Patent Application
20240002541
This document contains a Sequence Listing that has been submitted electronically as an ASCII text file named 44807-0384WO_SL_ST25.txt. The ASCII text file, created on Nov. 30, 2021, is 335 kilobytes in size. The material in the ASCII text file is hereby incorporated by reference in its entirety.
This document relates to methods and materials for treating T cell cancers. For example, a composition containing one or more bispecific molecules can be administered to a mammal having a T cell cancer to treat the mammal. For example, this document provides methods and materials for using one or more bispecific molecules to treat a mammal having a T cell cancer.
T cell cancers are a heterogeneous group of malignancies that comprises about 15% of non-Hodgkin's lymphomas (Swerdlow et al., Blood 127:2375-2390 (2016)) and 20% of acute lymphoblastic leukemias (ALL; Han et al., Cancer Causes & Control 19:841-858 (2008); and Dores et al., Blood 119:34-43 (2012). Outcomes of T cell lymphomas and relapsed T cell ALL (T-ALL) are worse than those for equivalent B cell malignancies, with an estimated 5-year survival of only 32% in T cell lymphomas (Weisenburger et al., Blood 117:3402-3408 (2011)) and 7% in relapsed T-ALL (Fielding et al., Blood 109:944-950 (2007)).
Malignant B or T cells do not express cell-surface antigens that are distinct from their non-cancerous counterparts. There are several targeted immunotherapeutic agents for B cell malignancies that target pan-B cell antigens such as CD19 or CD20, which is feasible because the associated normal B cell aplasia is clinically well tolerated. However, a similar strategy targeting pan-T cell antigens is not feasible because the resultant T cell depletion would lead to a clinically unacceptable level of immunosuppression.
This document provides methods and materials for treating T cell cancers. In some cases, this document provides bispecific molecules that can be used to treat T cell cancers. For example, a bispecific molecule that includes at least two antigen binding domains, where a first antigen binding domain (e.g., a first single-chain variable fragment (scFv)) can bind a T cell receptor β chain variable (TRBV) polypeptide and a second antigen binding domain (e.g., a second scFv) can bind a T cell co-receptor polypeptide, can be used to treat a mammal (e.g., a human) having a T cell cancer. In some cases, this document provides methods for treating T cell cancers. For example, one or more bispecific molecules provided herein (e.g., a composition containing one or more bispecific molecules provided herein) can be administered to a mammal having a T cell cancer to treat the mammal.
As demonstrated herein, T cell cancers can be treated by targeting specific subsets of T cell receptor (TCR) antigens. For example, bispecific antibodies targeting TRBV5-5 and CD3 can stimulate healthy T cells to specifically lyse TRBV5-5+ malignant T cell cells. Similarly, bispecific antibodies targeting TRBV12 and CD3 can stimulate healthy T cells to specifically lyse TRBV12+ malignant T cells. Also as demonstrated herein, bispecific antibodies targeting TRBV5-5 and CD3 and bispecific antibodies targeting TRBV12 and CD3 can preserve the majority of normal T cells within a mammal and can improve survival.
VDJ recombination, combined with allelic exclusion, results in expression of one of the 30 T cell receptor β chain variable (TRBV) polypeptides on the surface of each T cell, such that each TRBV is expressed on the surface of 1 to 5% of the total normal human peripheral blood T cells. In contrast, clonal T cell cancers express a single TRBV polypeptide. Having the ability to treat T cell cancers as described herein (e.g., by administering one or more bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) provides a unique and unrealized opportunity to selectively deplete clonal T cell cancers while retaining the majority of the normal T cells (see, e.g.,
In general, one aspect of this document features bispecific molecules including a first polypeptide comprising a first antigen binding domain that can bind a TRBV polypeptide, and a second polypeptide comprising a second antigen binding domain that can bind a T cell co-receptor polypeptide. The first polypeptide can be a single-chain variable fragment (scFv), an antigen-binding fragment (Fab), a F(ab′)2 fragment, or biologically active fragments thereof. The TRBV polypeptide can be a TRBV2 polypeptide, a TRBV3-1 polypeptide, a TRBV4-1 polypeptide, a TRBV4-2 polypeptide, a TRBV4-3 polypeptide, a TRBV5-1 polypeptide, a TRBV5-4 polypeptide, a TRBV5-5 polypeptide, a TRBV5-6 polypeptide, a TRBV5-8 polypeptide, a TRBV6-1 polypeptide, a TRBV6-2 polypeptide, a TRBV6-3 polypeptide, a TRBV6-4 polypeptide, a TRBV6-5 polypeptide, a TRBV6-6 polypeptide, a TRBV6-8 polypeptide, a TRBV6-9 polypeptide, a TRBV7-2 polypeptide, a TRBV7-3 polypeptide, a TRBV7-4 polypeptide, a TRBV7-6 polypeptide, a TRBV7-7 polypeptide, a TRBV7-8 polypeptide, a TRBV7-9 polypeptide, a TRBV9 polypeptide, a TRBV10-1 polypeptide, a TRBV10-2 polypeptide, a TRBV10-3 polypeptide, a TRBV11-1 polypeptide, a TRBV11-2 polypeptide, a TRBV11-3 polypeptide, a TRBV12-2 polypeptide, a TRBV12-3 polypeptide, a TRBV12-4 polypeptide, a TRBV12-5 polypeptide, a TRBV13 polypeptide, a TRBV14 polypeptide, a TRBV15 polypeptide, a TRBV16 polypeptide, a TRBV18 polypeptide, a TRBV19 polypeptide, a TRBV20-1 polypeptide, a TRBV24-1 polypeptide, a TRBV25-1 polypeptide, a TRBV27 TRBV28 polypeptide, a TRBV29-1 polypeptide, or a TRBV30 polypeptide. For example, the TRBV polypeptide can be a TRBV5-5 polypeptide. A first antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain including a VL CDR1 having an amino acid sequence set forth in SEQ ID NO:1, a VL CDR2 having an amino acid sequence set forth in SEQ ID NO:2, and a VL CDR3 having an amino acid sequence set forth in SEQ ID NO:3; and can include a heavy chain including a VH CDR1 having an amino acid sequence set forth in SEQ ID NO:4, a VH CDR2 having an amino acid sequence set forth in SEQ ID NO:5, and a VH CDR3 having an amino acid sequence set forth in SEQ ID NO:6. In some cases, the light chain can include an amino acid sequence set forth in SEQ ID NO:7, and the heavy chain can include an amino acid sequence set forth in SEQ ID NO:8. In some cases, the light chain can include an amino acid sequence set forth in SEQ ID NO:38, and the heavy chain can include an amino acid sequence set forth in SEQ ID NO:39. For example, TRBV polypeptide can be TRBV12 polypeptide. A first antigen binding domain that can bind to a TRBV12 polypeptide can include a light chain including a VL CDR1 having an amino acid sequence set forth in SEQ ID NO:9, a VL CDR2 having an amino acid sequence set forth in SEQ ID NO:10, and a VL CDR3 having an amino acid sequence set forth in SEQ ID NO:11; and can include a heavy chain including a VH CDR1 having an amino acid sequence set forth in SEQ ID NO:12, a VH CDR2 having an amino acid sequence set forth in SEQ ID NO:13, and a VH CDR3 having an amino acid sequence set forth in SEQ ID NO:14. In some cases, the light chain can include an amino acid sequence set forth in SEQ ID NO: 15, and the heavy chain can include an amino acid sequence set forth in SEQ ID NO:16. In some cases, the light chain can include an amino acid sequence set forth in SEQ ID NO:40, and the heavy chain can include an amino acid sequence set forth in SEQ ID NO:41. The second polypeptide can be a scFv, an Fab, a F(ab′)2 fragment, or biologically active fragments thereof. The T cell co-receptor polypeptide can be a cluster of differentiation 3 (CD3) polypeptide or a T cell receptor polypeptide. A second antigen binding domain that can bind to a CD3 polypeptide can include a light chain including a VL CDR1 having an amino acid sequence set forth in SEQ ID NO:17, a VL CDR2 having an amino acid sequence set forth in SEQ ID NO:18, and a VL CDR3 having an amino acid sequence set forth in SEQ ID NO:19; and can include a heavy chain including a VH CDR1 having an amino acid sequence set forth in SEQ ID NO:20, a VH CDR2 having an amino acid sequence set forth in SEQ ID NO:21, and a VH CDR3 having an amino acid sequence set forth in SEQ ID NO:22. In some cases, the light chain can include an amino acid sequence set forth in SEQ ID NO:23, and the heavy chain can include an amino acid sequence set forth in SEQ ID NO:24.
In another aspect, this document features methods for treating a mammal having a T cell cancer. The methods can include, or consist essentially of, administering to a mammal having a T cell cancer a bispecific molecule including a first polypeptide having a first antigen binding domain that can bind a TRBV polypeptide, and a second polypeptide having a second antigen binding domain that can bind a T cell co-receptor polypeptide. The mammal can be a human. The T cell cancer can be a clonal T cell cancer. The T cell cancer can be an acute lymphoblastic leukemia (ALL), a peripheral T cell lymphomas (PTCL), an angioimmunoblastic T cell lymphomas (AITL), a T cell prolymphocytic leukemia (T-PLL), an adult T cell leukemia/lymphoma (ATLL), an nteropathy-associated T-cell lymphoma (EATL), a monomorphic epitheliotropic intestinal T-cell lymphoma (MEITL), a follicular T-cell lymphoma (FTCL), a nodal peripheral T-cell lymphoma (nodal PTCL), a cutaneous T cell lymphomas (CTCL), an anaplastic large cell lymphoma (ALCL), a T-cell large granular lymphocytic leukemia (T-LGL), an extra nodal NK/T-Cell lymphoma (NKTL), or a hepatosplenic T-cell lymphoma. The cancer cells within the mammal can be reduced by at least 95 percent. The method can be effective to improve survival of the mammal (e.g., can be effective to improve survival of the mammal by at least 37.5 percent).
In another aspect, this document features methods for treating a mammal having celiac disease. The methods can include, or consist essentially of, administering to a mammal having celiac disease a bispecific molecule including a first polypeptide having a first antigen binding domain that can bind a TRBV polypeptide and a second polypeptide having a second antigen binding domain that can bind a T cell co-receptor polypeptide. The mammal can be a human. The TRBV polypeptide can be a TRBV4 polypeptide, a TRBV6 polypeptide, a TRBV7 polypeptide, a TRBV9 polypeptide, a TRBV20, or a TRBV29 polypeptide, and the T cell co-receptor polypeptide can be a CD3 polypeptide. The TRBV polypeptide can be a TRBV6-1 polypeptide, a TRBV7-2 polypeptide, a TRBV9-1 polypeptide, a TRBV20-1 polypeptide, or a TRBV29-1 polypeptide, and the T cell co-receptor polypeptide can be a CD3 polypeptide.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
This document provides methods and materials for treating T cell cancers. In some cases, this document provides bispecific molecules that can be used to treat T cell cancers. For example, this document provides bispecific molecules that include at least two antigen binding domains where a first antigen binding domain (e.g., a first scFv) can bind a TRBV polypeptide and a second antigen binding domain (e.g., a second scFv) can bind a T cell co-receptor polypeptide) can be used to treat a mammal (e.g., a human) having a T cell cancer. This document also provides methods for treating T cell cancers. For example, one or more bispecific molecules provided herein (e.g., a composition containing one or more bispecific molecules provided herein) can be administered to a mammal having a T cell cancer to treat the mammal. In some cases, a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can activate T cells within a mammal to target (e.g., target and destroy) T cells expressing a TRBV polypeptide that can be targeted by the bispecific molecule. For example, a T cell expressing a T cell co-receptor polypeptide that can be targeted by a bispecific molecule provided herein can be activated to target (e.g., target and destroy) T cells (e.g., cancerous T cells) expressing a TRBV polypeptide that can be targeted by the bispecific molecule.
Any appropriate mammal (e.g., a mammal having a T cell cancer) can be treated as described herein. For example, humans, non-human primates (e.g., monkeys), horses, bovine species, porcine species, dogs, cats, mice, and rats can be treated as described herein. In some cases, a human having a T cell cancer can be administered one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide).
The materials and methods described herein can be used to treat a mammal (e.g., a human) having any type of T cell cancer. In some cases, a T cell cancer treated as described herein can include one or more solid tumors. In some cases, a T cell cancer treated as described herein can be a blood cancer. In some cases, a T cell cancer treated as described herein can be a primary cancer. In some cases, a T cell cancer treated as described herein can be a metastatic cancer. In some cases, a T cell cancer treated as described herein can be a refractory cancer. In some cases, a T cell cancer treated as described herein can be a non-Hodgkin's lymphoma. In some cases, a T cell cancer treated as described herein can be a Hodgkin's lymphoma. Examples of T cell cancers that can be treated as described herein include, without limitation, ALL, PTCL, AITL, T-PLL, ATLL, EATL, MEITL, FTCL, nodal PTCL, CTCL, ALCL, T-LGL, NKTL, and hepatosplenic T-cell lymphoma.
In some cases, the materials and methods provided herein can be used to reduce or eliminate the number of cancer cells present within a mammal (e.g., a human) having a T cell cancer. For example, a mammal in need thereof (e.g., a mammal having a T cell cancer) can be administered one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) to reduce or eliminate the number of cancer cells present within the mammal. For example, the materials and methods described herein can be used to reduce the number of cancer cells present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the materials and methods described herein can be used to reduce the size (e.g., volume) of one or more tumors present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the number of cancer cells present within a mammal being treated can be monitored. Any appropriate method can be used to determine whether or not the number of cancer cells present within a mammal is reduced. For example, imaging techniques can be used to assess the number of cancer cells present within a mammal.
In some cases, the materials and methods provided herein can be used to improve survival of a mammal (e.g., a human) having a T cell cancer. For example, a mammal in need thereof (e.g., a mammal having a T cell cancer) can be administered one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) to improve survival of the mammal. For example, the materials and methods described herein can be used to improve the survival of a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the materials and methods described herein can be used to improve the survival of a mammal having cancer by, for example, at least 6 months (e.g., about 6 months, about 8 months, about 10 months, about 1 year, about 1.5 years, about 2 years, about 2.5 years, about 3 years, about 4 years, about 5 years, or more).
In some cases, when a mammal in need thereof (e.g., a mammal having a T cell cancer) is administered one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide), the majority of normal T cells within the mammal can be preserved. For example, the materials and methods described herein can be used to treat mammal having a T cell cancer as described herein while preserving, for example, 50, 60, 70, 80, 90, 95, or more percent of normal (e.g., non-cancerous) T cells within the mammal. In some cases, from about 75 percent to about 100 percent (e.g., from about 75 percent to about 99 percent, from about 75 percent to about 95 percent, from about 75 percent to about 93 percent, from about 75 percent to about 90 percent, from about 75 percent to about 85 percent, from about 80 percent to about 100 percent, from about 85 percent to about 100 percent, from about 90 percent to about 100 percent, or from about 95 percent to about 100 percent) of normal (e.g., non-cancerous) T cells within a mammal can be preserved when the mammal is administered one or more bispecific molecules provided herein.
In some cases, the methods described herein also can include identifying a mammal as having a T cell cancer. Examples of methods for identifying a mammal as having a T cell cancer include, without limitation, physical examination, laboratory tests (e.g., blood and/or urine), biopsy, imaging tests (e.g., X-ray, PET/CT, MRI, and/or ultrasound), nuclear medicine scans (e.g., bone scans), endoscopy, and/or genetic tests. Once identified as having a T cell cancer, a mammal can be administered or instructed to self-administer one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide).
Any appropriate bispecific molecule can be administered to a mammal (e.g., a human) as described herein. In some cases, a bispecific molecule can include at least two (e.g., two, three, or four) antigen binding domains, where a first antigen binding domain (e.g., a first scFv) can bind a TRBV polypeptide and a second antigen binding domain (e.g., a second scFv) can bind a T cell co-receptor polypeptide. In some cases, a bispecific molecule provided herein can include a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide.
A first antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be any appropriate type of antigen binding domain. In some cases, a first antigen binding domain that can be used in a bispecific molecule provided herein can include a variable region of an immunoglobulin light chain (a VL) and a variable region of an immunoglobulin heavy chain (VH). For example, a first antigen binding domain that can be used in a bispecific molecule provided herein can include a first complementarity determining region (CDR) from an immunoglobulin light chain (a VL CDR1), a second CDR from an immunoglobulin light chain (a VL CDR2), and a third CDR an immunoglobulin light chain (a VL CDR3), a first CDR from an immunoglobulin heavy chain (a VH CDR1), a second CDR from an immunoglobulin heavy chain (a VH CDR2), and a third CDR an immunoglobulin heavy chain (a VH CDR2). Examples of antigen binding domains that can be used as a can be used as a first antigen binding domain in a bispecific molecule provided herein include, without limitation, single-chain variable fragment (scFv), an antigen-binding fragment (Fab), a F(ab′)2 fragment, and biologically active fragments thereof (e.g., a fragment that retains the ability to bind the target molecule such as a TRBV polypeptide). In some cases, an antigen binding domain that can be used as a first antigen binding domain in a bispecific molecule provided herein can be a scFv.
A first antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can bind any appropriate TRBV Examples of TRBVs that can be targeted by a first antigen binding domain in a bispecific molecule provided herein include, without limitation, TRBV2 polypeptides, TRBV3-1 polypeptides, TRBV4-1 polypeptides, TRBV4-2 polypeptides, TRBV4-3 polypeptides, TRBV5-1 polypeptides, TRBV5-4 polypeptides, TRBV5-5 polypeptides, TRBV5-6 polypeptides, TRBV5-8 polypeptides, TRBV6-1 polypeptides, TRBV6-2 polypeptides, TRBV6-3 polypeptides, TRBV6-4 polypeptides, TRBV6-5 polypeptides, TRBV6-6 polypeptides, TRBV6-8 polypeptides, TRBV6-9 polypeptides, TRBV7-2 polypeptides, TRBV7-3 polypeptides, TRBV7-4 polypeptides, TRBV7-6 polypeptides, TRBV7-7 polypeptides, TRBV7-8 polypeptides, TRBV7-9 polypeptides, TRBV9 polypeptides, TRBV10-1 polypeptides, TRBV10-2 polypeptides, TRBV10-3 polypeptides, TRBV11-1 polypeptides, TRBV11-2 polypeptides, TRBV11-3 polypeptides, TRBV12-2 polypeptides, TRBV12-3 polypeptides, TRBV12-4 polypeptides, TRBV12-5 polypeptides, TRBV13 polypeptides, TRBV14 polypeptides, TRBV15 polypeptides, TRBV16 polypeptides, TRBV18 polypeptides, TRBV19 polypeptides, TRBV20-1 polypeptides, TRBV24-1 polypeptides, TRBV25-1 polypeptides, TRBV27 TRBV28 polypeptides, TRBV29-1 polypeptides, and TRBV30 polypeptides. In some cases, a first antigen binding domain that binds a TRBV is specific for that TRBV For example, a first antigen binding domain that binds a TRBV can bind to that TRBV with an affinity having a dissociation constant (KD) of from about 2 nM to about 30 nM (e.g., from about 2 nM to about 25 nM, from about 2 nM to about 20 nM, from about 2 nM to about 15 nM, from about 2 nM to about 10 nM, from about 2 nM to about 5 nM, from about 5 nM to about 30 nM, from about 10 nM to about 30 nM, from about 15 nM to about 30 nM, from about 20 nM to about 30 nM, from about 25 nM to about 30 nM, from about 2.6 nM to about 25.2 nM, from about 5 nM to about 20 nM, from about 10 nM to about 15 nM, from about 5 nM to about 10 nM, from about 15 nM to about 20 nM, or from about 20 nM to about 25 nM). In some cases, a first antigen binding domain that specifically binds a TRBV does not bind (or does not substantially bind) a different TRBV. In some cases, a first antigen binding domain in a bispecific molecule provided herein can be as described elsewhere (see, e.g., Wang et al., Nat. Genet., 47, 1426-1434 (2015); and de Masson et al., Sci. Transl. Med., 10, (2018)).
In some cases, a first antigen binding domain that can be used in a bispecific molecule provided herein can bind to a TRBV5-5 polypeptide. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include each of the CDRs set forth below:
In some cases, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:1, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:2, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:3. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:7. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:38. In some cases, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:4, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:5, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:6. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:8. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:39. In some cases, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:1, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:2, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:3, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:4, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:5, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:6. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:7 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:8. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:38 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:39.
In some cases, a first antigen binding domain that can be used in a bispecific molecule provided herein can bind to a TRBV12 polypeptide. For example, an antigen binding domain that can bind to a TRBV12 polypeptide can include each of the CDRs set forth below:
In some cases, an antigen binding domain that can bind to a TRBV12 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:9, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:10, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO: 11. For example, an antigen binding domain that can bind to a TRBV12 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:15. For example, an antigen binding domain that can bind to a TRBV12 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:40. In some cases, an antigen binding domain that can bind to a TRBV12 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:12, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:13, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:14. For example, an antigen binding domain that can bind to a TRBV12 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:16. For example, an antigen binding domain that can bind to a TRBV12 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:41. In some cases, an antigen binding domain that can bind to a TRBV12 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:9, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO: 10, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO: 11, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:12, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:13, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:14. For example, an antigen binding domain that can bind to a TRBV12 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:15 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:16. For example, an antigen binding domain that can bind to a TRBV5-5 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:40 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:41.
In some cases, a first antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be as described elsewhere (see, e.g., Beta Mark TCR Vbeta Repertoire Kit, 25 Tests, RUO, Package insert. Beckman Coulter Life Sciences, Technical Document (2009); and U.S. Pat. No. 5,861,155 at, for example,
A second antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be any appropriate type of antigen binding domain. In some cases, a second antigen binding domain that can be used in a bispecific molecule provided herein can include a variable region of an immunoglobulin light chain (a VL) and a variable region of an immunoglobulin heavy chain (VH). For example, a second antigen binding domain that can be used in a bispecific molecule provided herein can include a first complementarity determining region (CDR) from an immunoglobulin light chain (a VL CDR1), a second CDR from an immunoglobulin light chain (a VL CDR2), and a third CDR an immunoglobulin light chain (a VL CDR3), a first CDR from an immunoglobulin heavy chain (a VH CDR1), a second CDR from an immunoglobulin heavy chain (a VH CDR2), and a third CDR an immunoglobulin heavy chain (a VH CDR2). Examples of antigen binding domains that can be used as a can be used as a second antigen binding domain in a bispecific molecule provided herein include, without limitation, scFv, a Fab, a F(ab′)2 fragment, and biologically active fragments thereof (e.g., a fragment that retains the ability to bind the target molecule such as a T cell co-receptor polypeptide). In some cases, an antigen binding domain that can be used as a second antigen binding domain in a bispecific molecule provided herein can be a scFv.
A second antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can bind any appropriate T cell co-receptor polypeptide. Examples of T cell co-receptor polypeptides that can be targeted by a second antigen binding domain in a bispecific molecule provided herein include, without limitation, CD3 polypeptides and T cell receptor polypeptides.
In some cases, a second antigen binding domain that can be used in a bispecific molecule provided herein can bind to a CD3 polypeptide. For example, an antigen binding domain that can bind to a CD3 polypeptide can include one of each of the CDRs set forth below:
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO: 17, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:18, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:19. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:23. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:42.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:44, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:48, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:51. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:61.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:45, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:49, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:52. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:63.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:46, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:50, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:53. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:65.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:47, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:48, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:51. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:67.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:20, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:21, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:22. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:24. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:43.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:54, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:56, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:59. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:62.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:54, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:56, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:59. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:64.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:55, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:57, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:60. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:66.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:54, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:58, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:59. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:68.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:17, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO: 18, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO: 19, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:20, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:21, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:22. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:23 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:24. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:42 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:43.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:44, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:48, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:51, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:54, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:56, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:59. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:61 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:62.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:45, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:49, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:52, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:54, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:56, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:59. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:63 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:64.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:46, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:50, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:53, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:55, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:57, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:60. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:65 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:66.
In some cases, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain having a VL CDR1 including the amino acid sequence set forth in SEQ ID NO:47, a VL CDR2 including the amino acid sequence set forth in SEQ ID NO:48, and a VL CDR3 including the amino acid sequence set forth in SEQ ID NO:51, and can include a heavy chain having a VH CDR1 including the amino acid sequence set forth in SEQ ID NO:54, a VH CDR2 including the amino acid sequence set forth in SEQ ID NO:58, and a VH CDR3 including the amino acid sequence set forth in SEQ ID NO:59. For example, an antigen binding domain that can bind to a CD3 polypeptide can include a light chain including the amino acid sequence set forth in SEQ ID NO:67 and can include a heavy chain including the amino acid sequence set forth in SEQ ID NO:68.
In some cases, a second antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be as described elsewhere (see, e.g., Zhu et al., Journal of Immunology, 155:1903-1910 (1995); and Junttila et al., Cancer Research, 74:5561-5571 (2014)).
In some cases, a first antigen binding domain and a second antigen binding domain in a bispecific molecule provided herein (e.g., a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be connected via a linker (e.g., a polypeptide linker). A linker can include any appropriate number of amino acids. For example, a linker can include from about 5 amino acids to about 20 amino acids (e.g., from about 5 amino acids to about 18 amino acids, from about 5 amino acids to about 15 amino acids, from about 5 amino acids to about 12 amino acids, from about 5 amino acids to about 10 amino acids, from about 5 amino acids to about 8 amino acids, from about 7 amino acids to about 20 amino acids, from about 10 amino acids to about 20 amino acids, from about 12 amino acids to about 20 amino acids, from about 16 amino acids to about 20 amino acids, from about 8 amino acids to about 16 amino acids, from about 10 amino acids to about 12 amino acids, from about 8 amino acids to about 12 amino acids, from about 10 amino acids to about 15 amino acids, or from about 12 amino acids to about 16 amino acids). In some cases, a linker can alter the flexibility of the bispecific molecule. In some cases, a linker can alter the solubility of the bispecific molecule. A linker can include any appropriate amino acids. In some cases, a linker can be a glycine-rich linker. In some cases, a linker can be serine and/or threonine-rich linker. A linker can connect the first antigen binding domain and the second antigen binding domain in a bispecific molecule provided herein in any order. For example, a linker can connect the N-terminus of a first antigen binding domain in a bispecific molecule provided herein with the C-terminus of the second antigen binding domain in a bispecific molecule, or vice versa. Examples of linkers that can be used to connect a first antigen binding domain and a second antigen binding domain in a bispecific molecule provided herein include, without limitation, a GGGGS linker (SEQ ID NO:25), a (GGGGS)3 linker (SEQ ID NO:26), and GGSGGSGGSGGSGGVD (SEQ ID NO:69).
In some cases, one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be formulated into a composition (e.g., a pharmaceutical composition) for administration to a mammal (e.g., a human). For example, one or more bispecific molecules provided herein can be formulated into a pharmaceutically acceptable composition for administration to a mammal (e.g., a human) having a T cell cancer. In some cases, one or more bispecific molecules provided herein can be formulated together with one or more pharmaceutically acceptable carriers (additives), excipients, and/or diluents. Examples of pharmaceutically acceptable carriers, excipients, and diluents that can be used in a composition described herein include, without limitation, sucrose, lactose, starch (e.g., starch glycolate), cellulose, cellulose derivatives (e.g., modified celluloses such as microcrystalline cellulose and cellulose ethers like hydroxypropyl cellulose (HPC) and cellulose ether hydroxypropyl methylcellulose (HPMC)), xylitol, sorbitol, mannitol, gelatin, polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), crosslinked polyvinylpyrrolidone (crospovidone), carboxymethyl cellulose, polyethylene-polyoxypropylene-block polymers, and crosslinked sodium carboxymethyl cellulose (croscarmellose sodium)), titanium oxide, azo dyes, silica gel, fumed silica, talc, magnesium carbonate, vegetable stearin, magnesium stearate, aluminum stearate, stearic acid, antioxidants (e.g., vitamin A, vitamin E, vitamin C, retinyl palmitate, and selenium), citric acid, sodium citrate, parabens (e.g., methyl paraben and propyl paraben), petrolatum, dimethyl sulfoxide, mineral oil, serum proteins (e.g., human serum albumin), glycine, sorbic acid, potassium sorbate, water, salts or electrolytes (e.g., saline, protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, and zinc salts), colloidal silica, magnesium trisilicate, polyacrylates, waxes, wool fat, and lecithin.
A composition (e.g., a pharmaceutical composition) containing one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be formulated into any appropriate dosage form. Examples of dosage forms include solid or liquid forms including, without limitation, pills, capsules, tablets, gels, liquids, suspensions, solutions (e.g., sterile solutions), sustained-release formulations, and delayed-release formulations.
A composition (e.g., a pharmaceutical composition) containing one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be designed for oral or parenteral (e.g., topical, subcutaneous, intravenous, intraperitoneal, intrathecal, and intraventricular) administration. When being administered orally, a composition can be in the form of a pill, tablet, or capsule. Compositions suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions that can contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.
A composition (e.g., a pharmaceutical composition) containing one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be administered locally or systemically. For example, a composition containing one or more bispecific molecules provided herein can be administered systemically by an intravenous injection to a mammal (e.g., a human). For example, a composition containing one or more bispecific molecules provided herein can be administered systemically by a subcutaneous injection to a mammal (e.g., a human).
An effective amount (e.g., effective dose) of one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can vary depending on the severity of the T cell cancer, the route of administration, the age and general health condition of the subject, excipient usage, the possibility of co-usage with other therapeutic treatments such as use of other agents, and/or the judgment of the treating physician.
An effective amount of a composition (e.g., a pharmaceutical composition) containing one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be any amount that can treat a mammal (e.g., a human) having a T cell cancer without producing significant toxicity to the mammal. An effective amount of one or more bispecific molecules provided herein can be any appropriate amount. The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal's response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and severity of the condition (e.g., a T cell cancer) may require an increase or decrease in the actual effective amount administered.
The frequency of administration of a composition (e.g., a pharmaceutical composition) containing one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be any frequency that can treat a mammal (e.g., a human) having a T cell cancer without producing significant toxicity to the mammal. For example, the frequency of administration can be once a day, once a week, once every 2 weeks, or once every 4 weeks. In some cases, an administration can include a continuous infusion of a composition containing one or more bispecific molecules provided herein. The frequency of administration can remain constant or can be variable during the duration of treatment. A course of treatment with a composition containing one or more bispecific molecules provided herein can include rest periods. As with the effective amount, various factors can influence the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, use of multiple treatment agents, route of administration, and severity of the condition (e.g., a T cell cancer) may require an increase or decrease in administration frequency.
An effective duration for administering a composition (e.g., a pharmaceutical composition) containing one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be any duration that treat a mammal (e.g., a human) having a T cell cancer without producing significant toxicity to the mammal. For example, the effective duration can vary from several days to several weeks, months, or years. In some cases, the effective duration for the treatment of a mammal can range in duration from about one month to about 10 years. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the frequency of administration, effective amount, use of multiple treatment agents, route of administration, and severity of the condition (e.g., a T cell cancer) being treated.
In some cases, one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be used as the sole active agent to treat a mammal (e.g., a human) having a T cell cancer.
In some cases, the methods and materials described herein can include one or more (e.g., one, two, three, four, five or more) additional therapeutic agents used to treat a mammal (e.g., a human) having a T cell cancer. For example, a mammal in need thereof (e.g., a mammal having a T cell cancer) can be administered one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) in combination with one or more anti-cancer agents. In some cases, an anti-cancer agent can be an alkylating agent. In some cases, an anti-cancer agent can be a platinum compound. In some cases, an anti-cancer agent can be a taxane. In some cases, an anti-cancer agent can be a luteinizing-hormone-releasing hormone (LHRH) agonist. In some cases, an anti-cancer agent can be an anti-estrogen. In some cases, an anti-cancer agent can be an aromatase inhibitor. In some cases, an anti-cancer agent can be an angiogenesis inhibitor. In some cases, an anti-cancer agent can be a poly(ADP)-ribose polymerase (PARP) inhibitor. In some cases, an anti-cancer agent can be a topoisomerase inhibitor. In some cases, an anti-cancer agent can be a corticosteroid. In some cases, an anti-cancer agent can be an antibody. In some cases, an anti-cancer agent can be an antibody drug conjugate. Examples of anti-cancer agents include, without limitation, busulfan, cisplatin, carboplatin, paclitaxel, docetaxel, nab-paclitaxel, altretamine, capecitabine, cyclophosphamide, etoposide (vp-16), gemcitabine, ifosfamide, irinotecan (cpt-11), melphalan, pemetrexed, topotecan, vinorelbine, goserelin, leuprolide, tamoxifen, letrozole, anastrozole, exemestane, bevacizumab, olaparib, rucaparib, niraparib, cyclophosphamide, doxorubicin (e.g., liposomal doxorubicin), prednisone, prednisolone, dexamethasone, mogamulizumab, brentuximab, and any combinations thereof. In some cases, the one or more additional therapeutic agents can be administered together with one or more bispecific molecules provided herein (e.g., in a single composition). In some cases, the one or more additional therapeutic agents can be administered independent of the one or more bispecific molecules provided herein. When the one or more additional therapeutic agents are administered independent of the one or more bispecific molecules provided herein, the one or more bispecific molecules provided herein can be administered first, and the one or more additional therapeutic agents administered second, or vice versa.
In some cases, the methods and materials described herein can include one or more (e.g., one, two, three, four, five or more) additional treatments (e.g., therapeutic interventions) that are effective to treat T cell cancers. For example, a mammal in need thereof (e.g., a mammal having a T cell cancer) can be administered one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) in combination with one or more therapeutic interventions. Examples of therapeutic interventions that can be used as described herein to treat a T cell cancer include, without limitation, cancer surgeries, radiation therapies, chemotherapies, and any combinations thereof. In some cases, the one or more additional treatments that are effective to treat T cell cancers can be performed at the same time as the administration of the one or more bispecific molecules provided herein. In some cases, the one or more additional treatments that are effective to treat T cell cancers can be performed before and/or after the administration of the one or more bispecific molecules provided herein.
In some cases, one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be used to treat a mammal having a disease or disorder other than cancer. For example, a mammal having a disease, disorder, or condition other than a T cell cancer that is associated with a clonal T cell expansion can be administered one or more bispecific molecules provided herein. In some cases, a disease, disorder, or condition other than a T cell cancer that is associated with a clonal T cell expansion can be an autoimmune disease. In some cases, a disease, disorder, or condition other than a T cell cancer that is associated with a clonal T cell expansion can be associated with transplant rejection. Examples of diseases and disorders associated with a clonal T cell expansion that can be targeted using one or more bispecific molecules provided herein include, without limitation, graft versus host disease (GVHD), celiac disease, and multiple sclerosis.
In some cases, the materials and methods described herein can be used to treat a mammal (e.g., a human) having celiac disease. For example, one or more bispecific molecules provided herein (e.g., bispecific molecules including a first antigen binding domain that can bind a TRBV polypeptide and a second antigen binding domain that can bind a T cell co-receptor polypeptide) can be administered to a mammal (e.g., a human) having celiac disease to treat the mammal. In some cases, a bispecific molecule including a first antigen binding domain that can bind a TRBV polypeptide associated with celiac disease and a second antigen binding domain that can bind a T cell co-receptor polypeptide (e.g., a CD3 polypeptide) can be administered to a mammal (e.g., a human) having celiac disease to treat the mammal. In some cases where a bispecific molecule provided herein is used to treat a mammal having celiac disease, the first antigen binding domain of the bispecific molecule can bind a TRBV polypeptide selected from the group consisting of TRBV4, TRBV6, TRBV7, TRBV9, TRBV20 and TRBV29, and the second antigen binding domain can bind a T cell co-receptor polypeptide (e.g., a CD3 polypeptide). In some cases where a bispecific molecule provided herein is used to treat a mammal having celiac disease, the first antigen binding domain of the bispecific molecule can bind a TRBV polypeptide selected from the group consisting of TRBV6-1, TRBV7-2, TRBV9-1, TRBV20-1 and TRBV29-1, and the second antigen binding domain can bind a T cell co-receptor polypeptide (e.g., a CD3 polypeptide).
In some cases, a first antigen binding domain described herein (e.g., a first antigen binding domain that can bind a TRBV polypeptide) can be included in chimeric antigen receptor (CAR) that can be presented on a T cell (a CAR T cell). For example, a CAR T cell that includes an antigen binding domain that can bind a TRBV polypeptide can be used to treat a mammal having a T cell cancer. In some cases, a mammal having a T cell cancer can be administered CAR T cells that include an antigen binding domain that can bind a TRBV polypeptide provided herein to treat the mammal. A CAR T cell that includes an antigen binding domain that can bind a TRBV polypeptide can be used in any type of CAR T cell therapy. CAR T cell therapies can include those as described elsewhere (see, e.g., Ali et al., Blood, 128(13):1688-700 (2016); Sadelain et al., Cancer Discov., 3(4):388-98 (2013); Porter et al., N. Engl. J. Med., 365(8):725-33 (2011); and Maciocia et al., Nat. Med., 23(12):1416-1423 (2017)).
In some cases, a first antigen binding domain described herein (e.g., a first antigen binding domain that can bind a TRBV polypeptide) can be included in an antibody drug conjugate (ADC). For example, an ADC that includes an antigen binding domain that can bind a TRBV polypeptide can be used to treat a mammal having a T cell cancer. In some cases, a mammal having a T cell cancer can be administered an ADC that includes an antigen binding domain that can bind a TRBV polypeptide provided herein to treat the mammal. An ADC that includes an antigen binding domain that can bind a TRBV polypeptide can include any type of drug. Drugs that can be used in an ADC can include those as described elsewhere (see, e.g., Younes et al., Lancet Oncol., 14(13):1348-56 (2013); Hamblett et al., Clin. Cancer. Res., 10(20):7063-70 (2004); and Lewis Phillips et al., Cancer Res., 68(22):9280-90 (2008)).
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
This Examples describe the generation and evaluation of a TRBC targeting BsAbs and two different TRBV targeting BsAbs for the treatment of T cell cancers. The TRBC-targeting BsAb can eradicate both the T cell cancers and the vast majority of healthy human (normal) T cells due to bidirectional T cell killing. The TRBV-targeting BsAbs can deplete cancerous T cells in vitro and in vivo while preserving the majority of normal T cells.
Anti-TRBV5-5 and anti-TRBV12 scFv sequences were used to generate anti-TRBV5-5 and anti-TRBV12 BsAbs (henceforth denoted “α-V5” and “α-V12”) for selective targeting of TRBV5-5+ or TRBV12+ T cells, respectively (
Basis for BsAb Targeting of T Cells that do not Express the Relevant TRBV or TRBC
To examine whether BsAbs result in killing of T cells not expressing the relevant TRBV or TRBC chain, TRBC1V cells were depleted from human T cells, then the depleted T cells were exposed to α-C1. After depletion of T cells expressing TRBC1, exposure to α-C1 did not result in statistically significant killing of the remaining T cells (
Exemplary BsAb molecules (
Exposure to α-CD3-CD19 and α-C1-CD19 resulted in considerably higher IFNγ levels and NALM6 cell cytotoxicity than exposure to α-V5-CD19 and α-V12-CD19. There are two potential reasons for this observation. First, approximately 35-45% human T cells express TRBC1 while 1.5% to 5% of normal T cells express TRBV5-5 or TRBV12 (
Similar experiments were performed that demonstrated α-C1 could mediate the death of clonal, neoplastic T cells expressing TRBC2 through bidirectional killing, even though these neoplastic T cells did not express TRBC1 (
Human T cell cancer-derived cell lines have rearranged TCRβ genes and express clonal TRBVs. It was observed that T-ALL derived Jurkat, HPB-ALL and CCRF-CEM T cell lines retained cell-surface TCR expression as assessed with anti-CD3 antibodies, while MOLT3 cells did not (
An increase in baseline IFNγ production, in the absence of any cancer cells, was noted after exposure to α-C1, and to a lesser degree with α-V5 and α-V12 (
As a further control for specificity of these BsAbs, isogenic cancer cells were created using CRISPR-based disruption of TCR alpha and beta constant regions in both Jurkat and HPB-ALL cell lines. The resultant TCR knock-out (KO) was confirmed by loss of cell-surface TRBV12 or TRBV5-5 (
To assess cytotoxicity, normal human T cells were co-cultured with Jurkat or HPB-ALL cells in presence of increasing concentrations of α-V12 or α-V5 BsAbs (
To determine whether α-V12 affects T cells expressing TRBV-families other than TRBV12, Jurkat cells and normal T cells were co-cultured in the presence of α-CD19 or α-V12, as noted above. TRBV gene sequencing was then performed to measure the percentage of TRBV depletion in surviving cells. A dramatic reduction (98.9%) in TRBV12-3 levels was detected after exposure to α-V12 compared with exposure to α-CD19 (
Primary malignant cells were collected from T-ALL patients. Flow cytometry identified two patients (Patients 1 and 2) with a substantial TRBV12+ population, suggesting presence of monoclonal cancer cells (
To assess efficacy in vivo, two disseminated xenograft models were established with luciferase-expressing Jurkat or HPB-ALL cancer cells injected intravenously into NOD.Cg-PrkdcscidIl2rgtw1Wj1/SzJ (NSG) mice (
Together these results demonstrate that TRBV-targeting BsAbs can deplete clonal cancerous T cells in vitro and in vivo while preserving the majority of normal T cells. Thus, TRBV-targeting BsAbs can be used to treat T cell cancers while avoiding treatment related immunosuppression.
Methods
Jurkat (Clone E6-1), CCRF-CEM, MOLT-3, (ATCC, Manassas, VA), HPB-ALL (DSMZ, Germany) and NALM6 cells were cultured in RPMI-1640 (ATCC, 30-2001) supplemented with 10% HyClone fetal bovine serum (FBS, GE Healthcare SH30071.03, Chicago, IL) and 1% Penicillin-Streptomycin (ThermoFisher Scientific, Waltham, MA). HEK293FT (ThermoFisher Scientific, Waltham, MA) was cultured in DMEM (ThermoFisher Scientific, 11995065) supplemented with 10% FBS, 2 mM GlutaMAX (ThermoFisher Scientific, 35050061), 0.1 mM MEM non-essential amino acids (ThermoFisher Scientific, 11140050), 1% Penicillin-Streptomycin, and 500 μg/mL Geneticin (ThermoFisher Scientific, 10131027). PBMCs were isolated from leukapheresis samples (Stem Cell Technologies, Vancouver, BC or Astarte Biologics, Bothell, WA) by Ficoll Paque Plus (GE Healthcare, GE17-1440-02) density gradient centrifugation. Human T cells were expanded from PBMCs either with addition of the anti-human CD3 antibody (clone OKT3, BioLegend, San Diego, CA, 317325) at 15 ng/mL, or with Human T-Activator CD3/CD28 Dynabeads (ThermoFisher Scientific, 11131D) for three days at a bead:cell ratio of 1:5. T cells were cultured in RPMI-1640 with 10% FBS, 1% Penicillin-Streptomycin, 100 IU/mL recombinant human IL-2 (aldesleukin, Prometheus Therapeutics and Diagnostics, San Diego, CA), and 5 ng/mL recombinant human IL-7 (BioLegend, 581906).
Cells were suspended at 1×106 cells/mL in flow stain buffer (PBS containing 0.5% BSA, 2 mM EDTA, 0.1% sodium azide) or flow sorting buffer (PBS containing 4% FBS) and incubated with appropriate antibodies for 30 minutes on ice. The antibodies used were: Brilliant Violet (BV)-711 anti-human CD3 (clone OKT3 BioLegend #317328); APC-anti-human CD45 (clone H130 BioLegend #304012); APC-anti-human CD19 (clone HIB19, Biolegend #302212), PE-anti-human CD4 (clone RPA-T4, Biolegend #300508), APC-anti-human CD8 (clone SKi, Biolegend #344722), PE-anti-human Cβ1 TCR (clone JOVI.1 BD #565776), PE-anti-human HLA-A3 (clone GAP.A3 BD #566605), PE-TCR v05.1 (clone ImmU157), PE-TCR Vβ5.3 (clone 3D11), PE-TCR V05.2 (clone 36213), FITC-TCR V08 (clone 56C5.2 Beckman Coulter), BV-421-anti-human CD25 (Biolegend #302630), APC-anti-human ICOS (Biolegend #313510), BV-750-anti-human-41BB (Biolegend #309844), BV-421-anti-human LAG3 (Biolegend #369314), and APC-anti-human-PD1 (Biolegend #329908). Stained cells were analyzed using an LSRII flow cytometer or sorted using BD FACSAria II (Becton Dickinson, Mansfield, MA). Gating on single live cells was performed with the use of viability dyes (LIVE/DEAD Fixable Near-IR, L10119; Aqua Dead Cell Stain Kit L34957 Invitrogen) and forward and side scatter characteristics. CellTrace Violet stain (ThermoFisher C34557) was performed per manufacturer instructions.
For TRBC1 T cell depletion, 1×108 normal T cells were stained with PE-mouse anti-human Cβ1 TCR (final concentration 1 μg/ml) followed by PE negative (TRBC1 depleted) cell sorting. For TRBV5 T cell depletion or enrichment, 1×108 normal T cells were stained with PE-TCR Vβ5.3 (binds TRBV5-5) and PE-TCR V35.2 (binds TRBV5-6), followed by PE negative (TRBV5 depleted) or PE positive (TRBV5 enriched) cell sorting. For TRBV12 T cell depletion or enrichment, 1×108 normal T cells were stained with FITC-TCR V08 (binds TRBV12-3 and TRBV12-4 T cells), followed by FITC negative (TRBV12 depleted) or FITC positive (TRBV12 enriched) cell sorting. Alternatively, an EasySep PE Positive Selection Kit II (StemCell Technologies, 17684) was used for cell isolation. For CD4 T cell depletion, normal T cells were stained with PE-anti-human CD4 followed by EasySep PE Positive Selection Kit II used for CD4 negative (CD4 depleted) cell isolation.
The α-TRBV5-5, α-TRBV12, α-TRBC1 and α-CD19 scFv sequences (Table 1) were synthesized by GeneArt (ThermoFisher Scientific). The scFv sequence was expressed as single chain diabody format using the following N- to C-terminus format: IL-2 signal sequence, anti-TRBV/TRBC/CD19 variable light chain (VL), GGGGS linker (SEQ ID NO:25), α-CD3 variable heavy chain (VH), (GGGGS)3 linker (SEQ ID NO:26), α-CD3 VL, GGGGS linker (SEQ ID NO:25), anti-TRBV/TRBC/CD19 VH, and 6×HIS tag, and cloned into a pcDNA3.4 vector (ThermoFisher Scientific). BsAbs were expressed and purified by the JHU Eukaryotic Tissue Culture Core Facility or by GeneArt. For BsAb expression from JHU Eukaryotic Tissue Culture Core Facility. 1 mg of plasmid was transfected with polyethylenimine (PEI) at a ratio of 1:3 into a 1 L suspension culture of HEK293F cells at a density of 2×106 cells/mL. Newly transfected HEK293F cells were grown in Freestyle293 expression media for 5 days at 37° C., 170 rpm, and 5% C02. Subsequently, the media was harvested by centrifugation, filtered with a 0.22 μm unit, and the BsAb was purified using Nickel affinity chromatography. For this purpose, 2 mL of Ni-NTA His-Bind (Millipore Sigma, 70666-6) resin was added to the filtered supernatant and incubated at 4° C. overnight in an orbital shaker. The supernatant-resin mixture was captured by a gravity chromatography column (Econo-Pac Chromatography Columns 7321010, Bio-Rad, Hercules, CA) and washed with 20 mM imidazole (GE Healthcare, 45-000-007) in phosphate buffered saline (PBS). The desired BsAb was eluted with 500 mM imidazole, and desalted into PBS using a 7k MWCO Zeba Spin desalting column (ThermoFisher Scientific, 89883). Proteins were quantified via SDS-PAGE gel electrophoresis (Mini-PROTEAN TGX Stain-Free Precast Gel, Bio-Rad, 4568095) and/or using BCA protein assay (Pierce, ThermoFisher, 23225). Proteins were stored at −80° C. with 7% glycerol. Alternatively, BsAbs were produced by GeneArt in Expi293s, and purified with a HisTrap column (GE Healthcare, 17-5255-01) followed by size exclusion chromatography using a HiLoad Superdex 200 26/600 column (GE Healthcare, 28989336). Analytic chromatography was performed using TSKgel G3000SWxl column (TOSOH Bioscience) using a running buffer of 50 mM sodium phosphate and 300 mM sodium chloride at pH 7, at a flow rate of 1.0 mL/minute. BsAb Coomassie blue stain (ThermoFisher Scientific, 20278) and anti-histidine western blot were performed using anti-6×-His tag antibody (ThermoFisher Scientific, MA1-21315) by GeneArt.
Thermal stability of the α-V12 and α-V5 BsAbs were evaluated by a differential scanning fluorimetry which monitors the fluorescence of a dye that binds to the hydrophobic region of a protein as it becomes exposed upon temperature induced denaturation. Reaction mixtures (20 μL) were set up in a white low-profile 96-well, unskirted polymerase chain reaction plates (Bio-Rad, MLL9651) by mixing 2 μL of purified α-V12 or α-V5 BsAb at a concentration of 1 mg/mL with 2 μL of 50×SYPRO orange dye (Invitrogen S6650) in pH 7.4 phosphate buffered saline (PBS, Gibco, 10010023). Plates were sealed with an optical transparent film and centrifuged for 1000×g for 30 seconds. Thermal scanning was performed from 25 to 100° C. (1° C./minute temperature gradient) using a CFX9 Connect real-time polymerase chain reaction instrument (Bio-Rad). Protein unfolding/melting temperature (Tm) was calculated from the maximum value of the negative first derivative of the melt curve using CFX Manager Software (Bio-Rad). Serum stability was assessed by incubating the BsAbs with human serum (Millipore Sigma #H4522) at 0.05 μg/mL concentration in a 37° C. incubator for 0, 24, and 96 hours. At each time point, the human serum BsAb mixture was collected and frozen at −80° C. until BsAb functional analysis by a co-culture assay.
The Alt-R CRISPR system (Integrated DNA Technologies, Coralville, IA) was used to generate TCR knock-out Jurkat and HPB-ALL cell lines as well as CD19 knock-out and CD19 low expressing NALM6 clones. For the knockout of TCRs, Alt-R CRISPR Cas9 crRNAs targeting the TRA constant region (AGAGTCTCTCAGCTGGTACA; SEQ ID NO:31), TRB constant region (AGAAGGTGGCCGAGACCCTC; SEQ ID NO:32), and Alt-R CRISPR-Cas9 tracrRNA (IDT, 1072533) were re-suspended at 100 μM in Nuclease-Free Duplex Buffer. The crRNAs and tracrRNA were duplexed at a 1:1 molar ratio for 5 minutes at 95° C. followed by cooling down slowly to room temperature according to the manufacturer's instructions. The duplexed RNA was then mixed with Cas9 Nuclease at a 1.2:1 molar ratio for 15 minutes. A total of 40 pmoles of the Cas9 RNP complexed with gRNA were mixed with 500,000 cells in 20 μL of OptiMEM (ThermoFisher, 51985091). This mixture was loaded into a 0.1 cm cuvette (Bio-Rad) and electroporated at 90 V for 15 milliseconds using an ECM 2001 (BTX, Holliston, MA). Cells were immediately transferred to the complete growth medium and cultured for 7 days. Single cell clones were established by limiting dilution and genomic DNA isolated using a Quick-DNA 96 Kit (Zymo Research, Irvine, CA, D3010). Regions flanking the CRISPR cut sites were PCR amplified (TCRα forward primer: GCCTAAGTTGGGGAGACCAC (SEQ ID NO:33), reverse primer: GAAGCAAGGAAACAGCCTGC (SEQ ID NO:34); TCRβ forward primer: TCGCTGTGTTTGAGCCATCAGA (SEQ ID NO:35), reverse primer: ATGAACCACAGGTGCCCAATTC (SEQ ID NO:36) and Sanger sequenced to select for TCRα-/β-clones. TRA and TRB chain gene disruption was confirmed by the loss of surface CD3 expression.
To generate CD19 knock-out and CD19 low NALM6 clones, an Alt-R CRISPR sgRNA (CGAGGAACCTCTAGTGGTGA; SEQ ID NO:37) was complexed with Cas9 Nuclease (IDT) at a 2:1 molar ratio for 15 minutes at room temperature. Then, 50 pmoles of Cas9 RNP were mixed with 200,000 NALM6 cells re-suspended in 20 μL SF buffer (Lonza) and electroporated with a 4D Nucleofector X-unit (Lonza) in 16-well cuvette strips using pulse code CV-104. The cells were cultured in complete growth media for 7 days prior to dilutional plating to select individual clones. The cell surface CD19 levels of clones were characterized by flow cytometry staining with anti-human CD19 antibody.
Non-tissue culture treated plates were coated with 100 μL RetroNectin (Clontech Takara, Mountain View, CA, T202) in PBS at 20 μg/mL overnight at 4° C., then blocked with 10% FBS for 1 hour at room temperature. Retrovirus (RediFect Red-FLuc-GFP, PerkinElmer CLS960003) and 2×105 target cells were added to each well and centrifuged at 2000×g for 1 hour at 20° C. Plates were incubated for two days at 37° C., after which cells were expanded to a 6-well plate. Transduced cells were isolated by FACS (BD FACSAria II) based on GFP expression.
Total RNA was isolated from samples with Qiagen AllPrep DNA/RNA Micro kits (Qiagen, 80284). RNA quality was validated using an Agilent TapeStation system. TCR sequencing libraries were prepared using a 5′ RACE (rapid amplification of cDNA ends) method consisting of a cDNA synthesis step followed by two PCR steps with gene-specific primers for the TCRβ constant region. Libraries were sequenced using an Illumina MiSeq platform. Reads were analyzed with MIGEC, MiXCR, and VDJtools. Frequencies of clonotypes were calculated as the proportion of UIDs (unique molecular identifier barcodes) representing the clonotype among all UIDs in the sample. The following non-functional TRBVs (listed as pseudogenes or as open reading frames in IMGT) were excluded from analysis; TRBV1, TRBV3-2, TRBV5-2, TRBV5-3, TRBV5-7, TRBV6-7, TRBV7-1, TRBV7-5, TRBV8, TRBV12-1, TRBV12-2, TRBV21, TRBV22, TRBV23-1, TRBV26.
The structures of PDB ID 5BRZ, 6EH5, 4P4K, and 4QRR were structurally aligned and residues 2-95 were extracted from 5BRZ, corresponding to the TCR beta variable region of TRBV 5.1. To model TRBV 5.4, 5.5, 5.6 and 5.8, in silico mutations were performed at positions 81 and 101 using Coot. Figures were rendered in PyMOL (v2.2.3, Schrödinger, LLC, New York, NY). Alignment of relevant TRBV sequences was performed using ClustalOmega and displayed using Espript.
Co-cultures were set up using 96-well flat-bottom tissue culture treated plates, with each well containing 5×104 normal human T cells (effector cells), 5×104 target cells (indicated in text) and BsAbs (concentration specified in text) in a total 100 μL volume RPMI media. The co-cultures were incubated for 17 hours at 37° C. The supernatant was assayed for cytokines using a Human IFN-gamma Quantikine ELISA Kit (R&D Systems, Minneapolis, MN, SIF50C), Human IL-2 Quantikine ELISA Kit (R&D Systems, S2050), Human TNF-alpha Quantikine ELISA Kit (R&D Systems, STA00D), Human IL-10 Quantikine ELISA Kit (R&D Systems, S1000B), or a Luminex assay (13-plex-Immunology Multiplex Assay, Millipore Sigma, USA, HMHEMAG-34K) performed on the Bio-Plex 200 system (Bio-Rad). For luciferase expressing target cells, cell viability was assayed by the Steady-Glo luciferase assay (E2510, Promega, Madison, WI), per manufacturer's instructions. Viability was calculated as the ratio of luminescence signal to the no antibody or control antibody condition: (antibody well luminescence)/(no antibody or control antibody well luminescence). Alternatively, tumor cells were quantified by flow cytometry based GFP expression (for GFP-expressing tumor cell lines) or distinct HLA expression (for patient-derived tumor cells). For experiments to detect effects of BsAbs on healthy T cells in the absence of target tumor cells, 1×106 normal human T cells was incubated with the BsAbs (concentration specified in text) in a total 1 mL volume RPMI media, and incubated for 17 hours at 37° C. Viable T cells were quantified by counting trypan blue stained cells on a hemocytometer.
T cell cancer patient samples were collected in accordance with the Johns Hopkins Institutional Review Board (IRB: NA_00028682, and NA_00028682) approved Hematologic Malignancy Cell Bank Protocol (J0969) or the Johns Hopkins Pediatric Leukemia Bank Protocol (J0968).
Six to eight week old female NOD.Cg-PrkdcscidIl2rgtm1wj1/SzJ (NSG) mice acquired from the Johns Hopkins Sidney Kimmel Comprehensive Cancer Center Animal Resources facility were maintained according to JHU Animal Care and Use Committee approved research protocol MO18M79. Cancer cell lines and human T cells were injected via the tail vein. Two-week micro-osmotic pumps (Model 1002, ALZET, Cupertino, CA) were filled with BsAb as indicated in the text using a 30G needle. Pumps were placed in the peritoneal space of each mouse using sterile surgical technique. For survival studies, animals were followed until day 80 or sacrificed when exhibited evidence of paralysis or GVHD (hunched posture, fur ruffling, scaling or denuded skin, reduced activity). Mouse bioluminescence was measured using the IVIS system (PerkinElmer, USA). Prior to imaging, mice were anesthetized using inhaled isoflurane in an induction chamber. Following induction, mice received intraperitoneal injection of luciferin (150 μl, RediJect D-Luciferin Ultra Bioluminescent Substrate, PerkinElmer, 770505), and were placed in the imaging chamber after 5 minutes. Luminescence images were analyzed using Living Image software (version 4.7.2, PerkinElmer). For flow-based detection of tumor cells and normal human T cells from mouse blood, 100 μL blood was collected in EDTA treated microvettes (Sarstedt Inc, NC9299309) by mouse cheek bleed, followed by 10 minutes incubation with 1 mL ACK lysis buffer (Quality Biological, 118-156-721), resuspension in flow stain buffer with mouse and human TrueStain FcX Fc receptor blocking solutions (BioLegend, 101320, 422302) and cell-surface staining antibodies. 10 μL of counting beads (Precision Count Beads, BioLegend, 424902) were added to equal volume (300 μL) of cell suspension in each tube. The number of tumor cells (GFP+, CD3+) or T cells (GFP−, CD3+) were counted based on acquisition of 500 beads for each sample. For cytokine and BsAb detection, blood from mice was collected in eppendorf tubes and allowed to clot for 30 minutes at room temperature, followed by centrifugation at 1000×g for 5 minutes at 4° C. Serum was collected and stored at −80° C. until cytokine (per manufacturer instructions) or BsAb ELISA. For BsAb ELISA, mouse serum was incubated in biotinylated recombinant human CD3 epsilon & CD3 delta (Acro Biosystems, DE, USA, #CDD-H52W4) coated streptavidin plates (R&D Systems, #CP004), followed by detection using HRP conjugated anti-human kappa light chain antibody (ThermoFisher Scientific, #A18853).
Mean±standard error of mean was used to summarize the data. The Student's t-test was used to compare differences in means between two samples for normally distributed variables. For three or more groups, one-way ANOVA with Tukey's multiple comparison test (when comparing all groups) or Dunnett's test (when comparing test groups to one control group) or Sidak test (when comparing two select groups) were used, with α=0.05. The Kaplan-Meier method was utilized to generate median survival, and the hazard ratios estimated by log-rank test. Prism version 8.0 software (GraphPad, La Jolla, CA) was used for statistical analysis and graph production.
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
This application claims the benefit of U.S. Patent Application Ser. No. 63/119,753, filed on Dec. 1, 2020. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.
This invention was made with government support under grants CA009071, AR048522, CA006973, CA062924, GM007309 and CA230400 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/061453 | 12/1/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63119753 | Dec 2020 | US |
