The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 2, 2021, is named 56884-775_601_SL.txt and is 146,197 bytes in size.
Inflammatory bowel disease (IBD) is a chronic, relapsing inflammatory disorder of the gastrointestinal tract. IBD has two common forms, Crohn's disease (CD) and ulcerative colitis (UC). IBDs are clinically heterogeneous with profoundly complex genetics, suggesting the underlying biological pathways differ in subgroups of patients. Thus, the development of targeted therapeutics hinges on subgroup stratification and identification of predictive biomarkers that can be used to predict natural history and therapeutic response. The suboptimal drug development landscape over the two decades highlights the need for elucidation of the unique molecular mechanisms underlying phenotypic expression of disease in order to identify appropriate therapeutic targets for patient-specific drug development strategies. Ribonuclease T2 (RNASET2) is characterized as a secreted protein with ectopic expression linked to tumorigenesis and identified as a potential IBD risk gene.
Provided here, in some embodiments are genetic risk variants at the Ribonuclease T2 (RNASET2) gene or gene locus that are associated in CD patients with more complicated or resistant disease. In some embodiments, the genetic risk variants described herein are associated with risk of a disease reoccurrence such as those described herein. RNASET2 is the only known human member of the Rh/T2/S family of ribonucleases and has been identified in genome wide association studies (GWAS) as a potential IBD risk gene. However, the functional role of RNASET2 in IBD pathogenesis remains unknown. Genetic variations in the tumor necrosis factor superfamily member 15 gene (TNFSF15, also called TLIA) have been associated with CD and TL1A is a mediator of mucosal inflammation. In IBD patients, elevated TL1A levels correlate with TNFSF15 genotype and disease severity. Patients with elevated expression of TL1A have an increased risk of developing stricturing disease behavior. Murine colitis models have demonstrated that TL1A blocking antibodies effectively attenuate inflammation and reverse fibrosis. The genetic association of TNFSF15 with disease and downstream functional outcomes justifies efforts to identify additional specific therapeutic targets in these pathways. TLIA potentiates marked enhancement of several pro-inflammatory cytokines including IFNγ In T cells, a functional and biological relationship between three IBD susceptibility genes, TNFSF15, RNASET2 and intracellular adhesion molecule (ICAM) have been shown, all of which are implicated in TL1A-mediated enhancement of IFNγ production. In addition, down-modulation of RNASET2 expression occurs following TL1A stimulation. RNASET2 disease risk variants are functionally associated with a decrease in its expression in peripheral and mucosal tissues and DNA hypermethylation in CD patients requiring surgical intervention for disease management. Furthermore, RNASET2 disease risk variants are associated in CD patients with a more complicated/resistant disease phenotype defined in part by therapeutic drug failure, increase in length of intestinal resection, a shorter time to reoperation and post-operative endoscopy with a high (>2) Rutgeerts score. RNASET2 disease risk variants are also associated with decreased expression in peripheral and mucosal tissues and DNA hypermethylation. Motif screening of RNASET2 disease risk variants and preliminary electrophoretic mobility shift assay (EMSA) and promoter-reporter analysis, identified potential regulatory single nucleotide polymorphism (SNP) 1 and Indel 1 as disrupting ETS-transcription factor (TF) binding sites within an enhancer region. Expression of RNASET2 correlates with that of multiple ETS-transcription factors. RNASET2 knockdown in T cells enhanced IFNγ secretion and accompanies an increase in ICAM1 expression and concomitant T cell aggregation while disruption of the lymphocyte function-associated antigen (LFA-1)-ICAM1 interaction, suppresses T cell aggregation and IFNγ, secretion. Conversely, preliminary data demonstrated both recombinant Rnaset2-FC and protein overexpression inhibited IFNγ secretion.
These findings establish a mechanistic relationship between decreased RNASET2 expression, enhanced ICAM1 expression and TNFSF15/TL1A mediated production of IFNγ, three genes which have been implicated by GWAS as potentially involved in IBD pathogenesis. Without being bound by any particular theory, these findings suggest that identifying the regulatory mechanisms and molecular components comprising TL1A-mediated down-regulation of RNASET2 expression, and the molecular events contributing to enhancement of pro-inflammatory cytokine expression/secretion related to decreased levels of RNASET2 and subsequent enhanced ICAM1 expression, will yield a more precisely defined molecular signature of a severe form of CD as well as potential targets, that may then be used alone or in combination to optimally mitigate severe disease development in a defined subset of patients with CD.
RNASET2 disease risk SNPs are also associated with decreased expression in T cells compared to monocytes or lymphoblastoid cell lines, reinforcing the significance of the findings disclosed herein. The findings disclosed herein altogether suggest that T cell mediated inflammation resulting in a decrease of RNASET2 expression underlie the complicated disease pathology triggered by TL1A and its downstream pathways.
Disclosed herein, in some embodiments, are therapeutic agents modulating RNASET2 activity or expression. Altered expression of RNASET2 is associated with cancers and autoimmune diseases, suggesting a role for RNASET2 in host immune responses, making it a promising target for the treatment of IBDs. In addition, RNASET2 is believed to contribute to cytoskeletal reorganization and caspase activation in response to oxidative stress.
Disclosed herein, in certain aspects, is a method of treating or preventing a disease or condition of gastrointestinal tissue in a subject comprising administering a therapeutic agent to the subject, provided the subject is identified as having a high likelihood of recurrence of the disease or condition following surgical treatment of the disease or disorder based at least partially on a presence of a genotype being detected in a sample obtained from the subject, wherein the genotype comprises an indel at Indel 1, a single nucleotide polymorphism (SNP) at SNP1, or a SNP in linkage disequilibrium (LD) therewith, or a combination thereof. In some embodiments, the high likelihood is relative to a likelihood of an individual that does not have the genotype to experience recurrence of the disease or condition following surgical treatment. In some embodiments, the therapeutic agent is a modulator of Ribonuclease T2 (RNASET2) activity or expression. In some embodiments, the therapeutic agent is a modulator of Tumor necrosis factor ligand-related molecule 1 A (TL1A) activity or expression.
Described herein, in certain aspects, is a method of predicting post-operative recurrence of a disease or a condition, the method comprising: (a) providing a sample obtained from a subject having a disease or condition of a gastrointestinal tissue; (b) detecting a presence or an absence of a genotype in the sample comprising an indel at Indel 1 or SNP at SNP1, or a SNP in LD therewith, or a combination thereof; and (c) if the presence of the genotype is detected in (b), then identifying the subject as having a high likelihood of recurrence of the disease or condition; or (d) if the absence of the genotype is detected in (b), then identifying the subject as not having the high likelihood of recurrence of the disease or condition, wherein the high likelihood is compared with a likelihood of an individual that does not have the genotype. In some embodiments, the disease or condition is mediated by TL1A. In some embodiments, the disease or condition is an inflammatory disease or condition. In some embodiments, the inflammatory disease or condition is an inflammatory bowel disease. In some embodiments, the inflammatory bowel disease is Crohn's disease, perianal Crohn's disease, ulcerative colitis, intestinal fibrosis, or intestinal fibrostenosis, or a combination thereof. In some embodiments, at least a portion of the gastrointestinal tissue was removed to treat the disease or condition. In some embodiments, the gastrointestinal tissue is the small intestine. In some embodiments, the small intestine is the ileum. In some embodiments, the genotype comprising the indel at Indel 1 is CCAGGGCTGGGTGAGGG. In some embodiments, the genotype comprising the SNP at SNP1 is a “T”. In some embodiments, the genotype is homozygous. In some embodiments, the genotype comprises a second SNP comprising SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in LD therewith, or any combination thereof. In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of a modulator of RNASET2 activity or expression, provided the presence of the genotype is detected in (b). In some embodiments, the modulator of RNASET2 activity or expression is an agonist of RNASET2 activity or expression. In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of a modulator of TL1A activity or expression, provided the presence of the genotype is detected in (b). In some embodiments, the modulator of TL1A comprises an anti-TL1A or anti-DR3 antibody provided in Table 1. In some embodiments, the methods further comprise administering to the subject a therapeutically effective amount of a therapeutic agent having RNASET2 activity, provided the presence of the genotype is detected in (b). In some embodiments, the therapeutic agent comprises a therapeutic agent having RNASET2 activity. In some embodiments, the therapeutic agent having RNASET2 activity comprises a RNASET2 protein or a functional fragment thereof. In some embodiments, the RNASET2 protein comprises the amino acid sequence of SEQ ID NO:11. In some embodiments, the RNASET2 protein comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to SEQ ID NO:11 or a functional fragment of the homologous amino acid sequence. In some embodiments, the RNASET2 protein comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:11 or a functional fragment of the amino acid sequence. In some embodiments, the therapeutic agent having RNASET2 activity comprises an agonist of RNASET2 expression or activity or a RNASET2-downstream signaling molecule. In some embodiments, the therapeutic agent having RNASET2 activity comprises a RNASET2 protein or a functional fragment thereof.
In one aspect, provided herein is a method of treating or preventing a disease or condition of gastrointestinal tissue in a subject comprising administering a therapeutic agent to the subject, provided the subject is identified as having a high likelihood of the disease or condition based at least partially on a presence of a genotype being detected in a sample obtained from the subject, wherein the genotype comprises (i) an indel at Indel 1, (ii) a first single nucleotide polymorphism (SNP) at SNP 1 or a SNP in linkage disequilibrium (LD) therewith, (iii) a second SNP at SNP 2 or a SNP in LD therewith, or (iv) a combination thereof.
In a further aspect, provide herein is a method of predicting a response to a therapeutic agent in a subject having a disease or condition of gastrointestinal tissue: (a) providing a sample obtained from a subject having a disease or condition of a gastrointestinal tissue; (b) detecting a presence or an absence of a genotype in the sample comprising (i) an indel at Indel 1, (ii) a first single nucleotide polymorphism (SNP) at SNP 1 or a SNP in linkage disequilibrium (LD) therewith, (iii) a second SNP at SNP 2 or a SNP in LD therewith, or (iv) a combination thereof; and (c) (i) if the presence of the genotype is detected in (b), then identifying the subject as having a high likelihood of responding to the therapeutic agent; or (ii) if the absence of the genotype is detected in (b), then identifying the subject as not having the high likelihood of responding to the therapeutic agent, wherein the high likelihood is compared with a likelihood of an individual that does not have the genotype.
In some embodiments of the various methods provided herein, including the methods provided in the preceding paragraphs, the methods further comprise preparing the sample for genotype detection. In certain embodiments, the methods further comprise administering to the subject a therapeutically effective amount of the therapeutic agent, provided the presence of the genotype is detected in (b). In some embodiments, the SNP in LD with SNP 2 comprises rs62436421. In some embodiments, the SNP in LD with SNP 1 comprises SNP4. In some embodiments, (i) the SNP 1 comprises SNP 1T, (ii) the SNP 2 comprises SNP 2T, (iii) Indel 1 comprises Indel 1I, (iv) SNP 4 comprises SNP 4C, or (v) any combination of (i) to (iv). In some embodiments, the disease or condition is mediated by a decreased protein level of RNASET2 in the subject compared to a subject without the genotype. In some embodiments, the disease or condition is mediated by an increased protein level of TL1A in the subject compared to a subject without the genotype. In some embodiments, the disease or condition is an inflammatory disease or condition. In some embodiments, the inflammatory disease or condition is an inflammatory bowel disease. In some embodiments, the inflammatory bowel disease is Crohn's disease, perianal Crohn's disease, ulcerative colitis, intestinal fibrosis, or intestinal fibrostenosis, or a combination thereof. In some embodiments, the disease or condition comprises recurrence following surgical treatment of the disease or condition. In some embodiments, the surgical treatment comprises removal of at least a portion of the gastrointestinal tissue. In some embodiments, the portion of the gastrointestinal tissue is in the small intestine. In some embodiments, the small intestine is the ileum. In some embodiments, the genotype is a homozygous genotype at SNP 1, SNP 2, Indel 1, SNP 4, rs62436421, or any combination thereof. In some embodiments, the genotype comprises a further SNP comprising SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in LD therewith, or any combination thereof. In some embodiments, the therapeutic agent comprises a therapeutic agent having RNASET2 activity. In some embodiments, the therapeutic agent having RNASET2 activity comprises a RNASET2 protein or a functional fragment thereof. In some embodiments, the RNASET2 protein comprises the amino acid sequence of SEQ ID NO:11. In some embodiments, the RNASET2 protein comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous to SEQ ID NO:11 or a functional fragment of the homologous amino acid sequence. In some embodiments, the RNASET2 protein comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:11 or a functional fragment of the amino acid sequence. In some embodiments, the therapeutic agent comprises an inhibitor of TL1A. In some embodiments, the inhibitor of TL1A comprises an anti-TL1A or anti-DR3 antibody provided in Table 1.
While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
Aspects disclosed herein provide methods of treating, diagnosing, prognosing, or monitoring, a disease or condition. In some embodiments of the various methods provided herein, the disease or condition is mediated by a decreased protein level of RNASET2 in the subject compared to a subject without the genotype. In other embodiments, the disease or condition is mediated by an increased protein level of TL1A in the subject compared to a subject without the genotype. In some cases, the disease or condition comprises an inflammatory disease, fibrostenotic disease, and/or fibrotic disease. Non-limiting examples of inflammatory diseases include diseases of the gastrointestinal (GI) tract, liver, gallbladder, and joints. In some cases, the inflammatory disease inflammatory bowel disease (IBD), Crohn's disease (CD), or ulcerative colitis, systemic lupus erythematosus (SLE), or rheumatoid arthritis. A subject may suffer from fibrosis, fibrostenosis, or a fibrotic disease, either isolated or in combination with an inflammatory disease.
An exemplary fibrotic disease is primary sclerosing cholangitis (PSC). In some instances, the disease or condition is refractory, which refers a quality of the disease or condition such that there is an observed failure of a standard treatment to induce remission of a disease or condition. Non-limiting examples of refractory inflammatory disease include refractory Crohn's disease, and medically refractory ulcerative colitis (e.g., mrUC). Non-limiting examples of standard treatment include glucocorticosteriods, anti-TNF therapy, anti-a4-b7 therapy (vedolizumab), anti-IL12p40 therapy (ustekinumab), Thalidomide, and Cytoxin. In some instances, the refractory disease or condition is characterized by an increase in colitis, inflammation, fibrosis, fibrostenosis, stricturing, penetrating, obstructive, or otherwise complicated, disease of the GI tract.
Disclosed herein, in some embodiments, are methods of treating, diagnosing, prognosing, or monitoring, a disease or condition in a subject. In some instances, the subject is a mammal. In some embodiments, the subject comprises a mouse, rat, guinea pig, rabbit, chimpanzee, or farm animal. In some instances, the subject is human. In some instances, the subject is diagnosed with the disease or condition disclosed herein. Non-limiting methods for diagnosis using existing indices and scoring systems include Crohn's Disease Activity Index (CDAI), Ulcerative Colitis Disease Activity Index (UCDAI), guidelines from American College of Gastroenterology (ACG) and European Crohn's and Colitis Organization (ECCO), patient-reported outcomes (PRO-2), Harvey-Bradshaw Index, Van Hess Index, Perianal Disease Activity Index (PDAI), Rachmilewitz score, Mayo score, Powell-Tuck index, Patient Simple Clinical Colitis Activity Index (P-SCCAI), Lichtiger index, Seo index, Inflammatory Bowel Disease Questionnaire (IBDQ), Manitoba IBD Index, Crohn's Disease Endoscopic Index of Severity (CDEIS), Simple Endoscopic Score for Crohn Disease (SES-CD), Lewis score (capsule endoscopy), Rutgeert's Score, and the Montreal Classification, and IBD questionnaire. In some instances, the subject is not diagnosed with the disease or condition. In some instances, the subject is suffering from a symptom related to a disease or condition disclosed herein (e.g., abdominal pain, cramping, diarrhea, rectal bleeding, fever, weight loss, fatigue, loss of appetite, dehydration, and malnutrition, anemia, or ulcers).
In some embodiments, the subject is susceptible to, or is inflicted with, thiopurine toxicity, or a disease caused by thiopurine toxicity (such as pancreatitis or leukopenia). In further embodiments provided, the subject is, or is suspected of being, non-responsive to a standard treatment (e.g., anti-TNF alpha therapy, anti-α4-b7 therapy (vedolizumab), anti-IL12p40 therapy (ustekinumab), Thalidomide, or Cytoxin). In some cases, the subject is not responsive to the induction of said therapy. In some cases, the subject loses response to said standard treatment after a period of time during treatment.
Ribonuclease T2, encoded by the gene RNASET2 (Entrez gene ID No. 8635 (Homo sapiens)) is a member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. RNASET2 is a single copy gene that maps to 6p27 human genomic position, a region associated with various human malignancies and chromosomal rearrangement. Disclosed herein, in some embodiments, are genotypes comprising one or more single nucleotide polymorphisms (SNPs) and/or indels at, or near, the RNASET2 gene locus. In some embodiments, the one or more SNPs and/or indels comprise rs16900967 (Indel 1), rs2149092 (SNP 1), rs1819333 (SNP 2), rs9355610 (SNP 3), and rs1044059 (SNP 4). In some embodiments, reference to “Indel 1” refers to the indel at rs16900967. In some embodiments, reference to “SNP 1” refers to the SNP at rs2149092. In some embodiments, reference to “SNP 2” refers to the SNP at rs1819333. In some embodiments, reference to “SNP 3” refers to the SNP at rs9355610. In some embodiments, reference to “SNP 4” refers to the SNP at rs1044059. In some embodiments, the genotypes described herein comprise one or more of Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C.
In some embodiments, SNP1 (rs2149092) is located at chr6:166959490 (GRCh38.p12), which means nucleotide position 166959490 within human chromosome 6 of the human genome according to build 38. In some embodiments, SNP1 is located at nucleic acid position 51 within SEQ ID NO: 2. In certain embodiments, the risk allele for SNP 1 is SNP 1T comprising a ‘T’ at the site of the polymorphism. In some embodiments, the non-risk allele for SNP 1 is SNP 1C comprising a “C” at the site of the polymorphism. In some specific embodiments, the risk allele SNP 1T comprises a ‘T’ at the 11th nucleotide in the sequence of TTGTCACTTCTTCCTGTACTG (SEQ ID NO: 392). In other specific embodiments, the non-risk allele SNP 1C comprises a “C” at the 11th nucleotide in the sequence of SEQ ID NO: 392. In some embodiments, Indel 1 is located at chr6:166957199-166957220 (GRCh38.p12). In some embodiments, Indel 1 is located at nucleic acid position 51 within SEQ ID NO: 1. In certain specific embodiments, the risk allele for Indel 1 is Mel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)). In some embodiments, SNP 2 is located at chr6:166960059(GRCh38.p12). In some embodiments, SNP 2 is located at nucleic acid position 51 within SEQ ID NO: 3. In certain embodiments, the risk allele for SNP 2 is SNP 2T comprising a ‘T’ at the site of the polymorphism. In some embodiments, the non-risk allele for SNP 2 is SNP 2G comprising a “G” at the site of the polymorphism. In some specific embodiments, the risk allele SNP 2T comprises a ‘T’ at the 11th nucleotide in the sequence of CTTCTTGGCATTAGCTCCAGGT (SEQ ID NO: 393). In other specific embodiments, the non-risk allele SNP 2G comprises a “G” at the 11th nucleotide in the sequence of SEQ ID NO: 393. In some embodiments, SNP 3 is located at chr6:166969587 (GRCh38.p12). In some embodiments, SNP 3 is located at nucleic acid position 51 within SEQ ID NO: 4. In some embodiments, SNP 4 is located at chr6:166956409 (GRCh38.p12). In some embodiments, SNP 4 is located at nucleic acid position 51 within SEQ ID NO: 5. In certain embodiments, the risk allele for SNP 4 is SNP 4C comprising a “C” at the site of the polymorphism. In some embodiments, the non-risk allele for SNP 4 is SNP 4A comprising an “A” at the site of the polymorphism. In some specific embodiments, the risk allele SNP 4C comprises a “C” at the 10th nucleotide in the sequence of CAGCCCTGGCGACCCGGGCCC (SEQ ID NO: 394). In other specific embodiments, the non-risk allele SNP 4A comprises an “A” at the 10th nucleotide in the sequence of SEQ ID NO: 394.
In some embodiments, the genotype is associated with a decrease in RNASET2 activity or expression. In some embodiments, the genotype is associated with an increase in RNASET2 activity or expression. In some embodiments, the genotypes are associated with a risk of recurrence of a disease or a condition described herein, such as Crohn's disease. In some embodiments, the genotypes are associated with a risk that a subject carrying one or more of the genotypes has, or is at risk of developing, a disease or conditions described herein (e.g., inflammatory bowel disease, Crohn's disease, ulcerative colitis). In some embodiments, the genotypes disclosed herein are useful for the selection of a patient for treatment with a therapeutic agent effective to increase or activate RNASET2 activity or expression. In some embodiments, the genotypes disclosed herein are useful for the selection of a patient for treatment with a therapeutic agent effective to decrease or reduce RNASET2 activity or expression. In some embodiments, the RNASET2 risk genotype comprises Indel1 (rs16900967). In some embodiments, the RNASET2 risk genotype comprises SNP1 (rs2149092). In some embodiments, the RNASET2 risk genotype comprises SNP2 (rs1819333). In some embodiments, the RNASET2 risk genotype comprises SNP3 (rs9355610). In some embodiments, the RNASET2 risk genotype comprises SNP4 (rs1044059). In some embodiments, the RNASET2 risk genotype comprises SNP5 (rs408080). In some embodiments, the RNASET2 risk genotype comprises SNP6 (rs64561430). In some embodiments, the RNASET2 risk genotype comprises SNP7 (rs34560498). In some embodiments, the RNASET2 risk genotype comprises SNP8 (rs12525855). In some embodiments, the RNASET2 risk genotype comprises SNP9 (rs2769346). In some embodiments, the RNASET2 risk genotype comprises SNP10(rs12213683). In some embodiments, the RNASET2 risk genotype comprises SNP11(rs12208359). In some embodiments, the RNASET2 risk genotype comprises SNP12 (rs405553). In some embodiments, the RNASET2 risk genotype comprises SNP13 (rs444988). In some embodiments, the RNASET2 risk genotype comprises SNP14 (rs3752520). In some embodiments, the RNASET2 risk genotype comprises SNP15 (rs12203510). In some embodiments, the RNASET2 risk genotype comprises SNP16 (rs9295384). In some embodiments, the RNASET2 risk genotype comprises SNP17 (rs9457260). In some embodiments, the RNASET2 risk genotype comprises SNP18 (rs424185). In some embodiments, the RNASET2 risk genotype comprises SNP19 (rs2757042). In some embodiments, the RNASET2 risk genotype comprises SNP20 (rs4710171). In some embodiments, the RNASET2 risk genotype comprises SNP21 (rs398278). In some embodiments, the RNASET2 risk genotype comprises SNP22 (rs9459849). In some embodiments, the RNASET2 risk genotype comprises SNP23 (rs2757050). In some embodiments, the RNASET2 risk genotype comprises SNP24 (rs6456151). In some embodiments, the RNASET2 risk genotype comprises SNP25 (rs365189). In some embodiments, the RNASET2 risk genotype comprises SNP26 (rs7748224). In some embodiments, the RNASET2 risk genotype comprises SNP27 (rs239934). In some embodiments, the RNASET2 risk genotype comprises SNP28 (rs4060951). In some embodiments, the RNASET2 risk genotype comprises SNP29 (rs2757046). In some embodiments, the RNASET2 risk genotype comprises SNP30 (rs364283). In some embodiments, the RNASET2 risk genotype comprises SNP31 (rs12527827). In some embodiments, the RNASET2 risk genotype comprises SNP32 (rs439553). In some embodiments, the RNASET2 risk genotype comprises SNP33 (rs2149091). In some embodiments, the RNASET2 risk genotype comprises SNP34 (rs2038580). In some embodiments, the RNASET2 risk genotype comprises SNP35 (rs385113). In some embodiments, the RNASET2 risk genotype comprises SNP36 (rs1060404). In some embodiments, the RNASET2 risk genotype comprises one or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises two or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises three or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises four or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises five or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises six or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises seven or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises eight or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises nine or more of SNP1-SNP36, and Indel 1. In some embodiments, the RNASET2 risk genotype comprises ten or more of SNP1-SNP36, and Indel 1.
In some embodiments, RNASET2 risk genotype (the “genotype”) comprises Indel 1. In some embodiments, the genotype comprises SNP 1. In some embodiments, the genotype comprises SNP 2. In some embodiments, the genotype comprises SNP 3. In some embodiments, the genotype comprises SNP 4. In some embodiments, the genotype comprises Indel 1 and SNP 1. In some embodiments, the genotype comprises Indel 1 and SNP 2. In some embodiments, the genotype comprises Indel 1 and SNP 3. In some embodiments, the genotype comprises Indel 1 and SNP 4. In some embodiments, the genotype comprises SNP 1 and SNP 2. In some embodiments, the genotype comprises SNP 1 and SNP 3. In some embodiments, the genotype comprises SNP 1 and SNP 4. In some embodiments, the genotype comprises SNP 2 and SNP 3. In some embodiments, the genotype comprises SNP 2 and SNP 4. In some embodiments, the genotype comprises SNP 3 and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 1, and SNP 2. In some embodiments, the genotype comprises Indel 1, SNP 1, and SNP 3. In some embodiments, the genotype comprises Indel 1, SNP 1, and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 2, and SNP 3. In some embodiments, the genotype comprises Indel 1, SNP 2, and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 3, and SNP 4. In some embodiments, the genotype comprises SNP 1, SNP 2, and SNP 3. In some embodiments, the genotype comprises SNP 1, SNP 2, and SNP 4. In some embodiments, the genotype comprises SNP 1, SNP 3, and SNP 4. In some embodiments, the genotype comprises SNP 2, SNP 3, and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 1, SNP 2, and SNP 3. In some embodiments, the genotype comprises Indel 1, SNP 1, SNP 2, and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 1, SNP 3, and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 2, and SNP 3, and SNP 4. In some embodiments, the genotype comprises SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the genotype comprises Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4.
In some instances, the genotype comprises one SNP, two SNPs, three SNPs, four SNPs, or five SNPs. Disclosed herein, in some embodiments are methods, kits, systems, and compositions comprising detecting at least two SNPs and/or indels in a gene encoding RNASET2. In some instances, methods, kits, systems, and compositions comprise administering a therapeutic agent disclosed herein to a subject having at least two SNPs and/or indels in a gene encoding RNASET2. The two SNPs and/or indels may be Indel 1 and SNP 1. The two SNPs and/or indels may be Indel 1 and SNP 2. The two SNPs and/or indels may be Indel 1 and SNP 3. The two SNPs and/or indels may be Indel 1 and SNP 4.
In some instances, methods, kits, systems, and compositions comprise detecting at least two SNPs and/or indels in a gene encoding RNASET2. In some instances, methods, kits, systems, and compositions comprise administering a therapeutic agent disclosed herein to a subject having at least two SNPs and/or indels in a gene encoding RNASET2. The two SNPs and/or indels may be SNP 1 and Indel 1. The two SNPs and/or indels may be SNP 1 and SNP 2. The two SNPs and/or indels may be SNP 1 and SNP 3. The two SNPs and/or indels may be SNP 1 and SNP 4.
In some instances, methods, kits, systems, and compositions comprise detecting at least two SNPs and/or indels in a gene encoding RNASET2. In some instances, methods, kits, systems, and compositions comprise administering a therapeutic agent disclosed herein to a subject having at least two SNPs and/or indels in a gene encoding RNASET2. The two SNPs and/or indels may be SNP 2 and Indel 1. The two SNPs and/or indels may be SNP 1 and SNP 2. The two SNPs and/or indels may be SNP 2 and SNP 3. The two SNPs and/or indels may be SNP 2 and SNP 4.
In some instances, methods, kits, systems, and compositions comprise detecting at least two SNPs and/or indels in a gene encoding RNASET2. In some instances, methods, kits, systems, and compositions comprise administering a therapeutic agent disclosed herein to a subject having at least three SNPs and/or indels in a gene encoding RNASET2. The three SNPs and/or indels may be SNP 2, Indel 1, and SNP 1. The three SNPs and/or indels may be SNP 2, Indel 1, and SNP 3. The three SNPs and/or indels may be SNP 2, Indel 1, and SNP 4. The three SNPs and/or indels may be Indel 1, SNP 4, and SNP 1. The three SNPs and/or indels may be Indel 1, SNP 4, and SNP 3. The three SNPs and/or indels may be Indel 1, SNP 4, and SNP 2. The three SNPs and/or indels may be SNP 3, SNP 4, and SNP 2. The three SNPs and/or indels may be SNP 3, SNP 4, and Indel 1. The three SNPs and/or indels may be SNP 3, SNP 1, and SNP 2.
Disclosed herein, in some embodiments, are methods of detecting a presence, absence, or level, of a genotype or biomarker in a sample obtained from a subject. In some instances, the methods of detection disclosed herein are useful for the diagnosis, prognosis, monitoring of disease progression, selection for treatment, monitoring of treatment, and/or treatment of inflammatory bowel disease (e.g., Crohn's disease, ulcerative colitis, and the like) disclosed herein.
In some embodiments, methods of detecting a presence, absence, or level of a genotype or biomarker in the sample obtained from the subject involve detecting a nucleic acid sequence. In some cases, the nucleic acid sequence comprises deoxyribonucleic acid (DNA). In some instances, the nucleic acid sequence comprises a denatured DNA molecule or fragment thereof. In some instances, the nucleic acid sequence comprises DNA selected from: genomic DNA, viral DNA, mitochondrial DNA, plasmid DNA, amplified DNA, circular DNA, circulating DNA, cell-free DNA, or exosomal DNA. In some instances, the DNA is single-stranded DNA (ssDNA), double-stranded DNA, denaturing double-stranded DNA, synthetic DNA, and combinations thereof. The circular DNA may be cleaved or fragmented. In some instances, the nucleic acid sequence comprises ribonucleic acid (RNA). In some instances, the nucleic acid sequence comprises fragmented RNA. In some instances, the nucleic acid sequence comprises partially degraded RNA. In some instances, the nucleic acid sequence comprises a microRNA or portion thereof. In some instances, the nucleic acid sequence comprises an RNA molecule or a fragmented RNA molecule (RNA fragments) selected from: a microRNA (miRNA), a pre-miRNA, a pri-miRNA, a mRNA, a pre-mRNA, a viral RNA, a viroid RNA, a virusoid RNA, circular RNA (circRNA), a ribosomal RNA (rRNA), a transfer RNA (tRNA), a pre-tRNA, a long non-coding RNA (lncRNA), a small nuclear RNA (snRNA), a circulating RNA, a cell-free RNA, an exosomal RNA, a vector-expressed RNA, an RNA transcript, a synthetic RNA, and combinations thereof.
Disclosed herein, in some embodiments, the genotype or biomarker is detected by subjecting a sample obtained from the subject to a nucleic acid-based detection assay. In some instances, the nucleic acid-based detection assay comprises quantitative polymerase chain reaction (qPCR), gel electrophoresis (including for e.g., Northern or Southern blot), immunochemistry, in situ hybridization such as fluorescent in situ hybridization (FISH), cytochemistry, or sequencing. In some embodiments, the sequencing technique comprises next generation sequencing. In some embodiments, the methods involve a hybridization assay such as fluorogenic qPCR (e.g., TaqMan™, SYBR green, SYBR green I, SYBR green II, SYBR gold, ethidium bromide, methylene blue, Pyronin Y, DAPI, acridine orange, Blue View or phycoerythrin), which involves a nucleic acid amplification reaction with a specific primer pair, and hybridization of the amplified nucleic acid probes comprising a detectable moiety or molecule that is specific to a target nucleic acid sequence. In some instances, a number of amplification cycles for detecting a target nucleic acid in a qPCR assay is about 5 to about 30 cycles. In some instances, the number of amplification cycles for detecting a target nucleic acid is at least about 5 cycles. In some instances, the number of amplification cycles for detecting a target nucleic acid is at most about 30 cycles. In some instances, the number of amplification cycles for detecting a target nucleic acid is about 5 to about 10, about 5 to about 15, about 5 to about 20, about 5 to about 25, about 5 to about 30, about 10 to about 15, about 10 to about 20, about 10 to about 25, about 10 to about 30, about 15 to about 20, about 15 to about 25, about 15 to about 30, about 20 to about 25, about 20 to about 30, or about 25 to about 30 cycles. For TaqMan™ methods, the probe may be a hydrolysable probe comprising a fluorophore and quencher that is hydrolyzed by DNA polymerase when hybridized to a target nucleic acid. In some cases, the presence of a target nucleic acid is determined when the number of amplification cycles to reach a threshold value is less than 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, or 20 cycles. In some instances, hybridization may occur at standard hybridization temperatures, e.g., between about 35° C. and about 65° C. in a standard PCR buffer.
An additional exemplary nucleic acid-based detection assay comprises the use of nucleic acid probes conjugated or otherwise immobilized on a bead, multi-well plate, or other substrate, wherein the nucleic acid probes are configured to hybridize with a target nucleic acid sequence. In some instances, the nucleic acid probe is specific to one or more genetic variants disclosed herein is used. In some instances, the nucleic acid probe specific to a SNP or SNV comprises a nucleic acid probe sequence sufficiently complementary to a risk or protective allele of interest, such that hybridization is specific to the risk or protective allele. In some instances, the nucleic acid probe specific to an indel comprises a nucleic acid probe sequence sufficiently complementary to an insertion of a nucleobase within a polynucleotide sequence flanking the insertion, such that hybridization is specific to the indel. In some instances, the nucleic acid probe specific to an indel comprises a probe sequence sufficiently complementary to a polynucleotide sequence flanking a deletion of a nucleobase within the polynucleotide sequence, such that hybridization is specific to the indel. In some instances, the nucleic acid probe specific to a biomarker comprises a nucleic acid probe sequence sufficiently complementary to the polynucleotide sequence of the biomarker. In some instances, the biomarker comprises a transcribed polynucleotide sequence (e.g., RNA, cDNA). In some embodiments, the nucleic acid probe can be, for example, a full-length cDNA, or a portion thereof, such as an oligonucleotide of at least about 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length and sufficient to specifically hybridize under standard hybridization conditions to the target nucleic acid sequence. In some embodiments, the target nucleic acid sequence is immobilized on a solid surface and contacted with a probe, for example by running the isolated target nucleic acid sequence on an agarose gel and transferring the target nucleic acid sequence from the gel to a membrane, such as nitrocellulose. In some embodiments, the probe(s) are immobilized on a solid surface, for example, in an Affymetrix gene chip array, and the probe(s) are contacted with the target nucleic acid sequence. The present disclosure provides exemplary probes that are hybridizable to a target nucleic acid sequence comprising a risk allele at Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the exemplary probes are hybridizable to target Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in linkage disequilibrium (LD) therewith, or any combination thereof. The present disclosure provides exemplary probes provided in SEQ ID NOS: 6-10, or 29-48, respectively. In some embodiments, the allele for SEQ ID NOS: 29-28 are provided in Table 3.
In some embodiments, the term “probe” with regards to nucleic acids, refers to any nucleic acid molecule that is capable of selectively binding to a specifically intended target nucleic acid sequence. In some instances, probes are specifically designed to be labeled, for example, with a radioactive label, a fluorescent label, an enzyme, a chemiluminescent tag, a colorimetric tag, or other labels or tags that are known in the art. In some instances, the fluorescent label comprises a fluorophore. In some instances, the fluorophore is an aromatic or heteroaromatic compound. In some instances, the fluorophore is a pyrene, anthracene, naphthalene, acridine, stilbene, benzoxaazole, indole, benzindole, oxazole, thiazole, benzothiazole, canine, carbocyanine, salicylate, anthranilate, xanthenes dye, coumarin. Exemplary xanthene dyes include, e.g., fluorescein and rhodamine dyes. Fluorescein and rhodamine dyes include, but are not limited to 6-carboxyfluorescein (FAM), 2′7′-dimethoxy-4′5′-dichloro-6-carboxyfluorescein (JOE), tetrachlorofluorescein (TET), 6-carboxyrhodamine (R6G), N,N,N; N′-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX). Suitable fluorescent probes also include the naphthylamine dyes that have an amino group in the alpha or beta position. For example, naphthylamino compounds include 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-toluidinyl-6-naphthalene sulfonate, 5-(2′-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS). Exemplary coumarins include, e.g., 3-phenyl-7-isocyanatocoumarin; acridines, such as 9-isothiocyanatoacridine and acridine orange; N-(p-(2-benzoxazolyl)phenyl) maleimide; cyanines, such as, e.g., indodicarbocyanine 3 (Cy3), indodicarbocyanine 5 (Cy5), indodicarbocyanine 5.5 (Cy5.5), 3-(-carboxy-pentyl)-3′-ethyl-5,5′-dimethyloxacarbocyanine (CyA); 1H, 5H, 11H, 15H-Xantheno[2,3, 4-ij: 5,6, 7-i′j′]diquinolizin-18-ium, 9-[2 (or 4)-[[[6-[2,5-dioxo-1-pyrrolidinyl)oxy]-6-oxohexyl]amino]sulfonyl]-4 (or 2)-sulfophenyl]-2,3, 6,7, 12,13, 16,17-octahydro-inner salt (TR or Texas Red); or BODIPY™ dyes. In some cases, the probe comprises FAM as the dye label.
Disclosed herein, in some embodiments, a genotype or biomarker is detected by subjecting a sample obtained from the subject to a nucleic acid amplification assay. In some instances, the amplification assay comprises polymerase chain reaction (PCR), qPCR, self-sustained sequence replication, transcriptional amplification system, Q-Beta Replicase, rolling circle replication, or any suitable other nucleic acid amplification technique. A suitable nucleic acid amplification technique is configured to amplify a region of a nucleic acid sequence comprising one or more genetic risk variants disclosed herein. In some instances, the amplification assays requires primers. The nucleic acid sequence for the genetic risk variants and/or genes known or provided herein is sufficient to enable one of skill in the art to select primers to amplify any portion of the gene or genetic variants. A DNA sample suitable as a primer may be obtained, e.g., by polymerase chain reaction (PCR) amplification of genomic DNA, fragments of genomic DNA, fragments of genomic DNA ligated to adaptor sequences or cloned sequences. A person of skill in the art would utilize computer programs to design of primers with the desired specificity and optimal amplification properties, such as Oligo version 7.0 (National Biosciences). Controlled robotic systems are useful for isolating and amplifying nucleic acids and can be used.
In some embodiments, detecting the biomarker or genotype of the subject comprises sequencing genetic material obtained from a biological sample from the subject. Sequencing can be performed with any appropriate sequencing technology, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, sequencing by ligation, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or sequencing by synthesis. Sequencing methods also include next-generation sequencing, e.g., modem sequencing technologies such as Illumina sequencing (e.g., Solexa), Roche 454 sequencing, Ion torrent sequencing, and SOLiD sequencing. In some cases, next-generation sequencing involves high-throughput sequencing methods. Additional sequencing methods available to one of skill in the art may also be employed.
In some instances, a number of nucleotides that are sequenced are at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 2000, 4000, 6000, 8000, 10000, 20000, 50000, 100000, or more than 100000 nucleotides. In some instances, the number of nucleotides sequenced is in a range of about 1 to about 100000 nucleotides, about 1 to about 10000 nucleotides, about 1 to about 1000 nucleotides, about 1 to about 500 nucleotides, about 1 to about 300 nucleotides, about 1 to about 200 nucleotides, about 1 to about 100 nucleotides, about 5 to about 100000 nucleotides, about 5 to about 10000 nucleotides, about 5 to about 1000 nucleotides, about 5 to about 500 nucleotides, about 5 to about 300 nucleotides, about 5 to about 200 nucleotides, about 5 to about 100 nucleotides, about 10 to about 100000 nucleotides, about 10 to about 10000 nucleotides, about 10 to about 1000 nucleotides, about 10 to about 500 nucleotides, about 10 to about 300 nucleotides, about 10 to about 200 nucleotides, about 10 to about 100 nucleotides, about 20 to about 100000 nucleotides, about 20 to about 10000 nucleotides, about 20 to about 1000 nucleotides, about 20 to about 500 nucleotides, about 20 to about 300 nucleotides, about 20 to about 200 nucleotides, about 20 to about 100 nucleotides, about 30 to about 100000 nucleotides, about 30 to about 10000 nucleotides, about 30 to about 1000 nucleotides, about 30 to about 500 nucleotides, about 30 to about 300 nucleotides, about 30 to about 200 nucleotides, about 30 to about 100 nucleotides, about 50 to about 100000 nucleotides, about 50 to about 10000 nucleotides, about 50 to about 1000 nucleotides, about 50 to about 500 nucleotides, about 50 to about 300 nucleotides, about 50 to about 200 nucleotides, or about 50 to about 100 nucleotides.
Disclosed herein, in some embodiments, are methods for detecting a transcriptomic risk signature or transcriptomic risk profile in a sample obtained from the subject. In some embodiments, the presence, level, or activity of two or more biomarkers in a sample is determined by detecting a transcribed or reverse transcribed polynucleotide, or portion thereof (e.g., mRNA, or cDNA), of a target gene making up the transcriptomic risk signature or transcriptomic risk profile. Any suitable method of detecting a biomarker, such as those disclosed herein, may be utilized to detect a transcriptomic risk signature or transcriptomic risk profile, such as those disclosed herein. A transcriptomic risk signature or transcriptomic risk profile can also be detected at the protein level, using a detection reagent that detects the protein product encoded by the mRNA of the biomarker, directly or indirectly, such the detection reagents disclosed herein.
Disclosed herein, in some embodiments, genetic material is extracted from a sample obtained from a subject, e.g., a sample of blood or serum. In certain embodiments where nucleic acids are extracted, the nucleic acids are extracted using any technique that does not interfere with subsequent analysis. In certain embodiments, this technique uses alcohol precipitation using ethanol, methanol or isopropyl alcohol. In certain embodiments, this technique uses phenol, chloroform, or any combination thereof. In certain embodiments, this technique uses cesium chloride. In certain embodiments, this technique uses sodium, potassium or ammonium acetate or any other salt commonly used to precipitate DNA. In certain embodiments, this technique utilizes a column or resin based nucleic acid purification scheme such as those commonly sold commercially, one non-limiting example would be the GenElute Bacterial Genomic DNA Kit available from Sigma Aldrich. In certain embodiments, after extraction the nucleic acid is stored in water, Tris buffer, or Tris-EDTA buffer before subsequent analysis. In an exemplary embodiment, the nucleic acid material is extracted in water. In some cases, extraction does not comprise nucleic acid purification. In certain embodiments, RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland).
In some embodiments, methods of detecting a presence, absence, or level of a target protein (e.g., biomarker) in the sample obtained from the subject involve detecting protein activity or expression. A target protein may be detected by use of an antibody-based assay, where an antibody specific to the target protein is utilized. In some embodiments, antibody-based detection methods utilize an antibody that binds to any region of target protein. An exemplary method of analysis comprises performing an enzyme-linked immunosorbent assay (ELISA). The ELISA assay may be a sandwich ELISA or a direct ELISA. Another exemplary method of analysis comprises a single molecule array, e.g., Simoa. Other exemplary methods of detection include immunohistochemistry and lateral flow assay. Additional exemplary methods for detecting target protein include, but are not limited to, gel electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like, or various immunological methods such as fluid or gel precipitation reactions, immunodiffusion (single or double), immunoelectrophoresis, radioimmunoassay (RIA), immunofluorescent assays, and Western blotting. In some embodiments, antibodies, or antibody fragments, are used in methods such as Western blots or immunofluorescence techniques to detect the expressed proteins. The antibody or protein can be immobilized on a solid support for Western blots and immunofluorescence techniques. Suitable solid phase supports or carriers include any support capable of binding an antigen or an antibody. Exemplary supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
In some cases, a target protein may be detected by detecting binding between the target protein and a binding partner of the target protein. In some cases, the target protein comprises Ribonuclease T2 (RNASET2), or another protein involved in the RNASET2 pathway described herein, and/or mediated by TNF Ligand-Related Molecule 1 (TL1A), encoded by the gene TNF Superfamily Member 15 (TNFSF15). Exemplary methods of analysis of protein-protein binding comprise performing an assay in vivo or in vitro, or ex vivo. In some instances, the method of analysis comprises an assay such as a co-immunoprecipitation (co-IP), pull-down, crosslinking protein interaction analysis, labeled transfer protein interaction analysis, or Far-western blot analysis, FRET based assay, including, for example FRET-FLIM, a yeast two-hybrid assay, BiFC, or split luciferase assay.
Disclosed herein, in some embodiments, are methods of detecting a presence or a level of one or more serological markers in a sample obtained from a subject. In some embodiments, the antibodies comprise immunoglobulin A (IgA), immunoglobulin G (IgG), immunoglobulin E (IgE), or immunoglobulin M (IgM), immunoglobulin D (IgD), or a combination thereof. Any suitable method for detecting a target protein or biomarker disclosed herein may be used to detect a presence, absence, or level of a serological marker. In some embodiments, the presence or the level of the one or more serological markers is detected using an enzyme-linked immunosorbent assay (ELISA), a single molecule array (Simoa), immunohistochemistry, internal transcribed spacer (ITS) sequencing, or any combination thereof. In some embodiments, the ELISA is a fixed leukocyte ELISA. In some embodiments, the ELISA is a fixed neutrophil ELISA. A fixed leukocyte or neutrophil ELISA may be useful for the detection of certain serological markers, such as those described in Saxon et al., A distinct subset of antineutrophil cytoplasmic antibodies is associated with inflammatory bowel disease, J. Allergy Clin. Immuno. 86:2; 202-210 (August 1990). In some embodiments, ELISA units (EU) are used to measure positivity of a presence or level of a serological marker (e.g., seropositivity), which reflects a percentage of a standard or reference value. In some embodiments, the standard comprises pooled sera obtained from well-characterized patient population (e.g., diagnosed with the same disease or condition the subject has, or is suspected of having) reported as being seropositive for the serological marker of interest. In some embodiments, the control or reference value comprises 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 EU. In some instances, a quartile sum scores are calculated using, for example, the methods reported in Landers C J, Cohavy O, Misra R. et al., Selected loss of tolerance evidenced by Crohn's disease-associated immune responses to auto- and microbial antigens. Gastroenterology (2002)123: 689-699.
Disclosed herein, in some embodiments, are methods of diagnosing a disease or condition in a subject. In some cases, the disease or condition comprises an inflammatory disease, fibrostenotic disease, and/or fibrotic disease. Non-limiting examples of inflammatory diseases include diseases of the GI tract, liver, gallbladder, and joints. In some cases, the inflammatory disease IBD, CD, UC, systemic lupus erythematosus (SLE), or rheumatoid arthritis. In some embodiments, the disease or condition comprises fibrosis, fibrostenosis, or a fibrotic disease, either isolated or in combination with an inflammatory disease. An exemplary fibrotic disease is PSC. In some embodiments, a subtype of the disease or condition is diagnosed in the subject. Non-limiting examples of subtypes of IBD include, stricturing disease, penetrating disease, stricturing and penetrating disease, obstructive disease, refractory disease, or another complicated form of IBD. In some instances, the subject is diagnosed with, or predicted to develop, one disease or condition, two disease or conditions, three disease or conditions, or more.
Disclosed herein, in some embodiments, are methods of diagnosing a disease a disease or condition in a subject comprising: (a) obtaining a sample from a subject; (b) subjecting the sample to an assay configured to detect a presence, absence, or level, of an RNASET2 risk genotype; (c) diagnosing the subject with the disease or condition, provided the presence, absence, or level of RNASET2 genotype is detected in the sample obtained from the subject. In some embodiments, the RNASET2 genotype is detected using one or more methods of detection, kits and/or compositions disclosed herein. In some embodiments, the subject is treated by administering a therapeutically effective amount of a therapeutic agent and/or additional agent disclosed herein to the subject, provided the subject is diagnosed with the disease or condition. In some embodiments, the RNASET2 risk genotype comprises Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the RNASET2 risk genotype comprises Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C, or any single nucleotide polymorphism (SNP) or indel in linkage disequilibrium (LD) therewith.
Disclosed herein, in some embodiments, are methods of predicting whether a subject will develop a disease a disease or condition, the method comprising: (a) obtaining a sample from a subject; (b) subjecting the sample to an assay configured to detect a presence, absence, or level, of RNASET2 risk genotype; (c) predicting that the subject will develope the disease or condition, provided the presence, absence, or level of RNASET2 risk genotype is detected in the sample obtained from the subject. In some embodiments, the RNASET2 risk genotype is detected using one or more methods of detection, kits and/or compositions disclosed herein. In some embodiments, the subject is treated by administering a therapeutically effective amount of a therapeutic agent and/or additional agent disclosed herein to the subject, provided the subject is predicted to develop the disease or condition. In some embodiments, the RNASET2 risk genotype comprises Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the RNASET2 risk genotype comprises Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in linkage disequilibrium (LD) therewith, or any combination thereof.
Disclosed herein, in some embodiments, are methods of predicting whether a subject will develop a post-operative reoccurance of a disease or condition, the method comprising: (a) obtaining a sample from a subject; (b) subjecting the sample to an assay configured to detect a presence, absence, or level, of RNASET2 risk genotype; (c) predicting that the subject will develop a post-operative reoccurance of the disease or condition, provided the presence, absence, or level of RNASET2 risk genotype is detected in the sample obtained from the subject. In some embodiments, the RNASET2 risk genotype is detected using one or more methods of detection, kits and/or compositions disclosed herein. In some embodiments, the subject is treated by administering a therapeutically effective amount of a therapeutic agent and/or additional agent disclosed herein to the subject, provided the subject is predicted to develop a post-operative reoccurance of the disease or condition. In some embodiments, the RNASET2 risk genotype comprises Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the RNASET2 risk genotype comprises Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T
, SNP 2T, SNP 3G, SNP 4G, SNP 4C, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in linkage disequilibrium (LD) therewith, or any combination thereof.
In some embodiments, multiple samples are obtained. In some embodiments, at least 1, 2, 3, 4, or 5 samples are taken following surgery. In some embodiments, a sample is obtained immediately following surgery. In some embodiments, sample is obtained at different time intervals following surgery. In some embodiments, a sample is obtained at least 1, 2, 3, 4, 5, 6, or 7 days. In some embodiments, samples are obtained at least 1, 2, 3, 4, or 5 weeks following surgery. In some embodiments, the sample is a gastrointestinal tissue. In some embodiments, the sample is blood. In some embodiments, the sample is plasma. In some embodiments, the sample is serum.
In some embodiments, the surgery comprises a surgery to treat a gastrointestinal disorder. Non-limiting surgeries include an intestinal resection, colectomy, perianal surgery, and stricturoplasty. In some embodiments, at least a portion of the gastrointestinal tissue was removed to treat the disease or condition. The portion of the gastrointestinal tract may be selected from the anus, the colon, the large intestine, the small intestine, the stomach, and the esophagus. The portion of the small intestine may be selected from the duodenum, the jejunum, and the ileum.
Disclosed herein, in some embodiments, are methods of characterizing a disease or condition, or a subtype of a disease or condition. In some embodiments, the disease or condition comprises a disease or condition of gastrointestinal tissue. In some cases, the disease or condition comprises an inflammatory disease, fibrostenotic disease, and/or fibrotic disease. Non-limiting examples of inflammatory diseases include diseases of the GI tract, liver, gallbladder, and joints. In some cases, the inflammatory disease IBD, CD, UC, systemic lupus erythematosus (SLE), or rheumatoid arthritis. In some embodiments, the disease or condition comprises fibrosis, fibrostenosis, or a fibrotic disease, either isolated or in combination with an inflammatory disease. An exemplary fibrotic disease is primary sclerosing cholangitis (PSC). In some cases, the fibrosis comprises pulomonary fibrosis. Non-limiting examples of subtypes of IBD include, stricturing disease, penetrating disease, stricturing and penetrating disease, obstructive disease, refractory disease, or another complicated or severe form of IBD.
Disclosed herein, in some embodiments, are methods of characterizing a disease a disease or condition, or a subtype of a disease or condition comprising: (a) obtaining a sample from a subject; (b) subjecting the sample to an assay configured to detect a presence, absence, or level, of RNASET2 risk genotype; (c) characterizing the disease or condition as being severe, complicated, and/or refractory disease, provided the presence, absence, or level of RNASET2 risk genotype is detected in the sample obtained from the subject. In some embodiments, the subject is identified as having a high likelihood of recurrence of the disease or condition, provided the RNASET2 risk genotype is detected in (b). In some embodiments, the is detected using one or more methods of detection, kits and/or compositions disclosed herein. In some embodiments, the subject is treated by administering a therapeutically effective amount of a therapeutic agent and/or additional agent disclosed herein to the subject, provided the subject is disease or condition is characterized as severe, complicated, and/or refractory disease. In some embodiments, the RNASET2 risk genotype comprises Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the RNASET2 risk genotype comprises Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in linkage disequilibrium (LD) therewith, or any combination thereof.
Disclosed herein, in some embodiments, are methods of treating a disease or condition, or a symptom of the disease or condition, in a subject, comprising administrating of therapeutic effective amount of one or more therapeutic agents to the subject. In some embodiments, the one or more therapeutic agents is administered to the subject alone (e.g., standalone therapy). In some embodiments, the one or more therapeutic agents is administered in combination with an additional agent. In some embodiments, the therapeutic agent is a first-line therapy for the disease or condition. In some embodiments, the therapeutic agent is a second-line, third-line, or fourth-line therapy, for the disease or condition.
Disclosed herein, in some aspects, are methods of treating or preventing a disease or a condition comprising administering a therapeutic agent to the subject. In some embodiments, the subject is identified as having a high likelihood of reoccurance of the disease or condition following surgical treatment of the disease or disorder based at least partially on a prescence of a genotype being detected in a sample obtained in the subject. In some embodiments, the genotype detects is an RNASET2 risk genotype. In some embodiments, the is detected using one or more methods of detection, kits and/or compositions disclosed herein. In some embodiments, the subject is treated by administering a therapeutically effective amount of a therapeutic agent and/or additional agent disclosed herein to the subject, provided the subject is disease or condition is characterized as severe, complicated, and/or refractory disease. In some embodiments, the RNASET2 risk genotype comprises Indel 1, SNP 1, SNP 2, SNP 3, and SNP 4. In some embodiments, the RNASET2 risk genotype comprises Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, SNP5, SNP6, SNP7, SNP8, SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, or a SNP in linkage disequilibrium (LD) therewith, or any combination thereof. In some embodiments, the sample is a gastrointestinal tissue. In some embodiments, the sample is blood. In some embodiments, the sample is plasma. In some embodiments, the sample is serum.
In one aspect, provided herein, provided herein is a method of treating or preventing a disease or condition of gastrointestinal tissue in a subject comprising administering a therapeutic agent to the subject, provided the subject is identified as having a high likelihood of the disease or condition based at least partially on a presence of a genotype being detected in a sample obtained from the subject, wherein the genotype comprises (i) an indel at Indel 1, (ii) a first single nucleotide polymorphism (SNP) at SNP 1 or a SNP in linkage disequilibrium (LD) therewith, (iii) a second SNP at SNP 2 or a SNP in LD therewith, or (iv) a combination thereof.
In another aspect, provided herein is a method of predicting a response to a therapeutic agent in a subject having a disease or condition of gastrointestinal tissue: (a) providing a sample obtained from a subject having a disease or condition of a gastrointestinal tissue; (b) detecting a presence or an absence of a genotype in the sample comprising (i) an indel at Indel 1, (ii) a first single nucleotide polymorphism (SNP) at SNP 1 or a SNP in linkage disequilibrium (LD) therewith, (iii) a second SNP at SNP 2 or a SNP in LD therewith, or (iv) a combination thereof; and (c) (i) if the presence of the genotype is detected in (b), then identifying the subject as having a high likelihood of responding to the therapeutic agent; or (ii) if the absence of the genotype is detected in (b), then identifying the subject as not having the high likelihood of responding to the therapeutic agent, wherein the high likelihood is compared with a likelihood of an individual that does not have the genotype. In one embodiment, the genotype comprises or consists of an indel at Indel 1. In some embodiments, the genotype comprises or consists of SNP 1 (or a SNP in LD with SNP 1). In certain embodiments, the genotype comprises or consists of SNP 2 (or a SNP in LD with SNP 2). In one embodiment, the genotype comprises or consists of an indel at Indel 1 and SNP 1 (or a SNP in LD with SNP 1). In some embodiments, the genotype comprises or consists of an indel at Indel 1 and SNP 2 (or a SNP in LD with SNP 2). In further embodiments, the genotype comprises or consists of SNP 1 (or a SNP in LD with SNP 1) and SNP 2 (or a SNP in LD with SNP 2). In yet other embodiments, the genotype comprises or consists of an indel at Indel 1, SNP 1 (or a SNP in LD with SNP 1), and SNP 2 (or a SNP in LD with SNP 2). In some embodiments, the genotype comprises or consists of any one of an indel at Indel 1, SNP 1 (or a SNP in LD with SNP 1), and SNP 2 (or a SNP in LD with SNP 2). In some embodiments, the genotype comprises or consists of any two of an indel at Indel 1, SNP 1 (or a SNP in LD with SNP 1), and SNP 2 (or a SNP in LD with SNP 2), in any combination or permutation. In certain embodiments, the SNP in LD with SNP 2 comprises rs62436421. In one embodiment, the SNP in LD with SNP 1 comprises SNP4. In some embodiments, multiple samples are obtained. In some embodiments, at least 1, 2, 3, 4, or 5 samples are taken following surgery. In some embodiments, a sample is obtained immediately following surgery. In some embodiments, sample is obtained at different time intervals following surgery. In some embodiments, a sample is obtained at least 1, 2, 3, 4, 5, 6, or 7 days. In some embodiments, samples are obtained at least 1, 2, 3, 4, or 5 weeks following surgery. In some embodiments, the sample is a gastrointestinal tissue. In some embodiments, the sample is blood. In some embodiments, the sample is plasma. In some embodiments, the sample is serum.
In some embodiments, the surgery comprises a surgery to treat a gastrointestinal disorder. Non-limiting surgeries include an intestinal resection, colectomy, perianal surgery, and stricturoplasty. In some embodiments, at least a portion of the gastrointestinal tissue was removed to treat the disease or condition. The portion of the gastrointestinal tract may be selected from the anus, the colon, the large intestine, the small intestine, the stomach, and the esophagus. The portion of the small intestine may be selected from the duodenum, the jejunum, and the ileum.
In one embodiment, the methods provided herein further comprise preparing the sample for genotype detection. In some embodiments, the methods of preparing the sample for genotype detection comprise processing PMBC from patient's blood sample. In some further embodiments, the methods of preparing the sample for genotype detection comprise isolating DNA from PMBC from patient's blood sample.
In another embodiment, the methods provided herein further comprise administering to the subject a therapeutically effective amount of the therapeutic agent, provided the presence of the genotype is detected. In a further embodiment, the methods provided herein further comprise administering to the subject a therapeutically effective amount of the therapeutic agent, provided the presence of the genotype is detected in (b) of the preceding paragraphs. In some embodiments, the administration can be any embodiments of administering therapeutic agent described further below in the Section entitled “Dose and Route of Administration.”
In certain embodiments, the SNP in LD with SNP 2 comprises rs62436421. In one embodiment, the SNP in LD with SNP 1 comprises SNP4. In another embodiment, the SNP 1 comprises SNP 1T. In yet another embodiment, the SNP 2 comprises SNP 2T. In a further embodiment, Indel 1 comprises Indel 1I. In one embodiment, SNP 4 comprises SNP 4C.
In yet another embodiment, the SNP 1 comprises SNP 1T and the SNP 2 comprises SNP 2T. In a further embodiment, the SNP 1 comprises SNP 1T and Indel 1 comprises Indel 1I. In one embodiment, the SNP 1 comprises SNP 1T and SNP 4 comprises SNP 4C. In a further embodiment, the SNP 2 comprises SNP 2T and Indel 1 comprises Indel 1I. In one embodiment, the SNP 2 comprises SNP 2T and SNP 4 comprises SNP 4C. In one embodiment, Indel 1 comprises Indel 1I and SNP 4 comprises SNP 4C.
In one embodiment, the SNP 1 comprises SNP 1T, the SNP 2 comprises SNP 2T, and Indel 1 comprises Indel 1I. In one embodiment, the SNP 1 comprises SNP 1T, the SNP 2 comprises SNP 2T, and SNP 4 comprises SNP 4C. In a further embodiment, the SNP 1 comprises SNP 1T, Indel 1 comprises Indel 1I, and SNP 4 comprises SNP 4C. In a further embodiment, the SNP 2 comprises SNP 2T, Indel 1 comprises Indel 1I, and SNP 4 comprises SNP 4C.
In yet another embodiment, the SNP 1 comprises SNP 1T, the SNP 2 comprises SNP 2T, Indel 1 comprises Indel 1I, and SNP 4 comprises SNP 4C.
In some embodiments of the various methods provided herein, the disease or condition is mediated by a decreased protein level of RNASET2 in the subject compared to a subject without the genotype. In other embodiments, the disease or condition is mediated by an increased protein level of TL1A in the subject compared to a subject without the genotype.
Disclosed herein, in some embodiments, are therapeutic agents useful for the treatment of a disease or condition, or symptom of the disease or condition, disclosed herein. In some embodiments, the therapeutic agent comprises a modulator, agonist, or partial agonist of Ribonuclease T2 (RNASET2). In some embodiments, the therapeutic agent comprises an agonist of RNASET2. In some embodiments, the therapeutic agent comprises a modulator and/or antagonist of TNF Superfamily Member 15 (TL1A), or the gene encoding TL1A (TNFSF15). In some embodiments, the therapeutic agent comprises a modulator of TL1A. In some embodiments, the therapeutic agent comprises a modulator, agonist, and/or antagonist of Adenylate Cyclase 7 (ADCY7). In some embodiments, the therapeutic agent comprises a modulator of ADCY7. In some embodiments, the therapeutic agent comprises a therapeutic agent having RNASET2 activity.
In some embodiments for the various methods provided herein, the therapeutic agents having RNASET2 activity comprise the RNASET2 protein. In certain embodiments, the therapeutic agents having RNASET2 activity comprise a functional fragment of the RNASET2 protein. In other embodiments, the RNASET2 protein or functional fragment thereof can be any RNASET2 protein or functional fragment thereof as provided in the various embodiments in the disclosure. In other embodiments, the therapeutic agents having RNASET2 activity comprise molecules upstream or downstream of RNASET2 in the signaling cascade by which the RNASET2 protein attenuates, inhibits, reduces, or prevents the pathogenesis of IBD. In some additional embodiments, the therapeutic agents having RNASET2 activity comprise molecules upstream or downstream of RNASET2 in the signaling cascade by which the RNASET2 protein attenuates, inhibits, reduces, or prevents the TL1A mediated secretion of IFN-γ in T cells (e.g. used as a proxy for the pathogenesis of IBD). In some specific embodiments, the therapeutic agents having RNASET2 activity comprise an antagonist for LFA-1, including LFA-1 blocking antibodies known and used in the field. In other specific embodiments, the therapeutic agents having RNASET2 activity comprise molecules that block the downstream signaling from activated LFA-1. In additional specific embodiments, the therapeutic agents having RNASET2 activity comprise an antagonist of ICAM-1 or other molecules, including ICAM-1 blocking antibodies known and used in the field that block the ICAM-1-LFA-1 interaction. In further specific embodiments, the therapeutic agents having RNASET2 activity comprise the molecules that that can decrease the expression or stability of ICAM-1 molecules.
In some embodiments, the therapeutic agent comprises a modulator, agonist, or partial agonist of Ribonuclease T2 (RNASET2). In some embodiments, the agonist of RNASET2 comprises an RNASET2 polypeptide. In some embodiments, the RNASET2 polypeptide comprises a human RNASET2 protein (huRNASET2). In some embodiments, the RNASET2 polypeptide comprises a recombinant RNASET2 polypeptide. In some embodiments, the recombinant huRNASET2 protein comprises SEQ ID NO: 11, which is the amino acid sequence of human RNASET2 (NCBI Reference Sequence No. NP_003721.2). In some embodiments, the huRNASET2 comprises an amino acid sequence about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% homologous to SEQ ID NO: 11 or a functional fragment thereof. In further embodiments, the RNASET2 protein comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:11 or a functional fragment of the amino acid sequence. In certain embodiments, the RNASET2 protein comprises an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical or homologou to SEQ ID NO:11, wherein the difference in sequences lies in the regions of RNASET2 outside the functional domain of RNASET2 required to reduce the TL1A mediated secretion of IFN-γ in T cells. In some additional embodiments, the therapeutic agents having RNASET2 activity comprise a functional fragment of the RNASET2 protein described in this paragraph, including the preceding sentence. In some embodiments, the functional activity for the RNASET2 protain and the functional fragment thereof can be determined by the assays described in Examples 18 and 21.
In some instances, the RNASET2 polypeptide is truncated. In some instances, the truncation is an N-terminal deletion. In other instances, the truncation is a C-terminal deletion. In additional instances, the truncation comprises both N-terminal and C-terminal deletions. For example, the truncation can be a deletion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or more residues from either the N-terminus or the C-terminus, or both termini. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or more residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 2 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 3 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 4 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 5 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 6 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 7 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 8 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 9 residues. In some cases, the RNASET2 polypeptide comprises an N-terminal deletion of at least or about 10 residues. In some embodiments, the truncated RNASET2 has reduced or ameliorated ribonucleolytic activity. Non-limiting examples of truncated RNASET2 polypeptides include hrtrRNASE-70 (SEQ ID NO: 13), and hrtrRNASE-50 (SEQ ID NO: 12). In some instances, the truncated RNASET2 has functionally active ribonucleolytic activity. In some instances, the RNASET2 polypeptide has an internal deletion or substitution.
In some embodiments, the RNASET2 polypeptide has an enhanced plasma half-life. In some instances, the plasma half-life comprises at least 30 minutes, 45 minutes, 60 minutes, 75 minutes, or 90 minutes, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 14 days, 21 days, 28 days, 30 days, or longer than the plasma half-life of the wild-type RNASET2 protein.
In some embodiments, the RNASET2 polypeptide is a conjugate. In some embodiments, the RNASET2 conjugate comprises an RNASET2 polypeptide comprising at least one amino acid and a conjugating moiety bound to the at least one 1 amino acid. In some embodiments, the at least one amino acid is located proximal to the N-terminus (e.g., proximal to the N-terminal residue). For example, the at least one amino acid is located optionally within the first 10, 20, 30, 40, or 50 residues from the N-terminus. In some cases, the at least one amino acid is located at the N-terminus (i.e., the at least one amino acid is the N-terminal residue of the RNASET2 polypeptide). In other embodiments, the at least one amino acid is located proximal to the C-terminus (e.g., proximal to the C-terminal residue). For example, the at least one amino acid is located optionally within the first 10, 20, 30, 40, or 50 residues from the C-terminus. In some cases, the at least one amino acid is located at the C-terminus (i.e., the at least one amino acid is the C-terminal residue of the RNASET2 polypeptide). In some instances, the RNASET2 conjugate has an enhanced plasma half-life, such as the half-lifes described herein. In some embodiments, the RNASET2 conjugate is functionally active (e.g., retains ribonucleolytic activity). In some embodiments, the RNASET2 conjugate is not functionally active (e.g., devoid of ribonucleolytic activity). In some embodiments, the conjugating moiety comprises a polymer comprising Polyethylene glycol (PEG).
In some embodiments, the RNASET2 polypeptide is fused with a second polypeptide. In some embodiments, the second polypeptide comprises a polypeptide with a long plasma half-life relative to the plasma half-life of the RNASET2 polypeptide. In some embodiments, the second polypeptide comprises an antibody or antibody fragment. In some embodiments, the antibody or antibody fragment comprises an IgG1, IgG2, IgG4, IgG3, or IgE. In some embodiments, the IgG is an Fc. In some embodiments, the IgG Fc is human. In some instances, the long plasma half-life polypeptide comprises HSA, transferrin, IgA monomer, Retinol-binding protein, Factor H, Factor XIII, C-reactive protein, Factor IX, Fibrinogen, IFN-alpha, Pentameric IgM, IL-2, or Thyroglobulin. In some instances, the RNASET2-Fc comprises RSLV-132.
In some embodiments, the therapeutic agent comprises a modulator and/or antagonist of TNF Superfamily Member 15 (TL1A), or the gene encoding TL1A (TNFSF15). In some embodiments, the modulator of TL1A is an antagonist of TL1A. In some embodiments the therapeutic agent or the additional therapeutic agent comprises an inhibitor of TL1A expression or activity. In some embodiments the therapeutic agent comprises an inhibitor of TL1A expression or activity. In some cases, the inhibitor of TL1A expression or activity is effective to inhibit TL1A-DR3 binding. In some embodiments, the inhibitor of TL1A expression or activity comprises an allosteric modulator of TL1A. An allosteric modulator of TL1A may indirectly influence the effects TL1A on DR3, or TR6/DcR3 on TL1A or DR3. The inhibitor of TL1A expression or activity may be a direct inhibitor or indirect inhibitor. Non-limiting examples of an inhibitor of TL1A expression include RNA to protein TL1A translation inhibitors, antisense oligonucleotides targeting the TNFSF15 mRNA (such as miRNAs, or siRNA), epigenetic editing (such as targeting the DNA-binding domain of TNFSF15, or post-translational modifications of histone tails and/or DNA molecules). Non-limiting examples of an inhibitor of TL1A activity include antagonists to the TL1A receptors, (DR3 and TR6/DcR3), antagonists to TL1A antigen, and antagonists to gene expression products involved in TL1A mediated disease. Antagonists as disclosed herein, may include, but are not limited to, an anti-TL1A antibody, an anti-TL1A-binding antibody fragment, or a small molecule. The small molecule may be a small molecule that binds to TL1A or DR3. The anti-TL1A antibody may be monoclonal or polyclonal. The anti-TL1A antibody may be humanized or chimeric. The anti-TL1A antibody may be a fusion protein. The anti-TL1A antibody may be a blocking anti-TL1A antibody. A blocking antibody blocks binding between two proteins, e.g., a ligand and its receptor. Therefore, a TL1A blocking antibody includes an antibody that prevents binding of TL1A to DR3 or TR6/DcR3 receptors. In a non-limiting example, the TL1A blocking antibody binds to DR3. In another example, the TL1A blocking antibody binds to DcR3. In some cases, the anti-TL1A antibody is an anti-TL1A antibody that specifically binds to TL1A.
The anti-TL1A antibody may comprise one or more of the antibody sequences of Table 1. The anti-DR3 antibody may comprise an amino acid sequence that is at least 85% identical to any one of SEQ ID NOS: 358-370 and an amino acid sequence that is at least 85% identical to any one of SEQ ID NOS: 371-375. The anti-DR3 antibody may comprise an amino acid sequence comprising the HCDR1, HCDR2, HCDR3 domains of any one of SEQ ID NOS: 358-370 and the LCDR1, LCDR2, and LCDR3 domains of any one of SEQ ID NOS: 371-375.
In some embodiments, an anti-TL1A antibody comprises a heavy chain comprising three complementarity-determining regions: HCDR1, HCDR2, and HCDR3; and a light chain comprising three complementarity-determining regions: LCDR1, LCDR2, and LCDR3. In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 209, a HCDR2 comprising SEQ ID NO: 210, a HCDR3 comprising SEQ ID NO: 211, a LCDR1 comprising SEQ ID NO: 212, a LCDR2 comprising SEQ ID NO: 213, and a LCDR3 comprising SEQ ID NO: 214. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 215 and a light chain (LC) variable domain comprising SEQ ID NO: 216.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 217, a HCDR2 comprising SEQ ID NO: 218, a HCDR3 comprising SEQ ID NO: 219, a LCDR1 comprising SEQ ID NO: 220, a LCDR2 comprising SEQ ID NO: 221, and a LCDR3 comprising SEQ ID NO: 222. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 223 and a light chain (LC) variable domain comprising SEQ ID NO: 224.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 225, a HCDR2 comprising SEQ ID NO: 226, a HCDR3 comprising SEQ ID NO: 227, a LCDR1 comprising SEQ ID NO: 228, a LCDR2 comprising SEQ ID NO: 229, and a LCDR3 comprising SEQ ID NO: 230. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 231 and a light chain (LC) variable domain comprising SEQ ID NO: 232.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 233, a HCDR2 comprising SEQ ID NO: 234, a HCDR3 comprising SEQ ID NO: 235, a LCDR1 comprising SEQ ID NO: 239, a LCDR2 comprising SEQ ID NO: 240, and a LCDR3 comprising SEQ ID NO: 241. In some cases, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 236, a HCDR2 comprising SEQ ID NO: 237, a HCDR3 comprising SEQ ID NO: 238, a LCDR1 comprising SEQ ID NO: 239, a LCDR2 comprising SEQ ID NO: 240, and a LCDR3 comprising SEQ ID NO: 241. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 242 and a light chain (LC) variable domain comprising SEQ ID NO: 243. In some cases, the anti-TL1A antibody comprises a heavy chain comprising SEQ ID NO: 244. In some cases, the anti-TL1A antibody comprises a light chain comprising SEQ ID NO: 245.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 246, a HCDR2 comprising SEQ ID NO: 247, a HCDR3 comprising SEQ ID NO: 248, a LCDR1 comprising SEQ ID NO: 249, a LCDR2 comprising SEQ ID NO: 250, and a LCDR3 comprising SEQ ID NO: 251. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 252 and a light chain (LC) variable domain comprising SEQ ID NO: 253.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 254, a HCDR2 comprising SEQ ID NO: 255, a HCDR3 comprising SEQ ID NO: 256, a LCDR1 comprising SEQ ID NO: 257, a LCDR2 comprising SEQ ID NO: 258, and a LCDR3 comprising SEQ ID NO: 259. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 260 and a light chain (LC) variable domain comprising SEQ ID NO: 261.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 262, a HCDR2 comprising SEQ ID NO: 264, a HCDR3 comprising SEQ ID NO: 265, a LCDR1 comprising SEQ ID NO: 267, a LCDR2 comprising SEQ ID NO: 269, and a LCDR3 comprising SEQ ID NO: 270. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 275. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 276. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 277. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 278.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 262, a HCDR2 comprising SEQ ID NO: 264, a HCDR3 comprising SEQ ID NO: 265, a LCDR1 comprising SEQ ID NO: 268, a LCDR2 comprising SEQ ID NO: 269, and a LCDR3 comprising SEQ ID NO: 270. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 279. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 280. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 281. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 271 and a light chain (LC) variable domain comprising SEQ ID NO: 282.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 262, a HCDR2 comprising SEQ ID NO: 264, a HCDR3 comprising SEQ ID NO: 265, a LCDR1 comprising SEQ ID NO: 267, a LCDR2 comprising SEQ ID NO: 269, and a LCDR3 comprising SEQ ID NO: 270. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 275. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 276. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 277. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 278.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 262, a HCDR2 comprising SEQ ID NO: 264, a HCDR3 comprising SEQ ID NO: 265, a LCDR1 comprising SEQ ID NO: 268, a LCDR2 comprising SEQ ID NO: 269, and a LCDR3 comprising SEQ ID NO: 270. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 279. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 280. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 281. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 272 and a light chain (LC) variable domain comprising SEQ ID NO: 282.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 263, a HCDR2 comprising SEQ ID NO: 264, a HCDR3 comprising SEQ ID NO: 266, a LCDR1 comprising SEQ ID NO: 267, a LCDR2 comprising SEQ ID NO: 269, and a LCDR3 comprising SEQ ID NO: 270. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 275. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 276. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 277. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 278. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 279. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 280. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 281. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 273 and a light chain (LC) variable domain comprising SEQ ID NO: 282.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 263, a HCDR2 comprising SEQ ID NO: 264, a HCDR3 comprising SEQ ID NO: 266, a LCDR1 comprising SEQ ID NO: 268, a LCDR2 comprising SEQ ID NO: 269, and a LCDR3 comprising SEQ ID NO: 270. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 279. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 280. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 281. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 282. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 275. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 276. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 277. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 274 and a light chain (LC) variable domain comprising SEQ ID NO: 278.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 283, a HCDR2 comprising SEQ ID NO: 284, a HCDR3 comprising SEQ ID NO: 285, a LCDR1 comprising SEQ ID NO: 286, a LCDR2 comprising SEQ ID NO: 287, and a LCDR3 comprising SEQ ID NO: 288. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 289 and a light chain (LC) variable domain comprising SEQ ID NO: 294. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 289 and a light chain (LC) variable domain comprising SEQ ID NO: 295. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 289 and a light chain (LC) variable domain comprising SEQ ID NO: 296. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 289 and a light chain (LC) variable domain comprising SEQ ID NO: 297. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 290 and a light chain (LC) variable domain comprising SEQ ID NO: 294. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 290 and a light chain (LC) variable domain comprising SEQ ID NO: 295. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 290 and a light chain (LC) variable domain comprising SEQ ID NO: 296. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 290 and a light chain (LC) variable domain comprising SEQ ID NO: 297. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 291 and a light chain (LC) variable domain comprising SEQ ID NO: 294. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 291 and a light chain (LC) variable domain comprising SEQ ID NO: 295. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 291 and a light chain (LC) variable domain comprising SEQ ID NO: 296. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 291 and a light chain (LC) variable domain comprising SEQ ID NO: 297. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 292 and a light chain (LC) variable domain comprising SEQ ID NO: 294. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 292 and a light chain (LC) variable domain comprising SEQ ID NO: 295. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 292 and a light chain (LC) variable domain comprising SEQ ID NO: 296. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 292 and a light chain (LC) variable domain comprising SEQ ID NO: 297. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 293 and a light chain (LC) variable domain comprising SEQ ID NO: 294. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 293 and a light chain (LC) variable domain comprising SEQ ID NO: 295. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 293 and a light chain (LC) variable domain comprising SEQ ID NO: 296. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 293 and a light chain (LC) variable domain comprising SEQ ID NO: 297.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 298, a HCDR2 comprising SEQ ID NO: 299, a HCDR3 comprising SEQ ID NO: 300, a LCDR1 comprising SEQ ID NO: 301, a LCDR2 comprising SEQ ID NO: 302, and a LCDR3 comprising SEQ ID NO: 303. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 304 and a light chain (LC) variable domain comprising SEQ ID NO: 305. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 306 and a light chain (LC) variable domain comprising SEQ ID NO: 307. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 308 and a light chain (LC) variable domain comprising SEQ ID NO: 309. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 310 and a light chain (LC) variable domain comprising SEQ ID NO: 311. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 312 and a light chain (LC) variable domain comprising SEQ ID NO: 313. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 314 and a light chain (LC) variable domain comprising SEQ ID NO: 315. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 316 and a light chain (LC) variable domain comprising SEQ ID NO: 317. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 318 and a light chain (LC) variable domain comprising SEQ ID NO: 319. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 320 and a light chain (LC) variable domain comprising SEQ ID NO: 321. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 322 and a light chain (LC) variable domain comprising SEQ ID NO: 323. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 324 and a light chain (LC) variable domain comprising SEQ ID NO: 325. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 326 and a light chain (LC) variable domain comprising SEQ ID NO: 327.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 328, a HCDR2 comprising SEQ ID NO: 329, a HCDR3 comprising SEQ ID NO: 330, a LCDR1 comprising SEQ ID NO: 331, a LCDR2 comprising SEQ ID NO: 332, and a LCDR3 comprising SEQ ID NO: 333. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 334 and a light chain (LC) variable domain comprising SEQ ID NO: 335.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 336, a HCDR2 comprising SEQ ID NO: 337, a HCDR3 comprising SEQ ID NO: 338, a LCDR1 comprising SEQ ID NO: 339, a LCDR2 comprising SEQ ID NO: 340, and a LCDR3 comprising SEQ ID NO: 341. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 342 and a light chain (LC) variable domain comprising SEQ ID NO: 343.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 346, a HCDR2 comprising SEQ ID NO: 347, a HCDR3 comprising SEQ ID NO: 348, a LCDR1 comprising SEQ ID NO: 349, a LCDR2 comprising SEQ ID NO: 350, and a LCDR3 comprising SEQ ID NO: 351. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 344 and a light chain (LC) variable domain comprising SEQ ID NO: 345. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 352 and a light chain (LC) variable domain comprising SEQ ID NO: 353. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 354 and a light chain (LC) variable domain comprising SEQ ID NO: 355. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 356 and a light chain (LC) variable domain comprising SEQ ID NO: 357.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 376, a HCDR2 comprising SEQ ID NO: 377, a HCDR3 comprising SEQ ID NO: 378, a LCDR1 comprising SEQ ID NO: 379, a LCDR2 comprising SEQ ID NO: 380, and a LCDR3 comprising SEQ ID NO: 381. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 382 and a light chain (LC) variable domain comprising SEQ ID NO: 383.
In some embodiments, the anti-TL1A antibody comprises a HCDR1 comprising SEQ ID NO: 384, a HCDR2 comprising SEQ ID NO: 385, a HCDR3 comprising SEQ ID NO: 386, a LCDR1 comprising SEQ ID NO: 387, a LCDR2 comprising SEQ ID NO: 388, and a LCDR3 comprising SEQ ID NO: 399. In some cases, the anti-TL1A antibody comprises a heavy chain (HC) variable domain comprising SEQ ID NO: 390 and a light chain (LC) variable domain comprising SEQ ID NO: 391.
In some embodiments, the anti-TL1A antibody comprises one or more of A101-A177 of Table 1. In some embodiments, the anti-TL1A antibody is A100. In some embodiments, the anti-TL1A antibody is A101. In some embodiments, the anti-TL1A antibody is A102. In some embodiments, the anti-TL1A antibody is A103. In some embodiments, the anti-TL1A antibody is A104. In some embodiments, the anti-TL1A antibody is A105. In some embodiments, the anti-TL1A antibody is A106. In some embodiments, the anti-TL1A antibody is A107. In some embodiments, the anti-TL1A antibody is A108. In some embodiments, the anti-TL1A antibody is A109. In some embodiments, the anti-TL1A antibody is A110. In some embodiments, the anti-TL1A antibody is A111. In some embodiments, the anti-TL1A antibody is A112. In some embodiments, the anti-TL1A antibody is A113. In some embodiments, the anti-TL1A antibody is A114. In some embodiments, the anti-TL1A antibody is A115. In some embodiments, the anti-TL1A antibody is A116. In some embodiments, the anti-TL1A antibody is A117. In some embodiments, the anti-TL1A antibody is A118. In some embodiments, the anti-TL1A antibody is A119. In some embodiments, the anti-TL1A antibody is A120. In some embodiments, the anti-TL1A antibody is A121. In some embodiments, the anti-TL1A antibody is A122. In some embodiments, the anti-TL1A antibody is A123. In some embodiments, the anti-TL1A antibody is A124. In some embodiments, the anti-TL1A antibody is A125. In some embodiments, the anti-TL1A antibody is A126. In some embodiments, the anti-TL1A antibody is A127. In some embodiments, the anti-TL1A antibody is A128. In some embodiments, the anti-TL1A antibody is A129. In some embodiments, the anti-TL1A antibody is A130. In some embodiments, the anti-TL1A antibody is A131. In some embodiments, the anti-TL1A antibody is A132. In some embodiments, the anti-TL1A antibody is A133. In some embodiments, the anti-TL1A antibody is A134. In some embodiments, the anti-TL1A antibody is A135. In some embodiments, the anti-TL1A antibody is A136. In some embodiments, the anti-TL1A antibody is A137. In some embodiments, the anti-TL1A antibody is A138. In some embodiments, the anti-TL1A antibody is A139. In some embodiments, the anti-TL1A antibody is A140. In some embodiments, the anti-TL1A antibody is A141. In some embodiments, the anti-TL1A antibody is A142. In some embodiments, the anti-TL1A antibody is A143. In some embodiments, the anti-TL1A antibody is A144. In some embodiments, the anti-TL1A antibody is A145. In some embodiments, the anti-TL1A antibody is A146. In some embodiments, the anti-TL1A antibody is A147. In some embodiments, the anti-TL1A antibody is A148. In some embodiments, the anti-TL1A antibody is A149. In some embodiments, the anti-TL1A antibody is A150. In some embodiments, the anti-TL1A antibody is A151. In some embodiments, the anti-TL1A antibody is A152. In some embodiments, the anti-TL1A antibody is A153. In some embodiments, the anti-TL1A antibody is A154. In some embodiments, the anti-TL1A antibody is A155. In some embodiments, the anti-TL1A antibody is A156. In some embodiments, the anti-TL1A antibody is A157. In some embodiments, the anti-TL1A antibody is A158. In some embodiments, the anti-TL1A antibody is A159. In some embodiments, the anti-TL1A antibody is A160. In some embodiments, the anti-TL1A antibody is A161. In some embodiments, the anti-TL1A antibody is A162. In some embodiments, the anti-TL1A antibody is A163. In some embodiments, the anti-TL1A antibody is A164. In some embodiments, the anti-TL1A antibody is A165. In some embodiments, the anti-TL1A antibody is A166. In some embodiments, the anti-TL1A antibody is A167. In some embodiments, the anti-TL1A antibody is A168. In some embodiments, the anti-TL1A antibody is A169. In some embodiments, the anti-TL1A antibody is A170. In some embodiments, the anti-TL1A antibody is A171. In some embodiments, the anti-TL1A antibody is A172. In some embodiments, the anti-TL1A antibody is A173. In some embodiments, the anti-TL1A antibody is A174. In some embodiments, the anti-TL1A antibody is A175. In some embodiments, the anti-TL1A antibody is A176. In some embodiments, the anti-TL1A antibody is A177.
In some embodiments, the anti-DR3 is A178. In some embodiments, the anti-DR3 is A179. In some embodiments, the anti-DR3 is A180. In some embodiments, the anti-DR3 is A181. In some embodiments, the anti-DR3 is A182. In some embodiments, the anti-DR3 is A183. In some embodiments, the anti-DR3 is A184. In some embodiments, the anti-DR3 is A185. In some embodiments, the anti-DR3 is A186. In some embodiments, the anti-DR3 is A187. In some embodiments, the anti-DR3 is A188. In some embodiments, the anti-DR3 is A189. In some embodiments, the anti-DR3 is A190. In some embodiments, the anti-DR3 is A191. In some embodiments, the anti-DR3 is A192. In some embodiments, the anti-DR3 is A193. In some embodiments, the anti-DR3 is A194. In some embodiments, the anti-DR3 is A195. In some embodiments, the anti-DR3 is A196. In some embodiments, the anti-DR3 is A197. In some embodiments, the anti-DR3 is A198. In some embodiments, the anti-DR3 is A199. In some embodiments, the anti-DR3 is A200. In some embodiments, the anti-DR3 is A201. In some embodiments, the anti-DR3 is A202. In some embodiments, the anti-DR3 is A203. In some embodiments, the anti-DR3 is A204. In some embodiments, the anti-DR3 is A205. In some embodiments, the anti-DR3 is A206. In some embodiments, the anti-DR3 is A207. In some embodiments, the anti-DR3 is A208. In some embodiments, the anti-DR3 is A209. In some embodiments, the anti-DR3 is A210. In some embodiments, the anti-DR3 is A211. In some embodiments, the anti-DR3 is A212. In some embodiments, the anti-DR3 is A213. In some embodiments, the anti-DR3 is A214. In some embodiments, the anti-DR3 is A215. In some embodiments, the anti-DR3 is A216. In some embodiments, the anti-DR3 is A217. In some embodiments, the anti-DR3 is A218. In some embodiments, the anti-DR3 is A219. In some embodiments, the anti-DR3 is A220. In some embodiments, the anti-DR3 is A221. In some embodiments, the anti-DR3 is A222. In some embodiments, the anti-DR3 is A223. In some embodiments, the anti-DR3 is A224. In some embodiments, the anti-DR3 is A225. In some embodiments, the anti-DR3 is A226. In some embodiments, the anti-DR3 is A227. In some embodiments, the anti-DR3 is A228. In some embodiments, the anti-DR3 is A229. In some embodiments, the anti-DR3 is A230. In some embodiments, the anti-DR3 is A231. In some embodiments, the anti-DR3 is A232. In some embodiments, the anti-DR3 is A233. In some embodiments, the anti-DR3 is A234. In some embodiments, the anti-DR3 is A235. In some embodiments, the anti-DR3 is A236. In some embodiments, the anti-DR3 is A237. In some embodiments, the anti-DR3 is A238. In some embodiments, the anti-DR3 is A239. In some embodiments, the anti-DR3 is A240. In some embodiments, the anti-DR3 is A241. In some embodiments, the anti-DR3 is A242.
In some embodiments, the therapeutic agent comprises a modulator, agonist, and/or antagonist of Adenylate Cyclase 7 (ADCY7). Disclosed herein, in some embodiments are methods of treating a disease or condition in a subject by administering a therapeutically effective amount of an agonist of ADCY7 to the subject, thereby increasing ADCY7 expression or activity. The agonist of ADCY7 expression or activity may be a direct agonist or indirect agonist. In some embodiments, the agonist of ADCY7 expression or activity comprises a complete agonist or a partial agonist. Non-limiting examples of an agonist of ADCY7 expression include RNA to protein ADCY7 translation agonists, antisense oligonucleotides targeting the ADCY7C, or homolog thereof, mRNA (such as miRNAs, or siRNA), epigenetic editing (such as post-translational modifications of histone tails and/or DNA molecules). Non-limiting examples of an agonist of ADCY7 activity include antagonists to the ADCY7 antigen, and antagonists to gene expression products involved in ADCY7 mediated disease. Agonists as disclosed herein, may include, but are not limited to, an ADCY7 antibody, an ADCY7-binding antibody fragment, recombinant polypeptide, or a small molecule. The small molecule may be a small molecule that binds to ADCY7 or binding partners to ADCY7. The ADCY7 antibody may be monoclonal or polyclonal. The ADCY7 antibody may be humanized or chimeric. The ADCY7 antibody may be a fusion protein. The ADCY7 antibody may be a blocking ADCY7 antibody. A blocking antibody blocks binding between two proteins, e.g., a ligand and its receptor. In a non-limiting example, the ADCY7 blocking antibody binds to a binding partner of ADCY7. In some cases, the ADCY7 antibody is an ADCY7 antibody that specifically binds to ADCY7. In some cases, the ADCY7 is naturally occurring. In some embodiments, the ADCY7 agonists comprise one or more small molecule compounds that are pan-activators of adenylyl cyclases (ACs). Non-limiting examples of ADCY7 agonists that are pan-activators of ACs include forskolin, colforsin daropate, and analogs thereof.
Disclosed herein, in some embodiments are methods of treating a disease or condition in a subject by administering a therapeutically effective amount of an antagonist of ADCY7 to the subject, thereby decreasing ADCY7 expression or activity. The antagonist of ADCY7 expression or activity may be a direct antagonist or indirect antagonist. In some embodiments, the antagonist of ADCY& expression or activity comprises a complete antagonist or a partial antagonist. Non-limiting examples of an antagonist of ADCY7 expression include RNA to protein ADCY7 translation antagonists, antisense oligonucleotides targeting the ADCY7C, or homolog thereof, mRNA (such as miRNAs, or siRNA), epigenetic editing (such as post-translational modifications of histone tails and/or DNA molecules). Non-limiting examples of an antagonist of ADCY7 activity include antagonists to the ADCY7 antigen, and antagonists to gene expression products involved in ADCY7 mediated disease. Antagonists as disclosed herein, may include, but are not limited to, an ADCY7 antibody, an ADCY7-binding antibody fragment, recombinant polypeptide, or a small molecule. The small molecule may be a small molecule that binds to ADCY7 or binding partners to ADCY7. The ADCY7 antibody may be monoclonal or polyclonal. The ADCY7 antibody may be humanized or chimeric. The ADCY7 antibody may be a fusion protein. The ADCY7 antibody may be a blocking ADCY7 antibody. A blocking antibody blocks binding between two proteins, e.g., a ligand and its receptor. In a non-limiting example, the ADCY7 blocking antibody binds to a binding partner of ADCY7. In some cases, the ADCY7 antibody is an ADCY7 antibody that specifically binds to ADCY7. In some cases, the ADCY7 is naturally occurring. In some embodiments, the ADCY7 antagonists comprise one or more small molecule compounds. In some embodiments, the small molecule comprises antagonist that are inverse agonists.
Disclosed herein, in some embodiments are methods of treating a disease or condition in a subject by administering a therapeutically effective amount of an allosteric modulator of ADCY7 activity or expression to the subject, thereby decreasing or increasing ADCY7 expression or activity. In some embodiments, the allosteric modulator of ADCY7 is a positive allosteric modulator (PAM) effective to enhance or potentiate a ligand of ADCY7. In some embodiments, the allosteric modulator of ADCY7 is a negative allosteric modulator (NAM) effective to reduce the effect of a primary ligand of ADCY7. In some embodiments, the allosteric modulator binds to a non-orthosteric binding site of ADCY7. In some embodiments, the modulator of ADCY7 affects a conformation of the orthosteric binding site of ADCY7 effective decrease or increase activity of ADCY7. In some embodiments, the modulator of ADCY7 is effective to increase or decrease a rate of catalysis of cyclic adenosine monophosphate (cAMP) from adenosine triphosphate (ATP) by ADCY7. In some embodiments, the modulator of ADCY7 is effective to reduce or enhance the inhibition of ADCY7 activity by calcium. Non-limiting examples of ligands that activate ADCY7 include G protein alpha subunit, G protein beta and gamma subunit complex, G Protein Subunit Alpha 13 (GNA13), G Protein Subunit Alpha 12 (GNA12), and ethanol. A non-limiting example of a ligand that inhibits ADCY7 includes lithium.
In general, methods disclosed herein comprise administering a therapeutic agent by oral administration. However, in some instances, methods comprise administering a therapeutic agent by intraperitoneal injection. In some instances, methods comprise administering a therapeutic agent in the form of an anal suppository. In some instances, methods comprise administering a therapeutic agent by intravenous (“i.v.”) administration. It is conceivable that one may also administer therapeutic agents disclosed herein by other routes, such as subcutaneous injection, intramuscular injection, intradermal injection, trasndermal injection percutaneous administration, intranasal administration, intralymphatic injection, rectal administration intragastric administration, or any other suitable parenteral administration. In some embodiments, routes for local delivery closer to site of injury or inflammation are preferred over systemic routes. Routes, dosage, time points, and duration of administrating therapeutics may be adjusted. In some embodiments, administration of therapeutics is prior to, or after, onset of either, or both, acute and chronic symptoms of the disease or condition.
An effective dose and dosage of therapeutics to prevent or treat the disease or condition disclosed herein is defined by an observed beneficial response related to the disease or condition, or symptom of the disease or condition. Beneficial response comprises preventing, alleviating, arresting, or curing the disease or condition, or symptom of the disease or condition (e.g., reduced instances of diarrhea, rectal bleeding, weight loss, and size or number of intestinal lesions or strictures, reduced fibrosis or fibrogenesis, reduced fibrostenosis, reduced inflammation). In some embodiments, the beneficial response may be measured by detecting a measurable improvement in the presence, level, or activity, of biomarkers, transcriptomic risk profile, or intestinal microbiome in the subject. An “improvement,” as used herein refers to shift in the presence, level, or activity towards a presence, level, or activity, observed in normal individuals (e.g. individuals who do not suffer from the disease or condition). In instances wherein the therapeutic agent is not therapeutically effective or is not providing a sufficient alleviation of the disease or condition, or symptom of the disease or condition, then the dosage amount and/or route of administration may be changed, or an additional agent may be administered to the subject, along with the therapeutic agent. In some embodiments, as a patient is started on a regimen of a therapeutic agent, the patient is also weaned off (e.g., step-wise decrease in dose) a second treatment regimen.
Suitable dose and dosage administrated to a subject is determined by factors including, but no limited to, the particular therapeutic agent, disease condition and its severity, the identity (e.g., weight, sex, age) of the subject in need of treatment, and can be determined according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, the condition being treated, and the subject or host being treated. In general, however, doses employed for adult human treatment are typically in the range of 0.01 mg-5000 mg per day. In one aspect, doses employed for adult human treatment are from about 1 mg to about 1000 mg per day. In one embodiment, the desired dose is conveniently presented in a single dose or in divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day. Non-limiting examples of effective dosages of for oral delivery of a therapeutic agent include between about 0.1 mg/kg and about 100 mg/kg of body weight per day, and preferably between about 0.5 mg/kg and about 50 mg/kg of body weight per day. In other instances, the oral delivery dosage of effective amount is about 1 mg/kg and about 10 mg/kg of body weight per day of active material. Non-limiting examples of effective dosages for intravenous administration of the therapeutic agent include at a rate between about 0.01 to 100 pmol/kg body weight/min. In some embodiments, the daily dosage or the amount of active in the dosage form are lower or higher than the ranges indicated herein, based on a number of variables in regard to an individual treatment regime. In various embodiments, the daily and unit dosages are altered depending on a number of variables including, but not limited to, the activity of the therapeutic agent used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.
In some embodiments, the administration of the therapeutic agent is hourly, once every 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, or 5 years, or 10 years. The effective dosage ranges may be adjusted based on subject's response to the treatment. Some routes of administration will require higher concentrations of effective amount of therapeutics than other routes.
In certain embodiments wherein the patient's condition does not improve, upon the doctor's discretion the administration of therapeutic agent is administered chronically, that is, for an extended period of time, including throughout the duration of the patient's life in order to ameliorate or otherwise control or limit the symptoms of the patient's disease or condition. In certain embodiments wherein a patient's status does improve, the dose of therapeutic agent being administered may be temporarily reduced or temporarily suspended for a certain length of time (i.e., a “drug holiday”). In specific embodiments, the length of the drug holiday is between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days. The dose reduction during a drug holiday is, by way of example only, by 10%-100%, including by way of example only 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. In certain embodiments, the dose of drug being administered may be temporarily reduced or temporarily suspended for a certain length of time (i.e., a “drug diversion”). In specific embodiments, the length of the drug diversion is between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days. The dose reduction during a drug diversion is, by way of example only, by 10%-100%, including by way of example only 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%. After a suitable length of time, the normal dosing schedule is optionally reinstated.
In some embodiments, once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, in specific embodiments, the dosage or the frequency of administration, or both, is reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained. In certain embodiments, however, the patient requires intermittent treatment on a long-term basis upon any recurrence of symptoms.
Toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 and the ED50. The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. In certain embodiments, the data obtained from cell culture assays and animal studies are used in formulating the therapeutically effective daily dosage range and/or the therapeutically effective unit dosage amount for use in mammals, including humans. In some embodiments, the daily dosage amount of the therapeutic agent described herein lies within a range of circulating concentrations that include the ED50 with minimal toxicity. In certain embodiments, the daily dosage range and/or the unit dosage amount varies within this range depending upon the dosage form employed and the route of administration utilized.
A therapeutic agent may be used alone or in combination with an additional therapeutic agent. In some cases, an “additional therapeutic agent” as used herein is administered alone. In some embodiments, the “additional therapeutic agent” is one of the therapeutic agents described herein (e.g., anti-TL1A antibody, RNASET2 agonist). The therapeutic agents may be administered together or sequentially. The combination therapies may be administered within the same day, or may be administered one or more days, weeks, months, or years apart. In some cases, a therapeutic agent provided herein is administered if the subject is determined to be non-responsive to a first line of therapy, e.g., such as TNF inhibitor. Such determination may be made by treatment with the first line therapy and monitoring of disease state and/or diagnostic determination that the subject would be non-responsive to the first line therapy.
In some embodiments, the additional therapeutic agent comprises an anti-TNF therapy, e.g., an anti-TNFα therapy. In some embodiments, the additional therapeutic agent comprises a second-line treatment to an anti-TNF therapy. In some embodiments, the additional therapeutic agent comprises an immunosuppressant, or a class of drugs that suppress, or reduce, the strength of the immune system. In some embodiments, the immunosuppressant is an antibody. Non-limiting examples of immunosuppressant therapeutic agents include STELARA® (ustekinumab) azathioprine (AZA), 6-mercaptopurine (6-MP), methotrexate, cyclosporin A. (CsA).
In some embodiments, the additional therapeutic agent comprises a selective anti-inflammatory drug, or a class of drugs that specifically target pro-inflammatory molecules in the body. In some embodiments, the anti-inflammatory drug comprises an antibody. In some embodiments, the anti-inflammatory drug comprises a small molecule. Non-limiting examples of anti-inflammatory drugs include ENTYVIO (vedolizumab), corticosteroids, aminosalicylates, mesalamine, balsalazide (Colazal) and olsalazine (Dipentum).
In some embodiments, the additional therapeutic agent comprises a stem cell therapy. The stem cell therapy may be embryonic or somatic stem cells. The stem cells may be isolated from a donor (allogeneic) or isolated from the subject (autologous). The stem cells may be expanded adipose-derived stem cells (eASCs), hematopoietic stem cells (HSCs), mesenchymal stem (stromal) cells (MSCs), or induced pluripotent stem cells (iPSCs) derived from the cells of the subject. In some embodiments, the therapeutic agent comprises Cx601/Alofisel® (darvadstrocel).
In some embodiments, the additional therapeutic agent comprises a small molecule. The small molecule may be used to treat inflammatory diseases or conditions, or fibrostenonic or fibrotic disease. Non-limiting examples of small molecules include Otezla® (apremilast), alicaforsen, or ozanimod (RPC-1063).
In some embodiments, the additional therapeutic agent comprises an agonist or antagonist of Janus Kinase 1 (JAK1) (Entrez Gene ID: 3716). Non-limiting examples of JAK1 inhibitors include Ruxolitinib (INCB018424), S-Ruxolitinib (INCB018424), Baricitinib (LY3009104, INCB028050), Filgotinib (GLPG0634), Momelotinib (CYT387), Cerdulatinib (PRT062070, PRT2070), LY2784544, NVP-BSK805, 2HCl, Tofacitinib (CP-690550, Tasocitinib), XL019, Pacritinib (SB1518), or ZM 39923 HCl.
In some instances, the additional therapeutic agent comprises administering to the subject an antimycotic agent. In some instances, the antimycotic agent comprises an active agent that inhibits growth of a fungus. In some instances, the antimycotic agent comprises an active agent that kills a fungus. In some embodiments, the antimycotic agent comprises polyene, an azole, an echinocandin, an flucytosine, an allylamine, a tolnaftate, or griseofulvin, or a combination thereof. In other embodiments, the azole comprises triazole, imidazole, clotrimazole, ketoconazole, itraconazole, terconazole, oxiconazole, miconazole, econazole, tioconazole, voriconazole, fluconazole, isavuconazole, itraconazole, pramiconazole, ravuconazole, or posaconazole. In some other embodiments, the polyene comprises amphotericin B, nystatin, or natamycin. In yet other embodiments, the echinocandin comprises caspofungin, anidulafungin, or micafungin. In various other embodiments, the allylamine comprises naftifine or terbinafine
A pharmaceutical composition, as used herein, refers to a mixture of a therapeutic agent, with other chemical components (i.e. pharmaceutically acceptable inactive ingredients), such as carriers, excipients, binders, filling agents, suspending agents, flavoring agents, sweetening agents, disintegrating agents, dispersing agents, surfactants, lubricants, colorants, diluents, solubilizers, moistening agents, plasticizers, stabilizers, penetration enhancers, wetting agents, anti-foaming agents, antioxidants, preservatives, or one or more combination thereof. Optionally, the compositions include two or more therapeutic agent (e.g., one or more therapeutic agents and one or more additional agents) as discussed herein. In practicing the methods of treatment or use provided herein, therapeutically effective amounts of therapeutic agents described herein are administered in a pharmaceutical composition to a mammal having a disease, disorder, or condition to be treated, e.g., an inflammatory disease, fibrostenotic disease, and/or fibrotic disease. In some embodiments, the mammal is a human. A therapeutically effective amount can vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the therapeutic agent used and other factors. The therapeutic agents can be used singly or in combination with one or more therapeutic agents as components of mixtures.
The pharmaceutical formulations described herein are administered to a subject by appropriate administration routes, including but not limited to, intravenous, intraarterial, oral, parenteral, buccal, topical, transdermal, rectal, intramuscular, subcutaneous, intraosseous, transmucosal, inhalation, or intraperitoneal administration routes. The pharmaceutical formulations described herein include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate and controlled release formulations.
Pharmaceutical compositions including a therapeutic agent are manufactured in a conventional manner, such as, by way of example only, by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes.
The pharmaceutical compositions may include at least a therapeutic agent as an active ingredient in free-acid or free-base form, or in a pharmaceutically acceptable salt form. In addition, the methods and pharmaceutical compositions described herein include the use of N-oxides (if appropriate), crystalline forms, amorphous phases, as well as active metabolites of these compounds having the same type of activity. In some embodiments, therapeutic agents exist in unsolvated form or in solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like. The solvated forms of the therapeutic agents are also considered to be disclosed herein.
In some embodiments, a therapeutic agent exists as a tautomer. All tautomers are included within the scope of the agents presented herein. As such, it is to be understood that a therapeutic agent or a salt thereof may exhibit the phenomenon of tautomerism whereby two chemical compounds that are capable of facile interconversion by exchanging a hydrogen atom between two atoms, to either of which it forms a covalent bond. Since the tautomeric compounds exist in mobile equilibrium with each other they may be regarded as different isomeric forms of the same compound.
In some embodiments, a therapeutic agent exists as an enantiomer, diastereomer, or other steroisomeric form. The agents disclosed herein include all enantiomeric, diastereomeric, and epimeric forms as well as mixtures thereof.
In some embodiments, therapeutic agents described herein may be prepared as prodrugs. A “prodrug” refers to an agent that is converted into the parent drug in vivo. Prodrugs are often useful because, in some situations, they may be easier to administer than the parent drug. They may, for instance, be bioavailable by oral administration whereas the parent is not. The prodrug may also have improved solubility in pharmaceutical compositions over the parent drug. An example, without limitation, of a prodrug would be a therapeutic agent described herein, which is administered as an ester (the “prodrug”) to facilitate transmittal across a cell membrane where water solubility is detrimental to mobility but which then is metabolically hydrolyzed to the carboxylic acid, the active entity, once inside the cell where water-solubility is beneficial. A further example of a prodrug might be a short peptide (polyaminoacid) bonded to an acid group where the peptide is metabolized to reveal the active moiety. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically active form of the therapeutic agent. In certain embodiments, a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically or therapeutically active form of the therapeutic agent.
Prodrug forms of the therapeutic agents, wherein the prodrug is metabolized in vivo to produce an agent as set forth herein are included within the scope of the claims. Prodrug forms of the herein described therapeutic agents, wherein the prodrug is metabolized in vivo to produce an agent as set forth herein are included within the scope of the claims. In some cases, some of the therapeutic agents described herein may be a prodrug for another derivative or active compound. In some embodiments described herein, hydrazones are metabolized in vivo to produce a therapeutic agent.
In certain embodiments, compositions provided herein include one or more preservatives to inhibit microbial activity. Suitable preservatives include mercury-containing substances such as merfen and thiomersal; stabilized chlorine dioxide; and quaternary ammonium compounds such as benzalkonium chloride, cetyltrimethylammonium bromide and cetylpyridinium chloride.
In some embodiments, formulations described herein benefit from antioxidants, metal chelating agents, thiol containing compounds and other general stabilizing agents. Examples of such stabilizing agents, include, but are not limited to: (a) about 0.5% to about 2% w/v glycerol, (b) about 0.1% to about 1% w/v methionine, (c) about 0.1% to about 2% w/v monothioglycerol, (d) about 1 mM to about 10 mM EDTA, (e) about 0.01% to about 2% w/v ascorbic acid, (f) 0.003% to about 0.02% w/v polysorbate 80, (g) 0.001% to about 0.05% w/v. polysorbate 20, (h) arginine, (i) heparin, (j) dextran sulfate, (k) cyclodextrins, (l) pentosan polysulfate and other heparinoids, (m) divalent cations such as magnesium and zinc; or (n) combinations thereof.
The pharmaceutical compositions described herein are formulated into any suitable dosage form, including but not limited to, aqueous oral dispersions, liquids, gels, syrups, elixirs, slurries, suspensions, solid oral dosage forms, aerosols, controlled release formulations, fast melt formulations, effervescent formulations, lyophilized formulations, tablets, powders, pills, dragees, capsules, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate release and controlled release formulations. In one aspect, a therapeutic agent as discussed herein, e.g., therapeutic agent is formulated into a pharmaceutical composition suitable for intramuscular, subcutaneous, or intravenous injection. In one aspect, formulations suitable for intramuscular, subcutaneous, or intravenous injection include physiologically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents, or vehicles include water, ethanol, polyols (propyleneglycol, polyethylene-glycol, glycerol, cremophor and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In some embodiments, formulations suitable for subcutaneous injection also contain additives such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the growth of microorganisms can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. In some cases it is desirable to include isotonic agents, such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, such as aluminum monostearate and gelatin.
For intravenous injections or drips or infusions, a therapeutic agent described herein is formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art. For other parenteral injections, appropriate formulations include aqueous or nonaqueous solutions, preferably with physiologically compatible buffers or excipients. Such excipients are known.
Parenteral injections may involve bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The pharmaceutical composition described herein may be in a form suitable for parenteral injection as a sterile suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. In one aspect, the active ingredient is in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
For administration by inhalation, a therapeutic agent is formulated for use as an aerosol, a mist or a powder. Pharmaceutical compositions described herein are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, such as, by way of example only, gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the therapeutic agent described herein and a suitable powder base such as lactose or starch.
Representative intranasal formulations are described in, for example, U.S. Pat. Nos. 4,476,116, 5,116,817 and 6,391,452, which are incorporated by reference. Formulations that include a therapeutic agent are prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, fluorocarbons, and/or other solubilizing or dispersing agents known in the art. See, for example, Ansel, H. C. et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, Sixth Ed. (1995). Preferably these compositions and formulations are prepared with suitable nontoxic pharmaceutically acceptable ingredients. These ingredients are known to those skilled in the preparation of nasal dosage forms and some of these can be found in REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY, 21st edition, 2005. The choice of suitable carriers is dependent upon the exact nature of the nasal dosage form desired, e.g., solutions, suspensions, ointments, or gels. Nasal dosage forms generally contain large amounts of water in addition to the active ingredient. Minor amounts of other ingredients such as pH adjusters, emulsifiers or dispersing agents, preservatives, surfactants, gelling agents, or buffering and other stabilizing and solubilizing agents are optionally present. Preferably, the nasal dosage form should be isotonic with nasal secretions.
Pharmaceutical preparations for oral use are obtained by mixing one or more solid excipient with one or more of the therapeutic agents described herein, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients include, for example, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, microcrystalline cellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose; or others such as: polyvinylpyrrolidone (PVP or povidone) or calcium phosphate. If desired, disintegrating agents are added, such as the cross-linked croscarmellose sodium, polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. In some embodiments, dyestuffs or pigments are added to the tablets or dragee coatings for identification or to characterize different combinations of active therapeutic agent doses.
In some embodiments, pharmaceutical formulations of a therapeutic agent are in the form of a capsules, including push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active therapeutic agent is dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In some embodiments, stabilizers are added. A capsule may be prepared, for example, by placing the bulk blend of the formulation of the therapeutic agent inside of a capsule. In some embodiments, the formulations (non-aqueous suspensions and solutions) are placed in a soft gelatin capsule. In other embodiments, the formulations are placed in standard gelatin capsules or non-gelatin capsules such as capsules comprising HPMC. In other embodiments, the formulation is placed in a sprinkle capsule, wherein the capsule is swallowed whole or the capsule is opened and the contents sprinkled on food prior to eating.
All formulations for oral administration are in dosages suitable for such administration. In one aspect, solid oral dosage forms are prepared by mixing a therapeutic agent with one or more of the following: antioxidants, flavoring agents, and carrier materials such as binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, and diluents. In some embodiments, the solid dosage forms disclosed herein are in the form of a tablet, (including a suspension tablet, a fast-melt tablet, a bite-disintegration tablet, a rapid-disintegration tablet, an effervescent tablet, or a caplet), a pill, a powder, a capsule, solid dispersion, solid solution, bioerodible dosage form, controlled release formulations, pulsatile release dosage forms, multiparticulate dosage forms, beads, pellets, granules. In other embodiments, the pharmaceutical formulation is in the form of a powder. Compressed tablets are solid dosage forms prepared by compacting the bulk blend of the formulations described above. In various embodiments, tablets will include one or more flavoring agents. In other embodiments, the tablets will include a film surrounding the final compressed tablet. In some embodiments, the film coating can provide a delayed release of a therapeutic agent from the formulation. In other embodiments, the film coating aids in patient compliance (e.g., Opadry® coatings or sugar coating). Film coatings including Opadry® typically range from about 1% to about 3% of the tablet weight. In some embodiments, solid dosage forms, e.g., tablets, effervescent tablets, and capsules, are prepared by mixing particles of a therapeutic agent with one or more pharmaceutical excipients to form a bulk blend composition. The bulk blend is readily subdivided into equally effective unit dosage forms, such as tablets, pills, and capsules. In some embodiments, the individual unit dosages include film coatings. These formulations are manufactured by conventional formulation techniques.
In another aspect, dosage forms include microencapsulated formulations. In some embodiments, one or more other compatible materials are present in the microencapsulation material. Exemplary materials include, but are not limited to, pH modifiers, erosion facilitators, anti-foaming agents, antioxidants, flavoring agents, and carrier materials such as binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, and diluents. Exemplary useful microencapsulation materials include, but are not limited to, hydroxypropyl cellulose ethers (HPC) such as Klucel® or Nisso HPC, low-substituted hydroxypropyl cellulose ethers (L-HPC), hydroxypropyl methyl cellulose ethers (HPMC) such as Seppifilm-LC, Pharmacoat®, Metolose SR, Methocel®-E, Opadry YS, PrimaFlo, Benecel MP824, and Benecel MP843, methylcellulose polymers such as Methocel®-A, hydroxypropylmethylcellulose acetate stearate Aqoat (HF-LS, HF-LG,HF-MS) and Metolose®, Ethylcelluloses (EC) and mixtures thereof such as E461, Ethocel®, Aqualon®-EC, Surelease®, Polyvinyl alcohol (PVA) such as Opadry AMB, hydroxyethylcelluloses such as Natrosol®, carboxymethylcelluloses and salts of carboxymethylcelluloses (CMC) such as Aqualon®-CMC, polyvinyl alcohol and polyethylene glycol co-polymers such as Kollicoat IR®, monoglycerides (Myverol), triglycerides (KLX), polyethylene glycols, modified food starch, acrylic polymers and mixtures of acrylic polymers with cellulose ethers such as Eudragit® EPO, Eudragit® L30D-55, Eudragit® FS 30D Eudragit® L100-55, Eudragit® L100, Eudragit® 5100, Eudragit® RD100, Eudragit® E100, Eudragit® L12.5, Eudragit® S12.5, Eudragit® NE30D, and Eudragit® NE 40D, cellulose acetate phthalate, sepifilms such as mixtures of HPMC and stearic acid, cyclodextrins, and mixtures of these materials.
Liquid formulation dosage forms for oral administration are optionally aqueous suspensions selected from the group including, but not limited to, pharmaceutically acceptable aqueous oral dispersions, emulsions, solutions, elixirs, gels, and syrups. See, e.g., Singh et al., Encyclopedia of Pharmaceutical Technology, 2nd Ed., pp. 754-757 (2002). In addition to therapeutic agent the liquid dosage forms optionally include additives, such as: (a) disintegrating agents; (b) dispersing agents; (c) wetting agents; (d) at least one preservative, (e) viscosity enhancing agents, (f) at least one sweetening agent, and (g) at least one flavoring agent. In some embodiments, the aqueous dispersions further includes a crystal-forming inhibitor.
In some embodiments, the pharmaceutical formulations described herein are self-emulsifying drug delivery systems (SEDDS). Emulsions are dispersions of one immiscible phase in another, usually in the form of droplets. Generally, emulsions are created by vigorous mechanical dispersion. SEDDS, as opposed to emulsions or microemulsions, spontaneously form emulsions when added to an excess of water without any external mechanical dispersion or agitation. An advantage of SEDDS is that only gentle mixing is required to distribute the droplets throughout the solution. Additionally, water or the aqueous phase is optionally added just prior to administration, which ensures stability of an unstable or hydrophobic active ingredient. Thus, the SEDDS provides an effective delivery system for oral and parenteral delivery of hydrophobic active ingredients. In some embodiments, SEDDS provides improvements in the bioavailability of hydrophobic active ingredients. Methods of producing self-emulsifying dosage forms include, but are not limited to, for example, U.S. Pat. Nos. 5,858,401, 6,667,048, and 6,960,563.
Buccal formulations that include a therapeutic agent are administered using a variety of formulations known in the art. For example, such formulations include, but are not limited to, U.S. Pat. Nos. 4,229,447, 4,596,795, 4,755,386, and 5,739,136. In addition, the buccal dosage forms described herein can further include a bioerodible (hydrolysable) polymeric carrier that also serves to adhere the dosage form to the buccal mucosa. For buccal or sublingual administration, the compositions may take the form of tablets, lozenges, or gels formulated in a conventional manner.
For intravenous injections, a therapeutic agent is optionally formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. For other parenteral injections, appropriate formulations include aqueous or nonaqueous solutions, preferably with physiologically compatible buffers or excipients.
Parenteral injections optionally involve bolus injection or continuous infusion. Formulations for injection are optionally presented in unit dosage form, e.g., in ampoules or in multi dose containers, with an added preservative. In some embodiments, a pharmaceutical composition described herein is in a form suitable for parenteral injection as a sterile suspensions, solutions or emulsions in oily or aqueous vehicles, and contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Pharmaceutical formulations for parenteral administration include aqueous solutions of an agent that modulates the activity of a carotid body in water soluble form. Additionally, suspensions of an agent that modulates the activity of a carotid body are optionally prepared as appropriate, e.g., oily injection suspensions.
Conventional formulation techniques include, e.g., one or a combination of methods: (1) dry mixing, (2) direct compression, (3) milling, (4) dry or non-aqueous granulation, (5) wet granulation, or (6) fusion. Other methods include, e.g., spray drying, pan coating, melt granulation, granulation, fluidized bed spray drying or coating (e.g., wurster coating), tangential coating, top spraying, tableting, extruding and the like.
Suitable carriers for use in the solid dosage forms described herein include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, sodium caseinate, soy lecithin, sodium chloride, tricalcium phosphate, dipotassium phosphate, sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose, microcrystalline cellulose, lactose, mannitol and the like.
Suitable filling agents for use in the solid dosage forms described herein include, but are not limited to, lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, hydroxypropylmethycellulose (HPMC), hydroxypropylmethycellulose phthalate, hydroxypropylmethylcellulose acetate stearate (HPMCAS), sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.
Suitable disintegrants for use in the solid dosage forms described herein include, but are not limited to, natural starch such as corn starch or potato starch, a pregelatinized starch, or sodium starch glycolate, a cellulose such as methylcrystalline cellulose, methylcellulose, microcrystalline cellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose, cross-linked carboxymethylcellulose, or cross-linked croscarmellose, a cross-linked starch such as sodium starch glycolate, a cross-linked polymer such as crospovidone, a cross-linked polyvinylpyrrolidone, alginate such as alginic acid or a salt of alginic acid such as sodium alginate, a gum such as agar, guar, locust bean, Karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, sodium lauryl sulfate, sodium lauryl sulfate in combination starch, and the like.
Binders impart cohesiveness to solid oral dosage form formulations: for powder filled capsule formulation, they aid in plug formation that can be filled into soft or hard shell capsules and for tablet formulation, they ensure the tablet remaining intact after compression and help assure blend uniformity prior to a compression or fill step. Materials suitable for use as binders in the solid dosage forms described herein include, but are not limited to, carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, hydroxyethylcellulose, hydroxypropylcellulose, ethylcellulose, and microcrystalline cellulose, microcrystalline dextrose, amylose, magnesium aluminum silicate, polysaccharide acids, bentonites, gelatin, polyvinylpyrrolidone/vinyl acetate copolymer, crospovidone, povidone, starch, pregelatinized starch, tragacanth, dextrin, a sugar, such as sucrose, glucose, dextrose, molasses, mannitol, sorbitol, xylitol, lactose, a natural or synthetic gum such as acacia, tragacanth, ghatti gum, mucilage of isapol husks, starch, polyvinylpyrrolidone, larch arabogalactan, polyethylene glycol, waxes, sodium alginate, and the like.
In general, binder levels of 20-70% are used in powder-filled gelatin capsule formulations. Binder usage level in tablet formulations varies whether direct compression, wet granulation, roller compaction, or usage of other excipients such as fillers which itself can act as moderate binder. Binder levels of up to 70% in tablet formulations is common.
Suitable lubricants or glidants for use in the solid dosage forms described herein include, but are not limited to, stearic acid, calcium hydroxide, talc, corn starch, sodium stearyl fumerate, alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, magnesium stearate, zinc stearate, waxes, Stearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol or a methoxypolyethylene glycol such as Carbowax™, PEG 4000, PEG 5000, PEG 6000, propylene glycol, sodium oleate, glyceryl behenate, glyceryl palmitostearate, glyceryl benzoate, magnesium or sodium lauryl sulfate, and the like.
Suitable diluents for use in the solid dosage forms described herein include, but are not limited to, sugars (including lactose, sucrose, and dextrose), polysaccharides (including dextrates and maltodextrin), polyols (including mannitol, xylitol, and sorbitol), cyclodextrins and the like.
Suitable wetting agents for use in the solid dosage forms described herein include, for example, oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, quaternary ammonium compounds (e.g., Polyquat 10®), sodium oleate, sodium lauryl sulfate, magnesium stearate, sodium docusate, triacetin, vitamin E TPGS and the like.
Suitable surfactants for use in the solid dosage forms described herein include, for example, sodium lauryl sulfate, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic® (BASF), and the like.
Suitable suspending agents for use in the solid dosage forms described here include, but are not limited to, polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, vinyl pyrrolidone/vinyl acetate copolymer (S630), sodium carboxymethylcellulose, methylcellulose, hydroxy-propylmethylcellulose, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone and the like.
Suitable antioxidants for use in the solid dosage forms described herein include, for example, e.g., butylated hydroxytoluene (BHT), sodium ascorbate, and tocopherol.
It should be appreciated that there is considerable overlap between additives used in the solid dosage forms described herein. Thus, the above-listed additives should be taken as merely exemplary, and not limiting, of the types of additives that can be included in solid dosage forms of the pharmaceutical compositions described herein. The amounts of such additives can be readily determined by one skilled in the art, according to the particular properties desired.
In various embodiments, the particles of a therapeutic agents and one or more excipients are dry blended and compressed into a mass, such as a tablet, having a hardness sufficient to provide a pharmaceutical composition that substantially disintegrates within less than about 30 minutes, less than about 35 minutes, less than about 40 minutes, less than about 45 minutes, less than about 50 minutes, less than about 55 minutes, or less than about 60 minutes, after oral administration, thereby releasing the formulation into the gastrointestinal fluid.
In other embodiments, a powder including a therapeutic agent is formulated to include one or more pharmaceutical excipients and flavors. Such a powder is prepared, for example, by mixing the therapeutic agent and optional pharmaceutical excipients to form a bulk blend composition. Additional embodiments also include a suspending agent and/or a wetting agent. This bulk blend is uniformly subdivided into unit dosage packaging or multi-dosage packaging units.
In still other embodiments, effervescent powders are also prepared. Effervescent salts have been used to disperse medicines in water for oral administration.
In some embodiments, the pharmaceutical dosage forms are formulated to provide a controlled release of a therapeutic agent. Controlled release refers to the release of the therapeutic agent from a dosage form in which it is incorporated according to a desired profile over an extended period of time. Controlled release profiles include, for example, sustained release, prolonged release, pulsatile release, and delayed release profiles. In contrast to immediate release compositions, controlled release compositions allow delivery of an agent to a subject over an extended period of time according to a predetermined profile. Such release rates can provide therapeutically effective levels of agent for an extended period of time and thereby provide a longer period of pharmacologic response while minimizing side effects as compared to conventional rapid release dosage forms. Such longer periods of response provide for many inherent benefits that are not achieved with the corresponding short acting, immediate release preparations.
In some embodiments, the solid dosage forms described herein are formulated as enteric coated delayed release oral dosage forms, i.e., as an oral dosage form of a pharmaceutical composition as described herein which utilizes an enteric coating to affect release in the small intestine or large intestine. In one aspect, the enteric coated dosage form is a compressed or molded or extruded tablet/mold (coated or uncoated) containing granules, powder, pellets, beads or particles of the active ingredient and/or other composition components, which are themselves coated or uncoated. In one aspect, the enteric coated oral dosage form is in the form of a capsule containing pellets, beads or granules, which include a therapeutic agent that are coated or uncoated.
Any coatings of some embodiments should be applied to a sufficient thickness such that the entire coating does not dissolve in the gastrointestinal fluids at pH below about 5, but does dissolve at pH about 5 and above. Coatings are typically selected from any of the following: Shellac—this coating dissolves in media of pH>7; Acrylic polymers—examples of suitable acrylic polymers include methacrylic acid copolymers and ammonium methacrylate copolymers. The Eudragit series E, L, S, RL, RS and NE (Rohm Pharma) are available as solubilized in organic solvent, aqueous dispersion, or dry powders. The Eudragit series RL, NE, and RS are insoluble in the gastrointestinal tract but are permeable and are used primarily for colonic targeting. The Eudragit series E dissolve in the stomach. The Eudragit series L, L-30D and S are insoluble in stomach and dissolve in the intestine; Poly Vinyl Acetate Phthalate (PVAP)—PVAP dissolves in pH>5, and it is much less permeable to water vapor and gastric fluids. Conventional coating techniques such as spray or pan coating are employed to apply coatings. The coating thickness of some embodiments must be sufficient to ensure that the oral dosage form remains intact until the desired site of topical delivery in the intestinal tract is reached.
In other embodiments, the formulations described herein are delivered using a pulsatile dosage form. A pulsatile dosage form is capable of providing one or more immediate release pulses at predetermined time points after a controlled lag time or at specific sites. Exemplary pulsatile dosage forms and methods of their manufacture are disclosed in U.S. Pat. Nos. 5,011,692, 5,017,381, 5,229,135, 5,840,329 and 5,837,284. In one embodiment, the pulsatile dosage form includes at least two groups of particles, (i.e. multiparticulate) each containing the formulation described herein. The first group of particles provides a substantially immediate dose of a therapeutic agent upon ingestion by a mammal. The first group of particles can be either uncoated or include a coating and/or sealant. In one aspect, the second group of particles comprises coated particles. The coating on the second group of particles provides a delay of from about 2 hours to about 7 hours following ingestion before release of the second dose. Suitable coatings for pharmaceutical compositions are described herein or known in the art.
In some embodiments, pharmaceutical formulations are provided that include particles of a therapeutic agent and at least one dispersing agent or suspending agent for oral administration to a subject. The formulations may be a powder and/or granules for suspension, and upon admixture with water, a substantially uniform suspension is obtained.
In some embodiments, particles formulated for controlled release are incorporated in a gel or a patch or a wound dressing.
In one aspect, liquid formulation dosage forms for oral administration and/or for topical administration as a wash are in the form of aqueous suspensions selected from the group including, but not limited to, pharmaceutically acceptable aqueous oral dispersions, emulsions, solutions, elixirs, gels, and syrups. See, e.g., Singh et al., Encyclopedia of Pharmaceutical Technology, 2nd Ed., pp. 754-757 (2002). In addition to the particles of a therapeutic agent, the liquid dosage forms include additives, such as: (a) disintegrating agents; (b) dispersing agents; (c) wetting agents; (d) at least one preservative, (e) viscosity enhancing agents, (f) at least one sweetening agent, and (g) at least one flavoring agent. In some embodiments, the aqueous dispersions can further include a crystalline inhibitor.
In some embodiments, the liquid formulations also include inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers. Exemplary emulsifiers are ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide, sodium lauryl sulfate, sodium doccusate, cholesterol, cholesterol esters, taurocholic acid, phosphotidylcholine, oils, such as cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, and sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols, fatty acid esters of sorbitan, or mixtures of these substances, and the like.
Furthermore, pharmaceutical compositions optionally include one or more pH adjusting agents or buffering agents, including acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.
Additionally, pharmaceutical compositions optionally include one or more salts in an amount required to bring osmolality of the composition into an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.
Other pharmaceutical compositions optionally include one or more preservatives to inhibit microbial activity. Suitable preservatives include mercury-containing substances such as merfen and thiomersal; stabilized chlorine dioxide; and quaternary ammonium compounds such as benzalkonium chloride, cetyltrimethylammonium bromide and cetylpyridinium chloride.
In one embodiment, the aqueous suspensions and dispersions described herein remain in a homogenous state, as defined in The USP Pharmacists' Pharmacopeia (2005 edition, chapter 905), for at least 4 hours. In one embodiment, an aqueous suspension is re-suspended into a homogenous suspension by physical agitation lasting less than 1 minute. In still another embodiment, no agitation is necessary to maintain a homogeneous aqueous dispersion.
Examples of disintegrating agents for use in the aqueous suspensions and dispersions include, but are not limited to, a starch, e.g., a natural starch such as corn starch or potato starch, a pregelatinized starch, or sodium starch glycolate; a cellulose such as methylcrystalline cellulose, methylcellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose, cross-linked carboxymethylcellulose, or cross-linked croscarmellose; a cross-linked starch such as sodium starch glycolate; a cross-linked polymer such as crospovidone; a cross-linked polyvinylpyrrolidone; alginate such as alginic acid or a salt of alginic acid such as sodium alginate; a gum such as agar, guar, locust bean, Karaya, pectin, or tragacanth; sodium starch glycolate; bentonite; a natural sponge; a surfactant; a resin such as a cation-exchange resin; citrus pulp; sodium lauryl sulfate; sodium lauryl sulfate in combination starch; and the like.
In some embodiments, the dispersing agents suitable for the aqueous suspensions and dispersions described herein include, for example, hydrophilic polymers, electrolytes, Tween ° 60 or 80, PEG, polyvinylpyrrolidone, and the carbohydrate-based dispersing agents such as, for example, hydroxypropylcellulose and hydroxypropyl cellulose ethers, hydroxypropyl methylcellulose and hydroxypropyl methylcellulose ethers, carboxymethylcellulose sodium, methylcellulose, hydroxyethylcellulose, hydroxypropylmethyl-cellulose phthalate, hydroxypropylmethyl-cellulose acetate stearate, noncrystalline cellulose, magnesium aluminum silicate, triethanolamine, polyvinyl alcohol (PVA), polyvinylpyrrolidone/vinyl acetate copolymer, 4-(1,1,3,3-tetramethylbutyl)-phenol polymer with ethylene oxide and formaldehyde (also known as tyloxapol), poloxamers; and poloxamines. In other embodiments, the dispersing agent is selected from a group not comprising one of the following agents: hydrophilic polymers; electrolytes; Tween® 60 or 80; PEG; polyvinylpyrrolidone (PVP); hydroxypropylcellulose and hydroxypropyl cellulose ethers; hydroxypropyl methylcellulose and hydroxypropyl methylcellulose ethers; carboxymethylcellulose sodium; methylcellulose; hydroxyethylcellulose; hydroxypropylmethyl-cellulose phthalate; hydroxypropylmethyl-cellulose acetate stearate; non-crystalline cellulose; magnesium aluminum silicate; triethanolamine; polyvinyl alcohol (PVA); 4-(1,1,3,3-tetramethylbutyl)-phenol polymer with ethylene oxide and formaldehyde; poloxamers; or poloxamines.
Wetting agents suitable for the aqueous suspensions and dispersions described herein include, but are not limited to, cetyl alcohol, glycerol monostearate, polyoxyethylene sorbitan fatty acid esters (e.g., the commercially available Tweens® such as e.g., Tween 20® and Tween 80®, and polyethylene glycols, oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium oleate, sodium lauryl sulfate, sodium docusate, triacetin, vitamin E TPGS, sodium taurocholate, simethicone, phosphotidylcholine and the like.
Suitable preservatives for the aqueous suspensions or dispersions described herein include, for example, potassium sorbate, parabens (e.g., methylparaben and propylparaben), benzoic acid and its salts, other esters of parahydroxybenzoic acid such as butylparaben, alcohols such as ethyl alcohol or benzyl alcohol, phenolic compounds such as phenol, or quaternary compounds such as benzalkonium chloride. Preservatives, as used herein, are incorporated into the dosage form at a concentration sufficient to inhibit microbial growth.
Suitable viscosity enhancing agents for the aqueous suspensions or dispersions described herein include, but are not limited to, methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, Plasdon® S-630, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof. The concentration of the viscosity enhancing agent will depend upon the agent selected and the viscosity desired.
Examples of sweetening agents suitable for the aqueous suspensions or dispersions described herein include, for example, acacia syrup, acesulfame K, alitame, aspartame, chocolate, cinnamon, citrus, cocoa, cyclamate, dextrose, fructose, ginger, glycyrrhetinate, glycyrrhiza (licorice) syrup, monoammonium glyrrhizinate (MagnaSweet®), malitol, mannitol, menthol, neohesperidine DC, neotame, Prosweet® Powder, saccharin, sorbitol, stevia, sucralose, sucrose, sodium saccharin, saccharin, aspartame, acesulfame potassium, mannitol, sucralose, tagatose, thaumatin, vanilla, xylitol, or any combination thereof.
In some embodiments, a therapeutic agent is prepared as transdermal dosage form. In some embodiments, the transdermal formulations described herein include at least three components: (1) a therapeutic agent; (2) a penetration enhancer; and (3) an optional aqueous adjuvant. In some embodiments the transdermal formulations include additional components such as, but not limited to, gelling agents, creams and ointment bases, and the like. In some embodiments, the transdermal formulation is presented as a patch or a wound dressing. In some embodiments, the transdermal formulation further include a woven or non-woven backing material to enhance absorption and prevent the removal of the transdermal formulation from the skin. In other embodiments, the transdermal formulations described herein can maintain a saturated or supersaturated state to promote diffusion into the skin.
In one aspect, formulations suitable for transdermal administration of a therapeutic agent described herein employ transdermal delivery devices and transdermal delivery patches and can be lipophilic emulsions or buffered, aqueous solutions, dissolved and/or dispersed in a polymer or an adhesive. In one aspect, such patches are constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents. Still further, transdermal delivery of the therapeutic agents described herein can be accomplished by means of iontophoretic patches and the like. In one aspect, transdermal patches provide controlled delivery of a therapeutic agent. In one aspect, transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the therapeutic agent optionally with carriers, optionally a rate controlling barrier to deliver the therapeutic agent to the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin.
In further embodiments, topical formulations include gel formulations (e.g., gel patches which adhere to the skin). In some of such embodiments, a gel composition includes any polymer that forms a gel upon contact with the body (e.g., gel formulations comprising hyaluronic acid, pluronic polymers, poly(lactic-co-glycolic acid (PLGA)-based polymers or the like). In some forms of the compositions, the formulation comprises a low-melting wax such as, but not limited to, a mixture of fatty acid glycerides, optionally in combination with cocoa butter which is first melted. Optionally, the formulations further comprise a moisturizing agent.
In certain embodiments, delivery systems for pharmaceutical therapeutic agents may be employed, such as, for example, liposomes and emulsions. In certain embodiments, compositions provided herein can also include an mucoadhesive polymer, selected from among, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), poly(methylmethacrylate), polyacrylamide, polycarbophil, acrylic acid/butyl acrylate copolymer, sodium alginate and dextran.
In some embodiments, a therapeutic agent described herein may be administered topically and can be formulated into a variety of topically administrable compositions, such as solutions, suspensions, lotions, gels, pastes, medicated sticks, balms, creams or ointments. Such pharmaceutical therapeutic agents can contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives.
Disclosed herein, in some embodiments, are the following embodiments:
Disclosed herein, in some embodiments, are compositions useful for the detection of a genotype or biomarker in a sample obtained from a subject according to the methods described herein. Aspects disclosed herein provide compositions comprises a polynucleotide sequence comprising at least 10 but less than 50 contiguous nucleotides of any one of SEQ ID NOS: 6-10, or 15-48, or reverse complements thereof, wherein the contiguous polynucleotide sequence comprises a detectable molecule. In various embodiments, the detectable molecule comprises a fluorophore. In other embodiments, the polynucleotide sequences further comprise a quencher.
Also disclosed herein are compositions comprising an antibody or antigen-binding fragment that specifically binds to RNASET2, wherein the antibody or antigen-binding fragment comprises a detectable molecule. In various embodiments, the antibody comprises a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a Fab, a Fab′, a F(ab′)2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody, a diabody, a multispecific antibody, a dual specific antibody, an anti-idiotypic antibody, or a bispecific antibody. In some embodiments, the antibody or antigen-binding fragment comprises an IgG antibody, an IgM antibody, and/or an IgE antibody. In some embodiments, the detectable molecule comprises a fluorophore. In some embodiments, the antibody or antigen-binding fragment is conjugated to a paramagnetic particle (e.g., bead).
Disclosed herein, in some embodiments, are kits useful for to detect the genotypes and/or biomarkers disclosed herein. In some embodiments, the kits disclosed herein may be used to diagnose and/or treat a disease or condition in a subject; or select a patient for treatment and/or monitor a treatment disclosed herein. In some embodiments, the kit comprises the compositions described herein, which can be used to perform the methods described herein. Kits comprise an assemblage of materials or components, including at least one of the compositions. Thus, in some embodiments the kit contains a composition including of the pharmaceutical composition, for the treatment of IBD. In other embodiments, the kits contains all of the components necessary and/or sufficient to perform an assay for detecting and measuring IBD markers, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results.
In some instances, the kits described herein comprise components for detecting the presence, absence, and/or quantity of a target nucleic acid and/or protein described herein. In some embodiments, the kit comprises the compositions described herein. In some embodiments, the kit further comprises components for detecting the presence, absence, and/or quantity of a serological marker described herein. In some embodiments, the kit comprises the compositions (e.g., primers, probes, antibodies) described herein. The disclosure provides kits suitable for assays such as enzyme-linked immunosorbent assay (ELISA), single-molecular array (Simoa), PCR, and qPCR. The exact nature of the components configured in the kit depends on its intended purpose. For example, some embodiments are configured for the purpose of treating a disease or condition disclosed herein (e.g., IBD, CD, UC) in a subject. In some embodiments, the kit is configured particularly for the purpose of treating mammalian subjects. In some embodiments, the kit is configured particularly for the purpose of treating human subjects. In further embodiments, the kit is configured for veterinary applications, treating subjects such as, but not limited to, farm animals, domestic animals, and laboratory animals. In some embodiments, the kit is configured to select a subject for a therapeutic agent, such as those disclosed herein. In some embodiments, the kit is configured to select a subject for treatment with a modulator of RNASET2 activity or expression (e.g., recombinant RNASET2 polypeptide).
Instructions for use may be included in the kit. Optionally, the kit also contains other useful components, such as, diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, pipetting or measuring tools, bandaging materials or other useful paraphernalia. The materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility. For example, the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures. The components are typically contained in suitable packaging material(s). As employed herein, the phrase “packaging material” refers to one or more physical structures used to house the contents of the kit, such as compositions and the like. The packaging material is constructed by suitable methods, preferably to provide a sterile, contaminant-free environment. The packaging materials employed in the kit are those customarily utilized in gene expression assays and in the administration of treatments. As used herein, the term “package” refers to a suitable solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding the individual kit components. Thus, for example, a package can be a glass vial or prefilled syringes used to contain suitable quantities of the pharmaceutical composition. The packaging material has an external label which indicates the contents and/or purpose of the kit and its components.
Disclosed herein, in some embodiments, is a system for detecting a particular RNASET2 risk genotype in a subject. The system is configured to implement the methods described in this disclosure, including, but not limited to, detecting the presence of a particular CD subtype to determine whether the subject is suitable for treatment with a particular therapy. In some embodiments, disclosed herein the RNASET2 risk genotype comprises Indel 1, SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, SNP9, SNP 10, SNP 11, SNP 12, SNP 13, SNP 14, SNP 15, SNP 16, SNP 17, SNP 18, SNP 19, SNP20, SNP21, SNP22, SNP23, SNP24, SNP25, SNP26, SNP27, SNP28, SNP29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, or SNP36, or any combination thereof. In some embodiments, the RNASET2 risk genotype comprises Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C, or any single nucleotide polymorphism (SNP) or indel in linkage disequilibrium (LD) therewith.
Disclosed herein, in some embodiment, are systems for detecting Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C in a subject, comprising: (a) a computer processing device, optionally connected to a computer network; and (b) a software module executed by the computer processing device to analyze a target nucleic acid sequence comprising Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C in a sample from a subject. In some instances, the system comprises a central processing unit (CPU), memory (e.g., random access memory, flash memory), electronic storage unit, computer program, communication interface to communicate with one or more other systems, and any combination thereof. In some instances, the system is coupled to a computer network, for example, the Internet, intranet, and/or extranet that is in communication with the Internet, a telecommunication, or data network. In some embodiments, the system comprises a storage unit to store data and information regarding any aspect of the methods described in this disclosure. Various aspects of the system are a product or article or manufacture.
One feature of a computer program includes a sequence of instructions, executable in the digital processing device's CPU, written to perform a specified task. In some embodiments, computer readable instructions are implemented as program modules, such as functions, features, Application Programming Interfaces (APIs), data structures, and the like, that perform particular tasks or implement particular abstract data types. In light of the disclosure provided herein, those of skill in the art will recognize that a computer program may be written in various versions of various languages.
The functionality of the computer readable instructions are combined or distributed as desired in various environments. In some instances, a computer program comprises one sequence of instructions or a plurality of sequences of instructions. A computer program may be provided from one location. A computer program may be provided from a plurality of locations. In some embodiment, a computer program includes one or more software modules. In some embodiments, a computer program includes, in part or in whole, one or more web applications, one or more mobile applications, one or more standalone applications, one or more web browser plug-ins, extensions, add-ins, or add-ons, or combinations thereof
In some embodiments, a computer program includes a web application. In light of the disclosure provided herein, those of skill in the art will recognize that a web application may utilize one or more software frameworks and one or more database systems. A web application, for example, is created upon a software framework such as Microsoft® .NET or Ruby on Rails (RoR). A web application, in some instances, utilizes one or more database systems including, by way of non-limiting examples, relational, non-relational, feature oriented, associative, and XML database systems. Suitable relational database systems include, by way of non-limiting examples, Microsoft® SQL Server, mySQL™, and Oracle®. Those of skill in the art will also recognize that a web application may be written in one or more versions of one or more languages. In some embodiments, a web application is written in one or more markup languages, presentation definition languages, client-side scripting languages, server-side coding languages, database query languages, or combinations thereof. In some embodiments, a web application is written to some extent in a markup language such as Hypertext Markup Language (HTML), Extensible Hypertext Markup Language (XHTML), or eXtensible Markup Language (XML). In some embodiments, a web application is written to some extent in a presentation definition language such as Cascading Style Sheets (CSS). In some embodiments, a web application is written to some extent in a client-side scripting language such as Asynchronous Javascript and XML (AJAX), Flash® Actionscript, Javascript, or Silverlight®. In some embodiments, a web application is written to some extent in a server-side coding language such as Active Server Pages (ASP), ColdFusion®, Perl, Java™, JavaServer Pages (JSP), Hypertext Preprocessor (PHP), Python™, Ruby, Tcl, Small-talk, WebDNA®, or Groovy. In some embodiments, a web application is written to some extent in a database query language such as Structured Query Language (SQL). A web application may integrate enterprise server products such as IBM® Lotus Domino®. A web application may include a media player element. A media player element may utilize one or more of many suitable multimedia technologies including, by way of non-limiting examples, Adobe® Flash®, HTML 5, Apple® QuickTime®, Microsoft® Silverlight®, Java™, and Unity®.
In some instances, a computer program includes a mobile application provided to a mobile digital processing device. The mobile application may be provided to a mobile digital processing device at the time it is manufactured. The mobile application may be provided to a mobile digital processing device via the computer network described herein.
A mobile application is created by techniques known to those of skill in the art using hardware, languages, and development environments known to the art. Those of skill in the art will recognize that mobile applications may be written in several languages. Suitable programming languages include, by way of non-limiting examples, C, C++, C #, Featureive-C, Java™, Javascript, Pascal, Feature Pascal, Python™ Ruby, VB.NET, WML, and XHTML/HTML with or without CSS, or combinations thereof.
Suitable mobile application development environments are available from several sources. Commercially available development environments include, by way of non-limiting examples, AirplaySDK, alcheMo, Appcelerator®, Celsius, Bedrock, Flash Lite, NET Compact Framework, Rhomobile, and WorkLight Mobile Platform. Other development environments may be available without cost including, by way of non-limiting examples, Lazarus, MobiFlex, MoSync, and Phonegap. Also, mobile device manufacturers distribute software developer kits including, by way of non-limiting examples, iPhone and iPad (iOS) SDK, Android™ SDK, BlackBerry® SDK, BREW SDK, Palm® OS SDK, Symbian SDK, webOS SDK, and Windows® Mobile SDK.
Those of skill in the art will recognize that several commercial forums are available for distribution of mobile applications including, by way of non-limiting examples, Apple® App Store, Android™ Market, BlackBerry® App World, App Store for Palm devices, App Catalog for webOS, Windows® Marketplace for Mobile, Ovi Store for Nokia® devices, Samsung® Apps, and Nintendo® DSi Shop.
In some embodiments, a computer program includes a standalone application, which is a program that may be run as an independent computer process, not an add-on to an existing process, e.g., not a plug-in. Those of skill in the art will recognize that standalone applications are sometimes compiled. In some instances, a compiler is a computer program(s) that transforms source code written in a programming language into binary feature code such as assembly language or machine code. Suitable compiled programming languages include, by way of non-limiting examples, C, C++, Featureive-C, COBOL, Delphi, Eiffel, Java™, Lisp, Python™, Visual Basic, and VB NET, or combinations thereof. Compilation may be often performed, at least in part, to create an executable program. In some instances, a computer program includes one or more executable complied applications.
A computer program, in some aspects, includes a web browser plug-in. In computing, a plug-in, in some instances, is one or more software components that add specific functionality to a larger software application. Makers of software applications may support plug-ins to enable third-party developers to create abilities which extend an application, to support easily adding new features, and to reduce the size of an application. When supported, plug-ins enable customizing the functionality of a software application. For example, plug-ins are commonly used in web browsers to play video, generate interactivity, scan for viruses, and display particular file types. Those of skill in the art will be familiar with several web browser plug-ins including, Adobe® Flash® Player, Microsoft® Silverlight®, and Apple® QuickTime®. The toolbar may comprise one or more web browser extensions, add-ins, or add-ons. The toolbar may comprise one or more explorer bars, tool bands, or desk bands.
In view of the disclosure provided herein, those of skill in the art will recognize that several plug-in frameworks are available that enable development of plug-ins in various programming languages, including, by way of non-limiting examples, C++, Delphi, Java™, PHP, Python™, and VB .NET, or combinations thereof.
In some embodiments, Web browsers (also called Internet browsers) are software applications, designed for use with network-connected digital processing devices, for retrieving, presenting, and traversing information resources on the World Wide Web. Suitable web browsers include, by way of non-limiting examples, Microsoft® Internet Explorer®, Mozilla® Firefox®, Google® Chrome, Apple® Safari®, Opera Software® Opera®, and KDE Konqueror. The web browser, in some instances, is a mobile web browser. Mobile web browsers (also called mircrobrowsers, mini-browsers, and wireless browsers) may be designed for use on mobile digital processing devices including, by way of non-limiting examples, handheld computers, tablet computers, netbook computers, subnotebook computers, smartphones, music players, personal digital assistants (PDAs), and handheld video game systems. Suitable mobile web browsers include, by way of non-limiting examples, Google® Android® browser, RIM BlackBerry R Browser, Apple® Safari®, Palm® Blazer, Palm® WebOS® Browser, Mozilla® Firefox® for mobile, Microsoft® Internet Explorer® Mobile, Amazon® Kindle® Basic Web, Nokia® Browser, Opera Software® Opera® Mobile, and Sony® PSP™ browser.
The medium, method, and system disclosed herein comprise one or more softwares, servers, and database modules, or use of the same. In view of the disclosure provided herein, software modules may be created by techniques known to those of skill in the art using machines, software, and languages known to the art. The software modules disclosed herein may be implemented in a multitude of ways. In some embodiments, a software module comprises a file, a section of code, a programming feature, a programming structure, or combinations thereof. A software module may comprise a plurality of files, a plurality of sections of code, a plurality of programming features, a plurality of programming structures, or combinations thereof. By way of non-limiting examples, the one or more software modules comprise a web application, a mobile application, and/or a standalone application. Software modules may be in one computer program or application. Software modules may be in more than one computer program or application. Software modules may be hosted on one machine. Software modules may be hosted on more than one machine. Software modules may be hosted on cloud computing platforms. Software modules may be hosted on one or more machines in one location. Software modules may be hosted on one or more machines in more than one location.
The medium, method, and system disclosed herein comprise one or more databases, or use of the same. In view of the disclosure provided herein, those of skill in the art will recognize that many databases are suitable for storage and retrieval of geologic profile, operator activities, division of interest, and/or contact information of royalty owners. Suitable databases include, by way of non-limiting examples, relational databases, non-relational databases, feature oriented databases, feature databases, entity-relationship model databases, associative databases, and XML databases. In some embodiments, a database is internet-based. In some embodiments, a database is web-based. In some embodiments, a database is cloud computing-based. A database may be based on one or more local computer storage devices.
The subject matter described herein, including methods for detecting a particular CD subtype, are configured to be performed in one or more facilities at one or more locations. Facility locations are not limited by country and include any country or territory. In some instances, one or more steps are performed in a different country than another step of the method. In some instances, one or more steps for obtaining a sample are performed in a different country than one or more steps for detecting the presence or absence of a particular CD subtype from a sample. In some embodiments, one or more method steps involving a computer system are performed in a different country than another step of the methods provided herein. In some embodiments, data processing and analyses are performed in a different country or location than one or more steps of the methods described herein. In some embodiments, one or more articles, products, or data are transferred from one or more of the facilities to one or more different facilities for analysis or further analysis. An article includes, but is not limited to, one or more components obtained from a subject, e.g., processed cellular material. Processed cellular material includes, but is not limited to, cDNA reverse transcribed from RNA, amplified RNA, amplified cDNA, sequenced DNA, isolated and/or purified RNA, isolated and/or purified DNA, and isolated and/or purified polypeptide. Data includes, but is not limited to, information regarding the stratification of a subject, and any data produced by the methods disclosed herein. In some embodiments of the methods and systems described herein, the analysis is performed and a subsequent data transmission step will convey or transmit the results of the analysis.
In some embodiments, any step of any method described herein is performed by a software program or module on a computer. In additional or further embodiments, data from any step of any method described herein is transferred to and from facilities located within the same or different countries, including analysis performed in one facility in a particular location and the data shipped to another location or directly to an individual in the same or a different country. In additional or further embodiments, data from any step of any method described herein is transferred to and/or received from a facility located within the same or different countries, including analysis of a data input, such as genetic or processed cellular material, performed in one facility in a particular location and corresponding data transmitted to another location, or directly to an individual, such as data related to the diagnosis, prognosis, responsiveness to therapy, or the like, in the same or different location or country.
The methods described herein may utilize one or more computers. The computer may be used for managing customer and sample information such as sample or customer tracking, database management, analyzing molecular profiling data, analyzing cytological data, storing data, billing, marketing, reporting results, storing results, or a combination thereof. The computer may include a monitor or other graphical interface for displaying data, results, billing information, marketing information (e.g. demographics), customer information, or sample information. The computer may also include means for data or information input. The computer may include a processing unit and fixed or removable media or a combination thereof. The computer may be accessed by a user in physical proximity to the computer, for example via a keyboard and/or mouse, or by a user that does not necessarily have access to the physical computer through a communication medium such as a modem, an internet connection, a telephone connection, or a wired or wireless communication signal carrier wave. In some cases, the computer may be connected to a server or other communication device for relaying information from a user to the computer or from the computer to a user. In some cases, the user may store data or information obtained from the computer through a communication medium on media, such as removable media. It is envisioned that data relating to the methods can be transmitted over such networks or connections for reception and/or review by a party. The receiving party can be but is not limited to an individual, a health care provider or a health care manager. In one embodiment, a computer-readable medium includes a medium suitable for transmission of a result of an analysis of a biological sample, such as exosome bio-signatures. The medium can include a result regarding an exosome bio-signature of a subject, wherein such a result is derived using the methods described herein.
The entity obtaining a RNASET2 risk genotype may enter sample information into a database for the purpose of one or more of the following: inventory tracking, assay result tracking, order tracking, customer management, customer service, billing, and sales. Sample information may include, but is not limited to: customer name, unique customer identification, customer associated medical professional, indicated assay or assays, assay results, adequacy status, indicated adequacy tests, medical history of the individual, preliminary diagnosis, suspected diagnosis, sample history, insurance provider, medical provider, third party testing center or any information suitable for storage in a database. Sample history may include but is not limited to: age of the sample, type of sample, method of acquisition, method of storage, or method of transport.
The database may be accessible by a customer, medical professional, insurance provider, or other third party. Database access may take the form of electronic communication such as a computer or telephone. The database may be accessed through an intermediary such as a customer service representative, business representative, consultant, independent testing center, or medical professional. The availability or degree of database access or sample information, such as assay results, may change upon payment of a fee for products and services rendered or to be rendered. The degree of database access or sample information may be restricted to comply with generally accepted or legal requirements for patient or customer confidentiality.
Disclosed herein, in some embodiments, are the following:
The terminology used herein is for the purpose of describing particular cases only and is not intended to be limiting. As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”
The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the given value. Where particular values are described in the application and claims, unless otherwise stated the term “about” should be assumed to mean an acceptable error range for the particular value.
As used herein “consisting essentially of” when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination for the stated purpose. Thus, a composition consisting essentially of the elements as defined herein would not exclude other materials or steps that do not materially affect the basic and novel characteristic(s) of the claimed disclosure, such as compositions for treating skin disorders like acne, eczema, psoriasis, and rosacea.
The terms “homologous,” “homology,” or “percent homology” are used herein to generally mean an amino acid sequence or a nucleic acid sequence having the same, or similar sequence to a reference sequence. Percent homology of sequences can be determined using the most recent version of BLAST, as of the filing date of this application.
The terms “increased,” or “increase” are used herein to generally mean an increase by a statically significant amount. In some embodiments, the terms “increased,” or “increase,” mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, standard, or control. Other examples of “increase” include an increase of at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 1000-fold or more as compared to a reference level.
The terms, “decreased” or “decrease” are used herein generally to mean a decrease by a statistically significant amount. In some embodiments, “decreased” or “decrease” means a reduction by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g., absent level or non-detectable level as compared to a reference level), or any decrease between 10-100% as compared to a reference level. In the context of a marker or symptom, by these terms is meant a statistically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40% or more, and is preferably down to a level accepted as within the range of normal for an individual without a given disease.
The terms “patient” or “subject” are used herein, and encompass mammals. Non-limiting examples of mammal include, any member of the mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. In one aspect, the mammal is a human. The term “animal” as used herein comprises human beings and non-human animals. In one embodiment, a “non-human animal” is a mammal, for example a rodent such as rat or a mouse. In some cases, the subject is a patient that is diagnosed with a disease or disorder described herein. In some cases, the subject is suspected of having the disease or disorder, but is not necessarily diagnosed.
The term “gene,” as used herein, refers to a segment of nucleic acid that encodes an individual protein or RNA (also referred to as a “coding sequence” or “coding region”), optionally together with associated regulatory region such as promoter, operator, terminator and the like, which may be located upstream or downstream of the coding sequence.
The term “genetic variant” as used herein refers to an aberration in (e.g., a mutation), or of (e.g., copy number variation), a nucleic acid sequence, as compared to the nucleic acid sequence in a reference population. In some embodiments, the genetic variant is common in the reference population. In some embodiments, the genetic variant is rare in the reference population.
The term, “genotype” as disclosed herein, refers to the chemical composition of polynucleotide sequences within the genome of an individual. In some embodiments, the genotype comprises single nucleotide variant (SNV), a single nucleotide polymorphism (SNP), or and indel (insertion or deletion, of a nucleobase within a polynucleotide sequence). In some embodiments, a genotype for a particular SNV, SNP, or indel is heterozygous. In some embodiments, a genotype for a particular SNV, SNP, or indel is homozygous.
The terms, “single nucleotide polymorphism,” or “SNP,” as disclosed herein, refer to a variation in a single nucleotide within a polynucleotide sequence. The variation of an SNP may have multiple different forms. A single form of an SNP is referred to as an “allele.” An SNP can be mono-, bi-, tri, or tetra-allelic. An SNP may include a “risk allele,” a “protective allele,” or neither. By way of example, a reference polynucleotide sequence reading 5′ to 3′ is TTACG. A SNP at allele position 3 (of 5′-TTACG-3′) comprise a substitution of the reference allele, “A” to a non-reference allele, “C.” If the “C” allele of the SNP is associated with an increased probability of developing a phenotypic trait, the allele is considered a “risk” allele. However, the same SNP may also comprise a substitution of the “A” allele to a “T” allele at position 3. If the T allele ofthe SNP is associated with a decreased probability of developing a phenotypic trait, the allele is considered a “protective” allele. The SNP, in some cases, is observed in at least 1% of a given population. In some embodiments, the SNP is represented by an “rs” number, which refers to the accession of reference cluster of one more submitted SNPs in the dbSNP bioinformatics database as of the filing date of this patent application, and which is included within a sequence that comprises the total number of nucleobases from 5′ to 3′. In some embodiments, a SNP may be further defined by the position of the SNV (nucleotide position) within the dbSNP sequence, the position of which is always with reference to 5′ length of the sequence plus 1. In some embodiments, a SNP is defined as the genomic position in a reference genome and the allele change. In some embodiments, the SNP is defined as the genomic position identified with an “N” in a sequence disclosed herein, such as SEQ ID NOS: 1-5.
The term, “indel,” as disclosed herein, refers to an insertion, or a deletion, of a nucleobase within a polynucleotide sequence. An indel can be mono-, bi-, tri, or tetra-allelic. An indel may be “risk,” a “protective,” or neither, for a phenotypic trait. In some embodiments, the indel is represented by an “rs” number, which refers to the accession of reference cluster of one more submitted indels in the dbSNP bioinformatics database as of the filing date of this patent application, and which is included in a sequence that comprises the total number of nucleobases from 5′ to 3′. In some embodiments, an indel may be further defined by the position of the insertion/deletion within the dbSNP sequence, the position of which is always with reference to the 5′ length of the sequence plus 1. In some embodiments, an indel is defined as the genomic position in a reference genome and the allele change. In some embodiments, the indel is defined as the genomic position identified with an “N” in a sequence disclosed herein in SEQ ID NOS: 1-6.
“Haplotype” as used herein, encompasses a group of one or more genotypes, SNVs, SNPs, or indels, which tend to be inherited together in a reference population. In some embodiments, a haplotype comprises particular SNPs, or indels, and any SNP, or indel in linkage disequilibrium therewith.
“Linkage disequilibrium,” or “LD,” as used herein refers to the non-random association of alleles or indels in different gene loci in a given population. LD may be defined by a D′ value corresponding to the difference between an observed and expected allele or indel frequencies in the population (D=Pab−PaPb), which is scaled by the theoretical maximum value of D. LD may be defined by an r2 value corresponding to the difference between an observed and expected unit of risk frequencies in the population (D=Pab−PaPb), which is scaled by the individual frequencies of the different loci. In some embodiments, D′ comprises at least 0.20. In some embodiments, r2 comprises at least 0.70.
The terms “treat,” “treating,” and “treatment” as used herein refers to alleviating or abrogating a disorder, disease, or condition; or one or more of the symptoms associated with the disorder, disease, or condition; or alleviating or eradicating a cause of the disorder, disease, or condition itself. Desirable effects of treatment can include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishing any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state and remission or improved prognosis.
The term “therapeutically effective amount” refers to the amount of a compound or therapy that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of a disorder, disease, or condition of the disease; or the amount of a compound that is sufficient to elicit biological or medical response of a cell, tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor, or clinician.
The terms “pharmaceutically acceptable carrier,” “pharmaceutically acceptable excipient,” “physiologically acceptable carrier,” or “physiologically acceptable excipient” refer to a pharmaceutically-acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material. A component can be “pharmaceutically acceptable” in the sense of being compatible with the other ingredients of a pharmaceutical formulation. It can also be suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit/risk ratio. See, Remington: The Science and Practice of Pharmacy, 21st Edition; Lippincott Williams & Wilkins: Philadelphia, Pa., 2005; Handbook of Pharmaceutical Excipients, 5th Edition; Rowe et al., Eds., The Pharmaceutical Press and the American Pharmaceutical Association: 2005; and Handbook of Pharmaceutical Additives, 3rd Edition; Ash and Ash Eds., Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, Gibson Ed., CRC Press LLC: Boca Raton, Fla., 2004).
The term “pharmaceutical composition” refers to a mixture of a compound disclosed herein with other chemical components, such as diluents or carriers. The pharmaceutical composition can facilitate administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to, oral, injection, aerosol, parenteral, and topical administration.
The terms “inflammatory bowel disease” or “IBD” as used herein refer to gastrointestinal disorders of the gastrointestinal tract. Non-limiting examples of IBD include, Crohn's disease (CD), ulcerative colitis (UC), indeterminate colitis (IC), microscopic colitis, diversion colitis, Behcet's disease, and other inconclusive forms of IBD. In some instances, IBD comprises fibrosis, fibrostenosis, stricturing and/or penetrating disease, obstructive disease, or a disease that is refractory (e.g., mrUC, refractory CD), perianal CD, or other complicated forms of IBD.
Non-limiting examples of “sample” include any material from which nucleic acids and/or proteins can be obtained. As non-limiting examples, this includes whole blood, peripheral blood, plasma, serum, saliva, mucus, urine, semen, lymph, fecal extract, cheek swab, cells or other bodily fluid or tissue, including but not limited to tissue obtained through surgical biopsy or surgical resection. In various embodiments, the sample comprises tissue from the large and/or small intestine. In various embodiments, the large intestine sample comprises the cecum, colon (the ascending colon, the transverse colon, the descending colon, and the sigmoid colon), rectum and/or the anal canal. In some embodiments, the small intestine sample comprises the duodenum, jejunum, and/or the ileum. Alternatively, a sample can be obtained through primary patient derived cell lines, or archived patient samples in the form of preserved samples, or fresh frozen samples.
The term “biomarker” comprises a measurable substance in a subject whose presence, level, or activity, is indicative of a phenomenon (e.g., phenotypic expression or activity; disease, condition, subclinical phenotype of a disease or condition, infection; or environmental stimuli). In some embodiments, a biomarker comprises a gene, or gene expression product. In some embodiments, a biomarker comprises a cytokine (e.g., IL-1α, IL-1β, IL-2, IL-3. IL-4, IL-5, IL-6, IL-8, IL-9, IL-10, IL-13, IL-17, IL-17F, IL-22, TNF-α, TNF-β, IFN-α1/-α2, IFN-β, IFN-γ, TNFSF superfamily: TNF, TL1A, FasL, LIGHT, TRAIL, and TWEAK). In some embodiments, a biomarker comprises a cell type (e.g., Natural Killer (NK) cells, T cells, Effector T cells (Teff), Regulatory T cells (Treg) B cells, T helper (Th) cells, cluster of differentiation (CD) cells, innate lymphoid cells (ILC), antigen-presenting cells (APC), monocytes Paneth cells, granulocytes, dendritic cells, and macrophages).
The term “serological marker,” as used herein refers to a type of biomarker representing an antigenic response in a subject that may be detected in the serum of the subject. In some embodiments, a serological comprises an antibody against various fungal antigens. Non-limiting examples of a serological marker comprise anti-Saccharomyces cerevisiae antibody (ASCA), an anti-neutrophil cytoplasmic antibody (ANCA), E. coli outer membrane porin protein C (OmpC), anti-Malassezia restricta antibody, anti-Malassezia pachydermatis antibody, anti-Malassezia furfur antibody, anti-Malassezia globasa antibody, anti-Cladosporium albicans antibody, anti-laminaribiose antibody (ALCA), anti-chitobioside antibody (ACCA), anti-laminarin antibody, anti-chitin antibody, pANCA antibody, anit-I2 antibody, and anti-Cbir1 flagellin antibody.
The terms “medically refractory” or “refractory,” as used herein, refer to the failure of a standard treatment to induce remission of a disease. In some embodiments, the disease comprises an inflammatory disease disclosed herein. A non-limiting example of refractory inflammatory disease includes refractory Crohn's disease, and refractory ulcerative colitis (e.g., mrUC). Non-limiting examples of standard treatment include glucocorticosteriods, anti-TNF therapy, anti-a4-b7 therapy (vedolizumab), anti-IL12p40 therapy (ustekinumab), Thalidomide, and Cytoxin.
The terms “anti-tumor necrosis factor (TNF) non-response” or “anti-TNF non-response,” as used herein, refer to a subject not responding to the induction of an anti-TNF therapy (primary non-response), or loss of response during maintenance after a successful induction of the anti-TNF therapy (secondary loss of response). In some embodiments, the induction of the anti-TNF therapy comprises 1, 2, 3, 4, or 5, doses of the therapy. In some embodiments, loss of response is characterized by a reappearance of symptoms consistent with a flare after an initial response to the anti-TNF therapy.
The term “therapeutic agent having RNASET2 activity,” as used herein, is intended to mean a molecule that having the same biological function as RNASET2 in the pathogenesis of IBD. Such therapeutic agents having RNASET2 activity can include the RNASET2 protein or a functional fragment thereof, and other molecules upstream or downstream of RNASET2 in the signaling cascade by which the RNASET2 protein attenuates, inhibits, reduces, or prevents the pathogenesis of IBD. Such therapeutic agents having RNASET2 activity can also include molecules upstream or downstream of RNASET2 in the signaling cascade by which the RNASET2 protein attenuates, inhibits, reduces, or prevents the TL1A mediated secretion of IFN-γ in T cells (used as a proxy for the pathogenesis of IBD). For example, therapeutic agents having RNASET2 activity can be an antagonist for LFA-1, including LFA-1 blocking antibodies known and used in the field, or molecules that block the downstream signaling from activated LFA-1. Other examples of therapeutic agents having RNASET2 activity include an antagonist of ICAM-1 or other molecules, including ICAM-1 blocking antibodies known and used in the field that block the ICAM-1-LFA-1 interaction, and the molecules that that can decrease the expression or stability of ICAM-1 molecules. In one specific embodiment, the agent having RNASET2 activity comprises or is a RNASET2 protein. In another specific embodiment, the agent having RNASET2 activity comprises or is a functional fragment of a RNASET2 protein.
The terms “RNASET2 protein,” and “RNASET2 polypeptide” are used interchangeably, and as used herein, are intended to mean ribonuclease T2, its allelic variants (e.g., SNP variants); splice variants; fragments; derivatives; substitution, deletion, and insertion variants; fusion polypeptides; interspecies homologs; orthologs; and/or paralogs; which can retain RNASET2 activity. The retention of such RNASET2 activity can be determined by the ability to attenuate, inhibit, reduce, or prevent the pathogenesis of IBD, or, as a proxy, to attenuate, inhibit, reduce, or prevent the TL1A mediated secretion of IFN-γ in T cells as described in Examples 18 and 21. Specific examples of RNASET2 protein include NCBI entry number NP_003721.2, and the isoforms XP_024302343.1, XP_016866888.1, XP_016866887.1, XP_016866886.1, and XP_024302344.1. The “functional fragment” of a RNASET2 protein refers to a fragment of a RNASET2 protein that retains the function of RNASET2 activity as described in this paragraph.
The terms “identity” or “identical” refer to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the exact match between the sequences. “Percent (%) identity” with respect to a reference polypeptide or nucleotide sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical with the amino acid residues or nucleotides in the reference polypeptide or nucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEGALIGN (DNAStar, Inc.) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
A candidate causal single nucleotide polymorphism (SNP) at the RNASET2 gene locus, SNP 1, was identified within a putative enhancer region and in linkage with disease tagging SNP 2. To evaluate its functional impact in regulating RNASET2 promoter/enhancer activity, −3.7 kb promoter regions from individuals homozygous for the risk and non-risk alleles were cloned. Sequencing revealed that the 17 bp insertion, Indel 1, located −610 bp from the RNASET2 transcriptional start site (
To assess the potential for SNP 1 and Indel 1 variants (
The functional consequence on gene expression was examined utilizing promoter reporter constructs containing the cloned −3.2 kb genomic region (
The roles of SNP 1 and Indel 1 variants on RNASET2 transcriptional activation was elucidated by using luciferase promoter reporter constructs transfected into primary T cells, shown in
Results show that carriage of the disease risk variant will be associated with attenuated RNASET2 promoter activity. Promoter-reporter analysis has been successful in assessing and predicting promoter-enhancer sequences and has the advantage of allowing examination of transcription in purified primary T cell populations. Thus, in this example, the critical regulatory regions and variant functional effects in regulation of the RNASET2 promoter are characterized and validated.
The data underscore the importance of elucidating the role of RNASET2 expression in the context of disease and strengthen the likelihood that SNP 1 and Indel 1 modulate TF-DNA interactions altering gene expression.
A functional relationship between RNASET2 and ICAM1 was demonstrated. TL1A enhanced IFNγ secretion was accompanied by decreased RNASET2 expression and a concomitant increase in ICAM1 levels. TLIA alone does not promote IFNγ secretion, however does induce early and transient upregulation of ICAM1 mRNA (
T cells were stimulated with TL1A in the presence of LFA1 blocking or IgG control antibody. Cells were gated on the IFN secreting population and then analyzed for single and aggregate cell fractions using propidium iodide. IFNγ secretion was measured in parallel by ELISA. In response to TL1A co-stimulation, the IFNγ producing CD4+ T cells shifted into cellular aggregates. Blocking LFA1/ICAM1 interaction reduced aggregation by 30% (
To verify the direct functional role of RNASET2 in regulation of IFNγ secretion, CM+ T cells obtained from multiple donors were treated with Rnaset2-Fc recombinant protein (
ICAMI plays a key role in facilitating transmigration during inflammation but the molecular mechanisms regulating ICAMI expression remain largely unknown. Chromatin accessibility and repression or activation of transcription is regulated in part through post-translational modification (PTM) of histones via acetylation and methylation of histone residues. The overall methylation status of H3K9, a PTM linked to transcriptional repression, is determined by the enzymatic balance between the methylation ‘writers’ or methyltransferases and ‘erasers’ or demethylases. TNF-a-mediated increase of ICAMI expression in endothelial cells involves dynamic regulation of these enzymes.
IBD is a pathobiologically heterogeneous disease and predicting disease natural history at time of diagnosis and therapeutic outcomes are challenges faced by clinicians. To stratify patient sub-populations and improve ability to predict therapeutic response CD3+ T cells were isolated and purified from peripheral and mucosal specimens from CD patients undergoing surgical intervention for disease management.
Transcriptional profiling was analyzed by RNA-seq. Unsupervised clustering and principal component analysis (PCA) clearly distinguished between gene expression in the periphery versus mucosa (
To establish the role of RNASET2 in modifying IFN secretion, CD4+ T cells from healthy donors were transfected with RNASET2 over-expression vectors or treated with recombinant protein followed by TL1A stimulation of cytokine production. Effect on gene expression was measured by qPCR or ELISA. Specifically, cells were transfected with RNASET2 vectors encoding either wild type (wt) or RNase catalytic mutant proteins to test the direct functional role of RNASET2 in regulation of IFNγ secretion. Over-expression of cytoplasmic RNASET2 was validated by qPCR and enhanced protein secretion using an ELISA developed (detection range 50-500 pg/ml). As shown in Table 2, in 10 out of 12 donors tested, there was a significant decrease (46%, p=0.02) in post-transcriptional regulation of IFNγ secretion, but not mRNA levels, in response to over-expression of full-length endogenous RNASET2 compared to empty vector. In contrast, in cells over-expressing the catalytically inactive RNASET2 protein (in 3 out of 4 donors) no decrease was observed suggesting that the ribonucleolytic activity is essential for regulation of cytokine secretion. For determination of the regulatory potential of exogenous RNASET2, a recombinant-FC fusion protein was generated that was designed to prolong the in-vivo serum protein half-life. Ribonuclease activity was confirmed. Cells were treated with recombinant protein for 1 hour prior to activation. In 5 out of 6 donors tested exogenous recombinant RNASET2 treatment resulted in a significant decrease (average 40%, p=0.03) in IFNγ secretion. No cytotoxic effect was detected.
Together, these results show that enhancement in RNaseT2 protein levels can serve as a regulator of inflammatory response, targeting activated T cells and secretion of IFNγ. This downregulation requires intact ribonucleolytic activity. IFNγ secretion was decreased in response to exogenous recombinant RNASET2 protein. These data support further development of recombinant RNASET2 as a potential therapeutic in an in-vivo IBD animal model(s) to explore its clinical potential to mitigate disease in a defined CD patient subset associated with decreased expression of RNASET2.
To determine whether RNASET2 is an independent hallmark of T cell activation, CD4+ T cells were treated with or without RNASET2 recombinant protein or transfected with over-expression vectors and stimulated with CD3/CD28, PMA/ionomycin or TL1A. Gene expression was measured by qPCR and cytokine production by ELISA. Results showed a decrease in RNASET2 expression (>50%) was observed within 8 hours following stimulation with either CD3/CD28, PMA/ionomycin or TL1A with levels falling below 50% by 24 hrs (
T cells stimulated in the presence of recombinant RNASET2 displayed a dose-dependent suppression of IFN mRNA and secretion. To establish whether the role of RNASET2 in modifying IFN secretion in CD4+ T cells from healthy donors was dose dependent, cells were treated with RNASET2 followed by TL1A stimulation of cytokine production.
A similar decrease in cytokine secretion was observed following over-expression of transfected full-length RNASET2 compared to empty vector (17/21 donors), as seen in
Samples were obtained from give healthy donors, and cells were treated with RNASET2-Fc recombinant protein. IFNγ secretion was measured using an ELISA developed (detection range 50-500 pg/ml). In donors that showed a decrease in IFNγ secretion also showed a corresponding decrease in IFNγ secretion when the same cells were transfected with an overexpression RNASET2 vector or treated with recombinant RNASET2-Fc protein, with or without subsequent treatment with TL1A. FIG.
RNASET2 Risk SNP 1 is Associated with Decreased Plasma RNASET2 Protein Levels
An ELISA assay was developed to examine whether the levels of circulating RNASET2 in blood was associated with disease risk carriage. The standard curve used is shown in
This example shows that down-modulation of RNASET2 is a hallmark of T cell activation. Pro-inflammatory cytokine secretion is suppressed in a dose-dependent and reproducible manner in response to recombinant RNASET2. RNASET2 risk variants are associated with both decreased expression and circulating protein levels. These results taken together with our previous findings highlight the potential of RNASET2 as a precision therapeutic which includes a diagnostic application to select patients who may benefit from a RNASET2 treatment approach.
Single Nucleotide Polymorphisms in cis-eQTL and mQTL with R1VASET2
To identify additional genetic variants that might be useful predictors of decrease in RNASET2 in patients with Crohn's disease, cis expression quantitative trait loci (eQTL) and methylation quantitative trait loci (mQTL) were analyzed. Genetic variants that are associated with expression (eQTL) and methylation (mQTL) of RNASET2, that are predicted to disrupt transcription factor binding are provided in Table 3. Without being bound by any particular theory, the genetic variants provided in Table 3 may be useful in predicting variation in RNASET2 expression as a means for selecting a patient for treatment with therapeutic agent described herein (e.g., RNASET2 agonist, TL1A inhibitor).
TG mice were developed that over-express murine TI1a mice display many of the characteristics associated with CD including fibrosis and stricturing disease. TI1a neutralizing antibodies reduced and reversed proinflammatory cytokine expression, inflammation and fibrosis in both models. In T cells, TL1A expression is inversely correlated with RNASET2 expression. Without being bound by any particular theory, it is hypothesized that mice with overexpression of TI1a would exhibit lower Rnaset2 expression in vivo. RNA from whole ileum and colon samples from WT and TI1a lymphoid TG mice was extracted and Rnaset2 measured by qPCR. Mice that overexpressed TI1a demonstrated reduced Rnaset2 expression in the ileum and colon in the DSS and Rag1−/− transfer models compared to WT (
The data presented above demonstrate genetic, molecular and cellular evidence of a relationship between TNFSF15 and RNASET2 in human in vitro and murine in vivo experimental systems. The results show that risk variants SNP 1/Indel 1 and markers of consequential downstream function define a sub-population of CD.
The data in
Additional characterization of allele-specific TFBS via EMSA analysis through consecutive oligo sequence mutation and competition will be performed. Super-shift assays targeting specific ETS factors or KLF4 will confirm the composite of the variant-specific nucleoprotein complex. Allele-specific TF binding will be verified in a cellular context by CHIP qRT-PCR utilizing T cell samples from individuals homozygous for either the non-risk or risk alleles to confirm inherent differences in DNA sequence preferences.
Several nucleo-protein complexes binding to both variant regions would suggest a multifaceted process of allele-specific regulation. Some of the protein binding seems to be allele-specific while others are indistinguishable. The SNP 1 C/T variant disrupts and shifts the ETS core motif and the DNA conformation. Results will indicate that the Indel 1 17 bp insertion can dramatically alter the DNA conformation and spacing of TF binding motif sequences within the promoter as well. Likewise, the indel possesses a redundant CCCAG motif suggested to facilitate enhancer accessibility and epigenetic remodeling. The EMSA oligos have thus far been designed with the SNP located at the center of each probe. However, additional EMSA oligos will be developed that shift/extend into regions outside of the variant site particularly to accommodate for flanking TFBS which play a critical role in selective ETS factor binding and gene activation. Considering the preliminary data confirming allele-specific nucleo-protein binding and confirmation of ETS1 as a TF binding component, EMSA analysis followed by CHIP qRT-PCR will identify the common and allele-specific TF binding to this region.
Chromosome conformation capture (3C) analysis suggests the physical juxtaposition of enhancer regions with distal target genes via chromosomal looping facilitates regulation of gene expression. 3C will be used to validate the interaction between enhancer variant regions. The presence of 3C-compatible enzyme sites in between SNP 2 and SNP 1 and between SNP 1 and Indel 1 will allow us to distinguish if any (or all) variants interact with SNP 3. SNP 3 will also be investigated to see whether it interacts with the RNASET2 promoter directly. Other candidate regions will be selected based upon functional evidence of significant regulation at the level of gene expression e.g., eQTL and mQTL, and upon display of putative activation marks as determined by “StatePaintR tracks” and data above.
3C is considered a “hypothesis driven” technique in which prior knowledge about the functional elements within target genomic locations is required. Prescreening candidate regions based on our previous functional evidence of eQTL, mQTL and epigenetic activation will enable the successful definition of distal RNASET2 regulatory elements. Physical interactions between the enhancer-enhancer regions adjacent to Indel 1/SNP 1/SNP 2 and SNP 3 and between SNP 3 and the RNASET2 promoter in which not only eQTL data, but also clinical indicators that correlate with disease severity, will be analyzed. A selective choice of 3 C-compatible enzymes will discriminate between interactions of Indel 1, SNP 1 and/or SNP 2. It is possible that additional enhancer/regulatory regions will impact RNASET2 expression. Because 3C is limited to pair-wise interaction and is constrained to genomic distance <1 MB, if needed, 4C analysis to expand and identify intra- and inter-chromosomal interactions will be performed.
The TFs participating in TL1A-mediated expression of the RNASET2 promoter-enhancer and the functional impact of risk and non-risk variants will be examined and defined. The allele-specific pattern of nuclear proteins binding to defined regions identified will be compared following TL1A stimulation and kinetics in the alteration of nucleo-complex formation assessed. A parallel series of transfections with promoter-reporter constructs as well as wt and mut TF expression will be carried out comparing expression of the numerous constructs to determine which of the known cis-regulatory regions identified participate in TL1A-mediated expression of the RNASET2 promoter and IFNγ secretion. These studies will yield important information regarding the identity of cooperative binding regions.
Preliminary data indicate allele-specific nucleoprotein complex formation as well as a decrease of enhancer-promoter activity when comparing the SNP 1 and Indel 1 risk and non-risk variants. Both SNP 1 and Indel 1 are strong candidates as functional/causal variants based upon multiple lines of evidence: 1) they are in strong linkage disequilibrium (LD) (r2=1) with the RNASET2 IBD index SNP (SNP 2); 2) eQTL and mQTL data associated with altered gene expression and methylation have been reported for the index SNP; 3) functional annotation suggests they are located in an active T cell enhancer-promoter region; 4) the variants disrupt multiple overlapping TFBS in particular members of the ETS family; 5) the nucleotide variations are predicted to distort 3 dimensional DNA conformation. TL1A-mediated alteration in the nucleoprotein and expression patterns is expected, particularly considering the correlation of ETS expression with RNASET2, and the fact that TLIA diminishes the level of ETS expression in IFNγ secreting cells.
Findings show a relationship between decreased RNASET2, enhanced ICAM1, cellular aggregation and IFNγ secretion. The specific molecular mechanisms by which downregulation of RNASET2 influences the expression of ICAMI will be further explored. By further defining the interface between TL1A-mediated downregulation of RNASET2 and LFA1/ICAM1-mediated T cell-T cell interactions, further understanding of the enhanced TL1A-mediated IFNγ production will be obtained to uncover additional molecules and signaling pathways thereby increasing our repertoire of therapeutic targets.
Identify the Molecular Events Involved in Altered ICAM1 Expression Resulting from Reduced RNASET2 Expression
Whether the effect of RNASET2 downregulation on ICAM1 expression is multifaceted, involving coordinated kinetic interplay of transcriptional upregulation and mRNA stability, resulting in regulation of ICAM1 gene expression and protein production will be investigated.
To identify the roles of transcriptional upregulation versus mRNA stabilization as mechanisms of increased ICAMI expression, kinetics of ICAM1 mRNA expression will be determined. The rate of ICAM1 mRNA transcription and post transcriptional modulation of stability will be examined using 4-thiouridine (4sU) incorporation, a naturally occurring uridine analog that is incorporated into nascent mRNA. Isolation of total RNA is followed by thiol-biotinylation and streptavidin bead separation of newly transcribed (4SU-tagged) from existing (un-tagged) mRNA.41 qPCR will then be performed on each population of RNA. Overall expression is calculated based on total RNA. Changes in transcription rate are calculated based on 4sU fraction of mRNA and the rate of mRNA decay/stabilization as a function of the ratio of 4sU-tagged to un-tagged mRNA. This technique has been used effectively to quantitate the rates of mRNA synthesis and decay in purified T cells. CD4+ T cells will be treated with IL12/IL18 or TL1A alone or in combination. Kinetics and peak expression of ICAM1 mRNA expression will be assayed by qPCR. Alteration in the rate of mRNA transcription and decay will be analyzed following washout of the stimulatory cytokine cocktail (TL1A, IL2 & IL18). Kinetics of ICAM1 protein levels measured by flow cytometry (FCM) will be correlated with mRNA expression. The direct impact of RNASET2 on ICAM1 mRNA upregulation and stability will be tested in cells following siRNA knockdown.
It is expected that TLIA and RNASET2 contributes to regulation of ICAMI expression. In other cell types a low basal level of ICAM1 expression is generally observed which increases substantially in response to immune activation and inflammation. While exposure to TLIA alone does not elicit IFNγ expression or regulation of RNASET2 expression, the preliminary data (
Whether RNASET2 downregulation induces LFA1 activation triggering and promoting LFA1/ICAM1 binding that augments TL1A-mediated ICAM1 expression will be investigated. The experiments are designed to characterize the crosstalk between LFA1 and RNASET2 resulting in T cell aggregation and cytokine secretion and to assess the effect of LFA1 activation on ICAM1 expression. An evaluation of TL1A-mediated intracellular IFNγ expression and cellular aggregation will be performed. The effect of TL1A and siRNA-mediated decrease in RNASET2 on LFA1 activation will be measured with an antibody specific for the active form of LFA1 (KIM127 or 327C) by FCM. Overexpression of RNASET2 or treatment with recombinant protein results in inhibition of IFNγ secretion in stimulated CD4+ T cells (
A conformational change leading to LFA1 activation is an integral component of TLIA-mediated decreased expression of RNASET2 resulting in downstream enhancement of cellular aggregation events and IFNγ secretion is expected. Thus, silencing of RNASET2 may well increase LFA1 activation. FCM using multi-staining of cells for IFNγ, RNASET2 and activated LFA1 will allow identification of T cell subset(s) and will measure cellular aggregation and LFA1 activation within this population. TCR activation studies indicate that LFA1 activation and ICAM1 upregulation are interdependent, and this relationship is anticipated to also apply to homotypic T cell interaction. Thus, ICAM1 silencing is expected to reduce LFA1 activation and inhibition of LFA1/ICAM1 interaction to reduce ICAM1 expression in TLIA stimulated cells.
Determine the Involvement of Actin Cytoskeleton in Enhanced Cellular Aggregation and LFA1/ICAM1 Interaction Resulting from Down-Regulated RNASET2
Whether TL1A-mediated cellular aggregation via LFAVICAM1 interaction, requires actin cytoskeleton rearrangement and decreased RNASET2 enables this process will be investigated. Using findings above, and the kinetics defined therein, the dynamics of the T cell cytoskeleton rearrangement in response to TL1A-mediated decrease in RNASET2 will be characterized in T cells stimulated in the presence or absence of TL1A and sorted into IFNγ-secreting and non-secreting subsets as described above. Cells will be fixed and actin cytoskeleton will be stained (fluorescently tagged phalloidin) and imaged via confocal microscopy to assess alterations in the pattern of actin filaments and stress fibers. Cytochalasin, will be used to inhibit actin polymerization and evaluate the role of actin cytoskeletal rearrangement in regulating T cell aggregation, LFA1 activation and ICAM1 expression in particular in the context of TL1A-mediated IFNγ expression and secretion. The direct role of RNASET2 in maintaining cytoskeletal structures will be examined in cells transfected with fluorescently tagged over-expressing RNASET2 vector or control vector prior to TL1A co-stimulation. Actin cytoskeleton will be imaged and membrane and cytosolic fractions will be isolated and assayed by western blot.
Ribonuclease T2 proteins are highly conserved among the phyla from viruses to humans suggesting an important evolutionary function. The parasite ribonuclease T2 protein, Omega-1 and fungal ACTIBIND bind actin and affect cytoskeletal organization. More recent studies have shown a role for RNASET2 in actin organization in human cancer cells and ability to bind to actin in vitro. Exposure to TL1A is expected to trigger cytoskeletal reorganization and actin recruitment to the membrane and overexpression of RNASET2 will inhibit this process. Likewise, it is anticipated that actin reorganization will affect downstream pathways including LFA1 activation, ICAM1 expression, cellular aggregation and ultimately IFNγ secretion.
Whether TL1A-mediated downregulation of RNASET2 is associated with epigenetic alterations in histone methylation of ICAM1 thereby inducing enhanced expression, will be investigated. The initial studies will focus on testing the role of RNASET2 in regulating of H3K9 methylation. T cells will be stimulated in the presence or absence of TLIA. The kinetics of ICAMI expression will determine the duration of treatment. The level of histone modification will be assayed using a histone multiplex bead-based ELISA Assay. The role of RNASET2 will be determined following siRNA mediated knockdown. Once an association of RNASET2 with the specific H3K9 modification is established, the ICAM1 promoter region involved will be identified through ChIP analysis and alteration in the histone binding levels will be validated. Epigenetic dysregulation in cancer has been investigated extensively and several specific pharmacological inhibitors disrupting histone methylation have been developed for clinical trials. These inhibitors, together with histone methylase/demethylase over-expression vectors, and siRNA knockdown will allow evaluation of the specificity of histone modification affecting RNASET2 mediated enhancement of ICAMI expression. In parallel, how alteration of histone methylase/demethylase affects downstream T cell aggregation and cytokine secretion will be evaluated.
It is anticipated that RNASET2-mediated enhanced ICAM1 expression involves epigenetic modulation of the ICAM1 promoter region. Based on the preliminary data (
Whether allele-specific expression of RNASET2 risk polymorphisms reflects its functional consequence in the context of disease and in response to exposure to TL1A will be investigated. Evaluation of potential for differential ASE of RNASET2 in T cells isolated from CD patients stimulated with or without TLIA in an in-vitro system, 2) assessment and comparison of ASE of RNASET2 in purified CD3+ T cells isolated from peripheral and mucosal samples from CD patients at the time of surgery, will be performed.
Evaluate Potential for Differential ASE of RNASET2 in T Cells Isolated from CD Patients Stimulated with or without TL1A in an In-Vitro System
The pattern of ASE will be compared with or without exposure to TLIA to measure whether TLIA influences allelic imbalance in expression. These studies will provide a complementary index to those of Aim 1 and establish the functionality of RNASET2 risk variants in cells isolated from CD patients and in response to TLIA. Moreover, the findings will provide the groundwork for the studies in Aim 3a2 to establish the molecular consequence of RNASET2 risk variants using cells isolated from patients at the time of surgery, which may be reflective of prior exposure in vivo to TLIA.
ASE will be assayed according to an innovative qPCR. Expression of the two alleles are assayed in a multiplex reaction using an adaptation of TaqMan SNP genotyping assay. A common primer pair is used to amplify the cDNA and allele-specific TaqMan probes labeled with either FAM or VIC discriminate and selectively detect the two allele transcripts. Because the candidate causal variants reside within a non-coding region common C/A SNP, SNP 4, was discovered in the 5′ UTR of RNASET2 that is in strong LD (R2=0.99) as a surrogate marker (
To identify allele-specific expression in the patient clusters, RNA-seq data generated from 101 paired samples of purified CD3+ T cell populations from gut mucosa and peripheral blood (202 total) will be utilized. With these datasets, whether GWAS risk alleles (present in RNASET2 transcripts as variants in LD with the causal allele) are differentially expressed in both populations of T cells will be tested. A second possibility is that T cell populations exhibit different expression profiles to meet the different physio-biological requirements of the microenvironment. The differential expression of transcription factors between peripheral T cells and gut T cells leads to TF-dependent RNASET2 deficiency in affected patient populations specifically in the gut due to reduced binding at the GWAS associated risk alleles will also be tested. The families of expressed transcription factors, (e.g. ETS1) previously identified from our MotifbreakR analysis of motif disruption will be the focus of this study. To accomplish these tasks, variants will be called following guidelines outlined by the Genome Analysis Toolkit (GATK) for best practices with RNA-seq. Briefly, the raw sequencing files were originally processed using Star-seq and will be analyzed with the HaplotypeCaller (HC) pipeline in RNA-seq mode. HC performs graph-based reassembly to account for splice junctions and other artifacts that result in false negative calls from the sequence alignment steps. Using essentially the same strategy outlined in SA3a1 (
Evaluate Therapeutic Potential of Recombinant RNASET2 (and Other Identified Therapeutic Targets) to Modify Inflammatory Response Using In-Vivo TL1A Over-Expressing and Knockout Mouse Models with Many of the Characteristics Associated with CD
The human RNASET2 gene encodes a highly conserved secreted ribonuclease with oncosuppressive activity. Secretion of RNASET2 triggers cellular migration of monocytes/macrophages into the tumor mass. Additionally, RNASET2 regulates cytoskeletal-action assembly thus supporting an interactive role for RNASET2 with intracellular and extracellular components. However, the ribonuclease catalytic activity is not required for either tumor suppressor or actin binding functions. Recombinant RNASET2 penetrates the cell membrane and can affect actin cytoskeleton reorganization. The efficacy of human recombinant RNASET2 in inhibiting tumor growth, cytoskeletal reorganization and inflammatory response has been demonstrated in a number of disease models supports the potential for RNASET2 as a soluble therapeutic drug.
Data disclosed herein showed that under colitogenic conditions (DSS and adoptive T-cell transfer models) constitutive expression of TI1a led to the development of chronic intestinal inflammation and fibrosis and is accompanied by reduced expression of Rnaset2 compared to wild-type littermates (
A mouse construct was generated for this purpose designated as Rnaset2:pFUSE-mIgG1-Fc2 (Rnaset2:Fc,
A knockout mouse in which TI1a expression has been deleted from all tissue was generated. This mouse will be used in chronic DSS and transfer TI1a/RAG double knock out colitis models to identify TI1a specific versus global activation pathways regulating Rnaset2 expression.
A phase 1 clinical trial is performed to evaluate the safety, tolerability, pharmacokinetics and pharmacodynamics of a modulator of RNASET2 activity or expression on subjects having moderate to severe Crohn's disease.
Single ascending dose (SAD) arms: Subjects in each group (subjects are grouped based on the presence Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, and/or a SNP provided in Table 3, receive either a single dose of the modulator of RNASET2 or a placebo. Exemplary doses are 1, 3, 10, 30, 100, 300, 600 and 800 mg of modulator of RNASET2. Safety monitoring and PK assessments are performed for a predetermined time. Based on evaluation of the PK data, and if the modulator of RNASET2 is deemed to be well tolerated, dose escalation occurs, either within the same groups or a further group of healthy subjects. Dose escalation continues until the maximum dose has been attained unless predefined maximum exposure is reached or intolerable side effects become apparent.
Multiple ascending dose (MAD) arms: Subjects in each group (subjects are grouped based on the same criteria as above) receive multiple doses of the modulator of RNASET2 or a placebo. The dose levels and dosing intervals are selected as those that are predicted to be safe from the SAD data. Dose levels and dosing frequency are chosen to achieve therapeutic drug levels within the systemic circulation that are maintained at steady state for several days to allow appropriate safety parameters to be monitored. Samples are collected and analyzed to determination PK profiles.
Inclusion Criteria: Healthy subjects of non-childbearing potential between the ages of 18 and 55 years. Healthy is defined as no clinically relevant abnormalities identified by a detailed medical history, full physical examination, including blood pressure and pulse rate measurement, 12 lead ECG and clinical laboratory tests. Female subjects of non-childbearing potential must meet at least one of the following criteria: (1) achieved postmenopausal status, defined as: cessation of regular menses for at least 12 consecutive months with no alternative pathological or physiological cause; and have a serum follicle stimulating hormone (FSH) level within the laboratory's reference range for postmenopausal females; (2) have undergone a documented hysterectomy and/or bilateral oophorectomy; (3) have medically confirmed ovarian failure. All other female subjects (including females with tubal ligations and females that do NOT have a documented hysterectomy, bilateral oophorectomy and/or ovarian failure) will be considered to be of childbearing potential. Body Mass Index (BMI) of 17.5 to 30.5 kg/m2; and a total body weight >50 kg (110 lbs). Evidence of a personally signed and dated informed consent document indicating that the subject (or a legal representative) has been informed of all pertinent aspects of the study.
Two groups of subjects are selected: (i) subjects having Indel 1I (where, for example, is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, and/or a SNP provided in Table 3, (ii) and subjects lacking the risk variant.
Exclusion Criteria: Evidence or history of clinically significant hematological, renal, endocrine, pulmonary, gastrointestinal, cardiovascular, hepatic, psychiatric, neurologic, or allergic disease (including drug allergies, but excluding untreated, asymptomatic, seasonal allergies at time of dosing). Subjects with a history of or current positive results for any of the following serological tests: Hepatitis B surface antigen (HBsAg), Hepatitis B core antibody (HBcAb), anti-Hepatitis C antibody (HCV Ab) or human immunodeficiency virus (HIV). Subjects with a history of allergic or anaphylactic reaction to a therapeutic drug. Treatment with an investigational drug within 30 days (or as determined by the local requirement, whichever is longer) or 5 half-lives or 180 days for biologics preceding the first dose of study medication. Pregnant females; breastfeeding females; and females of childbearing potential.
Primary Outcome Measures: Incidence of dose limiting or intolerability treatment related adverse events (AEs) [Time Frame: 12 weeks]. Incidence, severity and causal relationship of treatment emergent AEs (TEAEs) and withdrawals due to treatment emergent adverse events [Time Frame: 12 weeks]. Incidence and magnitude of abnormal laboratory findings [Time Frame: 12 weeks]. Abnormal and clinically relevant changes in vital signs, blood pressure (BP) and electrocardiogram (ECG) parameters [Time Frame: 12 weeks].
Secondary Outcome Measures: Single Ascending Dose: Maximum Observed Plasma Concentration (Cmax) [Time Frame: 12 weeks]. Single Ascending Dose: Time to Reach Maximum Observed Plasma Concentration (Tmax) [Time Frame: 12 weeks]. Single Ascending Dose: Area under the plasma concentration-time profile from time zero to 14 days (AUC14 days) [Time Frame: 12 weeks]. Single Ascending Dose: Area under the plasma concentration-time profile from time zero extrapolated to infinite time (AUCinf) [Time Frame: 12 weeks]. Single Ascending Dose: Area under the plasma concentration-time profile from time zero to the time of last quantifiable concentration (AUClast) [Time Frame: 12 weeks]. Single Ascending Dose: Dose normalized maximum plasma concentration (Cmax[dn]) [Time Frame: 12 weeks]. Single Ascending Dose: Dose normalized area under the plasma concentration-time profile from time zero extrapolated to infinite time (AUCinf[dn]) [Time Frame: 12 weeks]. Single Ascending Dose: Dose normalized area under the plasma concentration-time profile from time zero to the time of last quantifiable concentration (AUClast[dn]) [Time Frame: 12 weeks]. Single Ascending Dose: Plasma Decay Half-Life (t½) [Time Frame: 12 weeks]. Plasma decay half-life is the time measured for the plasma concentration to decrease by one half. Single Ascending Dose: Mean residence time (MRT) [Time Frame: 12 weeks]. Single Ascending Dose: Volume of Distribution at Steady State (Vss) [Time Frame: 6 weeks]. Volume of distribution is defined as the theoretical volume in which the total amount of drug would need to be uniformly distributed to produce the desired blood concentration of a drug. Steady state volume of distribution (Vss) is the apparent volume of distribution at steady-state. Single Ascending Dose: Systemic Clearance (CL) [Time Frame: 6]. CL is a quantitative measure of the rate at which a drug substance is removed from the body.
Multiple Ascending Dose First Dose: Maximum Observed Plasma Concentration (Cmax) [Time Frame: 12 weeks]. Multiple Ascending Dose First Dose: Time to Reach Maximum Observed Plasma Concentration (Tmax) [Time Frame: 12 weeks]. Multiple Ascending Dose First Dose: Area under the plasma concentration-time profile from time zero to time τ, the dosing interval where τ=2 weeks (AUCτ) [Time Frame: 12 weeks]. Multiple Ascending Dose First Dose: Dose normalized maximum plasma concentration (Cmax[dn]) [Time Frame: 12 weeks]. Multiple Ascending Dose First Dose: Dose normalized Area under the plasma concentration-time profile from time zero to time T, the dosing interval where τ=2 weeks (AUCτ[dn]) [Time Frame: 12 weeks]. Plasma Decay Half-Life (t½) [Time Frame: 12 weeks]. Plasma decay half-life is the time measured for the plasma concentration to decrease by one half. Multiple Ascending Dose First Dose: Mean residence time (MRT) [Time Frame: 12 weeks]. Apparent Volume of Distribution (Vz/F) [Time Frame: 12 weeks]. Volume of distribution is defined as the theoretical volume in which the total amount of drug would need to be uniformly distributed to produce the desired plasma concentration of a drug. Apparent volume of distribution after oral dose (Vz/F) is influenced by the fraction absorbed. Multiple Ascending Dose First Dose: Volume of Distribution at Steady State (Vss) [Time Frame: 12 weeks]. Volume of distribution is defined as the theoretical volume in which the total amount of drug would need to be uniformly distributed to produce the desired blood concentration of a drug. Steady state volume of distribution (Vss) is the apparent volume of distribution at steady-state. Multiple Ascending Dose First Dose: Apparent Oral Clearance (CL/F) [Time Frame: 12 weeks]. Clearance of a drug is a measure of the rate at which a drug is metabolized or eliminated by normal biological processes. Clearance obtained after oral dose (apparent oral clearance) is influenced by the fraction of the dose absorbed. Clearance is estimated from population pharmacokinetic (PK) modeling. Drug clearance is a quantitative measure of the rate at which a drug substance is removed from the blood. Multiple Ascending Dose First Dose: Systemic Clearance (CL) [Time Frame: 12 weeks]. CL is a quantitative measure of the rate at which a drug substance is removed from the body.
Multiple Ascending Dose Multiple Dose: Maximum Observed Plasma Concentration (Cmax) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Time to Reach Maximum Observed Plasma Concentration (Tmax) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Area under the plasma concentration-time profile from time zero to time τ, the dosing interval where τ=2 weeks (AUCτ) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Dose normalized maximum plasma concentration (Cmax[dn]) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Dose normalized Area under the plasma concentration-time profile from time zero to time t, the dosing interval where τ=2 weeks (AUCτ[dn]) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Plasma Decay Half-Life (t½) [Time Frame: 12 weeks]. Plasma decay half-life is the time measured for the plasma concentration to decrease by one half. Multiple Ascending Dose Multiple Dose: Apparent Volume of Distribution (Vz/F) [Time Frame: 12 weeks]. Volume of distribution is defined as the theoretical volume in which the total amount of drug would need to be uniformly distributed to produce the desired plasma concentration of a drug. Apparent volume of distribution after oral dose (Vz/F) is influenced by the fraction absorbed. Multiple Ascending Dose Multiple Dose: Volume of Distribution at Steady State (Vss) [Time Frame: 12 weeks]. Volume of distribution is defined as the theoretical volume in which the total amount of drug would need to be uniformly distributed to produce the desired blood concentration of a drug. Steady state volume of distribution (Vss) is the apparent volume of distribution at steady-state.
Multiple Ascending Dose Multiple Dose: Apparent Oral Clearance (CL/F) [Time Frame: 12 weeks]. Clearance of a drug is a measure of the rate at which a drug is metabolized or eliminated by normal biological processes. Clearance obtained after oral dose (apparent oral clearance) is influenced by the fraction of the dose absorbed. Clearance was estimated from population pharmacokinetic (PK) modeling. Drug clearance is a quantitative measure of the rate at which a drug substance is removed from the blood. Multiple Ascending Dose Multiple Dose: Systemic Clearance (CL) [Time Frame: 12 weeks]. CL is a quantitative measure of the rate at which a drug substance is removed from the body. Multiple Ascending Dose Multiple Dose: Minimum Observed Plasma Trough Concentration (Cmin) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Average concentration at steady state (Cav) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Observed accumulation ratio (Rac) [Time Frame: 12 weeks]. Multiple Ascending Dose Multiple Dose: Peak to trough fluctuation (PTF) [Time Frame: 12 weeks]. Multiple Ascending Dose Additional Parameter: estimate of bioavailability (F) for subcutaneous administration at the corresponding intravenous dose [Time Frame: 12 weeks]. Immunogenicity for both Single Ascending Dose and Multiple Ascending Dose: Development of anti-drug antibodies (ADA) [Time Frame: 12 weeks].
A phase 1b clinical trial is performed to evaluate efficacy of a modulator of RNASET2 activity or expression on subjects having moderate to severe Crohn's disease. Arms: 10 patients positive for Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C are administered the modulator of RNASET2. 5-10 patients negative for the Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C are administered the modulator of RNASET2. Patients are monitored in real-time. Central ready of endoscopy and biopsy is employed, with readers blinded to point of time of treatment and endpoints.
Inclusion Criteria: Two groups of subjects are selected: (i) subjects having Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C, and (ii) subjects lacking the risk variant.
Primary Outcome Measures: Simple Endoscopic Score for Crohn's Disease (SESCD), Crohn's Disease Activity Index (CDAI), and Patient Reported Outcome (PRO). If risk either positive group shows 50% reduction from baseline, a Phase 2a clinical trial is performed.
Inclusion Criteria: PRO entry criteria: Abdominal pain score of 2 or more and/or stool frequency score of 4 or more. Primary outcome would be pain core of 0 or 1 and stool frequency score of 3 or less with no worsening from baseline. Endoscopy entry criteria: SESCD ileum only entry at score of 4 and 6 if colon is involved. Primary endoscopic outcome is 40-50% delta of mean SESCD.
A phase 2a clinical trial is performed to evaluate the efficacy of a modulator of RNASET2 activity or expression in subjects having an moderate to severe Crohn's disease.
Arms: 40 patients per arm (modulator of RNASET2 and placebo arms) are treated with modulator of RNASET2 or placebo for 12 weeks. An interim analysis is performed after 20 patients from each group are treated at the highest dose to look for a 40-50% delta between placebo and treated group in primary outcome (50% reduction from baseline in SESCD, CDAI, and PRO).
Primary Outcome Measures: Simple Endoscopic Score for Crohn's Disease (SESCD), Crohn's Disease Activity Index (CDAI), and Patient Reported Outcome (PRO).
Inclusion Criteria: PRO entry criteria: Abdominal pain score of 2 or more and/or stool frequency score of 4 or more. Primary outcome would be pain core of 0 or 1 and stool frequency score of 3 or less with no worsening from baseline. Endoscopy entry criteria: SESCD ileum only entry at score of 4 and 6 if colon is involved. Primary endoscopic outcome is 40-50% delta of mean SESCD.
A moderate to severe inflammatory bowel disease (IBD), including moderate to severe Crohn's disease or ulcerative colitis, is treated in a subject, by first, determining the RNASET2 risk genotype of the subject. Optionally, the subject is, or is susceptible to be, non-responsive to certain therapies such as anti-TNF, steroids, or immunomodulators, such as those disclosed herein. A sample of whole blood is obtained from the subject. An assay is performed on the sample obtained from the subject to detect a presence or absence of Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C by Illumina ImmunoArray or polymerase chain reaction (PCR) under standard hybridization conditions. In addition, or alternatively, a sample of intestinal tissue is obtained from the subject.
The subject is determined to have, or be at risk for developing, moderate to severe IBD (e.g., CD or UC), if the Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C is detected in the sample obtained from the subject. A therapeutically effective amount of an activator of RNASET2 is administered to the subject, provided the subject is determined to have the Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, SNP 4C, and/or a SNP provided in Table 3.
The presence or absence of Indel 1I (where, for example, I is an insertion comprising or consisting of CCAGGGCTGGGTGAGGG (SEQ ID NO: 425)), SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C genotype in a subject is performed by quantitative polymerase chain reaction (qPCR).
Complementary DNA (cDNA) is generated using reverse transcription (see for e.g., High Capacity cDNA Reverse Transcription Kit, ThermoFischer) from Genomic DNA that is purified from a serum sample of the subject. The cDNA is aliquoted into a well of a PCR plate or a PCR tube. A mixture comprising the cDNA, primers, probes comprising a nucleic acid sequence complementary to Indel 1I, SNP 1T, SNP 2T, SNP 3G, SNP 4G, and/or SNP 4C (e.g., SEQ ID NO: 5-10), and TaqMan master mix is prepared, and an aliquot of the mixture is added to the PCR well or tube comprising DNA. qPCR is performed as follows: 95° C. for 10 minutes; 40 cycles of 95° C. for 0.15 seconds and 60° C. for 1 minute; and hold at 4° C. The reporter dye is FAM, and the quenching dye is MGB-NFQ.
The number of cycles required to reach the cycle threshold (Ct) is evaluated, where Ct values below 30 cycles indicate presence of the genotype. The subject has a Ct value below 30 cycles.
A subject having a presence of an RNASET2 risk genotype, as measured using methods described in Example 15, is treated with an anti-TL1A or anti-DR3 antibody disclosed in Table 1. Alternatively, or in addition, the subject having a presence of the RNASET2 risk genotype is treated with a RNASET2 agonist, such as the RNASET-Fc protein described herein.
Samples were taken from both normal patients (NL) and CD subjects at the time of surgery, as well as at first and second followup appointments. RNASET2 risk and non-risk genotypes were measured as described in Example 15. Circulating RNASET2 levels were measured using ELISA.
In serum, there was a significant increase of circulating RNASET2 levels in non-risk patients with a risk profile compared to risk patients (see
Moreover, circulating RNASET2 levels were found to increase following surgery in all populations, as depicted in
RNASET2 is the only human member of the Rh/T2/S family of acidic hydrolases. The functional role of RNASET2 in disease pathogenesis remains poorly defined before the present disclosure. Moreover, the cis-and trans-regulatory regions of RNASET2 are largely unknown before the present disclosure. TL1A, the protein encoded by TNFSF15, is a key mediator of mucosal inflammation. In IBD patients, elevated TL1A levels correlate with TNFSF15 genotype and disease severity. Crohn's disease (CD) patients with elevated serum/tissue levels of TL1A have increased risk of developing fibrosis/stricturing disease behavior. The disclosure provides that, in T cells, there is a functional and biological relationship between RNASET2 and TL1A-mediated enhancement of IFN-γ production, a key mediator of mucosal inflammation. The disclosure further provides that down-modulation of RNASET2 expression occurs following TL1A mediated T-cell stimulation. As is clear from the present disclosure, RNASET2 disease-risk variants are functionally associated a decrease in its expression in peripheral and mucosal tissues and with DNA hyper-methylation. Further described in this disclosure, RNASET2 disease-risk variants are associated in CD patients and a more complicated/resistant disease course. The disclosure thus provides that, in CD, T cell mediated inflammation resulting in a decrease in RNASET2 expression can underlie a complicated disease pathology.
In this and the following Examples (Examples 18-21), the inventors studied and identified the contribution of cis- and trans-acting variants in regulating RNASET2 expression. The disclosure demonstrates RNASET2 allelic imbalance in transcription factor complex formation, promoter transactivation and allele-specific expression. Decreased expression of RNASET2 is a general feature accompanying T-cell activation. The inventors demonstrate for the first time that the levels of circulating RNASET2 are associated with allelic carriage. As additionally described herein, circulating RNASET2 levels differ when comparing CD patients to healthy control subjects and in disease when computing CD pre-operative to post-operative levels. Finally, the disclosure demonstrates the therapeutic feasibility of recombinant RNASET2 to attenuate proinflammatory cytokine secretion.
Study Methods for this and the Following Examples (Examples 19-21)
Study Subjects:
Subjects were recruited through the Cedars-Sinai MIRIAD IBD Biobank at the F. Widjaja Foundation Inflammatory Bowel and Immunobiology Research Institute. Control subjects had no known personal or family history of autoimmune disease or IBD. Informed consent (approved by the Cedars-Sinai Institutional Review Board) was provided by all participating subjects. Genotyping for RNASET2 rs1819333 was as previously described (Gonsky R, et al. Gastroenterology 2017; 153:219-232, which is hereby incorporated in its entirety by reference). Linkage of rs1819333 risk-allele to rs16900967 indel 17 bp insertion was initially shown by assessing PCR product size, using the following primers: FWD: 5′-CCCACAGAGATGACTTCCG-3′ (SEQ ID NO:395) REV: 5′-GGAGCACCAACATTC CTAGA-3′ (SEQ ID NO:396), and validated in 339 IBD and non-IBD subject samples using an ABI custom designed genotyping assay.
Isolation of PBMC, Blood Plasma and CD4+ T Cells:
Peripheral blood mononuclear cells (PBMC) and plasma were isolated from healthy volunteers or IBD patients by separation on Ficoll-Hypaque gradients. CD4+ T were isolated using negative selection with magnetic beads (Stemcell Technologies, Vancouver, BC, Canada) and were at least 95% pure.
Gel Mobility Electrophoretic Shift Assay (EMSA):
Nuclear extract proteins isolated from CD4+ T cells (3-6 μg) were incubated at 25° C. with 0.25 mg/ml poly (dI-dC), in 20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris pH 7.5 for 10 min. Oligonucleotides 5′-IRD700-labeled (Integrated DNA Technology, Coraville, Iowa) (250 fmol) were then added and the binding reactions incubated for an additional 30 min. Specificity was determined by the addition of excess unlabeled oligonucleotide as competitor. Gel supershift assays were conducted by the addition of ETS1 Abs (Santa Cruz Biotechnology, Santa Cruz, Calif.) in the binding mixture prior to adding labeled oligonucleotide. The DNA-protein complexes were separated from unbound probe on a pre-run native 6% polyacrylamide gel in low ionic strength buffer (22.3 mM Tris pH 7.4, 22.3 mM Borate, 0.5 mM EDTA pH 8.0) and analyzed with Odyssey infrared imaging system (Li-Cor Biosciences). The oligonucleotides used were:
Quantitative PCR:
Total RNA from PBMC or CD4+ T cells was extracted using RNAeasy plus mini kit (Qiagen Germantown Md.). 1 μg total RNA was reverse-transcribed using Omniscript kit (Qiagen) and template cDNA was mixed in FastStart SYBR Green reagent (Sigma St. Luis, Mo.) with the following primer sets:
Reaction was loaded onto Mastercycler ep Realplex System (Eppendorf Enfield, CT). Expression levels of each gene were normalized to that of ACTB.
Allele Specific Expression (ASE):
ASE was assayed according to quantitative real-time TaqMan assay as previously described (Soldner F, et al. Nature 2016; 533:95-9, which is hereby incorporated in its entirety by reference). Because the candidate causal variant resides within a non-coding region a common C/A SNP, rs1044059, in the 5′ UTR of RNASET2 that is in strong LD (R2=0.99) was used as a surrogate marker. Real-Time TaqMan assay for rs1044059 (Applied Biosystems, Carlsbad Calif.) was used with the VIC-TaqMan probe detecting the A, non-risk allele, and FAM-TaqMan probe detecting the C, risk allele transcript. Sequential dilution of samples from healthy subjects homozygous for either the A-allele or C-allele were used to validate assay for probe efficiency (
Generation of Promoter-Reporter Constructs:
RNASET2 promoter regions were PCR amplified from genomic DNA isolated from individuals identified as risk and non-risk for rs1819333. Fragments spanned regions −4.0 kb, −3.6 kb and −1 kb to −162 bp. PCR products were digested with KpNI and ligated into KpnI/EcoRV cut pGL4.23 luciferase reporter vector. Primers used for amplification were: KpNI-T2P-4 kb FWD 5′-TTTGGTACCAGTGGCATCTGACGCATAG-3′ (SEQ ID NO:415); KpNI-T2P-3.6 kb FWD 5′-TTTGGTACCAGACCCAAATCCAGCCTT-3′ (SEQ ID NO:416); KpNI-T2-Promoter 1 kb FWD 5′-AAAGGTACCAAGGTGGGGCTGACATGA-3′ (SEQ ID NO:417); T2P REV 5′-GACGGCCTAAACCAGTATCTC-3′ (SEQ ID NO:418). The 17 bp indel was deleted from risk promoter constructs using Quickchange Site-directed mutagenesis kit (Agilent La Jolla, Calif.). Indel deletion primers were: FWR 5′-GGGGCAGGTGAGGCCCAGGCCCTTCTAG-3′ (SEQ ID NO:419) and REV 5′-CTAGAAGGGCCTGGGCCTCACCTGCCCC-3′ (SEQ ID NO:420). Deletion of indel was validated by sequencing.
Luciferase Assay:
CD4+ T cells transfected using a technique modified from that described previously (Hughes C C, et al. J Biol Chem 1996; 271:5369-77, which is hereby incorporated in its entirety by reference). Briefly, freshly isolated cells were rested overnight then washed and resuspended in 250 μl fresh medium at 2×107 cells/ml and electroporated in the presence of 50 μg of reporter construct (600 V, for 9 pulses of 500 μsec, with 100 μsec between pulses) using 4 mm (gap width) cuvettes in a BTX Electro Square Porator ECM 830 (Genetronics, Inc., San Diego, Calif.). A control plasmid containing the β-actin promoter driving a Renilla luciferase (provided by Dr. Christopher Wilson, University of Washington) was co-transfected as an internal standard and values were normalized to correct for transfection efficiency. After electroporation, the cells were diluted in fresh medium, allowed to rest for 1 h prior to plating, and then stimulated with 100 ng/ml TL1A (Fitzgerald, Concord, Mass.) plus 0.5 ng/ml IL12 (Peprotech Rocky Hill, N.J.) and 50 ng/ml IL18 (MBL Woburn, Mass.) for 4 h. Luminescence was measured using a Promega (Madison, Wis.) dual-luciferase assay kit and counted on the CLARIOstar microplate reader (BMG Labtech Cary, N.C.). Relative luciferase activity was quantified by dividing values for each promoter construct assay by levels with empty pGL4.23 vector.
4-Thiouridine (4SU) Labeling and Separation of Nascent and Pre-Existing RNA:
4SU metabolic labeling was performed as described in Garibaldi et al. (methods mol Biol 2017). Briefly, 250 uM 4SU were added to cultured PBMC 4 h prior to harvest time. Cells were lysed in Trizol and total RNA was isolated. 4SU-labeled RNA was biotinylated using EZ-link Biotin-HPDP (Thermo Scientific-Pierce, Waltham, Mass.) followed by streptavidin binding using uMacs Streptavidin kit (Miltenyi, Auburn, Calif.). Reaction was loaded onto uMac columns and labeled, and unlabeled RNA fractions were collected separately. Both fractions were precipitated, cleaned, and resuspended for quantification of expression.
Rnaset2 Overexpression:
CD4+ T cells were transfected with 25 ug of pQCXIP-RNASET2-HIS or pQCXIP control vector (both kindly gifted by Dr. Geng Wang from Tsinghua University) using electroporation protocol described herein. Cells were rested overnight and then stimulated with TL1A/cytokine cocktail (100 ng/ml TL1A, 0.5 ng/ml IL12, 50 ng/ml IL18 and 20 ng/ml IL15 (Peprotech Rocky Hill, N.J.)) for 24 h. RNASET2 overexpression was validated by western blot, ELISA and/or qPCR. For experiments using recombinant RNASET2 (Cat. 13509-H08B Thermo-Fisher Ashevile N.C.), cells were pretreated for 24 h with indicated concentration of recombinant protein prior to stimulation. Cells pellet were collected for RNA analysis and culture media for IFN-γ secretion by ELISA (Gonsky R, et al. J Immunol 2004; 173:6241-7, which is hereby incorporated in its entirety by reference).
Quantification of Plasma RNASET2:
To quantify circulating blood plasma levels of RNASET2, ELISA was developed (
Chromatin Functional Annotations:
Chromatin states were annotated using StatepaintR (statehub.org) based upon available Roadmap Epigenomics marks and ETS binding region using FANTOM (functional annotation of the mailman genome, fantom.gscsikenjp/data/) web tools. DNA topography was analyzed using the DNAshape and TFBSshape (rohslab.usc.edu/tools.html) bioinformatic tools.
Statistical Analysis:
Tests for statistical significance were determined using JMP Statistical Software (Cary, N.C.). Data were assessed for normality by the Shapiro-Wilk test. If data were normal a 2-tailed, unpaired Student's t test was used. For non-normal data, Wilcoxon Test was used to calculate P values. Quantification for significance when evaluating expression of nascent vs pre-existing RNASET2 transcripts was performed by comparing paired sample expression overtime prior and post 4SU-tagging for same individual. Analysis for identifying alteration in circulating RNASET2 protein levels was performed by comparing paired sample RNASET2 protein levels prior and post-surgery for individual patients. Paired sample significance was calculated using Wilcoxon signed rank test.
Study on Cis-Regulatory a Candidate Causal SNP, Rs2149092, on RNASET2 Promoter Affects ETS TF binding:
The disclosure provides an association of the rs1819333 RNASET2 disease risk variant with decreased T cell expression, DNA hypermethylation and clinical parameters of severity in CD patients. A putative candidate causal variant rs2149092, in LD with the tagging SNP, was predicted to disrupt a consensus ETS transcription factor binding site. The rs2149092 SNP lies within an enhancer region overlapping with IRF4 and SPI.1 and directly adjacent to C-jun binding sites suggesting the likelihood for a multifaceted cis-regulatory element impacting protein-DNA complex formation. Considering that epigenetic and environmental signals play a critical role in regulating enhancer activity and gene expression it is essential that studies are performed in the cell type relevant to disease. The impact of rs2149092 in the context of T cell transcriptional regulation was examined for the presence of tissue-specific active enhancer/promoter regions using StatepaintR. As seen in
Study on the Effect of RNASET2 SNPs Variants on Protein Complex Binding to Regulatory regions on RNASET2 promoter:
To further characterize allele-specific regulatory elements within the promoter region, a 3.7 kb promoter region was cloned encompassing the rs181933 tagging and rs2149092 SNPs from individuals homozygous for the risk and non-risk alleles. Sequencing the promoter revealed a 17 bp insertion/deletion (indel), rs16900967, located 610 bp upstream from the RNASET2 transcriptional start site. The 17 bp insertion was present only in subjects carrying rs1819333 risk variant (LD R2=1). To assess the functional potential for these SNPs to alter protein-DNA binding, EMSA analysis was performed using nuclear extracts isolated from primary CD4+ T cells and allele specific oligonucleotide probes (
Study on RNASET2 Transcript Downregulation as a Hallmark of T Cell Activation:
To address whether a decrease in RNASET2 expression was specific to TL1A-mediated activation or more globally associated with other classic modalities of T cell activation, i.e. T cell receptor (TCR) or PMA-lonomycin, CD4+ T cells were stimulated with the different activating agents and RNASET2 expression was measured. Activation of T cells via TL1A as well as TCR or PMA/ionomycin resulted in down regulation of RNASET2 expression (
Study on Allele Specific Enhanced Promoter Activity of RNASET2:
The functional significance of the tagging and candidate causal SNPs on RNASET2 gene transcription was examined utilizing promoter reporter constructs. DNA was cloned from individuals homozygous for the risk and non-risk rs1819333 tagging SNP. A series of deletion constructs consisting of successive truncated promoter regions defined by the presence or absence of the disease tagging SNP rs1819333, candidate causal SNPs rs2149092 or rs16900967 indel (
An in-vitro metabolic RNA labeling approach was used to further investigate the role of transcriptional upregulation v. mRNA stabilization as mechanisms involved in TL1A mediated regulation of RNASET2 expression. CD4+ T cells were activated with TL1A and then cells were labeled using 4-thiouridine (4sU) incorporation, a naturally occurring uridine analog to distinguish between nascent and previously transcribed mRNA populations. As seen in
Post-transcriptional regulation of mRNA processing is determined by interactions between cis-acting elements and trans-mediated regulators and may include altered pre-mRNA splicing, differential polyadenylation and miRNA mediated regulation (Manning Kans., et al. Nat Rev Mol Cell Biol 2017; 18:102-114, incorporated herein in its entirety by reference). Adenosine to inosine (A-to-I) RNA editing, catalyzed by adenosine deaminases acting on RNA (ADARs), is a post-transcriptional modification that alters the sequence of RNA. A-to-I editing can modify RNA nuclear retention, protein amino acid sequence and affect translation efficiency and mRNA degradation (Eisenberg E, et al. Nat Rev Genet 2018; 19:473-490, incorporated herein in its entirety by reference). The ADeditome web tool was utilized to analyze for functional annotation of A-to-I RNA editing within RNASET2 locus (Wu S, et al. Brief Bioinform 2021, incorporated herein in its entirety by reference). A number of editing events leading to differential gene expression between edited versus non-edited RNASET2 have been reported within intron 4 and 5. As seen in
Study Demonstrating that RNASET2 Risk Variant Dominates RNASET2 Expression:
The disconnect between RNASET2 mRNA levels and promoter activity suggests that transcriptional as well as post-transcriptional regulatory mechanisms can be involved in modulating the levels of RNASET2 expression. Allele-specific expression (ASE) was examined to determine the functionality of the risk variants and whether there is an imbalance between the expression levels of the risk vs non-risk alleles. Because the candidate causal variants reside within a non-coding region, the inventors identified a common C/A SNP, rs1044059, in the 5′ UTR of RNASET2 that is in strong LD (R2=0.99) as a surrogate marker (
Allelic imbalance in expression was likewise examined in primary cells in the context of disease (
RNASET2 is a secreted protein involved in macrophage chemotaxis and tissue remodeling and is induced following exposure to stress (Lu et al. front Immunol. 2018). Thus, the level of circulating protein may well provide further insight into the functional relevance of allelic variant carriage. The inventors developed an ELISA assay to evaluate the plasma levels of circulating RNASET2 protein in the context of risk allele carriage and in the context of disease. In healthy control subjects the levels of circulating RNASET2 echoed mRNA expression and was associated with SNP variant carriage with the levels of protein significantly decreased in subjects homozygous for the RNASET2 risk allele. (
These Examples demonstrate that decreased levels of RNASET2 is associated with disease and inflammatory cytokine secretion and that downregulation of RNASET2 is reversible following removal of inflammatory signal. Thus, the disclosure provides that RNASET2 can represent a potential novel therapeutic target in the treatment of IBD. The disclosure further confirmed whether raising the levels of RNASET2 had a direct effect on attenuation of cytokine secretion. Primary CD4+ T cells, isolated from healthy donors, were transfected with an RNASET2 over-expression or empty vector and the levels of secreted IFN-γ were measured following TL1A activation. As seen in
The disclosure provides that TL1A mediated T cell activation resulting in enhanced IFN-γ secretion is functionally associated with downregulation in RNASET2 expression. In CD patients the RNASET2 disease risk variant identified by GWAS, rs1819333, is associated with decreased expression and with a more severe disease phenotype (Gonsky R, et al. Gastroenterology 2017; 153:219-232, incorporated herein in its entirety by reference). In these Examples, an integrative multi-strategy approach was used to further identify cis- and trans-regulatory mechanisms mediating down-regulation of RNASET2 expression and enhancement of pro-inflammatory cytokine expression/secretion. These Examples demonstrate: 1) Allele specific cis-regulatory binding motifs associated with active chromatin regulatory features and ETS1 nucleo-protein complex 2) Allelic imbalance in RNASET2 promoter transactivation and mRNA levels supporting transcriptional and post-transcriptional regulatory mechanisms modulating RNASET2 expression 3) Pre-operative decrease and post-operatively recovery in circulating RNASET2 protein levels in CD patients requiring surgical intervention for disease management following removal of the inflamed intestinal region, and 4) Biological activity of recombinant RNASET2 protein in attenuating pro-inflammatory cytokine secretion.
In further defining the RNASET2 cis-regulatory features of candidate causal rs2149092, the inventors classified a 17 bp promoter insertion, rs16900967, in LD with rs1819333, as a disease risk variant. Using StatePaintR (Simon G. et al. bioRxiv 2017, incorporated herein in its entirety by reference) enrichment analysis, the inventors evaluated the chromatin/histone regulatory regions overlapping with the RNASET2 risk SNPs. The chromatin state of both the candidate causal rs2149092 and indel variants were enriched for epigenomic marks indicative for T-cell specific active enhancer and promoters regulatory elements. RNASET2 variant TF-DNA binding in the context of cell and tissue-specificity is of importance considering tissue-specific functionality related to altered RNASET2 expression. For example, in the case of activated T cells, a decrease in RNASET2 expression is associated with enhanced IFN-γ secretion whereas in activated granulocytes an increase in RNASET2 expression is associated with triggering innate immune response and recruitment of macrophages (Baranzini S E. Mult Scler 2019; 25:336-337, incorporated herein in its entirety by reference). DNA topography analysis integrating the DNA shape and sequence features indicated that SNP rs2149092 altered the 3D DNA conformation at an ETS TF binding site. EMSA nucleo-protein/super-shift data corroborated the potential for RNASET2 variants rs2149092 (candidate causal SNP) and rs16900967 (promoter indel) to modulate ETS TF DNA interactions. A parallel downmodulation of RNASET2, ETS1 and ELF2, following T cell activation strengthens a role for ETS in regulating RNASET2 transcription. In contrast, no allele-specificity was observed in nucleo-protein complex formation to the RNASET2 tagging SNP rs1819333. ETS TF is of particular relevance to T cell biology implicated in T cells differentiation, pro-inflammatory cytokine/chemokine expression and downstream signaling pathways (Russell L, et al. Cytokine 2010; 51:217-26, incorporated herein in its entirety by reference). Numerous studies support a role for ETS TF regulation in IBD. The disclosure provides that ETS TF binding sites were enriched within IBD susceptibility enhancer and promoter regions and ETS TF risk variants themselves were associated with IBD. Clinically, elevated expression of ETS TF was observed in inflamed mucosa from IBD patients and was associated with enhanced pro-inflammatory cytokine secretion and fistulizing disease (Ge Y, et al. J Autoimmun 2019; 101:109-120; and Scharl M, et al. World J Gastrointest Pathophysiol 2014; 5:205-12, both of which are incorporated herein in their entirety by reference). Thus the disclosure provides that ETS is involved in IBD pathogenesis.
The functional consequence of RNASET2 SNPs on gene expression was likewise examined utilizing promoter reporter constructs defined by the presence or absence of the disease tagging SNP rs1819333 or the candidate causal variants rs2149092 and rs16900967. Deletion of the proximal promoter −3.7 kb to −3.2 kb region, spanning the rs1819333 tagging SNP, resulted in an increase in transcriptional activation whereas, deletion of the indel rs16900967 resulted in a reduction of promoter activity. The cis-regulatory rs2149092 and rs16900967 variants demonstrated a functional allelic imbalance in promoter transactivation. Enhanced RNASET2 promoter activity was detected when comparing the disease risk vs non-risk alleles across both the −3.7 or −3.2 regions and a further enhanced allelic imbalance in promoter transactivation for all promoter constructs following T cell activation. Allele specific expression (ASE) assay concurred with reporter assay results, demonstrating an allelic imbalance with risk allele dominance in gene expression in cells isolated from control subjects, as well as, CD or UC patients. Surprisingly, while T-cell activation mediated a decrease in the overall levels of RNASET2 gene expression for both the risk and non-risk alleles, ASE enhanced expression of the risk allele compared to non-risk allele was observed in resting, as well as, activated cells.
As described herein, RNASET2 disease risk variants are associated with decreased RNASET2 expression in both T cells and CD mucosal biopsies along with a more complicated/resistant CD phenotype the present results were rather unexpected. One explanation for these findings can arise from differences in transcript levels and epistatic interactions in the presence of multiple cis-acting and/or trans-regulatory mechanisms. Comparison of RNASET2 levels between homozygous risk and non-risk individuals are subject to environmental differences in addition to cis- and trans-acting regulatory effects. In contrast allele specific expression is assayed from the two alleles from the same individual, which function as mutual internal controls, exposed to a shared cellular environment. Thus, differences between RNASET2 levels in individuals homozygous for risk vs non-risk variants and those detected in heterozygote individuals can indicate that other trans-regulatory or cellular factors, apart from cis-acting elements on RNASET2 promoter, are involved in controlling the level of expression. Likewise, gene expression is regulated not only on a transcriptional level but by the rate of mRNA degradation. The promoter-reporter analysis measures transcriptional activation of potential core promoter regions while the allele specific expression adds to this information reflecting both transcriptional and post-transcriptional regulation. In fact, 4sU-tagging of newly transcribed mRNA demonstrated that changes in overall RNASET2 gene expression was regulated on both transcriptional and post-transcriptional levels. T cell stimulation activated the transcriptional machinery enhancing newly synthesized RNASET2 expression whereas pre-existing RNASET2 transcripts underwent RNA degradation. Considering that ADAR A-to-I RNA editing plays a role in innate immune response (Quin J, et al. Trends Biochem Sci 2021, incorporated herein in its entirety by reference) and editing events targeting SNP sequences are enriched within CD GWAS loci (Wu D, et al. J Biol Chem 2020; 295:18199-18212, incorporated in its entirety by reference), these Examples show an altered balance between ADAR and RNASET2 expression associated with RNASET2 gene risk variant carriage provide new insight on the molecular mechanisms involved in the RNASET2 regulatory pathway.
The clinical relevance of RNASET2 polymorphisms was further facilitated by the development of an RNASET2 protein ELISA described herein. Changes in the levels of circulating RNASET2 were observed when comparing CD patients to healthy control subjects and in disease when computing CD pre-operative to post-operative levels. Circulating RNASET2 protein levels in CD patients requiring surgical intervention for disease management, compared to healthy control subjects, was decreased. Surgical removal of the diseased tissue that is contributing to inflammation, resulted in a sustained increase in the levels of circulating RNASET2. Furthermore, overexpression or recombinant RNASET2 treatment attenuated pro-inflammatory IFN-γ secretion. These Examples support the potential for reversing an RNASET2 mediated inflammatory response via therapeutic enhancement of RNASET2 protein levels.
Taken together these data provide a solid foundation that the combination of RNASET2 genetic markers and circulating protein levels can serve as a diagnostic tool in evaluating CD disease pathobiology and help identify a subset of severe Crohn's disease responsive to RNASET2 targeted therapeutics.
Some additional sequences disclosed herein are summarized in Table 4
While preferred embodiments of the present examples have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
This application claims the benefit of U.S. Provisional Application No. 63/034,278, filed Jun. 3, 2020, which application is incorporated herein by reference.
This invention was made with government support under Grant Nos. DK123511, DK043211, DK056328, DK046763, RR033176-01, and DK062413-18 awarded by National Institutes of Health. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2021/035543 | 6/2/2021 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63034278 | Jun 2020 | US |