravenously, subcutaneously, intramuscularly, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, including topical intranasal administration or administration by inhalant. topically or by liposome-mediated delivery. As used herein, “topical intranasal administration” means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the small molecule or ligand. Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
The dosage of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the infection being treated, the particular active agent used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) (ed. A.R. Gennaro, Mack Publishing Company, Easton, Pa. 1995.) Typically, an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic. Examples of the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution. The pH of the solution is preferably from about 5 to about 8.5, and more preferably from about 7.8 to about 8.2. Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.
Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. Other compounds will be administered according to standard procedures used by those skilled in the art.
Pharmaceutical compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like.
The terms “effective amount” and “effective dosage” are used interchangeably. The term “effective amount” is defined as any amount necessary to produce a desired physiologic response. Effective amounts and schedules for administering the compositions may be determined empirically, and making such determinations is within the skill in the art. The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms or disorder are affected. The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex, type of disease and extent of the disease in the patient, route of administration, or whether other drugs are included in the regimen, and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
Parenteral administration of a nucleic acid or vector to a subject is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Pat. No. 3,610,795, which is incorporated by reference herein. For additional discussion of suitable formulations and various routes of administration of therapeutic compounds, see, e.g., Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, Pa. 1995.
Also, provided are kits for screening for compounds comprising a plasmid which expresses a fusion protein comprising a p66 subunit, a p51 subunit, and Vpr, and a reverse transcriptase deficient proviral DNA. Also provided are kits comprising a cell comprising the plasmid. Also provided are kits for treating viral infections comprising a composition identified by the methods disclosed herein.
The present invention is more particularly described in the following examples, which are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.
Although the present process has been described with reference to specific details of certain embodiments thereof, it is not intended that such details should be regarded as limitations upon the scope of the invention except as and to the extent that they are included in the accompanying claims.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., Amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in ° C. or is at ambient temperature, and pressure is at or near atmospheric.
Expression and Virion Incorporation of Heterodimeric RT in Trans
For independent expression of the p51 and p66 subunits, the bicistronic pLR2P-vpr-p51-IRES-p66 (vpr-p51/p66) expression plasmid (abbreviations can be found in Table III) was constructed (
The proviral clone pSG3FN (FN) (
It was first determined whether the Vpr-p51 fusion protein could selectively incorporate p66 into virions. Virions derived by cotransfecting 293T cells with vpr-p51/p66 and FN were analyzed by immunoblot analysis. Using polyclonal anti-RT antiserum, two predominant proteins detected were consistent with the molecular masses of p51 and p66 (
To examine whether the trans-heterodimeric RT could rescue the defect in FN infectivity, the transfection-derived virions were analyzed using the single cycle TZM-b1 reporter assay. In three independent experiments, cotransfection of the vpr-p51/p66 expression plasmid rescued FN infectivity to levels of 15-20% compared to wildtype SG3 virus (
Specific Packaging of Heterodimeric RT
The strategy used for analyzing RT subunit function necessitates Vpr-p51-mediated selective incorporation of p66. Non-specifically packaged p66 can form p66/p66 homodimers and through proteolytic processing generate p51/p66 RT heterodimers, thus confounding the analysis of subunit-specific mutations. One explanation for the non-specific packaging of p66 observed in
Heterodimeric Trans-RT Rescues the Infectivity of RT-Deficient Virus
To determine if the heterodimeric trans-RT was functional, the M7 proviral construct was cotransfected into 293T cells with vpr-p51/p66 and vpr-IN. The vpr-IN expression plasmid was included since the M7 clone does not express the IN protein and integration of the nascent viral cDNA is required to detect infection using the TZM-b1 reporter cell line. Moreover, IN is also required for efficient initiation of reverse transcription (Wu et al., 1999). In three independent experiments, virus infectivity was rescued to about 15% of that of wild-type virus (
Subunit-Specific Analysis of the YMDD Motif
There exists a preponderance of evidence from biochemical and structural studies that shows HIV-1 reverse transcription is catalyzed by the p66 subunit of RT. However, the function of D185 and D186 in the p51 and p66 subunits, respectively, has not been directly tested in the context of an infectious virus. To study the function of these aspartate residues in one subunit independently of the other, either the p66 or the p51 coding region of the vpr-p51/p66 plasmid was mutated in both aspartates of the YMDD motif. Virus was analyzed for infectivity using the TZM-b1 reporter cell line and for DNA synthesis following acute infection of JC53 cells. Virus containing the p51/p66YMNN mutant RT with Asp185Asn and Asp186Asn mutations in p66 was severely defective in infectivity (
To further analyze the role of these p51 aspartates, they were mutated to alanines, glutamates, or lysines. Virus stocks containing each mutant RT were prepared by cotransfection and analyzed for infectivity and DNA synthesis. Similar to the asparagine mutations, the glutamic acid mutations (p51YMEE/p66) decreased virus infectivity and DNA synthesis only slightly (
Effect of Expressing p66 and IN in cis
The results indicate the rescue of M7 infectivity to a maximal level of approximately 15% compared to wildtype SG3. This can be explained, at least in part, by reports showing defects in virions lacking RT-IN expression and packaging as a contiguous protein, included aberrant morphology and RNA conformation. In an attempt to enhance the complementation efficiency of the assay, a vpr-p51/p66-IN expression plasmid was constructed and cotransfected into 293T cells with M7. Progeny virions exhibited decreased infectivity (lane 4) compared to virions generated with vpr-p51/p66. Virions concentrated by ultracentrifugation were analyzed by immunoblotting using the p66 (RNase H) specific MAb. The vpr-p51/p66 complemented virions (
Effect of Expressing p66 and vpr-p51 from Separated Plasmids
The efficiency of complementation when the Vpr-p51 and p66 subunits were expressed from separate mRNA in the transfected cells was examined. 293T cells were cotransfected with M7, pLR2P-vpr-p51 (vpr-51), pLR2P-p66 (p66) and vpr-IN and progeny virions were analyzed. Infectivity was rescued to levels similar to that exhibited previously using vpr-p51/p66, about 10-13% of wildtype SG3. Complementation analysis using either vpr-p51 or p66 only rescued infectivity by 0.1% and 0.2% of wildtype SG3, respectively (lanes 2 and 3). These results indicate rescue of M7 virion infectivity when p66 and Vpr-p51 are coexpressed from separate mRNAs. Expression of Vpr-p51 and p66 from separate genetic elements facilitates the manipulation of this approach for analyzing RT function, since this allows the ratios of the two plasmids to be varied.
Distinction between Vpr-p51 and p66 on Immunoblots
The vpr-p51/p66 construct places vpr and RT in-frame, and preserves the N-terminal protease cleavage site of RT by including 11 amino acids of PR (11Pro) between Vpr and RT. Thus, the molecular mass of the unprocessed Vpr-p51 fusion protein is indistinguishable from that of p66 when analyzed by Western blotting. This has necessitated the use of a MAb specific to the RNase H domain for specific detection of p66 in virions. To distinguish between these two proteins (Vpr-p51 and p66) by molecular mass, PR sequence encoding 30, 45 or 60 amino acids was introduced between the Vpr and p51 coding regions in vpr-p51 (vpr-30Prop51/p66, vpr-45Prop51/p66 and vpr-60Prop51/p66, respectively). Immunoblot analysis of virions derived by cotransfection of vpr-30Prop51/p66 along with M7 into 293T cells showed that adding 30 amino acids of PR was not sufficient to clearly differentiate Vpr-p51 and p66 (
Chemotherapeutic Inhibition of the Trans-RT Heterodimer
The trans-heterodimer assay is of clinical relevance for analyzing HIV-1 RT inhibitors, drug resistance and the effects of drug resistance mutations on viral fitness. To examine the response of the trans-heterodimeric RT to anti-RT drugs, transfection-derived M7 virions complemented with wildtype trans-RT (Vpr-p51/p66) were used to infect the TZM-b1 indicator cells in the absence or presence of either 3TC (0.04, 0.2 and 1.0 μM) or nevirapine (1.0, 5.0 and 5.0 μM). Both drugs exerted a potent, dosage-dependent antiviral effect, as evidenced by an inhibition of infectivity. The IC50s for 3TC and nevirapine were 0.138 and 0.011 mM, respectively. These results indicate that the effects of both NRTIs and NNRTIs on the trans-heterodimeric RT are similar to those observed for RT derived from the Gag-Pol precursor of HIV-1 provirus (
Discussion
Vpr-p51 and p66 form an intracellular dimer (Vpr-p51/p66) that is specifically incorporated into virions, processed by the viral PR to liberate p51/p66, and rescues the infectivity of RT-deficient HIV-1. By analyzing mutations in the YMDD aspartates of either p51 or p66 the function of these residues in the context of an infectious virus was delineated. The absence of minus-strand strong-stop DNA synthesis in cells infected with virus, in which the YMDD aspartates of p66 were mutated, corroborates findings from previous in vitro studies, and demonstrates that in a heterodimer, p66 is solely responsible for the catalytic/polymerase function of RT in vivo. The analysis of the p51 subunit indicates that mutations in the YMDD aspartates impair virus infection and DNA synthesis due to an effect on RT structure rather than catalytic function.
The YXDD motif (SEQ ID NO: 9) of retroviral RTs is highly conserved and it has been described in the active site of many viral and cellular polymerases (Kamer and Argos, 1984; Toh et al., 1983). The HIV-1 YMDD motif is situated in the palm domain (Ding et al., 1998; Kohlstaedt et al., 1992; Sarafianos et al., 2001). The Y183 and M184 amino acid residues contribute to the dNTP binding pocket of p66 (Huang et al., 1998). While some substitutions of these residues are tolerated, most mutations at these sites reduce polymerase function (Lowe et al., 1991; Wakefield et al., 1992). The most conserved feature of the YMDD motif is the aspartates (D185 and D186), which together with a third aspartate (D110) form the polymerase catalytic triad. Mutation of the aspartates abolishes RT catalytic function and virus infectivity (Boyer et al., 1992; Larder et al., 1987b; Lowe et al., 1991). The role of the catalytic aspartates in each RT subunit has been studied by expressing p51 and p66 separately in Escherichia coli (Hostomsky et al., 1992; Le Grice et al., 1991). Recombinant heterodimers containing polymerase active site mutations exclusive to p51 retain almost wild-type levels of polymerase activity, whereas heterodimers containing the same mutation(s) in p66 appear to be defective in polymerase activity. In the RT heterodimer, the polymerase domain of p51 assumes a closed conformation (Kohlstaedt et al., 1992), and therefore p51 does not appear to play a catalytic role in reverse transcription in vivo.
The role of the p51 YMDD aspartates in reverse transcription was investigated by analyzing the effects that different mutations had on reverse transcription and virus infectivity. The p51 YMDD aspartates were substituted with both conservative and non-conservative amino acid residues. The YMNN mutant is relatively conservative, since asparagine is almost isosteric to, but less charged than, Asp. In the YMEE mutant the length of the side chain is increased by one methylene group without changing the negative charge. Similar to aspartate, asparagine and glutamine are capable of participating in hydrogen bond interactions through their side chains. These two p51 mutants caused a slight reduction of infectivity and DNA synthesis. Substitution of the p51 YMDD aspartates with either alanines (YMAA) or lysines (YMKK) drastically reduced infectivity and DNA synthesis. The alanines have a short hydrophobic side chain that cannot make hydrogen bonds with neighboring polar residues. The lysines present an opposite polarity through a lengthened side chain. Small changes in charge and/or length of the side-chain can be tolerated (i.e. YMNN and YMEE), however, a charge shift and/or substantial changes in side chain length are not (i.e. YMKK and YMAA). These findings show that side chain interactions of p51 YMDD aspartates are important for RT function.
The D185 and D186 residues of p51 YMDD are within interacting distance (approximately 3 Å) of residues T409 and W410 of the p51 connection subdomain. The T409 and W410 residues lie in the loop between alpha helix L (αL) and beta sheet 20 (β20). This loop is a part of the putative “tryptophan motif” (Trp-motif) of the p51 connection subdomain, which is believed to be critical for p51-p66 dimerization (Baillon et al., 1991; Divita et al., 1994; Tachedjian et al., 2003). It is plausible that mutation at the p51 YMDD aspartates cause repositioning of the αL-β20 loop, which in turn could affect multiple interactions involving the Trp-motif and the heterodimer interface. The orientation of the αL-β20 loop could also influence template binding as these residues are in the proximity of the floor of the DNA binding cleft/RNase H primer grip, which includes K390, K395 and E396 of p51 that interact directly with the template-primer (Huang et al., 1998; Sarafianos et al., 2001). Mutation of the p51 YMDD aspartates may also affect intermolecular interactions that maintain its structure in the RT heterodimer. In the p51 subunit, the connection subdomain folds into the expanded cleft between its fingers and thumb subdomains, which gives it a “closed” conformation. Since the connection subdomain of p51 makes multiple contacts with the three other subdomains of p51 (fingers, palm and thumb), destabilization of the interaction between the αL-β20 loop and YMDD can have global effects on RT folding. In addition to the interactions with T409 and W410, the YMDD motif is buried within the core of p51, and thus, the aspartates could interact with other neighboring residues. These include interdomain interactions between D185/186 and R72 of the p51 fingers subdomain; D185 and Q151-G152 at the tip of α helix E in the palm subdomain and D185/D186 with the tryptophan-rich region of p51 (
The finding that subunit-specific analysis of RT function can be studied using infectious virus has broad implications. While the p51 subunit was believed to function primarily as a scaffold to maintain the active structure of p66 (Hughes, 2001; Telesnitsky and Goff, 1997), other functions have been suggested, including involvement in tRNA primer-binding (Arts et al., 1994; Jacques et al., 1994), loading of p66 onto the template-primer (Harris et al., 1998) and enhancement of strand displacement (Amacker et al., 1995; Hottiger et al., 1994). The dimer interface between p51 and p66 is critical for reverse transcription and it has been proposed as an ideal target for therapeutic intervention (Divita et al., 1994; Morris et al., 1999; Restle et al., 1990). This notion was supported by several studies demonstrating that mutation of amino acid residues involved in subunit interactions alter the arrangement of the RT subdomains and disrupt RT function (Ghosh et al., 1996; Menendez-Arias et al., 2001; Tachedjian et al., 2003). Mutations in p51 have been also implicated in resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) and inhibitors of RNase H activity. The E138K mutation, which confers resistance to TSAO {2′,5′-Bis-O-(tert-butyldimethylsilyl)-3′spiro-5″-(4″-amino-1″,2″-oxathiole-2″,2″-dioxide)} has been mapped to the p51 subunit (Jonckheere et al., 1994; Sluis-Cremer et al., 2000). The C280S mutation in RT causes resistance to the RNase H inhibitor N-ethylmaleimide (NEM) (Loya et al., 1997). Both the p51 and p66 subunits were found to contribute to the resistance of the enzyme to NEM in vitro.
Materials and Methods
Cells and Antibodies
The 293T, JC53 (Platt et al., 1998), and TZM-b1 cell lines (Wei et al., 2002) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplement with 10% fetal bovine serum (FBS), penicillin (100 units/ml) and streptomycin (0.1 mg/ml). The anti-RT antiserum (R1465) was generated against HIV-1 RT expressed in E. coli. Briefly, the entire RT coding region of HIV-1/pSG3 was ligated into the prokaryotic pGEX expression vector (pGEX-RT). E. coli (DH5α) were transformed with pGEX-RT and protein expression was induced with isopropyl β-D-thiogalactopyranoside (IPTG). Expression of the glutathione S-transferase-(gst) RT fusion protein was confirmed by SDS-PAGE. Soluble gst-RT protein was purified and RT was released by thrombin cleavage using previously described procedures (Smith and Johnson, 1988). New Zealand white female rabbits were immunized subcutaneously with 200 μg of purified RT protein emulsified in an equal volume of Freund's complete adjuvant. Rabbits were boosted at two week intervals with 200 μg of RT mixed with an equal volume of Freund's incomplete adjuvant. Sera were tittered and analyzed for specificity by immunoblotting against purified preparations of both the immunizing protein and concentrated HIV-1 virions. Additional antibodies used in these studies included monoclonal antibodies to HIV-1 capsid (183-H12-5C) and HIV-1 RT (8C4 and 7E5.
HIV-1 Proviral Clones
The HIV-1 pSG3 proviral clone (SG3) (Ghosh et al., 1993) (Genbank Accession #L02317) was used to produce wild-type virus, and to construct RT deficient proviral clones and all recombinant RT and IN expression plasmids. The pSG3FN (FN) clone was constructed using the strategy described by Dubay et. al. (Dubay et al., 1992) for the HXB2 pFN clone (
The pSG3M7 (M7) proviral construct was created from pSG3S-RT (S-RT) (Wu et al., 1997). In addition to stop codons in the RT and IN coding regions of pSG3S-RT, M7 contains three additional stop codons at amino acid positions 441 (TAA), 444 (TGA) and 447 (TAG) and a D443N RNase H catalytic mutation in the RNase H reading frame. The primers (sense [5′-AAGCCCGGGATGGATGGCCCAAAAGT-3′], SEQ ID NO: 10 and antisense [5′-TCCTAAACGCGTCTCCCTCTAAGCTGCTCAATTTACTTAGAAAGT-3′], SEQ ID NO: 11) containing XmaI and MluI sites, respectively, and the primers (sense [5′-ACTTTCTAAGTAAATTGAGCAGCTTAGAGGGAGACGCGTTTAGGA-3′] (SEQ ID NO: 12) and antisense [5′-TATGTCGACACCCAATTATGAAAAG-3′] (SEQ ID NO: 13)) containing MluI and SalI sites, respectively, were used to amplify two DNA fragments from the S-RT constructs (nucleotides 2132-3455 and 3410-5340). The XmaI-MluI and MluI-SalI PCR products were digested with corresponding restriction endonucleases, purified and ligated together into an XmaI-SalI cut pSG3S-RT plasmid.
Construction of Heterodimeric RT Expression Plasmid
To express the RT subunits in trans with RT-minus proviral DNA, the pLR2P-vpr-p51-IRES-p66 (vpr-p51/p66) expression plasmid was constructed. Briefly, the sense [5′-TAGATCAGATCTGTTGACTCAGATTGGTTGCA-3′] (SEQ ID NO: 14) and antisense [5′-ATCTACACGCGTTTAGAAGGTTTCTGCGCCTT-3′] (SEQ ID NO: 15) primers containing the BglII and MluI restriction sites (underlined), respectively, were used to PCR amplify a p51-containing DNA fragment from pSG3. The internal ribosome entry site (RES) was PCR amplified from the encephalomyocarditis virus (EMCV) (Duke et al., 1992) (Genbank Accession #NC—001479) using the sense ([5′-TTATTAACGCGTCCGCCCCTCTCCCTCCCCCC-3′] (SEQ ID NO: 16) and antisense [5′-CCATCCCGGGCTTTAATTTTACTGGTACAGTTTCAATAGGAC TAATGGGTCCCATGGTATTATCGTCTT-3′] (SEQ ID NO: 17) primers containing MluI and XmaI sites (underlined), respectively. The PCR-derived p51 fragment was digested with BglII and MluI, while the IRES fragment was digested with MluI and XmaI. These two fragments were ligated simultaneously into the BglII-XmaI-cut pLR2P-vprRT (Wu et al., 1997), generating pLR2P-vpr-p51-IRES-p66. This construction strategy (
Transfections and Analysis of Virus Infectivity
DNA transfections were performed on monolayer cultures of 293T cells grown in E-well plates using the calcium phosphate DNA precipitation method. Unless otherwise noted, each cell monolayer (well) was transfected with 6 μg of proviral DNA, 3 μg of the vpr-p51/p66 constructs and 1 μg of the vpr-IN constructs. Culture supernatants from the 293T cells were collected 60 h post-transfection, clarified by low-speed centrifugation (1000×g, 10 min), and filtered through 0.45 μm pore-size sterile filters. The clarified supernatants were analyzed for HIV-1 p24 antigen concentration by ELISA (Beckman-Coulter Inc.).
Virus infectivity was assessed using the TZM-b1 reporter cell line as described earlier (Wei et al., 2002). Briefly, virus containing supernatants were normalized for p24 antigen concentration, serially diluted (five-fold dilutions) and used to infect monolayer cultures of TZM-b1 cells. At 48 hrs post-infection, the cells were fixed and stained with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) reagent as described earlier (Kimpton and Emerman, 1992). The blue-stained cells were counted using a light microscope. Wells containing between 30 and 300 blue cells were used to calculate the infectious units of virus per ng of p24 antigen (IU/p24-ng).
Semiquantitative Detection of Viral DNA
The PCR method used to analyze the synthesis of nascent viral DNA in infected cells was similar to those described earlier (Fassati and Goff, 2001; Zack et al., 1990). Briefly, 500-ng equivalents (p24 antigen) of transfection-derived virions were incubated with DNase I (4 μg/ml; Worthington Inc.) at 37° C. for 1 hr to minimize plasmid DNA carryover. The treated virus was then used to infect one million JC53 cells for 4 hrs in DMEM (1% FBS, 10 μg/ml DEAE-dextran). The cells were washed twice with DMEM, and the medium was replaced with complete DMEM (10% FBS). At 18 hrs post-infection, the cells were lysed and total DNA was extracted by organic methods, resuspended in 200 μl of distilled water and treated with the DpnI restriction endonuclease to digest bacterially derived plasmid DNA. Each PCR subjected 250 pgs of DNA extract to 30 rounds of amplification with primers designed to detect early (R-U5 [sense nucleotides 79-99 AGCTTGCCTTGAGTGCTTCAA (SEQ ID NO: 18) and antisense nucleotides 182-157 CTGCTAGAGATTTTCCACACTGACTA] SEQ ID NO: 19) and late (R-gag [sense nucleotides 43-63 GGCTAGCTAGGGAACCCACTG (SEQ ID NO: 20) and antisense nucleotides 355-334 ATACTGACGCTCTCGCACCCAT] (SEQ ID NO: 21)) viral DNA. The PCR products were separated on a 1.0% agarose gel and visualized by ethidium bromide staining. The relative amount of amplified DNA was determined by comparison to known standards (serial dilutions of pSG3 DNA).
Western Blot (Immunoblot) Analysis
Transfection-derived virions were concentrated by ultracentrifugation through 20% sucrose cushion (125,000×g, 2 hr, 4° C.) using a SW41 rotor (Beckman Inc.). Pellets were solubilized in loading buffer (62.5 mM Tris-HCl [pH 6.8], 0.2% SDS, 5% 2-mercaptoethanol, 10% glycerol), boiled, and proteins were separated on 12.0% polyacrylamide gels containing SDS. Following electrophoresis, proteins were transferred to nitrocellulose (0.2-μm pore size) by, electroblotting and incubated for 1 hr at room temperature in blocking buffer (5% nonfat dry milk in phosphate-buffered saline [PBS]). The blocked blot was exposed to the appropriate primary antibody for 1 hr in blocking buffer with constant mixing. After extensive washing, bound antibodies were detected by chemiluminescence using horseradish peroxidase-conjugated species-specific secondary antibodies (Southern Biotechnology Associates, Inc.) as described by the manufacturer (Amersham Biosciences).
Disclosed are biochemical assays for determining reverse transcriptase activity. One example of such an assay is the Chemiluminescent Reverse Transcriptase Assay by Roche (Cat. No. 1 828 657, Instruction Manual Version 3, February 2004, herein incorporated by reference in its entirety for its teaching regarding reverse transcriptase assays). The protocol is a non-radioactive enzyme immunoassay useful for highly sensitive, quantitative determination of reverse transcriptase activity by chemiluminescence detection. This assay is designed for highly-sensitive and quantitative determination of RT activity, e.g. in cell cultures and other life science research applications. The assay has been shown to be useful for the determination of RT activity derived from a variety of retroviruses, including HIV-1, HIV-2, SIV-1 and CAEV. The assay can be used to determine the propagation of retroviruses in retrovirus-infected mammalian cell cultures. The assay can also be used for in vitro screening for RT inhibitors.
Regarding Table 4: the table shows that Vpr-p51-ires-p66 rescues the infectivity of RT-IN-minus virus (M7), and viruses derived from proviral DNA containing mutations in the YMDD motif of RT, including YMAA and YMND. Virus derived from proviral DNA and the control pLR2P-vpr is not infectious. Methods: 293T cells were transfected with the indicated plasmid (either viral DNA or trans-RT DNA) DNAs plus the pLR2P-vor-IN expression plasmid DNA. 48 hrs later the supernatant viruses were collected and analyzed for infectivity using the JC53-BL reporter assay.
The Trp-motif of HIV-1 is comprised of aromatic amino acids in the connection subdomain (between amino acid positions 398 and 14). Alignment analysis shows that the six tryptophans (W398, W401, W402, W406, W410 and W414) and tyrosine (Y405) residues are conserved within the connection subdomain of most primate lentiviruses (
Expression and Virion Incorporation of Hetromeric RT Containing p51 Trp-Motif Mutations
The p51 Trp-motif residues were independently mutated to alanines in the pLR2P-vpr-p51-IRES-p66 (vpr-p51/p66) expression plasmid. Wildtype and each of the mutant DNAs were cotransfected into 293T cells with the RT-IN defective M7 proviral DNA, and progeny virions were examined by immunoblot analysis. The control RT-IN-minus M7 particles (
To examine if the aberrant p66 was due to misprocessing by the viral protease (PR), 293T cells were cotransfected with a PR-defective proviral DNA (PR catalytic mutant: D25A) and vpr-p51W398A/p66. Detection of the aberrant p66 product in these virions (data not shown), suggested that it was generated independently of the HIV-1 PR.
Functional Analysis of p51 Trp-Motif RT Mutants
The functionality of the p51 Trp-motif mutants was analyzed in a single-round infectivity assay, using the TZM-b1 reporter cell line (Wei et al. Antimicrob. Agents Chemother. 46:1895-905 (2002)). Virions were generated by cotransfecting 293T cells with M7, wildtype or mutant vpr-p51/p66 and vpr-IN. vpr-IN was included since M7 lacks IN, which is required for efficient initiation of reverse transcription and for integration of the nascent viral cDNA (Mulky et al. (2004); Wu et al. J. Virol. 73:2126-35 (1999)). The infectivity of virions containing the wildtype trans-RT (Vpr-p51/p66) was normalized to 100% (
Subunit-Specific Mutagenesis of Trp-Motif Residues at the Heterodimer Interface
The analysis of inter-subunit interactions was focused initially on mutagenesis of individual residues to either alanine or leucine. The infectivity of the wildtype RT trans-heterodimer was normalized to 100% (
To further delineate these Trp-motif interactions, residues that lie within interacting distance of each other were mutated in pairs. Mutations were made in conjunction at residues W401 and W410 of p51 and p66, respectively. Infectivity analysis of p51W401A/p66W410A, p51W401A/p66W410L and p51W401L/p66W410A showing that mutagenesis of both residues together reduced viral infectivity (approximately 40%) to a significantly greater extent compared to that of the single mutations (
Analysis of the Inter-Subunit Interface in Provirus
The results indicated an interaction at the dimer interface between residues p51W401 and p66W410 that is important for subunit interaction. Additional analysis of the W401A and W410A mutations was conducted in the context of the complete HIV-1 NL4-3 proviral clone. The wildtype or mutant proviral DNAs were transfected into 293T ceils and progeny virions were analyzed for infectivity. The infectivity of virus containing the W401A mutation was less than 5% of that of wildtype (
Analysis of W401A Mutation in the RT Trans-Heterodimer
To determine the effect of the W401A proviral DNA mutation on RT, the mutation was analyzed by subunit-specific trans-complementation, wherein the mutation was present p51, p66 or both p51 and p66. The infectivity of virions complemented with the wildtype trans-heterodimeric RT was normalized to 100% (
Analysis of virions produced by coexpressing vpr-p51W401A/p66 demonstrated, as expected, wildtype levels of both subunits (
To analyze the infectivity of trans-RT complemented virions in a target cells that is more physiologically relevant, the JLTRG-R5 reporter cell line was used. These cells are derived from JLTRG cells and are of Jurkat T cell lineage. (Ochsenbauer-Jambor et al. submitted (2004); Kutsch et al. Antimicrob. Agents Chemother. 48:1652-63 (2004)). The JLTRG-R5, cells have stably integrated EGFP reporter under control of the HIV-1 LTR, and thus EGFP expression is induced by virus infection. Infectivity for the wildtype trans-RT heterodimer was normalized to 100% (
Efavirenz Enhances Subunit Interaction in the Trans-RT W401A Double Mutant
To examine the effect of dimerization enhancing drugs on the dimerization-defective W401A mutant trans-heterodimeric RT, EFV was added to the producer cells (transfected 293T cells) at concentrations ranging from 0.01-1.0 μM. Examination of virion-associated p66W401A incorporation, which is dependent upon interaction with p51W401A (Vpr-p51W401A), showed that EFV rescued subunit dimerization in a dose-dependent manner (
Discussion
Two significant problems have heretofore hindered structure/function studies of RT using infectious virus. First, RT is encoded and assembled into virions as part of the Prl60Gag-Pol polyprotein, and consequently, mutations in RT/Prl60Gag-Pol can be pleiotropic, affecting multiple steps of the viral life cycle such as assembly, maturation, etc. (Yu et al. Virology 219:29-36 (1996), Quillent et al. Virology 219:29-36 (1996), Olivares et al. (2004), Tomonaga et al. Arch. Virol. 143, 1-14 (1998)). Analogous with the results for the W401A proviral mutant, Yu et al. have reported that mutations in the polymerase primer grip decrease virion-associated RT due in part to premature Gag-Pol processing (Yu et al. Virology 219:29-36 (1996)). The second problem was due to the heterodimeric nature of the RT. The asymmetry of the p51 and p66 subdomains entails that a mutation in one subunit is structurally and functionally non-equivalent to the same mutation in the other subunit. Thus a novel trans-complementation approach for analyzing the RT heterodimer in precise was developed molecular detail in the context of infectious virions. By exploiting this approach, several relevant questions concerning HIV-1 RT biology have been answered that were previously experimentally inaccessible. Primarily, these include (i) the role of hydrophobic, amino acid residues comprising the Trp-motif for subunit interaction and RT function, (ii) the contribution of amino acids at the p51/p66 connection subdomain interface to RT dimerization and virus infection, and (iii) the availability of a biologic approach capable of assessing the effects of both dimerization enhancing and disrupting drugs.
Structural analysis of interactions in the Trp-motif with residues at the subunit interface in several complexes of RT with substrate or inhibitors shows that the side-chain of W410 in the p66 αL-β20 loop, consistently within interacting distance of p51 residues W401, Y405, and N363 (
The most severe effect on heterodimerization was observed for the p51W401A/p66W401A mutant. The presence of W401A in both subunits markedly impaired p51-p66 interaction, directly evidenced by a significant decrease in Vpr-p51W401A mediated p66W401A packaging. Based on this data, the structural analysis of several RT crystal structures and previous reports on the Trp-motif, repositioning the αL-β20 loop by mutating p66W401 and disruption of interactions involving p51W401, p51W405, p51N363 and p66W401 account for the findings. Subunit-specific mutational analysis of the W401 RT mutants demonstrates that W401 of the p66 and p51 subunits has distinct structural roles in the stabilization the RT heterodimer. In p51 the W401A mutation appears to affect the interactions at the interface, through disruption of the π-π interactions with p66W410. However, the p66-W401A mutation affects the folding of the p66 subunit because it is at the interface of two helices (αL and αK) (
Structural analysis of the dimer interface in several RT crystal structures highlighted the potential importance of a cluster of four tryptophans in p51 (W398, W402, W406 and W414) proximal to the dimer interface. While these four p51 tryptophans do not directly interact with p66 residues, they are clustered together through hydrophobic interactions and seem poised to indirectly affect the dimer interface by their proximity to residues Y405, W401, and N363 of p51 that are at the p51-p66 interface (
Cells, Antibodies and Antiviral Drugs
The 293T, JC53 (Platt et al. J. Virol. 72:2855-64 (1998), and TZM-b1 cell lines (Wei et al. Antimicrob. Agents Chemother. 46:1895-905 (2002) were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), penicillin (100 units/ml) and streptomycin (0.1 mg/ml). The JLTRG-R5 cell line 34 was maintained in Roswell Park Memorial Institute (RPMI) 1640 medium containing 15% FBS and gentamycin (0.1 mg/ml). Antibodies used included polyclonal anti-RT and anti-Vpr sera (Wu et al. J. Viroi. 69:389-98 (1995) and mAbs to human α-tubulin (Sigma), HIV-1 CA (183-H12-5C) and HIV-1 RT and RNase H (8C4 and 7E5), respectively, obtained through the NIH AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH.
Plasmid Constructs
The HIV-1 pSG3 (SG3) proviral clone (Genbank Accession #L02317) (Ghosh et al. Virology 194:858-64 (1993)) was used to produce wildtype virus, and to construct the RT-deficient proviral clone and all recombinant RT and IN expression plasmids (for abbreviations of plasmids see Table 3). The pSG3 (FN) clone was constructed using the strategy described by Dubay et al. (J. Virol. 66:6616-25, 1992) for the HXB2 pFN clone (
Construction of Heterodimeric RT Expression Plasmids.
The pLR2P-vpr-p51-IRES-p66 (vpr-p51/p66) plasmid was constructed for independent expression of the RT subunits in trans. Since the molecular mass of the unprocessed Vpr-p51 fusion protein is very similar to that of p66, these two proteins are not distinguishable using antibody directed to the polymerase domain of RT. To allow differentiation between Vpr-p51 and p66 by molecular mass, three derivatives of the original vpr-p51/p66 construct were made. These constructs were generated by including additional PR sequence 5′ of the p51-coding region in vpr-p51. Either 90, 120 or 150 bps of PR sequence (encoding 30, 45 and 60 amino acids, respectively) were introduced at this position, generating vpr-30Prop51/p66, vpr-45Prop51/p66 and vpr-60Prop51/p66, respectively. The vpr-p51/p66-IN was constructed by cutting the pLR2P-vpr-RT-IN plasmid with XmaI-XhoI and ligating the RT-IN fragment with XmaI-XhoI cut pLR2P-vpr-p51-IRES-p66. The vpr-Δp51/p66 control plasmid was constructed to contain a translational stop codon at the first amino acid position of p51. Other derivatives of vpr-p51/p66 were constructed using PCR-based site-directed mutagenesis and cloning into the BglII-MluI or XmaI-XhoI sites of either p51 or p66, respectively. All clones were confirmed by nucleotide sequencing.
Transfection and Analysis of Virus Infectivity
DNA transfections were performed on monolayer cultures of 293T cells grown in 6-well plates using the calcium phosphate DNA precipitation method. Unless otherwise noted, each cell monolayer (well) was transfected with 6 μg of proviral DNA, 3 μg of the vpr-p51/p66 constructs and 1 μg of the vpr-lN construct. Culture supernatants from the 293T cells were collected 60 h post-transfection, clarified by low-speed centrifugation (1000×g, 10 min), and filtered through 0.45 μm pore-size sterile filers. The clarified supernatants were analyzed for HIV-1 p24 concentration by ELISA (Beckman-Coulter Inc.).
Virus infectivity was assessed using the TZM-b1 reporter cell line as described earlier (Wei et al. Antimicrob. Agents Chemother. 46:1895-905 (2002)). Briefly, virus containing supernatants were normalized for p24 antigen concentration, serially diluted (five-fold dilutions) and used to infect monolayer cultures of TZM-b1 cells. At 48 h post-infection, the cells were fixed and stained with 5-bromo-4-chloro-3-indolyl-β-D-galacto X-gal staining, the blue-stained cells were counted using a light microscope. Wells containing between 30 and 300 blue cells were used to calculate the infectious units of virus per ng of p24 antigen (IU/p24-ng).
The ability of trans-RT-containing virions to infect T cells was tested by quantitatively analyzing infection of the JLTRG-R5 reporter T cell line. 12-well flat-bottomed culture plates containing 1.0×105 JLTRG-R5 cells were infected at a multipilicity of infection (MOI) of 5.0 (as determined by the TZM-b1 assay) for the wildtype Vpr-p51/p66 complemented virons. The other trans-RT-containing virion preparations were normalized for p24 antigen equivalent to that of that of the wildtype trans-RT. The total volume was adjusted to 1 ml and the infection was carried at 37° C. for 24 h. At 24 h post-infection, 1 ml of fresh RPMI 1640 was added to each well and culture was continued at 37° C. for an additional 48 h. Then the cells were washed (2×) in phosphate buffered saline (PBS). The cell pellet was resuspended in 50 μl PBS and then fixed in 1% paraformaldehyde (in PBS). The expression of EGFP was measured using a FACStar Plus flow cytometer with CellQuest software (Becton Dickinson).
Effects of NNRT is on Trans-RT Subunit Interaction
DNA transfections were performed on monolayer cultures of 293T cells grown in 6-well plates using the FuGENE 6 Transfection Reagent (Roche), as recommended by manufacturer. The M7 and vpr-p51/p66-based plasmids were used at a ratio of 2:1. At 24 h post-transfection, the specified concentrations of drug were added. Culture supernatants from the 293T cells were collected 60 h post-transfection, clarified by low-speed centrifugation (1000×g, 10 min), and filtered through 0.45 μm pore-size sterile filters. The clarified supernatants were processed for and analyzed by immunoblot as described below.
Immunobiot Analysis
Transfection-derived virions were concentrated by ultracentrifugation through 20% sucrose cushion (125,000×g, 2 hr, 4° C.) using a SW41 rotor (Beckman Inc.). Pellets were solubilized in Laemmli loading buffer (62.5 mM Tris-HCl [ph 6.8], 0.2% SDS, 5% 2-mercaptoethanol, 10% glycerol), boiled, and proteins were separated on 12.0% polyacrylamide gels containing SDS. Following electrophoresis, proteins were transferred to nitrocellulose (0.2-μm pore size) by electroblotting and incubated for 1 h at room temperature in blocking buffer (5% nonfat dry milk in PBS). The blocked blots were exposed to an appropriate primary antibody for 1 h in blocking buffer with constant mixing. After extension washing, bound antibodies were detected by chemiluminescence using horseradish peroxidase-conjugated species-specific secondary antibodies (Southern Biotechnology Associates, Inc.).
Inhibition of Trans-RT Using NRTI and NNRTI
Virions were derived by cotransfection of 293T cells with M7, vpr-p51/p66 and vpr-IN. The TZM-b1 cells were seeded overnight in 24-well plates at a concentration of 40,000 cells in 250 μl of medium per well. The culture medium was removed and replaced with 250 μl of DMEM containing 1% FBS and 2× drug concentrations (5-fold dilutions). 250 μl of virus suspension normalized for equal IU, as determined by TZM-b1 assay (diluted in DMEM containing 1% FBS and 80 μg/ml DEAE-dextran), was then added to the cells. The two RT drugs used in this analysis, 3TC and nevirapine, were at final concentrations ranging from 0.04-1.0 μM and 1.0-25.0 μM, respectively. The cells were fixed 48 h post-infection, stained with X-gal reagent, and the blue-stained cells were counted using a light microscope as described above. The 50% inhibition concentration (IC50) was measured with a 95% confidence interval.
The table shows the trans-complementation analysis of Vpr-p51-IRES-p66 with viruses derived from proviral DNA containing mutations in the YMDD motif of RT, including YMAA and YMND. pLR2P-vpr is used as a negative control. The results show that the trans-heterodimeric RT can be expressed with proviral DNA, including mutant DNA, and incorporated into virions produced from the said cells, and function in reverse transcription. Methods: 293T cells were transfected with the indicated plasmid (either viral DNA or trans-RT DNA) DNAs. 48 hrs later the supernatant viruses were collected and analyzed for HIV-1 p24 antigen and infectivity using the JC53-BL reporter assay.
Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.
This application claims priority to U.S. provisional applications Ser. No. 60/573,918 filed on May 24, 2004 and Ser. No. 60/668,858, filed Apr. 6, 2005, which are herein incorporated by reference in their entirety
This invention was funded by the National Institutes of Health, Grant No. AI47714. Therefore, the United States Government may have certain rights in this invention.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US05/18335 | 5/24/2005 | WO | 00 | 7/30/2009 |
| Number | Date | Country | |
|---|---|---|---|
| 60573918 | May 2004 | US | |
| 60668858 | Apr 2005 | US |