Methods and compositions for weed control

Information

  • Patent Grant
  • 10609930
  • Patent Number
    10,609,930
  • Date Filed
    Tuesday, March 11, 2014
    10 years ago
  • Date Issued
    Tuesday, April 7, 2020
    4 years ago
  • Inventors
  • Original Assignees
  • Examiners
    • Fan; Weihua
    Agents
    • Carmany-Rampey; Amanda
    • Arnold & Porter Kaye Scholer LLP
Abstract
The present invention provides novel compositions for use to enhance weed control. Specifically, the present invention provides for methods and compositions that modulate gene expression in johnsongrass. The present invention also provides for combinations of compositions and methods that enhance johnsongrass control. The invention comprises a method of Sorghum species weed control, in particular johnsongrass (Sorghum halepense) plant control comprising an external application of a herbicidal composition to a Sorghum halepense plant or a part of the Sorghum halepense plant in need of control, said herbicidal composition comprising a polynucleotide, an organosilicone surfactant concentration of about 0.2 percent or greater, and an effective dose of a nonpolynucleotide herbicide.
Description
INCORPORATION OF SEQUENCE LISTING

A computer readable form of a sequence listing is filed with this application by electronic submission and is incorporated into this application by reference in its entirety. The sequence listing is contained in the file named P34106US01_SEQ.txt, which is 415,089 bytes in size (measured in operating system MS windows) and was created on Sep. 10, 2015.


FIELD OF THE INVENTION

The invention relates generally to the field of weed management. More specifically, the invention relates to control of Sorghum weed species and compositions containing polynucleotide molecules. The invention further provides methods and compositions useful for Johnsongrass control.


BACKGROUND OF THE INVENTION

Weeds are plants that compete with cultivated plants in an agronomic environment and cost farmers billions of dollars annually in crop losses and the expense of efforts to keep weeds under control. Weeds also serve as hosts for crop diseases and insect pests. Weeds are plants that are unwanted in any particular environment. The losses caused by weeds in agricultural production environments include decreases in crop yield, reduced crop quality, increased irrigation costs, increased harvesting costs, reduced land value, injury to livestock, and crop damage from insects and diseases harbored by the weeds. The principal means by which weeds cause these effects are: 1) competing with crop plants for water, nutrients, sunlight and other essentials for growth and development, 2) production of toxic or irritant chemicals that cause human or animal health problem, 3) production of immense quantities of seed or vegetative reproductive parts or both that contaminate agricultural products and perpetuate the species in agricultural lands, and 4) production on agricultural and nonagricultural lands of vast amounts of vegetation that must be disposed of Herbicide tolerant weeds are a problem with nearly all herbicides in use, there is a need to effectively manage these weeds. There are over 365 weed biotypes currently identified as being herbicide resistant to one or more herbicides by the Herbicide Resistance Action Committee (HRAC), the North American Herbicide Resistance Action Committee (NAHRAC), and the Weed Science Society of America (WSSA).



Sorghum weed species, especially, Johnsongrass (Sorghum halepense) shattercane (Sorghum bicolor) and sudangrass (Sorghum Sudanese) are difficult to control weeds that have been shown to develop tolerance to several classes of frequently used herbicides.


The present invention provides herbicidal compositions that comprise polynucleotide compositions useful for modulating gene expression in the Sorghum weed species, johnsongrass in particular, genes providing the production of herbicide target proteins, such as, acetyl-CoA carboxylase (ACCase), acetolactate synthase (ALS large subunit and ALS small subunit, also known as acetohydroxyacid synthase, AHAS), dihydropteroate synthetase (DHPS), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glutamine synthetase (GS2), 4-hydroxyphenyl-pyruvate-dioxygenase (HPPD), phytoene desaturase (PDS), protoporphyrinogen IX oxidase (PPDX) in plants for the purpose of enhancing control of johnsongrass in an agronomic environment and for the management of herbicide resistant johnsongrass.


SUMMARY OF THE INVENTION

The invention comprises a method of Sorghum species weed control, in particular johnsongrass (Sorghum halepense) plant control comprising an external application of a herbicidal composition to a Sorghum halepense plant or a part of the Sorghum halepense plant in need of control, said herbicidal composition comprising a polynucleotide, an organosilicone surfactant concentration of about 0.2 percent or greater, and an effective dose of a nonpolynucleotide herbicide, wherein the polynucleotide is at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 1-120, wherein said treated plant is more sensitive to said nonpolynucleotide herbicide relative to a similar plant treated with a herbicide composition not containing said polynucleotide.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 1-25, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of aryloxyphenoxypropionates, cyclohexanediones and phenylpyrazoline.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 26-44, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidinyl(thio)benzoates, and sulfonylaminocarbonyl-triazolinones.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 45-59, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidinyl(thio)benzoates, and sulfonylaminocarbonyl-triazolinones.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 60-66, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of sulfonamides and asulam.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 67-74, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of glyphosate.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 75-89, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of glufosinate.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 90-96, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of triketones, isoxazoles, and pyrazoles.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 97-105, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of pyridazinones, pyridinecarboxamides, beflubutamid, fluridone, flurochloridone and flurtamone.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous polynucleotides in length and essentially identical or essentially complementary to a segment of a Sorghum halepense gene polynucleotide selected from the group consisting of SEQ ID NO: 106-120, and an organosilicone surfactant concentration of about 0.2 percent or greater, and a nonpolynucleotide herbicide selected from the group consisting of acifluorfen-Na, bifenox, chlomethoxyfen, fluoroglycofen-ethyl, fomesafen, halosafen, lactofen, oxyfluorfen, fluazolate, pyraflufen-ethyl, cinidon-ethyl, flumioxazin, flumiclorac-pentyl, fluthiacet-methyl, thidiazimin, oxadiazon, oxadiargyl, azafenidin, carfentrazone-ethyl, sulfentrazone, pentoxazone, benzfendizone, butafenacil, pyrazogyl, and profluazol.


The polynucleotide of the herbicide composition is at least 19 contiguous nucleotides, and at least 85 percent identical to a gene sequence selected from the group consisting of SEQ ID NO:1-120. The polynucleotide can also be sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA, or dsDNA/RNA hybrids.


In another aspect of the invention, the herbicide composition comprises a polynucleotide at least 19 contiguous nucleotide in length or at least 85 percent homologous to polynucleotides selected from the group consisting of SEQ ID NO: 121-386. The polynucleotide can also be sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA, or dsDNA/RNA hybrids.


In a further aspect of the invention, the polynucleotide molecule containing composition of the invention may be combined with other herbicidal compounds in a premix or tankmix to provide additional control of unwanted johnsongrass plants in a field of crop plants or combined with other agricultural chemicals to provide additional benefit to crop plants in a field treated with the herbicide composition of the invention.







DETAILED DESCRIPTION

The invention provides a method and herbicide compositions containing a polynucleotide that provide for regulation of herbicide target gene expression and enhanced control of weedy Sorghum plant species and important herbicide resistant Sorghum weed biotypes. Aspects of the method can be applied to manage johnsongrass plants in agronomic and other cultivated environments.


The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Where a term is provided in the singular, the inventors also contemplate aspects of the invention described by the plural of that term.


Herbicide activity is often directed to known enzymes in a plant cell. These enzymes include acetyl-CoA carboxylase (ACCase), acetolactate synthase (ALS large subunit and ALS small subunit, also known as acetohydroxyacid synthase, AHAS), dihydropteroate synthetase (DHPS), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glutamine synthetase (GS2), 4-hydroxyphenyl-pyruvate-dioxygenase (HPPD), phytoene desaturase (PDS), and protoporphyrinogen IX oxidase (PPDX). Plant genes encode for these enzymes and the polynucleotides that provide for the expression of these enzymes have been isolated from johnsongrass (Sorghum halepense) in the invention. The genes that encode for these enzymes are herein referred to as herbicide target genes.


The Acetyl-CoA carboxylase (ACCase) enzyme catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, this is the first and the committed step in the biosynthesis of long-chain fatty acids. This enzyme is the target of many herbicides that include members of the chemical families of aryloxyphenoxypropionates, cyclohexanediones and phenylpyrazoline, that include, but are not limited to an aryloxyphenoxypropionate comprising clodinafop (Propanoic acid, 2-[4-[(5-chloro-3-fluoro-2-pyridinyl)oxy]phenoxy]-2-propynyl ester, (2R)), cyhalofop (butyl(2R)-2-[4-(4-cyano-2-fluorophenoxy)phenoxy]propionate), diclofop(methyl 2-[4-(2,4-dichlorophenoxy)phenoxy]propanoate), fenoxaprop (ethyl(R)-2-[4-(6-chloro-1,3-benzoxazol-2-yloxy)phenoxy]propionate), fluazifop (2R)-2-[4-[[5-(trifluoromethyl)-2-pyridinyl]oxy]phenoxy]propanoic acid), haloxyfop (2-[4-[[3-chloro-5-(trifluoromethyl)-2-pyridinyl]oxy]phenoxy]propanoic acid), propaquizafop (2-[[(1-methylethylidene)amino]oxy]ethyl(2R)-2-[4-[(6-chloro-2quinoxalinyl)oxy]phenoxy]propanoate) and quizalofop(2R)-2-[4-[(6-chloro-2-quinoxalinyl)oxy]phenoxy]propanoic acid; a cyclohexanedione comprising alloxydim(methyl 2,2-dimethyl-4,6-dioxo-5-[(1E)-1-[(2-propen-1-yloxy)imino]butyl]cyclohexanecarboxylate), butroxydim (2-[1-(ethoxyimino)propyl]-3-hydroxy-5-[2,4,6-trimethyl-3-(1-oxobutyl)phenyl]-2-cyclohexen-1-one), clethodim (2-[1-[[[(2E)-3-chloro-2-propen-1-yl]oxy]imino]propyl]-5-[2-(ethylthio)propyl]-3-hydroxy-2-cyclohexen-1-one), cycloxydim (2-[1-(ethoxyimino)butyl]-3-hydroxy-5-(tetrahydro-2H-thiopyran-3-yl)-2-cyclohexen-1-one), profoxydim (2-[1-[[2-(4-chlorophenoxy)propoxy]imino]butyl]-3-hydroxy-5-(tetrahydro-2H-thiopyran-3-yl)-2-cyclohexen-1-one), sethoxydim (2-[1-(ethoxyimino)butyl]-5-[2-(ethylthio)propyl]-3-hydroxy-2-cyclohexen-1-one), tepraloxydim (2-[1-[[[(2E)-3-chloro-2-propen-1-yl]oxy]imino]propyl]-3-hydroxy-5-(tetrahydro-2H-pyran-4-yl)-2-cyclohexen-1-one) and tralkoxydim (2-[1-(ethoxyimino)propyl]-3-hydroxy-5-(2,4,6-trimethylphenyl)-2-cyclohexen-1-one); a phenylpyrazoline comprising pinoxaden (8-(2,6-diethyl-4-methylphenyl)-1,2,4,5-tetrahydro-7-oxo-7H-pyrazolo[1,2-d][1,4,5]oxadiazepin-9-yl 2,2-dimethylpropanoate).


The ALS (acetolactate synthase, also known as acetohydroxyacid synthase, AHAS) enzyme catalyzes the first step in the synthesis of the branched-chain amino acids (valine, leucine, and isoleucine). This enzyme is the target of many herbicides that include members of the chemical families of Sulfonylureas, Imidazolinones, Triazolopyrimidines, Pyrimidinyl(thio)benzoates, and Sulfonylaminocarbonyl-triazolinones, amidosulfuron, azimsulfuron, bensulfuron-methyl, chlorimuron-ethyl, chlorsulfuron, cinosulfuron, cyclosulfamuron, ethametsulfuron-methyl, ethoxysulfuron, flazasulfuron, flupyrsulfuron-methyl-Na, foramsulfuron, halosulfuron-methyl, imazosulfuron, iodosulfuron, metsulfuron-methyl, nicosulfuron, oxasulfuron, primisulfuron-methyl, prosulfuron, pyrazosulfuron-ethyl, rimsulfuron, sulfometuron-methyl, sulfosulfuron, thifensulfuron-methyl, triasulfuron, tribenuron-methyl, trifloxysulfuron, triflusulfuron-methyl, tritosulfuron, imazapic, imazamethabenz-methyl, imazamox, imazapyr, imazaquin, imazethapyr, cloransulam-methyl, diclosulam, florasulam, flumetsulam, metosulam, bispyribac-Na, pyribenzoxim, pyriftalid, pyrithiobac-Na, pyriminobac-methyl, flucarbazone-Na, and procarbazone-Na.


The dihydropteroate synthetase (DHPS) is an enzyme involved in folic acid synthesis which is needed for purine nucleotide biosynthesis. This enzyme is the target of herbicides that include the carbamate chemical family and sulfonamides and asulam.


The EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) enzyme catalyzes the conversion of shikimate-3-phosphate into 5-enolpyruvyl-shikimate-3-phosphate, an intermediate in the biochemical pathway for creating three essential aromatic amino acids (tyrosine, phenylalanine, and tryptophan). The EPSPS enzyme is the target for the herbicide N-phosphonomethyl glycine also known as glyphosate.


The glutamine synthetase (GS2) enzyme is an essential enzyme in the metabolism of nitrogen by catalyzing the condensation of glutamate and ammonia to form glutamine. This enzyme is the target of phosphinic acids herbicides that include glufosinate-ammonium and bialaphos.


The 4-hydroxyphenyl-pyruvate-dioxygenase (HPPD) is an Fe-containing enzyme, that catalyzes the second reaction in the catabolism of tyrosine, the conversion of 4-hydroxyphenylpyruvate to homogentisate. This enzyme is the target of many herbicides that include members of the chemical families of Triketones, Isoxazoles, and Pyrazoles, includes but are not limited to Triketones, such as, mesotrione, tefuryltrione, tembotrione, and sulcotrione; Isoxazoles, such as, isoxachlortole, pyrasulfotole, and isoxaflutole; Pyrazoles, such as, benzofenap, pyrazolynate, topramezone and pyrazoxyfen. Additional HPPD inhibitors include benzobicyclon and bicyclopyrone,


The phytoene desaturase (PDS) enzyme is an essential enzyme in the carotenoid biosynthesis pathway. This enzyme is the target of herbicides that include Pyridazinones, Pyridinecarboxamides, beflubutamid, fluridone, flurochloridone and flurtamone.


Protoporphyrinogen oxidase (PPDX) catalyses the oxidation of protoporphyrinogen IX to protoporphyrin IX during the synthesis of tetrapyrrole molecules. PPDX inhibitor herbicide, which include but is not limited to acifluorfen-Na, bifenox, chlomethoxyfen, fluoroglycofen-ethyl, fomesafen, halosafen, lactofen, oxyfluorfen, fluazolate, pyraflufen-ethyl, cinidon-ethyl, flumioxazin, flumiclorac-pentyl, fluthiacet-methyl, thidiazimin, oxadiazon, oxadiargyl, azafenidin, carfentrazone-ethyl, sulfentrazone, pentoxazone, benzfendizone, butafenacil, pyrazogyl, and profluazol.


As used herein “solution” refers to homogeneous mixtures and non-homogeneous mixtures such as suspensions, colloids, micelles, and emulsions.


Weedy plants are plants that compete with cultivated plants, those of particular importance include, but are not limited to important invasive and noxious weeds and herbicide resistant biotypes in crop production, such as, Amaranthus species—A. albus, A. blitoides, A. hybridus, A. palmeri, A. powellii, A. retroflexus, A. spinosus, A. tuberculatus, and A. viridis; Ambrosia species—A. trifida, A. artemisifolia; Lolium species—L. multiflorum, L. rigidium, L perenne; Digitaria species—D. insularis; Euphorbia species—E. heterophylla; Kochia species—K. scoparia; Sorghum species—S. halepense; Conyza species—C. bonariensis, C. canadensis, C. sumatrensis; Chloris species—C. truncate; Echinochola species—E. colona, E. crus-galli; Eleusine species—E. indica; Poa species—P. annua; Plantago species—P. lanceolate; Avena species—A. fatua; Chenopodium species—C. album; Setaria species—S. viridis, Abutilon theophrasti, Ipomoea species, Sesbania, species, Cassia species, Sida species, Brachiaria, species and Solanum species.



Sorghum weed species include, but are not limited to johnsongrass (Sorghum halepense), shattercane (Sorghum biocolor), and sudangrass (Sorghum sudanese). The polynucleotide molecules of the invention were isolated from johnsongrass and may be applicable in the method and compositions to provide control of the sorghum weed species other than johnsongrass where sufficient homology and complementarity of the molecules exist.


It is contemplated that the composition of the present invention will contain multiple polynucleotides and herbicides that include any one or more polynucleotides identical or complementary to a segment of the any one or more herbicide target gene sequences, and the corresponding nonpolynucleotide herbicides. Additionally, the composition may contain a pesticide, where the pesticide is selected from the group consisting of insecticides, fungicides, nematocides, bactericides, acaricides, growth regulators, chemosterilants, semiochemicals, repellents, attractants, pheromones, feeding stimulants, and biopesticides. Any one or more of these compounds can be added to the trigger oligonucleotide to form a multi-component pesticide giving an even broader spectrum of agricultural protection. Examples of such agricultural protectants with which compounds of this invention can be formulated are: insecticides such as abamectin, acephate, azinphos-methyl, bifenthrin, buprofezin, carbofuran, chlorfenapyr, chlorpyrifos, chlorpyrifos-methyl, cyfluthrin, beta-cyfluthrin, cyhalothrin, lambda-cyhalothrin, deltamethrin, diafenthiuron, diazinon, diflubenzuron, dimethoate, esfenvalerate, fenoxycarb, fenpropathrin, fenvalerate, fipronil, flucythrinate, tau-fluvalinate, fonophos, imidacloprid, isofenphos, malathion, metaldehyde, methamidophos, methidathion, methomyl, methoprene, methoxychlor, methyl 7-chloro-2,5-dihydro-2-[[N-(methoxycarbonyl)-N-[4-(trifluoromethoxy)phenyl]amino]carbonyl]indeno[1,2-e][1,3,4]oxadiazine-4a(3H)-carboxylate (DPX-JW062), monocrotophos, oxamyl, parathion, parathion-methyl, permethrin, phorate, phosalone, phosmet, phosphamidon, pirimicarb, profenofos, rotenone, sulprofos, tebufenozide, tefluthrin, terbufos, tetrachlorvinphos, thiodicarb, tralomethrin, trichlorfon and triflumuron; most preferably a glyphosate compound is formulated with a fungicide compound or combinations of fungicides, such as azoxystrobin, benomyl, blasticidin-S, Bordeaux mixture (tribasic copper sulfate), bromuconazole, captafol, captan, carbendazim, chloroneb, chlorothalonil, copper oxychloride, copper salts, cymoxanil, cyproconazole, cyprodinil (CGA 219417), diclomezine, dicloran, difenoconazole, dimethomorph, diniconazole, diniconazole-M, dodine, edifenphos, epoxiconazole (BAS 480F), famoxadone, fenarimol, fenbuconazole, fenpiclonil, fenpropidin, fenpropimorph, fluazinam, fluquinconazole, flusilazole, flutolanil, flutriafol, folpet, fosetyl-aluminum, furalaxyl, hexaconazole, ipconazole, iprobenfos, iprodione, isoprothiolane, kasugamycin, kresoxim-methyl, mancozeb, maneb, mepronil, metalaxyl, metconazole, S-methyl 7-benzothiazolecarbothioate (CGA 245704), myclobutanil, neo-asozin (ferric methanearsonate), oxadixyl, penconazole, pencycuron, probenazole, prochloraz, propiconazole, pyrifenox, pyroquilon, quinoxyfen, spiroxamine (KWG4168), sulfur, tebuconazole, tetraconazole, thiabendazole, thiophanate-methyl, thiram, triadimefon, triadimenol, tricyclazole, trifloxystrobin, triticonazole, validamycin and vinclozolin; combinations of fungicides are common for example, cyproconazole and azoxystrobin, difenoconazole, and metalaxyl-M, fludioxonil and metalaxyl-M, mancozeb and metalaxyl-M, copper hydroxide and metalaxyl-M, cyprodinil and fludioxonil, cyproconazole and propiconazole; commercially available fungicide formulations for control of Asian soybean rust disease include, but are not limited to Quadris® (Syngenta Corp), Bravo® (Syngenta Corp), Echo 720® (Sipcam Agro Inc), Headline® 2.09EC (BASF Corp), Tilt® 3.6EC (Syngenta Corp), PropiMax™ 3.6 EC (Dow AgroSciences), Bumper® 41.8EC (MakhteshimAgan), Folicur® 3.6F (Bayer CropScience), Laredo® 25EC (Dow AgroSciences), Laredo™ 25EW (Dow AgroSciences), Stratego® 2.08F (Bayer Corp), Domark™ 125SL (Sipcam Agro USA), and Pristine®38% WDG (BASF Corp) these can be combined with glyphosate compositions as described in the present invention to provide enhanced protection from soybean rust disease; nematocides such as aldoxycarb and fenamiphos; bactericides such as streptomycin; acaricides such as amitraz, chinomethionat, chlorobenzilate, cyhexatin, dicofol, dienochlor, etoxazole, fenazaquin, fenbutatin oxide, fenpropathrin, fenpyroximate, hexythiazox, propargite, pyridaben and tebufenpyrad; and biological agents such as Bacillus thuringiensis, Bacillus thuringiensis delta endotoxin, baculovirus, and entomopathogenic bacteria, virus and fungi.


Numerous nonpolynucleotide herbicides are available that can be added to the composition of the present invention, for example, members of the herbicide families that include but are not limited to amide herbicides, aromatic acid herbicides, arsenical herbicides, benzothiazole herbicides, benzoylcyclohexanedione herbicides, benzofuranyl alkylsulfonate herbicides, carbamate herbicides, cyclohexene oxime herbicides, cyclopropylisoxazole herbicides, dicarboximide herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenyl ether herbicides, dithiocarbamate herbicides, halogenated aliphatic herbicides, imidazolinone herbicides, inorganic herbicides, nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenoxy herbicides, phenylenediamine herbicides, pyrazole herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyrimidinediamine herbicides, pyrimidinyloxybenzylamine herbicides, quaternary ammonium herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazinone herbicides, triazole herbicides, triazolone herbicides, triazolopyrimidine herbicides, uracil herbicides, and urea herbicides. In particular, the rates of use of the added herbicides can be reduced in compositions comprising the polynucleotides of the invention. Use rate reductions of the additional added herbicides can be 10-25 percent, 26-50 percent, 51-75 percent or more can be achieved that enhance the activity of the polynucleotides and herbicide composition and is contemplated as an aspect of the invention.


An agronomic field in need of johnsongrass plant control is treated by application of the herbicide composition of the present invention directly to the surface of the growing plants, such as by a spray. For example, the method is applied to control johnsongrass in a field of crop plants by spraying the field with the composition. The composition can be provided as a tank mix, a sequential treatment of components (generally the polynucleotide containing composition followed by the herbicide), or a simultaneous treatment or mixing of one or more of the components of the composition from separate containers. Treatment of the field can occur as often as needed to provide weed control and the components of the composition can be adjusted to target specific johnsongrass herbicide target genes through utilization of specific polynucleotides or polynucleotide compositions identical or complementary to the gene sequences. The composition can be applied at effective use rates according to the time of application to the field, for example, preplant, at planting, post planting, post-harvest. The nonpolynucleotide herbicides can be applied to a field at effective rates of 1 to 2000 g ai/ha (active ingredient per hectare) or more. The polynucleotides of the composition can be applied at rates of 1 to 30 grams per acre depending on the number of polynucleotide molecules as needed for effective johnsongrass control.


Crop plants in which johnsongrass weed control is needed include but are not limited to, i) corn, soybean, cotton, canola, sugar beet, alfalfa, sugarcane, rice, and wheat; ii) vegetable plants including, but not limited to, tomato, sweet pepper, hot pepper, melon, watermelon, cucumber, eggplant, cauliflower, broccoli, lettuce, spinach, onion, peas, carrots, sweet corn, Chinese cabbage, leek, fennel, pumpkin, squash or gourd, radish, Brussels sprouts, tomatillo, garden beans, dry beans, or okra; iii) culinary plants including, but not limited to, basil, parsley, coffee, or tea; or, iv) fruit plants including but not limited to apple, pear, cherry, peach, plum, apricot, banana, plantain, table grape, wine grape, citrus, avocado, mango, or berry; v) a tree grown for ornamental or commercial use, including, but not limited to, a fruit or nut tree; or, vi) an ornamental plant (e. g., an ornamental flowering plant or shrub or turf grass). The methods and compositions provided herein can also be applied to plants produced by a cutting, cloning, or grafting process (i. e., a plant not grown from a seed) include fruit trees and plants that include, but are not limited to, citrus, apples, avocados, tomatoes, eggplant, cucumber, melons, watermelons, and grapes as well as various ornamental plants. The crop plants can be transgenic and genetically engineered or genetically selected to be resistant to one or more of the nonpolynucleotide herbicides.


Polynucleotides


As used herein, the term “DNA”, “DNA molecule”, “DNA polynucleotide molecule” refers to a single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA) molecule of genomic or synthetic origin, such as, a polymer of deoxyribonucleotide bases or a DNA polynucleotide molecule. As used herein, the term “DNA sequence”, “DNA nucleotide sequence” or “DNA polynucleotide sequence” refers to the nucleotide sequence of a DNA molecule. As used herein, the term “RNA”, “RNA molecule”, “RNA polynucleotide molecule” refers to a single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA) molecule of genomic or synthetic origin, such as, a polymer of ribonucleotide bases that comprise single or double stranded regions. Unless otherwise stated, nucleotide sequences in the text of this specification are given, when read from left to right, in the 5′ to 3′ direction. The nomenclature used herein is that required by Title 37 of the United States Code of Federal Regulations § 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.


As used herein, “polynucleotide” refers to a DNA or RNA molecule containing multiple nucleotides and generally refers both to “oligonucleotides” (a polynucleotide molecule of typically 50 or fewer nucleotides in length) and polynucleotides of 51 or more nucleotides. Embodiments of this invention include compositions including oligonucleotides having a length of 19-25 nucleotides (19-mers, 20-mers, 21-mers, 22-mers, 23-mers, 24-mers, or 25-mers), or medium-length polynucleotides having a length of 26 or more nucleotides (polynucleotides of 26, 27, 28, 29, 30, 46, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 270, about 280, about 290, or about 300 nucleotides), or long polynucleotides having a length greater than about 300 nucleotides (for example, polynucleotides of between about 300 to about 400 nucleotides, between about 400 to about 500 nucleotides, between about 500 to about 600 nucleotides, between about 600 to about 700 nucleotides, between about 700 to about 800 nucleotides, between about 800 to about 900 nucleotides, between about 900 to about 1000 nucleotides, between about 300 to about 500 nucleotides, between about 300 to about 600 nucleotides, between about 300 to about 700 nucleotides, between about 300 to about 800 nucleotides, between about 300 to about 900 nucleotides, or about 1000 nucleotides in length, or even greater than about 1000 nucleotides in length, for example up to the entire length of a herbicide target gene including coding or non-coding or both coding and non-coding portions of the target gene). A herbicide target gene comprises any polynucleotide molecule of the gene in a plant cell or fragment thereof for which the modulation of the expression of the herbicide target gene product is provided by the methods and compositions of the present invention. Where a polynucleotide is double-stranded, its length can be similarly described in terms of base pairs. Oligonucleotides and polynucleotides of the present invention can be made that are essentially identical or essentially complementary to adjacent genetic elements of a gene, for example, spanning the junction region of an intron and exon, the junction region of a promoter and a transcribed region, the junction region of a 5′ leader and a coding sequence, the junction of a 3′ untranslated region and a coding sequence.


Polynucleotide compositions used in the various embodiments of this invention include compositions including oligonucleotides or polynucleotides or a mixture of both, including RNA or DNA or RNA/DNA hybrids or chemically modified oligonucleotides or polynucleotides or a mixture thereof. In some embodiments, the polynucleotide may be a combination of ribonucleotides and deoxyribonucleotides, for example, synthetic polynucleotides consisting mainly of ribonucleotides but with one or more terminal deoxyribonucleotides or synthetic polynucleotides consisting mainly of deoxyribonucleotides but with one or more terminal dideoxyribonucleotides. In some embodiments, the polynucleotide includes non-canonical nucleotides such as inosine, thiouridine, or pseudouridine. In some embodiments, the polynucleotide includes chemically modified nucleotides. Examples of chemically modified oligonucleotides or polynucleotides are well known in the art; see, for example, US Patent Publication 20110171287, US Patent Publication 20110171176, and US Patent Publication 20110152353, US Patent Publication, 20110152346, US Patent Publication 20110160082, herein incorporated by reference. For example, including but not limited to the naturally occurring phosphodiester backbone of an oligonucleotide or polynucleotide can be partially or completely modified with phosphorothioate, phosphorodithioate, or methylphosphonate internucleotide linkage modifications, modified nucleoside bases or modified sugars can be used in oligonucleotide or polynucleotide synthesis, and oligonucleotides or polynucleotides can be labeled with a fluorescent moiety (for example, fluorescein or rhodamine) or other label (for example, biotin).


The polynucleotides can be single- or double-stranded RNA or single- or double-stranded DNA or double-stranded DNA/RNA hybrids or modified analogues thereof, and can be of oligonucleotide lengths or longer. In more specific embodiments of the invention the polynucleotides that provide single-stranded RNA in the plant cell are selected from the group consisting of (a) a single-stranded RNA molecule (ssRNA), (b) a single-stranded RNA molecule that self-hybridizes to form a double-stranded RNA molecule, (c) a double-stranded RNA molecule (dsRNA), (d) a single-stranded DNA molecule (ssDNA), (e) a single-stranded DNA molecule that self-hybridizes to form a double-stranded DNA molecule, and (f) a single-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (g) a double-stranded DNA molecule (dsDNA), (h) a double-stranded DNA molecule including a modified Pol III gene that is transcribed to an RNA molecule, (i) a double-stranded, hybridized RNA/DNA molecule, or combinations thereof. In some embodiments these polynucleotides include chemically modified nucleotides or non-canonical nucleotides. In embodiments of the method the polynucleotides include double-stranded DNA formed by intramolecular hybridization, double-stranded DNA formed by intermolecular hybridization, double-stranded RNA formed by intramolecular hybridization, or double-stranded RNA formed by intermolecular hybridization. In one embodiment the polynucleotides include single-stranded DNA or single-stranded RNA that self-hybridizes to form a hairpin structure having an at least partially double-stranded structure including at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. Not intending to be bound by any mechanism, it is believed that such polynucleotides are or will produce single-stranded RNA with at least one segment that will hybridize to RNA transcribed from the gene targeted for suppression. In certain other embodiments the polynucleotides further includes a promoter, generally a promoter functional in a plant, for example, a pol II promoter, a pol III promoter, a pol IV promoter, or a pol V promoter.


The term “gene” refers to chromosomal DNA, plasmid DNA, cDNA, intron and exon DNA, artificial DNA polynucleotide, or other DNA that encodes a peptide, polypeptide, protein, or RNA transcript molecule, and the genetic elements flanking the coding sequence that are involved in the regulation of expression, such as, promoter regions, 5′ leader regions, 3′ untranslated regions. Any of the components of the herbicide target gene are potential targets for the oligonucleotides and polynucleotides of the present invention.


The polynucleotide molecules of the present invention are designed to modulate expression by inducing regulation or suppression of an endogenous herbicide target gene in a johnsongrass plant and are designed to have a nucleotide sequence essentially identical or essentially complementary to the nucleotide sequence of the gene or to the sequence of RNA transcribed from the target gene, which can be coding sequence or non-coding sequence. These effective polynucleotide molecules that modulate expression are referred to as “a trigger, or triggers”. By “essentially identical” or “essentially complementary” is meant that the trigger polynucleotides (or at least one strand of a double-stranded polynucleotide or portion thereof, or a portion of a single strand polynucleotide) are designed to hybridize to the endogenous gene noncoding sequence (including promoters and regulatory elements of the gene) or to RNA transcribed (known as messenger RNA or an RNA transcript) from the endogenous gene to effect regulation or suppression of expression of the endogenous gene. Trigger molecules are identified by “tiling” the gene targets with partially overlapping probes or non-overlapping probes of antisense or sense polynucleotides that are essentially identical or essentially complementary to the nucleotide sequence of an endogenous gene. Multiple target sequences can be aligned and sequence regions with homology in common, according to the methods of the present invention, are identified as potential trigger molecules for the multiple targets. Multiple trigger molecules of various lengths, for example 19-25 nucleotides, 26-50 nucleotides, 51-100 nucleotides, 101-200 nucleotides, 201-300 nucleotides or more can be pooled into a few treatments in order to investigate polynucleotide molecules that cover a portion of a gene sequence (for example, a portion of a coding versus a portion of a noncoding region, or a 5′ versus a 3′ portion of a gene) or an entire gene sequence including coding and noncoding regions of a target gene. Polynucleotide molecules of the pooled trigger molecules can be divided into smaller pools or single molecules in order to identify trigger molecules that provide the desired effect.


The herbicide target gene RNA and DNA polynucleotide molecules are sequenced by any number of available methods and equipment. Some of the sequencing technologies are available commercially, such as the sequencing-by-hybridization platform from Affymetrix Inc. (Sunnyvale, Calif.) and the sequencing-by-synthesis platforms from 454 Life Sciences (Bradford, Conn.), Illumina/Solexa (Hayward, Calif.) and Helicos Biosciences (Cambridge, Mass.), and the sequencing-by-ligation platform from Applied Biosystems (Foster City, Calif.), as described below. In addition to the single molecule sequencing performed using sequencing-by-synthesis of Helicos Biosciences, other single molecule sequencing technologies are encompassed by the method of the invention and include the SMRT™ technology of Pacific Biosciences, the Ion Torrent™ technology, and nanopore sequencing being developed for example, by Oxford Nanopore Technologies.


Embodiments of single-stranded polynucleotides functional in this invention have sequence complementarity that need not be 100 percent, but is at least sufficient to permit hybridization to RNA transcribed from the herbicide target gene or DNA of the herbicide target gene to form a duplex to permit a gene silencing mechanism. Thus, in embodiments, a polynucleotide fragment is designed to be essentially identical to, or essentially complementary to, a sequence of 19 or more contiguous nucleotides in either DNA gene sequence or messenger RNA transcribed from the target gene. By “essentially identical” is meant having 100 percent sequence identity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity when compared to the sequence of 19 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene; by “essentially complementary” is meant having 100 percent sequence complementarity or at least about 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence complementarity when compared to the sequence of 19 or more contiguous nucleotides in either the target gene or RNA transcribed from the target gene. In some embodiments of this invention polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to one allele or one family member of a given target gene (coding or non-coding sequence of a gene for of the present invention); in other embodiments the polynucleotide molecules are designed to have 100 percent sequence identity with or complementarity to multiple alleles or family members of a given target gene.


In certain embodiments, the polynucleotides used in the compositions that are essentially identical or essentially complementary to the target gene or transcript will comprise the predominant nucleic acid in the composition. Thus in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript will comprise at least about 50%, 75%, 95%, 98% or 100% of the nucleic acids provided in the composition by either mass or molar concentration. However, in certain embodiments, the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, or about 30% to about 50% of the nucleic acids provided in the composition by either mass or molar concentration. Also provided are compositions where the polynucleotides that are essentially identical or essentially complementary to the target gene or transcript can comprise at least about 1% to 100%, about 10% to 100%, about 20% to about 100%, about 30% to about 50%, or about 50% to a 100% of the nucleic acids provided in the composition by either mass or molar concentration.


“Identity” refers to the degree of similarity between two polynucleic acid or protein sequences. An alignment of the two sequences is performed by a suitable computer program. A widely used and accepted computer program for performing sequence alignments is CLUSTALW v1.6 (Thompson, et al. Nucl. Acids Res., 22: 4673-4680, 1994). The number of matching bases or amino acids is divided by the total number of bases or amino acids, and multiplied by 100 to obtain a percent identity. For example, if two 580 base pair sequences had 145 matched bases, they would be 25 percent identical. If the two compared sequences are of different lengths, the number of matches is divided by the shorter of the two lengths. For example, if there are 100 matched amino acids between a 200 and a 400 amino acid protein, they are 50 percent identical with respect to the shorter sequence. If the shorter sequence is less than 150 bases or 50 amino acids in length, the number of matches are divided by 150 (for nucleic acid bases) or 50 (for amino acids), and multiplied by 100 to obtain a percent identity.


Trigger molecules for specific herbicide target gene family members can be identified from coding and/or non-coding sequences of gene families of a plant or multiple plants, by aligning and selecting 200-300 polynucleotide fragments from the least homologous regions amongst the aligned sequences and evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the herbicidal phenotype. The effective segments are further subdivided into 50-60 polynucleotide fragments, prioritized by least homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by least homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments are utilized singly, or again evaluated in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the yield/quality phenotype.


Trigger molecules for broad activity against Sorghum weed species can be identified from coding and/or non-coding sequences of gene families of a plant or multiple plants, by aligning and selecting 200-300 polynucleotide fragments from the most homologous regions amongst the aligned sequences and evaluated using topically applied polynucleotides (as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA) to determine their relative effectiveness in inducing the yield/quality phenotype. The effective segments are subdivided into 50-60 polynucleotide fragments, prioritized by most homology, and reevaluated using topically applied polynucleotides. The effective 50-60 polynucleotide fragments are subdivided into 19-30 polynucleotide fragments, prioritized by most homology, and again evaluated for induction of the yield/quality phenotype. Once relative effectiveness is determined, the fragments may be utilized singly, or in combination with one or more other fragments to determine the trigger composition or mixture of trigger polynucleotides for providing the yield/quality phenotype.


Methods of making polynucleotides are well known in the art. Chemical synthesis, in vivo synthesis and in vitro synthesis methods and compositions are known in the art and include various viral elements, microbial cells, modified polymerases, and modified nucleotides. Commercial preparation of oligonucleotides often provides two deoxyribonucleotides on the 3′ end of the sense strand. Long polynucleotide molecules can be synthesized from commercially available kits, for example, kits from Applied Biosystems/Ambion (Austin, Tex.) have DNA ligated on the 5′ end in a microbial expression cassette that includes a bacterial T7 polymerase promoter that makes RNA strands that can be assembled into a dsRNA and kits provided by various manufacturers that include T7 RiboMax Express (Promega, Madison, Wis.), AmpliScribe T7-Flash (Epicentre, Madison, Wis.), and TranscriptAid T7 High Yield (Fermentas, Glen Burnie, Md.). dsRNA molecules can be produced from microbial expression cassettes in bacterial cells (Ongvarrasopone et al. ScienceAsia 33:35-39; Yin, Appl. Microbiol. Biotechnol 84:323-333, 2009; Liu et al., BMC Biotechnology 10:85, 2010) that have regulated or deficient RNase III enzyme activity or the use of various viral vectors to produce sufficient quantities of dsRNA. In some embodiments design parameters such as Reynolds score (Reynolds et al. Nature Biotechnology 22, 326-330 (2004) and Tuschl rules (Pei and Tuschl, Nature Methods 3(9): 670-676, 2006) are known in the art and are used in selecting polynucleotide sequences effective in gene silencing. In some embodiments random design or empirical selection of polynucleotide sequences is used in selecting polynucleotide sequences effective in gene silencing. In some embodiments the sequence of a polynucleotide is screened against the genomic DNA of the intended plant to minimize unintentional silencing of other genes.


The polynucleotide compositions of this invention are useful in compositions, such as solutions of polynucleotide molecules, at low concentrations, alone or in combination with other components either in the same solution or in separately applied solutions that provide a permeability-enhancing agent. While there is no upper limit on the concentrations and dosages of polynucleotide molecules that can useful in the methods of this invention, lower effective concentrations and dosages will generally be sought for efficiency. The concentrations can be adjusted in consideration of the volume of spray or treatment applied to plant leaves or other plant part surfaces, such as flower petals, stems, tubers, fruit, anthers, pollen, or seed. In one embodiment, a useful treatment for herbaceous plants using 25-mer oligonucleotide molecules is about 1 nanomole (nM) of oligonucleotide molecules per plant, for example, from about 0.05 to 1 nM per plant. Other embodiments for herbaceous plants include useful ranges of about 0.05 to about 100 nM, or about 0.1 to about 20 nM, or about 1 nM to about 10 nM of polynucleotides per plant. To illustrate embodiments of the invention, the factor 1×, when applied to oligonucleotide molecules is arbitrarily used to denote a treatment of 0.8 nM of polynucleotide molecule per plant; 10×, 8 nM of polynucleotide molecule per plant; and 100×, 80 nM of polynucleotide molecule per plant.


The polynucleotide compositions of this invention are useful in compositions, such as liquids that comprise polynucleotide molecules, alone or in combination with other components either in the same liquid or in separately applied liquids that provide a transfer agent. As used herein, a transfer agent is an agent that, when combined with a polynucleotide in a composition that is topically applied to a target plant surface, enables the polynucleotide to enter a plant cell. In certain embodiments, a transfer agent is an agent that conditions the surface of plant tissue, e. g., leaves, stems, roots, flowers, or fruits, to permeation by the polynucleotide molecules into plant cells. The transfer of polynucleotides into plant cells can be facilitated by the prior or contemporaneous application of a polynucleotide-transferring agent to the plant tissue. In some embodiments the transferring agent is applied subsequent to the application of the polynucleotide composition. The polynucleotide transfer agent enables a pathway for polynucleotides through cuticle wax barriers, stomata and/or cell wall or membrane barriers into plant cells. Suitable transfer agents to facilitate transfer of the polynucleotide into a plant cell include agents that increase permeability of the exterior of the plant or that increase permeability of plant cells to oligonucleotides or polynucleotides. Such agents to facilitate transfer of the composition into a plant cell include a chemical agent, or a physical agent, or combinations thereof. Chemical agents for conditioning or transfer include (a) surfactants, (b) an organic solvent or an aqueous solution or aqueous mixtures of organic solvents, (c) oxidizing agents, (d) acids, (e) bases, (f) oils, (g) enzymes, or combinations thereof. Embodiments of the method can optionally include an incubation step, a neutralization step (e.g., to neutralize an acid, base, or oxidizing agent, or to inactivate an enzyme), a rinsing step, or combinations thereof. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include emulsions, reverse emulsions, liposomes, and other micellar-like compositions. Embodiments of agents or treatments for conditioning of a plant to permeation by polynucleotides include counter-ions or other molecules that are known to associate with nucleic acid molecules, e. g., inorganic ammonium ions, alkyl ammonium ions, lithium ions, polyamines such as spermine, spermidine, or putrescine, and other cations. Organic solvents useful in conditioning a plant to permeation by polynucleotides include DMSO, DMF, pyridine, N-pyrrolidine, hexamethylphosphoramide, acetonitrile, dioxane, polypropylene glycol, other solvents miscible with water or that will dissolve phosphonucleotides in non-aqueous systems (such as is used in synthetic reactions). Naturally derived or synthetic oils with or without surfactants or emulsifiers can be used, e. g., plant-sourced oils, crop oils, such as those listed in the 9th Compendium of Herbicide Adjuvants, can be used, e. g., paraffinic oils, polyol fatty acid esters, or oils with short-chain molecules modified with amides or polyamines such as polyethyleneimine or N-pyrrolidine. Transfer agents include, but are not limited to, organosilicone preparations.


In certain embodiments, an organosilicone preparation that is commercially available as Silwet® L-77 surfactant having CAS Number 27306-78-1 and EPA Number: CAL.REG.NO. 5905-50073-AA, and currently available from Momentive Performance Materials, Albany, N.Y. can be used to prepare a polynucleotide composition. In certain embodiments where a Silwet L-77 organosilicone preparation is used as a pre-spray treatment of plant leaves or other plant surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation comprising Silwet L-77 in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


In certain embodiments, any of the commercially available organosilicone preparations provided such as the following Breakthru S 321, Breakthru S 200 Cat #67674-67-3, Breakthru OE 441 Cat #68937-55-3, Breakthru S 278 Cat #27306-78-1, Breakthru S 243, Breakthru S 233 Cat #134180-76-0, available from manufacturer Evonik Goldschmidt (Germany), Silwet® HS 429, Silwet® HS 312, Silwet® HS 508, Silwet® HS 604 (Momentive Performance Materials, Albany, N.Y.) can be used as transfer agents in a polynucleotide composition. In certain embodiments where an organosilicone preparation is used as a pre-spray treatment of plant leaves or other surfaces, freshly made concentrations in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) are efficacious in preparing a leaf or other plant surface for transfer of polynucleotide molecules into plant cells from a topical application on the surface. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and an organosilicone preparation in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


Organosilicone preparations used in the methods and compositions provided herein can comprise one or more effective organosilicone compounds. As used herein, the phrase “effective organosilicone compound” is used to describe any organosilicone compound that is found in an organosilicone preparation that enables a polynucleotide to enter a plant cell. In certain embodiments, an effective organosilicone compound can enable a polynucleotide to enter a plant cell in a manner permitting a polynucleotide mediated suppression of a target gene expression in the plant cell. In general, effective organosilicone compounds include, but are not limited to, compounds that can comprise: i) a trisiloxane head group that is covalently linked to, ii) an alkyl linker including, but not limited to, an n-propyl linker, that is covalently linked to, iii) a poly glycol chain, that is covalently linked to, iv) a terminal group. Trisiloxane head groups of such effective organosilicone compounds include, but are not limited to, heptamethyltrisiloxane. Alkyl linkers can include, but are not limited to, an n-propyl linker. Poly glycol chains include, but are not limited to, polyethylene glycol or polypropylene glycol. Poly glycol chains can comprise a mixture that provides an average chain length “n” of about “7.5”. In certain embodiments, the average chain length “n” can vary from about 5 to about 14. Terminal groups can include, but are not limited to, alkyl groups such as a methyl group. Effective organosilicone compounds are believed to include, but are not limited to, trisiloxane ethoxylate surfactants or polyalkylene oxide modified heptamethyl trisiloxane.




embedded image


In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a trisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone preparation that comprises an organosilicone compound comprising a heptamethyltrisiloxane head group is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments, an organosilicone composition that comprises Compound I is used in the methods and compositions provided herein. In certain embodiments of the methods and compositions provided herein, a composition that comprises a polynucleotide molecule and one or more effective organosilicone compound in the range of about 0.015 to about 2 percent by weight (wt percent) (e. g., about 0.01, 0.015, 0.02, 0.025, 0.03, 0.035, 0.04, 0.045, 0.05, 0.055, 0.06, 0.065, 0.07, 0.075, 0.08, 0.085, 0.09, 0.095, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.5 wt percent) is used or provided.


Compositions of the present invention include but are not limited components that are one or more polynucleotides essentially identical to, or essentially complementary to herbicide target gene sequence (promoter, intron, exon, 5′ untranslated region, 3′ untranslated region), a transfer agent that provides for the polynucleotide to enter a plant cell, a herbicide that complements the action of the polynucleotide, one or more additional herbicides that further enhance the herbicide activity of the composition or provide an additional mode of action different from the complementing herbicide, various salts and stabilizing agents that enhance the utility of the composition as an admixture of the components of the composition.


In aspects of the invention, methods include one or more applications of a polynucleotide composition and one or more applications of a permeability-enhancing agent for conditioning of a plant to permeation by polynucleotides. When the agent for conditioning to permeation is an organosilicone composition or compound contained therein, embodiments of the polynucleotide molecules are double-stranded RNA oligonucleotides, single-stranded RNA oligonucleotides, double-stranded RNA polynucleotides, single-stranded RNA polynucleotides, double-stranded DNA oligonucleotides, single-stranded DNA oligonucleotides, double-stranded DNA polynucleotides, single-stranded DNA polynucleotides, chemically modified RNA or DNA oligonucleotides or polynucleotides or mixtures thereof.


In various embodiments, a johnsongrass herbicide target gene includes coding (protein-coding or translatable) sequence, non-coding (non-translatable) sequence, or both coding and non-coding sequence. Compositions of the invention can include polynucleotides and oligonucleotides designed to target multiple genes, or multiple segments of one or more genes. The target gene can include multiple consecutive segments of a target gene, multiple non-consecutive segments of a target gene, multiple alleles of a target gene, or multiple target genes from one or more species.


An aspect of the invention provides a method for modulating expression of an herbicide target gene in a johnsongrass plant including (a) conditioning of a plant to permeation by polynucleotides and (b) treatment of the plant with the polynucleotide molecules, wherein the polynucleotide molecules include at least one segment of 19 or more contiguous nucleotides cloned from or otherwise identified from the target gene in either anti-sense or sense orientation, whereby the polynucleotide molecules permeate the interior of the plant and induce modulation of the target gene. The conditioning and polynucleotide application can be performed separately or in a single step. When the conditioning and polynucleotide application are performed in separate steps, the conditioning can precede or can follow the polynucleotide application within minutes, hours, or days. In some embodiments more than one conditioning step or more than one polynucleotide molecule application can be performed on the same plant. In embodiments of the method, the segment can be cloned or identified from (a) coding (protein-encoding), (b) non-coding (promoter and other gene related molecules), or (c) both coding and non-coding parts of the target gene. Non-coding parts include DNA, such as promoter regions or the RNA transcribed by the DNA that provide RNA regulatory molecules, including but not limited to: introns, 5′ or 3′ untranslated regions, and microRNAs (miRNA), trans-acting siRNAs, natural anti-sense siRNAs, and other small RNAs with regulatory function or RNAs having structural or enzymatic function including but not limited to: ribozymes, ribosomal RNAs, t-RNAs, aptamers, and riboswitches.


The following examples are included to demonstrate examples of certain preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.


EXAMPLES
Example 1. Polynucleotides Related to the Herbicide Target Genes of Johnsongrass (Sorghum halepense)

Polynucleotides were isolated from johnsongrass and sequenced and those identified as noncoding or coding regions of herbicide target genes acetyl-CoA carboxylase (ACCase), acetolactate synthase (ALS large subunit and ALS small subunit, also known as acetohydroxyacid synthase, AHAS), dihydropteroate synthetase (DHPS), 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glutamine synthetase (GS2), 4-hydroxyphenyl-pyruvate-dioxygenase (HPPD), phytoene desaturase (PDS), protoporphyrinogen IX oxidase (PPDX) were selected. These are shown as SEQ ID NO:1-120.


Polynucleotide molecules were extracted from johnsongrass tissues by methods standard in the field, for example, total RNA was extracted using Trizol Reagent (Invitrogen Corp, Carlsbad, Calif. Cat. No. 15596-018), following the manufacturer's protocol or modifications thereof by those skilled in the art of polynucleotide extraction that may enhance recover or purity of the extracted RNA. Briefly, starting with approximately 1 gram of ground plant tissue for extraction. Prealiquot 10 milliliters (mL) Trizol reagent to 15 mL conical tubes. Add ground powder to tubes and shake to homogenize. Incubate the homogenized samples for 5 minutes (min) at room temperature (RT) and then add 3 mL of chloroform. Shakes tubes vigorously by hand for 15-30 seconds (sec) and incubate at RT for 3 min. Centrifuge the tubes at 7,000 revolutions per minute (rpm) for 10 min at 4 degrees C. (centigrade). Transfer the aqueous phase to a new 1.5 mL tube and add 1 volume of cold isopropanol. Incubate the samples for 20-30 min at RT and centrifuge at 10,000 rpm for 10 min at 4 degrees C. Wash pellet with Sigma-grade 80 percent ethanol. Remove the supernatant and briefly air-dry the pellet. Dissolve the RNA pellet in approximately 200 microliters of Diethylpyrocarbonate (DEPC) treated water. Heat briefly at 65 C to dissolve pellet and vortex or pipet to resuspend RNA pellet. Adjust RNA concentration to 1-2 microgram/microliter. RNA was used to make cDNA libraries by standard methods that were then sequenced.


Genomic DNA (gDNA) was extracted using EZNA SP Plant DNA Mini kit (Omega Biotek, Norcross Ga., Cat # D5511) and Lysing Matrix E tubes (Q-Biogen, Cat #6914), following the manufacturer's protocol or modifications thereof by those skilled in the art of polynucleotide extraction that may enhance recover or purity of the extracted DNA. Briefly, aliquot ground tissue to a Lysing Matrix E tube on dry ice, add 800 μl Buffer SP1 to each sample, homogenize in a bead beater for 35-45 sec, incubate on ice for 45-60 sec, centrifuge at ≥14000 rpm for 1 min at RT, add 10 microliter RNase A to the lysate, incubate at 65° C. for 10 min, centrifuge for 1 min at RT, add 280 μl Buffer SP2 and vortex to mix, incubate the samples on ice for 5 min, centrifuge at ≥10,000 g for 10 min at RT, transfer the supernatant to a homogenizer column in a 2 ml collection tube, centrifuge at 10,000 g for 2 min at RT, transfer the cleared lysate into a 1.5 ml microfuge tube, add 1.5 volumes Buffer SP3 to the cleared lysate, vortex immediately to obtain a homogeneous mixture, transfer up to 650 μl supernatant to the Hi-Bind column, centrifuge at 10,000 g for 1 min, repeat, apply 100 μl 65° C. Elution Buffer to the column, centrifuge at 10,000 g for 5 min at RT.


Next-generation DNA sequencers, such as the 454-FLX (Roche, Branford, Conn.), the SOLiD (Applied Biosystems), and the Genome Analyzer (HiSeq2000, Illumina, San Diego, Calif.) are used to provide polynucleotide sequence from the DNA and RNA extracted from the plant tissues. Raw sequence data is assembled into contigs. The contig sequence is used to identify trigger molecules that can be applied to the plant to enable regulation of the gene expression. SEQ ID NO: 1-120 (summarized in Table 1) contains the target cDNA and gDNA sequence contigs from the various herbicide target genes of johnsongrass.









TABLE 1







Johnsongrass herbicide target gene sequences


and fragments SEQ ID NO: 1-120.









SEQ




ID NO
GENE
TYPE












1
ACCase
cDNAContig


2
ACCase
cDNAContig


3
ACCase
gDNAContig


4
ACCase
gDNAContig


5
ACCase
gDNAContig


6
ACCase
gDNAContig


7
ACCase
gDNAContig


8
ACCase
gDNAContig


9
ACCase
gDNAContig


10
ACCase
gDNAContig


11
ACCase
gDNAContig


12
ACCase
gDNAContig


13
ACCase
gDNAContig


14
ACCase
gDNAContig


15
ACCase
gDNAContig


16
ACCase
gDNAContig


17
ACCase
gDNAContig


18
ACCase
gDNAContig


19
ACCase
gDNAContig


20
ACCase
gDNAContig


21
ACCase
gDNAContig


22
ACCase
gDNAContig


23
ACCase
gDNAContig


24
ACCase
gDNAContig


25
ACCase
gDNAContig


26
ALS
cDNAContig


27
ALS
cDNAContig


28
ALS
cDNAContig


29
ALS
cDNAContig


30
ALS
cDNAContig


31
ALS
gDNAContig


32
ALS
gDNAContig


33
ALS
gDNAContig


34
ALS
gDNAContig


35
ALS
gDNAContig


36
ALS
gDNAContig


37
ALS
gDNAContig


38
ALS
gDNAContig


39
ALS
gDNAContig


40
ALS
gDNAContig


41
ALS
gDNAContig


42
ALS
gDNAContig


43
ALS
gDNAContig


44
ALS
gDNAContig


45
ALS_small
cDNAContig


46
ALS_small
cDNAContig


47
ALS_small
cDNAContig


48
ALS_small
gDNAContig


49
ALS_small
gDNAContig


50
ALS_small
gDNAContig


51
ALS_small
gDNAContig


52
ALS_small
gDNAContig


53
ALS_small
gDNAContig


54
ALS_small
gDNAContig


55
ALS_small
gDNAContig


56
ALS_small
gDNAContig


57
ALS_small
gDNAContig


58
ALS_small
gDNAContig


59
ALS_small
gDNAContig


60
DHPS
cDNAContig


61
DHPS
cDNAContig


62
DHPS
gDNAContig


63
DHPS
gDNAContig


64
DHPS
gDNAContig


65
DHPS
gDNAContig


66
DHPS
gDNAContig


67
EPSPS
cDNAContig


68
EPSPS
gDNAContig


69
EPSPS
gDNAContig


70
EPSPS
gDNAContig


71
EPSPS
gDNAContig


72
EPSPS
gDNAContig


73
EPSPS
gDNAContig


74
EPSPS
gDNAContig


75
GS2
cDNAContig


76
GS2
gDNAContig


77
GS2
gDNAContig


78
GS2
gDNAContig


79
GS2
gDNAContig


80
GS2
gDNAContig


81
GS2
gDNAContig


82
GS2
gDNAContig


83
GS2
gDNAContig


84
GS2
gDNAContig


85
GS2
gDNAContig


86
GS2
gDNAContig


87
GS2
gDNAContig


88
GS2
gDNAContig


89
GS2
gDNAContig


90
HPPD
cDNAContig


91
HPPD
gDNAContig


92
HPPD
gDNAContig


93
HPPD
gDNAContig


94
HPPD
gDNAContig


95
HPPD
gDNAContig


96
HPPD
gDNAContig


97
PDS
cDNAContig


98
PDS
gDNAContig


99
PDS
gDNAContig


100
PDS
gDNAContig


101
PDS
gDNAContig


102
PDS
gDNAContig


103
PDS
gDNAContig


104
PDS
gDNAContig


105
PDS
gDNAContig


106
PPOX
cDNAContig


107
PPOX
gDNAContig


108
PPOX
gDNAContig


109
PPOX
gDNAContig


110
PPOX
gDNAContig


111
PPOX
gDNAContig


112
PPOX
cDNAContig


113
PPOX
cDNAContig


114
PPOX
gDNAContig


115
PPOX
gDNAContig


116
PPOX
gDNAContig


117
PPOX
gDNAContig


118
PPOX
gDNAContig


119
PPOX
gDNAContig


120
PPOX
gDNAContig









Example 2. Polynucleotides of the Invention Related to Trigger Molecules of the Johnsongrass Herbicide Target Genes

The gene sequences and fragments of SEQ ID NO: 1-120 were selected into short polynucleotide lengths of 30 contiguous nucleotides as shown in Table 2, SEQ ID NO:121-386. These polynucleotides are tested to select an efficacious trigger to any of the herbicide target gene sequence regions. The trigger polynucleotides are constructed as sense or anti-sense ssDNA or ssRNA, dsRNA, or dsDNA, or dsDNA/RNA hybrids and combined with an organosilicone based transfer agent and nonpolynucleotide herbicide to provide a new herbicidal composition. The polynucleotides are combined into sets of two to three polynucleotides per set, using 4-8 nM of each polynucleotide. Each polynucleotide set is prepared with the organosilicone transfer agent and applied to a johnsongrass plant or to a field of crop plants containing johnsongrass plants in combination with a nonpolynucleotide herbicide that targets one or more of the enzymes of the herbicide target genes, or followed by the nonpolynucleotide herbicide treatment one to three days later. The effect is measured as stunting the growth and/or killing of the plant and is measured 8-14 days after treatment with the herbicidal composition. The most efficacious trigger sets are identified and the individual polynucleotides are tested in the same methods as the sets are and the most efficacious single polynucleotide is identified. By this method it is possible to identify one oligonucleotide or several oligonucleotides that effect plant sensitivity to nonpolynucleotide herbicide.


It is contemplated that additional 19-30 polynucleotides can be selected from the sequences of SEQ ID NO: 1-120 that are specific for a herbicide target gene in johnsongrass or include activity against a few related weed species, for example, Sorghum bicolor and Sorghum Sudanese.









TABLE 2







Polynucleotides SEQ ID NO: 121-386.









SEQ ID




NO
SEQ
GENE





121
GGAGAATACTATTTTCTGGAGCTTAATCCC
ACCase





122
GGGAAAGTGAAGGAGATAACTTTTAAAGCC
ACCase





123
GGATAGCATGGAAGATTTAGTCTCTGCCCC
ACCase





124
GGTGAAACTCAAGTTGGATTGTGATGGGCC
ACCase





125
GGTCGCTTGGATCTTGGAGATGTCAACACC
ACCase





126
GGCTTATGGAAGCATTGGTATATCCAAACC
ACCase





127
GGCTTATGGAAGCATTGGTATATCCAAACC
ACCase





128
GGAGGATCCAATGCTTCGCCATGTGGAACC
ACCase





129
GGTCTCAGGGCTTAAAAACCTCGTCTATCC
ACCase





130
GGAGAATACTATTTTCTGGAGCTTAATCCC
ACCase





131
GGGCGAATACTATTTTTTGGAGCTTAATCC
ACCase





132
GGAGGATCCAATGCTTCGCCATGTGGAACC
ACCase





133
GGAAGGTTACAATGAAGTAAAATACACCCC
ACCase





134
GGTAATATTGACAATGAAGTAGGACGCGCC
ACCase





135
GGAGAATACTATTTTCTGGAGCTTAATCCC
ACCase





136
GGTGAAACTCAAGTTGGATTGTGATGGGCC
ACCase





137
GGAACATGAAGCTGTCCACGCCAGAATTCC
ACCase





138
GGAAGTGGTGCGATTGCCAGTGCATATTCC
ACCase





139
GGTCAGGTGTGGTTCCCAGATTCTGCAGCC
ACCase





140
GGTGTGCTGGTCGCTAACAATGGGATGGCC
ACCase





141
GGTCGCTTGGATCTTGGAGATGTCAACACC
ACCase





142
GGTTGGATCCAACCCAACCCACCCAACCCC
ACCase





143
GGATAGCATGGAAGATTTAGTCTCTGCCCC
ACCase





144
GGTGAAACTCAAGTTGGATTGTGATGGGCC
ACCase





145
GGTCGCTTGGATCTTGGAGATGTCAACACC
ACCase





146
GGTGTGCTGGTCGCTAACAATGGGATGGCC
ACCase





147
GGCGCTGCTGCCTGGCCGGCTGGCTCAGCC
ACCase





148
GGATTGGACTGGGGACGCCCCCCAGCGGCC
ACCase





149
GGTGTGCTGGTCGCTAACAATGGGATGGCC
ACCase





150
GGCGCTGCTGCCTGGCCGGCTGGCTCAGCC
ACCase





151
GGATTGGACTGGGGACGCCCCCCAGCGGCC
ACCase





152
GGGAGAGTGGATTTGGGGTTGTTTCAACCC
ACCase





153
GGTTCATTCCCCGGTCAAGGGTGAGCATCC
ACCase





154
GGGCCTTGGCAACTTCCCCGGCGACGACCC
ALS





155
GGGTGATGTGTTATTTATGTGATGTTCTCC
ALS





156
GGGCCTTGGCAACTTCCCCGGCGACGACCC
ALS





157
GGGTGATGTGTTATTTATGTGATGTTCTCC
ALS





158
GGGTGATGTGTTATTTATGTGATGTTCTCC
ALS





159
GGGCCTTGGCAACTTCCCCGGTGACGACCC
ALS





160
GGAGCGGAGACGGAGGAAGGCGTGGCACCC
ALS





161
GGCCGCCAAATAGGCCACCACGGCACCACC
ALS





162
GGCCAAGAGCATTTGCACGTCACCAATGCC
ALS





163
GGATAATAGCCGATACAGTAGCTGTCAGCC
ALS





164
GGGCGGTGAACACTGCGACTGACCCGCCCC
ALS





165
GGACTGGATGCGCCTGAAAATCACCGCACC
ALS





166
GGCGTCCCCATCGAAACCATCGCACAAGCC
ALS





167
GGGTGATGGACCCTTGGGGCATTGTTAACC
ALS





168
GGAGGCATCCAAAGATTTGGGCCGCAGCCC
ALS





169
GGACAAGCGGGCAGAGTTCGGGTTACTGCC
ALS





170
GGCCGACCGTTTCCGCCCACTCGGCAGGCC
ALS





171
GGCCGCGCAGGACGTCGCGGCATCGACACC
ALS





172
GGTTGCCGACTCACTGTCGAGCCTTGATCC
ALS





173
GGACCGCGAAGAAGACTGATTCGTGCGCCC
ALS





174
GGTGTCAACACCGCAGCGATTGCTCATCCC
ALS





175
GGTTTTGGGGTGACGACCCATGGTGGCACC
ALS





176
GGGCATCAACGCCATTCGGTCGGCCATGCC
ALS





177
GGACAGCACGACCTGCCCGATATCTCTGCC
ALS





178
GGGTGCGTCAGTTACAGCGGATGAAAAACC
ALS





179
GGTGAAGAAACGCCCGAGGAAGAAATCTCC
ALS





180
GGAGCCAGTAATGATGAAATCACGATCGCC
ALS





181
GGCGACGAGGACAGCAACGATGATGAGGCC
ALS





182
GGGTGACGTTCCCTAGATCCCAAGACAACC
ALS





183
GGCATTGAAACGAGCTTCCGTGAGGAGACC
ALS





184
GGTATCTCCAAGCTGCGTTGGTCAATTTCC
ALS





185
GGTGCCATTGATGTCGTGGGGAGGAAAACC
ALS





186
GGGGGGCATATCGTCGATGACGACGAGGCC
ALS





187
GGCCGCGCTCCAAATAAAACTGACGGCACC
ALS





188
GGCCAGAGTGGAGTTGTCAAGAACCTCTCC
ALS





189
GGTCAACTACCACGGACTTGATATCAATCC
ALS





190
GGCCGTTCATGATCGCCTACCAGGATTTCC
ALS





191
GGTGGCAATTACGCAGCTTCGCTGCGTTCC
ALS





192
GGAGATACCGACGTGAAGGTCTCTGAGCCC
ALS





193
GGACATGGCATCAATCCCGGTGATGACGCC
ALS





194
GGGCTTACCCTTCTCCAGTGCGTGGATGCC
ALS





195
GGGTTCACCGTTGCCAATGACGTCACTGCC
ALS





196
GGGTGCTGACACCTTCTGCCCGCTGGGGCC
ALS





197
GGGTATCACACCGTCGGGGGGCTCATAGCC
ALS





198
GGACTGTCGGTGAACCTGCCGGAAAAAGCC
ALS





199
GGCATGACCGCGATGAGTTGGGTGGACGCC
ALS





200
GGGGGACAATCGAAGAAGGTTCTCAAGACC
ALS





201
GGTCCTGACACCGATATAGCCGCAATGACC
ALS





202
GGAGCGGAGACGGAGGAAGGCGTGGCACCC
ALS





203
GGCCGCCAAATAGGCCACCACGGCACCACC
ALS





204
GGCCAAGAGCATTTGCACGTCACCAATGCC
ALS





205
GGATAATAGCCGATACAGTAGCTGTCAGCC
ALS





206
GGTCGGTGTCAGTGCCGTTTACTCTGGGCC
ALS





207
GGAGGGAGGCCTCCACGCACATCCCCCTCC
ALS





208
GGGCGCACCTCCTGGCCGCACGGCGCGCCC
ALS





209
GGGCCTTGGCAACTTCCCCGGCGACGACCC
ALS





210
GGGTGATGTGTTATTTATGTGATGTTCTCC
ALS





211
GGTTACAGCATGCTAGTTGTTTAGACTTCC
ALS_small





212
GGCCCCCGCTGCCGTGTCGGCGGTCGCCCC
ALS_small





213
GGTGACCAAACAGCTCAATAAGATTATTCC
ALS_small





214
GGAGCGGAGACGGAGGAAGGCGTGGCACCC
ALS_small





215
GGCCGCCAAATAGGCCACCACGGCACCACC
ALS_small





216
GGCCAAGAGCATTTGCACGTCACCAATGCC
ALS_small





217
GGATAATAGCCGATACAGTAGCTGTCAGCC
ALS_small





218
GGAACAGAAGGTATTAAAAGGGTATTACCC
DHPS





219
GGTCTGATAGAAGTCTCATCATGGGGATCC
DHPS





220
GGAGGAAAGTTTCAACCAGTGGAAGCTGCC
DHPS





221
GGTGAGAGAAGCAGAGTTATCTGGGATTCC
DHPS





222
GGAGGAAAGTTTCAACCAGTGGAAGCTGCC
DHPS





223
GGTGAGAGAAGCAGAGTTATCTGGGATTCC
DHPS





224
GGTCATTTGTTTTAGCACCTCTTGTTGACC
DHPS





225
GGAGGTAAGTTTCAACAAGTGGAAGCTGCC
DHPS





226
GGTGAGAGAAGCAGAGTTATCTGGGATTCC
DHPS





227
GGCACCTCCTAGTCTTTGCTGTCTTCATCC
DHPS





228
GGGTGCTAGCTTAAAAAAAAGATTAACACC
DHPS





229
GGCATTTACGCCAGTAATTGTACAAGGACC
DHPS





230
GGCGCCGGCGCCTCAGCTTGTACGGCCTCC
DHPS





231
GGCACTCAGGGTCTTCCTGATCTTGTTCCC
DHPS





232
GGAGTGCTGATGGGAATATCCCTTGTAGCC
DHPS





233
GGAACAGAAGGTATTAAAAGGGTATTACCC
DHPS





234
GGTCTGAGAGAACTCTCATCATGGGGATCC
DHPS





235
GGAGGAAAGTTTCAACCAATGGAAGCTGCC
DHPS





236
GGAAAAGTTTTTTGGGTGAAATATGCAACC
DHPS





237
GGGCTCTCTGTCGAAGCAGACAAAGTTGCC
EPSPS





238
GGCTCCATCAGCAGTCAGTACTTGAGTGCC
EPSPS





239
GGTCAAAAATACAAGTCCCCCAAAAATGCC
EPSPS





240
GGCTATTGATGTTAACATGAACAAAATGCC
EPSPS





241
GGCCCAACAGCTATCAGAGACGTGGCGTCC
EPSPS





242
GGCTATTGATGTTAACATGAACAAAATGCC
EPSPS





243
GGGGCATTTAATGCAGCAAAATGACAGGCC
EPSPS





244
GGAAAAGGTACTTGATTGGTTTTTTGTGCC
EPSPS





245
GGACCGAGACTAGCGTTACTGTTACTGGCC
EPSPS





246
GGACAAGGCACTTGATTGGTTTTTTGCCCC
EPSPS





247
GGCAGGCGCCGAGGAGATCGTGCTGCAGCC
EPSPS





248
GGTGGGTGTCGCCCTATGCCCCTATCGGCC
EPSPS





249
GGGCTCTCTGTCGAAGCAGACAAAGTTGCC
EPSPS





250
GGTCATCCCTAACTAGCAAACCATGTTTCC
EPSPS





251
GGCGGGCGCCGAGGAGATCGTGCTGCAGCC
EPSPS





252
GGTGGGTGTCGCCCTATGCCCCTATCGGCC
EPSPS





253
GGGCTCTCTGTCGAAGCAGACAAAGTTGCC
EPSPS





254
GGTCATCCCTAACTAGCAAACCATGTTTCC
EPSPS





255
GGCTCCATCAGCAGTCAGTACTTGAGTGCC
EPSPS





256
GGCTATTGATGTTAACATGAACAAAATGCC
EPSPS





257
GGGGCATTGAATGCAGCAAAATGACAGGCC
EPSPS





258
GGCGGGCGCCGAGGAGATCGTGCTGCAGCC
EPSPS





259
GGTGGGTGTCGCCCTATGCCCCTATCGGCC
EPSPS





260
GGGCTCTCTGTCGAAGCAGACAAAGTTGCC
EPSPS





261
GGCTCCATCAGCAGTCAGTACTTGAGTGCC
EPSPS





262
GGCTATTGATGTTAACATGAACAAAATGCC
EPSPS





263
GGGGCATTGAATGCAGCAAAATGACAGGCC
EPSPS





264
GGTGAACTAGACTGATGACTGGGCGGGTCC
EPSPS





265
GGATCCATCAGGCCCGCCTCGAACCCGGCC
EPSPS





266
GGCGGGCGCCGAGGAGATCGTGCTGCAGCC
EPSPS





267
GGGCTCTCTGTCGAAGCAGACAAAGTTGCC
EPSPS





268
GGTCATCCCTAACTAGCAAACCATGTTTCC
EPSPS





269
GGCTCCATCAGCAGTCAGTACTTGAGTGCC
EPSPS





270
GGAAAAGGTACTTGATTGGTTTTTTGTGCC
EPSPS





271
GGACCGAGACTAGCGTTACTGTTACTGGCC
EPSPS





272
GGCGCCTCGCCGGGGTTCAAGGTCATGGCC
GS2





273
GGGAGAAGACAGTGAAGTCATTCTATACCC
GS2





274
GGCACAGGGCTGCGCAAATTTTTAGTGACC
GS2





275
GGAACTCTATAAATATAAATCAAATCAACC
GS2





276
GGATTTGGAGAGGGGTTTTGGGAGACCGCC
GS2





277
GGCCCGGTGACCGATCCCAGCAAGCTGCCC
GS2





278
GGTAGGTACGGTATTGAGCAGGAGTACACC
GS2





279
GGCAACTTCTTTTGTAACCCTCAAGCTACC
GS2





280
GGCTGCTCTGTTCGTGTGGGGCGAGATACC
GS2





281
GGAAAAAAGTTCAATTTATCTCTCCCAACC
GS2





282
GGTGATCTAACATGTAAAATGTAAGACTCC
GS2





283
GGTGCCGGCGCACACACCAACTACAGCACC
GS2





284
GGCAGGCACGAGACCGCCGACATCAACACC
GS2





285
GGATTGATGTGAATCCGACTAAACAAGGCC
GS2





286
GGGGCCAACAAATTAAATCTGAGATATCCC
GS2





287
GGTGCCGGCGCACACACCAACTACAGCACC
GS2





288
GGCAGGCACGAGACCGCCGACATCAACACC
GS2





289
GGCCCGGTGACCGATCCCAGCAAGCTGCCC
GS2





290
GGTAGGTACGGTATTGAGCAGGAGTACACC
GS2





291
GGCAACTTCTTTTGTAACCCTCAAGCTACC
GS2





292
GGCCCGGTGACCGATCCCAGCAAGCTGCCC
GS2





293
GGCCCTATAATGTGCTTGGTTTCCCGTTCC
GS2





294
GGAAAAAAGTTTAATTTATCTCTCCCAGCC
GS2





295
GGACAGGGTAATTAACCCAACAATGCCTCC
GS2





296
GGACAGTGTCCTATGGTTTGGTGGGGTGCC
GS2





297
GGTGCTTGCTCTGATGCTGGTAATTGTACC
GS2





298
GGTCTGGGTGGATGCATCATGCATCATGCC
GS2





299
GGCTCATGTTGTGGGTGGATGCGTCATGCC
GS2





300
GGTAGGTACGGTATTGAGCAGGAGTACACC
GS2





301
GGCAACTTCTTTTGTAACCCTCAAGCTACC
GS2





302
GGTGCCGGCGCACACACCAACTACAGCACC
GS2





303
GGCAGGCACGAGACCGCCGACATCAACACC
GS2





304
GGCTGGGCACCCATATTTCTCCCTCGGACC
GS2





305
GGCTCCTCCAGAAATGGCTTACGGTGGGCC
GS2





306
GGAGCCACCAAGCACTGCACGGCCCCCTCC
GS2





307
GGGCCGATTGGCCGGATCGAATACTTCTCC
GS2





308
GGTCAGTCAAGCCCTGACAGCGGCCGGCCC
GS2





309
GGCAAGCATTCCACGCAGTGTCTCTCAGCC
GS2





310
GGTTCCACTAGTCTTCTTGGTCTAGTGACC
GS2





311
GGGGCCAACAAATTAAACTCTGAGATATCC
GS2





312
GGGTTTGCATGCCTCTGAAGGATCAGGCCC
GS2





313
GGCAACGTGCCGGAGCTGGCGCCGGCGGCC
HPPD





314
GGAGAACGTGCTGCTCCCACTCAACGAGCC
HPPD





315
GGCCCCGGCGTGCAGCACATGGCGCTGGCC
HPPD





316
GGCAACGTGCCGGAGCTGGCGCCGGCGGCC
HPPD





317
GGAGAACGTGCTGCTCCCACTCAACGAGCC
HPPD





318
GGCCCCGGCGTGCAGCACATGGCGCTGGCC
HPPD





319
GGTCTCCAGGGAACAAGAAGTTGCTGCGCC
HPPD





320
GGCCAGGTCGCCGCCAATTGCCGTCCAGCC
HPPD





321
GGTCTCCAGGGAACAAGAAGTTGCTGCGCC
HPPD





322
GGGCGCCCTCGCTTTCCTCTTCACGGCGCC
HPPD





323
GGCGCCGACGCCGCCACGGCCTCGCTGCCC
HPPD





324
GGAGAACGTGCTGCTCCCACTCAACGAGCC
HPPD





325
GGCCCCGGCGTGCAGCACATGGCGCTGGCC
HPPD





326
GGGCGCCCTCGCTTTCCTCTTCACGGCGCC
HPPD





327
GGGCTTCATATCTTTTTTGGAGCTTATCCC
PDS





328
GGTTTACAAAACTGTCCCAAACTGTGAACC
PDS





329
GGTGGTTCCAATCAATCGGTTAAATCATCC
PDS





330
GGGGCGTCTAGCGCCTTGCACGGGTGACCC
PDS





331
GGTTGCGCTATCGTTCATGTTTGAATGTCC
PDS





332
GGTGGTTCCTATCAATCGGTTAATTCATCC
PDS





333
GGAAGATTTGTCCATTCTGCTTGGTGCCCC
PDS





334
GGACCAAGAAAGCATCAGAACAATAATACC
PDS





335
GGATATACTCCTAGTAGTCTGTAGTGCGCC
PDS





336
GGGCTCCCCCGCCTCCACGACACTGCCTCC
PDS





337
GGTGCTACGAAATTGTCTAGAACGAGGTCC
PDS





338
GGCTTCATGAACTGTGGGTCTAATGGCTCC
PDS





339
GGACGGAGGCCCATGTGAGCAAGTTGGGCC
PDS





340
GGCAGTGGTACTAGTATCCGAAATGTGACC
PDS





341
GGTTAACTATATATTTTTGTAGATGTCGCC
PDS





342
GGCAACTCCCGACGGATCTATTGCCTCCCC
PDS





343
GGGGAAGCTTATCCCCCCTCTTATCGAGCC
PDS





344
GGTCTCTGCTCCGGTAGCGGCGCGTCTCCC
PDS





345
GGTTGCGCTATCGTTCATGTTTGAATGTCC
PDS





346
GGTGGTTCCTATCAATCGGTTAATTCATCC
PDS





347
GGAAGATTTGTCCATTCTGCTTGGTGGCCC
PDS





348
GGACCAAGAAAGCATCAGAACAATAATACC
PDS





349
GGCCTACCTTTATGGATCGAATAATCAACC
PDS





350
GGCCGGCCGGCCGGCCGACGGACCGAGACC
PDS





351
GGCGGCGACCAGGGTGATCGGATCCAAGCC
PDS





352
GGCACGCTGAAGAAGCTTGTGAACGAGTCC
PDS





353
GGCGGCAACATCACCACCGTCGAGCGCCCC
PPOX





354
GGGCCGGTCTCGGCGCGCTTGGCATCCGCC
PPOX





355
GGAGGTGCTACAAACACAGGAATTGTTTCC
PPOX





356
GGAGGTGCTACAAACACAGGAATTGTTTCC
PPOX





357
GGTTAGCAATACTCTGCCAAAGCTATTGCC
PPOX





358
GGGGACGTGCTTGTCACGGAGGCCCGCGCC
PPOX





359
GGGCCGGTCTCGGCGCGCTTGGCATCCGCC
PPOX





360
GGAGGTGCTACAAACACAGGAATTGTTTCC
PPOX





361
GGTTAGCAATACTCTGCCAAAGCTATTGCC
PPOX





362
GGGCCGGTCTCGGCGCGCTTGGCATCCGCC
PPOX





363
GGTAGAAGCATCAAATGAAAAGAATTGCCC
PPOX





364
GGATAGTTCTGTTGGAAAAGTTGAAGTCCC
PPOX





365
GGGTTTCTCTGGGATGAAGGAGCGAACACC
PPOX





366
GGACATTACTTCACAATGAGTATCACTTCC
PPOX





367
GGATCACGGTTCGCAGGTCAGCTTGTGGCC
PPOX





368
GGAGACCAGCCTGAACTTGCTTCCGAAACC
PPOX





369
GGTATATGGCATTCCAGAATTCCGTCTTCC
PPOX





370
GGTCCACCGCCGTGTCACGGACACGGCTCC
PPOX





371
GGTTATTGAGGAAAATTTGGATCAGCTGCC
PPOX





372
GGTGGCATTAACCCTGCATCATGATTTTCC
PPOX





373
GGTAGAAGCATCAAATGAAAAGAATTGCCC
PPOX





374
GGATAGTTCTGTTGGAAAAGTTGACGTCCC
PPOX





375
GGTCCTAGCTCAGTTGGTTGAGGGTATGCC
PPOX





376
GGCTCTCGCCGCCGCCGCCGCCTCGAGGCC
PPOX





377
GGTCCACCGCCGTGTCACGGACACGGCTCC
PPOX





378
GGTTATTGAGGAAAATTTGGATCAGCTGCC
PPOX





379
GGTGGCATTAACCCTGCATCATGATTTTCC
PPOX





380
GGTAGAAGCATCAAATGAAAAGAATTGCCC
PPOX





381
GGATAGTTCTGTTGGAAAAGTTGAAGTCCC
PPOX





382
GGTCCTAGCTCAGTTGGTTGAGGGTATGCC
PPOX





383
GGACATTACTTCACAATGAGTATCACTTCC
PPOX





384
GGACTCACGGCTGCTGAAGAGCTCGCCTCC
PPOX





385
GGCGGCCGCTTAGAAAACGCTGAGTTATCC
PPOX





386
GGGCGGCGGCTAATGCCACCTGGTTGAACC
PPOX









Example 3. Methods Used in the Invention Related to Treating Plants or Plant Parts with a Topical Mixture of the Trigger Molecules

Johnsongrass plants are grown in the greenhouse (30/20 C day/night T; 14 hour photoperiod) in 4 inch square pots containing Sun Gro® Redi-Earth and 3.5 kg/cubic meter Osmocote® 14-14-14 fertilizer. When the plants at 5 to 10 cm in height are pre-treated with a mixture of single-strand antisense or double-strand polynucleotides (ssDNA ro dsRNA targeting one or more of the herbicide target gene sequences from SEQ ID NO: 1-120) at 16 nM, formulated in 10 millimolar sodium phosphate buffer (pH 6.8) containing 2% ammonium sulfate and 0.5% Silwet L-77. Plants are treated manually by pipetting 10 μL of polynucleotide solution on fully expanded mature leaves, for a total of 40 microliters of solution per plant. Twenty-four and forty-eight hours later, the plants are treated with and effective dose of the nonpolynucleotide herbicide corresponding to the herbicide target gene in which the polynucleotides have homology. Four replications of each treatment is conducted. Plant height is determined just before treatment and at intervals up to twelve days after herbicide treatments to determine effect of the polynucleotide and herbicide treatments.


Example 4. A Method to Control Johnsongrass in a Field

A method to control johnsongrass in a field comprises the use of trigger polynucleotides that can modulate the expression of one or more herbicide target genes in johnsongrass. In Table 2, an analysis of herbicide target gene sequences provided a collection of 30-mer polynucleotides that can be used in compositions to affect the growth or develop or sensitivity to a polynucleotide herbicide to control multiple weed species in a field. A composition containing 1 or 2 or 3 or 4 or more of the polynucleotides of Table 2 or fragments thereof would enable broad activity of the composition against the herbicide resistant johnsongrass species or multiple Sorghum weed species that occur in a field environment.


The method includes creating a composition that comprises components that include at least one polynucleotide of Table 2 or fragment thereof or any other effective gene expression modulating polynucleotide essentially identical or essentially complementary to SEQ ID NO:1-120, a transfer agent that mobilizes the polynucleotide into a plant cell and nonpolynucleotide herbicide. The polynucleotide of the composition includes a dsRNA, ssDNA or dsDNA or a combination thereof. A composition containing a polynucleotide can have a use rate of about 1 to 30 grams or more per acre depending on the size of the polynucleotide and the number of polynucleotides in the composition. The composition may include one or more additional herbicides as needed to provide effective multi-species weed control in addition to control of johnsongrass and related weed species. A field of crop plants in need of weed plant control is treated by spray application of the composition. The composition can be provided as a tank mix, a sequential treatment of components (generally the polynucleotide followed by the nonpolynucleotide herbicide), a simultaneous treatment or mixing of one or more of the components of the composition from separate containers or as a premix of all of the components of the herbicidal composition. Members of the nonpolynucleotide herbicide families include but are not limited to amide herbicides, aromatic acid herbicides, arsenical herbicides, benzothiazole herbicides, benzoylcyclohexanedione herbicides, benzofuranyl alkylsulfonate herbicides, carbamate herbicides, cyclohexene oxime herbicides, cyclopropylisoxazole herbicides, dicarboximide herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenyl ether herbicides, dithiocarbamate herbicides, halogenated aliphatic herbicides, imidazolinone herbicides, inorganic herbicides, nitrile herbicides, organophosphorus herbicides, oxadiazolone herbicides, oxazole herbicides, phenoxy herbicides, phenylenediamine herbicides, pyrazole herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyrimidinediamine herbicides, pyrimidinyloxybenzylamine herbicides, quaternary ammonium herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, triazine herbicides, triazinone herbicides, triazole herbicides, triazolone herbicides, triazolopyrimidine herbicides, uracil herbicides, and urea herbicides. Treatment of the plants in the field can occur as often as needed to provide weed control and the components of the composition can be adjusted to target specific weed species or weed families.

Claims
  • 1. A method of controlling a Sorghum species plant comprising: treating a Sorghum species plant or a part thereof in need of control with a first herbicidal composition comprising a double-stranded RNA (dsRNA) polynucleotide, an organosilicone surfactant in a concentration of about 0.2 percent or greater by weight, and an effective dose of a nonpolynucleotide herbicide, wherein said dsRNA polynucleotide is identical or complementary to at least 21 contiguous nucleotides of a Sorghum species gene polynucleotide selected from the group consisting of SEQ ID NOs: 26, 27, 30-36, 38-41, 43, 46-57, 59-66, 76, 79, 82, 84, 86, 87, 90, 93-120, 122-129, 131-133, 136, and 140-153, wherein said Sorghum species plant is more sensitive to said nonpolynucleotide herbicide, relative to a similar plant treated with a second herbicidal composition not containing said dsRNA polynucleotide.
  • 2. The method of claim 1, wherein said Sorghum species plant is selected from the group consisting of Sorghum halepense, Sorghum bicolor, and Sorghum sudanense.
  • 3. The method of claim 1, wherein (a) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 122-129, 131-133, 136, and 140-153, and said nonpolynucleotide herbicide is selected from the group consisting of aryloxyphenoxypropionates, cyclohexanediones, and phenylpyrazoline;(b) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 26, 27, 30-36, 38-41, and 43, and said nonpolynucleotide herbicide is selected from the group consisting of sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidinyl(thio)benzoates, and sulfonylaminocarbonyl-triazolinones;(c) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 46-57 and 59 and said nonpolynucleotide herbicide is selected from the group consisting of sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidinyl(thio)benzoates, and sulfonylaminocarbonyl-triazolinones;(d) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 60-66 and said nonpolynucleotide herbicide is selected from the group consisting of sulfonamides and asulam;(e) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 76, 79, 82, 84, 86, and 87 and said nonpolynucleotide herbicide is glufosinate;(f) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 90 and 93-96 and said nonpolynucleotide herbicide is selected from the group consisting of triketones, isoxazoles, and pyrazoles;(g) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 97-105 and said nonpolynucleotide herbicide is selected from the group consisting of pyridazinones, pyridinecarboxamides, beflubutamid, fluridone, flurochloridone, and flurtamone; or(h) said Sorghum species gene polynucleotide is selected from the group consisting of SEQ ID NOs: 106-120 and said nonpolynucleotide herbicide is selected from the group consisting of acifluorfen-Na, bifenox, chlomethoxyfen, fluoroglycofen-ethyl, fomesafen, halosafen, lactofen, oxyfluorfen, fluazolate, pyraflufen-ethyl, cinidon-ethyl, flumioxazin, flumiclorac-pentyl, fluthiacet-methyl, thidiazimin, oxadiazon, oxadiargyl, azafenidin, carfentrazone-ethyl, sulfentrazone, pentoxazone, benzfendizone, butafenacil, pyrazogyl, and profluazol.
  • 4. The method of claim 1, wherein said dsRNA polynucleotide is at least 20 contiguous nucleotides in length.
  • 5. The method of claim 1, wherein said dsRNA polynucleotide is selected from the group consisting of SEQ ID NOs: 154-159, 164-201, 208-210, 218-236, 275-279, 289-301, 313-318, and 322-386.
  • 6. The method of claim 1, wherein said first herbicidal composition comprises any combination of two or more of said dsRNA polynucleotides and two or more of said nonpolynucleotide herbicides that inhibit the activity of two or more proteins selected from the group consisting of acetyl-CoA carboxylase (ACCase), acetolactate synthase (ALS) large subunit, ALS small subunit, 7,8-dihydropteroate synthase (DHPS), glutamine synthetase 2 (GS2), 4-hydroxyphenyl-pyruvate-dioxygenase (HPPD), phytoene desaturase (PDS), protoporphyrinogen IX oxidase (PPDX), and wherein said Sorghum species plant is more sensitive to said two or more nonpolynucleotide herbicides, relative to a similar plant treated with a herbicidal composition not containing said two or more dsRNA polynucleotides.
  • 7. The method of claim 1, wherein said first herbicidal composition further comprises one or more herbicides selected from the group consisting of: 5-diarylpyrazole herbicides, 2-thiopyrimidine herbicides, 3-CF3-benzene herbicides, acetamide herbicides, amide herbicides, aminoacrylate herbicides, aminotriazine herbicides, aromatic acid herbicides, arsenical herbicides, arylaminopropionic acid herbicides, arylcarboxamide herbicides, arylcyclodione herbicides, aryloxyphenoxy-propionate herbicides, azolecarboxamide herbicides, azoloazinone herbicides, azolotriazine herbicides, benzamide herbicides, benzenesulfonamide herbicides, benzhydryl herbicides, benzimidazole herbicides, benzofuran herbicides, benzofuranyl alkylsulfonate herbicides, benzohydrazide herbicides, benzoic acid herbicides, benzophenylmethanone herbicides, benzothiadiazinone herbicides, benzothiazole herbicides, benzothiazoleacetate herbicides, benzoxazole herbicides, benzoylcyclohexanedione herbicides, benzyloxymethylisoxazole herbicides, benzylpyrazole herbicides, benzylpyridine herbicides, benzylpyrimidone herbicides, bipyridylium herbicides, carbamate herbicides, chloroacetamide herbicides, chloroacetamide herbicides, chlorocarbonic acid herbicides, cyclohexanedione herbicides, cyclohexene oxime herbicides, cyclopropylisoxazole herbicides, diarylether herbicides, dicarboximide herbicides, dihydropyrancarboxamide herbicides, diketo-epoxide herbicides, diketopiperazine herbicides, dinitroaniline herbicides, dinitrophenol herbicides, diphenylether herbicides, diphenylfuranone herbicides, dithiocarbamate herbicides, fluoroalkene herbicides, glyphosate herbicides, halogenated aliphatic herbicides, hydantocidin herbicides, hydroxypyrazole herbicides, imidazolinone herbicides, indazole herbicides, indenedione herbicides, inorganic herbicides, isoxazole herbicides, isoxazolesulfone herbicides, isoxazolidinone herbicides, nicotinohydrazide herbicides, nitrile herbicides, nitrile-amide herbicides, nitropyrazole herbicides, N-phenylphthalimide herbicides, organoarsenical herbicides, organophosphates herbicides, organophosphorus herbicides, oxabicycloheptane herbicides, oxadiazole herbicides, oxadiazolebenzamide herbicides, oxadiazolone herbicides, oxazole herbicides, oxazolidinedione herbicides, oxyacetamide herbicides, phenoxy herbicides, phenoxyalkyne herbicides, phenoxycarboxylic acid herbicides, phenoxypyridazinol herbicides, phenylalkanoate herbicides, phenylcarbamate herbicides, phenylenediamine herbicides, phenylethylurea herbicides, phenylimidazole herbicides, phenylisoxazole herbicides, phenylpyrazole herbicides, phenylpyrazoline herbicides, phenylpyridazine herbicides, phenylpyridine herbicides, phenylpyrrolidone herbicides, phosphinic acid herbicides, phosphonate herbicides, phosphoroamidate herbicides, phosphorodithioate herbicides, phthalamate herbicides, propionamide herbicides, pyrazole herbicides, pyrazole-arylether herbicides, pyrazolium herbicides, pyridazine herbicides, pyridazinone herbicides, pyridine herbicides, pyridinecarboxamide herbicides, pyridinecarboxylic acid herbicides, pyridinone herbicides, pyridyl-benzylamide herbicides, pyridyl-ether-carboxamide herbicides, pyrimidinecarboxylic acid herbicides, pyrimidinediamine herbicides, pyrimidinedione herbicides, pyrimidinedione herbicides, pyrimidinone herbicides, pyrimidinyl(thio)benzoate herbicides, pyriinidinyloxybenzylamine herbicides, pyrimidylmethanol herbicides, pyrrolidone herbicides, quaternary Ammonium herbicides, quinoline-carboxylic acid herbicides, quinoxaline herbicides, semicarbazone herbicides, sulfonamide herbicides, sulfonylamino-carbonyl-triazolinone herbicides, sulfonylurea herbicides, sulfonylurea herbicides, tetrazolinone herbicides, thiadiazole herbicides, thiatriazine herbicides, thienopyrimidine herbicides, thiocarbamate herbicides, thiocarbonate herbicides, thiourea herbicides, tolyltriazole herbicides, triazine herbicides, triazinedione herbicides, triazine-sulfonanilide herbicides, triazinone herbicides, triazole herbicides, triazolecarboxamide herbicides, triazoleimine herbicides, triazolinone herbicides, triazolone herbicides, triazolopyrimidine herbicides, triketone herbicides, uracil herbicides, and urea herbicides.
  • 8. The method of claim 1, wherein said organosilicone surfactant is in a concentration of about 0.2 percent to about 2.0 percent by weight.
  • 9. A herbicidal composition comprising an admixture of a dsRNA polynucleotide, an organosilicone surfactant in a concentration of about 0.2 percent or greater by weight, and an effective dose of a nonpolynucleotide herbicide, wherein said dsRNA polynucleotide is identical or complementary to at least 21 contiguous nucleotides of a Sorghum species gene polynucleotide selected from the group consisting of SEQ ID NOs: 26, 27, 30-36, 38-41, 43, 46-57, 59-66, 76, 79, 82, 84, 86, 87, 90, 93-120, 122-129, 131-133, 136, and 140-153, wherein a Sorghum species plant treated with said herbicidal composition is more sensitive to said nonpolynucleotide herbicide, relative to a similar plant treated with a herbicidal composition not containing said dsRNA polynucleotide.
  • 10. The herbicidal composition of claim 9, wherein said dsRNA polynucleotide is selected from the group consisting of SEQ ID NOs: 154-159, 164-201, 208-210, 218-236, 275-279, 289-301, 313-318, and 322-386.
  • 11. The herbicidal composition of claim 9, further comprising a pesticide, wherein said pesticide is selected from the group consisting of insecticides, fungicides, nematicides, bactericides, acaricides, growth regulators, chemosterilants, semiochemicals, repellents, attractants, pheromones, feeding stimulants, and biopesticides.
  • 12. The herbicidal composition of claim 9, comprising a premix or a tankmix combination.
CROSS REFERENCE TO RELATED APPLICATIONS

This application is a U.S. National Stage Application of PCT/US2014/023409, filed on Mar. 11, 2014, which claims the benefit of U.S. Provisional Application No. 61/779,476, filed on Mar. 13, 2013, which is incorporated by reference in its entirety herein.

PCT Information
Filing Document Filing Date Country Kind
PCT/US2014/023409 3/11/2014 WO 00
Publishing Document Publishing Date Country Kind
WO2014/164761 10/9/2014 WO A
US Referenced Citations (389)
Number Name Date Kind
3687808 Merigan et al. Aug 1972 A
3791932 Schuurs et al. Feb 1974 A
3839153 Schuurs et al. Oct 1974 A
3850578 McConnell Nov 1974 A
3850752 Schuurs et al. Nov 1974 A
3853987 Dreyer Dec 1974 A
3867517 Ling Feb 1975 A
3879262 Schuurs et al. Apr 1975 A
3901654 Gross Aug 1975 A
3935074 Rubenstein et al. Jan 1976 A
3984533 Uzgiris Oct 1976 A
3996345 Ullman et al. Dec 1976 A
4034074 Miles Jul 1977 A
4098876 Piasio et al. Jul 1978 A
4469863 Ts'o et al. Sep 1984 A
4476301 Imbach et al. Oct 1984 A
4535060 Comai Aug 1985 A
4581847 Hibberd et al. Apr 1986 A
4666828 Gusella May 1987 A
4683202 Mullis Jul 1987 A
4761373 Anderson et al. Aug 1988 A
4769061 Comai Sep 1988 A
4801531 Frossard Jan 1989 A
4810648 Stalker Mar 1989 A
4879219 Wands et al. Nov 1989 A
4940835 Shah et al. Jul 1990 A
4971908 Kishore et al. Nov 1990 A
5004863 Umbeck Apr 1991 A
5011771 Bellet et al. Apr 1991 A
5013659 Bedbrook et al. May 1991 A
5015580 Christou et al. May 1991 A
5023243 Tullis Jun 1991 A
5034506 Summerton et al. Jul 1991 A
5094945 Comai Mar 1992 A
5141870 Bedbrook et al. Aug 1992 A
5145783 Kishore et al. Sep 1992 A
5159135 Umbeck Oct 1992 A
5166315 Summerton et al. Nov 1992 A
5177196 Meyer, Jr. et al. Jan 1993 A
5185444 Summerton et al. Feb 1993 A
5188642 Shah et al. Feb 1993 A
5188897 Suhadolnik et al. Feb 1993 A
5192659 Simons Mar 1993 A
5214134 Weis et al. May 1993 A
5216141 Benner Jun 1993 A
5235033 Summerton et al. Aug 1993 A
5264423 Cohen et al. Nov 1993 A
5264562 Matteucci Nov 1993 A
5264564 Matteucci Nov 1993 A
5272057 Smulson et al. Dec 1993 A
5276019 Cohen et al. Jan 1994 A
5281521 Trojanowski et al. Jan 1994 A
5286634 Stadler et al. Feb 1994 A
5286717 Cohen et al. Feb 1994 A
5304732 Anderson et al. Apr 1994 A
5310667 Eichholtz et al. May 1994 A
5312910 Kishore et al. May 1994 A
5321131 Agrawal et al. Jun 1994 A
5331107 Anderson et al. Jul 1994 A
5339107 Henry et al. Aug 1994 A
5346107 Bouix et al. Sep 1994 A
5378824 Bedbrook et al. Jan 1995 A
5384253 Krzyzek et al. Jan 1995 A
5390667 Kumakura et al. Feb 1995 A
5392910 Bell et al. Feb 1995 A
5393175 Courville Feb 1995 A
5399676 Froehler Mar 1995 A
5405938 Summerton et al. Apr 1995 A
5405939 Suhadolnik et al. Apr 1995 A
5416011 Hinchee et al. May 1995 A
5453496 Caruthers et al. Sep 1995 A
5455233 Spielvogel et al. Oct 1995 A
5459127 Felgner et al. Oct 1995 A
5460667 Moriyuki et al. Oct 1995 A
5462910 Ito et al. Oct 1995 A
5463174 Moloney et al. Oct 1995 A
5463175 Barry et al. Oct 1995 A
5466677 Baxter et al. Nov 1995 A
5470967 Huie et al. Nov 1995 A
5476925 Letsinger et al. Dec 1995 A
5489520 Adams et al. Feb 1996 A
5489677 Sanghvi et al. Feb 1996 A
5491288 Chaubet et al. Feb 1996 A
5510471 Lebrun et al. Apr 1996 A
5518908 Corbin et al. May 1996 A
5519126 Hecht May 1996 A
5536821 Agrawal et al. Jul 1996 A
5538880 Lundquist et al. Jul 1996 A
5541306 Agrawal et al. Jul 1996 A
5541307 Cook et al. Jul 1996 A
5550111 Suhadolnik et al. Aug 1996 A
5550318 Adams et al. Aug 1996 A
5550398 Kocian et al. Aug 1996 A
5550468 Häberlein et al. Aug 1996 A
5558071 Ward et al. Sep 1996 A
5561225 Maddry et al. Oct 1996 A
5561236 Leemans et al. Oct 1996 A
5563253 Agrawal et al. Oct 1996 A
5569834 Hinchee et al. Oct 1996 A
5571799 Tkachuk et al. Nov 1996 A
5587361 Cook et al. Dec 1996 A
5591616 Hiei et al. Jan 1997 A
5593874 Brown et al. Jan 1997 A
5596086 Matteucci et al. Jan 1997 A
5597717 Guerineau et al. Jan 1997 A
5602240 De Mesmaeker et al. Feb 1997 A
5605011 Bedbrook et al. Feb 1997 A
5608046 Cook et al. Mar 1997 A
5610289 Cook et al. Mar 1997 A
5618704 Sanghvi et al. Apr 1997 A
5623070 Cook et al. Apr 1997 A
5625050 Beaton et al. Apr 1997 A
5627061 Barry et al. May 1997 A
5633360 Bischofberger et al. May 1997 A
5633435 Barry et al. May 1997 A
5633448 Lebrun et al. May 1997 A
5639024 Mueller et al. Jun 1997 A
5646024 Leemans et al. Jul 1997 A
5648477 Leemans et al. Jul 1997 A
5663312 Chaturvedula Sep 1997 A
5677437 Teng et al. Oct 1997 A
5677439 Weis et al. Oct 1997 A
5719046 Guerineau et al. Feb 1998 A
5721138 Lawn Feb 1998 A
5731180 Dietrich Mar 1998 A
5739180 Taylor-Smith Apr 1998 A
5746180 Jefferson et al. May 1998 A
5767361 Dietrich Jun 1998 A
5767373 Ward et al. Jun 1998 A
5780708 Lundquist et al. Jul 1998 A
5804425 Barry et al. Sep 1998 A
5824877 Hinchee et al. Oct 1998 A
5837848 Ely et al. Nov 1998 A
5859347 Brown et al. Jan 1999 A
5866775 Eichholtz et al. Feb 1999 A
5874265 Adams et al. Feb 1999 A
5879903 Strauch et al. Mar 1999 A
5914451 Martinell et al. Jun 1999 A
5919675 Adams et al. Jul 1999 A
5928937 Kakefuda et al. Jul 1999 A
5939602 Volrath et al. Aug 1999 A
5969213 Adams et al. Oct 1999 A
5981840 Zhao et al. Nov 1999 A
5985793 Sandbrink et al. Nov 1999 A
RE36449 Lebrun et al. Dec 1999 E
6040497 Spencer et al. Mar 2000 A
6056938 Unger et al. May 2000 A
6069115 Pallett et al. May 2000 A
6084089 Mine et al. Jul 2000 A
6084155 Volrath et al. Jul 2000 A
6118047 Anderson et al. Sep 2000 A
6121513 Zhang et al. Sep 2000 A
6130366 Herrera-Estrella et al. Oct 2000 A
6140078 Sanders et al. Oct 2000 A
6153812 Fry et al. Nov 2000 A
6160208 Lundquist et al. Dec 2000 A
6177616 Bartsch et al. Jan 2001 B1
6194636 McElroy et al. Feb 2001 B1
6225105 Sathasivan et al. May 2001 B1
6225114 Eichholtz et al. May 2001 B1
6232526 McElroy et al. May 2001 B1
6245968 Boudec et al. Jun 2001 B1
6248876 Barry et al. Jun 2001 B1
6252138 Karimi et al. Jun 2001 B1
RE37287 Lebrun et al. Jul 2001 E
6268549 Sailland et al. Jul 2001 B1
6271359 Norris et al. Aug 2001 B1
6282837 Ward et al. Sep 2001 B1
6288306 Ward et al. Sep 2001 B1
6288312 Christou et al. Sep 2001 B1
6294714 Matsunaga et al. Sep 2001 B1
6326193 Liu et al. Dec 2001 B1
6329571 Hiei Dec 2001 B1
6348185 Piwnica-Worms Feb 2002 B1
6365807 Christou et al. Apr 2002 B1
6384301 Martinell et al. May 2002 B1
6385902 Schipper et al. May 2002 B1
6399861 Anderson et al. Jun 2002 B1
6403865 Koziel et al. Jun 2002 B1
6414222 Gengenbach et al. Jul 2002 B1
6421956 Boukens et al. Jul 2002 B1
6426446 McElroy et al. Jul 2002 B1
6433252 McElroy et al. Jul 2002 B1
6437217 McElroy et al. Aug 2002 B1
6453609 Soll et al. Sep 2002 B1
6479291 Kumagai et al. Nov 2002 B2
6506559 Fire et al. Jan 2003 B1
6642435 Antoni et al. Nov 2003 B1
6644341 Chemo et al. Nov 2003 B1
6645914 Woznica et al. Nov 2003 B1
6768044 Boudec et al. Jul 2004 B1
6992237 Habben et al. Jan 2006 B1
7022896 Weeks et al. Apr 2006 B1
7026528 Cheng et al. Apr 2006 B2
RE39247 Barry et al. Aug 2006 E
7105724 Weeks et al. Sep 2006 B2
7119256 Shimizu et al. Oct 2006 B2
7138564 Tian et al. Nov 2006 B2
7297541 Moshiri et al. Nov 2007 B2
7304209 Zink et al. Dec 2007 B2
7312379 Andrews et al. Dec 2007 B2
7323310 Peters et al. Jan 2008 B2
7371927 Yao et al. May 2008 B2
7392379 Le Pennec et al. Jun 2008 B2
7405347 Hammer et al. Jul 2008 B2
7406981 Hemo et al. Aug 2008 B2
7462379 Fukuda et al. Dec 2008 B2
7485777 Nakajima et al. Feb 2009 B2
7525013 Hildebrand et al. Apr 2009 B2
7550578 Budworth et al. Jun 2009 B2
7622301 Ren et al. Nov 2009 B2
7657299 Huizenga et al. Feb 2010 B2
7671254 Tranel et al. Mar 2010 B2
7714188 Castle et al. May 2010 B2
7738626 Weese et al. Jun 2010 B2
7807791 Sekar et al. Oct 2010 B2
7838263 Dam et al. Nov 2010 B2
7838733 Wright et al. Nov 2010 B2
7842856 Tranel et al. Nov 2010 B2
7884262 Clemente et al. Feb 2011 B2
7910805 Duck et al. Mar 2011 B2
7935869 Pallett et al. May 2011 B2
7943819 Baum et al. May 2011 B2
7973218 McCutchen et al. Jul 2011 B2
8090164 Bullitt et al. Jan 2012 B2
8143480 Axtell et al. Mar 2012 B2
8548778 Hart et al. Oct 2013 B1
8554490 Tang et al. Oct 2013 B2
9121022 Sammons et al. Sep 2015 B2
9422557 Ader Aug 2016 B2
9445603 Baum et al. Sep 2016 B2
20010006797 Kumagai et al. Jul 2001 A1
20010042257 Connor-Ward et al. Nov 2001 A1
20020069430 Kisaka et al. Jun 2002 A1
20020114784 Li et al. Aug 2002 A1
20030150017 Mesa et al. Aug 2003 A1
20030154508 Stevens et al. Aug 2003 A1
20030167537 Jiang Sep 2003 A1
20030221211 Rottmann et al. Nov 2003 A1
20040029275 Brown et al. Feb 2004 A1
20040053289 Allen et al. Mar 2004 A1
20040055041 Labate et al. Mar 2004 A1
20040072692 Hoffman et al. Apr 2004 A1
20040082475 Hoffman et al. Apr 2004 A1
20040123347 Hinchey et al. Jun 2004 A1
20040126845 Eenennaam et al. Jul 2004 A1
20040133944 Hake et al. Jul 2004 A1
20040147475 Li et al. Jul 2004 A1
20040177399 Hammer et al. Sep 2004 A1
20040216189 Houmard et al. Oct 2004 A1
20040244075 Cai et al. Dec 2004 A1
20040250310 Shukla et al. Dec 2004 A1
20050005319 della-Cioppa et al. Jan 2005 A1
20050215435 Menges et al. Sep 2005 A1
20050223425 Clinton Oct 2005 A1
20050246784 Plesch et al. Nov 2005 A1
20050250647 Hills et al. Nov 2005 A1
20060009358 Kibler et al. Jan 2006 A1
20060021087 Baum et al. Jan 2006 A1
20060040826 Eaton et al. Feb 2006 A1
20060111241 Gerwick, III et al. May 2006 A1
20060130172 Whaley et al. Jun 2006 A1
20060135758 Wu Jun 2006 A1
20060200878 Lutfiyya et al. Sep 2006 A1
20060223708 Hoffman et al. Oct 2006 A1
20060223709 Helmke et al. Oct 2006 A1
20060247197 Van De Craen et al. Nov 2006 A1
20060272049 Waterhouse et al. Nov 2006 A1
20060276339 Windsor et al. Dec 2006 A1
20070011775 Allen et al. Jan 2007 A1
20070021360 Nyce et al. Jan 2007 A1
20070050863 Tranel et al. Mar 2007 A1
20070124836 Baum et al. May 2007 A1
20070199095 Allen et al. Aug 2007 A1
20070250947 Boukharov et al. Oct 2007 A1
20070259785 Heck et al. Nov 2007 A1
20070269815 Rivory et al. Nov 2007 A1
20070281900 Cui et al. Dec 2007 A1
20070300329 Allen et al. Dec 2007 A1
20080022423 Roberts et al. Jan 2008 A1
20080050342 Fire et al. Feb 2008 A1
20080092256 Kohn Apr 2008 A1
20080113351 Naito et al. May 2008 A1
20080155716 Sonnewald et al. Jun 2008 A1
20080214443 Baum et al. Sep 2008 A1
20080216187 Tuinstra Sep 2008 A1
20090011934 Zawierucha et al. Jan 2009 A1
20090018016 Duck et al. Jan 2009 A1
20090036311 Witschel et al. Feb 2009 A1
20090054240 Witschel et al. Feb 2009 A1
20090075921 Ikegawa et al. Mar 2009 A1
20090098614 Zamore et al. Apr 2009 A1
20090118214 Paldi et al. May 2009 A1
20090137395 Chicoine et al. May 2009 A1
20090165153 Wang et al. Jun 2009 A1
20090165166 Feng et al. Jun 2009 A1
20090188005 Boukharov et al. Jul 2009 A1
20090205079 Kumar et al. Aug 2009 A1
20090215628 Witschel et al. Aug 2009 A1
20090285784 Raemaekers et al. Nov 2009 A1
20090293148 Ren et al. Nov 2009 A1
20090298787 Raemaekers et al. Dec 2009 A1
20090306189 Raemaekers et al. Dec 2009 A1
20090307803 Baum et al. Dec 2009 A1
20100005551 Roberts et al. Jan 2010 A1
20100048670 Biard et al. Feb 2010 A1
20100068172 Van De Craen Mar 2010 A1
20100071088 Sela et al. Mar 2010 A1
20100099561 Selby et al. Apr 2010 A1
20100100988 Tranel et al. Apr 2010 A1
20100152443 Hirai et al. Jun 2010 A1
20100154083 Ross et al. Jun 2010 A1
20100192237 Ren et al. Jul 2010 A1
20100247578 Salama Sep 2010 A1
20100248373 Baba et al. Sep 2010 A1
20110015084 Christian et al. Jan 2011 A1
20110015284 Dees et al. Jan 2011 A1
20110028412 Cappello et al. Feb 2011 A1
20110035836 Eudes et al. Feb 2011 A1
20110041400 Trias Vila et al. Feb 2011 A1
20110053226 Rohayem Mar 2011 A1
20110098180 Michel et al. Apr 2011 A1
20110105327 Nelson May 2011 A1
20110105329 Song et al. May 2011 A1
20110112570 Mannava et al. May 2011 A1
20110126310 Feng et al. May 2011 A1
20110126311 Velcheva et al. May 2011 A1
20110152339 Brown et al. Jun 2011 A1
20110152346 Karleson et al. Jun 2011 A1
20110152353 Koizumi et al. Jun 2011 A1
20110160082 Woo et al. Jun 2011 A1
20110166022 Israels et al. Jul 2011 A1
20110166023 Nettleton-Hammond et al. Jul 2011 A1
20110171176 Baas et al. Jul 2011 A1
20110171287 Saarma et al. Jul 2011 A1
20110177949 Krapp et al. Jul 2011 A1
20110185444 Li et al. Jul 2011 A1
20110185445 Bogner et al. Jul 2011 A1
20110191897 Poree et al. Aug 2011 A1
20110201501 Song et al. Aug 2011 A1
20110203013 Peterson et al. Aug 2011 A1
20110296555 Ivashuta et al. Dec 2011 A1
20110296556 Sammons Dec 2011 A1
20120036594 Cardoza et al. Feb 2012 A1
20120107355 Harris et al. May 2012 A1
20120108497 Paldi et al. May 2012 A1
20120137387 Baum et al. May 2012 A1
20120150048 Kang et al. Jun 2012 A1
20120156784 Adams, Jr. et al. Jun 2012 A1
20120157512 Ben-Chanoch et al. Jun 2012 A1
20120164205 Baum et al. Jun 2012 A1
20120174262 Azhakanandam et al. Jul 2012 A1
20120185967 Sela et al. Jul 2012 A1
20120198586 Narva et al. Aug 2012 A1
20120230565 Steinberg et al. Sep 2012 A1
20120258646 Sela et al. Oct 2012 A1
20130003213 Kabelac et al. Jan 2013 A1
20130041004 Drager et al. Feb 2013 A1
20130047297 Sammons et al. Feb 2013 A1
20130047298 Tang Feb 2013 A1
20130060133 Kassab et al. Mar 2013 A1
20130067618 Ader et al. Mar 2013 A1
20130084243 Goetsch et al. Apr 2013 A1
20130096073 Sidelman Apr 2013 A1
20130097726 Ader et al. Apr 2013 A1
20130212739 Giritch et al. Aug 2013 A1
20130226003 Edic et al. Aug 2013 A1
20130247247 Ader et al. Sep 2013 A1
20130254940 Ader et al. Sep 2013 A1
20130254941 Ader et al. Sep 2013 A1
20130288895 Ader et al. Oct 2013 A1
20130318657 Avniel et al. Nov 2013 A1
20130318658 Ader et al. Nov 2013 A1
20130324842 Mittal et al. Dec 2013 A1
20130326731 Ader et al. Dec 2013 A1
20140018241 Sammons et al. Jan 2014 A1
20140057789 Sammons et al. Feb 2014 A1
20140109258 Van De Craen et al. Apr 2014 A1
20140230090 Avniel et al. Aug 2014 A1
20140274712 Finnessy et al. Sep 2014 A1
20140275208 Hu et al. Sep 2014 A1
20140296503 Avniel et al. Oct 2014 A1
20150096079 Avniel et al. Apr 2015 A1
20150143580 Beattie et al. May 2015 A1
20150159156 Inberg et al. Jun 2015 A1
20150203867 Beattie et al. Jul 2015 A1
20150240258 Beattie et al. Aug 2015 A1
20160015035 Tao Jan 2016 A1
20160029644 Tao Feb 2016 A1
Foreign Referenced Citations (260)
Number Date Country
2008258254 Jul 2014 AU
101279950 Oct 2008 CN
101279951 Oct 2008 CN
101892247 Nov 2010 CN
101914540 Dec 2010 CN
102154364 Aug 2011 CN
102481311 May 2012 CN
102906263 Jan 2013 CN
288618 Apr 1991 DE
10000600 Jul 2001 DE
10116399 Oct 2002 DE
10256353 Jun 2003 DE
10256354 Jun 2003 DE
10256367 Jun 2003 DE
10204951 Aug 2003 DE
10234875 Feb 2004 DE
10234876 Feb 2004 DE
102004054666 May 2006 DE
102005014638 Oct 2006 DE
102005014906 Oct 2006 DE
102007012168 Sep 2008 DE
102010042866 May 2011 DE
0 804 600 Nov 1997 EP
1 155 615 Nov 2001 EP
1 157 991 Nov 2001 EP
1 238 586 Sep 2002 EP
1 416 049 May 2004 EP
1 496 123 Jan 2005 EP
1 889 902 Feb 2008 EP
1 964 919 Sep 2008 EP
2 147 919 Jan 2010 EP
2 160 098 Nov 2010 EP
2 530 159 Mar 2011 EP
2 305 813 Apr 2011 EP
2 545 182 Jan 2013 EP
2545182 Jan 2013 EP
2001253874 Sep 2001 JP
2002080454 Mar 2002 JP
2002138075 May 2002 JP
2002145707 May 2002 JP
2002220389 Aug 2002 JP
2003064059 Mar 2003 JP
2003096059 Apr 2003 JP
2004051628 Feb 2004 JP
2004107228 Apr 2004 JP
2005008583 Jan 2005 JP
2005239675 Sep 2005 JP
2005314407 Nov 2005 JP
2006232824 Sep 2006 JP
2006282552 Oct 2006 JP
2007153847 Jun 2007 JP
2007161701 Jun 2007 JP
2007182404 Jul 2007 JP
2008074840 Apr 2008 JP
2008074841 Apr 2008 JP
2008133207 Jun 2008 JP
2008133218 Jun 2008 JP
2008169121 Jul 2008 JP
2009-508481 Mar 2009 JP
2009067739 Apr 2009 JP
2009114128 May 2009 JP
2009126792 Jun 2009 JP
2009137851 Jun 2009 JP
WO 8911789 Dec 1989 WO
WO 9534659 Dec 1995 WO
WO 9534668 Dec 1995 WO
WO 96005721 Feb 1996 WO
WO 96033270 Oct 1996 WO
WO 96038567 Dec 1996 WO
WO 96040964 Dec 1996 WO
WO 1997049816 Dec 1997 WO
WO 99024585 May 1999 WO
WO 9926467 Jun 1999 WO
WO 9927116 Jun 1999 WO
WO 9932619 Jul 1999 WO
WO 9961631 Dec 1999 WO
WO 9967367 Dec 1999 WO
WO 0032757 Jun 2000 WO
WO 00044914 Aug 2000 WO
WO 200107601 Feb 2001 WO
WO 2001085970 Nov 2001 WO
WO 0214472 Feb 2002 WO
WO 02066660 Aug 2002 WO
WO 03000679 Jan 2003 WO
WO 03006422 Jan 2003 WO
WO 2003004649 Jan 2003 WO
WO 03012052 Feb 2003 WO
WO 03013247 Feb 2003 WO
WO 03016308 Feb 2003 WO
WO 2003014357 Feb 2003 WO
WO 03020704 Mar 2003 WO
WO 03022051 Mar 2003 WO
WO 03022831 Mar 2003 WO
WO 03022843 Mar 2003 WO
WO 03029243 Apr 2003 WO
WO 03037085 May 2003 WO
WO 03037878 May 2003 WO
WO 03045878 Jun 2003 WO
WO 03050087 Jun 2003 WO
WO 03051823 Jun 2003 WO
WO 03051824 Jun 2003 WO
WO 03051846 Jun 2003 WO
WO 03064625 Aug 2003 WO
WO 03076409 Sep 2003 WO
WO 03077648 Sep 2003 WO
WO 03087067 Oct 2003 WO
WO 03090539 Nov 2003 WO
WO 03091217 Nov 2003 WO
WO 03093269 Nov 2003 WO
WO 03104206 Dec 2003 WO
WO 2004002947 Jan 2004 WO
WO 2004002981 Jan 2004 WO
WO 2004005485 Jan 2004 WO
WO 2004009761 Jan 2004 WO
WO 2004011429 Feb 2004 WO
WO 2004022771 Mar 2004 WO
WO 2004029060 Apr 2004 WO
WO 2004035545 Apr 2004 WO
WO 2004035563 Apr 2004 WO
WO 2004035564 Apr 2004 WO
WO 2004037787 May 2004 WO
WO 2004049806 Jun 2004 WO
WO 2004062351 Jul 2004 WO
WO 2004067518 Aug 2004 WO
WO 2004067527 Aug 2004 WO
WO 2004074443 Sep 2004 WO
WO 2004077950 Sep 2004 WO
WO 2005000824 Jan 2005 WO
WO 2005003362 Jan 2005 WO
WO 2005007627 Jan 2005 WO
WO 2005007860 Jan 2005 WO
WO 2005040152 May 2005 WO
WO 2005047233 May 2005 WO
WO 2005047281 May 2005 WO
WO 2005061443 Jul 2005 WO
WO 2005061464 Jul 2005 WO
WO 2005068434 Jul 2005 WO
WO 2005070889 Aug 2005 WO
WO 2005089551 Sep 2005 WO
WO 2005095335 Oct 2005 WO
WO 2005107437 Nov 2005 WO
WO 2005110068 Nov 2005 WO
WO 2006006569 Jan 2006 WO
WO 2006024820 Mar 2006 WO
WO 2006029828 Mar 2006 WO
WO 2006029829 Mar 2006 WO
WO 2006037945 Apr 2006 WO
WO 2006050803 May 2006 WO
WO 2006074400 Jul 2006 WO
WO 2006090792 Aug 2006 WO
WO 2006123088 Nov 2006 WO
WO 2006125687 Nov 2006 WO
WO 2006125688 Nov 2006 WO
WO 2006132270 Dec 2006 WO
WO 2006138638 Dec 2006 WO
WO 2007003294 Jan 2007 WO
WO 2007007316 Jan 2007 WO
WO 2007024783 Mar 2007 WO
WO 2007026834 Mar 2007 WO
WO 2007035650 Mar 2007 WO
WO 2007038788 Apr 2007 WO
WO 2007039454 Apr 2007 WO
WO 2007050715 May 2007 WO
WO 2007070389 Jun 2007 WO
WO 2007071900 Jun 2007 WO
WO 2007074405 Jul 2007 WO
WO 2007077201 Jul 2007 WO
WO 2007077247 Jul 2007 WO
WO 2007080126 Jul 2007 WO
WO 2007080127 Jul 2007 WO
WO 2007083193 Jul 2007 WO
WO 2007096576 Aug 2007 WO
WO 2007051462 Oct 2007 WO
WO 2007051462 Oct 2007 WO
WO 2007119434 Oct 2007 WO
WO 2007134984 Nov 2007 WO
WO 2008007100 Jan 2008 WO
WO 2008009908 Jan 2008 WO
WO 2008029084 Mar 2008 WO
WO 2008042231 Apr 2008 WO
WO 2008059948 May 2008 WO
WO 2008063203 May 2008 WO
WO 2008071918 Jun 2008 WO
WO 2008074991 Jun 2008 WO
WO 2008084073 Jul 2008 WO
WO 2008100426 Aug 2008 WO
WO 2008102908 Aug 2008 WO
WO 2008148223 Dec 2008 WO
WO 2008152072 Dec 2008 WO
WO 2008152073 Dec 2008 WO
WO 2009000757 Dec 2008 WO
WO 2009005297 Jan 2009 WO
WO 2009029690 Mar 2009 WO
WO 2009035150 Mar 2009 WO
WO 2009037329 Mar 2009 WO
WO 2009046384 Apr 2009 WO
WO 2009063180 May 2009 WO
WO 2009068170 Jun 2009 WO
WO 2009068171 Jun 2009 WO
WO 2009086041 Jul 2009 WO
WO 2009090401 Jul 2009 WO
WO 2009090402 Jul 2009 WO
WO 2009115788 Sep 2009 WO
WO 2009116558 Sep 2009 WO
WO 2009125401 Oct 2009 WO
WO 2009144079 Dec 2009 WO
WO 2009152995 Dec 2009 WO
WO 2009158258 Dec 2009 WO
WO 2010012649 Feb 2010 WO
WO 2010026989 Mar 2010 WO
WO 2010034153 Apr 2010 WO
WO 2010049270 May 2010 WO
WO 2010049369 May 2010 WO
WO 2010049405 May 2010 WO
WO 2010049414 May 2010 WO
WO 2010056519 May 2010 WO
WO 2010063422 Jun 2010 WO
WO 2010069802 Jun 2010 WO
WO 2010078906 Jul 2010 WO
WO 2010078912 Jul 2010 WO
WO 2010093788 Aug 2010 WO
WO 2010104217 Sep 2010 WO
WO 2010108611 Sep 2010 WO
WO 2010112826 Oct 2010 WO
WO 2010116122 Oct 2010 WO
WO 2010119906 Oct 2010 WO
WO 2010130970 Nov 2010 WO
WO 2011001434 Jan 2011 WO
WO 2011003776 Jan 2011 WO
WO 2011035874 Mar 2011 WO
WO 2011045796 Apr 2011 WO
WO 2011065451 Jun 2011 WO
WO 2011067745 Jun 2011 WO
WO 2011075188 Jun 2011 WO
WO 2011080674 Jul 2011 WO
WO 2011112570 Sep 2011 WO
WO 2011132127 Oct 2011 WO
WO 2012001626 Jan 2012 WO
WO 2012056401 May 2012 WO
WO 2012092580 Jul 2012 WO
WO 2012164100 Dec 2012 WO
WO 2013010691 Jan 2013 WO
WO 2013025670 Feb 2013 WO
WO 2013039990 Mar 2013 WO
WO 2013040005 Mar 2013 WO
WO 2013040021 Mar 2013 WO
WO 2013040033 Mar 2013 WO
WO 2013040049 Mar 2013 WO
WO 2013040057 Mar 2013 WO
WO 2013040116 Mar 2013 WO
WO 2013040117 Mar 2013 WO
WO 2013153553 Oct 2013 WO
WO 2013175480 Nov 2013 WO
WO 2014022739 Feb 2014 WO
WO 2014106837 Jul 2014 WO
WO 2014106838 Jul 2014 WO
WO 2014151255 Sep 2014 WO
WO 2014164761 Oct 2014 WO
WO 2014164797 Oct 2014 WO
WO 2015010026 Jan 2015 WO
Non-Patent Literature Citations (670)
Entry
Vila-Aiub, M. M., et al. “Glyphosate resistance in perennial Sorghum halepense (Johnsongrass), endowed by reduced glyphosate translocation and leaf uptake.” Pest management science 68.3 (2012): 430-436. First published: Sep. 23, 2011 (Year: 2011).
Riar, Dilpreet S., et al. “Glyphosate resistance in a johnsongrass (Sorghum halepense) biotype from Arkansas.” Weed Science 59.3 (2011): 299-304. (Year: 2011).
Pratt, Lee H., et al. “Sorghum expressed sequence tags identify signature genes for drought, pathogenesis, and skotomorphogenesis from a milestone set of 16,801 unique transcripts.” Plant physiology 139.2 (2005): 869-884. (Year: 2005).
Vila-Aiub, Martin M., et al. “Glyphosate resistance in perennial Sorghum halepense (Johnsongrass), endowed by reduced glyphosate translocation and leaf uptake.” Pest management science 68.3 (2012): 430-436. (Year: 2012).
Agrios, Plant Pathology (Second Edition), 2:466-470 (1978).
Alarcón-Reverte et al., “Resistance to ACCase-inhibiting herbicides in the weed Lolium multiflorum,” Comm. Appl. Biol. Sci., 73(4):899-902 (2008).
Amarzguioui et al., “An algorithm for selection of functional siRNA sequences,” Biochemical and Biophysical Research Communications, 316:1050-1058 (2004).
Ambrus et al., “The Diverse Roles of RNA Helicases in RNAi,” Cell Cycle, 8(21):3500-3505 (2009).
An et al., “Transient RNAi Induction against Endogenous Genes in Arabidopsis Protoplasts Using in Vitro-Prepared Double-Stranded RNA,” Biosci Biotechnol Biochem, 69(2):415-418 (2005).
Andersson et al., “A novel selection system for potato transformation using a mutated AHAS gene,” Plant Cell Reports, 22(4):261-267 (2003).
Anonymous, “A handbook for high-level expression and purification of 6xHis-tagged proteins,” The QiaExpressionist, (2003).
Anonymous, “Agronomy Facts 37: Adjuvants for enhancing herbicide performance,” n. p., 1-8, (Jan. 26, 2000), Web, (Jan. 21, 2014).
Anonymous, “Devgen, The mini-Monsanto,” KBC Securities (2006).
Anonymous, “Do Monsanto have the next big thing?,” Austalian Herbicide Resistance Initiative (AHRI), (Apr. 23, 2013) Web. (Jan. 19, 2015).
Aoki et al., “In Vivo Transfer Efficiency of Antisense Oligonucleotides into the Myocardium Using HVJ—Liposome Method,” Biochem Biophys Res Commun, 231:540-545 (1997).
Arpaia et al., “Production of transgenic eggplant (Solanum melongena L.) resistant to Colorado Potato Beetle (Leptinotarsa decemlineata Say),” (1997) Theor. Appl. Genet., 95:329-334 (1997).
Artymovich, “Using RNA interference to increase crop yield and decrease pest damage,” MMG 445 Basic Biotech., 5(1):7-12 (2009).
Australian Patent Examination report No. 1 dated Nov. 11, 2013, in Australian Application No. 2011224570.
Axtell et al., “A Two-Hit Trigger for siRNA Biogenesis in Plants,” Cell, 127:565-577 (2006).
Baerson et al., “Glyphosate-Resistant Goosegrass. Identification of a Mutation in the Target Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase,” Plant Physiol., 129(3):1265-1275 (2002).
Bai et al., “Naturally Occurring Broad-Spectrum Powdery Mildew Resistance in a Central American Tomato Accession Is Caused by Loss of Mlo Function,” MPMI, 21(1):30-39 (2008).
Bannerjee et al., “Efficient production of transgenic potato (S. tuberosum L. ssp. andigena) plants via Agrobacterium tumefaciens-mediated transformation,” Plant Sci., 170:732 738 (2006).
Baulcombe, “RNA silencing and heritable epigenetic effects in tomato and Arabidopsis,” Abstract 13th Annual Fall Symposium, Plant Genomes to Phenomes, Donald Danforth Plant Science Center, 28-30 (2011).
Bayer et al., “Programmable ligand-controlled riboregulators of eukaryotic gene expression,” Nature Biotechnol., 23(3):337-343 (2005).
Beal, et al., “Second Structural Motif for Recognition of DNA by Oligonucleotide-Directed Triple-Helix Formation,” Science, 251:1360-1363 (1992).
Becker et al., “Fertile transgenic wheat from microprojectile bombardment of scutellar tissue,” The Plant Journal, 5(2):299-307 (1994).
Bhargava et al., “Long double-stranded RNA-mediated RNA interference as a tool to achieve site-specific silencing of hypothalamic neuropeptides,” Brain Research Protocols, 13:115-125 (2004).
Boletta et al., “High Efficient Non-Viral Gene Delivery to the Rat Kidney by Novel Polycationic Vectors,” J. Am Soc. Nephrol., 7:1728 (1996).
Bolognesi et al., “Characterizing the Mechanism of Action of Double-Stranded RNA Activity against Western Corn Rootworm(Diabrotica virgifera virgifera LeConte),” PLoS ONE 7(10):e47534 (2012).
Bolter et al., “A chloroplastic inner envelope membrane protease is essential for plant development,” FEBS Letters, 580:789-794 (2006).
Bourgeois et al., “Field and producer survey of ACCase resistant wild oat in Manitoba,” Canadian Journal of Plant Science, 709-715 (1997).
Breaker et al., “A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity,” Chemistry and Biology, 2:655-660 (1995).
Brodersen et al., “The diversity of RNA silencing pathways in plants,” Trends in Genetics, 22(5):268-280 (2006).
Brugière et al., “Glutamine Synthetase in the Phloem Plays a Major Role in Controlling Proline Production,” The Plant Cell, 11:1995-2011 (1999).
Busi et al., “Gene flow increases the initial frequency of herbicide resistance alleles in unselectedpopulations,” Agriculture, Ecosystems and Environments, Elsevier, Amsterdam, NL, 142(3):403-409 (2011).
Butler et al., “Priming and re-drying improve the survival of mature seeds of Digitalis purpurea during storage,” Annals of Botany, 103:1261-1270 (2009).
Bytebier et al., “T-DNA organization in tumor cultures and transgenic plants of the monocotyledon Asparagus officinalis,” Proc. Natl. Acad. Sci. U.S.A., 84:5345-5349 (1987).
Campbell et al., “Gene-knockdown in the honey bee mite Varroa destructor by a non-invasive approach: studies on a glutathione 5-transferase,” Parasites & Vectors, 3(1):73, pp. 1-10 (2010).
Chabbouh et al., “Cucumber mosaic virus in artichoke,” FAO Plant Protection Bulletin, 38:52-53 (1990).
Chakravarty et al., “Genetic Transformation in Potato: Approaches and Strategies,” Amer J Potato Res, 84:301 311 (2007).
Chang et al., “Cellular Internalization of Fluorescent Proteins via Arginine-rich Intracellular Delivery Peptide in Plant Cells,” Plant Cell Physiol., 46(3):482-488 (2005).
Chee et al., “Transformation of Soybean (Glycine max) by Infecting Germinating Seeds with Agrobacterium tumefaciens,” Plant Physiol., 91:1212-1218 (1989).
Chen et al., “In Vivo Analysis of the Role of atTic20 in Protein Import into Chloroplasts,” The Plant Cell, 14:641-654 (2002).
Cheng et al., “Production of fertile transgenic peanut (Arachis hypogaea L.) plants using Agrobacterium tumefaciens,” Plant Cell Reports, 15:653-657 (1996).
Chi et al., “The Function of RH22, a DEAD RNA Helicase, in the Biogenesis of the 50S Ribosomal Subunits of Arabidopsis Chloroplasts,” Plant Physiology, 158:693-707 (2012).
Chinese Office Action dated Aug. 28, 2013 in Chinese Application No. 201180012795.2.
Chupp et al., “Chapter 8: White Rust,” Vegetable Diseases and Their Control, The Ronald Press Company, New York, pp. 267-269 (1960).
Clough et al., “Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana,” The Plant Journal, 16(6):735-743 (1998).
CN101914540 Patent Diclosure, “Introduction of RNA into plant by interference,” (2010).
Colbourne et al., “The Ecoresponsive Genome of Daphnia pulex,” Science, 331(6017):555-561 (2011).
Colombian Office Action dated Aug. 2, 2013 in Application No. 12 152898.
Colombian Office Action dated Feb. 21, 2014 in Application No. 12 152898.
Communication pursuant to Article 94(3) EPC dated Jun. 26, 2015, as received in European Patent Application No. 11 753 916.3.
Communication pursuant to Article 94(3) EPC dated Oct. 23, 2015, as received in European Patent Application No. 12 831 945.6.
Cooney et al., “Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in Vitro,” Science ,241:456-459 (1988).
COST Action FA0806 progress report “Plant virus control employing RNA-based vaccines: A novel non-transgenic strategy” (2010).
Coticchia et al., “Calmodulin modulates Akt activity in human breast cancer cell lines,” Breast Cancer Res. Treat, 115:545-560 (2009).
Dalmay et al., “An RNA-Depenedent RNA Polymerase Gene in Arabidopsis Is Required for Posttranscriptional Gene Silencing Mediated by a Transgene but Not by a Virus,” Cell, 101:543-553 (2000).
Database EMBL CBIB Daphnia—XP-002732239 (2011).
Davidson et al., “Engineering regulatory RNAs,” TRENDS in Biotechnology, 23(3):109-112 (2005).
De Block, et al. “Engineering herbicide resistance in plants by expression of a detoxifying enzyme,” EMBO J. 6(9):2513-2519 (1987).
De Framond, “MINI-Ti: A New Vector Strategy for Plant Genetic Engineering,” Nature Biotechnology, 1:262-269 (1983).
Della-Cioppa et al., “Import of a precursor protein into chloroplasts is inhibited by the herbicide glyphosate,” The EMBO Journal, 7(5):1299-1305 (1988).
Desai et al., “Reduction in deformed wing virus infection in larval and adult honey bees (Apis mellifera L.) by double-stranded RNA ingestion,” Insect Molecular Biology, 21(4):446-455 (2012).
Diallo et al., “Long Endogenous dsRNAs Can Induce Complete Gene Silencing in Mammalian Cells and Primary Cultures,” Oligonucleotides, 13:381-392 (2003).
Dietemann et al.,“Varroa destructor: research avenues towards sustainable control,” Journal of Apicultural Research, 51(1):125-132 (2012).
Du et al., “A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites,” Nucleic Acids Research, 33(5):1671-1677 (2005).
Dunoyer et al., “Small RNA Duplexes Function as Mobile Silencing Signals Between Plant Cells,” Science, 328:912-916 (2010).
Ellington et al., “In vitro selection of RNA molecules that bind specific ligands,” Nature, 346:818-822 (1990).
Emery et al., “Radial Patterning of Arabidopsis Shoots by Class III HD-ZIP and Kanadi Genes,” Current Biology, 13:1768-1774 (2003).
Eurasian Office Action dated Feb. 24, 2014, in Application No. 201201264.
European Cooperation in the field of Scientific and Technical Research—Memorandum of Understanding for COST Action FA0806 (2008).
European Supplemental Search Report dated Oct. 8, 2013 in Application No. 11753916.3.
Extended European Search Report dated Feb. 2, 2015, in European Patent Application No. 12 830 932.5.
Extended European Search Report dated Feb. 27, 2015, in European Patent Application No. 12 832 160.1.
Extended European Search Report dated Feb. 3, 2015, in European Patent Application No. 12 831 945.6.
Extended European Search Report dated Jan. 21, 2015, in European Patent Application No. 12 832 415.9.
Extended European Search Report dated Jan. 29, 2015, in European Patent Application No. 12 831 567.8.
Extended European Search Report dated Jun. 29, 2015, in European Patent Application No. 12 831 494.5.
Extended European Search Report dated Mar. 17, 2015, in European Patent Application No. 12 831 684.1.
Extended European Search Report dated Mar. 3, 2015, in European Patent Application No. 12 831 166.9.
Farooq et al., “Rice seed priming,” IPRN, 30(2):45-48 (2005).
Final Office Action dated Nov. 10, 2015, in U.S. Appl. No. 13/612,985.
Final Office Action dated Nov. 7, 2013, in U.S. Appl. No. 13/042,856.
Final Office Action dated Nov. 30, 2015, in U.S. Appl. No. 13/612,948.
Fire et al., “Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans,” Nature, 391:806-811 (1998).
First Examination Report dated Apr. 23, 2013, in New Zealand Patent Application No. 601784.
First Examination Report dated Jul. 28, 2014, in New Zealand Patent Application No. 627060.
First Office Action dated Sep. 9, 2015, in Chinese Patent Application No. 201280055409.2.
First Office Action dated Mar. 12, 2015, in Chinese Patent Application No. 201280053984.9.
First Office Action dated Mar. 2, 2015, in Chinese Patent Application No. 201280054819.5.
First Office Action dated May 27, 2015, in Chinese Patent Application No. 201280054179.8.
First Office Action dated Jul. 7, 2015, in Chinese Patent Application No. 201280054820.8.
First Office Action dated Aug. 31, 2015, in Chinese Patent Application No. 201280053985.3.
Fukuhara et al., “Enigmatic Double-Stranded RNA in Japonica Rice,” Plant Molecular Biology, 21:1121-1130 (1993).
Fukuhara et al., “The Unusual Structure of a Novel RNA Replicon in Rice,” The Journal of Biological Chemistry, 270(30):18147-18149 (1995).
Fukuhara et al., “The wide distribution of endornaviruses, large double-stranded RNA replicons with plasmid-like properties,” Archives of Virology, 151:995-1002 (2006).
Further Examination Report issued in New Zealand Patent Application No. 601784 dated May 16, 2014.
Gaines et al., “Gene amplification confers glyphosate resistance in Amaranthus palmeri,” Proc. Natl. Acad. Sci. USA, 107(3):1029-1034 (2010).
Gan et al., “Bacterially expressed dsRNA protects maize against SCMV infection,” Plant Cell Rep, 11:1261-1268 (2010).
Gao et al., “Down-regulation of acetolactate synthase compromises 01-1-mediated resistance to powdery mildew in tomato,” BMC Plant Biology, 14 (2014).
Garbian et al., “Bidirectional Transfer of RNAi between Honey Bee and Varroa destructor: Varroa Gene Silencing Reduces Varroa Population,” 8(12):1-9:e1003035 (2012).
Ge et al., “Rapid vacuolar sequestration: the horseweed glyphosate resistance mechanism,” Pest Management Sci., 66:345-348 (2010).
GenBank Accession No. AY545657.1, published 2004.
GenBank Accession No. DY640489, PU2_plate27_F03 PU2 Prunus persica cDNA similar to expressed mRNA inferred from Prunus persica hypothetical domain/motif containing IPR011005:Dihydropteroate synthase-like, MRNA sequence (2006) [Retrieved on Feb. 4, 2013]. Retrieved from the internet <URL: http://www.ncbi.nlm.nih.gov/nucest/DY640489>.
GenBank Accession No. EU24568—“Amaranthus hypochondriacus acetolactate synthase (ALS) gene,” (2007).
GenBank Accession No. FJ972198, Solanum lycopersicum cultivar Ailsa Craig dihydropterin pyrophosphokinase-dihydropteroate synthase (HPPK-DHPS) gene, complete cds (2010) [Retrieved on Nov. 26, 2012]. Retrieved from the internet ,URL: http://www.ncbi.nlm.nih.gov/nuccore/FJ972198>.
GenBank Accession No. GI:186478573, published Jan. 22, 2014.
GenEmbl FJ861243, published Feb. 3, 2010.
Gong et al., “Silencing of Rieske iron-sulfur protein using chemically synthesised siRNA as a potential biopesticide against Plutella xylostella,” Pest Manag Sci, 67:514-520 (2011).
Gressel et al., “A strategy to provide long-term control of weedy rice while mitigating herbicide resistance transgene flow, and its potential use for other crops with related weeds,” Pest Manag Sci, 65(7):723-731 (2009).
Gutensohn et al., “Functional analysis of the two Arabidopsis homologues of Toc34, a component of the chloroplast protein import apparatus,” The Plant Journal, 23(6):771-783 (2000).
Haigh, “The Priming of Seeds: Investigation into a method of priming large quantities of seeds using salt solutions,” Thesis submitted to Macquarie University (1983).
Hamilton et al., “Guidelines for the Identification and Characterization of Plant Viruses,” J. gen. Virol., 54:223-241 (1981).
Hamilton et al., “Two classes of short interfering RNA in RNA silencing,” EMBO J., 21(17):4671-4679 (2002).
Han et al., “Molecular Basis for the Recognition of Primary microRNAs by the Drosha-DGCR8 Complex,” Cell, 125(5):887-901 (2006).
Hannon, “RNA interference,” Nature,481:244-251 (2002).
Hardegree, “Drying and storage effects on germination of primed grass seeds,” Journal of Range Management, 47(3):196-199 (1994).
Harrison et al., “Does Lowering Glutamine Synthetase Activity in Nodules Modigy Nitrogen Metabolism and Growth of Lotus japonicus?,” Plant Physiology, 133:253-262 (2003).
Herman et al., “A three-component dicamba O-demethylase from Pseudomonas maltophilia, strain DI-6: gene isolation, characterization, and heterologous expression,” J. Biol. Chem., 280: 24759-24767 (2005).
Hewezi et al., “Local infiltration of high- and low-molecular-weight RNA from silenced sunflower (Helianthus annuus L.) plants triggers post-transcriptional gene silencing in non-silenced plants,” Plant Biotechnology Journal, 3:81-89 (2005).
Hidayat et al., “Enhanced Metabolism of Fluazifop Acid in a Biotype of Digitaria sanguinalis Resistant to the Herbicide Fluazifop-P-Butyl,” Pesticide Biochem. Physiol., 57:137-146 (1997).
Himber et al., “Transitivity-dependant and -independent cell-to-cell movement of RNA silencing,” The EMBO Journal, 22(17):4523-4533 (2003).
Hirschberg et al., “Molecular Basis of Herbicide Resistance in Amaranthus hybridus,” Science, 222:1346-1349 (1983).
Hoekema et al., “A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid,” Nature, 303:179-180 (1983).
Hofgen et al., “Repression of Acetolactate Synthase Activity through Antisense Inhibition: Molecular and Biochemical Analysis of Transgenic Potato (Solanum tuberosum L. cv Desiree) Plants,” Plant Physiol., 107(2):469-477 (1995).
Hsieh et al., “A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens,” Nucleic Acids Res., 32(3):893-901 (2004).
Huesken et al., “Design of a genome-wide siRNA library using an artificial neural network,” Nature Biotechnology, 23(8): 995-1001 (2005).
Hunter et al., “RNA Interference Strategy to suppress Psyllids & Leafhoppers,” International Plant and Animal Genome XIX, 15-19 (2011).
Ichihara et al., “Thermodynamic instability of siRNA duplex is a prerequisite for dependable prediction of siRNA activities,” Nucleic Acids Res., 35(18):e123 (2007).
International Preliminary Report on Patentability (Chapter II) dated Jul. 24, 2015, in International Application No. PCT/US2014/047204.
International Preliminary Report on Patentability dated Sep. 11, 2014, in International Application No. PCT/IL2013/050447.
International Search Report and the Written Opinion dated Feb. 25, 2013, in International Application No. PCT/US12/054883.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US12/054814.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US12/054842.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US12/054862.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US12/054894.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US12/054974.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US12/054980.
International Search Report and the Written Opinion dated Jul. 15 2014, in International Application No. PCT/US2014/025305.
International Search Report and the Written Opinion dated Jul. 22 2014, in International Application No. PCT/IL2013/051083.
International Search Report and the Written Opinion dated Jul. 22 2014, in International Application No. PCT/IL2013/051085.
International Search Report and the Written Opinion dated Jul. 24 2014, in International Application No. PCT/US2014/026036.
International Search Report and the Written Opinion dated May 10, 2011, in International Application No. PCT/US11/027528.
International Search Report and the Written Opinion dated Oct. 1, 2013, in International Application No. PCT/IL2013/050447.
International Search Report and Written Opinion dated Aug. 25, 2014, in International Application No. PCT/US2014/023503.
International Search Report and Written Opinion dated Aug. 27, 2014, in International Application No. PCT/US2014/023409.
International Search Report and Written Opinion dated Feb. 23, 2015, in International Application No. PCT/US2014/063832.
International Search Report and Written Opinion dated Jul. 8, 2015, in International Application No. PCT/US2015/011408.
International Search Report and Written Opinion dated Mar. 26, 2015, in International Application No. PCT/US2014/069353.
International Search Report and Written Opinion dated Nov. 24, 2015, in International Application No. PCT/US2015/037522.
International Search Report dated Mar. 12, 2013, in International Application No. PCT/US2012/054789.
Invitation to Pay Additional Fees dated May 6, 2014, in International Application No. PCT/IL2013/051083.
Invitation to Pay Additional Fees dated May 6, 2014, in International Application No. PCT/IL2013/051085.
Invitation to Pay Additional Fees dated Nov. 25, 2014, in International Application No. PCT/US2014/047204.
Invitation to Pay Additional Fees dated Sep. 8, 2015, in International Application No. PCT/US2015/037015.
Invitation to Pay Additional Fees dated Sep. 9, 2015, in International Application No. PCT/US2015/037522.
Isaacs et al., “Engineered riboregulators enable post-transcriptional control of gene expression,” Nature Biotechnology, 22(7):841-847 (2004).
Ji et al., “Regulation of small RNA stability: methylation and beyond,” Cell Research, 22:624-636 (2012).
Jofre-Garfias et al., “Agrobacterium-mediated transformation of Amaranthus hypochondriacus: light- and tissue-specific expression of a pea chlorophyll a/b-binding protein promoter,” Plant Cell Reports, 16:847-852 (1997).
Jones-Rhoades et al., “MicroRNAs and Their Regulatory Roles in Plants,” Annu. Rev. Plant Biol., 57:19-53 (2006).
Josse et al., “A DELLA in Disguise: SPATULA Restrains the Growth of the Developing Arabidopsis Seedling,” Plant Cell, 23:1337-1351 (2011).
Kam et al., “Nanotube Molecular Transporters: Internalization of Carbon Nanotube—Protein Conjugates into Mammalian Cells,” J. Am. Chem. Soc., 126(22):6850-6851 (2004).
Katoh et al., “Specific residues at every third position of siRNA shape its efficient RNAi activity,” Nucleic Acids Res., 35(4): e27 (2007).
Kertbundit et al., “In vivo random β-glucuronidase gene fusions in Arabidopsis thaliana,” Proc. Natl. Acad. Sci. U S A., 88:5212-5216 (1991).
Khachigian, “DNAzymes: Cutting a path to a new class of therapeutics,” Curr Opin Mol Ther 4(2):119-121 (2002).
Khan et al., “Matriconditioning of Vegetable Seeds to Improve Stand Establishment in Early Field Plantings,” J. Amer. Soc. Hort. Sci., 117(1):41-47 (1992).
Khodakovskaya et al., “Carbon Nanotubes Are Able to Penetrate Plant Seed Coat and Dramatically Affect Seed Germination and Plant Growth,” ACS Nano, 3(10):3221-3227 (2009).
Kim et al., “Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy,” Nature Biotechnology, 23(2):222-226 (2005).
Kirkwood, “Use and Mode of Action of Adjuvants for Herbicides: A Review of some Current Work,” Pestic Sci., 38:93-102 (1993).
Klahre et al., “High molecular weight RNAs and small interfering RNAs induce systemic posttranscriptional gene silencing in plants,” Proc. Natl. Acad. Sci. USA, PNAS, 99(18):11981-11986 (2002).
Kronenwett et al., “Oligodeoxyribonucleotide Uptake in Primary Human Hematopoietic Cells Is Enhanced by Cationic Lipids and Depends on the Hematopoietic Cell Subset,” Blood, 91(3):852-862 (1998).
Kusaba et al., “Low glutelin content1: A Dominant Mutation That Suppresses the Glutelin Multigene Family via RNA Silencing ni Rice,” The Plant Cell, 15(6):1455-1467 (2003).
Kusaba, “RNA interference in crop plants,” Curr Opin Biotechnol, 15(2):139-143 (2004).
Lavigne et al., “Enhanced antisense inhibition of human immunodeficiency virus type 1 in cell cultures by DLS delivery system,” Biochem Biophys Res Commun, 237:566-571 (1997).
Lee et al., “Aptamer Database,” Nucleic Acids Research, 32:D95-D100 (2004).
Lein et al., “Target-based discovery of novel herbicides,” Current Opinion in Plant Biology, 7:219-225 (2004).
Leopold et al., “Chapter 4: Moisture as a Regulator of Physiological Reaction in Seeds,” Seed Moisture, CSSA Special Publication No. 14, pp. 51-69 (1989).
Lermontova et al., “Reduced activity of plastid protoporphyrinogen oxidase causes attenuated photodynamic damage during high-light compared to low-light exposure,” The Plant Journal, 48(4):499-510 (2006).
Lesnik et al., “Prediction of rho-independent transcriptional terminators in Escherichia coli,” Nucleic Acids Research, 29(17):3583-3594 (2001).
Li et al., “Establishment of a highly efficient transformation system for pepper (Capsicum annuum L.),” Plant Cell Reports, 21: 785-788 (2003).
Li et al., “The FAST technique: a simplified Agrobacterium-based transformation method for transient gene expression analysis in seedlings of Arabidopsis and other plant species,” Plant Methods, 5(6):1-15 (2009).
Liu et al., “Carbon Nanotubes as Molecular Transporters for Walled Plant Cells,” Nano Letters, 9(3):1007-1010 (2009).
Liu et al., “Comparative study on the interaction of DNA with three different kinds of surfactants and the formation of multilayer films,” Bioelectrochemistry, 70:301-307 (2007).
Liu et al., “DNAzyme-mediated recovery of small recombinant RNAs from a 5S rRNA-derived chimera expressed in Escherichia coli,” BMC Biotechnology, 10:85 (2010).
Llave et al., “Endogenous and Silencing-Associated Small RNAs in Plants,” The Plant Cell, 14:1605-1619 (2002).
Lu et al., “OligoWalk: an online siRNA design tool utilizing hybridization thermodynamics,” Nucleic Acids Research, 36:W104-W108 (2008).
Lu et al., “RNA silencing in plants by the expression of siRNA duplexes,” Nucleic Acids Res., 32(21):e171 (2004).
Luft, “Making sense out of antisense oligodeoxynucleotide delivery: getting there is half the fun,” J Mol Med, 76:75-76 (1998).
Maas et al., “Mechanism and optimized conditions for PEG mediated DNA transfection into plant protoplasts,” Plant Cell Reports, 8:148-149 (1989).
MacKenzie et al., “Transgenic Nicotiana debneyii expressing viral coat protein are resistant to potato virus S infection,” Journal of General Virology, 71:2167-2170 (1990).
Maher III et al., “Inhibition of DNA binding proteins by oligonucleotide-directed triple helix formation,” Science, 245(4919):725-730 (1989).
Makkouk et al., “Virus Diseases of Peas, Beans, and Faba Bean in the Mediterranean region,” Adv Virus Res, 84:367-402 (2012).
Mandal et al., “Adenine riboswitches and gene activation by disruption of a transcription terminator,” Nature Struct. Mol. Biol., 11(1):29-35 (2004).
Mandal et al., “Gene Regulation by Riboswitches,” Nature Reviews | Molecular Cell Biology, 5:451-463 (2004).
Manoharan, “Oligonucleotide Conjugates as Potential Antisense Drugs with Improved Uptake, Biodistribution, Targeted Delivery, and Mechanism of Action,” Antisense & Nucleic Acid Drug Development, 12:103-128 (2002).
Maori et al., “IAPV, a bee-affecting virus associated with Colony Collapse Disorder can be silenced by dsRNA ingestion,” Insect Molecular Biology, 18(1):55-60 (2009).
Masoud et al., “Constitutive expression of an inducible ß-1,3-glucanase in alfalfa reduces disease severity caused by the oomycete pathogen Phytophthora megasperma f. sp medicaginis, but does not reduce disease severity of chitincontaining fungi,” Transgenic Research, 5:313-323 (1996).
Matveeva et al., “Prediction of antisense oligonucleotide efficacy by in vitro methods,” Nature Biotechnology, 16:1374-1375 (1998).
Meinke, et al., “Identifying essential genes in Arabidopsis thaliana,” Trends Plant Sci., 13(9):483-491 (2008).
Meins et al., “RNA Silencing Systems and Their Relevance to Plant Development,” Annu. Rev. Cell Dev. Biol., 21:297-318 (2005).
Melnyk et al., “Intercellular and systemic movement of RNA silencing signals,” The EMBO Journal, 30:3553-3563 (2011).
Misawa et al., “Expression of an Erwinia phytoene desaturase gene not only confers multiple resistance to herbicides interfering with carotenoid biosynthesis but also alters xanthophyll metabolism in transgenic plants,” The Plant Journal, 6(4):481-489 (1994).
Misawa et al., “Functional expression of the Erwinia uredovora carotenoid biosynthesis gene crtl in transgenic plants showing an increase of β-carotene biosynthesis activity and resistance to the bleaching herbicide norflurazon,” The Plant Journal, 4(5):833-840 (1993).
Miura et al., “The Balance between Protein Synthesis and Degradation in Chloroplasts Determines Leaf Variegation in Arabidopsis yellow variegated Mutants,” The Plant Cell, 19:1313-1328 (2007).
Molina et al., “Inhibition of protoporphyrinogen oxidase expression in Arabidopsis causes a lesion-mimic phenotype that induces systemic acquired resistance,” The Plant Journal, 17(6):667-678 (1999).
Molnar et al., “Plant Virus-Derived Small Interfering RNAs Originate redominantly from Highly Structured Single-Stranded Viral RNAs,” Journal of Virology, 79(12):7812-7818 (2005).
Molnar et al., “Small Silencing RNAs in Plants Are Mobile and Direct Epigenetic Modification in Recipient Cells,” Science, 328:872-875 (2010).
Moriyama et al., “Double-stranded RNA in rice: a novel RNA replicon in plants,” Molecular & General Genetics, 248(3):364-369 (1995).
Moriyama et al., “Stringently and developmentally regulated levels of a cytoplasmic double-stranded RNA and its high-efficiency transmission via egg and pollen in rice,” Plant Molecular Biology, 31:713-719 (1996).
Morrissey et al., “Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs,” Nat Biotechnol. 23(8):1002-1007 (2005).
Moser et al., “Sequence-Specific Cleavage of Double Helical DNA by Triple Helix Formation,” Science, 238:645-646 (1987).
Non-Final Office Action dated Apr. 11, 2013, in U.S. Appl. No. 13/042,856.
Non-Final Office Action dated Aug. 12, 2015, in U.S. Appl. No. 13/612,936.
Non-Final Office Action dated Aug. 13, 2015, in U.S. Appl. No. 13/612,929.
Non-Final Office Action dated Jul. 23, 2015, in U.S. Appl. No. 14/335,135.
Non-Final Office Action dated Jul. 30, 2014, in U.S. Appl. No. 13/042,856.
Non-Final Office Action dated Jun. 5, 2015, in U.S. Appl. No. 13/612,948.
Non-Final Office Action dated Jun. 8, 2015, in U.S. Appl. No. 13/612,941.
Non-Final Office Action dated Mar. 30, 2015, in U.S. Appl. No. 13/583,302.
Non-Final Office Action dated May 15, 2015, in U.S. Appl. No. 14/608,951.
Non-Final Office Action dated May 22, 2015, in U.S. Appl. No. 13/612,985.
Nord-Larsen et al., “Cloning, characterization and expression analysis of tonoplast intrinsic proteins and glutamine synthetase in ryegrass (Lolium perenne L.),” Plant Cell Reports, 28(10):1549-1562 (2009).
Notice of Allowance dated Oct. 5, 2015, in U.S. Appl. No. 13/583,302.
Nowak et al., “A new and efficient method for inhibition of RNA viruses by DNA interference,” The FEBS Journal, 276:4372-4380 (2009).
Office Action dated Feb. 17, 2014, in Mexican Patent Application No. MX/a/2012/010479.
Office Action dated Jul. 23, 2015, in Ukrainian Patent Application No. 201211548.
Office Action dated Nov. 3, 2014, in Chinese Patent Application No. 201180012795.2.
Office Action dated Jan. 6, 2015, in Japanese Patent Application No. 2012-557165.
Office Action dated Nov. 19, 2014, in Eurasian Patent Application No. 201201264/28.
Office Action dated Oct. 5, 2015, in Eurasian Patent Application No. 201201264/28.
Office Action dated Sep. 9, 2015, in Chinese Patent Application No. 201280055409.2.
Ongvarrasopone et al., “A Simple and Cost Effective Method to Generate dsRNA for RNAi Studies in Invertebrates,” Science Asia, 33:35-39 (2007).
Orbović et al., “Foliar-Applied Surfactants and Urea Temporarily Reduce Carbon Assimilation of Grapefruit Leaves,” J. Amer. Soc. Hort. Sci., 126(4):486-490 (2001).
Ouellet et al., “Members of the Acetohydroxyacid Synthase Muligene Family of Brassica napus Have Divergent Patterns of Expression,” The Plant Journal, Blackwell Scientific Publications, Oxford, GB, 2(3):321-330 (1992).
Paddison et al., “Stable suppression of gene expression by RNAi in mammalian cells,” Proc. Natl Acad. Sci. USA, 99(3):1443-1448 (2002).
Palauqui et al., “Activation of systemic acquired silencing by localised introduction of DNA,” Current Biology, 9:59-66 (1999).
Parera et al., “Dehydration Rate after Solid Matrix Priming Alters Seed Performance of Shrunken-2 Corn,” J. Amer. Soc. Hort. Sci., 119(3):629-635 (1994).
Partial Supplementary European Search Report dated Mar. 2, 2015, in European Patent Application No. 12 831 494.5.
Paungfoo-Lonhienne et al., “DNA is Taken up by Root Hairs and Pollen, and Stimulates Root and Pollen Tube Growth,” Plant Physiology, 153:799-805 (2010).
Paungfoo-Lonhienne et al., “DNA uptake by Arabidopsis induces changes in the expression of CLE peptides which control root morphology,” Plant Signaling & Behavior, 5(9):1112-1114 (2010).
Pei et al., “On the art of identifying effective and specific siRNAs,” Nature Methods, 3(9):670-676 (2006).
Peretz et al., “A Universal Expression/Silencing Vector in Plants,” Plant Physiology, 145:1251-1263 (2007).
Pornprom et al., “Glutamine synthetase mutation conferring target-site-based resistance to glufosinate in soybean cell selections,” Pest Manag Sci, 2009; 65(2):216-222 (2009).
Pratt et al., “Amaranthus rudis and A. tuberculatus, One Species or Two?,” Journal of the Torrey Botanical Society, 128(3):282-296 (2001).
Preston et al., “Multiple effects of a naturally occurring proline to threonine substitution within acetolactate synthase in two herbicide-resistant populations of Lactuca serriola,” Pesticide Biochem. Physiol., 84(3):227-235 (2006).
Qiwei,“Advance in DNA interference,” Progress in Veterinary Medicine, 30(1):71-75 (2009).
Rajur et al., “Covalent Protein—Oligonucleotide Conjugates for Efficient Delivery of Antisense Molecules,” Bioconjug Chem., 8:935-940 (1997).
Reddy et al “Organosilicone Adjuvants Increased the Efficacy of Glyphosate for Control of Weeds in Citrus (Citrus spp.)” HortScience 27(9):1003-1005 (1992).
Reddy et al., “Aminomethylphosphonic Acid Accumulation in Plant Species Treated with Glyphosate,” J. Agric. Food Chem., 56(6):2125-2130 (2008).
Reither et al., “Specificity of DNA triple helix formation analyzed by a FRET assay,” BMC Biochemistry, 3:27 (2002).
Restriction Requirement dated Apr. 21, 2015, in U.S. Appl. No. 13/612,954.
Restriction Requirement dated Feb. 12, 2015, in U.S. Appl. No. 13/612,985.
Restriction Requirement dated Mar. 12, 2015, in U.S. Appl. No. 13/612,948.
Restriction Requirement dated Mar. 4, 2015, in U.S. Appl. No. 13/612,941.
Restriction Requirement dated May 4, 2015, in U.S. Appl. No. 13/612,929.
Restriction Requirement dated May 5, 2015, in U.S. Appl. No. 13/612,936.
Restriction Requirement dated May 7, 2015, in U.S. Appl. No. 13/612,925.
Restriction Requirement dated May 7, 2015, in U.S. Appl. No. 13/612,995.
Restriction Requirement dated Oct. 2, 2012, in U.S. Appl. No. 13/042,856.
Restriction Requirement dated Oct. 21, 2014, in U.S. Appl. No. 13/583,302.
Rey et al., “Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands,” Viruses, 4:1753-1791 (2012).
Reynolds et al., “Rational siRNA design for RNA interference,” Nature Biotechnology, 22:326-330 (2004).
Riggins et al., “Characterization of de novo transcriptome for waterhemp (Amaranthus tuberculatus) using GS-FLX 454 pyrosequencing and its application for studies of herbicide target-site genes,” Pest Manag. Sci., 66:1042-1052 (2010).
Rose et al., “Functional polarity is introduced by Dicer processing of short substrate RNAs,” Nucleic Acids Research, 33(13):4140-4156 (2005).
Rothnie et al., Pararetroviruses and Retroviruses: A Comparative Review of Viral Structure and Gene Expression Strategies, Advances in Virus Research, 44:1-67 (1994).
Ryabov et al., “Cell-to-Cell, but Not Long-Distance, Spread of RNA Silencing That Is Induced in Individual Epidermal Cells,” Journal of Virology, 78(6):3149-3154 (2004).
Ryan, “Human endogenous retroviruses in health and disease: a symbiotic perspective,” Journal of the Royal Society of Medicine, 97:560-565 (2004).
Santoro et al., “A general purpose RNA-cleaving DNA enzyme,” Proc. Natl. Acad. Sci. USA, 94:4262-4266 (1997).
Sathasivan et al., “Nucleotide sequence of a mutant acetolactate synthase gene from an imidazolinone-resistant Arabidopsis thaliana var. Columbia,” Nucleic Acids Research, 18(8):2188-2193 (1990).
Schwab et al., “RNA silencing amplification in plants: Size matters,” PNAS, 107(34):14945-14946 (2010).
Schweizer et al., “Double-stranded RNA interferes with gene function at the single-cell level in cereals,” The Plant Journal, 24(6):895-903 (2000).
Schwember et al., “Drying Rates following Priming Affect Temperature Sensitivity of Germination and Longevity of Lettuce Seeds,” HortScience, 40(3):778-781 (2005).
Second Chinese Office Action issued in Chinese Patent Application No. 201180012795.2, dated Jun. 10, 2014.
Seidman et al., “The potential for gene repair via triple helix formation,” J Clin Invest., 112(4):487-494 (2003).
Selvarani et al., “Evaluation of seed priming methods to improve seed vigour of onion (Allium cepa cv. Aggregatum) and carrot (Daucus carota),” Journal of Agricultural Technology, 7(3):857-867 (2011).
Senthil-Kumar et al., “A systematic study to determine the extent of gene silencing in Nicotiana benthamiana and other Solanaceae species when heterologous gene sequences are used for virus-induced gene silencing,” New Phytologist, 176:782-791 (2007).
Sharma et al., “A simple and efficient Agrobacterium-mediated procedure for transformation of tomato,” J. Biosci., 34(3):423 433 (2009).
Sijen et al., “On the Role of RNA Amplification in dsRNA-Triggered Gene Silencing,” Cell, 107:465-476 (2001).
Silwet L-77 Spray Adjuvant for agricultural applications, product description from Momentive Performance Materials, Inc. (2003).
Singh et al., “Absorption and translocation of glyphosate with conventional and organosilicone adjuvants,” Weed Biology and Management, 8:104-111 (2008).
Snead et al., “Molecular basis for improved gene silencing by Dicer substrate interfering RNA compared with other siRNA variants,” Nucleic Acids Research, 41(12):6209-6221 (2013).
Steeves et al., “Transgenic soybeans expressing siRNAs specific to a major sperm protein gene suppress Heterodera glycines reproduction,” Funct. Plant Biol., 33:991-999 (2006).
Stevens et al., “New Formulation Technology—Silwet® Organosilicone Surfactants Have Physical and Physiological Properties Which Enhance the Performance of Sprays,” Proceedings of the 9th Australian Weeds Conference, pp. 327-331 (1990).
Stock et al., “Possible Mechanisms for Surfactant-Induced Foliar Uptake of Agrochemicals,” Pestic. Sci., 38:165-177 (1993).
Strat et al., “Specific and nontoxic silencing in mammalian cells with expressed long dsRNAs,” Nucleic Acids Research, 34(13):3803-3810 (2006).
Street, “Why is DNA (and not RNA) a stable storage form for genetic information?,” Biochemistry Revisited, pp. 1-4 (2008).
Sudarsan et al., “Metabolite-binding RNA domains are present in the genes of eukaryotes,” RNA, 9:644-647 (2003).
Sun et al., “A Highly efficient Transformation Protocol for Micro-Tom, a Model Cultivar for Tomato Functional Genomics,” Plant Cell Physiol., 47(3):426-431 (2006).
Sun et al., “Sweet delivery—sugar translocators as ports of entry for antisense oligodeoxynucleotides in plant cells,” The Plant Journal, 52:1192-1198 (2007).
Sutton et al., “Activity of mesotrione on resistant weeds in maize,” Pest Manag. Sci., 58:981-984 (2002).
Takasaki et al., “An Effective Method for Selecting siRNA Target Sequences in Mammalian Cells,” Cell Cycle, 3:790-795 (2004).
Tank Mixing Chemicals Applied to Peanut Crops: Are the Chemicals Compatible?, College of Agriculture & Life Sciences, NC State University, AGW-653, pp. 1-11 (2004).
Taylor, “Seed Storage, Germination and Quality,” The Physiology of Vegetable Crops, pp. 1-36 (1997).
Temple et al., “Can glutamine synthetase activity levels be modulated in transgenic plants by the use of recombinant DNA technology?” Transgenic Plants and Plant Biochemistry, 22(4):915-920 (1994).
Temple et al., “Down-regulation of specific members of the glutamine synthetase gene family in Alfalfa by antisense RNA technology,” Plant Molecular Biology, 37:535-547 (1998).
Templeton et al., “Improved DNA: liposome complexes for increased systemic delivery and gene expression,” Nature Biotechnology, 15:647-652 (1997).
Tenllado et al., “Crude extracts of bacterially expressed dsRNA can be used to protect plants against virus infection,” BMC Biotechnology, 3(3):1-11 (2003).
Tenllado et al., “RNA interference as a new biotechnological tool for the control of virus diseases in plants,” Virus Research, 102:85-96 (2004).
Tepfer, “Risk assessment of virus resistant transgenic plants,” Annual Review of Phytopathology, 40:467-491 (2002).
The Seed Biology Place, Website Gerhard Leubner Lab Royal Holloway, University of London, <http://www.seedbiology.de/seedtechnology.asp.
Third Party Submission filed on Nov. 29, 2012 in U.S. Appl. No. 13/042,856.
Thompson, et al., “CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice,” Nucl. Acids Res., 22(22):4673-4680 (1994).
Timmons et al., “Specific interference by ingested dsRNA,” Nature, 395:854 (1998).
Tomari et al., “Perspective: machines for RNAi,” Genes & Dev., 19:517-529 (2005).
Töpfer et al., “Uptake and Transient Expression of Chimeric Genes in Seed-Derived Embryos,” Plant Cell, 1:133-139 (1989).
Toriyama et al., “Transgenic Rice Plants After Direct Gene Transfer Into Protoplasts,” Bio/Technology, 6:1072-1074 (1988).
Tran et al., “Control of specific gene expression in mammalian cells by co-expression of long complementary RNAs,” FEBS Lett.;573(1-3):127-134 (2004).
Tranel et al., “Resistance of weeds to ALS-inhibiting herbicides: what have we learned?,” Weed Science, 50:700-712 (2002).
Tsugawa et al., “Efficient transformation of rice protoplasts mediated by a synthetic polycationic amino polymer,” Theor Appl Genet, 97:1019-1026 (1998).
Turina et al., “Tospoviruses in the Mediterranean Area,” Advances in Virus Research, 84:403-437 (2012).
Tuschl, “Expanding small RNA interference,” Nature Biotechnol., 20: 446-448 (2002).
Tuschl, “RNA Interference and Small Interfering RNAs,” ChemBiochem. 2(4):239-245 (2001).
Ui-Tei et al., “Guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference,” Nucleic Acids Res., 32(3): 936-948 (2004).
Unnamalai et al., “Cationic oligopeptide-mediated delivery of dsRNA for post-transcriptional gene silencing in plant cells,” FEBS Letters, 566:307-310 (2004).
Unniraman et al., “Alternate Paradigm for Intrinsic Transcription Termination in Eubacteria,” The Journal of Biological Chemistry, 276(45)(9):41850-41855 (2001).
Urayama et al., “Knock-down of OsDCL2 in Rice Negatively Affects Maintenance of the Endogenous dsRNA Virus, Oryza sativa Endornavirus,” Plant and Cell Physiology, 51(1):58-67 (2010).
Van de Wetering et al., “Specific inhibition of gene expression using a stably integrated, inducible small-interfering-RNA vector,” EMBO Rep., 4(6):609-615 (2003).
Vasil et al., “Herbicide Resistant Fertile Transgenic Wheat Plants Obtained by Microprojectile Bombardment of Regenerable Embryogenic Callus,” Bio/Technology,10:667-674 (1992).
Vaucheret, “Post-transcriptional small RNA pathways in plants: mechanisms and regulations,” Genes Dev., 20:759-771 (2006).
Vencill et al., “Resistance of Weeds to Herbicides,” Herbicides and Environment, 29:585-594 (2011).
Verma et al., “Modified oligonucleotides: synthesis and strategy for users,” Annu. Rev. Biochem., 67:99-134 (1998).
Vermeulen et al., “The contributions of dsRNA structure to Dicer specificity and efficiency,” RNA, 11(5):674-682 (2005).
Vert et al., “An accurate and interpretable model for siRNA efficacy prediction,” BMC Bioinformatics, 7:520 (2006).
Voinnet et al., “Systemic Spread of Sequence-Specific Transgene RNA Degradation in Plants Is Initiated by Localized Introduction of Ectopic Promoterless DNA,” Cell, 95:177-187 (1998).
Wakelin et al., “A target-site mutation is present in a glyphosate-resistant Lolium rigidum population,” Weed Res. (Oxford), 46(5):432-440 (2006).
Walton et al., “Prediction of antisense oligonucleotide binding affinity to a structured RNA target,” Biotechnol Bioeng 65(1):1-9 (1999).
Wan et al., “Generation of Large Numbers of Independently Transformed Fertile Barley Plants,” Plant Physiol., 104:37-48 (1994).
Wang et al., “Foliar uptake of pesticides-Present status and future challenge,” ScienceDirect, 87:1-8 (2007).
Wardell, “Floral Induction of Vegetative Plants Supplied a Purified Fraction of Deoxyribonucleic Acid from Stems of Flowering Plants,” Plant Physiol, 60:885-891 (1977).
Wardell,“Floral Activity in Solutions of Deoxyribonucleic Acid Extracted from Tobacco Stems,” Plant Physiol, 57:855-861 (1976).
Waterhouse et al., “Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA,” Proc Natl Acad Sci USA, 95 13959-13964 (1998).
Welch et al., “Expression of ribozymes in gene transfer systems to modulate target RNA levels,” Curr Opin Biotechnol. 9(5):486-496 (1998).
Wilson, et al., “Transcription termination at intrinsic terminators: The role of the RNA hairpin,” Proc. Natl. Acad. Sci. USA, 92:8793-8797 (1995).
Winkler et al., “Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression,” Nature, 419:952-956 (2002).
Written Opinion dated May 8, 2014, in International Application No. PCT/IL2013/050447.
Written Opinion dated Sep. 1, 2014, in Singapore Patent Application No. 201206152-9.
Xu et al., Characterization and Functional Analysis of the Calmodulin-Binding Domain of Rac1 GTPase, Plos One, 7(8)1-12:e42975 (2012).
Yin et al., “Production of double-stranded RNA for interference with TMV infection utilizing a bacterial prokaryotic expression system,” Appl. Microbiol. Biotechnol., 84(2):323-333 (2009).
YouTube video by General Electric Company “Silwet Surfactants,” screen shot taken on Jan. 11, 2012 of video of www.youtube.com/watch?v=WBw7nXMqHk8 (uploaded Jul. 13, 2009).
Zagnitko, “Lolium regidum clone LS1 acetyl-CoA carboxylase mRNA, partial cds; nuclear gene for plastid product,” GenBank: AF359516.1, 2 pages (2001).
Zagnitko, et al., “An isoleucine/leucine residue in the carboxyltransferase domain of acetyl-CoA carboxylase is critical for interaction with aryloxyphenoxypropionate and cyclohexanedione inhibitors,” PNAS, 98(12):6617-6622 (2001).
Zhang et al., “A novel rice gene, NRR responds to macronutrient deficiency and regulates root growth,” Mol Plant, 5(1):63-72 (2012).
Zhang et al., “Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method,” Nature Protocols, 1(2):1-6 (2006).
Zhang et al., “Cationic lipids and polymers mediated vectors for delivery of siRNA,” Journal of Controlled Release, 123:1-10 (2007).
Zhang et al., “DEG: a database of essential genes,” Nucleic Acids Res., 32:D271-D272 (2004).
Zhang et al., “Transgenic rice plants produced by electroporation-mediated plasmid uptake into protoplasts,” The Plant Cell Rep., 7:379-384 (1988).
Zhao et al.,“Phyllotreta striolata (Coleoptera: Chrysomelidae):Arginine kinase cloning and RNAi-based pest control,” European Journal of Entomology, 105(5):815-822 (2008).
Zhu et al., “Ingested RNA interference for managing the populations of the Colorado potato beetle, Leptinotarsa decemlineata,” Pest Manag Sci, 67:175-182 (2010).
Communication pursuant to Article 94(3) EPC dated Mar. 24, 2016, in European Patent Application No. 12 831 684.1.
Communication pursuant to Article 94(3) EPC dated Mar. 4, 2016, in European Patent Application No. 12 830 932.5.
Communication pursuant to Article 94(3) EPC dated Mar. 9, 2016, in European Patent Application No. 12 831 166.9.
Communication pursuant to Article 94(3) EPC dated Mar. 18, 2016, in European Patent Application No. 12 832 160.1.
Communication pursuant to Article 94(3) EPC dated Jan. 14, 2016, in European Patent Application No. 12 832 415.9.
Extended European Search Report dated Jan. 20, 2016, in European Patent Application No. 13 794 339.5.
Extended European Search Report dated Oct. 8, 2013, in European Patent Application No. 11753916.3.
First Office Action dated Feb. 2, 2016, in Chinese Patent Application No. 201380039346.6.
Fukunaga et al., “dsRNA with 5′ overhangs contributes to endogenous and antiviral RNA silencing pathways in plants,” The EMBO Journal, 28(5):545-555 (2009).
GenBank Accession No. GU120406, “Chrysomela tremulae ribosomal protein L7 (RpL7) mRNA, complete cds” (2009).
GenBank Accession No. Q4GXM3_BIPLU, “Ribosomal protein L7e” (2006).
GenBank Accession No. FE348695, “CBIB7954.fwd CBIB_Daphnia_pulex_Chosen_One_Library_2 Daphnia pulex cDNA clone CBIB7954 5′, mRNA sequence” (2011).
GenBank Accession No. HD315444, “Sequence 192160 from Patent EP2213738” (2010).
GenBank Accession No. EW765249, “ST020010B10C12 Normalized and subtracted western corn rootworm female head cDNA library Diabrotica virgifera virgifera cDNA clone STO20010B10C12 5-, mRNA sequence,” (2007).
GenBank Accession No. EW771198, “ST020010B10C12 Normalized and subtracted western corn rootworm female head cDNA library Diabrotica virgifera virgifera cDNA clone ST020010B10C12 5-, mRNA sequence,” (2007).
GenBank Accession No. CB377464, “CmaE1_37_J02_T3 Cowpea weevil larvae Lambda Zap Express Library Callosobruchus maculatus cDNA, mRNA sequence,” (2007).
GenBank Accession No. Y08611.1, “P.sativum mRNA for dihydropterin pyrophosphokinase/dihydropteroate synthase ” (2006).
Gudkov, “Minireview: The L7/L12 ribosomal domain of the ribosome: structural and functional studies,” FEBS Letters, 407:253-256 (1997).
Heffer et al., “Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report,” EvoDevo Journal, 2(7):1-5 (2011).
International Search Report and Written Opinion dated Nov. 27, 2015, in International Application No. PCT/US2015/037015.
International Search Report and Written Opinion dated May 26, 2016, in International Application No. PCT/US2016/014344.
Knudsen, “Promoter2.0: for the recognition of Poll promoter sequences,” Bioniformatics, 15(5):356-361 (1999).
Migge et al., “Greenhouse-grown conditionally lethal tobacco plants obtained by expression of plastidic glutamine synthetase antisense RNA may contribute to biological safety,” Plant Science 153:107-112 (2000).
Office Action dated Aug. 28, 2013, in Chinese Patent Application No. 201180012795.2.
Office Action dated Feb. 24, 2014, in Eurasian Patent Application No. 201201264.
Office Action dated Apr. 13, 2016, in Chinese Patent Application No. 201280053985.3.
Patent Examination Report No. 1 dated Feb. 8, 2016, in Australian Patent Application No. 2014262189.
Patent Examination Report No. 1 dated Nov. 11, 2013, in Australian Patent Application No. 2011224570.
Promoter Prediction for SEQ ID No. 1702 from 13/612929/MK/, Promoter 2.0 Prediction Results, pp. 1-4 (2016).
Salanenka et al.,“Seedcoat Permeability: Uptake and Post-germination Transport of Applied Model Tracer Compounds,” HortScience, 46(4):622-626 (2011).
Scott et al., Botanical Insecticides for Controlling Agricultural Pests: Piperamides and the Colorado Potato Beetle Leptinotarsa decemlineata Say (Coleoptera: Chrysomelidae), Archives of Insect Biochemistry and Physiology, 54:212-225 (2003).
Second Office Action dated Mar. 4, 2016, in Chinese Patent Application No. 201280054820.8.
Second Office Action dated Feb. 25, 2016, in Chinese Patent Application No. 201280054179.8.
Shintani et al., “Antisense Expression and Overexpression of Biotin Carboxylase in Tobacco Leaves,” Plant Physiol., 114:881-886 (1997).
Written Opinion dated Apr. 7, 2016, in Singapore Patent Application No. 201206152-9.
Bachman et al., “Characterization of the spectrum of insecticidal activity of a double-stranded RNA with targeted activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte),” Transgenic Res., pp. 1-16 (2013).
Colliver et al., “Differential modification of flavonoid and isoflavonoid biosynthesis with an antisense chalcone synthase construct in transgenic Lotus corniculatus,” Plant Molecular Biology, 35:509-522 (1997).
Communication pursuant to Article 94(3) EPC dated Jun. 26, 2015, in European Patent Application No. 11 753 916.3.
Communication pursuant to Article 94(3) EPC dated Oct. 23, 2015, in European Patent Application No. 12 831 945.6.
Concise Descriptions of Relevance filed by a third party on Nov. 29, 2012, in U.S. Appl. No. 13/042,856.
Dalakouras et al., “Induction of Silencing in Plants by High-Pressure Spraying of In vitro-Synthesized Small RNAs,” Frontiers in Plant Science, 7(1327):1-5 (2016).
Dawson et al., “cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts,” Proc. Natl. Acad. Sci. USA, 83:1832-1836 (1986).
Extended European Search Report dated Sep. 29, 2016, in European Patent Application No. 14778840.0.
Final Office Action dated Apr. 7, 2016, in U.S. Appl. No. 13/619,980.
Final Office Action dated Dec. 17, 2015, in U.S. Appl. No. 14/335,135.
Final Office Action dated Feb. 17, 2016, in U.S. Appl. No. 13/612,929.
Final Office Action dated Feb. 4, 2016, in U.S. Appl. No. 13/612,936.
Final Office Action dated Jun. 30, 2016, in U.S. Appl. No. 13/901,326.
Final Office Action dated Mar. 2, 2016, in U.S. Appl. No. 13/612,995.
Final Office Action dated Mar. 21, 2016, in U.S. Appl. No. 13/612,925.
Final Office Action dated May 26, 2016, in U.S. Appl. No. 14/532,596.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 13/612,954.
Final Office Action dated Nov. 19, 2015, in U.S. Appl. No. 13/612,941.
Final Office Action dated Nov. 10, 2016, in U.S. Appl. No. 13/583,302.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 14/608,951.
Final Office Action dated Sep. 9, 2016, in U.S. Appl. No. 14/603,347.
Final Office Action dated Oct. 20, 2016, in U.S. Appl. No. 14/480,199.
Final Office Action dated Oct. 22, 2015, in U.S. Appl. No. 14/608,951.
Fraley et al., “Liposome-mediated delivery of tobacco mosaic virus RNA into tobacco protoplasts: A sensitive assay for monitoring liposome-protoplast interactions,” Proc Natl Acad Sci U S A., 79(6):1859-1863 (1982).
Fukunaga et al., “dsRNA with 5′ overhangs v contributes to endogenous and antiviral RNA silencing pathways in plants,” The EMBO Journal, 28(5):545-555 (2009).
Further Examination Report dated May 16, 2014, in New Zealand Patent Application No. 601784.
Gan et al., “Inhibition of Leaf Senescence by Autoregulated Production of Cytokinin,” Science, 270:1986-1988 (1995).
Gao et al., “Nonviral Methods for siRNA Delivery,” Molecular Pharmaceutics, 6(3):651-658 (2008).
GenBank Accession No. AY545657.1 (2004).
GenBank Accession No. DY640489, “PU2_plate27_F03 PU2 Prunus persica cDNA similar to expressed mRNA inferred from Prunus persica hypothetical domain/motif cont aining IPR011005:Dihydropteroate synthase-like, MRNA sequence” (2006).
GenBank Accession No. EU024568, “Amaranthus hypochondriacus acetolactate synthase (ALS) gene” (2007).
GenBank Accession No. FJ972198, “Solanum lycopersicum cultivar Ailsa Craig dihydropterin pyrophosphokinase-dihydropteroate synthase (HPPK-DHPS) gene, complete cds” (2010).
GenBank Accession No. GI:186478573 (2014).
GenBank Accession No. U87257.1, “Daucus carota 4-hydroxyphenylpyruvate dioxygenase mRNA, complete cds” (1997).
GenBank Accession No. XM_ 014456745.1, PREDICTED: Myotis lucifugus ribonucleoprotein, PTB-binding 2 (RAVER2), transcript variant X3, mRNA,: (2015).
GenEmbl Accession No. FJ861243 (2010).
Hajirezaei et al., “Impact of elevated cytosolic and apoplastic invertase activity on carbon metabolism during potato tuber development,” Journal of Experimental Botany, 51:439-445 (2000).
Holtra et al., “Assessment of the Physiological Condition of Salvinia Natans L. Exposed to Copper(II) Ions,” Environ. Protect. Eng., 41:147-158 (2015).
International Preliminary Report on Patentability dated Sep. 11, 2012, in International Application No. PCT/US2011/027528.
International Rice Genome Sequencing Project, The map-based sequence of the rice genome, Nature, 436(11):793-800 (2005).
International Search Report and the Written Opinion dated Feb. 25, 2013, in International Application No. PCT/US2012/054883.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054814.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054842.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054862.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054894.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054974.
International Search Report and the Written Opinion dated Feb. 27, 2013, in International Application No. PCT/US2012/054980.
International Search Report and the Written Opinion dated May 10, 2011, in International Application No. PCT/US2011/027528.
Jin et al., “Posttranslational Elevation of Cell Wall Invertase Activity by Silencing its Inhibitor in Tomato Delays Leaf Senescence and Increases Seed Weight and Fruit Hexose Level,” The Plant Cell, 21:2072-2089 (2009).
Kaloumenos et al., “Identification of a Johnsongrass (Sorghum halepense) Biotype Resistant to ACCase-Inhibiting Herbicides in Northern Greece,” Weed Technol, 23:470-476 (2009).
Kambiranda et al., “Relationship Between Acid Invertase Activity and Sugar Content in Grape Species,” Journal of Food Biochemistry, 35:1646-1652 (2011).
Kim et al., “Optimization of Conditions for Transient Agrobacterium-Mediated Gene Expression Assays in Arabidopsis,” Plant Cell Reports, 28:1159-1167 (2009).
Kirkwood, “Herbicides and Plants,” Botanical Journal of Scotland, 46(3):447-462 (1993).
Liu, “Influence of Sugars on the Foliar Uptake of Bentazone and Glyphosate,” New Zealand Plant Protection, 55:159-162 (2002).
Luque et al., “Water Permeability of Isolated Cuticular Membranes: A Structural Analysis,” Archives of Biochemistry and Biophysics, 317(2):417-422 (1995).
Mora et al., “How Many Species Are There on Earth and in the Ocean?,” PLOS Biol., 9(8):e100127, p. 1-8 (2011).
Mount et al., “Gene and Metabolite Regulatory Network Analysis of Early Developing Fruit Tissues Highlights New Candidate Genes for the Control of Tomato Fruit Composition and Development,” Plant Physiology, 149:1505-1528 (2009).
Non-Final Office Action dated Aug. 19, 2016, in U.S. Appl. No. 13/612,925.
Non-Final Office Action dated Aug. 19, 2016, in U.S. Appl. No. 13/612,929.
Non-Final Office Action dated Apr. 29, 2016, in U.S. Appl. No. 13/583,302.
Non-Final Office Action dated Aug. 10, 2016, in U.S. Appl. No. 13/612,995.
Non-Final Office Action dated Nov. 9, 2016, in U.S. Appl. No. 14/901,003.
Non-Final Office Action dated Aug. 3, 2016, in U.S. Appl. No. 14/015,715.
Non-Final Office Action dated Aug. 5, 2016, in U.S. Appl. No. 14/015,785.
Non-Final Office Action dated Aug. 8, 2016, in U.S. Appl. No. 13/612,936.
Non-Final Office Action dated Dec. 17, 2015, in U.S. Appl. No. 14/532,596.
Non-Final Office Action dated Feb. 10, 2016, in U.S. Appl. No. 13/901,326.
Non-Final Office Action dated Feb. 23, 2016, in U.S. Appl. No. 14/603,347.
Non-Final Office Action dated Feb. 23, 2016, in U.S. Appl. No. 14/608,951.
Non-Final Office Action dated Sep. 6, 2016, in U.S. Appl. No. 14/335,135.
Non-Final Office Action dated Mar. 1, 2016, in U.S. Appl. No. 13/612,954.
Non-Final Office Action dated Oct. 3, 2016, in U.S. Appl. No. 14/403,491.
Non-Final Office Action dated Sep. 1, 2015, in U.S. Appl. No. 13/612,954.
Non-Final Office Action dated Sep. 11, 2015, in U.S. Appl. No. 13/612,925.
Non-Final Office Action dated Sep. 4, 2015, in U.S. Appl. No. 13/612,995.
Nookaraju et al., “Molecular approaches for enhancing sweetness in fruits and vegetables,” Scientia Horticulture, 127:1-15 (2010).
Notice of Allowance dated Apr. 11, 2016, in U.S. Appl. No. 13/612,985.
Notice of Allowance dated Apr. 19, 2016, in U.S. Appl. No. 13/612,941.
Notice of Allowance dated Apr. 20, 2016, in U.S. Appl. No. 13/612,948.
Notice of Allowance dated Feb. 23, 2015, in U.S. Appl. No. 13/042,856.
Notice of Allowance dated Jun. 2, 2015, in U.S. Appl. No. 13/042,856.
Office Action dated Jul. 18, 2016, in Indonesian Patent Application No. W00201203610.
Office Action dated Sep. 5, 2016, in Ukrainian Patent Application No. a 2014 03846.
Office Action dated Aug. 25, 2016, in Eurasian Patent Application No. 201201264.
Office Action dated Jun. 20, 2016, in Chinese Patent Application No. 201280054819.5.
Office Action dated Jun. 24, 2016, in Chinese Patent Application No. 201280053984.9.
Office Action dated Nov. 15, 2016, in Mexican Patent Application. No. MX/a/2014/003068.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03845.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03852.
Office Action dated Dec. 13, 2016, in Ukrainian Patent Application No. a 2014 03843.
Office Action dated Dec. 15, 2016, in Ukrainian Patent Application No. a 2014 03849.
Office Action dated Dec. 14, 2016, in Ukrainian Patent Application No. a 2014 03850.
Office Action dated Dec. 27, 2016, in Ukrainian Patent Application No. a 2012 11548.
Office Action dated Mar. 16, 2017, in Chinese Patent Application No. 201280054819.5.
Patent Examination Report No. 1 dated Jun. 17, 2016, in Australian Patent Application No. 2012308659.
Patent Examination Report No. 1 dated Jun. 17, 2016, in Australian Patent Application No. 2012308660.
Promoter Prediction for SEQ ID No. 4 from 13/612995/MK/, Promoter 2.0 Prediction Results, pp. 1-3 (2016).
Promoter Prediction for SEQ ID No. 7 from 13/612936/MK/, Promoter 2.0 Prediction Results, pp. 1-2 (2016).
Promoter Prediction for SEQ ID No. 8 from 13/612,925/MK/, Promoter 2.0 Prediction Results, pp. 1-6 (2016).
Regalado, “The Next Great GMO Debate,” MIT Technology Review, pp. 1-19 (2015).
Restriction Requirement dated Jul. 18, 2016, in U.S. Appl. No. 14/143,836.
Restriction Requirement dated Oct. 13, 2016, in U.S. Appl. No. 14/206,707.
Restriction Requirement dated Oct. 28, 2015, in U.S. Appl. No. 14/603,347.
Restriction Requirement dated Sep. 2, 2015, in U.S. Appl. No. 14/532,596.
Robson et al., “Leaf senescence is delayed in maize expressing the Agrobacterium IPT gene under the control of a novel maize senescence-enhanced promoter,” Plant Biotechnology Journal, 2:101-112 (2004).
Roitsch et al., “Function and regulation of plant invertases: sweet sensations,” Trades in Plant Science, 9(12):606-613 (2004).
Ruan et al., “Suppression of Sucrose Synthase Gene Expression Represses Cotton Fiber Cell Initiation, Elongation, and Seed Development,” The Plant Cell, 15:952-964 (2003).
Schönherr, “Water Permeability of Isolated Cuticular Membranes: The Effect of pH and Cations on Diffusion, Hydrodynamic Permeability and Size of Polar Pores in the Cutin Matrix,” Planta, 128:113-126 (1976).
Second Chinese Office Action dated Jun. 10, 2014, in Chinese Patent Application No. 201180012795.2.
Shaoquan, “The action target of herbicide and the innovation of a new variety,” Chemical Industry Press, pp. 23-24 (2001).
Showalter, “Structure and Function of Plant Cell Wall Proteins,” The Plant Cell, 5:9-23 (1993).
Song et al., “Herbicide,” New Heterocyclic Pesticide, Chemical Industry Press, 354-356 (2011).
Stevens, “Organosilicone Surfactants as Adjuvants for Agrochemicals,” Journal of Pesticide Science, 38:103-122 (1993).
Tang et al., “Efficient delivery of small interfering RNA to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing,” Plant Science, 171:375-381 (2006).
Tenllado et al., “Double-Stranded RNA-Mediated Interference with Plant Virus Infection,” Journal of Virology, 75(24):12288-12297 (2001).
Thomas et al., “Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana bentharniana using a potato virus X vector,” The Plant Journal, 25(4):417-425 (2001).
Tomlinson et al., “Evidence that the hexose-to-sucrose ratio does not control the switch to storage product accumulation in oilseeds: analysis of tobacco seed development and effects of overexpressing apoplastic invertase,” Journal of Experimental Botany.
Unniraman et al., “Conserved Economics of Transcription Termination in Eubacteria,” Nucleic Acids Research, 30(3):675-684 (2002).
Widholm et al., “Glyphosate selection of gene amplification in suspension cultures of 3 plant species,” Phyisologia Plantarum, 112:540-545 (2001).
Wiesman et al., “Novel cationic vesicle platform derived from vernonia oil for efficient delivery of DNA through plant cuticle membranes,” Journal of Biotechnology, 130:85-94 (2007).
Written Opinion dated Mar. 6, 2017, in Singaporean Patent Application No. 2012061529.
Zhang et al., “Chapter 10: New Characteristics of Pesticide Research & Development,” New Progress of the world agriculture chemicals, p. 209 (2010).
Agricultural Chemical Usage 2006 Vegetables Summary, Agricultural Statistics Board, NASS, USDA, pp. 1-372 (2007).
Al-Kaff et al., “Plants rendered herbicide-susceptible by cauliflower mosaic virus—elicited suppression of a 35S promoter-regulated transgene,” Nature Biotechnology, 18:995-999 (2000).
Andersen et al., “Delivery of siRNA from lyophilized polymeric surfaces,” Biomaterials, 29:506-512 (2008).
Anonymous, “Resistant Weeds Spur Research Into New Technologies,” Grains Research & Development Corporation, 2013.
Bachman et al., “Characterization of the spectrum of insecticidal activity of a double-stranded RNA with targeted activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte),” Transgenic Res., pp. 1-16 (2013) Herewith.
Balibrea et al., “Extracellular Invertase is an Essential Component of Cytokinin-Mediated Delay of Senescence,” The Plant Cell, 16(5):1276-1287 (2004).
Bart et al., “A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts,” Plant Methods, 2(13):1-9 (2006).
Basu et al., “Weed genomics: new tools to understand weed biology,” TRENDS in Plant Science, 9(8):391-398 (2004).
Bauer et al., “The major protein import receptor of plastids is essential for chloroplast biogenesis,” Nature, 403:203-207 (2000).
Busch et al., “RNAi for discovery of novel crop protection products,” Pflanzenschutz-Nachrichten Bayer, 58(1):34-50 (2005).
Chabannes et al., “In situ analysis of lignins in transgenic tobacco reveals a differential impact of individual transformations on the spatial patterns of lignin deposition at the cellular and subcellular levels,” The Plant Journal, 28(3):271-282 (2001).
Chang et al., “Dual-target gene silencing by using long, sythetic siRNA duplexes without triggering antiviral responses,” Molecules and Cells, 27(6):689-695 (2009).
Chen et al., “Transfection and Expression of Plasmid DNA in Plant Cells by an Arginine-Rich Intracellular Delivery Peptide without Protoplast Preparation,” FEBS Letters, 581, pp. 1891-1897 (2007).
Cheng et al., “Transient Expression of Minimum Linear Gene Cassettes in Onion Epidermal Cells Via Direct Transformation,” Appl Biochem Biotechnol, 159:739-749 (2009).
Christiaens et al., “The challenge of RNAi-mediated control of hemipterans,” Current Opinion in Insect Science, 6:15-21 (2014).
Database EMBL XP-002781749(BG442539) dated Mar. 20, 2001.
Egli et al., “A Maize Acetyl-Coenzyme A Carboxylase cDNA Sequence,” Plant Physiol., 108: 1299-1300 (1995).
Eudes et al., “Cell-penetrating peptides,” Plant Signaling & Behavior, 3(8):549-5550 (2008).
European Search Report dated Sep. 7, 2017, in European Patent Application No. 17152830.0.
Examination Report dated Mar. 1, 2018, in Australian Patent Application No. 2013264742.
Examination Report No. 2, dated Mar. 23, 2018, in Australian Patent Application No. 2014248958.
Examination Report dated Jun. 29, 2017, in Australian Patent Application No. 2012308818.
Extended European Search Report dated Nov. 7, 2017, in European Patent Application No. 15811092.4.
Extended European Search Report dated Nov. 8, 2017, in European Patent Application No. 15737282.2.
Extended European Search Report dated Apr. 13, 2018, in European Patent Application No. 15812530.0.
Extended European Search Report dated Mar. 15, 2018, in European Patent Application No. 17181861.0.
Gallie et al., “Identification of the motifs within the tobacco mosaic virus 5′-leader responsible for enhancing translation,” Nucleic Acids Res., 20(17):4631-4638 (1992).
Gan et al., “Bacterially expressed dsRNA protects maize against SCMV infection,” Plant Cell Rep, 29(11):1261-1268 (2010).
Gasser et al., “Structure, Expression, and Evolution of the 5-Enolpyruvylshikimate-3-phosphate Synthase Genes of Petunia and Tomato,” J. Biol. Chem., 263: 4280-4287 (1988).
Gomez-Zurita et al., “Recalibrated Tree of Leaf Beetles (Chrysomelidae) Indicates Independent Diversification of Angiosperms and Their Insect Herbivores,” PLoS One, 4(e360):1-8 (2007).
Hoermann et al., “Tic32, as Essential Component in Chloroplast Biogenesis,” The Journal of Biological Chemistry, 279(33):34756-34762 (2004).
Hu et al., “High efficiency transport of quantum dots into plant roots with the aid of silwet L-77,” Plant Physiology and Biochemistry, 48:703-709 (2010).
Inaba et al., “Arabidopsis Tic110 Is Essential for the Assembly and Function of the Protein Import Machinery of Plastids,” The Plant Cell, 17:1482-1496 (2005).
Jarvis et al, “An Arabidopsis mutant defective in the plastid general protein import apparatus,” Science, 282:100-103 (1998).
Kovacheva et al., “Further in vivo studies on the role of the molecular chaperone, Hsp93, in plastid protein import,” The Plant Journal, 50:364-379 (2007).
Kovacheva et al., “In vivo studies on the roles of Tic100, Tic40 and Hsp93 during chloroplast protein import,” The Plant Journal, 41:412-428 (2005).
Li et al., “Long dsRNA but not siRNA initiates RNAi in western corn rootworm larvae and adults,” Journal of Applied Entomology, 139(6):432-445 (2015).
Liu, “The Transformation of Nucleic Acid Degradants in Plants,” China Organic Fertilizers, Agriculture Press, ISBN: 7-1091634 (with English translation).
Non-Final Office Action dated Mar. 21, 2018, in U.S. Appl. No. 13/619,980.
Office Action dated Dec. 5, 2017, in Japanese Patent Application No. 2016-502033.
Office Action dated Feb. 21, 2018, in Mexican Patent Application No. MX/a/2015/012632 (with English translation).
Office Action dated Mar. 8, 2018 (with English translation), in Chilean Patent Application No. 201403192.
Partial European Search Report dated Dec. 6, 2017, in European Patent Application No. 17181861.0.
Partial European Search Report dated Jun. 29, 2018, in European Patent Application No. 18157745.3.
Partial Supplementary European Search Report dated Jan. 11, 2018, in European Patent Application No. 15812530.0.
Qichuan et al., Seed Science, China Agriculture Press, pp. 101-103, Tables 2-37 (2001).
Regalado, The Next Great GMO Debate, MIT Technology Review, pp. 1-19 (2015) <https://www.technologyreview.com/s/540136/the-next-great-gmo-debate/>.
Roberts, “Fast-track applications: The potential for direct delivery of proteins and nucleic acids to plant cells for the discovery of gene function,” Plant Methods, 1(12):1-3 (2005).
Roitsch et al., “Extracellular invertase: key metabolic enzyme and PR protein,” Journal of Experimental Botany, 54(382):513-524 (2003).
Search Report dated Oct. 20, 2017, in Chinese Patent Application No. 201380039346.6.
Stevens, “Organosilicone Surfactants as Adjuvants for Agrochemicals,” New Zealand Journal of Forestry Science, 24:27-34 (1994).
Summons to Attend Oral Proceedings Pursuant to Rule 115(1) EPC, dated Aug. 7, 2017, in European Patent Application No. 12832160.1.
Sun et al.,“Antisense oligodeoxynucleotide inhibition as a potentstrategy in plant biology: identification of SUSIBA2 as atranscriptional activator in plant sugar signalling,” The Plant Journal, 44:128-138 (2005).
Sun, “Characterization of Organosilicone Surfactants and Their Effects on Sulfonylurea Herbicide Activity,” Thesis Submitted to the Faculty of the Virginia Polytechnic Institute and State University dated Apr. 5, 1996.
Teng et al., “Tic21 Is an Essential Translocon Component for Protein Translocation across the Chloroplast Inner Envelope Membrane,” The Plant Cell, 18:2247-2257 (2006).
Ulrich et al., “Large scale RNAi screen in Tribolium reveals novel target genes for pest control and the proteasome as prime target,” BMC genomics, 16(1):671 (2015).
Wild Carrot, Noxious Weed Control Board (NWCB) of Washington State (2010).
Zaimin et al., Chapter III Seeds and Seedlings, Botany, Northwest A&F University Press, pp. 87-92 (2009).
Zhang et al., “Development and Validation of Endogenous Reference Genes for Expression Profiling of Medaka (Oryzias latipes) Exposed to Endocrine Disrupting Chemicals by Quantitative Real-Time RT-PCR,” Toxicological Sciences, 95(2):356-368 (2007).
Zhang, Chapter 10: New Characteristics of Pesticide Research & Development, p. 209 (2010).
Zhong et al., “A pea antisense gene for the chloroplast stromal processing peptidase yields seedling lethals in Arabidopsis: survivors show defective GFP import in vivo,” The Plant Journal, 34:802-812 (2003).
Zotti et al., “RNAi technology for insect management and protection of beneficial insects from diseases: lessons, challenges and risk assessments,” Neotropical Entomology, 44(3):197-213 (2015).
Wang et al., “Principle and technology of genetic engineering in plants,” in Plant genetic engineering principles and techniques, Beijing: Science Press, pp. 313-315 (1998).
Asad et al., “Silicon Carbide Whisker-mediated Plant Transformation,” Properties and Applicants of Silicon Carbide, pp. 345-358 (2011).
Ascencio-Ibanez et al., “DNA Abrasion onto Plants is an Effective Method for Geminivirus Infection and Virus-Induced Gene Silencing,” Journal of Virological Methods, 142:198-203 (2007).
Baker, “Chlorophyll Fluorescence: A Probe of Photosynthesis In Vivo,” Annu. Rev. Plant Biol., 59:89-113 (2008).
Baum et al., “Progress Towards RNAi-Mediated Insect Pest Management” Advances in Insect Physiology, 47:249-295 (2014).
Bedell et al., “Sorghum Genome Sequencing by Methylation Filtration,” PLOS Biology, 3(1):E13/104-115 (2005).
Belhadj et al., “Methyl Jasmonate Induces Defense Responses in Grapevine and Triggers Protection Against Erysiphe Necator,” J. Agric Food Chem., 54:9119-9125 (2006).
Burgos et al., “Review: Confirmation of Resistance to Herbicides and Evaluation of Resistance Levels,” Weed Science, 61(1):4-20 (2013).
Burleigh, “Relative quantitative RT-PCR to Study the Expression of Plant Nutrient Transporters in Arbuscular Mycorrhizas,” Plant Science, 160:899-904 (2001).
Chang et al., “Dual-Target Gene Silencing by Using Long, Synthetic siRNA duplexes without triggering antiviral responses,” Molecules and Cells, 27(6)689-695 (2009).
Chen et al., “Exploring MicroRNA-Like Small RNAs in the Filamentous Fungus Fusarium oxysporum,” PLoS One, 9(8):e104956:1-10 (2014).
Communication Pursuant to Article 94(3) EPC dated Sep. 5, 2018, in European Patent Application No. 17152830.0.
Constan et al., “An Outer Envelope Membrane Component of the Plastid Protein Import Apparatus Plays an Essential Role in Arabidopsis,” The Plant Journal, 38:93-106 (2004).
Declaration of Jerzy Zabkiewicz executed Nov. 28, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-73.
Declaration of Jerzy Zabkiewicz executed Nov. 28, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-4.
Declaration of Neena Mitter executed Nov. 30, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-114.
Declaration of Neena Mitter executed Nov. 30, 2017, as filed by Opponent in Australian Patent Application No. 2014262189, pp. 1-25.
Delye et al., “PCR-based detection of resistance to acetyl-CoA carboxylase-inhibiting herbicides in black-grass (Alopecurus myosuroides Huds) and ryegrass (Lolium rigidum Gaud),” Pest Management Science, 58:474-478 (2002).
Delye et al., “Variation in the Gene Encoding Acetolactate-Synthase in Lolium Aspecies and Proactive Detection of Mutant, Herbicide-Resistant Alleles,” Weed Research, 49:326-336 (2009).
Desveaux et al., “PBF-2 Is a Novel Single-Stranded DNA Binding Factor Implicated in PR-10a Gene Activation in Potato,” The Plant Cell, 12:1477-1489 (2000).
Di Stilio et al., “Virus-Induced Gene Silencing as a Tool for Comparative Functional Studies in Thalictrum,” PLoS One, 5(8):e12064 (2010).
Dietzgen et al., “Transgenic Gene Silencing Strategies for Virus Control,” Australasian Plant Pathology, 35:605-618 (2006).
Dilpreet et al., “Glyphosate Resistance in a Johnsongrass (Sorghum halepense) Biotype from Arkansas,” Weed Science, 59(3):299-304 (2011).
Duhoux et al., “Reference Genes to Study Herbicide Stress Response in Lolium sp.: Up-Regulation of P3450 Genes in Plants Resistant to Acetolactate-Synthase Inhibitors,” PLoS One, 8(5):e63576 (2013).
Eamens et al., “RNA Silencing in Plants: Yesterday, Today, and Tomorrow,” Plant Physiology, 147(2):456-468 (2008).
Extended European Search Report dated Dec. 19, 2018, in European Patent Application No. 16804395.8.
Extended European Search Report dated Nov. 16, 2018, in European Patent Application No. 18182238.8.
Extended European Search Report dated Nov. 21, 2018, in European Patent Application No. 18175809.5.
Extended European Search Report dated Sep. 28, 2018, in European Patent Application No. 16740770.9.
Fassler, BLAST Glossary, National Center for Biotechnology Information (2011).
Fernandez et al., “Uptake of Hydrophilic Solutes Through Plant Leaves: Current State of Knowledge and Perspectives of Foliar Fertilization,” Critical Reviews in Plant Sciences, 28:36-38 (2009).
Feuillet et al., “Crop Genome Sequencing: Lessons and Rationales,” Trends Plant Sci., 16:77-88 (2011).
Friedberg, “Automated Protein Function Prediction—the Genomic Challenge,” Briefings in Bioinformatics, 7(3):225-242 (2006).
Funke et al., “Molecular Basis for herbicide Resistance in Roundup Ready Crops,” PNAS, 103:13010-13015 (2006).
Gaskin et al., “Novel Organosillicone Adjuvants to Reduce Agrochemical spray volumes on row crops,” New Zealand Plant Protection, 53:350-354 (2000).
GenBank Accession No. EF143582 (2007).
Gilmer et al., “Latent Viruses of Apple I. Detection with Woody Indicators,” Plant Pathology, 1(10):1-9 (1971).
Gossamer Threads, Compendium of Herbicide Adjuvants: Organo-Silicone Surfactant, p. 1-4 (1998).
Guttieri et al., “DNA Sequence Variation in Domain A of the Acetolactate Synthase Genes of Herbicide-Resistant and -Susceptible Weed Biotypes,” Weed Science, 40:670-679 (1992).
Hagio, “Chapter 25: Direct Gene Transfer into Plant Mature Seeds via Electroporation After Vacuum Treatment,” Electroporation and Sonoporation in Developmental Biology, p. 285-293 (2009).
Hess, “Surfactants and Additives,” 1999 Proceedings of the California Weed Science Society, 51:156-172 (1999).
Huang et al., “In Vivo Analyses of the Roles of Essential Omp85-Related Proteins in the Chloroplast Outer Envelope Membrane,” Plant Physiol., 157:147-159 (2011).
Huggett et al., “Real-time RT-PCR Normalisation; Strategies and Considerations,” Genes and Immunity, 6:279-284 (2005).
Ivanova et al., “Members of the Toc159 Import Receptor Family Represent Distinct Pathways for Protein Targeting to Plastids,” Molecular Biology of the Cell, 15:3379-3392 (2004).
Jacque et al., “Modulation of HIV-1 replication by RNA interference,” Nature, 418, 435-438 (2002).
Jang et al., “Resistance to herbicides caused by Single Amino Acid Mutations in Acetyl-CoA Carboxylase in resistant Populations of Grassy Weeds,” New Phytologist, 197(4):1110-1116 (2013).
Jiang et al., Chapter III Seeds and Seedlings, Botany, Northwest A&F University Press, pp. 87-92 (2009).
Kikkert et al., “Stable Transformation of Plant Cells by Particle Bombardment/Biolistics,” Methods in Molecular Biology, 286:61-78 (2005).
Kim et al., “Synthesis and Characterization of Mannosylated Pegylated Polyethylenimine as a Carrier for siRNA,” International Journal of Pharmaceutics, 427:123-133 (2012).
Kirkwood, “Recent developments in our understanding of the plant cuticle as a barrier to the foliar uptake of pesticides,” Pestic Sci, 55:69-77 (1999).
Kumar et al., “Sequencing, De Novo Assembly and Annotation of the Colorado Potato Beetle, Leptinotarsa decemlineata,Transcriptome,” PLoS One, 9(1):e86012 (2014).
Liu et al., “Identification and Application of a Rice Senescence-Associated Promoter,” Plant Physiology, 153:1239-1249 (2010).
Liu, “Confocal laser scanning microscopy—an attractive tool for studying the uptake of xenobiotics into plant foliage,” Journal of Microscopy, 213(Pt 2):87-93 (2004).
Liu et al., “The Helicase and RNaseIIIa Domains of Arabidopsis Dicer-Like1 Modulate Catalytic Parameters during MicroRNA Biogenesis,” Plant Physiology, 159:748-758 (2012).
Liu, “Calmodulin and Cell Cycle,” Foreign Medical Sciences Section of Pathophysiology and Clinical Medicine, 18(4):322-324 (1998).
Lodish et al., Molecular Cell Biology, Fourth Edition, p. 210 (2000).
Lucas et al., “Plasmodesmata—Bridging the Gap Between Neighboring Plant Cells,” Trends in Cell Biology, 19:495-503 (2009).
Morozov et al., “Evaluation of Preemergence Herbicides for Control of Diclofop-Resistant Italian Ryegrass (Lolium multiflorum) in Virginia,” Virginia Polytechnic Institute and State University, pp. 43-71 (2004).
Nemeth, “Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees,” Martinus Nijhoff Publishers, 197-204 (1986).
N-TER Nanoparticle siRNA, Sigma Aldrich TM website, Web. Nov. 20, 2018 <https://www.sigmaaldrich.com/life-science/custom-oligos/sirna-oligos/n-ter-nanoparticle.html>.
Office Action dated Aug. 1, 2017, in European Patent Application No. 12 830 932.5.
Office Action dated Aug. 14, 2017, in Israeli Patent Application No. 235878.
Office Action dated Aug. 22, 2017, in Korean Patent Application No. 10-2012-7023415.
Office Action dated Aug. 3, 2017, in Chinese Patent Application No. 201480014392.5 (with English translation).
Office Action dated Aug. 3, 2017, in European Patent Application No. 12 831 684.1.
Office Action dated Aug. 8, 2017, in Chilean Patent Application No. 201501874.
Office Action dated Aug. 9, 2018, in Canadian Patent Application No. 2,848,371.
Office Action dated Jul. 11, 2017, in Mexican Patent Application No. MX/a/2015/013118 (with English translation).
Office Action dated Jul. 3, 2017, in Mexican Patent Application No. MX/a/2015/012632 (with English translation).
Office Action dated Jul. 30, 2018, in Canadian Patent Application No. 2,848,576.
Office Action dated Jul. 6, 2017, in Mexican Patent Application No. MX/a/2015/013103 (with English translation).
Office Action dated May 3, 2016, in Chilean Patent Application No. 201601057.
Office Action dated Nov. 15, 2016, in Mexican Patent Application No. MX/a/2014/003068 (with English translation).
Office Action dated Sep. 20, 2018, in Chilean Patent Application No. 201601440 (with English translation).
Office Action dated Sep. 6, 2017, in Chinese Patent Application No. 2014800154012 (with English translation).
Patent Examination Report No. 1 dated Jun. 8, 2017, in Australian Patent Application No. 2012308686.
Powles et al., “Evolution in Action: Plants Resistant to Herbicides,” Annual Review of Plant Biology, 61(1):317-347 (2010).
Pratt et al., “Sorghum Expressed Sequence Tags Identify Signature Genes for Drought, Pathogenesis, and Skotomorphogenesis from a Milestone Set of 16,801 Unique Transcripts,” Plant Physiology, 139:869-884 (2005).
Rakoczy-Trojanowska, “Alternative Methods of Plant Transformation—A Short Review,” Cellular & Molecular Biology Letters, 7:849-858 (2002).
Restriction Requirement dated Jul. 15, 2016, in U.S. Appl. No. 14/143,748.
Reverdatto et al., “A Multisubunit Acetyl Coenzyme A Carboxylase from Soybean,” Plant Physiol., 119: 961-978 (1999).
Richardson et al., “Targeting and assembly of components of the TOC protein import complex at the chloroplast outer envelope membrane,” Frontiers in Plant Science, 5:1-14 (2014).
Schöinherr et al.,“Size selectivity of aqueous pores in astomatous cuticular membranes isolated from Populus canescens (Aiton) Sm. Leaves,” Planta, 219:405-411 (2004).
Search Report dated Jul. 24, 2017, in Chinese Patent Application No. 201480014392.5 (with English translation).
Simeoni et al., “Insight into the mechanism of the peptide-based gene delivery system MPG: implications for delivery of siRNA into mammalian cells,” Nucleic Acids Research, 31(11):2717-2724 (2003).
Small, “RNAi for revealing and Engineering Plant Gene Functions,” Current Opinion in Biotechnology, 18:148-153 (2007).
Statement of Grounds and Particulars dated Sep. 1, 2017, in Australian Patent No. 2014262189.
Stevens, “Formulation of Sprays to Improve the Efficacy of Foliar Fertilisers,” New Zealand Journal of Forestry Science, 24(1):27-34 (1994).
Tice, “Selecting the right compounds for screening: does Lipinski's Rule of 5 for pharmaceuticals apply to agrochemicals?” Pest Management Science, 57(1):3-16 (2001).
Tomlinson, “Evidence that the Hexose-to-Sucrose Ratio Does Not Control the Switch to Storage Product Accumulation in Oilseeds: Analysis of Tobacco Seed Development and Effects..,” Jrnl. of Exper. Bot., 55(406):2291-2303 (2004).
Trucco et al., “Amaranthus Hybridus can be Pollinated Frequently by A. Tuberculatus Under Filed Conditions,” Heredity, 94:64-70 (2005).
Voinnet, “Origin, Biogenesis, and Activity of Plant MicroRNAs,” Cell, 136:669-687 (2009).
Watson et al., “RNA silencing platforms in plants,” FEBS Letters, 579:5982-5987 (2005).
Wool et al., “Structure and Evolution of Mammalian Ribosomal Proteins,” Biochem. Cell Biol., 73:933-947 (1995).
Yan et al., Seed Science, China Agriculture Press, pp. 101-103, Tables 2-37 (2001).
Yu et al., “Diversity of Acetyl-Coenzyme A Carboxylase Mutations in Resistant Lolium Populations: Evaluation Using Clethodim,” Plant Physiology, 145:547-558 (2007).
Yu et al., “Glyphosate, paraquat and ACCase Multiple Herbicide Resistance Evolved in a Lolium rigidum biotype,” Planta, 225:499-513 (2007).
Zabkiewicz, “Adjuvants and Herbicidal Efficacy—Present Status and Future Prospects,” Weed Research, 40:139-149 (2000).
Zhang, “Artificial Trans-Acting Small Interfering RNA: A Tool for Plant Biology Study and Crop Improvements,” Planta, 239:1139-1146 (2014).
Zhao et al., “Ps0r1, a Potential Target for RNA Interference-Based Pest Management,” Insect Molecular Biology, 20(1):97-104 (2011).
Zhao et al., “Vegetable Standardized Production Technology,” Hangzhou: Zhejiang Science and Technology Press, p. 19 (2008).
Zhong et al., “A Forward Genetic Screen to Explore Chloroplast Protein Import in vivo Identifies Moco Sulfurase, Pivotal for ABA and IAA Biosynthesis and Purine Turnover,” The Plant Journal, 63:44-59 (2010).
Related Publications (1)
Number Date Country
20160029644 A1 Feb 2016 US
Provisional Applications (1)
Number Date Country
61779476 Mar 2013 US