Patent Application
20180223368
The invention relates generally to methods for diagnosis and treatment of follicular lymphoma. Specifically, the invention relates to detecting the presence or absence of a lysine (K)-specific methyltransferase 2D (KMT2D) alteration to diagnose or treat follicular lymphoma.
Lymphoma is the most common blood cancer. There are two main forms of lymphoma, which are Hodgkin lymphoma and non-Hodgkin lymphoma (NHL). The body has two main types of lymphocytes that can develop into lymphomas. They are: B-lymphocytes (B-cells) and T-lymphocytes (T-cells). Follicular lymphoma (FL), a B-cell lymphoma, is the most common form of B-cell lymphoma. It is a slow-growing lymphoma. It is also called an “indolent” lymphoma for its slow nature, in terms of its behavior and how it looks under the microscope. Follicular lymphoma is subtle, with minor warning signs that often go unnoticed for a long time. Often, people with follicular lymphoma have no obvious symptoms of the disease at diagnosis. Follicular lymphoma remains incurable despite recent advances in lymphoma therapy. Follicular lymphoma arises from germinal center B-cells and the disease is typically triggered by the translocation t(14; 18) that activates the anti-apoptotic BCL2 oncogene. However, the t(14; 18) translocation is also detectable in many healthy adults who never develop the disease. This indicates that additional genetic and epigenetic events contribute to lymphomagenesis. Indeed, recent genome sequencing studies have catalogued many recurrent mutations in human B-cell lymphoma.
Accordingly, there exists a need to understand the genetics and molecular mechanisms of follicular lymphoma, and thereby develop improved methods for diagnosis and treatment.
In one embodiment, the invention provides a method for diagnosing a follicular lymphoma, in a subject, the method comprising the steps of: obtaining a biological sample from said subject; and testing said biological sample to detect the presence or absence of a lysine (K)-specific methyltransferase 2D (KMT2D) alteration in said biological sample, wherein the presence of said KMT2D alteration indicates a diagnosis of said follicular lymphoma in said subject. In one embodiment, the invention provides a method for diagnosing responsiveness of a follicular lymphoma in a subject to therapy, the method comprising the steps of: obtaining a biological sample from said subject; and testing said biological sample to detect the presence or absence of a lysine (K)-specific methyltransferase 2D (KMT2D) alteration in said biological sample, wherein the presence of said KMT2D alteration indicates a poor responsiveness or contraindication of said follicular lymphoma in said subject of the therapy. In an exemplary embodiment, said KMT2D alteration is a mutation in KMT2D. In another exemplary embodiment, the response to therapy is said subject's response or responsiveness to an immunotherapy, for example, said subject's tumor response to immunotherapy. In one embodiment the therapy is B cell therapy. In one embodiment, a patient with a KMT2D alteration may not be effectively treated with anti-CD40 therapy. In another embodiment, anti-CD40 therapy is contraindicated in a patient found to have a KMT2D alteration. In another embodiment, methods for treating follicular lymphoma include a determination of KMT2D alteration and guiding therapy away from anti-CD40 in the presence of an altered KMT2D. The use or non-use of anti-CD40 therapy may be in conjunction with the use or non-use of anti-IgM therapy.
In another embodiment, the invention provides a method of determining a treatment outcome for treating a follicular lymphoma, in a subject, the method comprising the steps of: obtaining a biological sample from said subject; and testing said biological sample to detect the presence or absence of a KMT2D alteration in said biological sample, wherein the presence of said KMT2D alteration indicates a response to a therapy, thereby determining said treatment outcome for treating said follicular lymphoma in said subject. In one embodiment, a patient with a KMT2D alteration may not be effectively treated with anti-CD40 therapy. In another embodiment, anti-CD40 therapy is contraindicated in a patient found to have a KMT2D alteration. In another embodiment, methods for treating follicular lymphoma include a determination of KMT2D alteration and guiding therapy away from anti-CD40 in the presence of an altered KMT2D. The use or non-use of anti-CD40 therapy may be in conjunction with the use or non-use of anti-IgM therapy.
In another embodiment, the invention provides a method for treating a follicular lymphoma, in a subject, the method comprising: (a) obtaining a biological sample from said subject; and testing said biological sample to detect the presence or absence of a KMT2D alteration in said biological sample, wherein the presence of said KMT2D alteration indicates a response to a therapy; (b) based on the determination of said response to said therapy, administering an effective amount of a therapeutic agent to treat said follicular lymphoma, thereby treating said follicular lymphoma in said subject. In one embodiment, a patient with a KMT2D alteration may not be effectively treated with anti-CD40 therapy. In another embodiment, anti-CD40 therapy is contraindicated in a patient found to have a KMT2D alteration. In another embodiment, methods for treating follicular lymphoma include a determination of KMT2D alteration and guiding therapy away from anti-CD40 in the presence of an altered KMT2D. The use or non-use of anti-CD40 therapy may be in conjunction with the use or non-use of anti-IgM therapy.
In another embodiment, the invention provides a method for identifying a molecule that increases sensitivity of a follicular lymphoma in a subject to immunotherapy, the method comprising: providing a plurality of molecules; and screening said plurality of molecules to identify a molecule that effectively enhances the level of a KMT2D, thereby identifying said molecule that effectively increases sensitivity of said follicular lymphoma in said subject to immunotherapy.
In another embodiment, the invention provides a method for treating a follicular lymphoma in a subject, the method comprising: administering to said subject a molecule that effectively enhances the level of a KMT2D in said subject, in combination with anti-CD40 antibodies, thereby treating said follicular lymphoma in said subject.
In any of the foregoing embodiments, therapy is B cell therapy, such as but not limited to anti-CD40 antibody, anti-CD20 antibody or anti-IgM therapy, or any combination thereof.
Other features and advantages of the present invention will become apparent from the following detailed description examples and figures. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the invention are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
This application claims priority under 35 USC 119(e) to U.S. patent application Ser. No. 62/135,040, filed Mar. 18, 2015, and to U.S. patent application Ser. No. 62/201,390, filed Aug. 5, 2015, both of which are incorporated herein by reference in their entireties.
The invention relates generally to methods for diagnosis and treatment of follicular lymphoma. Specifically, the invention relates to detecting the presence of, or the normal or an altered presence, activity, or expression of lysine (K)-specific methyltransferase 2D (KMT2D) to diagnose or treat follicular lymphoma.
The gene encoding the lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma and diffuse large B cell lymphoma; however, the biological consequences of KMT2D mutations on lymphoma development are not known. In one embodiment, KMT2D is shown to function as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. In one embodiment, KMT2D deficiency also delays germinal center involution and impedes B cell differentiation and class switch recombination. Integrative genomic analyses indicate that KMT2D affects methylation of lysine 4 on histone H3 (H3K4) and expression of a specific set of genes, including those in the CD40, JAK-STAT, Toll-like receptor and B cell receptor signaling pathways. Other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3 and TNFRSF14. In one embodiment, KMT2D mutations promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell-activating pathways.
Thus, the inventors of the instant application have surprisingly and unexpectedly found that KMT2D is a bona fide tumor suppressor and KMT2D deficiency promotes follicular lymphoma development in vivo. In addition, the inventors have surprisingly and unexpectedly found that KMT2D mutations contribute to lymphoma development. Furthermore, the inventors found that the presence of a KMT2D alteration adversely affects the normally tumor suppressive effects of anti-CD40, thereby reducing the effectiveness of anti-CD40 therapies when an alteration in KMT2D is present or potentially stimulating disease progression thereby. This finding is useful to help determine the response or responsiveness of a patient's tumor to a particular therapy, or lack thereof, thereby guiding the optimal course of therapy for a patient with follicular lymphoma, in particular whether antiCD40 or related therapy may be effective, or should be avoided because patients may do worse with such treatment. Thus, in one embodiment, a patient with a KMT2D alteration may not be effectively treated with anti-CD40 therapy. In another embodiment, anti-CD40 therapy is contraindicated in a patient found to have a KMT2D alteration. In another embodiment, methods for treating follicular lymphoma include a determination of KMT2D alteration and guiding therapy away from anti-CD40 in the presence of an altered KMT2D. In any of the foregoing embodiments, the guidance for the use or non-use of anti-CD40 therapy may be in conjunction with the respective use or non-use of anti-IgM therapy.
The results described herein establish the tumor suppressor function of KMT2D in germinal center B cells. The H3K4 methyltransferase KMT2D is one of the most frequently mutated genes in DLBCL and FL3,4, and we show that it controls the expression of multiple key regulators of the CD40, TLR and BCR signaling pathways (
Therapy or immunotherapy in one embodiment is B cell therapy. Therapy or immunotherapy in another embodiment is anti-CD40 antibody, anti-CD20 antibody or anti-IgM therapy, or any combination thereof.
The terms “KMT2D alteration,” as used herein, refer to any genetic change in KMT2D structure or its molecular expression. In one aspect, KMT2D alteration refers to a mutation in KMT2D. In another aspect, KMT2D alteration refers to a change in the expression level of KMT2D mRNA or KMT2D protein, or activity of the KMT2D protein, relative to a predetermined level (i.e., control level) of a healthy subject. Activity of the KMT2D protein may be enzymatic activity or histone binding activity, by KMT2D directly or by proteins associated with or complexed therewith. Activity may also include regulation of gene transcription activity.
The terms “mutation,” as used herein, refer to the presence of a mutation in KMT2D. In one aspect, the mutation refers to a change in the KMT2D gene with respect to the standard wild-type sequence. Mutations can be inherited, or they can occur in one or more cells during the lifespan of an individual. In some embodiments, the KMT2D mutation is homozygous. In other embodiments, the KMT2D mutation is heterozygous. The KMT2D mutation can be any type of mutation, for example, but not limited to, a non-sense mutation, a missense mutation, an insertion mutation, a deletion mutation, a replacement mutation, a point mutation, or a combination thereof.
As used herein, a “biological sample” is a sample that contains cells or cellular material. Non-limiting examples of biological samples include urine, blood, plasma, serum, cerebrospinal fluid, pleural fluid, sputum, peritoneal fluid, bladder washings, secretions (e.g., breast secretion), oral washings, tissue samples, tumor samples, touch preps, or fine-needle aspirates. A biological sample can be obtained using any suitable method. For example, a blood sample (e.g., a peripheral blood sample) can be obtained from a subject using conventional phlebotomy procedures. Similarly, plasma and serum can be obtained from a blood sample using standard methods.
KMT2D protein of the invention may comprise the amino acid sequence set forth in SEQ ID NO.: 1 (GenBank Accession No.: AAC51734.1). In one example, KMT2D protein comprises a homolog, a variant, an isomer, or a functional fragment of SEQ ID NO: 1. In another example, the amino acid sequence is approximately 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% identical to SEQ ID NO.: 1. Each possibility represents a separate embodiment of the present invention.
KMT2D protein of the invention may be encoded by the nucleic acid sequence set forth in SEQ ID NO.: 2 (GenBank Accession No.: AF010403.1). In one example, KMT2D nucleic acid sequence comprises a homolog, a variant, an isomer, or a functional fragment of SEQ ID NO: 2. In another example, the nucleic acid sequence is approximately 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% identical to SEQ ID NO.: 2. Each possibility represents a separate embodiment of the present invention.
In one aspect, the invention provides methods for detecting the KMT2D mutation. The KMT2D mutation in a sample can be detected using any technique that is suitable for detecting a mutation or genetic variation in a biological sample. Suitable techniques for detecting mutations or genetic variations in cells from a biological sample are well known to those of skill in the art. Examples of such techniques include, but are not limited to, PCR, Southern blot analysis, microarrays, and in situ hybridization. In a particular embodiment, a high-throughput system, for example, a microarray, is used to detect the KMT2D mutation.
In one aspect, nucleic acids can be isolated from the biological sample. The isolated nucleic acids can include a KMT2D nucleic acid sequence. In some embodiments, the KMT2D nucleic acid sequence can include a nucleotide sequence variant of SEQ ID NO: 2. As used herein, “isolated nucleic acid” refers to a nucleic acid that is separated from other nucleic acid molecules that are present in a mammalian genome, including nucleic acids that normally flank one or both sides of the nucleic acid in a mammalian genome (e.g., nucleic acids that encode non-KMT2D proteins). The term “isolated” as used herein with respect to nucleic acids also includes any non-naturally-occurring nucleic acid sequence since such non-naturally-occurring sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome.
An isolated nucleic acid can be, for example, a DNA molecule, provided one of the nucleic acid sequences normally found immediately flanking that DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a DNA molecule that exists as a separate molecule (e.g., a chemically synthesized nucleic acid, or a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid can include an engineered nucleic acid such as a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid. A nucleic acid existing among hundreds to millions of other nucleic acids within, for example, cDNA libraries or genomic libraries, or gel slices containing a genomic DNA restriction digest, is not to be considered an isolated nucleic acid.
The nucleic acid molecules provided herein can be between about 8 and about 15,789 nucleotides in length. In one example, a nucleic acid can be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 34, 36, 38, 40, 45, or 50 nucleotides in length. Alternatively, the nucleic acid molecules provided herein can be greater than 50 nucleotides in length (e.g., 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 500 or more than 500 nucleotides in length). Nucleic acid molecules can be in a sense or antisense orientation, can be complementary to a KMT2D reference sequence (e.g., the sequence shown in GenBank Accession No. AF010403.1), and can be DNA, RNA, or nucleic acid analogs. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid.
The isolated nucleic acid molecules provided herein can be produced using standard techniques including, without limitation, chemical synthesis.
Nucleic acids of the invention can also be isolated using a commercially available kit. In one embodiment, DNA from a peripheral blood sample can be isolated using a DNeasy DNA isolation kit, a QIAamp DNA blood kit, or a PAXgene blood DNA kit from Qiagen Inc. (Valencia, Calif.). DNA from other tissue samples also can be obtained using a DNeasy DNA isolation kit. Any other suitable DNA extraction and purification technique also can be used, including liquid-liquid and solid-phase techniques ranging from phenol-chloroform extraction to automated magnetic bead nucleic acid capture systems.
In one aspect, once nucleic acid has been obtained, it can be contacted with at least one oligonucleotide (e.g., a primer) that can result in specific amplification of a mutant KMT2D gene, if the mutant KMT2D gene is present in the biological sample. In another embodiment, the nucleic acid also can be contacted with a second oligonucleotide (e.g., a reverse primer) that hybridizes to either a mutant or a wild-type KMT2D gene. The nucleic acid sample and the oligonucleotides can be subjected to conditions that will result in specific amplification of a portion of the mutant KMT2D gene if the mutant KMT2D gene is present in the biological sample.
Once the amplification reactions are completed, the presence or absence of an amplified product can be detected using any suitable method. Such methods include, without limitation, those known in the art, such as gel electrophoresis with or without a fluorescent dye (depending on whether the product was amplified with a dye-labeled primer), a melting profile with an intercalating dye, and hybridization with an internal probe. Alternatively, the amplification and detection steps can be combined in a real time PCR assay. In some embodiments, the detection of an amplified product indicates that cells containing the KMT2D mutation were present in the biological sample, while the absence of an amplified product indicates that cells containing the KMT2D mutation were not present in the biological sample.
In another aspect, the methods provided herein also can include contacting the nucleic acid sample with a third oligonucleotide that can result in specific amplification of a wild-type KMT2D gene without detectable amplification of a mutant KMT2D. These methods can further include subjecting the nucleic acid and the oligonucleotides to conditions that will result in specific amplification of a wild-type KMT2D sequence if a wild-type KMT2D gene is present in the biological sample. The presence or absence of an amplified product containing a wild-type KMT2D sequence can be detected using any suitable method, including those disclosed above. Methods that include using oligonucleotides for amplification of both mutant and wild-type KMT2D sequences also can include quantifying and comparing the amounts of amplified product for each sequence. The relative levels of mutant and wild-type products can indicate the fraction of cells in the biological sample that contain a mutant KMT2D gene.
In some embodiments, the methods disclosed herein can further include a first, universal amplification step. Such methods can include contacting nucleic acids obtained from a biological sample with, for example, a cocktail of degenerate primers, and using standard PCR procedures for an overall amplification of the DNA. This preliminary amplification can be followed by specific amplification and detection of products, as described herein.
In another embodiment, the KMT2D mutation is detected by Southern blot hybridization. Suitable probes for Southern blot hybridization of a given sequence can be produced from the nucleic acid sequences of the KMT2D. Methods for preparation of labeled probes, and the conditions for hybridization thereof to target nucleotide sequences, are well known in the art and are described in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapters 10 and 11.
In another embodiment, the KMT2D mutation can be detected by a technique of in situ hybridization. This technique requires fewer cells than the Southern blotting technique, and involves depositing whole cells onto a microscope cover slip and probing the nucleic acid content of the cell with a solution containing radioactive or otherwise labeled nucleic acid probes. This technique is particularly well-suited for analyzing tissue biopsy samples from subjects. The practice of the in situ hybridization technique is described in more detail in U.S. Pat. No. 5,427,916, the disclosure of which is incorporated herein by reference. In an exemplary embodiment, the in situ hybridization technique is a FISH (fluorescent in situ hybridization) technique.
In another embodiment, detection the KMT2D mutation, for example, a mutation in KMT2D, can be accomplished by micro array techniques. The microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length are 5′-amine modified and printed using commercially available microarray systems, e.g., the GENEMACHINE, OMNIGRID 100 MICROARRAYER and AMERSHAM CODELINK activated slides. The microarray can be processed by direct detection of the tagged molecules using, e.g., STREPTAVIDIN-ALEXA647 conjugate, and scanned utilizing conventional scanning methods.
Other techniques for detecting the KMT2D mutation are also within the skill in the art, and include various techniques for detecting genetic variations.
In another aspect, KMT2D alteration is detected by measuring a change in the expression level of KMT2D mRNA or KMT2D protein, relative to a predetermined level (i.e., control level) of a healthy subject.
In one example, the invention features agents which are capable of detecting KMT2D polypeptide or mRNA such that the presence of KMT2D is detected. As defined herein, an “agent” refers to a substance which is capable of identifying or detecting KMT2D in a biological sample (e.g., identifies or detects KMT2D mRNA, KMT2D DNA, KMT2D protein, KMT2D activity). In one embodiment, the agent is a labeled or labelable antibody which specifically binds to KMT2D polypeptide. As used herein, the phrase “labeled or labelable” refers to the attaching or including of a label (e.g., a marker or indicator) or ability to attach or include a label (e.g., a marker or indicator). Markers or indicators include, but are not limited to, for example, radioactive molecules, colorimetric molecules, and enzymatic molecules which produce detectable changes in a substrate.
In one embodiment the agent is an antibody which specifically binds to all or a portion of a KMT2D protein. As used herein, the phrase “specifically binds” refers to binding of, for example, an antibody to an epitope or antigen or antigenic determinant in such a manner that binding can be displaced or competed with a second preparation of identical or similar epitope, antigen or antigenic determinant. In an exemplary embodiment, the agent is an antibody which specifically binds to all or a portion of the human KMT2D protein.
In yet another embodiment the agent is a labeled or labelable nucleic acid probe capable of hybridizing to KMT2D mRNA. For example, the agent can be an oligonucleotide primer for the polymerase chain reaction which flank or lie within the nucleotide sequence encoding human KMT2D. In a preferred embodiment, the biological sample being tested is an isolate, for example, RNA. In yet another embodiment, the isolate (e.g., the RNA) is subjected to an amplification process which results in amplification of KMT2D nucleic acid. As defined herein, an “amplification process” is designed to strengthen, increase, or augment a molecule within the isolate. For example, where the isolate is mRNA, an amplification process such as RT-PCR can be utilized to amplify the mRNA, such that a signal is detectable or detection is enhanced. Such an amplification process is beneficial particularly when the biological, tissue, or tumor sample is of a small size or volume.
Detection of RNA transcripts may be achieved by Northern blotting, for example, wherein a preparation of RNA is run on a denaturing agarose gel, and transferred to a suitable support, such as activated cellulose, nitrocellulose or glass or nylon membranes. Radiolabeled cDNA or RNA is then hybridized to the preparation, washed and analyzed by autoradiography.
Detection of RNA transcripts can further be accomplished using known amplification methods. For example, it is within the scope of the present invention to reverse transcribe mRNA into cDNA followed by polymerase chain reaction (RT-PCR); or, to use a single enzyme for both steps as described in U.S. Pat. No. 5,322,770, or reverse transcribe mRNA into cDNA followed by symmetric gap ligase chain reaction (RT-AGLCR). Any suitable known amplification method known to one skilled in the art can be used. In situ hybridization visualization may also be employed, wherein a radioactively labeled antisense RNA probe is hybridized with a thin section of a biopsy sample, washed, cleaved with RNase and exposed to a sensitive emulsion for autoradiography. The samples may be stained with haematoxylin to demonstrate the histological composition of the sample, and dark field imaging with a suitable light filter shows the developed emulsion. Non-radioactive labels such as digoxigenin may also be used.
In another aspect of the invention pertains to measuring a change in the level of KMT2D protein, for example, using anti-KMT2D antibodies. The term “antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as KMT2D. The invention provides polyclonal and monoclonal antibodies that bind KMT2D.
It is generally preferred to use antibodies, or antibody equivalents, to detect KMT2D protein. Methods for the detection of protein are well known to those skilled in the art, and include ELISA (enzyme linked immunosorbent assay), RIA (radioimmunoassay), Western blotting, and immunohistochemistry. Immunoassays such as ELISA or RIA, which can be extremely rapid, are more generally preferred.
Immunohistochemistry may also be used to detect expression of human KMT2D in a biopsy sample. A suitable antibody is brought into contact with, for example, a thin layer of cells, washed, and then contacted with a second, labeled antibody. Labeling may be by fluorescent markers, enzymes, such as peroxidase, avidin, or radiolabelling. The assay is scored visually, using microscopy.
The invention also encompasses kits for detecting the presence of KMT2D in a biological sample. In one aspect, the kit can comprise a labeled or labelable agent capable of detecting KMT2D or its mutation. In another aspect, the kit can comprise a labeled or labelable agent capable of detecting KMT2D protein or mRNA in a biological sample and a means for determining the amount of KMT2D in the sample. The kit may also include instructions for the detections.
The step of detection of the invention can be performed prior to or after a treatment by one or more therapeutic modalities, for example, but not limited to, an immunotherapy, a chemotherapy, a radiation therapy, and a combination thereof. Therapy in one embodiment is B cell therapy, such as but not limited to anti-CD40 antibody, anti-CD20 antibody or anti-IgM therapy, or any combination thereof. In one embodiment, the detection step is performed prior to administering an antibody (e.g., an anti-CD40 antibody, an anti-CD20 antibody—rituximab) to treat a follicular lymphoma. Coadministration with anti-IgM is also embodied herein. In another embodiment, the detection step is performed after administering an antibody to treat a follicular lymphoma. In another embodiment, the detection step is performed prior to administering a chemotherapy agent to treat a follicular lymphoma. In another embodiment, the detection step is performed after administering a chemotherapy agent to treat a follicular lymphoma. In another embodiment, the detection step is performed prior to a radiation therapy to treat a follicular lymphoma. In another embodiment, the detection step is performed after a radiation therapy to treat a follicular lymphoma.
In another aspect, provided herein is a method of determining a treatment outcome for treating a follicular lymphoma, in a subject, the method comprising the steps of: obtaining a biological sample from said subject; and testing said biological sample to detect the presence or absence of a KMT2D alteration in said biological sample, wherein the presence of said KMT2D alteration indicates a response (e.g., a tumor response) to a therapy, thereby determining said treatment outcome for treating said follicular lymphoma in said subject. In another aspect, provided herein is a method for treating a follicular lymphoma, in a subject, the method comprising: (a) obtaining a biological sample from said subject; and testing said biological sample to detect the presence or absence of a KMT2D alteration in said biological sample, wherein the presence of said KMT2D alteration indicates a response to a therapy; (b) based on the determination of said tumor response to said therapy, administering an effective amount of a therapeutic agent to treat said follicular lymphoma, thereby treating said follicular lymphoma in said subject. In all embodiments herein, a response may include a lack of a response.
As noted herein above, the presence of a KMT2D alteration adversely affects the normally tumor suppressive effects of anti-CD40, thereby reducing the effectiveness of anti-CD40 therapies when an alteration in KMT2D is present or potentially stimulating disease progression thereby. Therefore, a response to therapy relates to, in one embodiment, whether antiCD40 or related therapy may be effective, or should be avoided because patients may do worse with such treatment. Thus, in one embodiment, a patient with a KMT2D alteration may not be effectively treated with anti-CD40 therapy. In another embodiment, anti-CD40 therapy is contraindicated in a patient found to have a KMT2D alteration. In another embodiment, methods for treating follicular lymphoma include a determination of KMT2D alteration and guiding therapy away from anti-CD40 in the presence of an altered KMT2D. In any of the foregoing embodiments, the guidance for the use or non-use of anti-CD40 therapy may be in conjunction with the respective use or non-use of anti-IgM therapy. In another embodiment, an effective therapeutic agent to treat follicular lymphoma may be one or more agents excluding anti-CD40, anti-CD20 or anti-IgM therapy (and any combination thereof) but other chemotherapeutic agents such as but not limited to cyclophosphamide, vincristine, prednisone, doxorubicin, bortezomib, everolimus, idelalisib, ibrutinib, lenalidomide, ofatumumab, or panobinostat, or combinations thereof, by way of non-limiting examples.
In yet another aspect, provided herein is a method for treating a follicular lymphoma in a subject, the method comprising: administering to said subject a molecule that effectively enhances the level of a KMT2D in said subject, thereby treating said follicular lymphoma in said subject.
As used herein, “response” can refer to the outcome or responsiveness, or predicted outcome or responsiveness, of a patient's disease or cancer to a particular therapy, i.e., whether the patient will benefit from or the cancer will be treated by the therapy, whether the patient or cancer will have little or no effect from the therapy, or whether the therapy may exacerbate the disease or cause the patient to do worse as a result of use of a particular therapy. In one embodiment, a response can mean no response or a lack of a response.
As used herein, the terms “treat” and “treatment” refer to therapeutic treatment, wherein the object is to prevent or slow down (lessen) an undesired physiological change associated with a disease or disorder. Beneficial or desired clinical results include alleviation of symptoms, diminishment of the extent of a disease or disorder, stabilization of a disease or disorder (i.e., where the disease or disorder does not worsen), delay or slowing of the progression of a disease or disorder, amelioration or palliation of the disease or disorder, and remission (whether partial or total) of the disease or disorder, whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease or disorder as well as those prone to having the disease or disorder.
In one aspect, the treatment includes administering a KMT2D protein. In another aspect, the treatment includes administering a nucleic acid sequence encoding the KMT2D protein. In yet another aspect, the treatment includes administering an agent that enhances the activity of KMT2D.
The treatment compositions of the invention may be administered alone (monotherapy), or in combination with one or more therapeutically effective agents or treatments (combination therapy).
Cancers treated by the invention include, but are not limited to, a Grade 1, 2, or 3 follicular lymphoma and a Stage 1, 2, 3, or 4 follicular lymphoma.
In another aspect, provided herein is a method for identifying a molecule that effectively treats a follicular lymphoma in a subject, the method comprising: providing a plurality of molecules; and screening said plurality of molecules to identify a molecule that effectively enhances the level of a KMT2D, thereby identifying said molecule that effectively treats said follicular lymphoma in said subject.
The terms “subject” and “individual” are defined herein to include animals, such as mammals, including but not limited to, primates, cows, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent, or murine species.
All patents and literature references cited in the present specification are hereby incorporated by reference in their entirety.
The following examples are presented in order to more fully illustrate the preferred embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention.
Measurement of KMT2D mRNA Expression in Human B Cells.
The human tonsil and bone marrow samples were obtained in Pamplona (Spain) at the Clinica Universidad de Navarra and the obtention of these samples was approved by the ethical committee of Clinica Universidad de Navarra (Spain). Cells from tonsils and bone marrow were immunophenotyped using eight-color antibody combination: CD20-Pacific Blue (PB), CD45-Oranje Chrome 515 (00515), CD38-fluorescein isothiocyanate (FITC), CXCR4-phycoerythrin (PE), CD3-peridinin chlorophyll protein-cyanin 5.5 (PerCP-Cy5.5), CD10-PE-cyanin 7 (PE-Cy7), CD27-allophycocyanin (APC) and CD44-APCH7 aimed at the identification and high-purity (□97%) FACS-sorting (FACSAria II, Becton Dickinson Biosciences, San Jose, Calif.) of the following B cell (CD3−CD20+CD45+) subsets (after careful exclusion of CD3+CD20−CD45+ T cells): naive B cells (CD10−CD44+CD27−CD38−), germinal center (CD10+CD44loCD38+) centrocytes (CXCR4−) and centroblasts (CXCR4+), memory B cells (CD10−CD27+CD44+) and new-born plasmablasts (CD10−CD27hiCD38hiCD44hi). The strand-specific RNA-seq was performed in naive B cells (n=5 samples), centroblasts (n=7), centrocytes (n=7), memory cells (n=8), tonsilar plasma B cells (n=5) and purified plasma B cells from bone marrow of healthy donors (n=3). Each red dot represents a separate human tonsil and the mean expression is represented in TPM (transcripts per million).
Characterization of Human FL Samples.
The Institutional Review Board (IRB) of Weill Cornell Medical College (IRB#0107004999) approved the study protocol. The specimens were derived from excess diagnostic materials that were banked in the lymphoma repository. A waiver of informed consent has been obtained for this retrospective study. The IRB-approved protocol permitted association of these specimens with a particular individual, allowing review of the medical records for the minimum information necessary to complete the study. All of the data that were provided to investigators were stripped of protected health information.
Sample preparation. Frozen single-cell suspensions of individual tumor samples were first thawed in a 37° C. water bath and then resuspended in RPMI+10% FBS and incubated in an incubator (37° C. and 5% CO2) for 1 h. Half of the sample was used to isolate B cells by using EasySep Human B Cell Enrichment Kit (STEMCELL Technologies, Vancouver, Canada), and the other half was used to isolate T cells with Easy Sep Human T Cell Isolation Kit. DNA was extracted from isolated cell populations by using PureLink Genomic DNA kit (LifeTechnologies, Grand Island, N.Y.). Total RNA was extracted using the Qiagen RNeasy Mini Kit (Valencia, Calif.). The quantity of DNA and RNA samples was measured by a Qubit Fluorometer (LifeTechnologies, Grand Island, N.Y.), and the quality of DNA and RNA samples was assessed by a bioanalyzer (Agilent Technologies, Santa Clara, Calif.).
Exome sequencing. For each tumor sample and the respective T cell control sample, 3 □g of high-molecular-weight genomic DNA was used to prepare exome sequencing libraries using the Aglient SureSelectXT Human All Exon 50 Mb Target Enrichment System for Illumina Pair-End Sequencing Library kit (Agilent Technologies, Santa Clara, Calif.). Each library was sequenced on one entire lane of a flow cell on an Illumina HiSeq 2000. Sequence information of 75 bp on each end of the DNA library fragment (PE75) was collected.
Targeted resequencing. A targeted-enrichment panel was designed by RainDance Technologies (Billerica, Mass.) for 36 of the most commonly mutated lymphoma genes including, ARID1A, ATP6AP1, B2M, BCL2, BCL6, BTG1, BTG2, CARD11, CD79B, CREBBP, EB1, EEF1A1, EP300, EZH2, GNAl3, HIST1H1B, HIST1H1C, HVCN1, IRF4, IRF8, KLHL6, KMT2D, MEF2B, MYD88, PCGFS, PDSSA, PIM1, POU2F2, PRDM1, SGK1, STAT6, SZT2, TBL1XR1, TNFAIP3, TP53 and XPOT. The entire coding regions of this set of genes were targeted by overlapping PCR amplicons averaging 200 bp. DNA (200 ng) was first sheared to around 3 kb by using a Covaris S220 Focused ultrasonicator (Woburn, Mass.) and then merged with primer pairs in a picoliter-droplet format on a Raindance ThunderStorm system. Targeted regions were amplified with the addition of specific tailed primers. A second round of PCR was performed to add indexed adaptor sequences for Illumina sequencing. Final indexed products from 48 samples were multiplexed together and sequenced on one entire lane of flow cell on Illumina HiSeq 2500 by using the fast mode setting. Sequence information of 100 bp on each end of the library fragment (PE100) was collected.
Discovery of single-nucleotide variants (SNV). Sequencing reads were aligned to human genome assembly GRCh37/hg19 using the BWA aligner24. After filtering duplicated paired reads, variants were detected as previously described25-27. Novel coding region SNVs were defined as those that were not present in SNP132. These SNVs were then further filtered by sequencing depth (□20×) and variant percentage (□25%). To obtain the list of somatic mutations in each tumor sample, we compared the variant ratio of each novel coding SNV between tumor B cells and their respective control T cells and estimated the statistical significance of the difference using a chi-squared test, corrected with multiple hypothesis testing (Benjamini-Hochberg corrected P<0.1).
Characterization of DLBCL Samples.
We analyzed 347 newly diagnosed DLBCL cases, in which individuals were treated with R-CHOP (given with curative intent) at the BC Cancer Agency (Vancouver). Subject sample use was approved by the University of British Columbia, British Columbia Cancer Agency, Research Ethics Board (REB #H13-01478). The cases were selected on the basis of the following criteria: 16 years of age or older; histologically confirmed de novo DLBCL according to the 2008 WHO classification; available DNA extracted from fresh-frozen biopsy material (tumor content >30%). All cases were centrally classified by A.M. and R.D.G., who were blinded for sample identity to determine the diagnosis. Individuals were excluded if they were younger than 16 years old and had DLBCL that was not de novo DLBCL (primary mediastinal large B cell lymphoma, primary central nervous system lymphoma and a previous diagnosis of an indolent lymphoproliferative disorder) and positive HIV serology.
Targeted Resequencing in DLBCL Samples.
Targeted resequencing of the coding exons of KMT2D in 347 DLBCL cases was performed using a Truseq Custom Amplicon assay (Illumina) and libraries were run on the MiSeq (Illumina). Mutation calling was done with Mutascope pipeline. Cell of origin (COO) classification was available in 331 cases according to gene expression profiling by the Lymph2Cx assay using the NanoString platform28 in 299 subjects, as well as Hans algorithm29 in 32 cases with low tumor content. 194 cases were assigned to GCB subtype, 107 cases to the ABC (non-GCB) subtype and 30 were unclassifiable.
Correlation Between KMT2D Mutation Status with Disease Progression and Survival. Baseline characteristics were compared between the groups with KMT2D mutation type using the chi-squared test.
We measured the endpoints from the time of the initial pathologic diagnosis to the following events: overall survival (OS; the date of death from any cause or to the last follow-up); progression-free survival (PFS; the date of progression, relapse or death from any cause); disease-specific survival (DSS; the date from lymphoma or acute treatment toxicity) and time-to-progression (TTP; the date of progression, relapse or death from lymphoma or acute treatment toxicity). OS, PFS, DSS and TTP were estimated using the Kaplan-Meier method and differences in outcome between groups were assessed using the log-rank test. Two-sided P<0.05 was considered significant. Data were analyzed using SPSS software (SPSS version 14.0; SPSS Inc, IL).
Generation of Mice.
Kmt2dfl/fl mice were previously described7 and here we bred them with CD19-Cre mice (Jackson no. 006785) where Cre is expressed from the pre-B cell stage and removes exons 16-19 of Kmt2d causing an open reading frame shift that creates a stop codon in exon 20. Kmt2dfl/fl×CD19-Cre mice were maintained in a mixed C57BL/6; 129 background. Mice were monitored for tumor formation once a week for the first 4 months and every day after then. All mice were housed in the Frederick National Laboratory and treated with procedures approved by the US National Institutes of Health (NIH) Animal Care and Use Committee.
The VavP-Bcl2 mouse model of FL9 was adapted to the adoptive transfer approach using retrovirally transduced HPCs. HPC isolation and transduction were performed as in ref. 30. 8- to 10-week-old lethally irradiated (4.5 Gy twice) C57BL/6 females were used as recipients for all transplantation experiments. shRNAs to mouse Kmt2d were designed using Designer of Small Interfering RNA (DSIR, http://biodev.extra.cea.fr/DSIR/) and are based on MSCV31: shKmt2d #1 (mouse), GACTGGTCTAGCCGATGTAAA (SEQ ID NO:20) and shKmt2d #2 (mouse), TGAATCTTTATCTTCAGCAGG (SEQ ID NO:21).
Mouse B220+ Tumor Sample Preparation.
B220+ cells were purified from mouse lymphoma tumors by immunomagnetic enrichment with CD45R (B220) microbeads (Miltenyi Biotech). RNA extraction was performed using TRIzol (Ambion) using the manufacturer's protocol.
Histology.
Mouse tissues were fixed overnight in formalin, embedded in paraffin blocks and sectioned. Tissue sections were stained with hematoxilin and eosin (H&E) or with Ki67, TUNEL, B220 or PNA following standard procedures32,33.
Flow Cytometric Analysis.
Vavp-Bcl2 Tumors.
Tumor cell suspensions of representative tumors for each genotype were stained as described30. The antibodies used were B220 (CD45R; BD PharMingen, #553092) or IgG1 (BD PharMingen #560089), which were conjugated with APC, and to B220 (CD45R; BD PharMingen, #553090), CD19 (BD PharMingen, #557399), IgM (PharMingen, #553409), Thy1 (CD90; Cedarlane, #CL8610PE), CD8 (PharMingen, #553032), Sca-1 (PharMingen, #553108), IgD (BD PharMingen #558597) and GL7 (BD PharMingen #561530), which were conjugated with phycoerythrin. Analysis was performed with a BD LSRFortessa cell analyzer and FlowJo software (Tree Star).
Kmt2d−/− Tumors.
Single-cell suspensions were obtained from spleens according to standard procedures. Red blood cells were lysed with ACK Lysing Buffer (Quality Biological) and surface markers on tumor cells were analyzed on FACSCalibur (BD Biosciences) using the following fluorochrome-cojugated antibodies: IgM-PE (BD Pharmingen, clone R6-60.2 #553409), IgM-FITC (BD Pharmingen, clone R6-60.2 #553408), IgD-FITC (BD Pharmingen, clone 11-26c.2a #553439), FITC-conjugated Ig, λ1, λ2 and λ3 (BD Pharmingen, clone R26-46 #553434), Igκ-FITC (BD Pharmingen, clone 187.1 #550003), CD19-APC (BD Pharmingen, clone 1D3 #550992), B220-PE (BD Pharmingen, clone RA3-6B2 #553090), B220-PE (BD Pharmingen, clone RA3-6B2 #553088), CD138-PE (BD Pharmingen, clone 281.2 #553714), CD24-FITC (BD Pharmingen, clone M1/69 #553261), CD11b-APC (BD Pharmingen, clone M1/70 #553312), CD4-PE (Biolengend, clone GK1.5 #100408), CD8-FITC (BD Pharmingen, clone 53-6.7 #553031), CD3-PE (BD Pharmingen, clone 500A2 #553240), and CD43-biotin (BD Pharmingen, clone S7 #553269) and B220-biotin (BD Pharmingen RA3-6B2 #553085) followed by Streptavidin-APC (BD Pharmingen). Analysis was performed with FlowJo software (Tree Star).
Characterization of Nonmalignant B Cell Populations in Kmt2d−/− Mice.
To identify the different B cell populations, two stains were performed in splenocytes from 4- to 5.5-month-old mice (two female and one male wild-type mice and four female Kmt2d−/− mice). First, to identify transitional, follicular and marginal zone populations, cells were stained with the following antibodies: CD21-FITC (Biolegend, clone 7E9, #123407), CD5-PE (eBioscience, clone 53-7.3 #12-0051-81), CD23-PECY7 (Biolegend, clone B3B4 #101613), IgM-APC (Biolegend, clone RMM-1 #406509) or B220-Alexa700 (Biolegend, clone RA3 #103232). To identify intermediate plasma cells or plasmablasts (IPC), plasma cells (PC) and germinal center populations, cells were stained with the following antibodies: GL7-FITC (Biolegend, clone GL7 #144003), CD138-PE (Biolegend, clone 281-2 #142503), CD95-APC (eBioscience, clone 15A7 #17-0951-80) or B220-Alexa700 (Biolegend, clone RA3 #103232). To determine the percentages of cell populations, values were normalized by percentage of B220+ single live cells (single cells, 7-AAD−B220+; 7-AAD (Life Technologies) was used to identify dead cells). Data acquisition was performed in a BD LSR II Flow Cytometer (BD Biosciences) and analysis was performed with FlowJo software (Tree Star).
DLBCL Cell Lines.
CD40R expression on DLBCL cell lines was measured using FITC-conjugated anti-CD40 (BD clone C53 #B555588). DLBCL cell line viability was measured by APC-conjugated anti-annexin V (BD #B550474) and DAPI exclusion. Data were acquired on MacsQuant flow cytometer (Miltenyi Biotec) and analyzed using FlowJo software package (TreeStar).
IgVH Rearrangement Analysis.
PCR to evaluate IgVH rearrangements was performed on cDNA of VavP-Bcl2 lymphoma cells with a set of a forward primer that anneal to the framework region of the most abundantly used IgVL gene families and a reverse primer located in the Jλ1,3 gene segment (IgL-Vλ1: GCCATTTCCCCAGGCTGTTGTGACTCAGG [SEQ ID NO:22] and IgL-Jλ1,3: ACTCACCTAGGACAGTCAGCTTGGTTCC; SEQ ID NO:23)34.
Class Switch Recombination (CSR) in Kmt2d□/□ Tumors.
Genomic DNA isolated from tumors cell suspensions and MEFS as a germinal band control were restricted and for Southern blot hybridization was performed with the following probes: JH probe (PCR amplified with 5′-TATGGACTACTGGGGTCAAGGAAC-3′ [SEQ ID NO:3] and 5′-CCAACTACAGCCCCAACTATCCC-3′ [SEQ ID NO:4], 3′Smu probe (PCR amplified with 5′-CCATGGGCTGCCTAGCCCGGGACTTCCTGCCC [SEQ ID NO:5] and 5′-ATCTGTGGTGAAGCCAGATTCCACGAGCTTCCCATCC-3′; SEQ ID NO:6) and IgκIII a EcoRI/SacI fragment downstream Jκ5 at Igκ locus.
Somatic Hypermutation.
The genomic sequences from VH to the intron downstream of JH4 were PCR-amplified from tumor DNA using degenerate forward primers for the different VH families35 and a reverse primer (5′-AGGCTCTGAGATCCCTAGACAG-3′; SEQ ID NO:7)36 downstream of JH4. Proofreading polymerase (Phusion High Fidelity, NEB) was used for amplification with previously published PCR conditions35. Amplification products were isolated from agarose gels and submitted to Sanger sequencing. Sequences were compared with reference and mutation rate calculated using IMGT/V-QUEST37 and UCSC BLAT. PCR amplification and sequencing was repeated two or three times for each sample. As a negative and a positive control, DNA extracted from mouse embryonic fibroblasts (MEFS) and Igκ-AID B cells, respectively, were used in parallel.
Characterization of Mouse B Cell Differentiation and Antibody Production.
Germinal Center Assessment in Mice.
HPCs from C57BL/6 mice were retrovirally transduced with empty vector or shKmt2d and adoptive transfer approach was performed in 2-month-old C57BL/6 females irradiated with 4.5 Gy (n=3 or 4 per group). After 4 and 7 weeks after injection of HPCs, females were immunized intraperitoneally with 0.5 ml of 2% sheep red blood cell (SRBC) suspension in PBS (Cocalico Biologicals). Nine weeks later spleens were collected for histology and immunohistochemistry analysis. Ki67-positive cells were quantified using Metamorph software.
For analysis of the formation of GCs in Km2d−/− mice, four mice for each genotype (1.5- to 2-month-old, wild-type: 2 males and 2 females; Kmt2d−/− mice: 3 males and 1 female) were immunized intraperitoneally with 100 μg of NP21-CGG (Biosearch Technologies) in Imject alum (Pierce). On day 6 after immunization, splenocytes were harvested and B cell populations were analyzed by flow cytometry as above (see Characterization of B cell populations in Kmt2d−/− mice).
ELISA Analysis of NP-Specific Antibody Production.
Serum from NP-CGG-immunized Kmt2d+/+ (wild-type) or Kmt2d−/− mice was analyzed for NP-specific IgM or IgG1 titer using the SBA Clonotyping System-HRP (SouthernBiotech). Plates were coated with 10 ug/ml NP(20)-BSA (Biosearch Technologies) and serum from immunized or nonimmunized mice was added to 96-well assay plates (Costar) at increasing dilutions in PBS with 1% BSA. Bound antibodies were detected with HRP-labeled goat anti-mouse IgG1 or IgM antibodies. The optical density of each well was measured at 405 nm.
In vitro class-switch recombination. For class switch recombination to IgG1, resting splenic B cells were isolated from 2.5- to 5-month-old Kmt2d+/+ CD19-Cre− (wild-type, 2 females and 3 males) and Kmt2dfl/fl CD19-Cre+ (Kmt2d−/−; 2 females and 3 males) mice by immunomagnetic depletion with anti-CD43 MicroBeads (anti-Ly48, Miltenyi Biotech), and cultured at 0.5×106 cells/ml with LPS (25 μg/ml; Sigma), IL-4 (5 ng/ml; Sigma) and RP105 (anti-mouse CD180; 0.5 μg/ml; BD Pharmingen) for 4 d. B cells were infected at 24 and 48 h in culture with pMX-Cre-IRES-GFP as described38 to enhance Kmt2dfl/fl deletion. Class switching to IgG1 was measured at 96 h in the GFP+ population (>90%) by flow cytometry using the following antibodies: IgG1-biotin (BD Pharmingen, clone A85-1 #553441) following streptavidin-Pacific Blue (Molecular Probes) and B220-Alexa700 (Biolegend, clone RA3 #103232). Data acquisition was performed on the BD LSR II Flow Cytometer (BD Biosciences) equipped with CellQuest software (Becton Dickinson). Analysis was performed with FlowJo software (Tree Star).
mRNA-Seq Library Preparation and Sequencing Analysis.
RNA was purified using the RNAeasy Plus Kit (QIAGEN) that included a genomic DNA elimination step. RNA size, concentration and integrity were verified using Agilent 2100 Bioanalyzer (Agilent Technologies). Libraries were generated using Illumina's TruSeq RNA sample Prep Kit v2, following the manufacturer's protocol. Sequencing of 8-10 pM of each library was done on the HiSeq2500 sequencer as 50-bp single-read runs. RNA-seq data from mouse B220 cells were aligned to the mm9 genome using STAR. RNA-seq data from FL subjects were aligned to the hg19 genome using TopHat. −2.0.10 with default parameters except −r 150 (TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions). Read counts were derived from HTSeq.scripts.count module in HTSeq-0.6.0 with default parameters (HTSeq—a Python framework to work with high-throughput sequencing data). Differentially expressed genes were generated by DESeq2-1.6.3 in R [moderated estimation of fold change and dispersion for RNA-seq data with DESeq2].
ChIP and ChIP-Seq Library Preparation and Sequencing Analysis.
H3K4me1 and H3K4me2 ChIP was performed as previously described39. Briefly, 4×106 mouse B220+ cells or DLBCL cells were fixed with 1% formaldehyde, lysed and sonicated (Branson Sonicator; Branson) leading to a DNA average size of 200 bp. 4 ul of H3K4me1 and H3K4me2-specific antibody (Abcam 32356 lot GR106705-5), tested for specificity by histone-peptide array (Active Motif 13001), was added to the precleared sample and incubated overnight at 4° C. The complexes were purified using protein-A beads (Roche) followed by elution from the beads and reverse cross-linking. DNA was purified using PCR purification columns (QIAGEN).
H3K4me1 and H3K4me2 ChIP-seq libraries were prepared using 10 ng of DNA and Illumina's TruSeq ChIP sample prep, according to the manufacturer. Libraries were validated using the Agilent Technologies 2100 Bioanalyzer and Quant-iT dsDNA HS Assay (Life Technologies) and 8-10 pM was sequenced on a HiSeq2500 sequencer as 50-bp single-read runs. ChIP-seq data was aligned to the hg18 and hg19 genomes using STAR. Peak calling and read density in peak regions were performed by ChIPseeqer-2.1 with default parameters (an integrated ChIP-seq analysis platform with customizable workflows).
KMT2D ChIP assays were performed as previously described40. Briefly, 3-5×107 cells were cross-linked with 1% paraformaldehyde at room temperature for 15 min and sonicated to generate chromatin fragments of 200-600 bp. Fragmented chromatin was then immunoprecipitated overnight with in-house-generated human KMT2D antibody specific for the N terminus previously described5, followed by washes and elution. ChIP-sequencing libraries were prepared with KAPA HTP ChIP-seq sample prep kit (KAPA Bioystems) for further high-throughput sequencing.
H3K4me1 and H3K4me2 ChIP DNA from OCI-LY7 cells transduced with KMT2D shRNA or empty vector control lentivirus were quantified by qPCR. Primers were designed to amplify loci with KMT2D peaks in OCI-LY7 and H3K4me1 and H3K4me2 depletion in OCI-LY1. Enrichment was calculated relative to input. The primers used were:
Human_Downregulated_Genes are downregulated genes (log fold change (log FC)<0, P val<0.05, n=519) in FL subjects with nonsense KMT2D mutations versus those with wild-type KMT2D,
For H3K4me1 and H3K4me2 ChIP data from mouse B220+ cells, candidate peaks were the union of the peaks called from each control replicate (n=3) with ChIPseeqer. We defined peaks that overlapped with promoters (defined as ±2 kb windows centered on RefSeq transcription start sites (TSS)). Peaks that didn't overlap with promoters, gene bodies and exons were treated as enhancer peaks. Enhancer peaks inside gene bodies were identified as intragenic enhancer peaks. Intergenic enhancer peaks were defined as being within a 50-kb window from the corresponding genes. TSS Mouse_Enh_H3K4me1/me2_Loss were genes identified with H3K4me1 and H3K4me2 depletion (>25% read density loss and P val<0.05, t-test, n=680) at enhancer peaks in shKmt2d (n=3) (
We derived Mouse_Pro_H3K4me1/me2 Loss gene sets (n=602,
For H3K4me1 and H3K4me2 ChIP data from OCI-LY1 and OCI-LY7 cell lines, candidate peaks were the union of the peaks called from two OCI-LY7 replicates (KMT2D WT) with ChIPseeqer. Promoter and enhancer peaks were determined by the same method described above for mouse B220 H3K4me1-H3K4me2 ChIPseq. In addition all enhancer peaks were overlapped with annotated enhancers previously determined in OCI-LY7. Human_H3K4me1/me2 LOSS50 were genes with H3K4me1 and H3K4me2 depletion (>50% read density loss, n=4416) in OCI-LY1 versus OCI-LY7 (
KMT2D peaks from KMT2D ChIP-seq data were called using ChIPseeqer. Human_H3K4me1/me2_Loss50_KMT2D were genes with H3K4me1-H3K4me2 loss peaks (>50% read density loss and overlapped with KMT2D peaks, n=1,248,
Gene Ontology (GO) Analysis with iPAGE.
The GO analyses were performed with iPAGE41. The concept of mutual information (MI)42 to directly quantify the dependency between expression and known pathways in MsigDB43 or in the lymphoid signature database from the Staudt Lab44 are used in iPAGE. Nonparametric statistical tests are then used to determine whether a pathway is significantly informative about the observed expression measurements. An iPAGE input file is defined across around 24,000 genes from Refseq genes, where each gene is associated with a unique expression status in our analysis. Meanwhile, each gene can be associated with a subset of M known pathways (for example, from the Gene Ontology annotations). For each pathway, the pathway profile is defined as binary vector with N elements, one for each gene. “1” indicates that the gene belongs to the pathway and “0” indicates that it does not.
Given a pathway profile and an expression file with Ne groups, iPAGE creates a table C of dimensions 2×Ne, in which C(1,j) represents the number of genes that are contained in the jth expression group and are also present in the given pathway. C(2,j) contains the number of genes that are in the jth expression group but not assigned to the pathway. Given this table, we calculate the empirical mutual information (MI) as follows:
To assess the statistical significance of the calculated MI values, we used a nonparametric randomized-based statistical test. Given I as the real MI value and keeping the pathway profile unaltered, the expression file is shuffled 10,000 times and the corresponding MI values Irandom are calculated. A pathway is accepted only if I is larger than (1-max_p) of the Irandom values (max_p is set to 0.005). This corresponds to a P<0.005. In iPAGE, pathways are first sorted by information (from informative to noninformative). Starting from the most informative pathways, the statistical test described above is applied to each pathway, and pathways that pass the test are returned. When 20 contiguous pathways in the sorted list do not pass the test, the procedure is stopped.
Highly statistically significant mutual information is explained by combination of over-representation and under-representation in specific expression groups. To quantify the level of over- and under-representation, the hypergeometric distribution is used to calculate two distinct P values:
where x equals the number of genes in the given expression group that are also assigned to the give pathway, m is the number of genes assigned to the pathway (foreground), n is the number of genes in the expression group and N is the total number of genes (background). If Pover<Punder, we consider the pathway to be over-represented in the expression cluster, otherwise it is under-represented. In the heat map, the red color indicates (in log10) the over-represented P values and the blue shows under-representation.
Gene Set Enrichment (GSEA) Analysis.
All the GSEA analysis results in this manuscript were generated from GSEA preranked mode43,45. There were two kinds of input files: (i) FL subjects: gene expression level log FC (nonsense KMT2D mutation versus WT) and (ii) B220: gene expression level log FC (shKMT2D versus MLS). In those input files, we chose the minimum log FC when a gene had multi-transcripts. All the gene sets used in GSEA were described in the Computational Methods section.
Human Cell Lines.
The lymphoma cell lines HT, DoHH2, SU-DHL4, Toledo, Karpas-442, OCI-LY8, NU-DUL1 and SU-DHL10 were maintained in RPMI 1640 with 10% FBS, 1%
Proliferation assays in lentiviral-transduced OCI-LY7 cells were performed using Viacount assay from Guava Technologies performed as reported46. 5×105 cells were seeded in 2 ml into a single well of a 6-well dish. Each experiment was done in triplicate.
For the IL-21 stimulation assay, OCI-LY7 cells transduced with lentiviruses with vector or shRNA against KMT2D were seeded and recombinant human IL-21 (PeproTech #200-21) was added to a 10 ng/ml final concentration; cells were collected after 48 h and whole cell lysates were prepared.
For CD40-IgM stimulation assays, DLBCL cells were seeded at 2.5×105 cells in 500 ul into a single well of a 12-well plate and cultured with anti-CD40 (2.5 ug/ml; RD Systems #AF632) alone or in combination with anti-IgM (10 ug/ml; Jackson ImmunoResearch #109-006-129) for 1, 2 or 4 d. After 1 or 2 d, cells were collected for RNA isolation. After 4 d, cell death was measured using annexin-V and DAPI staining.
Histone Extraction and Quantitative Mass Spectrometry Analysis.
Nuclei were isolated and histone proteins were extracted as described previously with minor modifications47. Briefly, histones were acid-extracted from nuclei with 0.2 M H2SO4 for 2 h and precipitated with 25% trichloroacetic acid (TCA) overnight. Protein pellets were redissolved in 100 mM NH4HCO3 and the protein concentration was measured by Bradford assay. Histone proteins were derivatized by propionic anhydride and digested with trypsin for about 6 h (ref. 47). Peptides were also derivatized by propionic anhydride and desalted by C18 Stage-tips. Histone peptides were loaded to a 75 μm inner diameter (I.D.)×15 cm fused silica capillary column packed with Reprosil-Pur C18-AQ resin (3 μm; Dr. Maisch GmbH, Germany) using an EASY-nLC 1000 HPLC system (Thermo Scientific, Odense, Denmark). The HPLC gradient was 2-35% solvent B (A=0.1% formic acid in water; B=0.1% formic acid in acetonitrile) in 40 min and from 35% to 98% solvent B in 20 min at a flow rate of 300 nl/min. HPLC was coupled to an LTQ-Orbitrap Elite (Thermo Fisher Scientific, Bremen, Germany). Full MS spectrum (m/z 290-1400) was performed in the Orbitrap with a resolution of 60,000 (at 400 m/z), and the 10 most intense ions were selected for tandem mass spectrometry (MS/MS) performed with collision-induced dissociation (CID) with normalized collision energy of 35 in the ion trap. Automatic gain control (AGC) targets of full MS and MS/MS scans are 1×106 and 1×104, respectively. Precursor ion charge state screening was enabled and all unassigned charge states as well as singly-charged species were rejected. The dynamic exclusion list was restricted to a maximum of 500 entries with a maximum retention period of 30 s. Lock mass calibration in full MS scan is implemented using polysiloxane ion 371.10123. Histone peptide abundances were calculated from the acquired raw data by EpiProfile program48.
Immunoblot Analysis.
PBS lysis buffer (1% Triton X-100, 1 mM DTT, in PBS) followed by 0.2 N HCl solution was used to prepare lysates for histone fraction of lymphoma (B220+) cells. RIPA buffer (Boston Bioproducts) was used to prepare whole-cell lysates of OCI-LY7 cells. Immunoblot analyses were performed according to standard procedures. Membranes were probed with the indicated primary antibodies to: H3K4me1 (Abcam, #ab8895), H3K4me2 (Millipore #07-030), H3K4me3 (Millipore #07-473), total H3 (abcam #ab1791), p-Tyr705-STAT3 (Cell Signaling #9145), total-STAT3 (Cell Signaling #12640) and SOCS3 (Cell Signaling #2932). Enhanced chemiluminescence was used for detection (ECL, Amersham).
Validation of KMT2D Targets by Quantitative Real Time PCR Analyses.
Total RNA from cells was extracted using TRIzol (Invitrogen). Reverse transcription was performed using random primers and SuperScript III First Strand (Invitrogen #18080-400). Quantitative real time-PCR was performed using TaqMan Universal Master Mix (Applied Biosystems) in a 7900 HT Fast Real Time thermocycler (Applied Biosystem). The housekeeping gene used for input normalization of all the qRT-PCR data is β-actin. Taqman gene expression assays used: Kmt2d (Mm02600438_m1), Actb (encoding β-actin) (#4352663), Socs3 (Mm00545913), Dusp1 (Mm00457274), Tnfaip3 (Mm00437121), Arid1a (Mm00473838), Fos (Mm00487425), Ikbkb (Mm01222247), Tnfrsf14 (Mm00619239), KMT2D (Hs00231606), SOCS3 (Hs02330328), TNFRSF14 (Hs00998604), TNFAIP3 (Hs00234713), ARID1A (Hs00195664), DUSP1 (Hs00610256), TRAF3 (Hs00936781), NR4A1 (Hs00374226), IKBKB (Hs00233287), DNMT3A (Hs01027166), ASXL1 (Hs00392415), ARID3B (Hs00356736), MAP3K8 (Hs00178297) and ACTB (#4352667).
Statistical Methods.
Sample sizes for comparisons between cell types or between mouse genotypes followed Mead's recommendations49. Samples were allocated to their experimental groups according to their predetermined type (i.e., mouse genotype) and, therefore, there was no randomization. Investigators were not blinded to the experimental groups unless indicated. In the case in
Accession Codes.
The Gene Expression Omnibus accession codes for the data in this manuscript are: GES67291 (mouse B220+ lymphoma H3K4me1 and H3K4me2 ChIPseq and RNAseq), GES67314 (KMT2D ChIPseq in OCI-LY7 lymhoma cells), GES67381 (H3K4me1 and H3K4me2 ChIPseq in OCI-LY7 and OCI-LY1 lymphoma cells), SRP056293 (FL samples RNA-seq), SRP056292 (targeted resequencing in FL samples) and SRP056291 (exome sequencing in FL samples).
To directly test the effect of KMT2D deficiency in the development of GC-derived lymphoma, we used the VavP-Bcl2 mouse model. In this model, the Vav promoter drives expression of the Bcl2 oncogene in all hematopoietic lineages, and this results in the development of B cell lymphomas that recapitulate key aspects of the genetics, pathology and GC origin of human FLs9-11. To knock down Kmt2d we transduced unselected VavP-Bcl2 (C57BL/6) transgenic fetal liver cells (embryonic day (ED) 14.5, which are a rich source of hematopoietic progenitor cells (HPCs), with MSCV (Murine Stem Cell Virus) retroviruses that encoded a GFP reporter and either short hairpin RNAs targeting Kmt2d (shKmt2d; n=30), an empty vector (vector; n=37) or the Myc oncogene as a positive control for lymphomagenesis (c-Myc; n=16). We injected an unsorted mix of transduced and untransduced HPCs into syngeneic (C57BL/6) wild-type (WT), lethally irradiated female mice and monitored the recipients for 200 d by peripheral blood smears for the emergence of lymphomas (
The mice transplanted with the VavP-Bcl2-shKmt2d HPCs showed significant splenomegaly and the lymphomas were marked by pathognomonic follicular expansion of neoplastic B220+ B lymphocytes that showed positive staining with peanut agglutinin (PNA) and had low Ki67 staining indicating slow proliferation like human FLs (
Next we analyzed the potential tumor suppressor function of KMT2D in the absence of any cooperating genetic lesions. We crossed Kmt2d conditional knockout mice (Kmt2dfl/fl)7 with a CD19-Cre strain to induce Kmt2d deletion in CD19+ early B cells. The majority (58%) of the Kmt2dfl/fl×CD19-Cre mice (herein referred to as Kmt2d−/−) became moribund with a survival of 338 d (
KMT2D mutations are typically seen in lymphomas that originate from GC B cells that are exposed to the genotoxic activity of the GC-specific enzyme activation-induced cytidine deaminase (AID). Therefore we tested whether the genomic instability caused by AID would synergize with the Kmt2d deficiency to promote lymphoma development in vivo. We crossed the Kmt2d−/− mice to animals overexpressing AID (encoded by Aicda; referred to here as ‘AID-Tg’ mice) and observed a further acceleration of lymphoma onset (
Heritable nonsense mutations in KMT2D are a major cause of the rare congenital Kabuki syndrome (also known as Kabuki makeup or Niikawa-Kuroki syndrome). The syndrome is named for its typical facial features and often comprises a mild immune defect with decreased production of class-switched antibodies and a propensity for ear infections, although a link to tumor development has not been clearly established13. We wanted to examine how KMT2D deficiency affects normal B cells. First we analyzed KMT2D expression using RNA-seq in purified mature B cell subsets isolated from human tonsils. KMT2D expression levels were similar in naive, centroblast, centrocyte and memory B cells, whereas it was reduced in plasma B cells, suggesting a functional role for KMT2D before terminal B cell differentiation (
To determine whether Kmt2d loss affects B cell antibody production, we measured serum IgM and IgG1 levels by ELISA in WT and Kmt2d−/− mice. Results showed that IgM antibody levels were similar for both groups of mice under basal conditions, and although the wild-type mice showed the expected increase in IgG1 levels following NP-CGG (Chicken Gamma Globulin) immunization, Kmt2d−/− mice had decreased IgG1 levels, indicating a class switch defect (
To explore the effects of KMT2D mutations on clinical behavior, we established the KMT2D mutation status in a cohort of 104 human FL specimens. We detected KMT2D mutations in nearly 40% of samples but did not find an apparent hotspot (
Next we analyzed KMT2D status in a cohort of 347 newly diagnosed, clinically annotated DLBCL cases that were all treated with rituximab (R) plus a combination of cyclophosphamide, vincristine, doxorubicin and prednisone (CHOP)—referred to here as R-CHOP—at the BC Cancer Agency (Vancouver) and that were classified as GC B cell (GCB) or activated B cell (ABC) subtype by gene expression profiling. The cases were selected on the basis of the following criteria: individuals were 16 years of age or older with histologically confirmed de novo DLBCL according to the 2008 World Health Organization (WHO) classification, and DNA extracted from fresh-frozen biopsy material (tumor content >30%) was available. The overall mutation frequency was similar to our FL cohort, however we noticed a higher prevalence of nonsense mutations in the GCB subtype (17.6%) than in the ABC subtype (8.4%) (
Next we investigated the transcriptional changes related to KMT2D mutation status by RNA-seq on seven human FL specimens with KMT2D nonsense mutations and 12 with wild-type KMT2D. As expected, the most differentially expressed genes in FLs with nonsense mutation-containing KMT2D were skewed toward gene downregulation, such that among the top 100 genes 70% were decreased, whereas that fraction decreased to 55% when 500 genes were included (
To assess how KMT2D depletion contributes to transcriptional regulation, we measured H3K4 mono- and dimethylation (H3K4me1 and H3K4me2, respectively) in Kmt2d-deficient and control lymphomas. Using an antibody that specifically recognizes H3K4me1 and H3K4me2 on DNA, we performed ChIP-seq on purified B220+ mouse lymphoma cells (n=3 for both empty vector-containing and shKmt2d-containing VavP-Bcl2 cells). First, analysis of ChIP-seq data for H3K4me1 and H3K4me2 abundance did not reveal a global loss of the marks genome wide (
Next we analyzed H3K4me1 and H3K4me2 abundance in human lymphoma cells lines that were either wild type (OCI-LY7, HT, DOHH2 and SU-DHL4) or mutant (OCI-LY1, OCI-LY18, Toledo and Karpas422) for KMT2D. As in the mouse lymphomas, measurements of global H3K4 methylation by immunoblotting and mass spectrometry showed no differences between the lymphoma lines with WT and mutant KMT2D (
On the basis of concordant changes in expression, H3K4me1 and H3K4me2 depletion and KMT2D binding, we selected several candidate KMT2D targets for further validation (SOCS3, TNFSRF14, TNFAIP3, ARID1A, DUSP1, TRAF3, NR4A1, IKBKB, DNMT3A, ASXL1, ARID3B, MAP3K8 and SGK1). First we generated isogenic pairs of parental and KMT2D-knockdown human lymphoma cells using the wild-type KMT2D-containing lines OCI-LY7 and SU-DHL4. Unlike in certain solid tumor cells17, KMT2D-deficient lymphoma cells were more proliferative in vitro than their KMT2D-proficient parental counterparts (
Next we probed how KMT2D loss in human lymphoma cells affected the specific functions of key KMT2D targets. We generated isogenic pairs of KMT2D-proficient and KMT2D-deficient human lymphoma cell lines using shRNA knockdown. We identified SOCS3, a negative regulator of STAT3 signaling, as a KMT2D target. Accordingly, we found a reduction of SOCS3 protein levels and an augmentation in the JAK-STAT response to IL-21 stimulation in the KMT2D-deficient cells as compared to those in the isogenic control OCI-LY7 cells (
It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications that are within the spirit and scope of the invention, as defined by the appended claims.
The following tables are included herein:
This application claims priority under 35 USC 119(e) to U.S. patent application Ser. No. 62/135,040, filed Mar. 18, 2015, and to U.S. patent application Ser. No. 62/201,390, filed Aug. 5, 2015, both of which are incorporated herein by reference in their entireties.
This invention was made with government support under grants CA183876, CA019038, CA187109, GM110174, CA150265, DP2OD007447 and CA008748 from the National Institutes of Health, and Grant 11557134 from the Department of Defense. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US16/22953 | 3/17/2016 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62135040 | Mar 2015 | US | |
| 62201390 | Aug 2015 | US |
