The present invention relates to methods and compositions for diagnosing prostate cancer and/or determining whether a subject having prostate cancer is at increased risk for relapse or rapid relapse.
Prostate cancer is one of the most common and lethal malignancies in men: The annual mortality rate reached 32,000 in the US in 2009 (1-3). Previous cytogenetic and other genome studies suggest a clear link between genome abnormalities and the prostate cancer (4-9). Currently, several treatment options are available for prostate cancer patients including watchful waiting, radiation, hormonal/chemo-therapy and radical prostatectomy. Gleason's grading alone or in combination with other clinical indicators such as serum prostate specific antigen levels and pathological or clinical staging has been the guiding tool in selecting these treatment options. Significant numbers of prostate cancer patients, however, experienced relapse after surgical resection of the prostate gland. There is clearly a need for better prediction of the behavior of prostate cancer.
The present invention relates to methods and compositions for diagnosing prostate cancer and/or determining whether a prostate cancer patient is at increased risk of suffering a relapse, or a rapid relapse, of his cancer. It is based, at least in part, on the results of a comprehensive genome analysis on 241 prostate cancer samples (104 prostate cancer, 85 matched bloods, 49 matched benign prostate tissues adjacent to cancer, and 3 cell lines) which indicate that (i) genome copy number variation (CNV) occurred in both cancer and non-cancer tissues, and (ii) CNV predicts prostate cancer progression.
Armed with the present invention, the health care practitioner is better able to advise a prostate cancer patient whether or not to undergo more aggressive forms of therapy or whether watchful waiting would be an appropriate recommendation, where in subjects at higher risk more aggressive forms of therapy may be recommended, including but not limited to prostate resection, antiandrogen therapy, radiotherapy and/or chemotherapy.
In certain non-limiting embodiments, the present invention provides for methods and compositions for diagnosing prostate cancer in a subject. In other non-limiting embodiments, the present invention provides for methods and compositions for determining whether a prostate cancer patient is at increased risk of suffering a relapse, or a rapid relapse, of his cancer. In other non-limiting embodiments, the present invention provides for methods and compositions for determining whether a prostate cancer patient is at decreased risk of suffering a relapse, or a rapid relapse, of his cancer (in other words, is at increased risk or has an increased likelihood of not suffering a relapse).
A “prostate cancer patient” is a subject having or who has had a carcinoma of the prostate. The use of the term “patient” does not suggest that the subject has received any treatment for the cancer, but rather that the subject has at some point come to the attention of the healthcare system. Said patient/subject, prior to or contemporaneous with the practicing of the invention, may be untreated for prostate cancer or may have received treatment, including but not limited to surgical, chemotherapeutic, antiandrogen, or radiologic treatment.
“Increased risk” means an increased likelihood that relapse will occur relative to other prostate cancer patients. In particular non-limiting embodiments, there is a statistically validated increase in the likelihood of relapse or rapid relapse relative to subjects without relapse or rapid relapse with a p value of 0.003 for relapse and <0.001 for fast relapse when using “gene specific” CNV of prostate cancer samples, 0.04 for relapse and 0.015 for fast relapse when using “gene specific” CNV of AT samples, <0.001 for relapse and 0.001 for fast relapse when using median sizes of CNV of blood samples from prostate cancer patients, <0.001 for both relapse and fast relapse when using “median sizes” CNV of prostate cancer samples, and 0.004 for relapse when using “mean sizes” of CNV of AT samples.
“Relapse,” as that term is used herein, refers to a clinical course including one or more of the following: (i) where the cancer had been removed or put into remission, a recurrence of prostate cancer at the original site or occurrence at a new site, including metastatic spread; (ii) where the cancer had not been removed or put into remission, extension of the cancer and/or metastatic spread; (iii) whether or not the cancer had been treated, an advancement in the clinical grade, for example the Gleasons grade, of the cancer; and/or a prostate specific antigen (“PSA”) doubling time of 15 months or longer.
By “rapid”, or “relapse quickly”, it is meant that relapse occurs within a period of 5 years. In certain embodiments, patients suffering a rapid relapse also manifest a PSA doubling time of 3 months or less or 4 months or less.
In particular, non-limiting embodiments, the method of the invention may be performed as follows. One or more sample may be obtained from a subject. For example, the sample may be a sample of malignant tumor (or presumptively malignant tumor, where a diagnosis has not yet been made) tissue (e.g., microdissection may be performed to achieve a tumor purity of at least about 70 percent or at least about 80 percent or greater than 80%). As another example, a sample may be tissue adjacent a malignant tumor tissue (e.g., prostate tissue that is not identified as tumor located in a prostate gland that contains tumor; in certain non-limiting embodiments the adjacent tissue is non-malignant prostate tissue located at least 3 mm from tumor tissue). As another example, a sample may be a tissue sample which is considered by a skilled artisan to appear abnormal (microscopically and/or macroscopically) and is to be tested to determine whether it is cancerous. As another example, a sample may be a blood sample that contains at least some nucleated cells (to serve as a source of DNA, e.g., whole blood or buffy coat). Multiple samples may be prepared for a single subject; for example, samples of tumor (meaning malignant) tissue, tissue adjacent tumor tissue, and blood may be prepared and the results of analysis of each may be compared.
For example, DNA may be extracted from a sample, for example using a Qiagen tissue kit or other method known in the art. Then genotyping may be performed to identify CNVs across the genome or a portion of the genome, for example, by fragmenting the DNA using restriction enzymes, ligated with adaptors, amplifying the fragments using primers that correspond to the adaptor sequences (for example, Genome wide human snp NSP/STY assay kit, Affymetrix, CA), optionally performing an additional fragmentation step, labeling the amplified (optionally further fragmented) DNA product, and then hybridizing the resulting labeled DNA with a plurality of test DNA molecules representative of the genome or a genome portion of interest, for example, but not limited to, as provided in an array such as Affymetrix Genome-Wide Human SNP Array 6.0, under appropriate conditions (for example as described by the array manufacturer). The results may then be interpreted to determine the number or approximate number of CNVs in the genome or portion thereof. For example, Partek Genome Suite 6.6™ or a Affymetrix Genotyping Console may be used.
In one set of non-limiting embodiments of the invention, the number of CNVs across the genome are determined. The present invention provides for a method of diagnosing a prostate cancer in a subject comprising determining the number and/or size of CNVs in a tumor sample, a sample of tissue adjacent a tumor, and/or in a blood sample, where if the number and/or size of CNVs exceeds a particular threshold, a diagnosis of prostate cancer is indicated. The present invention also provides for a method of determining that a prostate cancer patient is at increased risk for relapse or rapid relapse comprising determining the number and/or size of CNVs in a prostate tumor sample, tissue adjacent a prostate tumor, and/or blood, where if the number and/or size of CNVs exceeds a particular threshold, the subject is deemed at risk for relapse or rapid relapse.
In another set of non-limiting embodiments of the invention, CNV of one or more particular gene or chromosome or chromosome region is determined. In specific, non-limiting embodiments of the invention, genes for which CNVs may be determined may include one or more of the genes listed in Tables 2-5, where a CNV in one of the genes listed is indicative of increased risk of relapse (in Table 2 based on a prostate cancer tissue sample or in Table 4 based on tissue adjacent to prostate cancer tissue) or rapid relapse (in Table 3 based on a prostate cancer tissue sample or in Table 5 based on tissue adjacent to prostate cancer tissue). The present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse or rapid relapse comprising determining the number and/or size of CNVs of a specific gene as listed in Table 2, 3, 4 or 5 in a prostate tumor sample, tissue adjacent a prostate tumor, and/or blood, where if the number of CNVs for the gene exceeds a particular threshold, a diagnosis of prostate cancer is indicated and/or the subject is deemed at risk for relapse or rapid relapse.
For clarity of description and not by way of limitation, the detailed description of the invention is divided into the following subsections:
(i) Diagnosis based on CNV number and size;
(ii) Assessment of risk based on CNV number and size;
(iii) Assessment of risk based on CNV of particular genes; and
In non-limiting embodiments of the invention, the number of CNVs across the genome are determined. CNV may be detected using methodology known in the art, including the hybridization to gene arrays and the analysis of the results of hybridization using software that determines copy number variation, including, but not limited to, the method using Affymetrix products described above. In non-limiting embodiments of the invention, the entire genome or a portion thereof may be analyzed; for example, in a subset of non-limiting embodiments, the chromosome region for which CNVs is determined is one or more of 8p, 13p, 16p, 17p, and/or 8q.
In certain non-limiting embodiments, the present invention provides for a method of diagnosing a prostate cancer in a subject comprising determining the number and/or size of CNVs in DNA from a tumor sample, a sample of tissue adjacent a tumor, and/or in a blood sample, where if the number and/or size of CNVs exceeds a particular threshold, a diagnosis of prostate cancer is indicated.
In a tissue, CNV in at least about 90 loci, each locus being at least 10 kb in length, is consistent with a diagnosis of prostate cancer rather than benign tissue. Accordingly, the present invention provides for a method of diagnosing a prostate cancer in a subject comprising determining the number and size of CNVs in DNA from a tumor or prostate tissue sample, where if the number of CNVs exceeds 90 loci, each locus being at least 10 kb in length, a diagnosis of prostate cancer is indicated.
In a blood sample, CNV in at least 4 loci, each locus being at least 10 kb in length, is consistent with a diagnosis of prostate cancer rather than no malignancy. Accordingly, the present invention provides for a method of diagnosing a prostate cancer in a subject, where said subject is a male having one or more of the following clinical findings: increased serum prostate specific antigen, enlarged prostate on physical exam, difficulty urinating and/or urinary retention, comprising determining the number and/or size of CNVs in DNA from a blood sample from the subject, where if the number of CNVs exceeds 4 loci, each locus being at least 10 kb in length, a diagnosis of prostate cancer is indicated.
In a tissue or a blood sample, a deletion of at least 3 megabases in one or more of the following chromosome regions is consistent with a diagnosis of prostate cancer rather than benign tissue: 8p, 13p, 16q, and/or 17p. Deletions in these regions can be deduced from CNV information. Accordingly, the present invention provides for a method of diagnosing a prostate cancer in a subject comprising determining the presence of deletions in one or more of chromosome regions 8p, 13p, 16q, and/or 17p in DNA from a prostate tissue or a blood sample from the subject, where if there is a deletion of at least 3 megabases in one or more of these regions, a diagnosis of prostate cancer is indicated.
In a tissue or a blood sample, an amplification of a locus in chromosome region 8q and/or X is consistent with a diagnosis of prostate cancer rather than benign tissue. Amplification in these regions can be deduced using CNV information. Accordingly, the present invention provides for a method of diagnosing a prostate cancer in a subject comprising determining the presence of amplification in one or more of chromosome regions 8q and X in DNA from a prostate tissue or a blood sample from the subject, where if there is amplification of a locus in one or more of these regions, a diagnosis of prostate cancer is indicated.
If a diagnosis of prostate cancer is indicated, a healthcare provider may optionally take the further step of recommending and/or performing a further diagnostic test, such as a biopsy or prostate ultrasound, and/or recommending and/or performing a therapeutic procedure, for example but not limited to surgical excision, radiotherapy, and/or chemotherapy.
In non-limiting embodiments of the invention, CNVs across the genome are determined. CNV may be detected using methodology known in the art, including the hybridization to gene arrays and the analysis of the results of hybridization using software that determines copy number variation, including, but not limited to, the method using Affymetrix products described above. In non-limiting embodiments of the invention, the entire genome or a portion thereof may be analyzed; for example, in a subset of non-limiting embodiments, the chromosome region for which CNVs is determined is one or more of 8p, 13p, 16p, 17p, and/or 8q.
In non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse or rapid relapse comprising determining the size of CNVs in a prostate tumor sample, tissue adjacent a prostate tumor, and/or blood, where if the size of CNVs is less than a particular threshold, the patient is deemed to be at decreased risk for relapse or rapid relapse.
In non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse or rapid relapse comprising determining the mean and/or median size of CNVs in a prostate tumor sample, tissue adjacent a prostate tumor, and/or blood, where if the mean or median size of CNVs is less than a particular threshold, the patient is deemed to be at decreased risk for relapse or rapid relapse.
In non-limiting embodiments, the present invention may utilize the average (mean) size of CNV to assess the likelihood that a prostate cancer will relapse. CNV size may be determined using the same genotyping analysis techniques as described above and as are known in the art. In particular non-limiting embodiments of the invention, using the Partek software described above, segments with copy number change may be obtained (including amplification and deletions), and those with the criteria p<0.001, length >2000 bp and >10 markers, may be selected and then the mean length of the CNVs thus identified may be determined.
In certain non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse comprising determining the size of CNVs in DNA from a blood sample from the patient, where if the average (i.e., mean) size of CNVs is 40 kb or less or 33 kb or less, the patient is deemed to be at decreased risk for relapse.
In certain non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse comprising determining the size of CNVs in DNA from a sample of tissue adjacent a prostate cancer from the patient, where if the mean size of CNVs is 95 kb or less or 81.1 kb or less, the patient is deemed to be at decreased risk for relapse.
In certain non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse comprising determining the size of CNVs in DNA from a sample of prostate cancer tissue from the patient, where if the mean size of CNVs is 385 kb or less or 105 kb or less, the patient is deemed to be at decreased risk for relapse.
In further non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse or rapid relapse comprising determining the mean or median size of CNVs in a prostate tumor sample, tissue adjacent a prostate tumor, and/or blood, where if the mean or median size of CNVs exceeds a particular threshold, the patient is deemed to be at increased risk for relapse or rapid relapse.
In one non-limiting embodiment, in a blood sample from a prostate cancer patient, an average (mean) CNV size of 70 kb or more, is consistent with a likelihood that the prostate cancer will relapse. Accordingly, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining the mean size of CNVs in DNA from a blood sample from the patient, where if the average (i.e., mean) size of CNVs is 70 kb or more, the patient is deemed to be at increased risk for relapse.
In other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining the mean size of CNVs in DNA from a sample of tissue adjacent to prostate cancer from the patient, where if the mean size of CNVs is 246 kb or more, the patient is deemed to be at increased risk for relapse.
In other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining the mean size of CNVs in DNA from a sample of prostate cancer tissue from the patient, where if the mean size of CNVs is 817 kb or more, the patient is deemed to be at increased risk for relapse.
In other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for rapid relapse comprising determining the mean size of CNVs in DNA from a sample of prostate cancer tissue from the patient, where if the mean size of CNVs is 1060 kb or more, the patient is deemed to be at increased risk for rapid relapse.
In further non-limiting embodiments, the present invention may utilize the median size of CNV to assess the likelihood that a prostate cancer will relapse. CNV size may be determined using the same genotyping analysis techniques as described above and as are known in the art. In particular non-limiting embodiments of the invention, using the Partek software described above, segments with copy number change may be obtained (including amplification and deletions), and those with the criteria p<0.001, length >2000 bp and >10 markers, may be selected and then the median length of the CNVs thus identified may be determined.
In one non-limiting embodiment, in a blood sample from a prostate cancer patient, a median CNV size of about 17 kb or less is consistent with a likelihood that the prostate cancer will not relapse. Accordingly, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse comprising determining the median size of CNVs in a blood sample, where if the median size of CNVs is 17 kb or less, the subject is deemed to be at decreased risk for relapse.
In certain non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse comprising determining the median size of CNVs in DNA from a sample of tissue adjacent to a prostate cancer from the patient, where if the median size of CNVs is 16 kb or less, the patient is deemed to be at decreased risk for relapse.
In certain non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at decreased risk for relapse comprising determining the median size of CNVs in DNA from a sample of prostate cancer tissue from the patient, where if the median size of CNVs is 185 kb or less, the patient is deemed to be at decreased risk for relapse.
In certain other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining the median size of CNVs in DNA from a blood sample from the patient, where if the median size of CNVs is 23 kb or more, the patient is deemed to be at increased risk for relapse.
In other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining the median size of CNVs in DNA from a sample of tissue adjacent to prostate cancer from the patient, where if the median size of CNVs is 17384 or more or 18 kb or more, the patient is deemed to be at increased risk for relapse.
In other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for rapid relapse comprising determining the median size of CNVs in DNA from a sample of tissue adjacent to prostate cancer from the patient, where if the median size of CNVs is 32651 bp or more, or 33 kb or more, the patient is deemed to be at increased risk for rapid relapse.
In other non-limiting embodiments, the present invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining the median size of CNVs in DNA from a sample of prostate cancer tissue from the patient, where if the median size of CNVs is 647 kb or more, the patient is deemed to be at increased risk for relapse.
If is determined that the patient is at increased risk for relapse or rapid relapse, a healthcare provider may optionally take the further step of recommending and/or performing frequent monitoring of the patient for recurrence (e.g., a PSA test or imaging (e.g. ultrasound, CT scan, MRI or PET scan)) and/or recommending and/or performing a therapeutic procedure, for example but not limited to surgical excision, radiotherapy, and/or chemotherapy.
In non-limiting embodiments of the invention, the number of CNVs across the genome are determined. CNV may be detected using methodology known in the art, including the hybridization to gene arrays and the analysis of the results of hybridization using software that determines copy number variation, including, but not limited to, the method using Affymetrix products described above. In non-limiting embodiments of the invention, the entire genome or a portion thereof may be analyzed; for example, in a subset of non-limiting embodiments, the chromosome region for which CNVs is determined is one or more of 8p, 13p, 16p, 17p, and/or 8q. Further, the CNV of particular genes may be determined and utilized as set forth in this section.
In further non-limiting embodiments, a CNV in a gene in a prostate cancer tissue from a subject, where the gene is listed in Table 2, indicates that the subject is likely to relapse. In further non-limiting embodiments, a CNV in a gene in a prostate cancer tissue from a subject, where the gene is listed in Table 3, indicates that the subject is likely to experience rapid relapse.
In further non-limiting embodiments, a CNV in a gene in a tissue adjacent to prostate cancer tissue from a subject, where the gene is listed in Table 4, indicates that the subject is likely to relapse. In further non-limiting embodiments, a CNV in a gene in a tissue adjacent a prostate cancer tissue from a subject, where the gene is listed in Table 5, indicates that the subject is likely to experience rapid relapse.
In on set of non-limiting embodiments, the present invention provides for a gene-based prediction in any one or more of four scenarios: relapse or fast relapse prediction in tumor (T) or tissues adjacent to tumor (AT). According to this set of embodiments, the methods for these four scenarios are the same except for the gene lists used are different. In particular, for each scenario, two gene lists are utilized: one list for genes amplified (list “a”) and one list for genes deleted (list ‘b”). Using Partek, the copy number change status of each gene for each sample could be determined; the status could be amplified, deleted or unchanged.
For a given T sample, the number of genes in list “a” that are amplified and the number of genes in list “b” that are deleted are counted, and the number of amplified genes in list “a” may be designated “a” and the number of deleted genes in list “b” may be designated “b”. Genes in list “a” for relapse include HECTD1, MIR1827, UBXN8, SMAP1, C6orf147, DDX43, SLC17A5, LRRIQ4, LRRC31, SAMD7, LOC100128164, SEC62, GPR160, and PHC3. Genes in list “b” for relapse include SLC7A5, CA5A, BANP, ZFPM1, ZC3H18, IL17C, CYBA, MVD, MGC23284, SNAI3, RNF166, GALNS, TRAPPC2L, CBFA2T3, ACSF3, C16orf81, CDH15, ANKRD11, SPG7, RPL13, SNORD68, CDK10, SPATA2L, C16orf7, ZNF276, SYT16, GRIN2B, BCAT1, OVCH1, BEYLA, GPR125, and GBA3. If the number (a+b) is larger than a pre-set cutoff C (i.e. a+b>C), the corresponding sample is assigned the risk designation relapse or fast relapse, depending upon the list that is drawn from. In a particular non-limiting embodiment, in a +b>C, C=0 meaning that the threshold is 0 so that if a or b is a non-zero number, there is an increased risk of relapse.
In non-limiting embodiments, the invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining whether a gene is amplified or whether a gene is deleted in DNA from a sample of prostate cancer tissue from the patient, wherein (a) if one or more gene is amplified from the group consisting of HECTD1, MIR1827, UBXN8, SMAP1, C6orf147, DDX43, SLC17A5, LRRIQ4, LRRC31, SAMD7, LOC100128164, SEC62, GPR160, and PHC3 and/or (b) if one or more gene is deleted from the group consisting of SLC7A5, CA5A, BANP, ZFPM1, ZC3H18, IL17C, CYBA, MVD, MGC23284, SNAI3, RNF166, GALNS, TRAPPC2L, CBFA2T3, ACSF3, C16orf81, CDH15, ANKRD11, SPG7, RPL13, SNORD68, CDK10, SPATA2L, C16orf7, ZNF276, SYT16, GRIN2B, BCAT1, OVCH1, BEYLA, GPR125, and GBA3, then the patient is deemed to be at increased risk for relapse.
In other non-limting embodiments, genes in list “a” for rapid relapse include BRMS1L, KCNMB4, MIR548A1, ORC3L, SDAD1, CXCL9, ART3, CXCL10, CXCL11. Genes in list “b” for rapid relapse include GALNTL1, FLJ44817, KIAA0247, LOC100289511, SFRS5, SLC10A1, SLC8A3, SNORD56B, PABPC3, MTMR6, ATP8A2, NAV2, ZC3H12C, FDX1, ARHGAP20, C11orf88, LAYN, and CD28. In a particular non-limiting embodiment, in a+b>C, C=0, meaning that the threshold is 0 so that if a or b is a non-zero number, there is an increased risk of rapid relapse.
In non-limiting embodiments, the invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining whether a gene is amplified or whether a gene is deleted in DNA from a sample of prostate cancer tissue from the patient, wherein (a) if one or more gene is amplified from the group consisting of BRMS1L, KCNMB4, MIR548A1, ORC3L, SDAD1, CXCL9, ART3, CXCL10, and CXCL11 and/or (b) if one or more gene is deleted from the group consisting of GALNTL1, FLJ44817, KIAA0247, LOC100289511, SFRS5, SLC10A1, SLC8A3, SNORD56B, PABPC3, MTMR6, ATP8A2, NAV2, ZC3H12C, FDX1, ARHGAP20, C11orf88, LAYN, CD28, then the patient is deemed to be at increased risk for rapid relapse.
In related embodiments applied to AT, two gene lists are utilized: one list for genes amplified (list “c”) and one list for genes deleted (list “d”). Using Partek, the copy number change status of each gene for each sample could be determined; the status could be amplified, deleted or unchanged. For a given T sample, the number of genes in list “c” that are amplified and the number of genes in list “d” that are deleted are counted, and the number of amplified genes in list “c” may be designated “c” and the number of deleted genes in list “d” may be designated “d”. Genes in list “c” for relapse include DZIP1, ZHX2, DERL1, WDR67, COL22A1, BHLHE40 and, in a non-limiting embodiment, there is no gene in list “d”. In a particular non-limiting embodiment, in a+b>C, C=0 meaning that the threshold is 0 so that if c or d is a non-zero number, there is a likelihood of relapse. In other non-limiting embodiments applied to AT, genes in list “c” for rapid relpase include MAGEL2, NDN, RSU1, ADCY2, UBE2E1 and genes in list “d” for rapid relpase based on AT include RPL23AP82, RABL2B, CA10, C13orf36, SMAD9, ALG5, RETNLB, TRAT1, GUCA1C, MORC1. In a particular non-limiting embodiment, in a+b>C, C=1 meaning that the threshold is 1 so that if the sum of c and d is greater than one, there is a likelihood of rapid relapse.
In non-limiting embodiments, the invention provides for a method of determining that a prostate cancer patient is at increased risk for relapse comprising determining whether a gene is amplified in DNA from a sample of tissue adjacent to prostate cancer tissue from the patient, wherein if one or more genes is amplified from the group consisting of DZIP1, ZHX2, DERL1, WDR67, COL22A1, BHLHE40 then the patient is deemed to be at increased risk for relapse.
In non-limiting embodiments, the invention provides for a method of determining that a prostate cancer patient is at increased risk for rapid relapse comprising determining whether a gene is amplified or whether a gene is deleted in DNA from a sample of tissue adjacent to prostate cancer tissue from the patient, wherein (a) if one or more genes is amplified from the group consisting of MAGEL2, NDN, RSU1, ADCY2, UBE2E1 and/or (b) one or more genes is deleted from the group consisting of RPL23AP82, RABL2B, CA10, C13orf36, SMAD9, ALG5, RETNLB, TRAT1, GUCA1C, MORC1, wherein the total number of genes amplified from the group listed in (a) and/or deleted from the group listed in (b) is greater than or equal to 2, then the patient is deemed to be at increased risk for rapid relapse.
If is determined that the patient is at increased risk for relapse or rapid relapse, a healthcare provider may optionally take the further step of recommending and/or performing frequent monitoring of the patient for recurrence (e.g., a PSA test or imaging (e.g. ultrasound, CT scan, MRI or PET scan), digital rectal exam) and/or recommending and/or performing a therapeutic procedure, for example but not limited to surgical excision, radiotherapy, and/or chemotherapy.
If is determined that the patient is at decreased risk for relapse, a healthcare provider may optionally take the further step of recommending that the patient not seek imminent further treatment and/or performing frequent monitoring of the patient for recurrence (e.g., a PSA test or imaging (e.g. ultrasound, CT scan, MRI or PET scan), digital rectal exam) (“watchful waiting”).
In non-limiting embodiments, the present invention provides for kits that may be used to practice the invention. Such kits may include an array comprising nucleic acid representing at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 15, at least 20, at least 30, at least 40, or at least 50 of the following genes, where the genes listed below constitute up to 50 percent or up to 60 percent or up to 70 percent or up to 80 percent or up to 90 percent or up to 95 percent or up to 100 percent of the total set of genes represented in the array:
genes listed in Table 2;
genes listed in Table 3;
genes listed in Table 4;
genes listed in Table 5;
HECTD1, MIR1827, UBXN8, SMAP1, C6orf147, DDX43, SLC17A5, LRRIQ4, LRRC31, SAMD7, LOC100128164, SEC62, GPR160, PHC3, SLC7A5, CA5A, BANP, ZFPM1, ZC3H18, IL17C, CYBA, MVD, MGC23284, SNAI3, RNF166, GALNS, TRAPPC2L, CBFA2T3, ACSF3, C16orf81, CDH15, ANKRD11, SPG7, RPL13, SNORD68, CDK10, SPATA2L, C16orf7, ZNF276, SYT16, GRIN2B, BCAT1, OVCH1, BEYLA, GPR125, GBA3, BRMS1L, KCNMB4, MIR548A1, ORC3L, SDAD1, CXCL9, ART3, CXCL10, CXCL11, GALNTL1, FLJ44817, KIAA0247, LOC100289511, SFRS5, SLC10A1, SLC8A3, SNORD56B, PABPC3, MTMR6, ATP8A2, NAV2, ZC3H12C, FDX1, ARHGAP20, C11orf88, LAYN, CD28 DZIP1, ZHX2, DERL1, WDR67, COL22A1, BHLHE40, MAGEL2, NDN, RSU1, ADCY2, UBE2E1, RPL23AP82, RABL2B, CA10, C13orf36, SMAD9, ALG5, RETNLB, TRAT1, GUCA1C, and MORC1.
For example, but not by way of limitation, an array may comprise sets of genes as listed above for lists “a”, “b”, “c” and/or “d”.
Such kits may optionally comprise software, or internet access to software, in electronically readable form, that determines the number and size of CNVs in the genes represented in the array, and optionally software, or internet access to software, in electronically readable form, that determines whether CNVs in a DNA sample exceed or fall below a threshold set forth herein that indicates an increased risk of relapse or an increased risk of rapid relapse of prostate cancer.
6.1 Materials and Methods
Tissue Processing, DNA extraction, Amplicon generation, labeling, hybridization, washing and scanning of SNP 6.0 chips. Prostate cancer samples were obtained from the University of Pittsburgh Medical Center Tissue Bank, Pittsburgh, Pa. These samples were collected from 1998 to 2009. To make the analysis balance, samples of short prostate specific antigen doubling time (“PSADT”) (<4 months), long PSADT (>15 months), and no relapse (cancer free for >5 years after radical prostatectomy) each were made to constitute approximately one third of the total number. Whenever possible, nonrelapse samples were chosen to match pathological stages and Gleason grades of relapse samples. A total of 214 samples were from whites, whereas 5 samples were from African Americans and 19 samples were from patients with an unknown race. The patients whom these samples were obtained from either experienced relapse or had no relapse for at least 5 years, based on chemical (serum PSA) and radiological evidence. Frozen tissues were used for blood, prostate cancer, and benign prostate tissue adjacent to cancer. Clinical follow-up was conducted by office examination record, blood PSA survey, and radiographical follow-up. These follow-up visits were performed for up to a 10-year period after the patient underwent a radical prostatectomy. The protocol was approved by the Institutional Review Board. For prostate cancer, microdissection was performed to achieve tumor purity >80%. For benign prostate tissues adjacent to cancer, benign tissues away from prostate cancer (at least 3 mm) were microdissected. Whenever available, whole blood or buffy coat from the same patients was used as a normal control. PC3, DU145, and LNCaP cells were obtained from American Type Culture Collection Inc. (Manassas, Va.) in 2000, 2001, and 2007, respectively. The genomes of these cell lines were tested for short tandem repeat DNA profiling on eight different loci (CSF1PO, D13S317, D16S539, D5S818, D7S820, THO1, TPDX, and νVA) of the genomes by PCR using the following sets of primers:
These cell lines were authenticated because the short tandem repeat profiles of the cell lines have a perfect match with those published by American Type Culture Collection Inc. DNA was then extracted using a Qiagen tissue kit (Qiagen, Valencia, Calif.). Detailed case information is shown in Tables 1A-D. Genome DNA (500 ng), was digested with Sty1 and Nsp1 for 2 hours at 37° C. The digested DNA was purified and ligated with primer/adaptors at 16° C. for 12 to 16 hours. Amplicons were generated by performing PCR using primers provided by the manufacturer (Affymetrix, Santa Clara, Calif.) on the ligation products using the following program: 94° C. for 3 minutes and then 35 cycles of 94° C. for 30 seconds, 60° C. for 45 seconds, and 65° C. for 1 minute. This was followed by extension at 68° C. for 7 minutes. The PCR products were then purified and digested with DNaseI for 35 minutes at 37° C. to fragment the amplified DNA. The fragmented DNA was then labeled with biotinylated nucleotide through terminal deoxynucleotide transferase for 4 hours at 37° C. Fragmented DNA, 250 μg, was hybridized with a pre-equilibrated Affymetrix SNP 6.0 chip at 50° C. for 18 hours. Procedures of washing and scanning of SNP 6.0 chips followed the manuals provided by Affymetrix.
SYBR-green real time quantitation PCR: LightCycler FastStart DNA Master SYBR-Green I kit was used for real time PCR amplification. The reaction was carried out in a MasterCycler Realplex™ (Eppendorf, Hauppauge, N.Y.). A quantitation standard curve of normal male DNA from 50,000 to 500,000 copies of genome was generated using known amounts of template copies. Twenty nanograms of genomic DNA were used for all of the experimental and control samples. Taq DNA polymerase was activated with a 2 min pre-incubation step at 94° C. Amplification of the following primers was performed:
ARL17B (ACTGTCATAGCAGTGCTGAGG (SEQ ID NO:17)/ACTTACCTACTGTAGGGACGG SEQ ID NO:18),
SCAPER (AGGAAGGCCTATTCGTTCTCG SEQ ID NO:19/GAACAGTATGGGAGGAGTTCG (SEQ ID NO: 20),
WWOX (GCCAGTTGATGTGACAACTGC (SEQ ID NO:21)/CAGCTGAGAGTGGTTTCTTTGC (SEQ ID NO:22)),
EPHA3 (ATCAGGACTTACCAGGTGTGC (SEQ ID NO:23)/ACCGTGTCTGGAAACATAGCC (SEQ ID NO:24)), and
ERBB4 (AGTGGCCTGTCCTTGCTTATC (SEQ ID NO:25)/CAGAGCAACAATTCTGACCGG (SEQ ID NO:26)) with 35 cycles of the following program: 94° C. for 30 s, 62° C. for 30 s, and 68° C. for 3 min. Realplex™ data software was used to quantify and to fit the data with a standard curve. A separate β-actin (TCTTTGCACTTTCTGCATGTCCCC (SEQ ID NO: 27)/GTCCATCACGATGCCAGTGGTAC (SEQ ID NO:28)) DNA quantification was also performed as an internal control for each analysis.
Statistical analysis: Two hundred forty-one ce1 files were analyzed with the Genotyping console 4.0 from Affymetrix, Inc. for quality control analysis. Samples with QC call above 80% and QC contrast ratio above 0.4 were admitted into the analysis. To analyze CNV, eel files were imported into Partek GenomeSuite 6.6 to generate copy number from raw intensity. To plot the histograms, GC adjust was performed. Deletion or amplification of genomes were analyzed by first limiting to the regions with p-value less than 0.05/total number of regions detected, i.e. family-wise error rate (EWER) is controlled using Bonferroni's correction (10). The selected regions were subsequently filtered by limiting to the regions with at least 100 markers and 10 kb. The regions were then mapped to known genes. For a subset of the sample (i.e. tumor or relapse with rapid progression), the frequencies of amplification/deletion are calculated on the gene level. The frequencies were plotted to the genome corresponding to the gene locations.
Prediction analysis and ROC curve: The following prediction analysis for the comparison of (1) non-relapse versus fast-relapse+slow-relapse); (2) non-relapse+slow-relapse versus fast-relapse was performed. A test sample was first left out from prediction model construction. The remaining samples were used as the training set. Loci with more than r % amplification or r % deletion in the case group but none locus aberration in the control group were selected as predictive loci. To predict the left-out test sample, the percentage of locus aberration (amplification or deletion) among the identified predictive loci was calculated. The test sample was predicted as a case if the percent of aberration is greater than p % threshold, and control otherwise. The “leave-one-out” cross-validation was repeated until each sample was left out and predicted. In this prediction scheme, r is a parameter that determines the number of predictive loci used in the model. For a given r, the threshold p % was varied to locus rate an ROC curve with sensitivity/specificity trade-off. We selected r that produced the best “area under curve” (AUC)(11). To report the best sensitivity and specificity trade-off and overall accuracy rate, we chose the threshold p % such that the Youden index (sensitivity+specificity−1) is maximized. This criterion gave equal importance to sensitivity and specificity. To further evaluate whether the prediction result is better than obtained by random, AUC was used as a test statistics, and permutation analysis was performed to assess the statistical significance. Specifically, class labels (case and control) were randomly shuffled and AUC calculation was performed. Such permutations were repeated for 1000 times to generate the null distribution. The p-value was calculated as the percentage that the 1000 null AUCs from permutation are greater than the observed AUC. The genes that are overlapped with the loci used in the test and the frequency of utilization are listed in Tables 2-5. For Gleason score prediction, the ROC curve was generated by varying Gleason score threshold. AUC and its associated p-value were similarly calculated. For CNV size prediction, CNV was limited to >2 kb, p<0.001 and >10 markers. The ROC curve was generated by varying sizes of CNV threshold. AUC and its associated p-value were similarly calculated.
Prediction analysis for blood versus tumor: To predict blood versus tumor, the total number of aberrations in each sample was counted instead of the predictive locus selection described above. The ROC curve, AUC and the associated p-value were similarly generated.
6.2 Results
The SNP 6.0 chip hybridization results were analyzed through Partek Genome Suite 6.6™, using blood (B) samples as normal references. As shown in histograms of
To assess the reproducibility of these analyses, a large set of reference normal samples (n=800) available to public through Partek, Inc. was used. This re-analysis showed genome segment abnormalities of B, AT and T overlapped at least 93 percent between these two analyses (
Five loci from chromosomes 16, 17, 3, 2 and 15 with deletions of at least 10 kb and overlapping with nearby genes were selected for quantitative-PCR analysis. As shown in
To investigate whether the CNV profiles of B, AT and T are distinctive from each other, classification analysis was performed to predict genomes of blood versus those of prostate cancer, by aggregating genome loci that have differential amplification or deletion proportion between blood and prostate cancer (see methods for more detail). The prediction accuracy under unbiased “leave-one-out” cross-validation (23) was 89% for blood (76/85) and 94% for prostate cancer (98/104). The overall accuracy was 92% (174/189,
The vast majority of prostate cancers are not lethal(25). Prediction analysis with “leave-one-out” cross-validation based on loci that have significant proportion of amplification or deletion in the group of relapse but none in the non-relapsed group was performed. The resulting Receiver Operating Characteristic curves (ROC) were generated by varying sensitivity-specificity trade-off (FIG. 2A,B). The cutoff that generates the best Youden index (i.e. sensitivity+specificity−1) has an accuracy of 73% (74/102, ROC p=0.003, positive prediction=76% [57/75], negative prediction=63% [17/27]) for relapse prediction. Gleason's grading has been a strong predictor of recurrence but in this analysis it was statistically insignificant from baseline (ROC p=0.32) and much worse than CNV analysis.
Prostate cancers with rapid progression, as defined by rates of PSA rise, are lethal1(2,26). Those with PSA doubling time (PSADT)<4 months after relapse and those who died of prostate cancer were compared to those with PSADT>15 months or having no relapse. A similar prediction with “Leave-One-Out” cross-validation analysis was performed to examine the accuracy of CNV profiling (see the genes listed in TABLE 3) in predicting rapidly progressing prostate cancer. As shown in
Since the genome alterations in AT are most similar to those of T, the CNV of AT to predict relapse was examined using cross-validation. As shown in
To rule out aging being a factor in our analysis, correlation analyses between our gene-specific or size-based model and the patient age were performed, and revealed no significant correlation between age and our prediction methods. Age did not predict outcomes (
To investigate the reproducibility of our prediction models, we collected an additional 25 samples, including 10 tumors, 10 benign tissues adjacent to tumors, and 5 blood samples from patients with prostate cancer. These experiments and analyses were performed in a separate time period and by different personnel. By using a genespecific model, we correctly predicted 7 of 10 relapse and 8 of 10 short PSADT from tumor samples, whereas we correctly predicted 7 of 10 for both relapse and short PSADT from AT samples. By using mean size of CNV from tumor, we correctly predicted 7 of 10 cases of both relapse and short PSADT, 7 of 10 for relapse from AT, and 4 of 5 for relapse and 4 of 5 for short PSADT from blood. By using median size of CNV from tumors, we correctly predicted 6 of 10 for relapse and 7 of 10 for short PSADT, whereas from blood, we correctly predicted 5 of 5 for relapse and 4 of 5 for short PSADT. Taken together, the gene-specific CNV model has an overall prediction rate of 72.5% in the replication data set, similar to those found in the first set of data. The mean CNV sizes of blood, tumor, and benign prostate tissues have an overall prediction rate of 72% for relapse, and the mean CNV sizes of blood and tumor samples have an overall prediction rate of 73% for short PSADT, whereas the median CNV sizes of blood and tumor have overall prediction rates of 73% for relapse and 80% for short PSADT. These results are also similar to those found in the original study, reflecting good consistency and reproducibility of our prediction models.
6.3 Discussion
Genome-wide analyses of prostate cancer using other methodologies were performed previously(27-30). However, there was no attempt to construct a model to predict the prognosis of prostate cancer. The genome abnormality found in blood from prostate cancer patients in this study is novel. Even though a tiny amount (<0.1% of blood cell population) of circulating tumor cells may exist in the blood sample(31,32), the stringency of CNV analysis (>30% contamination to be detected) ruled out contamination of tumor cells in the blood as a contending interpretation. Analysis of some of the previously published matched normal samples of other malignancies (33,34) also reveals significant CNV. This suggests that CNV is widely present in tissues of patients carrying malignancies. However, it is unclear whether healthy individuals carry these abnormalities. The CNV of blood may be somatic and acquired through aging; this alteration would tend to be random and spontaneous. Alternatively, genome copy number abnormalities may occur at germ line level. To distinguish these two possibilities, longitudinal blood samples of the same aging individual could identify if CNV is accumulated. Independent of the mechanism, however, genome CNV correlates with the eventual behavior of prostate cancer: This is observed in the primary prostate cancer, in the histologically normal tissue from a prostate gland containing cancer and in the blood of prostate cancer patient. The field effect of genome alterations appears to extend beyond the organ to the entire host.
Conceivably, CNV analysis offers a better option than Gleason's grading in predicting the behavior of prostate cancer not only because of a better prediction rate on the tumor samples, but also its applicability to non-tumor tissues. There are several salient potentials for clinical application using the CNV tests: For a patient being diagnosed of prostate cancer, CNV analysis done on the blood or perhaps other normal tissues from the patient would eliminate the need for additional invasive procedure to decide a treatment mode. For a patient already having a radical prostatectomy, the CNV analysis on tumor or blood sample may help to decide whether additional treatment is warranted to prevent relapse. When morphology becomes in-determinate in a biopsy sample, the gene specific CNV field effect in benign prostate tissues may help to obtain a firmer diagnosis. The main limitation of the genome CNV analysis for clinical test is its requirement of high quality genome DNA. Formalin-fixed paraffin-embedded tissues may not be suitable. When gene specific CNV prediction is performed, a training set containing samples with known outcome is required for the prediction (while there is no need of training set when size of CNV analysis is performed). Despite these limitations, CNV analysis on the genome of blood, no mal prostate or tumor tissues of the prostate cancer patients holds promise to become a more efficient and accurate way to predict the behavior of prostate cancer.
Various publications are cited herein, the contents of which are hereby incorporated by reference in their entireties.
indicates data missing or illegible when filed
indicates data missing or illegible when filed
indicates data missing or illegible when filed
indicates data missing or illegible when filed
This application claims priority to U.S. Provisional Application No. 61/535,240, filed Sep. 15, 2011, the contents of which is hereby incorporated by reference in its entirety herein.
This invention was made with government support under Grant No. RO1-CA098249 awarded by the National Cancer Institute. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 61535240 | Sep 2011 | US |