Site-specific endonucleases theoretically allow for the targeted manipulation of a single site within a genome and are useful in the context of gene targeting as well as for therapeutic applications. In a variety of organisms, including mammals, site-specific endonucleases have been used for genome engineering by stimulating either non-homologous end joining or homologous recombination. In addition to providing powerful research tools, site-specific nucleases also have potential as gene therapy agents, and two site-specific endonucleases have recently entered clinical trials: one, CCR5-2246, targeting a human CCR-5 allele as part of an anti-HIV therapeutic approach (NCT00842634, NCT01044654, NCT01252641), and the other one, VF24684, targeting the human VEGF-A promoter as part of an anti-cancer therapeutic approach (NCT01082926).
Specific cleavage of the intended nuclease target site without or with only minimal off-target activity is a prerequisite for clinical applications of site-specific endonuclease, and also for high-efficiency genomic manipulations in basic research applications, as imperfect specificity of engineered site-specific binding domains has been linked to cellular toxicity and undesired alterations of genomic loci other than the intended target. Most nucleases available today, however, exhibit significant off-target activity, and thus may not be suitable for clinical applications. Technology for evaluating nuclease specificity and for engineering nucleases with improved specificity are therefore needed.
Some aspects of this disclosure are based on the recognition that the reported toxicity of some engineered site-specific endonucleases is based on off-target DNA cleavage, rather than on off-target binding alone. Some aspects of this disclosure provide strategies, compositions, systems, and methods to evaluate and characterize the sequence specificity of site-specific nucleases, for example, RNA-programmable endonucleases, such as Cas9 endonucleases, zinc finger nucleases (ZNFs), homing endonucleases, or transcriptional activator-like element nucleases (TALENs).
The strategies, methods, and reagents of the present disclosure represent, in some aspects, an improvement over previous methods for assaying nuclease specificity. For example, some previously reported methods for determining nuclease target site specificity profiles by screening libraries of nucleic acid molecules comprising candidate target sites relied on a “two-cut” in vitro selection method which requires indirect reconstruction of target sites from sequences of two half-sites resulting from two adjacent cuts of the nuclease of a library member nucleic acid (see e.g., PCT Application WO 2013/066438; and Pattanayak, V., Ramirez, C. L., Joung, J. K. & Liu, D. R. Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection. Nature methods 8, 765-770 (2011), the entire contents of each of which are incorporated herein by reference). In contrast to such “two-cut” strategies, the methods of the present disclosure utilize an optimized “one cut” screening strategy, which allows for the identification of library members that have been cut at least once by the nuclease. As explained in more detail elsewhere herein, the “one-cut” selection strategies provided herein are compatible with single end high-throughput sequencing methods and do not require computational reconstruction of cleaved target sites from cut half-sites, thus streamlining the nuclease profiling process.
Some aspects of this disclosure provide in vitro selection methods for evaluating the cleavage specificity of endonucleases and for selecting nucleases with a desired level of specificity. Such methods are useful, for example, for characterizing an endonuclease of interest and for identifying a nuclease exhibiting a desired level of specificity, for example, for identifying a highly specific endonuclease for clinical applications.
Some aspects of this disclosure provide methods of identifying suitable nuclease target sites that are sufficiently different from any other site within a genome to achieve specific cleavage by a given nuclease without any or at least minimal off-target cleavage. Such methods are useful for identifying candidate nuclease target sites that can be cleaved with high specificity on a genomic background, for example, when choosing a target site for genomic manipulation in vitro or in vivo.
Some aspects of this disclosure provide methods of evaluating, selecting, and/or designing site-specific nucleases with enhanced specificity as compared to current nucleases. For example, provided herein are methods that are useful for selecting and/or designing site-specific nucleases with minimal off-target cleavage activity, for example, by designing variant nucleases with binding domains having decreased binding affinity, by lowering the final concentration of the nuclease, by choosing target sites that differ by at least three base pairs from their closest sequence relatives in the genome, and, in the case of RNA-programmable nucleases, by selecting a guide RNA that results in the fewest off-target sites being bound and/or cut.
Compositions and kits useful in the practice of the methods described herein are also provided.
Some aspects of this disclosure provide methods for identifying a target site of a nuclease. In some embodiments, the method comprises (a) providing a nuclease that cuts a double-stranded nucleic acid target site, wherein cutting of the target site results in cut nucleic acid strands comprising a 5′ phosphate moiety; (b) contacting the nuclease of (a) with a library of candidate nucleic acid molecules, wherein each nucleic acid molecule comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence, under conditions suitable for the nuclease to cut a candidate nucleic acid molecule comprising a target site of the nuclease; and (c) identifying nuclease target sites cut by the nuclease in (b) by determining the sequence of an uncut nuclease target site on the nucleic acid strand that was cut by the nuclease in step (b). In some embodiments, the nuclease creates blunt ends. In some embodiments, the nuclease creates a 5′ overhang. In some embodiments, the determining of step (c) comprises ligating a first nucleic acid adapter to the 5′ end of a nucleic acid strand that was cut by the nuclease in step (b) via 5′-phosphate-dependent ligation. In some embodiments, the nucleic acid adapter is provided in double-stranded form. In some embodiments, the 5′-phosphate-dependent ligation is a blunt end ligation. In some embodiments, the method comprises filling in the 5′-overhang before ligating the first nucleic acid adapter to the nucleic acid strand that was cut by the nuclease. In some embodiments, the determining of step (c) further comprises amplifying a fragment of the concatemer cut by the nuclease that comprises an uncut target site via a PCR reaction using a PCR primer that hybridizes with the adapter and a PCR primer that hybridizes with the constant insert sequence. In some embodiments, the method further comprises enriching the amplified nucleic acid molecules for molecules comprising a single uncut target sequence. In some embodiments, the step of enriching comprises a size fractionation. In some embodiments, the determining of step (c) comprises sequencing the nucleic acid strand that was cut by the nuclease in step (b), or a copy thereof obtained via PCR. In some embodiments, the library of candidate nucleic acid molecules comprises at least 108, at least 109, at least 1010, at least 1011, or at least 1012 different candidate nuclease cleavage sites. In some embodiments, the nuclease is a therapeutic nuclease which cuts a specific nuclease target site in a gene associated with a disease. In some embodiments, the method further comprises determining a maximum concentration of the therapeutic nuclease at which the therapeutic nuclease cuts the specific nuclease target site, and does not cut more than 10, more than 5, more than 4, more than 3, more than 2, more than 1, or no additional nuclease target sites. In some embodiments, the method further comprises administering the therapeutic nuclease to a subject in an amount effective to generate a final concentration equal or lower than the maximum concentration. In some embodiments, the nuclease is an RNA-programmable nuclease that forms a complex with an RNA molecule, and wherein the nuclease:RNA complex specifically binds a nucleic acid sequence complementary to the sequence of the RNA molecule. In some embodiments, the RNA molecule is a single-guide RNA (sgRNA). In some embodiments, the sgRNA comprises 5-50 nucleotides, 10-30 nucleotides, 15-25 nucleotides, 18-22 nucleotides, 19-21 nucleotides, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the nuclease is a Cas9 nuclease. In some embodiments, the nuclease target site comprises a [sgRNA-complementary sequence]-[protospacer adjacent motif (PAM)] structure, and the nuclease cuts the target site within the sgRNA-complementary sequence. In some embodiments, the sgRNA-complementary sequence comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the nuclease comprises an unspecific nucleic acid cleavage domain. In some embodiments, the nuclease comprises a FokI cleavage domain. In some embodiments, the nuclease comprises a nucleic acid cleavage domain that cleaves a target sequence upon cleavage domain dimerization. In some embodiments, the nuclease comprises a binding domain that specifically binds a nucleic acid sequence. In some embodiments, the binding domain comprises a zinc finger. In some embodiments, the binding domain comprises at least 2, at least 3, at least 4, or at least 5 zinc fingers. In some embodiments, the nuclease is a Zinc Finger Nuclease. In some embodiments, the binding domain comprises a Transcriptional Activator-Like Element. In some embodiments, the nuclease is a Transcriptional Activator-Like Element Nuclease (TALEN). In some embodiments, the nuclease is an organic compound. In some embodiments, the nuclease comprises an enediyne functional group. In some embodiments, the nuclease is an antibiotic. In some embodiments, the compound is dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof. In some embodiments, the nuclease is a homing endonuclease.
Some aspects of this disclosure provide libraries of nucleic acid molecules, in which each nucleic acid molecule comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence of 10-100 nucleotides. In some embodiments, the constant insert sequence is at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, or at least 95 nucleotides long. In some embodiments, the constant insert sequence is not more than 15, not more than 20, not more than 25, not more than 30, not more than 35, not more than 40, not more than 45, not more than 50, not more than 55, not more than 60, not more than 65, not more than 70, not more than 75, not more than 80, or not more than 95 nucleotides long. In some embodiments, the candidate nuclease target sites are sites that can be cleaved by an RNA-programmable nuclease, a Zinc Finger Nuclease (ZFN), a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, an organic compound nuclease, or an enediyne antibiotic (e.g., dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin). In some embodiments, the candidate nuclease target site can be cleaved by a Cas9 nuclease. In some embodiments, the library comprises at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, or at least 1012 different candidate nuclease target sites. In some embodiments, the library comprises nucleic acid molecules of a molecular weight of at least 0.5 kDa, at least 1 kDa, at least 2 kDa, at least 3 kDa, at least 4 kDa, at least 5 kDa, at least 6 kDa, at least 7 kDa, at least 8 kDa, at least 9 kDa, at least 10 kDa, at least 12 kDa, or at least 15 kDa. In some embodiments, the library comprises candidate nuclease target sites that are variations of a known target site of a nuclease of interest. In some embodiments, the variations of a known nuclease target site comprise 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, or 2 or fewer mutations as compared to a known nuclease target site. In some embodiments, the variations differ from the known target site of the nuclease of interest by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30% on average, distributed binomially. In some embodiments, the variations differ from the known target site by no more than 10%, no more than 15%, no more than 20%, no more than 25%, nor more than 30%, no more than 40%, or no more than 50% on average, distributed binomially. In some embodiments, the nuclease of interest is a Cas9 nuclease, a zinc finger nuclease, a TALEN, a homing endonuclease, an organic compound nuclease, or an enediyne antibiotic (e.g., dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin). In some embodiments, the candidate nuclease target sites are Cas9 nuclease target sites that comprise a [sgRNA-complementary sequence]-[PAM] structure, wherein the sgRNA-complementary sequence comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
Some aspects of this disclosure provide methods for selecting a nuclease that specifically cuts a consensus target site from a plurality of nucleases. In some embodiments, the method comprises (a) providing a plurality of candidate nucleases that cut the same consensus sequence; (b) for each of the candidate nucleases of step (a), identifying a nuclease target site cleaved by the candidate nuclease that differ from the consensus target site using a method provided herein; (c) selecting a nuclease based on the nuclease target site(s) identified in step (b). In some embodiments, the nuclease selected in step (c) is the nuclease that cleaves the consensus target site with the highest specificity. In some embodiments, the nuclease that cleaves the consensus target site with the highest specificity is the candidate nuclease that cleaves the lowest number of target sites that differ from the consensus site. In some embodiments, the candidate nuclease that cleaves the consensus target site with the highest specificity is the candidate nuclease that cleaves the lowest number of target sites that are different from the consensus site in the context of a target genome. In some embodiments, the candidate nuclease selected in step (c) is a nuclease that does not cleave any target site other than the consensus target site. In some embodiments, the candidate nuclease selected in step (c) is a nuclease that does not cleave any target site other than the consensus target site within the genome of a subject at a therapeutically effective concentration of the nuclease. In some embodiments, the method further comprises contacting a genome with the nuclease selected in step (c). In some embodiments, the genome is a vertebrate, mammalian, human, non-human primate, rodent, mouse, rat, hamster, goat, sheep, cattle, dog, cat, reptile, amphibian, fish, nematode, insect, or fly genome. In some embodiments, the genome is within a living cell. In some embodiments, the genome is within a subject. In some embodiments, the consensus target site is within an allele that is associated with a disease or disorder. In some embodiments, cleavage of the consensus target site results in treatment or prevention of a disease or disorder, e.g., amelioration or prevention of at least one sign and/or symptom of the disease or disorder. In some embodiments, cleavage of the consensus target site results in the alleviation of a sign and/or symptom of the disease or disorder. In some embodiments, cleavage of the consensus target site results in the prevention of the disease or disorder. In some embodiments, the disease is HIV/AIDS. In some embodiments, the allele is a CCR5 allele. In some embodiments, the disease is a proliferative disease. In some embodiments, the disease is cancer. In some embodiments, the allele is a VEGFA allele.
Some aspects of this disclosure provide isolated nucleases that have been selected according to a method provided herein. In some embodiments, the nuclease has been engineered to cleave a target site within a genome. In some embodiments, the nuclease is a Cas9 nuclease comprising an sgRNA that is complementary to the target site within the genome. In some embodiments, the nuclease is a Zinc Finger Nuclease (ZFN) or a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, or an organic compound nuclease (e.g., an enediyne, an antibiotic nuclease, dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof). In some embodiments, the nuclease has been selected based on cutting no other candidate target site, not more than one candidate target site, not more than two candidate target sites, not more than three candidate target sites, not more than four candidate target sites, not more than five candidate target sites, not more than six candidate target sites, not more than seven candidate target sites, not more than eight candidate target sites, not more than eight candidate target sites, not more than nine candidate target sites, or not more than ten candidate target sites in addition to its known nuclease target site.
Some aspects of this disclosure provide kits comprising a library of nucleic acid molecules comprising candidate nuclease target sites as provided herein. Some aspects of this disclosure provide kits comprising an isolated nuclease as provided herein. In some embodiments, the nuclease is a Cas9 nuclease. In some embodiments, the kit further comprises a nucleic acid molecule comprising a target site of the isolated nuclease. In some embodiments, the kit comprises an excipient and instructions for contacting the nuclease with the excipient to generate a composition suitable for contacting a nucleic acid with the nuclease. In some embodiments, the composition is suitable for contacting a nucleic acid within a genome. In some embodiments, the composition is suitable for contacting a nucleic acid within a cell. In some embodiments, the composition is suitable for contacting a nucleic acid within a subject. In some embodiments, the excipient is a pharmaceutically acceptable excipient.
Some aspects of this disclosure provide pharmaceutical compositions that are suitable for administration to a subject. In some embodiments, the composition comprises an isolated nuclease as provided herein. In some embodiments, the composition comprises a nucleic acid encoding such a nuclease. In some embodiments, the composition comprises a pharmaceutically acceptable excipient.
Other advantages, features, and uses of the invention will be apparent from the detailed description of certain non-limiting embodiments of the invention; the drawings, which are schematic and not intended to be drawn to scale; and the claims.
As used herein and in the claims, the singular forms “a,” “an,” and “the” include the singular and the plural reference unless the context clearly indicates otherwise. Thus, for example, a reference to “an agent” includes a single agent and a plurality of such agents.
The term “Cas9” or “Cas9 nuclease” refers to an RNA-guided nuclease comprising a Cas9 protein, or a fragment thereof. A Cas9 nuclease is also referred to sometimes as a casn 1 nuclease or a CRISPR (clustered regularly interspaced short palindromic repeat)-associated nuclease. CRISPR is an adaptive immune system that provides protection against mobile genetic elements (e.g., viruses, transposable elements and conjugative plasmids). CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In type II CRISPR systems correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (mc) and a Cas9 protein. The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA. Subsequently, Cas9/crRNA/tracrRNA endonucleolytically cleaves linear or circular dsDNA target complementary to the spacer. The target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3′-5′ exonucleolytically. In nature, DNA-binding and cleavage typically requires protein and both RNA species. However, single guide RNAs (“sgRNA”, or simply “gNRA”) can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA molecule. See, e.g., Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of which is hereby incorporated by reference. Cas9 recognizes a short motif in the CRISPR repeat sequences (the PAM or protospacer adjacent motif) to help distinguish self versus non-self. Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., “Complete genome sequence of an M1 strain of Streptococcus pyogenes.” Ferretti J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L. expand/collapse author list McLaughlin R. E., Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.” Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y., Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E., Nature 471:602-607(2011); and “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference). Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus. Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, “The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems” (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference. In some embodiments, proteins comprising Cas9 or fragments thereof proteins are referred to as “Cas9 variants.” A Cas9 variant shares homology to Cas9, or a fragment thereof. For example a Cas9 variant is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% to wild type Cas9. In some embodiments, the Cas9 variant comprises a fragment of Cas9 (e.g., a gRNA binding domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% to the corresponding fragment of wild type Cas9. In some embodiments, wild type Cas9 corresponds to Cas9 from Streptococcus pyogenes (NCBI Reference Sequence: NC_017053.1, SEQ ID NO:40 (nucleotide); SEQ ID NO:41 (amino acid)).
The term “concatemer,” as used herein in the context of nucleic acid molecules, refers to a nucleic acid molecule that contains multiple copies of the same DNA sequences linked in a series. For example, a concatemer comprising ten copies of a specific sequence of nucleotides (e.g., [XYZ]10), would comprise ten copies of the same specific sequence linked to each other in series, e.g., 5′-XYZXYZXYZXYZXYZXYZXYZXYZXYZXYZ-3′. A concatemer may comprise any number of copies of the repeat unit or sequence, e.g., at least 2 copies, at least 3 copies, at least 4 copies, at least 5 copies, at least 10 copies, at least 100 copies, at least 1000 copies, etc. An example of a concatemer of a nucleic acid sequence comprising a nuclease target site and a constant insert sequence would be [(target site)-(constant insert sequence)]300. A concatemer may be a linear nucleic acid molecule, or may be circular.
The terms “conjugating,” “conjugated,” and “conjugation” refer to an association of two entities, for example, of two molecules such as two proteins, two domains (e.g., a binding domain and a cleavage domain), or a protein and an agent, e.g., a protein binding domain and a small molecule. In some aspects, the association is between a protein (e.g., RNA-programmable nuclease) and a nucleic acid (e.g., a guide RNA). The association can be, for example, via a direct or indirect (e.g., via a linker) covalent linkage or via non-covalent interactions. In some embodiments, the association is covalent. In some embodiments, two molecules are conjugated via a linker connecting both molecules. For example, in some embodiments where two proteins are conjugated to each other, e.g., a binding domain and a cleavage domain of an engineered nuclease, to form a protein fusion, the two proteins may be conjugated via a polypeptide linker, e.g., an amino acid sequence connecting the C-terminus of one protein to the N-terminus of the other protein.
The term “consensus sequence,” as used herein in the context of nucleic acid sequences, refers to a calculated sequence representing the most frequent nucleotide residues found at each position in a plurality of similar sequences. Typically, a consensus sequence is determined by sequence alignment in which similar sequences are compared to each other and similar sequence motifs are calculated. In the context of nuclease target site sequences, a consensus sequence of a nuclease target site may, in some embodiments, be the sequence most frequently bound, or bound with the highest affinity, by a given nuclease. With respect to RNA-programmable nuclease (e.g., Cas9) target site sequences, the consensus sequence may, in some embodiments, be the sequence or region to which a gRNA, or a plurality of gRNAs, is expected or designed to bind, e.g., based on complementary base pairing.
The term “effective amount,” as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, an effective amount of a nuclease may refer to the amount of the nuclease that is sufficient to induce cleavage of a target site specifically bound and cleaved by the nuclease. As will be appreciated by the skilled artisan, the effective amount of an agent, e.g., a nuclease, a hybrid protein, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, the specific allele, genome, target site, cell, or tissue being targeted, and the agent being used.
The term “enediyne,” as used herein, refers to a class of bacterial natural products characterized by either nine- and ten-membered rings containing two triple bonds separated by a double bond (see, e.g., K. C. Nicolaou; A. L. Smith; E. W. Yue (1993). “Chemistry and biology of natural and designed enediynes”. PNAS 90 (13): 5881-5888; the entire contents of which are incorporated herein by reference). Some enediynes are capable of undergoing Bergman cyclization, and the resulting diradical, a 1,4-dehydrobenzene derivative, is capable of abstracting hydrogen atoms from the sugar backbone of DNA which results in DNA strand cleavage (see, e.g., S. Walker; R. Landovitz; W. D. Ding; G. A. Ellestad; D. Kahne (1992). “Cleavage behavior of calicheamicin gamma 1 and calicheamicin T”. Proc Natl Acad Sci U.S.A. 89 (10): 4608-12; the entire contents of which are incorporated herein by reference). Their reactivity with DNA confers an antibiotic character to many enediynes, and some enediynes are clinically investigated as anticancer antibiotics. Nonlimiting examples of enediynes are dynemicin, neocarzinostatin, calicheamicin, esperamicin (see, e.g., Adrian L. Smith and K. C. Bicolaou, “The Enediyne Antibiotics” J. Med. Chem., 1996, 39 (11), pp 2103-2117; and Donald Borders, “Enediyne antibiotics as antitumor agents,” Informa Healthcare; 1st edition (Nov. 23, 1994, ISBN-10: 0824789385; the entire contents of which are incorporated herein by reference).
The term “homing endonuclease,” as used herein, refers to a type of restriction enzymes typically encoded by introns or inteins Edgell D R (February 2009). “Selfish DNA: homing endonucleases find a home”. Curr Biol 19 (3): R115-R117; Jasin M (June 1996). “Genetic manipulation of genomes with rare-cutting endonucleases”. Trends Genet 12 (6): 224-8; Burt A, Koufopanou V (December 2004). “Homing endonuclease genes: the rise and fall and rise again of a selfish element”. Curr Opin Genet Dev 14 (6): 609-15; the entire contents of which are incorporated herein by reference. Homing endonuclease recognition sequences are long enough to occur randomly only with a very low probability (approximately once every 7×1010 bp), and are normally found in only one instance per genome.
The term “library,” as used herein in the context of nucleic acids or proteins, refers to a population of two or more different nucleic acids or proteins, respectively. For example, a library of nuclease target sites comprises at least two nucleic acid molecules comprising different nuclease target sites. In some embodiments, a library comprises at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015 different nucleic acids or proteins. In some embodiments, the members of the library may comprise randomized sequences, for example, fully or partially randomized sequences. In some embodiments, the library comprises nucleic acid molecules that are unrelated to each other, e.g., nucleic acids comprising fully randomized sequences. In other embodiments, at least some members of the library may be related, for example, they may be variants or derivatives of a particular sequence, such as a consensus target site sequence.
The term “linker,” as used herein, refers to a chemical group or a molecule linking two adjacent molecules or moieties, e.g., a binding domain and a cleavage domain of a nuclease. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein). In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety.
The term “nuclease,” as used herein, refers to an agent, for example a protein or a small molecule, capable of cleaving a phosphodiester bond connecting nucleotide residues in a nucleic acid molecule. In some embodiments, a nuclease is a protein, e.g., an enzyme that can bind a nucleic acid molecule and cleave a phosphodiester bond connecting nucleotide residues within the nucleic acid molecule. A nuclease may be an endonuclease, cleaving a phosphodiester bonds within a polynucleotide chain, or an exonuclease, cleaving a phosphodiester bond at the end of the polynucleotide chain. In some embodiments, a nuclease is a site-specific nuclease, binding and/or cleaving a specific phosphodiester bond within a specific nucleotide sequence, which is also referred to herein as the “recognition sequence,” the “nuclease target site,” or the “target site.” In some embodiments, a nuclease is a RNA-guided (i.e., RNA-programmable) nuclease, which complexes with (e.g., binds with) an RNA having a sequence that complements a target site, thereby providing the sequence specificity of the nuclease. In some embodiments, a nuclease recognizes a single stranded target site, while in other embodiments, a nuclease recognizes a double-stranded target site, for example a double-stranded DNA target site. The target sites of many naturally occurring nucleases, for example, many naturally occurring DNA restriction nucleases, are well known to those of skill in the art. In many cases, a DNA nuclease, such as EcoRI, HindIII, or BamHI, recognize a palindromic, double-stranded DNA target site of 4 to 10 base pairs in length, and cut each of the two DNA strands at a specific position within the target site. Some endonucleases cut a double-stranded nucleic acid target site symmetrically, i.e., cutting both strands at the same position so that the ends comprise base-paired nucleotides, also referred to herein as blunt ends. Other endonucleases cut a double-stranded nucleic acid target sites asymmetrically, i.e., cutting each strand at a different position so that the ends comprise unpaired nucleotides. Unpaired nucleotides at the end of a double-stranded DNA molecule are also referred to as “overhangs,” e.g., as “5′-overhang” or as “3′-overhang,” depending on whether the unpaired nucleotide(s) form(s) the 5′ or the 3′ end of the respective DNA strand. Double-stranded DNA molecule ends ending with unpaired nucleotide(s) are also referred to as sticky ends, as they can “stick to” other double-stranded DNA molecule ends comprising complementary unpaired nucleotide(s). A nuclease protein typically comprises a “binding domain” that mediates the interaction of the protein with the nucleic acid substrate, and also, in some cases, specifically binds to a target site, and a “cleavage domain” that catalyzes the cleavage of the phosphodiester bond within the nucleic acid backbone. In some embodiments a nuclease protein can bind and cleave a nucleic acid molecule in a monomeric form, while, in other embodiments, a nuclease protein has to dimerize or multimerize in order to cleave a target nucleic acid molecule. Binding domains and cleavage domains of naturally occurring nucleases, as well as modular binding domains and cleavage domains that can be fused to create nucleases binding specific target sites, are well known to those of skill in the art. For example, zinc fingers or transcriptional activator like elements can be used as binding domains to specifically bind a desired target site, and fused or conjugated to a cleavage domain, for example, the cleavage domain of FokI, to create an engineered nuclease cleaving the target site.
The terms “nucleic acid” and “nucleic acid molecule,” as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g. nucleotides and/or nucleosides). In some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms “oligonucleotide” and “polynucleotide” can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, “nucleic acid” encompasses RNA as well as single and/or double-stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule. On the other hand, a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA/RNA hybrid, or including non-naturally occurring nucleotides or nucleosides. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the 5′ to 3′ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g. adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose, 2′-deoxyribose, arabinose, and hexose); and/or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages).
The term “pharmaceutical composition,” as used herein, refers to a composition that can be administrated to a subject in the context of treatment of a disease or disorder. In some embodiments, a pharmaceutical composition comprises an active ingredient, e.g., a nuclease or a nucleic acid encoding a nuclease, and a pharmaceutically acceptable excipient.
The term “proliferative disease,” as used herein, refers to any disease in which cell or tissue homeostasis is disturbed in that a cell or cell population exhibits an abnormally elevated proliferation rate. Proliferative diseases include hyperproliferative diseases, such as pre-neoplastic hyperplastic conditions and neoplastic diseases. Neoplastic diseases are characterized by an abnormal proliferation of cells and include both benign and malignant neoplasias. Malignant neoplasia is also referred to as cancer.
The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein, and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. A protein may comprise different domains, for example, a nucleic acid binding domain and a nucleic acid cleavage domain. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g., a compound that can act as a nucleic acid cleavage agent. In some embodiments, a protein is in a complex with, or is in association with, a nucleic acid, e.g., RNA.
The term “randomized,” as used herein in the context of nucleic acid sequences, refers to a sequence or residue within a sequence that has been synthesized to incorporate a mixture of free nucleotides, for example, a mixture of all four nucleotides A, T, G, and C. Randomized residues are typically represented by the letter N within a nucleotide sequence. In some embodiments, a randomized sequence or residue is fully randomized, in which case the randomized residues are synthesized by adding equal amounts of the nucleotides to be incorporated (e.g., 25% T, 25% A, 25% G, and 25% C) during the synthesis step of the respective sequence residue. In some embodiments, a randomized sequence or residue is partially randomized, in which case the randomized residues are synthesized by adding non-equal amounts of the nucleotides to be incorporated (e.g., 79% T, 7% A, 7% G, and 7% C) during the synthesis step of the respective sequence residue. Partial randomization allows for the generation of sequences that are templated on a given sequence, but have incorporated mutations at a desired frequency. For example, if a known nuclease target site is used as a synthesis template, partial randomization in which at each step the nucleotide represented at the respective residue is added to the synthesis at 79%, and the other three nucleotides are added at 7% each, will result in a mixture of partially randomized target sites being synthesized, which still represent the consensus sequence of the original target site, but which differ from the original target site at each residue with a statistical frequency of 21% for each residue so synthesized (distributed binomially). In some embodiments, a partially randomized sequence differs from the consensus sequence by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30% on average, distributed binomially. In some embodiments, a partially randomized sequence differs from the consensus site by no more than 10%, no more than 15%, no more than 20%, no more than 25%, nor more than 30%, no more than 40%, or no more than 50% on average, distributed binomially.
The term “RNA-programmable nuclease,” and “RNA-guided nuclease” are used interchangeably herein and refer to a nuclease that forms a complex with (e.g., binds or associates with) one or more RNA that is not a target for cleavage. In some embodiments, an RNA-programmable nuclease, when in a complex with an RNA, may be referred to as a nuclease:RNA complex. Typically, the bound RNA(s) is referred to as a guide RNA (gRNA) or a single-guide RNA (sgRNA). The gRNA/sgRNA comprises a nucleotide sequence that complements a target site, which mediates binding of the nuclease/RNA complex to said target site and providing the sequence specificity of the nuclease:RNA complex. In some embodiments, the RNA-programmable nuclease is the (CRISPR-associated system) Cas9 endonuclease, for example Cas9 (Csn1) from Streptococcus pyogenes (see, e.g., “Complete genome sequence of an M1 strain of Streptococcus pyogenes.” Ferretti J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L. expand/collapse author list McLaughlin R. E., Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); “CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III.” Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y., Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E., Nature 471:602-607(2011); and “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.” Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference
Because RNA-programmable nucleases (e.g., Cas9) use RNA:DNA hybridization to determine target DNA cleavage sites, these proteins are able to cleave, in principle, any sequence specified by the guide RNA. Methods of using RNA-programmable nucleases, such as Cas9, for site-specific cleavage (e.g., to modify a genome) are known in the art (See e.g., Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823 (2013); Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013); Hwang, W. Y. et al. Efficient genome editing in zebrafish using a CRISPR-Cas system. Nature biotechnology 31, 227-229 (2013); Jinek, M. et al. RNA-programmed genome editing in human cells. eLife 2, e00471 (2013); Dicarlo, J. E. et al. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic acids research (2013); Jiang, W. et al. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nature biotechnology 31, 233-239 (2013); the entire contents of each of which are incorporated herein by reference).
The terms “small molecule” and “organic compound” are used interchangeably herein and refer to molecules, whether naturally-occurring or artificially created (e.g., via chemical synthesis) that have a relatively low molecular weight. Typically, an organic compound contains carbon. An organic compound may contain multiple carbon-carbon bonds, stereocenters, and other functional groups (e.g., amines, hydroxyl, carbonyls, or heterocyclic rings). In some embodiments, organic compounds are monomeric and have a molecular weight of less than about 1500 g/mol. In certain embodiments, the molecular weight of the small molecule is less than about 1000 g/mol or less than about 500 g/mol. In certain embodiments, the small molecule is a drug, for example, a drug that has already been deemed safe and effective for use in humans or animals by the appropriate governmental agency or regulatory body. In certain embodiments, the organic molecule is known to bind and/or cleave a nucleic acid. In some embodiments, the organic compound is an enediyne. In some embodiments, the organic compound is an antibiotic drug, for example, an anticancer antibiotic such as dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
The term “subject,” as used herein, refers to an individual organism, for example, an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cattle, a cat, or a dog. In some embodiments, the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode.
The terms “target nucleic acid,” and “target genome,” as used herein in the context of nucleases, refer to a nucleic acid molecule or a genome, respectively, that comprises at least one target site of a given nuclease.
The term “target site,” used herein interchangeably with the term “nuclease target site,” refers to a sequence within a nucleic acid molecule that is bound and cleaved by a nuclease. A target site may be single-stranded or double-stranded. In the context of nucleases that dimerize, for example, nucleases comprising a FokI DNA cleavage domain, a target sites typically comprises a left-half site (bound by one monomer of the nuclease), a right-half site (bound by the second monomer of the nuclease), and a spacer sequence between the half sites in which the cut is made. This structure ([left-half site]-[spacer sequence]-[right-half site]) is referred to herein as an LSR structure. In some embodiments, the left-half site and/or the right-half site is between 10-18 nucleotides long. In some embodiments, either or both half-sites are shorter or longer. In some embodiments, the left and right half sites comprise different nucleic acid sequences. In the context of zinc finger nucleases, target sites may, in some embodiments comprise two half-sites that are each 6-18 bp long flanking a non-specified spacer region that is 4-8 bp long. In the context of TALENs, target sites may, in some embodiments, comprise two half-sites sites that are each 10-23 bp long flanking a non-specified spacer region that is 10-30 bp long. In the context of RNA-guided (e.g., RNA-programmable) nucleases, a target site typically comprises a nucleotide sequence that is complementary to the sgRNA of the RNA-programmable nuclease, and a protospacer adjacent motif (PAM) at the 3′ end adjacent to the sgRNA-complementary sequence. For the RNA-guided nuclease Cas9, the target site may be, in some embodiments, 20 base pairs plus a 3 base pair PAM (e.g., NNN, wherein N represents any nucleotide). Typically, the first nucleotide of a PAM can be any nucleotide, while the two downstream nucleotides are specified depending on the specific RNA-guided nuclease. Exemplary target sites for RNA-guided nucleases, such as Cas9, are known to those of skill in the art and include, without limitation, NNG, NGN, NAG, and NGG, wherein N represents any nucleotide. In addition, Cas9 nucleases from different species (e.g., S. thermophilus instead of S. pyogenes) recognizes a PAM that comprises the sequence NGGNG. Additional PAM sequences are known, including, but not limited to NNAGAAW and NAAR (see, e.g., Esvelt and Wang, Molecular Systems Biology, 9:641 (2013), the entire contents of which are incorporated herein by reference). For example, the target site of an RNA-guided nuclease, such as, e.g., Cas9, may comprise the structure [NZ]-[PAM], where each N is, independently, any nucleotide, and z is an integer between 1 and 50. In some embodiments, z is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50. In some embodiments, z is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50. In some embodiments, Z is 20.
The term “Transcriptional Activator-Like Effector,” (TALE) as used herein, refers to bacterial proteins comprising a DNA binding domain, which contains a highly conserved 33-34 amino acid sequence comprising a highly variable two-amino acid motif (Repeat Variable Diresidue, RVD). The RVD motif determines binding specificity to a nucleic acid sequence, and can be engineered according to methods well known to those of skill in the art to specifically bind a desired DNA sequence (see, e.g., Miller, Jeffrey; et. al. (February 2011). “A TALE nuclease architecture for efficient genome editing”. Nature Biotechnology 29 (2): 143-8; Zhang, Feng; et. al. (February 2011). “Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription”. Nature Biotechnology 29 (2): 149-53; Geiβler, R.; Scholze, H.; Hahn, S.; Streubel, J.; Bonas, U.; Behrens, S. E.; Boch, J. (2011), Shiu, Shin-Han. ed. “Transcriptional Activators of Human Genes with Programmable DNA-Specificity”. PLoS ONE 6 (5): e19509; Boch, Jens (February 2011). “TALEs of genome targeting”. Nature Biotechnology 29 (2): 135-6; Boch, Jens; et. al. (December 2009). “Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors”. Science 326 (5959): 1509-12; and Moscou, Matthew J.; Adam J. Bogdanove (December 2009). “A Simple Cipher Governs DNA Recognition by TAL Effectors”. Science 326 (5959): 1501; the entire contents of each of which are incorporated herein by reference). The simple relationship between amino acid sequence and DNA recognition has allowed for the engineering of specific DNA binding domains by selecting a combination of repeat segments containing the appropriate RVDs.
The term “Transcriptional Activator-Like Element Nuclease,” (TALEN) as used herein, refers to an artificial nuclease comprising a transcriptional activator like effector DNA binding domain to a DNA cleavage domain, for example, a FokI domain. A number of modular assembly schemes for generating engineered TALE constructs have been reported (see e.g., Zhang, Feng; et. al. (February 2011). “Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription”. Nature Biotechnology 29 (2): 149-53; Geiβler, R.; Scholze, H.; Hahn, S.; Streubel, J.; Bonas, U.; Behrens, S. E.; Boch, J. (2011), Shiu, Shin-Han. ed. “Transcriptional Activators of Human Genes with Programmable DNA-Specificity”. PLoS ONE 6 (5): e19509; Cermak, T.; Doyle, E. L.; Christian, M.; Wang, L.; Zhang, Y.; Schmidt, C.; Bailer, J. A.; Somia, N. V. et al. (2011). “Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting”. Nucleic Acids Research; Morbitzer, R.; Elsaesser, J.; Hausner, J.; Lahaye, T. (2011). “Assembly of custom TALE-type DNA binding domains by modular cloning”. Nucleic Acids Research; Li, T.; Huang, S.; Zhao, X.; Wright, D. A.; Carpenter, S.; Spalding, M. H.; Weeks, D. P.; Yang, B. (2011). “Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes”. Nucleic Acids Research; Weber, E.; Gruetzner, R.; Werner, S.; Engler, C.; Marillonnet, S. (2011). Bendahmane, Mohammed. ed. “Assembly of Designer TAL Effectors by Golden Gate Cloning”. PLoS ONE 6 (5): e19722; the entire contents of each of which are incorporated herein by reference).
The terms “treatment,” “treat,” and “treating,” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. As used herein, the terms “treatment,” “treat,” and “treating” refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed and/or after a disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.
The term “zinc finger,” as used herein, refers to a small nucleic acid-binding protein structural motif characterized by a fold and the coordination of one or more zinc ions that stabilize the fold. Zinc fingers encompass a wide variety of differing protein structures (see, e.g., Klug A, Rhodes D (1987). “Zinc fingers: a novel protein fold for nucleic acid recognition”. Cold Spring Harb. Symp. Quant. Biol. 52: 473-82, the entire contents of which are incorporated herein by reference). Zinc fingers can be designed to bind a specific sequence of nucleotides, and zinc finger arrays comprising fusions of a series of zinc fingers, can be designed to bind virtually any desired target sequence. Such zinc finger arrays can form a binding domain of a protein, for example, of a nuclease, e.g., if conjugated to a nucleic acid cleavage domain. Different type of zinc finger motifs are known to those of skill in the art, including, but not limited to, Cys2His2, Gag knuckle, Treble clef, Zinc ribbon, Zn2/Cys6, and TAZ2 domain-like motifs (see, e.g., Krishna S S, Majumdar I, Grishin N V (January 2003). “Structural classification of zinc fingers: survey and summary”. Nucleic Acids Res. 31 (2): 532-50). Typically, a single zinc finger motif binds 3 or 4 nucleotides of a nucleic acid molecule. Accordingly, a zinc finger domain comprising 2 zinc finger motifs may bind 6-8 nucleotides, a zinc finger domain comprising 3 zinc finger motifs may bind 9-12 nucleotides, a zinc finger domain comprising 4 zinc finger motifs may bind 12-16 nucleotides, and so forth. Any suitable protein engineering technique can be employed to alter the DNA-binding specificity of zinc fingers and/or design novel zinc finger fusions to bind virtually any desired target sequence from 3-30 nucleotides in length (see, e.g., Pabo C O, Peisach E, Grant R A (2001). “Design and selection of novel cys2His2 Zinc finger proteins”. Annual Review of Biochemistry 70: 313-340; Jamieson A C, Miller J C, Pabo C O (2003). “Drug discovery with engineered zinc-finger proteins”. Nature Reviews Drug Discovery 2 (5): 361-368; and Liu Q, Segal D J, Ghiara J B, Barbas C F (May 1997). “Design of polydactyl zinc-finger proteins for unique addressing within complex genomes”. Proc. Natl. Acad. Sci. U.S.A. 94 (11); the entire contents of each of which are incorporated herein by reference). Fusions between engineered zinc finger arrays and protein domains that cleave a nucleic acid can be used to generate a “zinc finger nuclease.” A zinc finger nuclease typically comprises a zinc finger domain that binds a specific target site within a nucleic acid molecule, and a nucleic acid cleavage domain that cuts the nucleic acid molecule within or in proximity to the target site bound by the binding domain. Typical engineered zinc finger nucleases comprise a binding domain having between 3 and 6 individual zinc finger motifs and binding target sites ranging from 9 base pairs to 18 base pairs in length. Longer target sites are particularly attractive in situations where it is desired to bind and cleave a target site that is unique in a given genome.
The term “zinc finger nuclease,” as used herein, refers to a nuclease comprising a nucleic acid cleavage domain conjugated to a binding domain that comprises a zinc finger array. In some embodiments, the cleavage domain is the cleavage domain of the type II restriction endonuclease FokI. Zinc finger nucleases can be designed to target virtually any desired sequence in a given nucleic acid molecule for cleavage, and the possibility to the design zinc finger binding domains to bind unique sites in the context of complex genomes allows for targeted cleavage of a single genomic site in living cells, for example, to achieve a targeted genomic alteration of therapeutic value. Targeting a double-strand break to a desired genomic locus can be used to introduce frame-shift mutations into the coding sequence of a gene due to the error-prone nature of the non-homologous DNA repair pathway. Zinc finger nucleases can be generated to target a site of interest by methods well known to those of skill in the art. For example, zinc finger binding domains with a desired specificity can be designed by combining individual zinc finger motifs of known specificity. The structure of the zinc finger protein Zif268 bound to DNA has informed much of the work in this field and the concept of obtaining zinc fingers for each of the 64 possible base pair triplets and then mixing and matching these modular zinc fingers to design proteins with any desired sequence specificity has been described (Pavletich N P, Pabo C O (May 1991). “Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A”. Science 252 (5007): 809-17, the entire contents of which are incorporated herein). In some embodiments, separate zinc fingers that each recognize a 3 base pair DNA sequence are combined to generate 3-, 4-, 5-, or 6-finger arrays that recognize target sites ranging from 9 base pairs to 18 base pairs in length. In some embodiments, longer arrays are contemplated. In other embodiments, 2-finger modules recognizing 6-8 nucleotides are combined to generate 4-, 6-, or 8-zinc finger arrays. In some embodiments, bacterial or phage display is employed to develop a zinc finger domain that recognizes a desired nucleic acid sequence, for example, a desired nuclease target site of 3-30 bp in length. Zinc finger nucleases, in some embodiments, comprise a zinc finger binding domain and a cleavage domain fused or otherwise conjugated to each other via a linker, for example, a polypeptide linker. The length of the linker determines the distance of the cut from the nucleic acid sequence bound by the zinc finger domain. If a shorter linker is used, the cleavage domain will cut the nucleic acid closer to the bound nucleic acid sequence, while a longer linker will result in a greater distance between the cut and the bound nucleic acid sequence. In some embodiments, the cleavage domain of a zinc finger nuclease has to dimerize in order to cut a bound nucleic acid. In some such embodiments, the dimer is a heterodimer of two monomers, each of which comprise a different zinc finger binding domain. For example, in some embodiments, the dimer may comprise one monomer comprising zinc finger domain A conjugated to a FokI cleavage domain, and one monomer comprising zinc finger domain B conjugated to a FokI cleavage domain. In this nonlimiting example, zinc finger domain A binds a nucleic acid sequence on one side of the target site, zinc finger domain B binds a nucleic acid sequence on the other side of the target site, and the dimerize FokI domain cuts the nucleic acid in between the zinc finger domain binding sites.
Site-specific nucleases are powerful tools for targeted genome modification in vitro or in vivo. Some site specific nucleases can theoretically achieve a level of specificity for a target cleavage site that would allow one to target a single unique site in a genome for cleavage without affecting any other genomic site. It has been reported that nuclease cleavage in living cells triggers a DNA repair mechanism that frequently results in a modification of the cleaved, repaired genomic sequence, for example, via homologous recombination. Accordingly, the targeted cleavage of a specific unique sequence within a genome opens up new avenues for gene targeting and gene modification in living cells, including cells that are hard to manipulate with conventional gene targeting methods, such as many human somatic or embryonic stem cells. Nuclease-mediated modification of disease-related sequences, e.g., the CCR-5 allele in HIV/AIDS patients, or of genes necessary for tumor neovascularization, can be used in the clinical context, and two site specific nucleases are currently in clinical trials.
One important aspect in the field of site-specific nuclease-mediated modification are off-target nuclease effects, e.g., the cleavage of genomic sequences that differ from the intended target sequence by one or more nucleotides. Undesired side effects of off-target cleavage range from insertion into unwanted loci during a gene targeting event to severe complications in a clinical scenario. Off-target cleavage of sequences encoding essential gene functions or tumor suppressor genes by an endonuclease administered to a subject may result in disease or even death of the subject. Accordingly, it is desirable to characterize the cleavage preferences of a nuclease before using it in the laboratory or the clinic in order to determine its efficacy and safety. Further, the characterization of nuclease cleavage properties allows for the selection of the nuclease best suited for a specific task from a group of candidate nucleases, or for the selection of evolution products obtained from a plurality of nucleases. Such a characterization of nuclease cleavage properties may also inform the de-novo design of nucleases with enhanced properties, such as enhanced specificity or efficiency.
In many scenarios where a nuclease is employed for the targeted manipulation of a nucleic acid, cleavage specificity is a crucial feature. The imperfect specificity of some engineered nuclease binding domains can lead to off-target cleavage and undesired effects both in vitro and in vivo. Current methods of evaluating site-specific nuclease specificity, including ELISA assays, microarrays, one-hybrid systems, SELEX, and its variants, and Rosetta-based computational predictions, are all premised on the assumption that the binding specificity of the nuclease is equivalent or proportionate to their cleavage specificity.
It was previously discovered that the prediction of nuclease off-target binding effects constitute an imperfect approximation of a nuclease's off-target cleavage effects that may result in undesired biological effects (see PCT Application WO 2013/066438; and Pattanayak, V., Ramirez, C. L., Joung, J. K. & Liu, D. R. Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection. Nature methods 8, 765-770 (2011), the entire contents of each of which are incorporated herein by reference). This finding was consistent with the notion that the reported toxicity of some site specific DNA nucleases results from off-target DNA cleavage, rather than off-target binding alone.
The methods and reagents of the present disclosure represent, in some aspects, an improvement over previous methods and allow for an accurate evaluation of a given nuclease's target site specificity and provide strategies for the selection of suitable unique target sites and the design or selection of highly specific nucleases for the targeted cleavage of a single site in the context of a complex genome. For example, some previously reported methods for determining nuclease target site specificity profiles by screening libraries of nucleic acid molecules comprising candidate target sites relied on a “two-cut” in vitro selection method which requires indirect reconstruction of target sites from sequences of two half-sites resulting from two adjacent cuts of the nuclease of a library member nucleic acid (see e.g., Pattanayak, V. et al., Nature Methods 8, 765-770 (2011)). In contrast to such “two-cut” strategies, the methods of the present disclosure utilize a “one cut” screening strategy, which allows for the identification of library members that have been cut at least once by the nuclease. The “one-cut” selection strategies provided herein are compatible with single end high-throughput sequencing methods and do not require computational reconstruction of cleaved target sites from cut half-sites because they feature, in some embodiments, direct sequencing of an intact target nuclease sequence in a cut library member nucleic acid.
Additionally, the presently disclosed “one-cut” screening methods utilize concatemers of a candidate nuclease target site and constant insert region that are about 10-fold shorter than previously reported constructs used for two-cut strategies (˜50 bp repeat sequence length versus ˜500 bp repeat sequence length in previous reports). This difference in repeat sequence length in the concatemers of the library allows for the generation of highly complex libraries of candidate nuclease target sites, e.g., of libraries comprising 1012 different candidate nuclease target sequences. As described herein, an exemplary library of such complexity has been generated, templated on a known Cas9 nuclease target site by varying the sequence of the known target site. The exemplary library demonstrated that a greater than 10-fold coverage of all sequences with eight or fewer mutations of the known target site can be achieved using the strategies provided herein. The use of a shorter repeat sequence also allows the use of single-end sequencing, since both a cut half-site and an adjacent uncut site of the same library member are contained within a 100 nucleotide sequencing read.
The strategies, methods, libraries, and reagents provided herein can be utilized to analyze the sequence preferences and specificity of any site-specific nuclease, for example, to Zinc Finger Nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), homing endonucleases, organic compound nucleases, and enediyne antibiotics (e.g., dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin). Suitable nucleases in addition to the ones described herein will be apparent to those of skill in the art based on this disclosure.
Further, the methods, reagents, and strategies provided herein allow those of skill in the art to identify, design, and/or select nucleases with enhanced specificity and minimize the off-target effects of any given nuclease (e.g., site-specific nucleases such as ZFNs, and TALENS which produce cleavage products with sticky ends, as well as RNA-programmable nucleases, for example Cas9, which produce cleavage products having blunt ends). While of particular relevance to DNA and DNA-cleaving nucleases, the inventive concepts, methods, strategies, and reagents provided herein are not limited in this respect, but can be applied to any nucleic acid:nuclease pair.
Identifying Nuclease Target Sites Cleaved by a Site-Specific Nuclease
Some aspects of this disclosure provide improved methods and reagents to determine the nucleic acid target sites cleaved by any site-specific nuclease. The methods provided herein can be used for the evaluation of target site preferences and specificity of both nucleases that create blunt ends and nucleases that create sticky ends. In general, such methods comprise contacting a given nuclease with a library of target sites under conditions suitable for the nuclease to bind and cut a target site, and determining which target sites the nuclease actually cuts. A determination of a nuclease's target site profile based on actual cutting has the advantage over methods that rely on binding in that it measures a parameter more relevant for mediating undesired off-target effects of site-specific nucleases. In general, the methods provided herein comprise ligating an adapter of a known sequence to nucleic acid molecules that have been cut by a nuclease of interest via 5′-phosphate-dependent ligation. Accordingly, the methods provided herein are particularly useful for identifying target sites cut by nucleases that leave a phosphate moiety at the 5′-end of the cut nucleic acid strand when cleaving their target site. After ligating an adapter to the 5′-end of a cut nucleic acid strand, the cut strand can directly be sequenced using the adapter as a sequencing linker, or a part of the cut library member concatemer comprising an intact target site identical to the cut target site can be amplified via PCR and the amplification product can then be sequenced.
In some embodiments, the method comprises (a) providing a nuclease that cuts a double-stranded nucleic acid target site, wherein cutting of the target site results in cut nucleic acid strands comprising a 5′-phosphate moiety; (b) contacting the nuclease of (a) with a library of candidate nucleic acid molecules, wherein each nucleic acid molecule comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence, under conditions suitable for the nuclease to cut a candidate nucleic acid molecule comprising a target site of the nuclease; and (c) identifying nuclease target sites cut by the nuclease in (b) by determining the sequence of an uncut nuclease target site on the nucleic acid strand that was cut by the nuclease in step (b).
In some embodiments, the method comprises providing a nuclease and contacting the nuclease with a library of candidate nucleic acid molecules comprising candidate target sites. In some embodiments, the candidate nucleic acid molecules are double-stranded nucleic acid molecules. In some embodiments, the candidate nucleic acid molecules are DNA molecules. In some embodiments, each nucleic acid molecule in the library comprises a concatemer of a sequence comprising a candidate nuclease target site and a constant insert sequence. For example, in some embodiments, the library comprises nucleic acid molecules that comprise the structure R1-[(candidate nuclease target site)-(constant insert sequence)]n-R2, wherein R1 and R2 are, independently, nucleic acid sequences that may comprise a fragment of the [(candidate nuclease target site)-(constant insert sequence)] structure, and n is an integer between 2 and y. In some embodiments, y is at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015. In some embodiments, y is less than 102, less than 103, less than 104, less than 105, less than 106, less than 107, less than 108, less than 109, less than 1010, less than 1011, less than 1012, less than 1013, less than 1014, or less than 1015
For example, in some embodiments, the candidate nucleic acid molecules of the library comprise a candidate nuclease target site of the structure [(NZ)-(PAM)], and, thus, the nucleic acid molecules of the library comprise the structure R1-[(NZ)-(PAM)-(constant region)]x-R2, wherein R1 and R2 are, independently, nucleic acid sequences that may comprise a fragment of the [(NZ)-(PAM)-(constant region)] repeat unit; each N represents, independently, any nucleotide; Z is an integer between 1 and 50; and X is an integer between 2 and y. In some embodiments, y is at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015. In some embodiments, y is less than 102, less than 103, less than 104, less than 105, less than 106, less than 107, less than 108, less than 109, less than 1010, less than 1011, less than 1012, less than 1013, less than 1014, or less than 1015. In some embodiments, Z is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50. In some embodiments, Z is 20. Each N represents, independently, any nucleotide. Accordingly, a sequence provided as NZ with Z=2 would be NN, with each N, independently, representing A, T, G, or C. Accordingly, NZ with Z=2 can represent AA, AT, AG, AC, TA, TT, TG, TC, GA, GT, GG, GC, CA, CT, CG, and CC.
In other embodiments, the candidate nucleic acid molecules of the library comprise a candidate nuclease target site of the structure [left-half site]-[spacer sequence]-[right-half site] (“LSR”), and, thus, the nucleic acid molecules of the library comprise the structure R1-[(LSR)-(constant region)]x-R2, wherein R1 and R2 are, independently, nucleic acid sequences that may comprise a fragment of the [(LSR)-(constant region)] repeat unit, and X is an integer between 2 and y. In some embodiments, y is at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015. In some embodiments, y is less than 102, less than 103, less than 104, less than 105, less than 106, less than 107, less than 108, less than 109, less than 1010, less than 1011, less than 1012, less than 1013, less than 1014, or less than 1015. The constant region, in some embodiments, is of a length that allows for efficient self-ligation of a single repeat unit. Suitable lengths will be apparent to those of skill in the art. For example, in some embodiments, the constant region is between 5 and 100 base pairs long, for example, about 5 base pairs, about 10 base pairs, about 15 base pairs, about 20 base pairs, about 25 base pairs, about 30 base pairs, about 35 base pairs, about 40 base pairs, about 50 base pairs, about 60 base pairs, about 70 base pairs, about 80 base pairs, about 90 base pairs, or about 100 base pairs long. In some embodiments, the constant region is 16 base pairs long. In some embodiments, the nuclease cuts a double-stranded nucleic acid target site and creates blunt ends. In other embodiments, the nuclease creates a 5′-overhang. In some such embodiments, the target site comprises a [left-half site]-[spacer sequence]-[right-half site] (LSR) structure, and the nuclease cuts the target site within the spacer sequence.
In some embodiments, a nuclease cuts a double-stranded target site and creates blunt ends. In some embodiments, a nuclease cuts a double-stranded target site and creates an overhang, or sticky end, for example, a 5′-overhang. In some such embodiments, the method comprises filling in the 5′-overhangs of nucleic acid molecules produced from a nucleic acid molecule that has been cut once by the nuclease, wherein the nucleic acid molecules comprise a constant insert sequence flanked by a left or right half-site and cut spacer sequence on one side, and an uncut target site sequence on the other side, thereby creating blunt ends.
In some embodiments, the determining of step (c) comprises ligating a first nucleic acid adapter to the 5′ end of a nucleic acid strand that was cut by the nuclease in step (b) via 5′-phosphate-dependent ligation. In some embodiments, the nuclease creates blunt ends. In such embodiments, an adapter can directly be ligated to the blunt ends resulting from the nuclease cut of the target site by contacting the cut library members with a double-stranded, blunt-ended adapter lacking 5′ phosphorylation. In some embodiments, the nuclease creates an overhang (sticky end). In some such embodiments, an adapter may be ligated to the cut site by contacting the cut library member with an excess of adapter having a compatible sticky end. If a nuclease is used that cuts within a constant spacer sequence between variable half-sites, the sticky end can be designed to match the 5′ overhang created from the spacer sequence. In embodiments, where the nuclease cuts within a variable sequence, a population of adapters having a variable overhang sequence and a constant annealed sequence (for use as a sequencing linker or PCR primer) may be used, or the 5′ overhangs may be filled in to form blunt ends before adapter ligation.
In some embodiments, the determining of step (c) further comprises amplifying a fragment of the concatemer cut by the nuclease that comprises an uncut target site via PCR using a PCR primer that hybridizes with the adapter and a PCR primer that hybridizes with the constant insert sequence. Typically, the amplification of concatemers via PCR will yield amplicons comprising at least one intact candidate target site identical to the cut target sites because the target sites in each concatemer are identical. For single-direction sequencing, an enrichment of amplicons that comprise one intact target site, no more than two intact target sites, no more than three intact target sites, no more than four intact target sites, or no more than five intact target sites may be desirable. In embodiments where PCR is used for amplification of cut nucleic acid molecules, the PCR parameters can be optimized to favor the amplification of short sequences and disfavor the amplification of longer sequences, e.g., by using a short elongation time in the PCR cycle. Another possibility for enrichment of short amplicons is size fractionation, e.g., via gel electrophoresis or size exclusion chromatography. Size fractionation can be performed before and/or after amplification. Other suitable methods for enrichment of short amplicons will be apparent to those of skill in the art and the disclosure is not limited in this respect.
In some embodiments, the determining of step (c) comprises sequencing the nucleic acid strand that was cut by the nuclease in step (b), or a copy thereof obtained via amplification, e.g., by PCR. Sequencing methods are well known to those of skill in the art. The disclosure is not limited in this respect.
In some embodiments, the nuclease being profiled using the inventive system is an RNA-programmable nuclease that forms a complex with an RNA molecule, and wherein the nuclease:RNA complex specifically binds a nucleic acid sequence complementary to the sequence of the RNA molecule. In some embodiments, the RNA molecule is a single-guide RNA (sgRNA). In some embodiments, the sgRNA comprises 5-50 nucleotides, 10-30 nucleotides, 15-25 nucleotides, 18-22 nucleotides, 19-21 nucleotides, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sgRNA comprises 5-50 nucleotides, 10-30 nucleotides, 15-25 nucleotides, 18-22 nucleotides, 19-21 nucleotides, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides that are complementary to a sequence of the nuclease target site. In some embodiments, the sgRNA comprises 20 nucleotides that are complementary to the nuclease target site. In some embodiments, the nuclease is a Cas9 nuclease. In some embodiments, the nuclease target site comprises a [sgRNA-complementary sequence]-[protospacer adjacent motif (PAM)] structure, and the nuclease cuts the target site within the sgRNA-complementary sequence. In some embodiments, the sgRNA-complementary sequence comprises 5-50 nucleotides, 10-30 nucleotides, 15-25 nucleotides, 18-22 nucleotides, 19-21 nucleotides, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
In some embodiments, the RNA-programmable nuclease is a Cas9 nuclease. The RNA-programmable Cas9 endonuclease cleaves double-stranded DNA (dsDNA) at sites adjacent to a two-base-pair PAM motif and complementary to a guide RNA sequence (sgRNA). Typically, the sgRNA sequence that is complementary to the target site sequence is about 20 nucleotides long, but shorter and longer complementary sgRNA sequences can be used as well. For example, in some embodiments, the sgRNA comprises 5-50 nucleotides, 10-30 nucleotides, 15-25 nucleotides, 18-22 nucleotides, 19-21 nucleotides, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The Cas9 system has been used to modify genomes in multiple cell types, demonstrating its potential as a facile genome-engineering tool.
In some embodiments, the nuclease comprises an unspecific nucleic acid cleavage domain. In some embodiments, the nuclease comprises a FokI cleavage domain. In some embodiments, the nuclease comprises a nucleic acid cleavage domain that cleaves a target sequence upon cleavage domain dimerization. In some embodiments, the nuclease comprises a binding domain that specifically binds a nucleic acid sequence. In some embodiments, the binding domain comprises a zinc finger. In some embodiments, the binding domain comprises at least 2, at least 3, at least 4, or at least 5 zinc fingers. In some embodiments, the nuclease is a Zinc Finger Nuclease. In some embodiments, the binding domain comprises a Transcriptional Activator-Like Element. In some embodiments, the nuclease is a Transcriptional Activator-Like Element Nuclease (TALEN). In some embodiments, the nuclease is a homing endonuclease. In some embodiments, the nuclease is an organic compound. In some embodiments, the nuclease comprises an enediyne functional group. In some embodiments, the nuclease is an antibiotic. In some embodiments, the compound is dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin, or a derivative thereof.
Incubation of the nuclease with the library nucleic acids will result in cleavage of those concatemers in the library that comprise target sites that can be bound and cleaved by the nuclease. If a given nuclease cleaves a specific target site with high efficiency, a concatemer comprising target sites will be cut, e.g., once or multiple times, resulting in the generation of fragments comprising a cut target site adjacent to one or more repeat units. Depending on the structure of the library members, an exemplary cut nucleic acid molecule released from a library member concatemer by a single nuclease cleavage may, for example, be of the structure (cut target site)-(constant region)-[(target site)-(constant region)]x-R2. For example, in the context of an RNA-guided nuclease, an exemplary cut nucleic acid molecule released from a library member concatemer by a single nuclease cleavage may, for example, be of the structure (PAM)-(constant region)-[(NZ)—(PAM)-(constant region)]x-R2. And in the context of a nuclease cutting an LSR structure within the spacer region, an exemplary cut nucleic acid molecule released from a library member concatemer by a single nuclease cleavage may, for example, be of the structure (cut spacer region)-(right half site)-(constant region)-[(LSR)-(constant region)]x-R2. Such cut fragments released from library candidate molecules can then be isolated and/or the sequence of the target site cleaved by the nuclease identified by sequencing an intact target site (e.g., an intact (NZ)-(PAM) site of released repeat units. See, e.g.,
Suitable conditions for exposure of the library of nucleic acid molecules will be apparent to those of skill in the art. In some embodiments, suitable conditions do not result in denaturation of the library nucleic acids or the nuclease and allow for the nuclease to exhibit at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of its nuclease activity.
Additionally, if a given nuclease cleaves a specific target site, some cleavage products will comprise a cut half site and an intact, or uncut target site. As described herein, such products can be isolated by routine methods, and because the insert sequence, in some aspects, is less than 100 base pairs, such isolated cleavage products may be sequenced in a single read-through, allowing identification of the target site sequence without reconstructing the sequence, e.g., from cut half sites.
Any method suitable for isolation and sequencing of the repeat units can be employed to elucidate the LSR sequence cleaved by the nuclease. For example, since the length of the constant region is known, individual released repeat units can be separated based on their size from the larger uncut library nucleic acid molecules as well as from fragments of library nucleic acid molecules that comprise multiple repeat units (indicating non-efficient targeted cleavage by the nuclease). Suitable methods for separating and/or isolating nucleic acid molecules based on their size are well-known to those of skill in the art and include, for example, size fractionation methods, such as gel electrophoresis, density gradient centrifugation, and dialysis over a semi-permeable membrane with a suitable molecular cutoff value. The separated/isolated nucleic acid molecules can then be further characterized, for example, by ligating PCR and/or sequencing adapters to the cut ends and amplifying and/or sequencing the respective nucleic acids. Further, if the length of the constant region is selected to favor self-ligation of individual released repeat units, such individual released repeat units may be enriched by contacting the nuclease treated library molecules with a ligase and subsequent amplification and/or sequencing based on the circularized nature of the self-ligated individual repeat units.
In some embodiments, where a nuclease is used that generates 5′-overhangs as a result of cutting a target nucleic acid, the 5′-overhangs of the cut nucleic acid molecules are filled in. Methods for filling in 5′-overhangs are well known to those of skill in the art and include, for example, methods using DNA polymerase I Klenow fragment lacking exonuclease activity (Klenow (3′→5′ exo-)). Filling in 5′-overhangs results in the overhang-templated extension of the recessed strand, which, in turn, results in blunt ends. In the case of single repeat units released from library concatemers, the resulting structure is a blunt-ended S2′R-(constant region)-LS1′, with S1′ and S2′ comprising blunt ends. PCR and/or sequencing adapters can then be added to the ends by blunt end ligation and the respective repeat units (including S2′R and LS1′ regions) can be sequenced. From the sequence data, the original LSR region can be deduced. Blunting of the overhangs created during the nuclease cleavage process also allows for distinguishing between target sites that were properly cut by the respective nuclease and target sites that were non-specifically cut, e.g., based on non-nuclease effects such as physical shearing. Correctly cleaved nuclease target sites can be recognized by the existence of complementary S2′R and LS1′ regions, which comprise a duplication of the overhang nucleotides as a result of the overhang fill in while target sites that were not cleaved by the respective nuclease are unlikely to comprise overhang nucleotide duplications. In some embodiments, the method comprises identifying the nuclease target site cut by the nuclease by determining the sequence of the left-half site, the right-half-site, and/or the spacer sequence of a released individual repeat unit. Any suitable method for amplifying and/or sequencing can be used to identify the LSR sequence of the target site cleaved by the respective nuclease. Methods for amplifying and/or sequencing nucleic acids are well known to those of skill in the art and the disclosure is not limited in this respect. In the case of nucleic acids released from library concatemers that comprise a cut half site and an uncut target site (e.g., comprises at least about 1.5 repeat sequences), filling in the 5′-overhangs also provides for assurance that the nucleic acid was cleaved by the nuclease. Because the nucleic acid also comprises an intact, or uncut target site, the sequence of said site can be determined without having to reconstruct the sequence from a left-half site, right-half site, and/or spacer sequence.
Some of the methods and strategies provided herein allow for the simultaneous assessment of a plurality of candidate target sites as possible cleavage targets for any given nuclease. Accordingly, the data obtained from such methods can be used to compile a list of target sites cleaved by a given nuclease, which is also referred to herein as a target site profile. If a sequencing method is used that allows for the generation of quantitative sequencing data, it is also possible to record the relative abundance of any nuclease target site detected to be cleaved by the respective nuclease. Target sites that are cleaved more efficiently by the nuclease will be detected more frequently in the sequencing step, while target sites that are not cleaved efficiently will only rarely release an individual repeat unit from a candidate concatemer, and thus, will only generate few, if any, sequencing reads. Such quantitative sequencing data can be integrated into a target site profile to generate a ranked list of highly preferred and less preferred nuclease target sites.
The methods and strategies of nuclease target site profiling provided herein can be applied to any site-specific nuclease, including, for example, ZFNs, TALENs, homing endonucleases, and RNA-programmable nucleases, such as Cas9 nucleases. As described in more detail herein, nuclease specificity typically decreases with increasing nuclease concentration, and the methods described herein can be used to determine a concentration at which a given nuclease efficiently cuts its intended target site, but does not efficiently cut any off-target sequences. In some embodiments, a maximum concentration of a therapeutic nuclease is determined at which the therapeutic nuclease cuts its intended nuclease target site but does not cut more than 10, more than 5, more than 4, more than 3, more than 2, more than 1, or any additional sites. In some embodiments, a therapeutic nuclease is administered to a subject in an amount effective to generate a final concentration equal or lower than the maximum concentration determined as described above.
In some embodiments, the library of candidate nucleic acid molecules used in the methods provided herein comprises at least 108, at least 109, at least 1010, at least 1011, or at least 1012 different candidate nuclease target sites.
In some embodiments, the nuclease is a therapeutic nuclease which cuts a specific nuclease target site in a gene associated with a disease. In some embodiments, the method further comprises determining a maximum concentration of the therapeutic nuclease at which the therapeutic nuclease cuts the specific nuclease target site and does not cut more than 10, more than 5, more than 4, more than 3, more than 2, more than 1, or no additional sites. In some embodiments, the method further comprises administering the therapeutic nuclease to a subject in an amount effective to generate a final concentration equal or lower than the maximum concentration.
Nuclease Target Site Libraries
Some embodiments of this disclosure provide libraries of nucleic acid molecules for nuclease target site profiling. In some embodiments, the candidate nucleic acid molecules of the library comprise the structure R1-[(NZ)-(PAM)-(constant region)]x-R2, wherein R1 and R2 are, independently, nucleic acid sequences that may comprise a fragment of the [(NZ)-(PAM)-(constant region)] repeat unit; each N represents, independently, any nucleotide; Z is an integer between 1 and 50; and X is an integer between 2 and y. In some embodiments, y is at least 10′, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015. In some embodiments, y is less than 102, less than 103, less than 104, less than 105, less than 106, less than 107, less than 108, less than 109, less than 1010, less than 1011, less than 1012, less than 1013, less than 1014, or less than 1015. In some embodiments, Z is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50. In some embodiments, Z is 20. Each N represents, independently, any nucleotide. Accordingly, a sequence provided as NZ with Z=2 would be NN, with each N, independently, representing A, T, G, or C. Accordingly, NZ with Z=2 can represent AA, AT, AG, AC, TA, TT, TG, TC, GA, GT, GG, GC, CA, CT, CG, and CC.
In some embodiments, a library is provided comprising candidate nucleic acid molecules that comprise target sites with a partially randomized left-half site, a partially randomized right-half site, and/or a partially randomized spacer sequence. In some embodiments, the library is provided comprising candidate nucleic acid molecules that comprise target sites with a partially randomized left half site, a fully randomized spacer sequence, and a partially randomized right half site. In some embodiments, a library is provided comprising candidate nucleic acid molecules that comprise target sites with a partially or fully randomized sequence, wherein the target sites comprise the structure [NZ-(PAM)], for example as described herein. In some embodiments, partially randomized sites differ from the consensus site by more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, or more than 30% on average, distributed binomially.
In some embodiments such a library comprises a plurality of nucleic acid molecules, each comprising a concatemer of a candidate nuclease target site and a constant insert sequence, also referred to herein as a constant region. For example, in some embodiments, the candidate nucleic acid molecules of the library comprise the structure R1-[(sgRNA-complementary sequence)-(PAM)-(constant region)]x-R2, or the structure R1-[(LSR)-(constant region)]x-R2, wherein the structure in square brackets (“[ . . . ]”) is referred to as a repeat unit or repeat sequence; R1 and R2 are, independently, nucleic acid sequences that may comprise a fragment of the repeat unit, and X is an integer between 2 and y. In some embodiments, y is at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015. In some embodiments, y is less than 102, less than 103, less than 104, less than 105, less than 106, less than 107, less than 108, less than 109, less than 1010, less than 1011, less than 1012, less than 1013, less than 1014, or less than 1015. The constant region, in some embodiments, is of a length that allows for efficient self-ligation of a single repeat unit. In some embodiments, the constant region is of a length that allows for efficient separation of single repeat units from fragments comprising two or more repeat units. In some embodiments, the constant region is of a length allows for efficient sequencing of a complete repeat unit in one sequencing read. Suitable lengths will be apparent to those of skill in the art. For example, in some embodiments, the constant region is between 5 and 100 base pairs long, for example, about 5 base pairs, about 10 base pairs, about 15 base pairs, about 20 base pairs, about 25 base pairs, about 30 base pairs, about 35 base pairs, about 40 base pairs, about 50 base pairs, about 60 base pairs, about 70 base pairs, about 80 base pairs, about 90 base pairs, or about 100 base pairs long. In some embodiments, the constant region is 1, 2, 3, 4, 5, 6, 7, 8, 9, 0, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 base pairs long.
An LSR site typically comprises a [left-half site]-[spacer sequence]-[right-half site] structure. The lengths of the half-size and the spacer sequence will depend on the specific nuclease to be evaluated. In general, the half-sites will be 6-30 nucleotides long, and preferably 10-18 nucleotides long. For example, each half site individually may be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, an LSR site may be longer than 30 nucleotides. In some embodiments, the left half site and the right half site of an LSR are of the same length. In some embodiments, the left half site and the right half site of an LSR are of different lengths. In some embodiments, the left half site and the right half site of an LSR are of different sequences. In some embodiments, a library is provided that comprises candidate nucleic acids which comprise LSRs that can be cleaved by a FokI cleavage domain, a Zinc Finger Nuclease (ZFN), a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, or an organic compound (e.g., an enediyne antibiotic such as dynemicin, neocarzinostatin, calicheamicin, and esperamicinl; and bleomycin).
In some embodiments, a library of candidate nucleic acid molecules is provided that comprises at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015 different candidate nuclease target sites. In some embodiments, the candidate nucleic acid molecules of the library are concatemers produced from a secularized templates by rolling cycle amplification. In some embodiments, the library comprises nucleic acid molecules, e.g., concatemers, of a molecular weight of at least 5 kDa, at least 6 kDa, at least 7 kDa, at least 8 kDa, at least 9 kDa, at least 10 kDa, at least 12 kDa, or at least 15 kDa. In some embodiments, the molecular weight of the nucleic acid molecules within the library may be larger than 15 kDa. In some embodiments, the library comprises nucleic acid molecules within a specific size range, for example, within a range of 5-7 kDa, 5-10 kDa, 8-12 kDa, 10-15 kDa, or 12-15 kDa, or 5-10 kDa or any possible subrange. While some methods suitable for generating nucleic acid concatemers according to some aspects of this disclosure result in the generation of nucleic acid molecules of greatly different molecular weights, such mixtures of nucleic acid molecules may be size fractionated to obtain a desired size distribution. Suitable methods for enriching nucleic acid molecules of a desired size or excluding nucleic acid molecules of a desired size are well known to those of skill in the art and the disclosure is not limited in this respect.
In some embodiments, partially randomized sites differ from the consensus site by no more than 10%, no more than 15%, no more than 20%, no more than 25%, nor more than 30%, no more than 40%, or no more than 50% on average, distributed binomially. For example, in some embodiments partially randomized sites differ from the consensus site by more than 5%, but by no more than 10%; by more than 10%, but by no more than 20%; by more than 20%, but by no more than 25%; by more than 5%, but by no more than 20%, and so on. Using partially randomized nuclease target sites in the library is useful to increase the concentration of library members comprising target sites that are closely related to the consensus site, for example, that differ from the consensus sites in only one, only two, only three, only four, or only five residues. The rationale behind this is that a given nuclease, for example a given ZFN or RNA-programmable nuclease, is likely to cut its intended target site and any closely related target sites, but unlikely to cut a target sites that is vastly different from or completely unrelated to the intended target site. Accordingly, using a library comprising partially randomized target sites can be more efficient than using libraries comprising fully randomized target sites without compromising the sensitivity in detecting any off-target cleavage events for any given nuclease. Thus, the use of partially randomized libraries significantly reduces the cost and effort required to produce a library having a high likelihood of covering virtually all off-target sites of a given nuclease. In some embodiments however it may be desirable to use a fully randomized library of target sites, for example, in embodiments, where the specificity of a given nuclease is to be evaluated in the context of any possible site in a given genome.
Selection and Design of Site-Specific Nucleases
Some aspects of this disclosure provide methods and strategies for selecting and designing site-specific nucleases that allow the targeted cleavage of a single, unique sites in the context of a complex genome. In some embodiments, a method is provided that comprises providing a plurality of candidate nucleases that are designed or known to cut the same consensus sequence; profiling the target sites actually cleaved by each candidate nuclease, thus detecting any cleaved off-target sites (target sites that differ from the consensus target site); and selecting a candidate nuclease based on the off-target site(s) so identified. In some embodiments, this method is used to select the most specific nuclease from a group of candidate nucleases, for example, the nuclease that cleaves the consensus target site with the highest specificity, the nuclease that cleaves the lowest number of off-target sites, the nuclease that cleaves the lowest number of off-target sites in the context of a target genome, or a nuclease that does not cleave any target site other than the consensus target site. In some embodiments, this method is used to select a nuclease that does not cleave any off-target site in the context of the genome of a subject at concentration that is equal to or higher than a therapeutically effective concentration of the nuclease.
The methods and reagents provided herein can be used, for example, to evaluate a plurality of different nucleases targeting the same intended targets site, for example, a plurality of variations of a given site-specific nuclease, for example a given zinc finger nuclease. Accordingly, such methods may be used as the selection step in evolving or designing a novel site-specific nucleases with improved specificity.
Identifying Unique Nuclease Target Sites within a Genome
Some embodiments of this disclosure provide a method for selecting a nuclease target site within a genome. As described in more detail elsewhere herein, it was surprisingly discovered that off target sites cleaved by a given nuclease are typically highly similar to the consensus target site, e.g., differing from the consensus target site in only one, only two, only three, only four, or only five nucleotide residues. Based on this discovery, a nuclease target sites within the genome can be selected to increase the likelihood of a nuclease targeting this site not cleaving any off target sites within the genome. For example, in some embodiments, a method is provided that comprises identifying a candidate nuclease target site; and comparing the candidate nuclease target site to other sequences within the genome. Methods for comparing candidate nuclease target sites to other sequences within the genome are well known to those of skill in the art and include for example sequence alignment methods, for example, using a sequence alignment software or algorithm such as BLAST on a general purpose computer. A suitable unique nuclease target site can then be selected based on the results of the sequence comparison. In some embodiments, if the candidate nuclease target site differs from any other sequence within the genome by at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides, the nuclease target site is selected as a unique site within the genome, whereas if the site does not fulfill this criteria, the site may be discarded. In some embodiments, once a site is selected based on the sequence comparison, as outlined above, a site-specific nuclease targeting the selected site is designed. For example, a zinc finger nuclease may be designed to target any selected nuclease target site by constructing a zinc finger array binding the target site, and conjugating the zinc finger array to a DNA cleavage domain. In embodiments where the DNA cleavage domain needs to dimerize in order to cleave DNA, to zinc finger arrays will be designed, each binding a half site of the nuclease target site, and each conjugated to a cleavage domain. In some embodiments, nuclease designing and/or generating is done by recombinant technology. Suitable recombinant technologies are well known to those of skill in the art, and the disclosure is not limited in this respect.
In some embodiments, a site-specific nuclease designed or generated according to aspects of this disclosure is isolated and/or purified. The methods and strategies for designing site-specific nucleases according to aspects of this disclosure can be applied to design or generate any site-specific nuclease, including, but not limited to Zinc Finger Nucleases, Transcription Activator-Like Effector Nucleases (TALENs), a homing endonuclease, an organic compound nuclease, or an enediyne antibiotic (e.g., dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin).
Isolated Nucleases
Some aspects of this disclosure provide isolated site-specific nucleases with enhanced specificity that are designed using the methods and strategies described herein. Some embodiments, of this disclosure provide nucleic acids encoding such nucleases. Some embodiments of this disclosure provide expression constructs comprising such encoding nucleic acids. For example, in some embodiments an isolated nuclease is provided that has been engineered to cleave a desired target site within a genome, and has been evaluated according to a method provided herein to cut less than 1, less than 2, less than 3, less than 4, less than 5, less than 6, less than 7, less than 8, less than 9 or less than 10 off-target sites at a concentration effective for the nuclease to cut its intended target site. In some embodiments an isolated nuclease is provided that has been engineered to cleave a desired unique target site that has been selected to differ from any other site within a genome by at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotide residues. In some embodiments, the isolated nuclease is an RNA-programmable nuclease, such as a Cas9 nuclease; a Zinc Finger Nuclease (ZFN); or a Transcription Activator-Like Effector Nuclease (TALEN), a homing endonuclease, an organic compound nuclease, or an enediyne antibiotic (e.g., dynemicin, neocarzinostatin, calicheamicin, esperamicin, bleomycin). In some embodiments, the isolated nuclease cleaves a target site within an allele that is associated with a disease or disorder. In some embodiments, the isolated nuclease cleaves a target site the cleavage of which results in treatment or prevention of a disease or disorder. In some embodiments, the disease is HIV/AIDS, or a proliferative disease. In some embodiments, the allele is a CCR5 (for treating HIV/AIDS) or a VEGFA allele (for treating a proliferative disease).
In some embodiments, the isolated nuclease is provided as part of a pharmaceutical composition. For example, some embodiments provide pharmaceutical compositions comprising a nuclease as provided herein, or a nucleic acid encoding such a nuclease, and a pharmaceutically acceptable excipient. Pharmaceutical compositions may optionally comprise one or more additional therapeutically active substances.
In some embodiments, compositions provided herein are administered to a subject, for example, to a human subject, in order to effect a targeted genomic modification within the subject. In some embodiments, cells are obtained from the subject and contacted with a nuclease or a nuclease-encoding nucleic acid ex vivo, and re-administered to the subject after the desired genomic modification has been effected or detected in the cells. Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and/or rats; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys.
Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping and/or packaging the product into a desired single- or multi-dose unit.
Pharmaceutical formulations may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, Md., 2006; incorporated in its entirety herein by reference) discloses various excipients used in formulating pharmaceutical compositions and known techniques for the preparation thereof. See also PCT application PCT/US2010/055131, incorporated in its entirety herein by reference, for additional suitable methods, reagents, excipients and solvents for producing pharmaceutical compositions comprising a nuclease. Except insofar as any conventional excipient medium is incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition, its use is contemplated to be within the scope of this disclosure.
The function and advantage of these and other embodiments of the present invention will be more fully understood from the Examples below. The following Examples are intended to illustrate the benefits of the present invention and to describe particular embodiments, but are not intended to exemplify the full scope of the invention. Accordingly, it will be understood that the Examples are not meant to limit the scope of the invention.
Materials and Methods
Oligonucleotides.
All oligonucleotides used in this study were purchased from Integrated DNA Technologies. Oligonucleotide sequences are listed in Table 9.
Expression and Purification of S. pyogenes Cas9.
E. coli Rosetta (DE3) cells were transformed with plasmid pMJ80611, encoding the S. pyogenes cas9 gene fused to an N-terminal 6×His-tag/maltose binding protein. The resulting expression strain was inoculated in Luria-Bertani (LB) broth containing 100 μg/mL of ampicillin and 30 μg/mL of chloramphenicol at 37° C. overnight. The cells were diluted 1:100 into the same growth medium and grown at 37° C. to OD600 ˜0.6. The culture was incubated at 18° C. for 30 min, and isopropyl β-D-1-thiogalactopyranoside (IPTG) was added at 0.2 mM to induce Cas9 expression. After ˜17 h, the cells were collected by centrifugation at 8,000 g and resuspended in lysis buffer (20 mM tris(hydroxymethyl)-aminomethane (Tris)-HCl, pH 8.0, 1 M KCl, 20% glycerol, 1 mM tris (2-carboxyethyl)phosphine (TCEP)). The cells were lysed by sonication (10 sec pulse-on and 30 sec pulse-off for 10 min total at 6 W output) and the soluble lysate was obtained by centrifugation at 20,000 g for 30 min. The cell lysate was incubated with nickel-nitriloacetic acid (nickel-NTA) resin (Qiagen) at 4° C. for 20 min to capture His-tagged Cas9. The resin was transferred to a 20-mL column and washed with 20 column volumes of lysis buffer. Cas9 was eluted in 20 mM Tris-HCl (pH 8), 0.1 M KCl, 20% glycerol, 1 mM TCEP, and 250 mM imidazole, and concentrated by Amicon ultra centrifugal filter (Millipore, 30-kDa molecular weight cut-off) to ˜50 mg/mL. The 6×His tag and maltose-binding protein were removed by TEV protease treatment at 4° C. for 20 h and captured by a second Ni-affinity purification step. The eluent, containing Cas9, was injected into a HiTrap SP FF column (GE Healthcare) in purification buffer containing 20 mM Tris-HCl (pH 8), 0.1 M KCl, 20% glycerol, and 1 mM TCEP. Cas9 was eluted with purification buffer containing a linear KCl gradient from 0.1 M to 1 M over five column volumes. The eluted Cas9 was further purified by a HiLoad Superdex 200 column in purification buffer, snap-frozen in liquid nitrogen, and stored in aliquots at −80° C.
In Vitro RNA Transcription.
100 pmol CLTA(#) v2.1 fwd and v2.1 template rev were incubated at 95° C. and cooled at 0.1° C./s to 37° C. in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad). 10 U of Klenow Fragment (3′→5′ exo−) (NEB) were added to the reaction mixture and a double-stranded CLTA(#) v2.1 template was obtained by overlap extension for 1 h at 37° C. 200 nM CLTA(#) v2.1 template alone or 100 nM CLTA(#) template with 100 nM T7 promoter oligo was incubated overnight at 37° C. with 0.16 U/μL of T7 RNA Polymerase (NEB) in NEB RNAPol Buffer (40 mM Tris-HCl, pH 7.9, 6 mM magnesium chloride, 10 mM dithiothreitol, 2 mM spermidine) supplemented with 1 mM rNTP mix (1 mM rATP, 1 mM rCTP, 1 mM rGTP, 1 mM rUTP). In vitro transcribed RNA was precipitated with ethanol and purified by gel electrophoresis on a Criterion 10% polyacrylamide TBE-Urea gel (Bio-Rad). Gel-purified sgRNA was precipitated with ethanol and redissolved in water.
In Vitro Library Construction.
10 pmol of CLTA(#) lib oligonucleotides were separately circularized by incubation with 100 units of CircLigase II ssDNA Ligase (Epicentre) in 1× CircLigase II Reaction Buffer (33 mM Tris-acetate, 66 mM potassium acetate, 0.5 mM dithiothreitol, pH 7.5) supplemented with 2.5 mM manganese chloride in a total reaction volume of 20 μL for 16 hours at 60° C. The reaction mixture was incubated for 10 minutes at 85° C. to inactivate the enzyme. 5 μL (5 pmol) of the crude circular single-stranded DNA were converted into the concatemeric pre-selection libraries with the illustra TempliPhi Amplification Kit (GE Healthcare) according to the manufacturer's protocol. Concatemeric pre-selection libraries were quantified with the Quant-it PicoGreen dsDNA Assay Kit (Invitrogen).
In Vitro Cleavage of On-Target and Off-Target Substrates.
Plasmid templates for PCR were constructed by ligation of annealed oligonucleotides CLTA(#) site fwd/rev into HindIII/XbaI double-digested pUC19 (NEB). On-target substrate DNAs were generated by PCR with the plasmid templates and test fwd and test rev primers, then purified with the QIAquick PCR Purification Kit (Qiagen). Off-target substrate DNAs were generated by primer extension. 100 pmol off-target (#) fwd and off-target (#) rev primers were incubated at 95° C. and cooled at 0.1° C./s to 37° C. in NEBuffer2 (50 mM sodium chloride, 10 mM Tris-HCl, 10 mM magnesium chloride, 1 mM dithiothreitol, pH 7.9) supplemented with 10 μM dNTP mix (Bio-Rad). 10 U of Klenow Fragment (3′→5′ exo-) (NEB) were added to the reaction mixture and double-stranded off-target templates were obtained by overlap extension for 1 h at 37° C. followed by enzyme inactivation for 20 min at 75° C., then purified with the QIAquick PCR Purification Kit (Qiagen). 200 nM substrate DNAs were incubated with 100 nM Cas9 and 100 nM (v1.0 or v2.1) sgRNA or 1000 nM Cas9 and 1000 nM (v1.0 or v2.1) sgRNA in Cas9 cleavage buffer (200 mM HEPES, pH 7.5, 1.5 M potassium chloride, 100 mM magnesium chloride, 1 mM EDTA, 5 mM dithiothreitol) for 10 min at 37° C. On-target cleavage reactions were purified with the QIAquick PCR Purification Kit (Qiagen), and off-target cleavage reactions were purified with the QIAquick Nucleotide Removal Kit (Qiagen) before electrophoresis in a Criterion 5% polyacrylamide TBE gel (Bio-Rad).
In Vitro Selection.
200 nM concatemeric pre-selection libraries were incubated with 100 nM Cas9 and 100 nM sgRNA or 1000 nM Cas9 and 1000 nM sgRNA in Cas9 cleavage buffer (200 mM HEPES, pH 7.5, 1.5 M potassium chloride, 100 mM magnesium chloride, 1 mM EDTA, 5 mM dithiothreitol) for 10 min at 37° C. Pre-selection libraries were also separately incubated with 2 U of BspMI restriction endonuclease (NEB) in NEBuffer3 (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM dithiothreitol, pH 7.9) for 1 h at 37° C. Blunt-ended post-selection library members or sticky-ended pre-selection library members were purified with the QIAQuick PCR Purification Kit (Qiagen) and ligated to 10 pmol adapter1/2(AACA) (Cas9:v2.1 sgRNA, 100 nM), adapter1/2(TTCA) (Cas9:v2.1 sgRNA, 1000 nM), adapter1/2 (Cas9:v2.1 sgRNA, 1000 nM), or lib adapter1/CLTA(#) lib adapter 2 (pre-selection) with 1,000 U of T4 DNA Ligase (NEB) in NEB T4 DNA Ligase Reaction Buffer (50 mM Tris-HCl, pH 7.5, 10 mM magnesium chloride, 1 mM ATP, 10 mM dithiothreitol) overnight (>10 h) at room temperature. Adapter-ligated DNA was purified with the QIAquick PCR Purification Kit and PCR-amplified for 10-13 cycles with Phusion Hot Start Flex DNA Polymerase (NEB) in Buffer HF (NEB) and primers CLTA(#) sel PCR/PE2 short (post-selection) or CLTA(#) lib seq PCR/lib fwd PCR (pre-selection). Amplified DNAs were gel purified, quantified with the KAPA Library Quantification Kit-Illumina (KAPA Biosystems), and subjected to single-read sequencing on an Illumina MiSeq or Rapid Run single-read sequencing on an Illumina HiSeq 2500 (Harvard University FAS Center for Systems Biology Core facility, Cambridge, Mass.).
Selection Analysis.
Pre-selection and post-selection sequencing data were analyzed as previously described21, with modification (Algorithms) using scripts written in C++. Raw sequence data is not shown; see Table 2 for a curated summary. Specificity scores were calculated with the formulae: positive specificity score=(frequency of base pair at position[post-selection]−frequency of base pair at position[pre-selection])/(1−frequency of base pair at position[pre-selection]) and negative specificity score=(frequency of base pair at position[post-selection]−frequency of base pair at position[pre-selection])/(frequency of base pair at position[pre-selection]). Normalization for sequence logos was performed as previously described22.
Cellular Cleavage Assays.
HEK293T cells were split at a density of 0.8×105 per well (6-well plate) before transcription and maintained in Dulbecco's modified eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) in a 37° C. humidified incubator with 5% CO2. After 1 day, cells were transiently transfected using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocols. HEK293T cells were transfected at 70% confluency in each well of 6-well plate with 1.0 μg of the Cas9 expression plasmid (Cas9-HA-2×NLS-GFP-NLS) and 2.5 μg of the single-strand RNA expression plasmid pSiliencer-CLTA (version 1.0 or 2.1). The transfection efficiencies were estimated to be ˜70%, based on the fraction of GFP-positive cells observed by fluorescence microscopy. 48 h after transfection, cells were washed with phosphate buffered saline (PBS), pelleted and frozen at −80° C. Genomic DNA was isolated from 200 μL cell lysate using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer's protocol.
Off-Target Site Sequence Determination.
100 ng genomic DNA isolated from cells treated with Cas9 expression plasmid and single-strand RNA expression plasmid (treated cells) or Cas9 expression plasmid alone (control cells) were amplified by PCR with 10 s 72° C. extension for 35 cycles with primers CLTA(#)-(#)-(#) fwd and CLTA(#)-(#)-(#) rev and Phusion Hot Start Flex DNA Polymerase (NEB) in Buffer GC (NEB), supplemented with 3% DMSO. Relative amounts of crude PCR products were quantified by gel, and Cas9-treated (control) and Cas9:sgRNA-treated PCRs were separately pooled in equimolar concentrations before purification with the QIAquick PCR Purification Kit (Qiagen). Purified DNA was amplified by PCR with primers PE1-barcode# and PE2-barcode# for 7 cycles with Phusion Hot Start Flex DNA Polymerase (NEB) in Buffer HF (NEB). Amplified control and treated DNA pools were purified with the QIAquick PCR Purification Kit (Qiagen), followed by purification with Agencourt AMPure XP (Beckman Coulter). Purified control and treated DNAs were quantified with the KAPA Library Quantification Kit-Illumina (KAPA Biosystems), pooled in a 1:1 ratio, and subjected to paired-end sequencing on an Illumina MiSeq.
Statistical Analysis.
Statistical analysis was performed as previously described21. P-values in Table 1 and Table 6 were calculated for a one-sided Fisher exact test.
Algorithms
All scripts were written in C++. Algorithms used in this study are as previous reported (reference) with modification.
Sequence Binning.
1) designate sequence pairs starting with the barcode “AACA” or “TTCA” as post-selection library members. 2) for post-selection library members (with illustrated example):
example read:
AACA
CATGGGTCGACACAAACACAA
CTCGGCAGGTACTTGCAGATGTAGT
i) search both paired reads for the positions, pos1 and pos2, of the constant sequence “CTCGGCAGGT” (SEQ ID NO:43). ii) keep only sequences that have identical sequences between the barcode and pos1 and preceding pos2. iii) keep the region between the two instances of the constant sequence (the region between the barcode and pos1 contains a cut half-site; the region that is between the two instances of the constant sequence contains a full site)
example:
ii) search the sequence for a selection barcode
for CLTA1,
for CLTA2,
for CLTA3,
for CLTA4)
example:
iii) the sequence before the barcode is the full post-selection library member (first four and last four nucleotides are fully randomized flanking sequence)
example:
iv) parse the quality scores for the positions corresponding to the 23 nucleotide post-selection library member
example read:
CTTTCCACATGGGTCGACACAAACACAACTCGGCAGGTATCTCGTATGCC
IIJJJHHHGHAEFCDDDDDDDDDDDDDDDDDDDDDDD?CDDEDD@DCCCD
v) keep sequences only if the corresponding quality score string (underlined) FASTQ quality characters for the sequence are ‘?’ or higher in ASCII code (Phred quality score>=30)
NHEJ Sequence Calling
example read:
GTGCACTGAAGAGCCA
CCCTGTGAAACACTACATCTGC
AATATCTTAATC
CTACTCAGTGAAGCTCTTCACAGTCATTGGATTAATTATGTTGAGTTCTT
example quality scores:
1) identify the 20 base pairs flanking both sides of 20 base pair target site+three base pair PAM for each target site
example flanking sequences:
GCTGGTGCACTGAAGAGCCA
AATATCTTAATCCTACTCAG
2) search all sequence reads for the flanking sequences to identify the potential off-target site (the sequence between the flanking sequences)
example potential off-target site:
CCCTGTGAAACACTACATCTGC
3) if the potential off-target site contains indels (length is less than 23), keep sequence as potential off-target site if all corresponding FASTQ quality characters for the sequence are ‘?’ or higher in ASCII code (Phred quality score>=30)
example potential off-target site length=22
example corresponding FASTQ quality characters:
4) bin and manually inspect all sequences that pass steps 2 and 3 and keep sequences as potential modified sequences if they have at least one deletion involving position 16, 17, or 18 (of 20 counting from the non-PAM end) of if they have an insertion between position 17 and 18, consistent with the most frequent modifications observed for the intended target site (
example potential off-target site (reverse complement, with positions labeled) with reference sequence:
GCAGATGTAGTGTTTC-ACAGGG
GCAGATGTAGTGTTTCCACAGGG
4) repeat steps 1-3 for read2 and keep only if the sequence is the same
5) compare overall counts in Cas9+sgRNA treated sample to Cas9 alone sample to identify modified sites
Filter Based on Cleavage Site (for Post-Selection Sequences)
1) tabulate the cleavage site locations across the recognition site by identifying the first position in the full sequenced recognition site (between the two constant sequences) that is identical to the first position in the sequencing read after the barcode (before the first constant sequence).
2) after tabulation, repeat step 1, keeping only sequences with cleavage site locations that are present in at least 5% of the sequencing reads.
Results
Broad Off-Target DNA Cleavage Profiling Reveals RNA Programmed Cas9 Nuclease Specificity.
Sequence-specific endonucleases including zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) have become important tools to modify genes in induced pluripotent stem cells (iPSCs),1-3 in multi-cellular organisms,4-8 and in ex vivo gene therapy clinical trials.9, 10 Although ZFNs and TALENs have proved effective for such genetic manipulation, a new ZFN or TALEN protein must be generated for each DNA target site. In contrast, the RNA-guided Cas9 endonuclease uses RNA:DNA hybridization to determine target DNA cleavage sites, enabling a single monomeric protein to cleave, in principle, any sequence specified by the guide RNA.11
Previous studies12-17 demonstrated that Cas9 mediates genome editing at sites complementary to a 20-nucleotide sequence in a bound guide RNA. In addition, target sites must include a protospacer adjacent motif (PAM) at the 3′ end adjacent to the 20-nucleotide target site; for Streptococcus pyogenes Cas9, the PAM sequence is NGG. Cas9-mediated DNA cleavage specificity both in vitro and in cells has been inferred previously based on assays against small collections of potential single-mutation off-target sites. These studies suggested that perfect complementarity between guide RNA and target DNA is required in the 7-12 base pairs adjacent to the PAM end of the target site (3′ end of the guide RNA) and mismatches are tolerated at the non-PAM end (5′ end of the guide RNA).11, 12, 17-19
Although such a limited number of nucleotides specifying Cas9:guide RNA target recognition would predict multiple sites of DNA cleavage in genomes of moderate to large size (>˜107 bp), Cas9:guide RNA complexes have been successfully used to modify both cells12, 13, 15 and organisms.14 A study using Cas9:guide RNA complexes to modify zebrafish embryos observed toxicity at a rate similar to that of ZFNs and TALENs.14 A recent, broad study of the specificity of DNA binding (transcriptional repression) in E. coli of a catalytically inactive Cas9 mutant using high-throughput sequencing found no detectable off-target transcriptional repression in the relatively small E. coli transcriptome.20 While these studies have substantially advanced our basic understanding of Cas9, a systematic and comprehensive profile of Cas9:guide RNA-mediated DNA cleavage specificity generated from measurements of Cas9 cleavage on a large number of related mutant target sites has not been described. Such a specificity profile is needed to understand and improve the potential of Cas9:guide RNA complexes as research tools and future therapeutic agents.
We modified our previously published in vitro selection,21 adapted to process the blunt-ended cleavage products produced by Cas9 compared to the overhang-containing products of ZFN cleavage, to determine the off-target DNA cleavage profiles of Cas9:single guide RNA (sgRNA)11 complexes. Each selection experiment used DNA substrate libraries containing ˜1012 sequences, a size sufficiently large to include ten-fold coverage of all sequences with eight or fewer mutations relative to each 22-base pair target sequence (including the two-base pair PAM) (
Pre-selection libraries of 1012 individual potential off-target sites were generated for each of four different target sequences in the human clathrin light chain A (CLTA) gene (
Pre-selection libraries were incubated under enzyme-limiting conditions (200 nM target site library, 100 nM Cas9:sgRNA v2.1) or enzyme-saturating conditions (200 nM target site library, 1000 nM Cas9:sgRNA v2.1) for each of the four guide RNAs targets tested (CLTA1, CLTA2, CLTA3, and CLTA4) (
Pre- and Post-Selection Library Composition.
The pre-selection libraries for CLTA1, CLTA2, CLTA3, and CLTA4 had observed mean mutation rates of 4.82 (n=1,129,593), 5.06 (n=847,618), 4.66 (n=692,997), and 5.00 (n=951,503) mutations per 22-base pair target site, including the two-base pair PAM, respectively. The post-selection libraries treated under enzyme-limiting conditions with Cas9 plus CLTA1, CLTA2, CLTA3, or CLTA4 v.2.1 sgRNAs contained means of 1.14 (n=1,206,268), 1.21 (n=668,312), 0.91 (n=1,138,568), and 1.82 (n=560,758) mutations per 22-base pair target site. Under enzyme-excess conditions, the mean number of mutations among sequences surviving selection increased to 1.61 (n=640,391), 1.86 (n=399,560), 1.46 (n=936,414), and 2.24 (n=506,179) mutations per 22-base pair target site, respectively, for CLTA1, CLTA2, CLTA3, or CLTA4 v2.1 sgRNAs. These results reveal that the selection significantly enriched library members with fewer mutations for all Cas9:sgRNA complexes tested, and that enzyme-excess conditions resulted in the putative cleavage of more highly mutated library members compared with enzyme-limiting conditions (
We calculated specificity scores to quantify the enrichment level of each base pair at each position in the post-selection library relative to the pre-selection library, normalized to the maximum possible enrichment of that base pair. Positive specificity scores indicate base pairs that were enriched in the post-selection library and negative specificity scores indicate base pairs that were de-enriched in the post-selection library. For example, a score of +0.5 indicates that a base pair is enriched to 50% of the maximum enrichment value, while a score of −0.5 indicates that a base pair is de-enriched to 50% of the maximum de-enrichment value.
In addition to the two base pairs specified by the PAM, all 20 base pairs targeted by the guide RNA were enriched in the sequences from the CLTA1 and CLTA2 selections (
All single-mutant pre-selection (n≥14,569) and post-selection library members (n≥103,660) were computationally analyzed to provide a selection enrichment value for every possible single-mutant sequence. The results of this analysis (
Specificity at the Non-PAM End of the Target Site.
To assess the ability of Cas9:v2.1 sgRNA under enzyme-excess conditions to tolerate multiple mutations distal to the PAM, we calculated maximum specificity scores at each position for sequences that contained mutations only in the region of one to 12 base pairs at the end of the target site most distal from the PAM (
The results of this analysis show no selection (maximum specificity score˜0) against sequences with up to three mutations, depending on the target site, at the end of the molecule farthest from the PAM when the rest of the sequence contains no mutations. For example, when only the three base pairs farthest from the PAM are allowed to vary (indicated by dark bars in
We also calculated the distribution of mutations (
Specificity at the PAM End of the Target Site.
We plotted positional specificity as the sum of the magnitudes of the specificity scores for all four base pairs at each position of each target site, normalized to the same sum for the most highly specified position (
Importantly, the selection results also reveal that the choice of guide RNA hairpin affects specificity. The shorter, less-active sgRNA v1.0 constructs are more specific than the longer, more-active sgRNA v2.1 constructs when assayed under identical, enzyme-saturating conditions that reflect an excess of enzyme relative to substrate in a cellular context (
Effects of Cas9:sgRNA Concentration on DNA Cleavage Specificity.
To assess the effect of enzyme concentration on patterns of specificity for the four target sites tested, we calculated the concentration-dependent difference in positional specificity and compared it to the maximal possible change in positional specificity (
Specificity of PAM Nucleotides.
To assess the contribution of the PAM to specificity, we calculated the abundance of all 16 possible PAM dinucleotides in the pre-selection and post-selection libraries, considering all observed post-selection target site sequences (
To account for the pre-selection library distribution of PAM dinucleotides, we calculated specificity scores for the PAM dinucleotides (
To confirm that the in vitro selection results accurately reflect the cleavage behavior of Cas9 in vitro, we performed discrete cleavage assays of six CLTA4 off-target substrates containing one to three mutations in the target site. We calculated enrichment values for all sequences in the post-selection libraries for the Cas9:CLTA4 v2.1 sgRNA under enzyme-saturating conditions by dividing the abundance of each sequence in the post-selection library by the calculated abundance in the pre-selection library. Under enzyme-saturating conditions, the single one, two, and three mutation sequences with the highest enrichment values (27.5, 43.9, and 95.9) were cleaved to ≥71% completion (
To determine if results of the in vitro selection and in vitro cleavage assays pertain to Cas9:guide RNA activity in human cells, we identified 51 off-target sites (19 for CLTA1 and 32 for CLTA4) containing up to eight mutations that were both enriched in the in vitro selection and present in the human genome (Tables 3-5). We expressed Cas9:CLTA1 sgRNA v1.0, Cas9:CLTA1 sgRNA v2.1, Cas9:CLTA4 sgRNA v1.0, Cas9:CLTA4 sgRNA v2.1, or Cas9 without sgRNA in HEK293T cells by transient transfection and used genomic PCR and high-throughput DNA sequencing to look for evidence of Cas9:sgRNA modification at 46 of the 51 off-target sites as well as at the on-target loci; no specific amplified DNA was obtained for five of the 51 predicted off-target sites (three for CLTA1 and two for CLTA4).
Deep sequencing of genomic DNA isolated from HEK293T cells treated with Cas9:CLTA1 sgRNA or Cas9:CLTA4 sgRNA identified sequences evident of non-homologous end-joining (NHEJ) at the on-target sites and at five of the 49 tested off-target sites (CLTA1-1-1, CLTA1-2-2, CLTA4-3-1, CLTA4-3-3, and CLTA4-4-8) (Tables 1 and 6-8). The CLTA4 target site was modified by Cas9:CLTA4 v2.1 sgRNA at a frequency of 76%, while off-target sites, CLTA4-3-1 CLTA4-3-3, and CLTA4-4-8, were modified at frequencies of 24%, 0.47% and 0.73%, respectively. The CLTA1 target site was modified by Cas9:CLTA1 v2.1 sgRNA at a frequency of 0.34%, while off-target sites, CLTA1-1-1 and CLTA1-2-2, were modified at frequencies of 0.09% and 0.16%, respectively.
Under enzyme-saturating conditions with the v2.1 sgRNA, the two verified CLTA1 off-target sites, CLTA1-1-1 and CLTA1-2-2, were two of the three most highly enriched sequences identified in the in vitro selection. CLTA4-3-1 and CLTA4-3-3 were the highest and third-highest enriched sequences of the seven CLTA4 three-mutation sequences enriched in the in vitro selection that are also present in the genome. The in vitro selection enrichment values of the four-mutation sequences were not calculated, since 12 out of the 14 CLTA4 sequences in the genome containing four mutations, including CLTA4-4-8, were observed at a level of only one sequence count in the post-selection library. Taken together, these results confirm that several of the off-target substrates identified in the in vitro selection that are present in the human genome are indeed cleaved by Cas9:sgRNA complexes in human cells, and also suggest that the most highly enriched genomic off-target sequences in the selection are modified in cells to the greatest extent.
The off-target sites we identified in cells were among the most-highly enriched in our in vitro selection and contain up to four mutations relative to the intended target sites. While it is possible that heterochromatin or covalent DNA modifications could diminish the ability of a Cas9:guide RNA complex to access genomic off-target sites in cells, the identification of five out of 49 tested cellular off-target sites in this study, rather than zero or many, strongly suggests that Cas9-mediated DNA cleavage is not limited to specific targeting of only a 7-12-base pair target sequence, as suggested in recent studies.11, 12, 19
The cellular genome modification data are also consistent with the increase in specificity of sgRNA v1.0 compared to sgRNA v2.1 sgRNAs observed in the in vitro selection data and discrete assays. Although the CLTA1-2-2, CLTA4-3-3, and CLTA4-4-8 sites were modified by the Cas9-sgRNA v2.1 complexes, no evidence of modification at any of these three sites was detected in Cas9:sgRNA v1.0-treated cells. The CLTA4-3-1 site, which was modified at 32% of the frequency of on-target CLTA4 site modification in Cas9:v2.1 sgRNA-treated cells, was modified at only 0.5% of the on-target modification frequency in v1.0 sgRNA-treated cells, representing a 62-fold change in selectivity. Taken together, these results demonstrate that guide RNA architecture can have a significant influence on Cas9 specificity in cells. Our specificity profiling findings present an important caveat to recent and ongoing efforts to improve the overall DNA modification activity of Cas9:guide RNA complexes through guide RNA engineering.11, 15
Overall, the off-target DNA cleavage profiling of Cas9 and subsequent analyses show that (i) Cas9:guide RNA recognition extends to 18-20 specified target site base pairs and a two-base pair PAM for the four target sites tested; (ii) increasing Cas9:guide RNA concentrations can decrease DNA-cleaving specificity in vitro; (iii) using more active sgRNA architectures can increase DNA-cleavage specificity both in vitro and in cells but impair DNA-cleavage specificity both in vitro and in cells; and (iv) as predicted by our in vitro results, Cas9:guide RNA can modify off-target sites in cells with up to four mutations relative to the on-target site. Our findings provide key insights to our understanding of RNA-programmed Cas9 specificity, and reveal a previously unknown role for sgRNA architecture in DNA-cleavage specificity. The principles revealed in this study may also apply to Cas9-based effectors engineered to mediate functions beyond DNA cleavage.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the appended claims.
In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the claims or from relevant portions of the description is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of using the composition for any of the purposes disclosed herein are included, and methods of making the composition according to any of the methods of making disclosed herein or other methods known in the art are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps. It should be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, steps, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, steps, etc. For purposes of simplicity those embodiments have not been specifically set forth in haec verba herein. Thus for each embodiment of the invention that comprises one or more elements, features, steps, etc., the invention also provides embodiments that consist or consist essentially of those elements, features, steps, etc.
Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. It is also to be understood that unless otherwise indicated or otherwise evident from the context and/or the understanding of one of ordinary skill in the art, values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.
In addition, it is to be understood that any particular embodiment of the present invention may be explicitly excluded from any one or more of the claims. Where ranges are given, any value within the range may explicitly be excluded from any one or more of the claims. Any embodiment, element, feature, application, or aspect of the compositions and/or methods of the invention, can be excluded from any one or more claims. For purposes of brevity, all of the embodiments in which one or more elements, features, purposes, or aspects is excluded are not set forth explicitly herein.
Table 1. Cellular Modification Induced by Cas9:CLTA4 sgRNA.
33 human genomic DNA sequences were identified that were enriched in the Cas9:CLTA4 v2.1 sgRNA in vitro selections under enzyme-limiting or enzyme-saturating conditions. Sites shown with underline contain insertions or deletions (indels) that are consistent with significant Cas9:sgRNA-mediated modification in HEK293T cells. In vitro enrichment values for selections with Cas9:CLTA4 v1.0 sgRNA or Cas9:CLTA4 v2.1 sgRNA are shown for sequences with three or fewer mutations. Enrichment values were not calculated for sequences with four or more mutations due to low numbers of in vitro selection sequence counts. Modification frequencies (number of sequences with indels divided by total number of sequences) in HEK293T cells treated with Cas9 without sgRNA (“no sgRNA”), Cas9 with CLTA4 v1.0 sgRNA, or Cas9 with CLTA4 v2.1 sgRNA. P-values are listed for those sites that show significant modification in v1.0 sgRNA- or v2.1 sgRNA-treated cells compared to cells treated with Cas9 without sgRNA. “Not tested (n.t.)” indicates that PCR of the genomic sequence failed to provide specific amplification products.
Table 2: Raw Selection Sequence Counts.
Positions −4 to −1 are the four nucleotides preceding the 20-base pair target site. PAM1, PAM2, and PAM3 are the PAM positions immediately following the target site. Positions +4 to +7 are the four nucleotides immediately following the PAM.
Table 3: CLTA1 Genomic Off-Target Sequences.
20 human genomic DNA sequences were identified that were enriched in the Cas9:CLTA1 v2.1 sgRNA in vitro selections under enzyme-limiting or enzyme-excess conditions. “m” refers to number of mutations from on-target sequence with mutations shown in lower case. Sites shown with underline contain insertions or deletions (indels) that are consistent with significant Cas9:sgRNA-mediated modification in HEK293T cells. Human genome coordinates are shown for each site (assembly GRCh37). CLTA1-0-1 is present at two loci, and sequence counts were pooled from both loci. Sequence counts are shown for amplified and sequenced DNA for each site from HEK293T cells treated with Cas9 without sgRNA (“no sgRNA”), Cas9 with CLTA1 v1.0 sgRNA, or Cas9 with CLTA1 v2.1 sgRNA.
Table 4: CLTA4 Genomic Off-Target Sequences.
33 human genomic DNA sequences were identified that were enriched in the Cas9:CLTA4 v2.1 sgRNA in vitro selections under enzyme-limiting or enzyme-excess conditions. “m” refers to number of mutations from on-target sequence with mutations shown in lower case. Sites shown with underline contain insertions or deletions (indels) that are consistent with significant Cas9:sgRNA-mediated modification in HEK293T cells. Human genome coordinates are shown for each site (assembly GRCh37). Sequence counts are shown for amplified and sequenced DNA for each site from HEK293T cells treated with Cas9 without sgRNA (“no sgRNA”), Cas9 with CLTA4 v1.0 sgRNA, or Cas9 with CLTA4 v2.1 sgRNA.
Table 5: Genomic Coordinates of CLTA1 and CLTA4 Off-Target Sites.
54 human genomic DNA sequences were identified that were enriched in the Cas9:CLTA1 v2.1 sgRNA and Cas9:CLTA4 v2.1 sgRNA in vitro selections under enzyme-limiting or enzyme-excess conditions. Human genome coordinates are shown for each site (assembly GRCh37).
Table 6: Cellular Modification Induced by Cas9:CLTA1 sgRNA.
20 human genomic DNA sequences were identified that were enriched in the Cas9:CLTA1 v2.1 sgRNA in vitro selections under enzyme-limiting or enzyme-excess conditions. Sites shown with underline contain insertions or deletions (indels) that are consistent with significant Cas9:sgRNA-mediated modification in HEK293T cells. In vitro enrichment values for selections with Cas9:CLTA1 v1.0 sgRNA or Cas9:CLTA1 v2.1 sgRNA are shown for sequences with three or fewer mutations. Enrichment values were not calculated for sequences with four or more mutations due to low numbers of in vitro selection sequence counts. Modification frequencies (number of sequences with indels divided by total number of sequences) in HEK293T cells treated with Cas9 without sgRNA (“no sgRNA”), Cas9 with CLTA1 v1.0 sgRNA, or Cas9 with CLTA1 v2.1 sgRNA. P-values of sites that show significant modification in v1.0 sgRNA- or v2.1 sgRNA-treated cells compared to cells treated with Cas9 without sgRNA were 1.1E−05 (v1.0) and 6.9E−55 (v2.1) for CLTA1-0-1, 2.6E−03 (v1.0) and 2.0E−10 (v2.1) for CLTA1-1-1, and 4.6E−08 (v2.1) for CLTA1-2-2. P-values were calculated using a one-sided Fisher exact test. “Not tested (n.t.)” indicates that the site was not tested or PCR of the genomic sequence failed to provide specific amplification products.
Table 7: CLTA1 Genomic Off-Target Indel Sequences.
Insertion and deletion-containing sequences from cells treated with amplified and sequenced DNA for the on-target genomic sequence (CLTA1-0-1) and each modified off-target site from HEK293T cells treated with Cas9 without sgRNA (“no sgRNA”), Cas9 with CLTA1 v1.0 sgRNA, or Cas9 with CLTA1 v2.1 sgRNA. “ref” refers to the human genome reference sequence for each site, and the modified sites are listed below. Mutations relative to the on-target genomic sequence are shown in lowercase letters. Insertions and deletions are shown in underlined bold letters or dashes, respectively. Modification percentages are shown for those conditions (v1.0 sgRNA or v2.1 sgRNA) that show statistically significant enrichment of modified sequences compared to the control (no sgRNA).
Table 8: CLTA4 Genomic Off-Target Indel Sequences.
Insertion and deletion-containing sequences from cells treated with amplified and sequenced DNA for the on-target genomic sequence (CLTA4-0-1) and each modified off-target site from HEK293T cells treated with Cas9 without sgRNA (“no sgRNA”), Cas9 with CLTA4 v1.0 sgRNA, or Cas9 with CLTA4 v2.1 sgRNA. “ref” refers to the human genome reference sequence for each site, and the modified sites are listed below. Mutations relative to the on-target genomic sequence are shown in lowercase letters. Insertions and deletions are shown in underlined bold letters or dashes, respectively. Modification percentages are shown for those conditions (v1.0 sgRNA or v2.1 sgRNA) that show statistically significant enrichment of modified sequences compared to the control (no sgRNA).
Table 9: Oligonucleotides Used in this Study.
All oligonucleotides were purchased from Integrated DNA Technologies. An asterisk (*) indicates that the preceding nucleotide was incorporated as a hand mix of phosphoramidites consisting of 79 mol % of the phosphoramidite corresponding to the preceding nucleotide and 4 mol % of each of the other three canonical phosphoramidites. “/5Phos/” denotes a 5′ phosphate group installed during synthesis.
CLTA4-0-1
0
GCAGATGTAGTGTTTCCACAGGG
CLTA
20
7.95
0.021%
<1E−55
CLTA4-3-1
3
aCAtATGTAGTaTTTCCACAGGG
16.5
12.5
0.006%
0.055%
6.0E−04
<1E−55
CLTA4-3-3
3
cCAGATGTAGTaTTcCCACAGGG
CELF1
1.00
4.95
0.469%
2.5E−21
CLTA4-4-8
4
ctAGATGaAGTGcTTCCACATGG
CDK8
0.009%
0.013%
0.730%
9.70E−21
CLTA1-0-1
0
AGTCCTCATCTCCCTCAAGCAGG
2
58889
18
42683
178
52845
CLTA1-1-1
1
AGTCCTCAaCTCCCTCAACCACC
1
39804
29000
40588
CLTA1-2-2
2
AcTCCTCATCcCCCTCAAGCCGG
3
21267
20042
22579
CLTA4-0-1
0
GCAGATGTAGTGTTTCCACAGGG
6
29191
2005
18640
14970
19661
CLTA4-3-1
3
aCAtATGTAGTaTTTCCACAGGC
2
34165
20018
16082
CLTA4-3-3
3
cCAGATGTAGTaTTcCCACAGGG
0
16559
12007
11082
CLTA4-4-8
4
ctAGATGaAGTGcTTCCACATGC
1
10692
7609
8077
CLTA1-0-1
0
AGTCCTCATCTCCCTCAAGCAGG
CLTA
41.4
23.3
0.003%
0.042%
0.337%
CLTA1-1-1
1
AGTCCTCAaCTCCCTCAACCAGG
TUSC3
25.9
14
0.003%
0.031%
0.091%
CLTA1-2-2
2
AcTCCTCATCcCCCTCAAGCCGG
ACAN
29.2
18.8
0.014%
0.005%
0.146%
ACTTGAGTTTGTC
AGCAGG (SEQ ID
TCACCTTTGAATTTGCACAAGCGTGCA
AGCAG
TCAGAAAGAGAGAAACA
AGCAGG (SEQ ID
CGTTTCCACTCACCTTGCGCCGC
AGCAGG
TGCTGGTTCTGTCATTAATAAGTTGAA
AGCAGG
TGTTTATGCATATTCAGATAAGCAA
AGCAGG
All publications, patents and sequence database entries mentioned herein, including those items listed above, are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.
This application is a continuation of and claims priority under 35 U.S.C. § 120 to U.S. application Ser. No. 14/320,370, filed Jun. 30, 2014, which claims priority under 35 U.S.C. § 119(e) to U.S. provisional patent application, U.S. Ser. No. 61/864,289, filed Aug. 9, 2013, each of which is incorporated herein by reference.
This invention was made with Government support under grant numbers HR0011-11-2-0003 and N66001-12-C-4207, awarded by the Department of Defense. The Government has certain rights in the invention.
Number | Name | Date | Kind |
---|---|---|---|
4182449 | Kozlow | Jan 1980 | A |
4880635 | Janoff et al. | Nov 1989 | A |
4906477 | Kurono et al. | Mar 1990 | A |
4911928 | Wallach | Mar 1990 | A |
4917951 | Wallach | Apr 1990 | A |
4920016 | Allen et al. | Apr 1990 | A |
4921757 | Wheatley et al. | May 1990 | A |
5139941 | Muzyczka et al. | Aug 1992 | A |
5449639 | Wei et al. | Sep 1995 | A |
5780053 | Ashley et al. | Jul 1998 | A |
5835699 | Kimura | Nov 1998 | A |
5962313 | Podsakoff et al. | Oct 1999 | A |
6057153 | Shaji et al. | May 2000 | A |
6453242 | Eisenberg et al. | Sep 2002 | B1 |
6503717 | Case et al. | Jan 2003 | B2 |
6534261 | Cox, III et al. | Mar 2003 | B1 |
6599692 | Case et al. | Jul 2003 | B1 |
6607882 | Cox, III et al. | Aug 2003 | B1 |
6824978 | Cox, III et al. | Nov 2004 | B1 |
6933113 | Case et al. | Aug 2005 | B2 |
6979539 | Cox, III et al. | Dec 2005 | B2 |
7013219 | Case et al. | Mar 2006 | B2 |
7163824 | Cox, III et al. | Jan 2007 | B2 |
7479573 | Chu et al. | Jan 2009 | B2 |
7794931 | Breaker et al. | Sep 2010 | B2 |
7919277 | Russell et al. | Apr 2011 | B2 |
7993672 | Huang et al. | Aug 2011 | B2 |
8361725 | Russell et al. | Jan 2013 | B2 |
8394604 | Liu et al. | Mar 2013 | B2 |
8546553 | Terns et al. | Oct 2013 | B2 |
8569256 | Heyes et al. | Oct 2013 | B2 |
8680069 | de Fougerolles et al. | Mar 2014 | B2 |
8691750 | Constien et al. | Apr 2014 | B2 |
8697359 | Zhang | Apr 2014 | B1 |
8709466 | Coady et al. | Apr 2014 | B2 |
8728526 | Heller | May 2014 | B2 |
8748667 | Budzik et al. | Jun 2014 | B2 |
8758810 | Okada et al. | Jun 2014 | B2 |
8759103 | Kim et al. | Jun 2014 | B2 |
8759104 | Unciti-Broceta et al. | Jun 2014 | B2 |
8771728 | Huang et al. | Jul 2014 | B2 |
8790664 | Pitard et al. | Jul 2014 | B2 |
8795965 | Zhang | Aug 2014 | B2 |
8846578 | McCray et al. | Sep 2014 | B2 |
8993233 | Zhang et al. | Mar 2015 | B2 |
8999641 | Zhang et al. | Apr 2015 | B2 |
9068179 | Liu et al. | Jun 2015 | B1 |
9163284 | Liu et al. | Oct 2015 | B2 |
9228207 | Liu et al. | Jan 2016 | B2 |
9234213 | Wu | Jan 2016 | B2 |
9322006 | Liu et al. | Apr 2016 | B2 |
9322037 | Liu et al. | Apr 2016 | B2 |
9340799 | Liu et al. | May 2016 | B2 |
9340800 | Liu et al. | May 2016 | B2 |
9359599 | Liu et al. | Jun 2016 | B2 |
9388430 | Liu et al. | Jul 2016 | B2 |
9512446 | Joung et al. | Dec 2016 | B1 |
9526724 | Liu et al. | Dec 2016 | B2 |
9737604 | Liu et al. | Aug 2017 | B2 |
9816093 | Donohoue et al. | Nov 2017 | B1 |
9840690 | Karli et al. | Dec 2017 | B2 |
9840699 | Liu et al. | Dec 2017 | B2 |
9873907 | Zeiner et al. | Jan 2018 | B2 |
9879270 | Hittinger et al. | Jan 2018 | B2 |
9938288 | Kishi et al. | Apr 2018 | B1 |
9944933 | Storici et al. | Apr 2018 | B2 |
9982279 | Gill et al. | May 2018 | B1 |
9999671 | Liu et al. | Jun 2018 | B2 |
10059940 | Zhong | Aug 2018 | B2 |
10077453 | Liu et al. | Sep 2018 | B2 |
10113163 | Liu et al. | Oct 2018 | B2 |
10167457 | Liu et al. | Jan 2019 | B2 |
10227581 | Liu et al. | Mar 2019 | B2 |
20040003420 | Kuhn et al. | Jan 2004 | A1 |
20040115184 | Smith et al. | Jun 2004 | A1 |
20050222030 | Allison et al. | Oct 2005 | A1 |
20060088864 | Smolke et al. | Apr 2006 | A1 |
20060104984 | Littlefield et al. | May 2006 | A1 |
20060246568 | Honjo et al. | Nov 2006 | A1 |
20070264692 | Liu et al. | Nov 2007 | A1 |
20080124725 | Barrangou et al. | May 2008 | A1 |
20080182254 | Hall et al. | Jul 2008 | A1 |
20090130718 | Short | May 2009 | A1 |
20090234109 | Han et al. | Sep 2009 | A1 |
20100076057 | Sontheimer et al. | Mar 2010 | A1 |
20100093617 | Barrangou et al. | Apr 2010 | A1 |
20100104690 | Barrangou et al. | Apr 2010 | A1 |
20100316643 | Eckert et al. | Dec 2010 | A1 |
20110059160 | Essner et al. | Mar 2011 | A1 |
20110104787 | Church et al. | May 2011 | A1 |
20110189776 | Terns et al. | Aug 2011 | A1 |
20110217739 | Terns et al. | Sep 2011 | A1 |
20120129759 | Liu et al. | May 2012 | A1 |
20120141523 | Castado et al. | Jun 2012 | A1 |
20120244601 | Bertozzi et al. | Sep 2012 | A1 |
20120270273 | Zhang et al. | Oct 2012 | A1 |
20130117869 | Duchateau et al. | May 2013 | A1 |
20130130248 | Haurwitz et al. | May 2013 | A1 |
20130158245 | Russell et al. | Jun 2013 | A1 |
20130165389 | Schellenberger et al. | Jun 2013 | A1 |
20130309720 | Schultz et al. | Nov 2013 | A1 |
20130344117 | Mirosevich et al. | Dec 2013 | A1 |
20140004280 | Loomis et al. | Jan 2014 | A1 |
20140005269 | Ngwuluka et al. | Jan 2014 | A1 |
20140017214 | Cost | Jan 2014 | A1 |
20140018404 | Chen et al. | Jan 2014 | A1 |
20140044793 | Goll et al. | Feb 2014 | A1 |
20140065711 | Liu et al. | Mar 2014 | A1 |
20140068797 | Doudna et al. | Mar 2014 | A1 |
20140127752 | Zhou et al. | May 2014 | A1 |
20140141094 | Smyth et al. | May 2014 | A1 |
20140141487 | Feldman et al. | May 2014 | A1 |
20140186843 | Zhang et al. | Jul 2014 | A1 |
20140186958 | Zhang et al. | Jul 2014 | A1 |
20140234289 | Liu et al. | Aug 2014 | A1 |
20140248702 | Cong | Sep 2014 | A1 |
20140273037 | Wu | Sep 2014 | A1 |
20140273226 | Wu | Sep 2014 | A1 |
20140273230 | Chen et al. | Sep 2014 | A1 |
20140295556 | Joung et al. | Oct 2014 | A1 |
20140295557 | Joung et al. | Oct 2014 | A1 |
20140342456 | Mali et al. | Nov 2014 | A1 |
20140342457 | Mali et al. | Nov 2014 | A1 |
20140342458 | Mali et al. | Nov 2014 | A1 |
20140349400 | Jakimo et al. | Nov 2014 | A1 |
20140356867 | Peter et al. | Dec 2014 | A1 |
20140356956 | Church et al. | Dec 2014 | A1 |
20140356958 | Mali et al. | Dec 2014 | A1 |
20140356959 | Church et al. | Dec 2014 | A1 |
20140357523 | Zeiner et al. | Dec 2014 | A1 |
20140377868 | Joung et al. | Dec 2014 | A1 |
20150010526 | Liu et al. | Jan 2015 | A1 |
20150031089 | Lindstrom | Jan 2015 | A1 |
20150031132 | Church et al. | Jan 2015 | A1 |
20150031133 | Church et al. | Jan 2015 | A1 |
20150044191 | Liu et al. | Feb 2015 | A1 |
20150044192 | Liu et al. | Feb 2015 | A1 |
20150044772 | Zhao | Feb 2015 | A1 |
20150050699 | Siksnys et al. | Feb 2015 | A1 |
20150056177 | Liu et al. | Feb 2015 | A1 |
20150056629 | Guthrie-Honea | Feb 2015 | A1 |
20150064138 | Lu et al. | Mar 2015 | A1 |
20150064789 | Paschon et al. | Mar 2015 | A1 |
20150071898 | Liu et al. | Mar 2015 | A1 |
20150071899 | Liu et al. | Mar 2015 | A1 |
20150071900 | Liu et al. | Mar 2015 | A1 |
20150071901 | Liu et al. | Mar 2015 | A1 |
20150071902 | Liu et al. | Mar 2015 | A1 |
20150071903 | Liu et al. | Mar 2015 | A1 |
20150071906 | Liu et al. | Mar 2015 | A1 |
20150079680 | Bradley et al. | Mar 2015 | A1 |
20150079681 | Zhang | Mar 2015 | A1 |
20150098954 | Hyde et al. | Apr 2015 | A1 |
20150118216 | Liu et al. | Apr 2015 | A1 |
20150132269 | Orkin et al. | May 2015 | A1 |
20150140664 | Byrne et al. | May 2015 | A1 |
20150159172 | Miller et al. | Jun 2015 | A1 |
20150165054 | Liu et al. | Jun 2015 | A1 |
20150166980 | Liu et al. | Jun 2015 | A1 |
20150166981 | Liu et al. | Jun 2015 | A1 |
20150166982 | Liu et al. | Jun 2015 | A1 |
20150166984 | Liu et al. | Jun 2015 | A1 |
20150166985 | Liu et al. | Jun 2015 | A1 |
20150191744 | Wolfe et al. | Jul 2015 | A1 |
20150197759 | Xu et al. | Jul 2015 | A1 |
20150211058 | Carstens et al. | Jul 2015 | A1 |
20150218573 | Loque et al. | Aug 2015 | A1 |
20150225773 | Farmer et al. | Aug 2015 | A1 |
20150252358 | Maeder et al. | Sep 2015 | A1 |
20150307889 | Petolino et al. | Oct 2015 | A1 |
20150315252 | Haugwitz et al. | Nov 2015 | A1 |
20160015682 | Cawthorne et al. | Jan 2016 | A2 |
20160017393 | Jacobson et al. | Jan 2016 | A1 |
20160017396 | Cann et al. | Jan 2016 | A1 |
20160032292 | Storici et al. | Feb 2016 | A1 |
20160032353 | Braman et al. | Feb 2016 | A1 |
20160046952 | Hittinger et al. | Feb 2016 | A1 |
20160046961 | Jinek et al. | Feb 2016 | A1 |
20160046962 | May et al. | Feb 2016 | A1 |
20160053272 | Wurtzel et al. | Feb 2016 | A1 |
20160053304 | Wurtzel et al. | Feb 2016 | A1 |
20160074535 | Ranganathan et al. | Mar 2016 | A1 |
20160076093 | Shendure et al. | Mar 2016 | A1 |
20160090603 | Carnes et al. | Mar 2016 | A1 |
20160115488 | Zhang et al. | Apr 2016 | A1 |
20160138046 | Wu et al. | May 2016 | A1 |
20160186214 | Brouns et al. | Jun 2016 | A1 |
20160200779 | Liu et al. | Jul 2016 | A1 |
20160201040 | Liu et al. | Jul 2016 | A1 |
20160201089 | Gersbach et al. | Jul 2016 | A1 |
20160206566 | Lu et al. | Jul 2016 | A1 |
20160208243 | Zhang et al. | Jul 2016 | A1 |
20160208288 | Liu et al. | Jul 2016 | A1 |
20160215275 | Zhong | Jul 2016 | A1 |
20160215276 | Liu et al. | Jul 2016 | A1 |
20160215300 | May et al. | Jul 2016 | A1 |
20160244784 | Jacobson et al. | Aug 2016 | A1 |
20160244829 | Bang et al. | Aug 2016 | A1 |
20160272965 | Zhang et al. | Sep 2016 | A1 |
20160281072 | Zhang | Sep 2016 | A1 |
20160304846 | Liu et al. | Oct 2016 | A1 |
20160304855 | Stark et al. | Oct 2016 | A1 |
20160312304 | Sorrentino et al. | Oct 2016 | A1 |
20160333389 | Liu et al. | Nov 2016 | A1 |
20160340662 | Zhang et al. | Nov 2016 | A1 |
20160345578 | Barrangou et al. | Dec 2016 | A1 |
20160346360 | Quake et al. | Dec 2016 | A1 |
20160346361 | Quake et al. | Dec 2016 | A1 |
20160346362 | Quake et al. | Dec 2016 | A1 |
20160348074 | Quake et al. | Dec 2016 | A1 |
20160350476 | Quake et al. | Dec 2016 | A1 |
20160369262 | Reik et al. | Dec 2016 | A1 |
20170009242 | McKinley et al. | Jan 2017 | A1 |
20170014449 | Bangera et al. | Jan 2017 | A1 |
20170020922 | Wagner et al. | Jan 2017 | A1 |
20170037432 | Donohue et al. | Feb 2017 | A1 |
20170044520 | Liu et al. | Feb 2017 | A1 |
20170044592 | Peter et al. | Feb 2017 | A1 |
20170053729 | Kotani et al. | Feb 2017 | A1 |
20170058271 | Joung et al. | Mar 2017 | A1 |
20170058272 | Carter et al. | Mar 2017 | A1 |
20170058298 | Kennedy et al. | Mar 2017 | A1 |
20170073663 | Wang et al. | Mar 2017 | A1 |
20170073670 | Nishida et al. | Mar 2017 | A1 |
20170087224 | Quake et al. | Mar 2017 | A1 |
20170087225 | Quake et al. | Mar 2017 | A1 |
20170088587 | Quake et al. | Mar 2017 | A1 |
20170088828 | Quake et al. | Mar 2017 | A1 |
20170107536 | Zhang et al. | Apr 2017 | A1 |
20170107560 | Peter et al. | Apr 2017 | A1 |
20170114367 | Chen et al. | Apr 2017 | A1 |
20170121693 | Liu et al. | May 2017 | A1 |
20170145394 | Yeo et al. | May 2017 | A1 |
20170145405 | Tang et al. | May 2017 | A1 |
20170145438 | Kantor | May 2017 | A1 |
20170152528 | Zhang | Jun 2017 | A1 |
20170152787 | Kubo et al. | Jun 2017 | A1 |
20170159033 | Kamtekar et al. | Jun 2017 | A1 |
20170166928 | Vyas et al. | Jun 2017 | A1 |
20170175104 | Doudna et al. | Jun 2017 | A1 |
20170175142 | Zhang et al. | Jun 2017 | A1 |
20170191047 | Terns et al. | Jul 2017 | A1 |
20170191078 | Zhang et al. | Jul 2017 | A1 |
20170198269 | Zhang et al. | Jul 2017 | A1 |
20170198277 | Kmiec et al. | Jul 2017 | A1 |
20170198302 | Feng et al. | Jul 2017 | A1 |
20170226522 | Hu et al. | Aug 2017 | A1 |
20170233703 | Xie et al. | Aug 2017 | A1 |
20170233756 | Begemann et al. | Aug 2017 | A1 |
20170247671 | Yung et al. | Aug 2017 | A1 |
20170247703 | Sloan et al. | Aug 2017 | A1 |
20170268022 | Liu et al. | Sep 2017 | A1 |
20170283797 | Robb et al. | Oct 2017 | A1 |
20170314016 | Kim et al. | Nov 2017 | A1 |
20170362635 | Chamberlain et al. | Dec 2017 | A1 |
20180064077 | Dunham et al. | Mar 2018 | A1 |
20180066258 | Powell | Mar 2018 | A1 |
20180068062 | Zhang et al. | Mar 2018 | A1 |
20180073012 | Liu et al. | Mar 2018 | A1 |
20180100147 | Yates et al. | Apr 2018 | A1 |
20180105867 | Xiao et al. | Apr 2018 | A1 |
20180119118 | Lu et al. | May 2018 | A1 |
20180127780 | Liu et al. | May 2018 | A1 |
20180155720 | Donohoue et al. | Jun 2018 | A1 |
20180163213 | Aneja et al. | Jun 2018 | A1 |
20180170984 | Harris et al. | Jun 2018 | A1 |
20180179503 | Maianti et al. | Jun 2018 | A1 |
20180179547 | Zhang et al. | Jun 2018 | A1 |
20180201921 | Malcolm | Jul 2018 | A1 |
20180230464 | Zhong | Aug 2018 | A1 |
20180230471 | Storici et al. | Aug 2018 | A1 |
20180236081 | Liu et al. | Aug 2018 | A1 |
20180237787 | Maianti et al. | Aug 2018 | A1 |
20180245066 | Yao et al. | Aug 2018 | A1 |
20180265864 | Li et al. | Sep 2018 | A1 |
20180273939 | Yu et al. | Sep 2018 | A1 |
20180282722 | Jakimo et al. | Oct 2018 | A1 |
20180305688 | Zhong | Oct 2018 | A1 |
20180305704 | Zhang | Oct 2018 | A1 |
20180312825 | Liu et al. | Nov 2018 | A1 |
20180312828 | Liu et al. | Nov 2018 | A1 |
20180312835 | Yao et al. | Nov 2018 | A1 |
20180327756 | Zhang et al. | Nov 2018 | A1 |
20190093099 | Liu et al. | Mar 2019 | A1 |
Number | Date | Country |
---|---|---|
2012244264 | Nov 2012 | AU |
2015252023 | Nov 2015 | AU |
2015101792 | Jan 2016 | AU |
112015013786 | Jul 2017 | BR |
2894668 | Jun 2014 | CA |
2894681 | Jun 2014 | CA |
2894684 | Jun 2014 | CA |
2 852 293 | Nov 2015 | CA |
1069962 | Mar 1993 | CN |
103224947 | Jul 2013 | CN |
103233028 | Aug 2013 | CN |
103388006 | Nov 2013 | CN |
103614415 | Mar 2014 | CN |
103642836 | Mar 2014 | CN |
103668472 | Mar 2014 | CN |
103820441 | May 2014 | CN |
103820454 | May 2014 | CN |
103911376 | Jul 2014 | CN |
103923911 | Jul 2014 | CN |
103981211 | Aug 2014 | CN |
103981212 | Aug 2014 | CN |
104004778 | Aug 2014 | CN |
104004782 | Aug 2014 | CN |
104017821 | Sep 2014 | CN |
104109687 | Oct 2014 | CN |
104178461 | Dec 2014 | CN |
104480144 | Jan 2015 | CN |
104342457 | Feb 2015 | CN |
104450774 | Mar 2015 | CN |
104498493 | Apr 2015 | CN |
104504304 | Apr 2015 | CN |
104531704 | Apr 2015 | CN |
104531705 | Apr 2015 | CN |
104560864 | Apr 2015 | CN |
104561095 | Apr 2015 | CN |
104593418 | May 2015 | CN |
104593422 | May 2015 | CN |
104611370 | May 2015 | CN |
104651392 | May 2015 | CN |
104651398 | May 2015 | CN |
104651399 | May 2015 | CN |
104651401 | May 2015 | CN |
104673816 | Jun 2015 | CN |
104725626 | Jun 2015 | CN |
104726449 | Jun 2015 | CN |
104726494 | Jun 2015 | CN |
104745626 | Jul 2015 | CN |
104762321 | Jul 2015 | CN |
104805078 | Jul 2015 | CN |
104805099 | Jul 2015 | CN |
104805118 | Jul 2015 | CN |
104846010 | Aug 2015 | CN |
104894068 | Sep 2015 | CN |
104894075 | Sep 2015 | CN |
104928321 | Sep 2015 | CN |
104404036 | Nov 2015 | CN |
105039339 | Nov 2015 | CN |
105039399 | Nov 2015 | CN |
105063061 | Nov 2015 | CN |
105087620 | Nov 2015 | CN |
105112422 | Dec 2015 | CN |
105112445 | Dec 2015 | CN |
105112519 | Dec 2015 | CN |
105121648 | Dec 2015 | CN |
105132427 | Dec 2015 | CN |
105132451 | Dec 2015 | CN |
105177038 | Dec 2015 | CN |
105177126 | Dec 2015 | CN |
105210981 | Jan 2016 | CN |
105219799 | Jan 2016 | CN |
105238806 | Jan 2016 | CN |
105255937 | Jan 2016 | CN |
105274144 | Jan 2016 | CN |
105296518 | Feb 2016 | CN |
105296537 | Feb 2016 | CN |
105316324 | Feb 2016 | CN |
105316327 | Feb 2016 | CN |
105316337 | Feb 2016 | CN |
105331607 | Feb 2016 | CN |
105331608 | Feb 2016 | CN |
105331609 | Feb 2016 | CN |
105331627 | Feb 2016 | CN |
105400773 | Mar 2016 | CN |
105400779 | Mar 2016 | CN |
105400810 | Mar 2016 | CN |
105441451 | Mar 2016 | CN |
105462968 | Apr 2016 | CN |
105463003 | Apr 2016 | CN |
105463027 | Apr 2016 | CN |
105492608 | Apr 2016 | CN |
105492609 | Apr 2016 | CN |
105505976 | Apr 2016 | CN |
105505979 | Apr 2016 | CN |
105518134 | Apr 2016 | CN |
105518135 | Apr 2016 | CN |
105518137 | Apr 2016 | CN |
105518138 | Apr 2016 | CN |
105518139 | Apr 2016 | CN |
105518140 | Apr 2016 | CN |
105543228 | May 2016 | CN |
105543266 | May 2016 | CN |
105543270 | May 2016 | CN |
105567688 | May 2016 | CN |
105567689 | May 2016 | CN |
105567734 | May 2016 | CN |
105567735 | May 2016 | CN |
105567738 | May 2016 | CN |
105593367 | May 2016 | CN |
105594664 | May 2016 | CN |
105602987 | May 2016 | CN |
105624146 | Jun 2016 | CN |
105624187 | Jun 2016 | CN |
105646719 | Jun 2016 | CN |
105647922 | Jun 2016 | CN |
105647962 | Jun 2016 | CN |
105647968 | Jun 2016 | CN |
105647969 | Jun 2016 | CN |
105671070 | Jun 2016 | CN |
105671083 | Jun 2016 | CN |
105695485 | Jun 2016 | CN |
105779448 | Jul 2016 | CN |
105779449 | Jul 2016 | CN |
105802980 | Jul 2016 | CN |
105821039 | Aug 2016 | CN |
105821040 | Aug 2016 | CN |
105821049 | Aug 2016 | CN |
105821072 | Aug 2016 | CN |
105821075 | Aug 2016 | CN |
105821116 | Aug 2016 | CN |
105838733 | Aug 2016 | CN |
105861547 | Aug 2016 | CN |
105861552 | Aug 2016 | CN |
105861554 | Aug 2016 | CN |
105886498 | Aug 2016 | CN |
105886534 | Aug 2016 | CN |
105886616 | Aug 2016 | CN |
105907758 | Aug 2016 | CN |
105907785 | Aug 2016 | CN |
105925608 | Sep 2016 | CN |
105950560 | Sep 2016 | CN |
105950626 | Sep 2016 | CN |
105950633 | Sep 2016 | CN |
105950639 | Sep 2016 | CN |
105985985 | Oct 2016 | CN |
106011104 | Oct 2016 | CN |
106011104 | Oct 2016 | CN |
106011150 | Oct 2016 | CN |
106011167 | Oct 2016 | CN |
106011171 | Oct 2016 | CN |
106032540 | Oct 2016 | CN |
106047803 | Oct 2016 | CN |
106047877 | Oct 2016 | CN |
106047930 | Oct 2016 | CN |
106086008 | Nov 2016 | CN |
106086028 | Nov 2016 | CN |
106086061 | Nov 2016 | CN |
106086062 | Nov 2016 | CN |
106109417 | Nov 2016 | CN |
106119275 | Nov 2016 | CN |
106119283 | Nov 2016 | CN |
106148286 | Nov 2016 | CN |
106148370 | Nov 2016 | CN |
106148416 | Nov 2016 | CN |
106167525 | Nov 2016 | CN |
106167808 | Nov 2016 | CN |
106167810 | Nov 2016 | CN |
106167821 | Nov 2016 | CN |
106172238 | Dec 2016 | CN |
106190903 | Dec 2016 | CN |
106191057 | Dec 2016 | CN |
106191061 | Dec 2016 | CN |
106191062 | Dec 2016 | CN |
106191064 | Dec 2016 | CN |
106191071 | Dec 2016 | CN |
106191099 | Dec 2016 | CN |
106191107 | Dec 2016 | CN |
106191113 | Dec 2016 | CN |
106191114 | Dec 2016 | CN |
106191116 | Dec 2016 | CN |
106191124 | Dec 2016 | CN |
106222177 | Dec 2016 | CN |
106222193 | Dec 2016 | CN |
106222203 | Dec 2016 | CN |
106244555 | Dec 2016 | CN |
106244591 | Dec 2016 | CN |
106244609 | Dec 2016 | CN |
106282241 | Jan 2017 | CN |
106318934 | Jan 2017 | CN |
106318973 | Jan 2017 | CN |
106350540 | Jan 2017 | CN |
106367435 | Feb 2017 | CN |
106399306 | Feb 2017 | CN |
106399311 | Feb 2017 | CN |
106399360 | Feb 2017 | CN |
106399367 | Feb 2017 | CN |
106399375 | Feb 2017 | CN |
106399377 | Feb 2017 | CN |
106434651 | Feb 2017 | CN |
106434663 | Feb 2017 | CN |
106434688 | Feb 2017 | CN |
106434737 | Feb 2017 | CN |
106434748 | Feb 2017 | CN |
106434752 | Feb 2017 | CN |
106434782 | Feb 2017 | CN |
106446600 | Feb 2017 | CN |
106479985 | Mar 2017 | CN |
106480027 | Mar 2017 | CN |
106480036 | Mar 2017 | CN |
106480067 | Mar 2017 | CN |
106480080 | Mar 2017 | CN |
106480083 | Mar 2017 | CN |
106480097 | Mar 2017 | CN |
106544351 | Mar 2017 | CN |
106544353 | Mar 2017 | CN |
106544357 | Mar 2017 | CN |
106554969 | Mar 2017 | CN |
106566838 | Apr 2017 | CN |
106701763 | May 2017 | CN |
106701808 | May 2017 | CN |
106701818 | May 2017 | CN |
106701823 | May 2017 | CN |
106701830 | May 2017 | CN |
106754912 | May 2017 | CN |
106755026 | May 2017 | CN |
106755077 | May 2017 | CN |
106755088 | May 2017 | CN |
106755091 | May 2017 | CN |
106755097 | May 2017 | CN |
106755424 | May 2017 | CN |
106801056 | Jun 2017 | CN |
106834323 | Jun 2017 | CN |
106834341 | Jun 2017 | CN |
106834347 | Jun 2017 | CN |
106845151 | Jun 2017 | CN |
106868008 | Jun 2017 | CN |
106868031 | Jun 2017 | CN |
106906240 | Jun 2017 | CN |
106906242 | Jun 2017 | CN |
106916820 | Jul 2017 | CN |
106916852 | Jul 2017 | CN |
106939303 | Jul 2017 | CN |
106947750 | Jul 2017 | CN |
106947780 | Jul 2017 | CN |
106957830 | Jul 2017 | CN |
106957831 | Jul 2017 | CN |
106957844 | Jul 2017 | CN |
106957855 | Jul 2017 | CN |
106957858 | Jul 2017 | CN |
106967697 | Jul 2017 | CN |
106967726 | Jul 2017 | CN |
106978428 | Jul 2017 | CN |
106987570 | Jul 2017 | CN |
106987757 | Jul 2017 | CN |
107012164 | Aug 2017 | CN |
107012174 | Aug 2017 | CN |
107012213 | Aug 2017 | CN |
107012250 | Aug 2017 | CN |
107022562 | Aug 2017 | CN |
107034188 | Aug 2017 | CN |
107034218 | Aug 2017 | CN |
107034229 | Aug 2017 | CN |
107043775 | Aug 2017 | CN |
107043779 | Aug 2017 | CN |
107043787 | Aug 2017 | CN |
107043787 | Aug 2017 | CN |
107058320 | Aug 2017 | CN |
107058328 | Aug 2017 | CN |
107058358 | Aug 2017 | CN |
107058372 | Aug 2017 | CN |
107083392 | Aug 2017 | CN |
107099533 | Aug 2017 | CN |
107099850 | Aug 2017 | CN |
107119053 | Sep 2017 | CN |
107119071 | Sep 2017 | CN |
107129999 | Sep 2017 | CN |
107130000 | Sep 2017 | CN |
107142272 | Sep 2017 | CN |
107142282 | Sep 2017 | CN |
107177591 | Sep 2017 | CN |
107177595 | Sep 2017 | CN |
107177631 | Sep 2017 | CN |
107190006 | Sep 2017 | CN |
107190008 | Sep 2017 | CN |
107217042 | Sep 2017 | CN |
107217075 | Sep 2017 | CN |
107227307 | Oct 2017 | CN |
107227352 | Oct 2017 | CN |
107236737 | Oct 2017 | CN |
107236739 | Oct 2017 | CN |
107236741 | Oct 2017 | CN |
107245502 | Oct 2017 | CN |
107254485 | Oct 2017 | CN |
107266541 | Oct 2017 | CN |
107267515 | Oct 2017 | CN |
107287245 | Oct 2017 | CN |
107298701 | Oct 2017 | CN |
107299114 | Oct 2017 | CN |
107304435 | Oct 2017 | CN |
107312785 | Nov 2017 | CN |
107312793 | Nov 2017 | CN |
107312795 | Nov 2017 | CN |
107312798 | Nov 2017 | CN |
107326042 | Nov 2017 | CN |
107326046 | Nov 2017 | CN |
107354156 | Nov 2017 | CN |
107354173 | Nov 2017 | CN |
107356793 | Nov 2017 | CN |
107362372 | Nov 2017 | CN |
107365786 | Nov 2017 | CN |
107365804 | Nov 2017 | CN |
107384894 | Nov 2017 | CN |
107384922 | Nov 2017 | CN |
107384926 | Nov 2017 | CN |
107400677 | Nov 2017 | CN |
107418974 | Dec 2017 | CN |
107435051 | Dec 2017 | CN |
107435069 | Dec 2017 | CN |
107446922 | Dec 2017 | CN |
107446923 | Dec 2017 | CN |
107446924 | Dec 2017 | CN |
107446932 | Dec 2017 | CN |
107446951 | Dec 2017 | CN |
107446954 | Dec 2017 | CN |
107460196 | Dec 2017 | CN |
107460196 | Dec 2017 | CN |
107474129 | Dec 2017 | CN |
107475300 | Dec 2017 | CN |
107488649 | Dec 2017 | CN |
107502608 | Dec 2017 | CN |
107502618 | Dec 2017 | CN |
107513531 | Dec 2017 | CN |
107519492 | Dec 2017 | CN |
107523567 | Dec 2017 | CN |
107523583 | Dec 2017 | CN |
107541525 | Jan 2018 | CN |
107557373 | Jan 2018 | CN |
107557378 | Jan 2018 | CN |
107557381 | Jan 2018 | CN |
107557390 | Jan 2018 | CN |
107557393 | Jan 2018 | CN |
107557394 | Jan 2018 | CN |
107557455 | Jan 2018 | CN |
107574179 | Jan 2018 | CN |
107586777 | Jan 2018 | CN |
107586779 | Jan 2018 | CN |
107604003 | Jan 2018 | CN |
107619829 | Jan 2018 | CN |
107619829 | Jan 2018 | CN |
107619837 | Jan 2018 | CN |
107630006 | Jan 2018 | CN |
107630041 | Jan 2018 | CN |
107630042 | Jan 2018 | CN |
107630043 | Jan 2018 | CN |
107641631 | Jan 2018 | CN |
107653256 | Feb 2018 | CN |
107686848 | Feb 2018 | CN |
206970581 | Feb 2018 | CN |
107760652 | Mar 2018 | CN |
107760663 | Mar 2018 | CN |
107760684 | Mar 2018 | CN |
107760715 | Mar 2018 | CN |
107784200 | Mar 2018 | CN |
107794272 | Mar 2018 | CN |
107794276 | Mar 2018 | CN |
107815463 | Mar 2018 | CN |
107828738 | Mar 2018 | CN |
107828794 | Mar 2018 | CN |
107828826 | Mar 2018 | CN |
107828874 | Mar 2018 | CN |
107858346 | Mar 2018 | CN |
107858373 | Mar 2018 | CN |
107880132 | Apr 2018 | CN |
107881184 | Apr 2018 | CN |
107893074 | Apr 2018 | CN |
107893075 | Apr 2018 | CN |
107893076 | Apr 2018 | CN |
107893080 | Apr 2018 | CN |
107893086 | Apr 2018 | CN |
107904261 | Apr 2018 | CN |
107937427 | Apr 2018 | CN |
107937432 | Apr 2018 | CN |
107937501 | Apr 2018 | CN |
107974466 | May 2018 | CN |
107988229 | May 2018 | CN |
107988246 | May 2018 | CN |
107988256 | May 2018 | CN |
107988268 | May 2018 | CN |
108018316 | May 2018 | CN |
108034656 | May 2018 | CN |
108048466 | May 2018 | CN |
108102940 | Jun 2018 | CN |
108103092 | Jun 2018 | CN |
108103098 | Jun 2018 | CN |
108103586 | Jun 2018 | CN |
108148835 | Jun 2018 | CN |
108148837 | Jun 2018 | CN |
108148873 | Jun 2018 | CN |
108192956 | Jun 2018 | CN |
108251423 | Jul 2018 | CN |
108251451 | Jul 2018 | CN |
108251452 | Jul 2018 | CN |
108342480 | Jul 2018 | CN |
108359691 | Aug 2018 | CN |
108359712 | Aug 2018 | CN |
108384784 | Aug 2018 | CN |
108396027 | Aug 2018 | CN |
108410877 | Aug 2018 | CN |
108410906 | Aug 2018 | CN |
108410907 | Aug 2018 | CN |
108410911 | Aug 2018 | CN |
108424931 | Aug 2018 | CN |
108441519 | Aug 2018 | CN |
108441520 | Aug 2018 | CN |
108486108 | Sep 2018 | CN |
108486111 | Sep 2018 | CN |
108486145 | Sep 2018 | CN |
108486146 | Sep 2018 | CN |
108486154 | Sep 2018 | CN |
108486159 | Sep 2018 | CN |
108486234 | Sep 2018 | CN |
108504657 | Sep 2018 | CN |
108504685 | Sep 2018 | CN |
108504693 | Sep 2018 | CN |
108546712 | Sep 2018 | CN |
108546717 | Sep 2018 | CN |
108546718 | Sep 2018 | CN |
108559730 | Sep 2018 | CN |
108559732 | Sep 2018 | CN |
108559745 | Sep 2018 | CN |
108559760 | Sep 2018 | CN |
108570479 | Sep 2018 | CN |
108588071 | Sep 2018 | CN |
108588123 | Sep 2018 | CN |
108588128 | Sep 2018 | CN |
108588182 | Sep 2018 | CN |
108610399 | Oct 2018 | CN |
108611364 | Oct 2018 | CN |
108624622 | Oct 2018 | CN |
108642053 | Oct 2018 | CN |
108642055 | Oct 2018 | CN |
108642077 | Oct 2018 | CN |
108642078 | Oct 2018 | CN |
108642090 | Oct 2018 | CN |
108690844 | Oct 2018 | CN |
108707604 | Oct 2018 | CN |
108707620 | Oct 2018 | CN |
108707621 | Oct 2018 | CN |
108707628 | Oct 2018 | CN |
108707629 | Oct 2018 | CN |
108715850 | Oct 2018 | CN |
108728476 | Nov 2018 | CN |
108728486 | Nov 2018 | CN |
108753772 | Nov 2018 | CN |
108753783 | Nov 2018 | CN |
108753813 | Nov 2018 | CN |
108753817 | Nov 2018 | CN |
108753832 | Nov 2018 | CN |
108753835 | Nov 2018 | CN |
108753836 | Nov 2018 | CN |
108795902 | Nov 2018 | CN |
108822217 | Nov 2018 | CN |
108823248 | Nov 2018 | CN |
108823249 | Nov 2018 | CN |
108823291 | Nov 2018 | CN |
108841845 | Nov 2018 | CN |
108853133 | Nov 2018 | CN |
108866093 | Nov 2018 | CN |
108893529 | Nov 2018 | CN |
108913664 | Nov 2018 | CN |
108913691 | Nov 2018 | CN |
108913714 | Nov 2018 | CN |
108913717 | Nov 2018 | CN |
208034188 | Nov 2018 | CN |
2 604 255 | Jun 2013 | EP |
2840140 | Feb 2015 | EP |
2 966 170 | Jan 2016 | EP |
3 009 511 | Apr 2016 | EP |
3031921 | Jun 2016 | EP |
3045537 | Jul 2016 | EP |
3144390 | Mar 2017 | EP |
3199632 | Aug 2017 | EP |
3216867 | Sep 2017 | EP |
3252160 | Dec 2017 | EP |
2 528 177 | Jan 2016 | GB |
2 531 454 | Apr 2016 | GB |
2542653 | Mar 2017 | GB |
1208045 | Feb 2016 | HK |
2007-501626 | Feb 2007 | JP |
2008-515405 | May 2008 | JP |
2010-539929 | Dec 2010 | JP |
2011-081011 | Apr 2011 | JP |
2011-523353 | Aug 2011 | JP |
2012-525146 | Oct 2012 | JP |
2012-531909 | Dec 2012 | JP |
101584933 | Jan 2016 | KR |
20160133380 | Nov 2016 | KR |
20170037025 | Apr 2017 | KR |
20170037028 | Apr 2017 | KR |
101748575 | Jun 2017 | KR |
2018-0022465 | Mar 2018 | KR |
2016104674 | Aug 2017 | RU |
2634395 | Oct 2017 | RU |
2652899 | May 2018 | RU |
10201707569 | Oct 2017 | SG |
10201710486 | Jan 2018 | SG |
10201710487 | Jan 2018 | SG |
10201710488 | Jan 2018 | SG |
1608100 | Dec 2017 | TW |
2018-29773 | Aug 2018 | TW |
WO 2001036452 | May 2001 | WO |
WO 2001038547 | May 2001 | WO |
WO-2002059296 | Aug 2002 | WO |
WO 2002068676 | Sep 2002 | WO |
WO 2002103028 | Dec 2002 | WO |
WO 2004007684 | Jan 2004 | WO |
WO 2005014791 | Feb 2005 | WO |
WO 2006002547 | Jan 2006 | WO |
WO 2006042112 | Apr 2006 | WO |
WO 2007025097 | Mar 2007 | WO |
WO 2007136815 | Nov 2007 | WO |
WO 2007143574 | Dec 2007 | WO |
WO 2008108989 | Sep 2008 | WO |
WO 2010054108 | Nov 2008 | WO |
WO 2009134808 | Nov 2009 | WO |
WO 2010011961 | Jan 2010 | WO |
WO 2010054154 | May 2010 | WO |
WO 2010068289 | Jun 2010 | WO |
WO 2010075424 | Jul 2010 | WO |
WO 2010102257 | Sep 2010 | WO |
WO 2010129019 | Nov 2010 | WO |
WO 2010129023 | Nov 2010 | WO |
WO 2010144150 | Dec 2010 | WO |
WO 2011002503 | Jan 2011 | WO |
WO 2011017293 | Feb 2011 | WO |
WO 2011053868 | May 2011 | WO |
WO 2011053982 | May 2011 | WO |
WO 2011075627 | Jun 2011 | WO |
WO 2011091311 | Jul 2011 | WO |
WO 2011109031 | Sep 2011 | WO |
WO 2011143124 | Nov 2011 | WO |
WO 2012054726 | Apr 2012 | WO |
WO 2012065043 | May 2012 | WO |
WO 2012125445 | Sep 2012 | WO |
WO 2012138927 | Oct 2012 | WO |
WO 2012149470 | Nov 2012 | WO |
WO 2012158985 | Nov 2012 | WO |
WO 2012158986 | Nov 2012 | WO |
WO 2012164565 | Dec 2012 | WO |
WO 2013012674 | Jan 2013 | WO |
WO 2013013105 | Jan 2013 | WO |
WO 2013047844 | Apr 2013 | WO |
WO 2013066438 | May 2013 | WO |
WO-2013066438 | May 2013 | WO |
WO 2013098244 | Jul 2013 | WO |
WO 2013119602 | Aug 2013 | WO |
WO 2013126794 | Aug 2013 | WO |
WO 2013130824 | Sep 2013 | WO |
WO 2013141680 | Sep 2013 | WO |
WO 2013142378 | Sep 2013 | WO |
WO 2013142578 | Sep 2013 | WO |
WO 2013160230 | Oct 2013 | WO |
WO 2013166315 | Nov 2013 | WO |
WO 2013169398 | Nov 2013 | WO |
WO 2013169802 | Nov 2013 | WO |
WO 2013176772 | Nov 2013 | WO |
WO 2013176915 | Nov 2013 | WO |
WO 2013176916 | Nov 2013 | WO |
WO 2013181440 | Dec 2013 | WO |
WO 2013186754 | Dec 2013 | WO |
WO 2013188037 | Dec 2013 | WO |
WO 2013188522 | Dec 2013 | WO |
WO 2013188638 | Dec 2013 | WO |
WO 2013192278 | Dec 2013 | WO |
WO 2014005042 | Jan 2014 | WO |
WO 2014011237 | Jan 2014 | WO |
WO 2014011901 | Jan 2014 | WO |
WO 2014018423 | Jan 2014 | WO |
WO 2014020608 | Feb 2014 | WO |
WO 2014022120 | Feb 2014 | WO |
WO 2014022702 | Feb 2014 | WO |
WO 2014036219 | Mar 2014 | WO |
WO 2014039513 | Mar 2014 | WO |
WO 2014039523 | Mar 2014 | WO |
WO 2014039684 | Mar 2014 | WO |
WO 2014039692 | Mar 2014 | WO |
WO 2014039702 | Mar 2014 | WO |
WO 2014039872 | Mar 2014 | WO |
WO 2014039970 | Mar 2014 | WO |
WO 2014041327 | Mar 2014 | WO |
WO 2014043143 | Mar 2014 | WO |
WO 2014047103 | Mar 2014 | WO |
WO 2014059173 | Apr 2014 | WO |
WO 2014059255 | Apr 2014 | WO |
WO 2014065596 | May 2014 | WO |
WO 2014066505 | May 2014 | WO |
WO 2014068346 | May 2014 | WO |
WO 2014070887 | May 2014 | WO |
WO 2014071006 | May 2014 | WO |
WO 2014071219 | May 2014 | WO |
WO 2014071235 | May 2014 | WO |
WO 2014072941 | May 2014 | WO |
WO 2014081729 | May 2014 | WO |
WO 2014081730 | May 2014 | WO |
WO 2014081855 | May 2014 | WO |
WO 2014082644 | Jun 2014 | WO |
WO 2014085261 | Jun 2014 | WO |
WO 2014085593 | Jun 2014 | WO |
WO 2014085830 | Jun 2014 | WO |
WO 2014089212 | Jun 2014 | WO |
WO 2014089290 | Jun 2014 | WO |
WO 2014089348 | Jun 2014 | WO |
WO 2014089513 | Jun 2014 | WO |
WO 2014089533 | Jun 2014 | WO |
WO 2014089541 | Jun 2014 | WO |
WO 2014093479 | Jun 2014 | WO |
WO 2014093595 | Jun 2014 | WO |
WO 2014093622 | Jun 2014 | WO |
WO 2014093635 | Jun 2014 | WO |
WO 2014093655 | Jun 2014 | WO |
WO 2014093661 | Jun 2014 | WO |
WO 2014093694 | Jun 2014 | WO |
WO 2014093701 | Jun 2014 | WO |
WO 2014093709 | Jun 2014 | WO |
WO 2014093712 | Jun 2014 | WO |
WO 2014093718 | Jun 2014 | WO |
WO 2014093736 | Jun 2014 | WO |
WO 2014093768 | Jun 2014 | WO |
WO 2014093852 | Jun 2014 | WO |
WO 2014096972 | Jun 2014 | WO |
WO 2014099744 | Jun 2014 | WO |
WO 2014099750 | Jun 2014 | WO |
WO 2014104878 | Jul 2014 | WO |
WO 2014110006 | Jul 2014 | WO |
WO 2014110552 | Jul 2014 | WO |
WO 2014113493 | Jul 2014 | WO |
WO 2014123967 | Aug 2014 | WO |
WO 2014124226 | Aug 2014 | WO |
WO 2014125668 | Aug 2014 | WO |
WO 2014127287 | Aug 2014 | WO |
WO 2014128324 | Aug 2014 | WO |
WO 2014128659 | Aug 2014 | WO |
WO 2014130706 | Aug 2014 | WO |
WO 2014130955 | Aug 2014 | WO |
WO 2014131833 | Sep 2014 | WO |
WO 2014138379 | Sep 2014 | WO |
WO 2014143381 | Sep 2014 | WO |
WO 2014144094 | Sep 2014 | WO |
WO 2014144155 | Sep 2014 | WO |
WO 2014144288 | Sep 2014 | WO |
WO 2014144592 | Sep 2014 | WO |
WO 2014144761 | Sep 2014 | WO |
WO 2014144951 | Sep 2014 | WO |
WO 2014145599 | Sep 2014 | WO |
WO 2014145736 | Sep 2014 | WO |
WO 2014150624 | Sep 2014 | WO |
WO 2014152432 | Sep 2014 | WO |
WO 2014153118 | Sep 2014 | WO |
WO 2014153470 | Sep 2014 | WO |
WO 2014161821 | Oct 2014 | WO |
WO 2014164466 | Oct 2014 | WO |
WO 2014165177 | Oct 2014 | WO |
WO 2014165349 | Oct 2014 | WO |
WO 2014165612 | Oct 2014 | WO |
WO 2014165707 | Oct 2014 | WO |
WO 2014165825 | Oct 2014 | WO |
WO 2014172458 | Oct 2014 | WO |
WO 2014172470 | Oct 2014 | WO |
WO 2014172489 | Oct 2014 | WO |
WO 2014173955 | Oct 2014 | WO |
WO 2014182700 | Nov 2014 | WO |
WO 2014183071 | Nov 2014 | WO |
WO 2014184143 | Nov 2014 | WO |
WO 2014184741 | Nov 2014 | WO |
WO 2014184744 | Nov 2014 | WO |
WO 2014186585 | Nov 2014 | WO |
WO 2014186686 | Nov 2014 | WO |
WO 2014190181 | Nov 2014 | WO |
WO 2014191128 | Dec 2014 | WO |
WO 2014191518 | Dec 2014 | WO |
WO 2014191521 | Dec 2014 | WO |
WO 2014191525 | Dec 2014 | WO |
WO 2014191527 | Dec 2014 | WO |
WO 2014193583 | Dec 2014 | WO |
WO 2014194190 | Dec 2014 | WO |
WO 2014197568 | Dec 2014 | WO |
WO 2014197748 | Dec 2014 | WO |
WO 2014199358 | Dec 2014 | WO |
WO 2014200659 | Dec 2014 | WO |
WO 2014201015 | Dec 2014 | WO |
WO 2014204578 | Dec 2014 | WO |
WO 2014204723 | Dec 2014 | WO |
WO 2014204724 | Dec 2014 | WO |
WO 2014204725 | Dec 2014 | WO |
WO 2014204726 | Dec 2014 | WO |
WO 2014204727 | Dec 2014 | WO |
WO 2014204728 | Dec 2014 | WO |
WO 2014204729 | Dec 2014 | WO |
WO 2014205192 | Dec 2014 | WO |
WO 2014207043 | Dec 2014 | WO |
WO 2015002780 | Jan 2015 | WO |
WO 2015004241 | Jan 2015 | WO |
WO 2015006290 | Jan 2015 | WO |
WO 2015006294 | Jan 2015 | WO |
WO 2015006437 | Jan 2015 | WO |
WO 2015006498 | Jan 2015 | WO |
WO 2015006747 | Jan 2015 | WO |
WO 2015007194 | Jan 2015 | WO |
WO 2015010114 | Jan 2015 | WO |
WO 2015011483 | Jan 2015 | WO |
WO-2015013583 | Jan 2015 | WO |
WO 2015013583 | Jan 2015 | WO |
WO 2015017866 | Feb 2015 | WO |
WO 2015018503 | Feb 2015 | WO |
WO 2015021353 | Feb 2015 | WO |
WO 2015021426 | Feb 2015 | WO |
WO 2015021990 | Feb 2015 | WO |
WO 2015024017 | Feb 2015 | WO |
WO 2015024986 | Feb 2015 | WO |
WO 2015026883 | Feb 2015 | WO |
WO 2015026885 | Feb 2015 | WO |
WO 2015026886 | Feb 2015 | WO |
WO 2015026887 | Feb 2015 | WO |
WO 2015027134 | Feb 2015 | WO |
WO 2015028969 | Mar 2015 | WO |
WO 2015030881 | Mar 2015 | WO |
WO 2015031619 | Mar 2015 | WO |
WO 2015031775 | Mar 2015 | WO |
WO 2015032494 | Mar 2015 | WO |
WO 2015033293 | Mar 2015 | WO |
WO 2015034872 | Mar 2015 | WO |
WO 2015034885 | Mar 2015 | WO |
WO 2015035136 | Mar 2015 | WO |
WO 2015035139 | Mar 2015 | WO |
WO 2015035162 | Mar 2015 | WO |
WO 2015040075 | Mar 2015 | WO |
WO 2015040402 | Mar 2015 | WO |
WO 2015042585 | Mar 2015 | WO |
WO 2015048577 | Apr 2015 | WO |
WO 2015048690 | Apr 2015 | WO |
WO 2015048707 | Apr 2015 | WO |
WO 2015048801 | Apr 2015 | WO |
WO 2015049897 | Apr 2015 | WO |
WO 2015051191 | Apr 2015 | WO |
WO 2015052133 | Apr 2015 | WO |
WO 2015052231 | Apr 2015 | WO |
WO 2015052335 | Apr 2015 | WO |
WO 2015053995 | Apr 2015 | WO |
WO 2015054253 | Apr 2015 | WO |
WO 2015054315 | Apr 2015 | WO |
WO 2015057671 | Apr 2015 | WO |
WO 2015057834 | Apr 2015 | WO |
WO 2015057852 | Apr 2015 | WO |
WO 2015057976 | Apr 2015 | WO |
WO 2015057980 | Apr 2015 | WO |
WO 2015059265 | Apr 2015 | WO |
WO 2015065964 | May 2015 | WO |
WO 2015066119 | May 2015 | WO |
WO 2015066634 | May 2015 | WO |
WO 2015066636 | May 2015 | WO |
WO 2015066637 | May 2015 | WO |
WO 2015066638 | May 2015 | WO |
WO 2015066643 | May 2015 | WO |
WO 2015069682 | May 2015 | WO |
WO 2015070083 | May 2015 | WO |
WO 2015070193 | May 2015 | WO |
WO 2015070212 | May 2015 | WO |
WO 2015071474 | May 2015 | WO |
WO 2015073683 | May 2015 | WO |
WO 2015073867 | May 2015 | WO |
WO 2015073990 | May 2015 | WO |
WO 2015075056 | May 2015 | WO |
WO 2015075154 | May 2015 | WO |
WO 2015075175 | May 2015 | WO |
WO 2015075195 | May 2015 | WO |
WO 2015075557 | May 2015 | WO |
WO 2015077058 | May 2015 | WO |
WO 2015077290 | May 2015 | WO |
WO 2015077318 | May 2015 | WO |
WO 2015079056 | Jun 2015 | WO |
WO 2015079057 | Jun 2015 | WO |
WO 2015086795 | Jun 2015 | WO |
WO 2015086798 | Jun 2015 | WO |
WO 2015088643 | Jun 2015 | WO |
WO 2015089046 | Jun 2015 | WO |
WO 2015089077 | Jun 2015 | WO |
WO 2015089277 | Jun 2015 | WO |
WO 2015089351 | Jun 2015 | WO |
WO 2015089354 | Jun 2015 | WO |
WO 2015089364 | Jun 2015 | WO |
WO 2015089406 | Jun 2015 | WO |
WO 2015089419 | Jun 2015 | WO |
WO 2015089427 | Jun 2015 | WO |
WO 2015089462 | Jun 2015 | WO |
WO 2015089465 | Jun 2015 | WO |
WO 2015089473 | Jun 2015 | WO |
WO 2015089486 | Jun 2015 | WO |
WO 2015095804 | Jun 2015 | WO |
WO 2015099850 | Jul 2015 | WO |
WO 2015100929 | Jul 2015 | WO |
WO 2015103057 | Jul 2015 | WO |
WO 2015103153 | Jul 2015 | WO |
WO 2015105928 | Jul 2015 | WO |
WO 2015108993 | Jul 2015 | WO |
WO 2015109752 | Jul 2015 | WO |
WO 2015110474 | Jul 2015 | WO |
WO 2015112790 | Jul 2015 | WO |
WO 2015112896 | Jul 2015 | WO |
WO 2015113063 | Jul 2015 | WO |
WO 2015114365 | Aug 2015 | WO |
WO 2015115903 | Aug 2015 | WO |
WO 2015116686 | Aug 2015 | WO |
WO 2015116969 | Aug 2015 | WO |
WO 2015117021 | Aug 2015 | WO |
WO 2015117041 | Aug 2015 | WO |
WO 2015117081 | Aug 2015 | WO |
WO 2015118156 | Aug 2015 | WO |
WO 2015119941 | Aug 2015 | WO |
WO 2015121454 | Aug 2015 | WO |
WO 2015122967 | Aug 2015 | WO |
WO 2015123339 | Aug 2015 | WO |
WO 2015124715 | Aug 2015 | WO |
WO 2015124718 | Aug 2015 | WO |
WO 2015126927 | Aug 2015 | WO |
WO 2015127428 | Aug 2015 | WO |
WO 2015127439 | Aug 2015 | WO |
WO 2015129686 | Sep 2015 | WO |
WO 2015131101 | Sep 2015 | WO |
WO 2015133554 | Sep 2015 | WO |
WO 2015134812 | Sep 2015 | WO |
WO 2015136001 | Sep 2015 | WO |
WO 2015138510 | Sep 2015 | WO |
WO 2015138739 | Sep 2015 | WO |
WO 2015138855 | Sep 2015 | WO |
WO 2015138870 | Sep 2015 | WO |
WO 2015139008 | Sep 2015 | WO |
WO 2015139139 | Sep 2015 | WO |
WO 2015143046 | Sep 2015 | WO |
WO 2015143177 | Sep 2015 | WO |
WO 2015145417 | Oct 2015 | WO |
WO 2015148431 | Oct 2015 | WO |
WO 2015148670 | Oct 2015 | WO |
WO 2015148680 | Oct 2015 | WO |
WO 2015148761 | Oct 2015 | WO |
WO 2015148860 | Oct 2015 | WO |
WO 2015148863 | Oct 2015 | WO |
WO 2015153760 | Oct 2015 | WO |
WO 2015153780 | Oct 2015 | WO |
WO 2015153789 | Oct 2015 | WO |
WO 2015153791 | Oct 2015 | WO |
WO 2015153889 | Oct 2015 | WO |
WO 2015153940 | Oct 2015 | WO |
WO 2015155341 | Oct 2015 | WO |
WO 2015155686 | Oct 2015 | WO |
WO 2015157070 | Oct 2015 | WO |
WO 2015157534 | Oct 2015 | WO |
WO 2015159068 | Oct 2015 | WO |
WO 2015159086 | Oct 2015 | WO |
WO 2015159087 | Oct 2015 | WO |
WO 2015160683 | Oct 2015 | WO |
WO 2015161276 | Oct 2015 | WO |
WO 2015163733 | Oct 2015 | WO |
WO 2015164740 | Oct 2015 | WO |
WO 2015164748 | Oct 2015 | WO |
WO 2015165274 | Nov 2015 | WO |
WO 2015165275 | Nov 2015 | WO |
WO 2015165276 | Nov 2015 | WO |
WO 2015166272 | Nov 2015 | WO |
WO 2015167766 | Nov 2015 | WO |
WO 2015167956 | Nov 2015 | WO |
WO 2015168125 | Nov 2015 | WO |
WO 2015168158 | Nov 2015 | WO |
WO 2015168404 | Nov 2015 | WO |
WO 2015168547 | Nov 2015 | WO |
WO 2015168800 | Nov 2015 | WO |
WO 2015171603 | Nov 2015 | WO |
WO 2015171894 | Nov 2015 | WO |
WO 2015171932 | Nov 2015 | WO |
WO 2015172128 | Nov 2015 | WO |
WO 2015173436 | Nov 2015 | WO |
WO 2015175642 | Nov 2015 | WO |
WO 2015179540 | Nov 2015 | WO |
WO 2015183025 | Dec 2015 | WO |
WO 2015183026 | Dec 2015 | WO |
WO 2015183885 | Dec 2015 | WO |
WO 2015184259 | Dec 2015 | WO |
WO 2015184262 | Dec 2015 | WO |
WO 2015184268 | Dec 2015 | WO |
WO 2015188056 | Dec 2015 | WO |
WO 2015188065 | Dec 2015 | WO |
WO 2015188094 | Dec 2015 | WO |
WO 2015188109 | Dec 2015 | WO |
WO 2015188132 | Dec 2015 | WO |
WO 2015188135 | Dec 2015 | WO |
WO 2015188191 | Dec 2015 | WO |
WO 2015189693 | Dec 2015 | WO |
WO 2015191693 | Dec 2015 | WO |
WO 2015191899 | Dec 2015 | WO |
WO 2015191911 | Dec 2015 | WO |
WO 2015193858 | Dec 2015 | WO |
WO 2015195547 | Dec 2015 | WO |
WO 2015195621 | Dec 2015 | WO |
WO 2015195798 | Dec 2015 | WO |
WO 2015198020 | Dec 2015 | WO |
WO 2015200334 | Dec 2015 | WO |
WO 2015200378 | Dec 2015 | WO |
WO 2015200555 | Dec 2015 | WO |
WO 2015200805 | Dec 2015 | WO |
WO 2016001978 | Jan 2016 | WO |
WO 2016004010 | Jan 2016 | WO |
WO 2016007347 | Jan 2016 | WO |
WO 2016007604 | Jan 2016 | WO |
WO 2016007948 | Jan 2016 | WO |
WO 2016011080 | Jan 2016 | WO |
WO 2016011210 | Jan 2016 | WO |
WO 2016011428 | Jan 2016 | WO |
WO 2016012544 | Jan 2016 | WO |
WO 2016012552 | Jan 2016 | WO |
WO 2016014409 | Jan 2016 | WO |
WO 2016014565 | Jan 2016 | WO |
WO 2016014794 | Jan 2016 | WO |
WO 2016014837 | Jan 2016 | WO |
WO 2016016119 | Feb 2016 | WO |
WO 2016016358 | Feb 2016 | WO |
WO 2016019144 | Feb 2016 | WO |
WO 2016020399 | Feb 2016 | WO |
WO 2016021972 | Feb 2016 | WO |
WO 2016021973 | Feb 2016 | WO |
WO 2016022363 | Feb 2016 | WO |
WO 2016022866 | Feb 2016 | WO |
WO 2016022931 | Feb 2016 | WO |
WO 2016025131 | Feb 2016 | WO |
WO 2016025469 | Feb 2016 | WO |
WO 2016025759 | Feb 2016 | WO |
WO 2016026444 | Feb 2016 | WO |
WO 2016028682 | Feb 2016 | WO |
WO 2016028843 | Feb 2016 | WO |
WO 2016028887 | Feb 2016 | WO |
WO 2016033088 | Mar 2016 | WO |
WO 2016033230 | Mar 2016 | WO |
WO 2016033246 | Mar 2016 | WO |
WO 2016033298 | Mar 2016 | WO |
WO 2016035044 | Mar 2016 | WO |
WO 2016036754 | Mar 2016 | WO |
WO 2016037157 | Mar 2016 | WO |
WO 2016040030 | Mar 2016 | WO |
WO 2016040594 | Mar 2016 | WO |
WO 2016044182 | Mar 2016 | WO |
WO 2016044416 | Mar 2016 | WO |
WO 2016046635 | Mar 2016 | WO |
WO 2016049024 | Mar 2016 | WO |
WO 2016049163 | Mar 2016 | WO |
WO 2016049230 | Mar 2016 | WO |
WO 2016049251 | Mar 2016 | WO |
WO 2016049258 | Mar 2016 | WO |
WO 2016053397 | Apr 2016 | WO |
WO 2016054326 | Apr 2016 | WO |
WO 2016057061 | Apr 2016 | WO |
WO 2016057821 | Apr 2016 | WO |
WO 2016057835 | Apr 2016 | WO |
WO 2016057850 | Apr 2016 | WO |
WO 2016057951 | Apr 2016 | WO |
WO 2016057961 | Apr 2016 | WO |
WO 2016061073 | Apr 2016 | WO |
WO 2016061374 | Apr 2016 | WO |
WO 2016061481 | Apr 2016 | WO |
WO 2016061523 | Apr 2016 | WO |
WO-2016064894 | Apr 2016 | WO |
WO 2016069282 | May 2016 | WO |
WO 2016069283 | May 2016 | WO |
WO 2016069591 | May 2016 | WO |
WO 2016069910 | May 2016 | WO |
WO 2016069912 | May 2016 | WO |
WO 2016070037 | May 2016 | WO |
WO 2016070070 | May 2016 | WO |
WO 2016070129 | May 2016 | WO |
WO 2016072399 | May 2016 | WO |
WO 2016072936 | May 2016 | WO |
WO 2016073433 | May 2016 | WO |
WO 2016073559 | May 2016 | WO |
WO 2016073990 | May 2016 | WO |
WO 2016075662 | May 2016 | WO |
WO-2016076672 | May 2016 | WO |
WO 2016077273 | May 2016 | WO |
WO 2016077350 | May 2016 | WO |
WO 2016080097 | May 2016 | WO |
WO-2016080795 | May 2016 | WO |
WO 2016081923 | May 2016 | WO |
WO 2016081924 | May 2016 | WO |
WO 2016082135 | Jun 2016 | WO |
WO 2016083811 | Jun 2016 | WO |
WO 2016084084 | Jun 2016 | WO |
WO 2016084088 | Jun 2016 | WO |
WO 2016086177 | Jun 2016 | WO |
WO 2016089433 | Jun 2016 | WO |
WO 2016089866 | Jun 2016 | WO |
WO 2016089883 | Jun 2016 | WO |
WO 2016090385 | Jun 2016 | WO |
WO-2016094679 | Jun 2016 | WO |
WO 2016094845 | Jun 2016 | WO |
WO 2016094867 | Jun 2016 | WO |
WO 2016094872 | Jun 2016 | WO |
WO 2016094874 | Jun 2016 | WO |
WO 2016094880 | Jun 2016 | WO |
WO 2016094888 | Jun 2016 | WO |
WO 2016097212 | Jun 2016 | WO |
WO 2016097231 | Jun 2016 | WO |
WO 2016097751 | Jun 2016 | WO |
WO 2016099887 | Jun 2016 | WO |
WO 2016100272 | Jun 2016 | WO |
WO 2016100389 | Jun 2016 | WO |
WO 2016100568 | Jun 2016 | WO |
WO 2016100571 | Jun 2016 | WO |
WO 2016100951 | Jun 2016 | WO |
WO 2016100955 | Jun 2016 | WO |
WO 2016100974 | Jun 2016 | WO |
WO 2016103233 | Jun 2016 | WO |
WO 2016104716 | Jun 2016 | WO |
WO 2016106236 | Jun 2016 | WO |
WO-2016106239 | Jun 2016 | WO |
WO 2016106244 | Jun 2016 | WO |
WO 2016106338 | Jun 2016 | WO |
WO 2016108926 | Jul 2016 | WO |
WO 2016109255 | Jul 2016 | WO |
WO 2016109840 | Jul 2016 | WO |
WO 2016110214 | Jul 2016 | WO |
WO 2016110453 | Jul 2016 | WO |
WO 2016110511 | Jul 2016 | WO |
WO 2016110512 | Jul 2016 | WO |
WO-2016111546 | Jul 2016 | WO |
WO-2016112242 | Jul 2016 | WO |
WO 2016112351 | Jul 2016 | WO |
WO 2016112963 | Jul 2016 | WO |
WO 2016114972 | Jul 2016 | WO |
WO 2016115179 | Jul 2016 | WO |
WO 2016115326 | Jul 2016 | WO |
WO 2016115355 | Jul 2016 | WO |
WO 2016116032 | Jul 2016 | WO |
WO 2016120480 | Aug 2016 | WO |
WO 2016123071 | Aug 2016 | WO |
WO 2016123230 | Aug 2016 | WO |
WO 2016123243 | Aug 2016 | WO |
WO 2016123578 | Aug 2016 | WO |
WO 2016126747 | Aug 2016 | WO |
WO 2016130600 | Aug 2016 | WO |
WO 2016130697 | Aug 2016 | WO |
WO-2016131009 | Aug 2016 | WO |
WO 2016132122 | Aug 2016 | WO |
WO-2016133165 | Aug 2016 | WO |
WO 2016135507 | Sep 2016 | WO |
WO 2016135557 | Sep 2016 | WO |
WO 2016135558 | Sep 2016 | WO |
WO 2016135559 | Sep 2016 | WO |
WO 2016137774 | Sep 2016 | WO |
WO 2016137949 | Sep 2016 | WO |
WO 2016141224 | Sep 2016 | WO |
WO 2016141893 | Sep 2016 | WO |
WO 2016142719 | Sep 2016 | WO |
WO 2016145150 | Sep 2016 | WO |
WO 2016148994 | Sep 2016 | WO |
WO 2016149484 | Sep 2016 | WO |
WO 2016149547 | Sep 2016 | WO |
WO 2016150336 | Sep 2016 | WO |
WO 2016150855 | Sep 2016 | WO |
WO 2016154016 | Sep 2016 | WO |
WO 2016154579 | Sep 2016 | WO |
WO 2016154596 | Sep 2016 | WO |
WO 2016155482 | Oct 2016 | WO |
WO 2016161004 | Oct 2016 | WO |
WO 2016161207 | Oct 2016 | WO |
WO 2016161260 | Oct 2016 | WO |
WO 2016161380 | Oct 2016 | WO |
WO-2016161446 | Oct 2016 | WO |
WO 2016164356 | Oct 2016 | WO |
WO 2016164797 | Oct 2016 | WO |
WO 2016166340 | Oct 2016 | WO |
WO-2016167300 | Oct 2016 | WO |
WO 2016170484 | Oct 2016 | WO |
WO 2016172359 | Oct 2016 | WO |
WO 2016172727 | Oct 2016 | WO |
WO 2016174056 | Nov 2016 | WO |
WO 2016174151 | Nov 2016 | WO |
WO 2016174250 | Nov 2016 | WO |
WO 2016176191 | Nov 2016 | WO |
WO 2016176404 | Nov 2016 | WO |
WO 2016176690 | Nov 2016 | WO |
WO 2016177682 | Nov 2016 | WO |
WO 2016178207 | Nov 2016 | WO |
WO 2016179038 | Nov 2016 | WO |
WO 2016179112 | Nov 2016 | WO |
WO 2016181357 | Nov 2016 | WO |
WO 2016182893 | Nov 2016 | WO |
WO 2016182917 | Nov 2016 | WO |
WO 2016182959 | Nov 2016 | WO |
WO 2016183236 | Nov 2016 | WO |
WO 2016183298 | Nov 2016 | WO |
WO 2016183345 | Nov 2016 | WO |
WO 2016183402 | Nov 2016 | WO |
WO 2016183438 | Nov 2016 | WO |
WO 2016183448 | Nov 2016 | WO |
WO 2016184955 | Nov 2016 | WO |
WO 2016184989 | Nov 2016 | WO |
WO 2016185411 | Nov 2016 | WO |
WO 2016186745 | Nov 2016 | WO |
WO 2016186772 | Nov 2016 | WO |
WO 2016186946 | Nov 2016 | WO |
WO 2016186953 | Nov 2016 | WO |
WO 2016187717 | Dec 2016 | WO |
WO 2016187904 | Dec 2016 | WO |
WO 2016191684 | Dec 2016 | WO |
WO 2016191869 | Dec 2016 | WO |
WO 2016196273 | Dec 2016 | WO |
WO 2016196282 | Dec 2016 | WO |
WO 2016196308 | Dec 2016 | WO |
WO-2016196361 | Dec 2016 | WO |
WO 2016196499 | Dec 2016 | WO |
WO 2016196539 | Dec 2016 | WO |
WO 2016196655 | Dec 2016 | WO |
WO 2016196805 | Dec 2016 | WO |
WO 2016196887 | Dec 2016 | WO |
WO 2016197132 | Dec 2016 | WO |
WO 2016197133 | Dec 2016 | WO |
WO 2016197354 | Dec 2016 | WO |
WO 2016197355 | Dec 2016 | WO |
WO 2016197356 | Dec 2016 | WO |
WO 2016197357 | Dec 2016 | WO |
WO 2016197358 | Dec 2016 | WO |
WO 2016197359 | Dec 2016 | WO |
WO 2016197360 | Dec 2016 | WO |
WO 2016197361 | Dec 2016 | WO |
WO 2016197362 | Dec 2016 | WO |
WO 2016198361 | Dec 2016 | WO |
WO 2016198500 | Dec 2016 | WO |
WO 2016200263 | Dec 2016 | WO |
WO 2016201047 | Dec 2016 | WO |
WO 2016201138 | Dec 2016 | WO |
WO 2016201152 | Dec 2016 | WO |
WO 2016201153 | Dec 2016 | WO |
WO 2016201155 | Dec 2016 | WO |
WO 2016205276 | Dec 2016 | WO |
WO 2016205613 | Dec 2016 | WO |
WO 2016205623 | Dec 2016 | WO |
WO 2016205680 | Dec 2016 | WO |
WO 2016205688 | Dec 2016 | WO |
WO 2016205703 | Dec 2016 | WO |
WO 2016205711 | Dec 2016 | WO |
WO 2016205728 | Dec 2016 | WO |
WO 2016205745 | Dec 2016 | WO |
WO 2016205749 | Dec 2016 | WO |
WO 2016205759 | Dec 2016 | WO |
WO 2016205764 | Dec 2016 | WO |
WO 2017001572 | Jan 2017 | WO |
WO 2017001988 | Jan 2017 | WO |
WO 2017004261 | Jan 2017 | WO |
WO 2017004279 | Jan 2017 | WO |
WO 2017004616 | Jan 2017 | WO |
WO 2017005807 | Jan 2017 | WO |
WO 2017009399 | Jan 2017 | WO |
WO-2017010556 | Jan 2017 | WO |
WO 2017011519 | Jan 2017 | WO |
WO 2017011721 | Jan 2017 | WO |
WO 2017011804 | Jan 2017 | WO |
WO 2017015015 | Jan 2017 | WO |
WO 2017015101 | Jan 2017 | WO |
WO 2017015567 | Jan 2017 | WO |
WO 2017015637 | Jan 2017 | WO |
WO 2017017016 | Feb 2017 | WO |
WO 2017019867 | Feb 2017 | WO |
WO 2017019895 | Feb 2017 | WO |
WO 2017023803 | Feb 2017 | WO |
WO 2017023974 | Feb 2017 | WO |
WO 2017024047 | Feb 2017 | WO |
WO 2017024319 | Feb 2017 | WO |
WO 2017024343 | Feb 2017 | WO |
WO-2017024602 | Feb 2017 | WO |
WO 2017025323 | Feb 2017 | WO |
WO 2017027423 | Feb 2017 | WO |
WO 2017028768 | Feb 2017 | WO |
WO 2017029664 | Feb 2017 | WO |
WO 2017031360 | Feb 2017 | WO |
WO 2017031483 | Feb 2017 | WO |
WO 2017035416 | Mar 2017 | WO |
WO 2017040348 | Mar 2017 | WO |
WO 2017040511 | Mar 2017 | WO |
WO 2017040709 | Mar 2017 | WO |
WO 2017040786 | Mar 2017 | WO |
WO 2017040793 | Mar 2017 | WO |
WO 2017040813 | Mar 2017 | WO |
WO-2017043573 | Mar 2017 | WO |
WO-2017043656 | Mar 2017 | WO |
WO 2017044419 | Mar 2017 | WO |
WO 2017044776 | Mar 2017 | WO |
WO 2017044857 | Mar 2017 | WO |
WO 2017049129 | Mar 2017 | WO |
WO 2017050963 | Mar 2017 | WO |
WO 2017053312 | Mar 2017 | WO |
WO 2017053431 | Mar 2017 | WO |
WO 2017053713 | Mar 2017 | WO |
WO 2017053729 | Mar 2017 | WO |
WO 2017053753 | Mar 2017 | WO |
WO 2017053762 | Mar 2017 | WO |
WO 2017053879 | Mar 2017 | WO |
WO 2017054721 | Apr 2017 | WO |
WO 2017058658 | Apr 2017 | WO |
WO 2017059241 | Apr 2017 | WO |
WO 2017062605 | Apr 2017 | WO |
WO 2017062723 | Apr 2017 | WO |
WO 2017062754 | Apr 2017 | WO |
WO 2017062855 | Apr 2017 | WO |
WO 2017062886 | Apr 2017 | WO |
WO 2017062983 | Apr 2017 | WO |
WO 2017064439 | Apr 2017 | WO |
WO 2017064546 | Apr 2017 | WO |
WO 2017064566 | Apr 2017 | WO |
WO 2017066175 | Apr 2017 | WO |
WO 2017066497 | Apr 2017 | WO |
WO 2017066588 | Apr 2017 | WO |
WO 2017066707 | Apr 2017 | WO |
WO 2017068077 | Apr 2017 | WO |
WO 2017068377 | Apr 2017 | WO |
WO 2017069829 | Apr 2017 | WO |
WO 2017070029 | Apr 2017 | WO |
WO 2017070032 | Apr 2017 | WO |
WO 2017070169 | Apr 2017 | WO |
WO 2017070284 | Apr 2017 | WO |
WO 2017070598 | Apr 2017 | WO |
WO 2017070605 | Apr 2017 | WO |
WO 2017070632 | Apr 2017 | WO |
WO 2017070633 | Apr 2017 | WO |
WO 2017072590 | May 2017 | WO |
WO 2017074526 | May 2017 | WO |
WO 2017074962 | May 2017 | WO |
WO 2017075261 | May 2017 | WO |
WO 2017075335 | May 2017 | WO |
WO 2017075475 | May 2017 | WO |
WO 2017077135 | May 2017 | WO |
WO 2017077329 | May 2017 | WO |
WO 2017078751 | May 2017 | WO |
WO 2017079400 | May 2017 | WO |
WO 2017079428 | May 2017 | WO |
WO 2017079673 | May 2017 | WO |
WO 2017079724 | May 2017 | WO |
WO 2017081097 | May 2017 | WO |
WO 2017081288 | May 2017 | WO |
WO 2017083368 | May 2017 | WO |
WO 2017083722 | May 2017 | WO |
WO 2017083766 | May 2017 | WO |
WO 2017087395 | May 2017 | WO |
WO 2017090724 | Jun 2017 | WO |
WO 2017091510 | Jun 2017 | WO |
WO 2017091630 | Jun 2017 | WO |
WO 2017092201 | Jun 2017 | WO |
WO 2017093370 | Jun 2017 | WO |
WO 2017095111 | Jun 2017 | WO |
WO 2017096041 | Jun 2017 | WO |
WO 2017096237 | Jun 2017 | WO |
WO 2017100158 | Jun 2017 | WO |
WO 2017100431 | Jun 2017 | WO |
WO 2017104404 | Jun 2017 | WO |
WO 2017105251 | Jun 2017 | WO |
WO 2017105350 | Jun 2017 | WO |
WO 2017105991 | Jun 2017 | WO |
WO 2017106414 | Jun 2017 | WO |
WO 2017106528 | Jun 2017 | WO |
WO 2017106537 | Jun 2017 | WO |
WO 2017106569 | Jun 2017 | WO |
WO 2017106616 | Jun 2017 | WO |
WO 2017106657 | Jun 2017 | WO |
WO 2017106767 | Jun 2017 | WO |
WO-2017109134 | Jun 2017 | WO |
WO 2017109757 | Jun 2017 | WO |
WO 2017112620 | Jun 2017 | WO |
WO 2017115268 | Jul 2017 | WO |
WO 2017117395 | Jul 2017 | WO |
WO 2017118598 | Jul 2017 | WO |
WO 2017118720 | Jul 2017 | WO |
WO 2017123609 | Jul 2017 | WO |
WO 2017123910 | Jul 2017 | WO |
WO 2017124086 | Jul 2017 | WO |
WO 2017124100 | Jul 2017 | WO |
WO 2017124652 | Jul 2017 | WO |
WO 2017126987 | Jul 2017 | WO |
WO 2017127807 | Jul 2017 | WO |
WO 2017131237 | Aug 2017 | WO |
WO 2017132112 | Aug 2017 | WO |
WO 2017136520 | Aug 2017 | WO |
WO 2017136629 | Aug 2017 | WO |
WO 2017136794 | Aug 2017 | WO |
WO 2017139264 | Aug 2017 | WO |
WO 2017139505 | Aug 2017 | WO |
WO-2017141173 | Aug 2017 | WO |
WO 2017142835 | Aug 2017 | WO |
WO 2017142999 | Aug 2017 | WO |
WO 2017143042 | Aug 2017 | WO |
WO-2017147278 | Aug 2017 | WO |
WO-2017147432 | Aug 2017 | WO |
WO-2017147446 | Aug 2017 | WO |
WO-2017147555 | Aug 2017 | WO |
WO-2017151444 | Sep 2017 | WO |
WO-2017152015 | Sep 2017 | WO |
WO 2017155717 | Sep 2017 | WO |
WO-2017157422 | Sep 2017 | WO |
WO-2017158153 | Sep 2017 | WO |
WO-2017160689 | Sep 2017 | WO |
WO-2017160752 | Sep 2017 | WO |
WO-2017160890 | Sep 2017 | WO |
WO-2017161068 | Sep 2017 | WO |
WO-2017165826 | Sep 2017 | WO |
WO-2017165862 | Sep 2017 | WO |
WO-2017172644 | Oct 2017 | WO |
WO-2017172645 | Oct 2017 | WO |
WO-2017172860 | Oct 2017 | WO |
WO-2017172860 | Oct 2017 | WO |
WO-2017173004 | Oct 2017 | WO |
WO-2017173054 | Oct 2017 | WO |
WO-2017173092 | Oct 2017 | WO |
WO-2017174329 | Oct 2017 | WO |
WO-2017176529 | Oct 2017 | WO |
WO 2017176806 | Oct 2017 | WO |
WO-2017178590 | Oct 2017 | WO |
WO-2017180694 | Oct 2017 | WO |
WO-2017180711 | Oct 2017 | WO |
WO-2017180915 | Oct 2017 | WO |
WO-2017180926 | Oct 2017 | WO |
WO-2017181107 | Oct 2017 | WO |
WO-2017181735 | Oct 2017 | WO |
WO-2017182468 | Oct 2017 | WO |
WO-2017184334 | Oct 2017 | WO |
WO-2017184768 | Oct 2017 | WO |
WO-2017184786 | Oct 2017 | WO |
WO-2017186550 | Nov 2017 | WO |
WO-2017189308 | Nov 2017 | WO |
WO-2017189336 | Nov 2017 | WO |
WO-2017190257 | Nov 2017 | WO |
WO-2017190664 | Nov 2017 | WO |
WO-2017191210 | Nov 2017 | WO |
WO-2017192172 | Nov 2017 | WO |
WO-2017192512 | Nov 2017 | WO |
WO-2017192544 | Nov 2017 | WO |
WO-2017192573 | Nov 2017 | WO |
WO-2017193029 | Nov 2017 | WO |
WO-2017193053 | Nov 2017 | WO |
WO-2017196768 | Nov 2017 | WO |
WO-2017197038 | Nov 2017 | WO |
WO-2017197238 | Nov 2017 | WO |
WO-2017197301 | Nov 2017 | WO |
WO 2017201476 | Nov 2017 | WO |
WO-2017205290 | Nov 2017 | WO |
WO-2017205423 | Nov 2017 | WO |
WO-2017207589 | Dec 2017 | WO |
WO-2017208247 | Dec 2017 | WO |
WO-2017209809 | Dec 2017 | WO |
WO-2017213896 | Dec 2017 | WO |
WO-2017213898 | Dec 2017 | WO |
WO-2017214460 | Dec 2017 | WO |
WO-2017216392 | Dec 2017 | WO |
WO-2017216771 | Dec 2017 | WO |
WO 2017218185 | Dec 2017 | WO |
WO-2017219027 | Dec 2017 | WO |
WO-2017219033 | Dec 2017 | WO |
WO-2017220751 | Dec 2017 | WO |
WO-2017222370 | Dec 2017 | WO |
WO-2017222773 | Dec 2017 | WO |
WO-2017222834 | Dec 2017 | WO |
WO-2017223107 | Dec 2017 | WO |
WO-2017223330 | Dec 2017 | WO |
WO-2018000657 | Jan 2018 | WO |
WO-2018002719 | Jan 2018 | WO |
WO-2018005117 | Jan 2018 | WO |
WO-2018005289 | Jan 2018 | WO |
WO-2018005691 | Jan 2018 | WO |
WO-2018005782 | Jan 2018 | WO |
WO-2018005873 | Jan 2018 | WO |
WO 201806693 | Jan 2018 | WO |
WO-2018009520 | Jan 2018 | WO |
WO-2018009562 | Jan 2018 | WO |
WO-2018009822 | Jan 2018 | WO |
WO-2018013821 | Jan 2018 | WO |
WO-2018013990 | Jan 2018 | WO |
WO-2018014384 | Jan 2018 | WO |
WO-2018015444 | Jan 2018 | WO |
WO-2018015936 | Jan 2018 | WO |
WO-2018017754 | Jan 2018 | WO |
WO-2018018979 | Feb 2018 | WO |
WO-2018020248 | Feb 2018 | WO |
WO-2018022480 | Feb 2018 | WO |
WO-2018022634 | Feb 2018 | WO |
WO-2018025206 | Feb 2018 | WO |
WO-2018026723 | Feb 2018 | WO |
WO-2018026976 | Feb 2018 | WO |
WO-2018027078 | Feb 2018 | WO |
WO 2018030608 | Feb 2018 | WO |
WO-2018031683 | Feb 2018 | WO |
WO-2018035250 | Feb 2018 | WO |
WO-2018035300 | Feb 2018 | WO |
WO-2018035423 | Feb 2018 | WO |
WO-2018035503 | Feb 2018 | WO |
WO-2018039145 | Mar 2018 | WO |
WO-2018039438 | Mar 2018 | WO |
WO-2018039440 | Mar 2018 | WO |
WO-2018039448 | Mar 2018 | WO |
WO-2018045630 | Mar 2018 | WO |
WO-2018048827 | Mar 2018 | WO |
WO-2018049168 | Mar 2018 | WO |
WO-2018051347 | Mar 2018 | WO |
WO-2018058064 | Mar 2018 | WO |
WO-2018062866 | Apr 2018 | WO |
WO-2018064352 | Apr 2018 | WO |
WO-2018064371 | Apr 2018 | WO |
WO-2018064516 | Apr 2018 | WO |
WO-2018067546 | Apr 2018 | WO |
WO-2018067846 | Apr 2018 | WO |
WO-2018068053 | Apr 2018 | WO |
WO-2018069474 | Apr 2018 | WO |
WO-2018071623 | Apr 2018 | WO |
WO-2018071663 | Apr 2018 | WO |
WO-2018071868 | Apr 2018 | WO |
WO-2018071892 | Apr 2018 | WO |
WO-2018074979 | Apr 2018 | WO |
WO-2018079134 | May 2018 | WO |
WO-2018080573 | May 2018 | WO |
WO-2018081504 | May 2018 | WO |
WO-2018081535 | May 2018 | WO |
WO-2018081728 | May 2018 | WO |
WO-2018083128 | May 2018 | WO |
WO 2018083606 | May 2018 | WO |
WO-2018085288 | May 2018 | WO |
WO-2018086623 | May 2018 | WO |
WO-2018093990 | May 2018 | WO |
WO 2018098383 | May 2018 | WO |
WO 2018098480 | May 2018 | WO |
WO 2018098587 | Jun 2018 | WO |
WO 2018099256 | Jun 2018 | WO |
WO 2018103686 | Jun 2018 | WO |
WO 2018106268 | Jun 2018 | WO |
WO 2018107028 | Jun 2018 | WO |
WO 2018107103 | Jun 2018 | WO |
WO 2018107129 | Jun 2018 | WO |
WO 2018-108272 | Jun 2018 | WO |
WO 2018109101 | Jun 2018 | WO |
WO 2018111946 | Jun 2018 | WO |
WO 2018111947 | Jun 2018 | WO |
WO 2018112336 | Jun 2018 | WO |
WO 2018112446 | Jun 2018 | WO |
WO 2018119354 | Jun 2018 | WO |
WO 2018119359 | Jun 2018 | WO |
WO 2018130830 | Jul 2018 | WO |
WO 2018135838 | Jul 2018 | WO |
WO 2018136396 | Jul 2018 | WO |
WO 2018138385 | Aug 2018 | WO |
WO 2018148246 | Aug 2018 | WO |
WO 2018148256 | Aug 2018 | WO |
WO 2018148647 | Aug 2018 | WO |
WO 2018149418 | Aug 2018 | WO |
WO 2018149888 | Aug 2018 | WO |
WO 2018152418 | Aug 2018 | WO |
WO 2018154380 | Aug 2018 | WO |
WO 2018154387 | Aug 2018 | WO |
WO 2018154412 | Aug 2018 | WO |
WO 2018154413 | Aug 2018 | WO |
WO 2018154418 | Aug 2018 | WO |
WO 2018154439 | Aug 2018 | WO |
WO 2018154459 | Aug 2018 | WO |
WO 2018154462 | Aug 2018 | WO |
WO 2018156372 | Aug 2018 | WO |
WO 2018161009 | Sep 2018 | WO |
WO 2018165504 | Sep 2018 | WO |
WO 2018165629 | Sep 2018 | WO |
WO 2018170015 | Sep 2018 | WO |
WO 2018170340 | Sep 2018 | WO |
WO 2018175502 | Sep 2018 | WO |
WO 2018177351 | Oct 2018 | WO |
WO 2018179578 | Oct 2018 | WO |
WO 2018183403 | Oct 2018 | WO |
WO 2018195545 | Oct 2018 | WO |
WO 2018195555 | Oct 2018 | WO |
WO 2018197020 | Nov 2018 | WO |
WO 2018197495 | Nov 2018 | WO |
WO 2018202800 | Nov 2018 | WO |
WO 2018204493 | Nov 2018 | WO |
WO 2018208755 | Nov 2018 | WO |
WO 2018208998 | Nov 2018 | WO |
WO 2018209158 | Nov 2018 | WO |
WO 2018209320 | Nov 2018 | WO |
WO 2018213708 | Nov 2018 | WO |
WO 2018213726 | Nov 2018 | WO |
WO 2018213771 | Nov 2018 | WO |
WO 2018213791 | Nov 2018 | WO |
WO 2018217852 | Nov 2018 | WO |
WO 2018217981 | Nov 2018 | WO |
WO 2018218166 | Nov 2018 | WO |
WO 2018218188 | Nov 2018 | WO |
WO 2018218206 | Nov 2018 | WO |
Entry |
---|
Pattanayak et al. (Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection, Nature Methods, vol. 8, No. 9, pp. 765-70, Aug. 11, 2011). |
Jinek et al. (A Programmable Dual-RNA—Guided DNA Endonuclease in Adaptive Bacterial Immunity, Science, vol. 337 No. 6096 pp . 816-821, Jun. 28, 2012). |
Carroll (A CRISPR Approach to Gene Targeting, Mol Ther. Sep. 2012;20(9):1658-60). |
Barrangou (RNA-mediated programmable DNA cleavage, Nature Biotechnology 30, 836-838, Sep. 10, 2012). |
Cong et al. (Multiplex Genome Engineering Using CRISPR/Cas Systems, Science, vol. 339 No. 6121 pp. 819-823, Jan. 3, 2013). |
Mali et al. (RNA-Guided Human Genome Engineering via Cas9, Science, vol. 339, No. 6121 pp. 823-826, Jan. 3, 2013). |
International Preliminary Report on Patentability for PCT/US2014/052231, dated Mar. 3, 2016. |
International Preliminary Report on patentability for PCT/US2014/050283, dated Feb. 18, 2016. |
International Preliminary Report on Patentability for PCT/US2014/054247, dated Mar. 17, 2016. |
International Preliminary Report on Patentability for PCT/US2014/054291, dated Mar. 17, 2016. |
International Preliminary Report on Patentability or PCT/US2014/054252, dated Mar. 17, 2016. |
International Preliminary Report on Patentability for PCT/US2014/070038, dated Jun. 23, 2016. |
International Search Report and Written Opinion for PCT/US2015/042770, dated Feb. 23, 2016. |
International Preliminary Report on Patentability for PCT/US2015/042770, dated Dec. 19, 2016. |
International Search Report and Written Opinion for PCT/US2015/058479, dated Feb. 11, 2016. |
International Preliminary Report on Patentability for PCT/US2015/058479, dated May 11, 2017. |
Invitation to Pay Additional Fees for PCT/US2016/058344, dated Mar. 1, 2017. |
International Search Report and Written Opinion for PCT/US2016/058344, dated Apr. 20, 2017. |
Addgene Plasmid # 44246. pdCas9-humanized, 2017, Stanley Qi. |
Addgene Plasmid # 73021. PCMV-BE3, 2017, David Liu. |
Addgene Plasmid # 79620. pcDNA3.1_pCMV-nCas-PmCDA1-ugi pHl-gRNA(HPRT), 2017, Akihiko Kondo. |
Anders et al., Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature. Sep. 25, 2014;513(7519):569-73. doi: 10.1038/nature13579. Epub Jul. 27, 2014. |
Barnes et al., Repair and genetic consequences of endogenous DNA base damage in mammalian cells. Annu Rev Genet. 2004;38:445-76. |
Beale et al., Comparison of the differential context-dependence of DNA deamination by APOBEC enzymes: correlation with mutation spectra in vivo. J Mol Biol. Mar. 26, 2004;337(3):585-96. |
Begley, Scientists unveil the ‘most clever CRISPR gadget’ so far. STAT, Apr. 20, 2016. https://www.statnews.com/2016/04/20/clever-crispr-advance-unveiled/. |
Birling et al., Site-specific recombinases for manipulation of the mouse genome. Methods Mol Biol. 2009;561:245-63. doi: 10.1007/978-1-60327-019-9_16. |
Bitinaite et al., FokI dimerization is required for DNA cleavage. Proc Natl Acad Sci U S A. Sep. 1, 1998;95(18):10570-5. |
Borman, Improved route to single-base genome editing. Chemical & Engineering News, Apr. 25, 2016;94(17)p5. http://cen.acs.org/articles/94/i17/Improved-route-single-base-genome.html. |
Britt et al., Re-engineering plant gene targeting. Trends Plant Sci. Feb. 2003;8(2):90-5. |
Brusse et al., Spinocerebellar ataxia associated with a mutation in the fibroblast growth factor 14 gene (SCA27): A new phenotype. Mov Disord. Mar. 2006;21(3):396-401. |
Buchholz et al., Alteration of Cre recombinase site specificity by substrate-linked protein evolution. Nat Biotechnol. Nov. 2001;19(11):1047-52. |
Bulow et al., Multienzyme systems obtained by gene fusion. Trends Biotechnol. Jul. 1991;9(7):226-31. |
Caldecott et al., Single-strand break repair and genetic disease. Nat Rev Genet. Aug. 2008;9(8):619-31. doi: 10.1038/nrg2380. |
Chadwick et al., In Vivo Base Editing of PCSK9 (Proprotein Convertase Subtilisin/Kexin Type 9) as a Therapeutic Alternative to Genome Editing. Arterioscler Thromb Vasc Biol. Sep. 2017;37(9):1741-1747. doi: 10.1161/Atvbaha.117.309881. Epub Jul. 27, 2015. |
Chavez et al., Highly efficient Cas9-mediated transcriptional programming. Nat Methods. Apr. 2015;12(4):326-8. doi: 10.1038/nmeth.3312. Epub Mar. 2, 2015. |
Chavez et al., Precise Cas9 targeting enables genomic mutation prevention. doi: https://doi.org/10.1101/058974. [Preprint]. |
Chen et al., Structure of the DNA deaminase domain of the HIV-1 restriction factor APOBEC3G. Nature. Mar. 6, 2008;452(7183):116-9. doi: 10.1038/nature06638. Epub Feb. 20, 2008. |
Chichili et al., Linkers in the structural biology of protein-protein interactions. Protein Science. 2013;22:153-67. |
Cho et al., Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol. Mar. 2013;31(3):230-2. doi: 10.1038/nbt.2507. Epub Jan. 29, 2013. |
Chu et al., Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotech. Feb. 13, 2015;33:543-8. |
Cox et al., Conditional gene expression in the mouse inner ear using Cre-loxP. J Assoc Res Otolaryngol. Jun. 2012;13(3):295-322. doi: 10.1007/s10162-012-0324-5. Epub Apr. 24, 2012. |
Cox et al., Therapeutic genome editing: prospects and challenges. Nat Med. Feb. 2015;21(2):121-31. doi: 10.1038/nm.3793. |
Cunningham et al., Ensembl 2015. Nucleic Acids Res. Jan. 2015;43(Database issue):D662-9. doi: 10.1093/nar/gku1010. Epub Oct. 28, 2014. |
Davis et al., Small molecule-triggered Cas9 protein with improved genome-editing specificity. Nat Chem Biol. May 2015;11(5):316-8. doi: 10.1038/nchembio.1793. Epub Apr. 6, 2015. |
Dormiani et al., Long-term and efficient expression of human β-globin gene in a hematopoietic cell line using a new site-specific integrating non-viral system. Gene Ther. Aug. 2015;22(8):663-74. doi: 10.1038/gt.2015.30. Epub Apr. 1, 2015. |
Doudna et al., Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. Nov. 28, 2014;346(6213):1258096. doi: 10.1126/science.1258096. |
Dunaime, Breakthrough method means CRISPR just got a lot more relevant to human health. The Verge. Apr. 20, 2016. http://www.theverge.com/2016/4/20/11450262/crispr-base-editing-single-nucleotides-dna-gene-liu-harvard. |
Eltoukhy et al., Nucleic acid-mediated intracellular protein delivery by lipid-like nanoparticles. Biomaterials. Aug. 2014;35(24):6454-61. doi: 10.1016/j.biomaterials.2014.04.014. Epub May 13, 2014. |
Fonfara et al., Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic Acids Res. Feb. 2014;42(4):2577-90. doi: 10.1093/nar/gkt1074. Epub Nov. 22, 2013. |
Freshney, Culture of Animal Cells. A Manual of Basic Technique. Alan R. Liss, Inc. New York. 1983;4. |
Fung et al., Repair at single targeted DNA double-strand breaks in pluripotent and differentiated human cells. PLoS One. 2011;6(5):e20514. doi: 10.1371/journal.pone.0020514. Epub May 25, 2011. |
Gaj et al., A comprehensive approach to zinc-finger recombinase customization enables genomic targeting in human cells. Nucleic Acids Res. Feb. 6, 2013;41(6):3937-46. |
Gaj et al., Enhancing the specificity of recombinase-mediated genome engineering through dimer interface redesign. J Am Chem Soc. Apr. 2, 2014;136(13):5047-56. doi: 10.1021/ja4130059. Epub Mar. 20, 2014. |
Gaj et al., Expanding the scope of site-specific recombinases for genetic and metabolic engineering. Biotechnol Bioeng. Jan. 2014;111(1):1-15. doi: 10.1002/bit.25096. Epub Sep. 13, 2013. |
Gao et al., DNA-guided genome editing using the Natronobacterium gregoryi Argonaute. Nat Biotechnol. Jul. 2016;34(7):768-73. doi: 10.1038/nbt.3547. Epub May 2, 2016. |
Gardlik et al., Vectors and delivery systems in gene therapy. Med Sci Monit. Apr. 2005;11(4):RA110-21. Epub Mar. 24, 2005. |
Gersbach et al., Directed evolution of recombinase specificity by split gene reassembly. Nucleic Acids Res. Jul. 2010;38(12):4198-206. doi: 10.1093/nar/gkq125. Epub Mar. 1, 2010. |
Gersbach et al., Targeted plasmid integration into the human genome by an engineered zinc-finger recombinase. Nucleic Acids Res. Sep. 1, 2011;39(17):7868-78. doi: 10.1093/nar/gkr421. Epub Jun. 7, 2011. |
Gonzalez et al., an iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells. Cell Stem Cell. Aug. 7, 2014;15(2):215-26. doi: 10.1016/j.stem.2014.05.018. Epub Jun. 12, 2014. |
Han, New CRISPR/Cas9-based Tech Edits Single Nucleotides Without Breaking DNA. Genome Web, Apr. 20, 2016. https://www.genomeweb.com/gene-silencinggene-editing/new-crisprcas9-based-tech-edits-single-nucleotides-without-breaking-dna. |
Harris et al., RNA editing enzyme APOBEC1 and some of its homologs can act as DNA mutators. Mol Cell. Nov. 2002;10(5):1247-53. |
Hess et al., Directed evolution using dCas9-targeted somatic hypermutation in mammalian cells. Nat Methods. Dec. 2016;13(12):1036-1042. doi: 10.1038/nmeth.4038. Epub Oct. 31, 2016. |
Hilton et al., Enabling functional genomics with genome engineering. Genome Res. Oct. 2015;25(10):1442-55. doi: 10.1101/gr.190124.115. |
Hondares et al., Peroxisome Proliferator-activated Receptor a (PPARα) Induces PPARγ Coactivator 1α (PGC-1α) Gene Expression and Contributes to Thermogenic Activation of Brown Fat. J Biol. Chem Oct. 2011; 286(50):43112-22. doi: 10.1074/jbc.M111.252775. |
Hou et al., Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. Sep. 24, 2013;110(39):15644-9. doi: 10.1073/pnas.1313587110. Epub Aug. 12, 2013. |
Jiang et al., Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. Science. Feb. 19, 2016;351(6275):867-71. doi: 10.1126/science.aad8282. Epub Jan. 14, 2016. |
Karpinsky et al., Directed evolution of a recombinase that excises the provirus of most HIV-1 primary isolates with high specificity. Nat Biotechnol. Apr. 2016;34(4):401-9. doi: 10.1038/nbt.3467. Epub Feb. 22, 2016. |
Kellendonk et al., Regulation of Cre recombinase activity by the synthetic steroid RU 486. Nucleic Acids Res. Apr. 15, 1996;24(8):1404-11. |
Kim et al., Genome-wide target specificities of CRISPR RNA-guided programmable deaminases. Nat Biotechnol. May 2017;35(5):475-480. doi: 10.1038/nbt.3852. Epub Apr. 10, 2017. |
Kim et al., Highly efficient RNA-guided base editing in mouse embryos. Nat Biotechnol. May 2017;35(5):435-437. doi: 10.1038/nbt.3816. Epub Feb. 27, 2017. |
Kim et al., Increasing the genome-targeting scope and precision of base editing with engineered Cas9-cytidine deaminase fusions. Nat Biotechnol. Apr. 2017;35(4):371-376. doi: 10.1038/nbt.3803. Epub Feb. 13, 2017. |
Kim et al., The role of apolipoprotein E in Alzheimer's disease. Neuron. Aug. 13, 2009;63(3):287-303. doi:10.1016/j.neuron.2009.06.026. |
Kim et al., Transcriptional repression by zinc finger peptides. Exploring the potential for applications in gene therapy. J Biol Chem. Nov. 21, 1997;272(47):29795-800. |
Kitamura et al., Uracil DNA glycosylase counteracts APOBEC3G-induced hypermutation of hepatitis B viral genomes: excision repair of covalently closed circular DNA. PLoS Pathog. 2013;9(5):e1003361. doi: 10.1371/journal.ppat.1003361. Epub May 16, 2013. |
Kleinstiver et al., Broadening the targeting range of Staphylococcus aureus CRISPR-Cas9 by modifying PAM recognition. Nat Biotechnol. Dec. 2015;33(12):1293-1298. doi: 10.1038/nbt.3404. Epub Nov. 2, 2015. |
Kleinstiver et al., Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. Jul. 23, 2015;523(7561):481-5. doi: 10.1038/nature14592. Epub Jun. 22, 2015. |
Kleinstiver et al., High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature. Jan. 28, 2016;529(7587):490-5. doi: 10.1038/nature16526. Epub Jan. 6, 2016. |
Klippel et al., Isolation and characterization of unusual gin mutants. EMBO J. Dec. 1, 1988;7(12):3983-9. |
Klippel et al., The DNA invertase Gin of phage Mu: formation of a covalent complex with DNA via a phosphoserine at amino acid position 9. EMBO J. Apr. 1988;7(4):1229-37. |
Komor et al., Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. Apr. 20, 2016;533(7603):420-4. doi: 10.1038/nature17946. |
Kuscu et al., CRISPR-STOP: gene silencing through base-editing-induced nonsense mutations. Nat Methods. Jul. 2017;14(7):710-712. doi: 10.1038/nmeth.4327. Epub Jun. 5, 2017. |
Kuscu et al., Genome-wide analysis reveals characteristics of off-target sites bound by the Cas9 endonuclease. Nat Biotechnol. Jul. 2014;32(7):677-83. doi: 10.1038/nbt.2916. Epub May 18, 2014. |
Landrum et al., ClinVar: public archive of interpretations of clinically relevant variants. Nucleic Acids Res. Jan. 4, 2016;44(D1):D862-8. doi: 10.1093/nar/gkv1222. Epub Nov. 17, 2015. |
Ledford, Gene-editing hack yields pinpoint precision. Nature, Apr. 20, 2016. http://www.nature.com/news/gene-editing-hack-yields-pinpoint-precision-1.19773. |
Lee et al., A chimeric thyroid hormone receptor constitutively bound to DNA requires retinoid X receptor for hormone-dependent transcriptional activation in yeast. Mol Endocrinol. Sep. 1994;8(9):1245-52. |
Lee et al., Recognition of liposomes by cells: in vitro binding and endocytosis mediated by specific lipid headgroups and surface charge density. Biochim Biophys Acta. Jan. 31, 1992;1103(2):185-97. |
Li et al., Generation of Targeted Point Mutations in Rice by a Modified CRISPR/Cas9 System. Mol Plant. Mar. 6, 2017;10(3):526-529. doi: 10.1016/j.molp.2016.12.001. Epub Dec. 8, 2016. |
Li et al., Highly efficient and precise base editing in discarded human tripronuclear embryos. Protein Cell. Aug. 19, 2017. doi: 10.1007/s13238-017-0458-7. [Epub ahead of print]. |
Lin et al., Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. Elife. Dec. 15, 2014;3:e04766. doi: 10.7554/eLife.04766. |
Liu et al., Apolipoprotein E and Alzheimer disease: risk, mechanisms and therapy. Nat Rev Neurol. Feb. 2013;9(2):106-18. doi: 10.1038/nrneuro1.2012.263. Epub Jan. 8, 2013. |
Lu et al., Precise Editing of a Target Base in the Rice Genome Using a Modified CRISPR/Cas9 System. Mol Plant. Mar. 6, 2017;10(3):523-525. doi: 10.1016/j.molp.2016.11.013. Epub Dec. 6, 2013. |
Lundquist et al., Site-directed mutagenesis and characterization of uracil-DNA glycosylase inhibitor protein. Role of specific carboxylic amino acids in complex formation with Escherichia coli uracil-DNA glycosylase. J Biol Chem. Aug. 22, 1997;272(34):21408-19. |
Ma et al., Targeted AID-mediated mutagenesis (TAM) enables efficient genomic diversification in mammalian cells. Nature Methods. Oct. 2016;13:1029-35. doi:10.1038/nmeth.4027. |
Marioni et al., DNA methylation age of blood predicts all-cause mortality in later life. Genome Biol. Jan. 30, 2015;16:25. doi: 10.1186/s13059-015-0584-6. |
Maruyama et al., Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat Biotechnol. May 2015;33(5):538-42. doi: 10.1038/nbt.3190. Epub Mar. 23, 2015. |
Mercer et al., Chimeric Tale recombinases with programmable DNA sequence specificity. Nucleic Acids Res. Nov. 2012;40(21):11163-72. doi: 10.1093/nar/gks875. Epub Sep. 26, 2012. |
Minoche et al., Evaluation of genomic high-throughput sequencing data generated on Illumina HiSeq and genome analyzer systems. Genome Biol. Nov. 8, 2011;12(11):R112. doi: 10.1186/gb-2011-12-11-r112. |
Mol et al., Crystal structure of human uracil-DNA glycosylase in complex with a protein inhibitor: protein mimicry of DNA. Cell. Sep. 8, 1995;82(5):701-8. |
Nishida et al., Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science. Sep. 16, 2016;353(6305). pii: aaf8729. doi: 10.1126/science.aaf8729. Epub Aug. 4, 2016. |
Offord, Advances in Genome Editing. The Scientist, Apr. 20, 2016. http://www.the-scientist.com/?articles.view/articleNo/45903/title/Advances-in-Genome-Editing/. |
Parker et al., Admixture mapping identifies a quantitative trait locus associated with FEV1/FVC in the COPDGene Study. Genet Epidemiol. Nov. 2014;38(7):652-9. doi: 10.1002/gepi.21847. Epub Aug. 11, 2014. |
Petolino et al., Editing Plant Genomes: a new era of crop improvement. Plant Biotechnol J. Feb. 2016;14(2):435-6. doi: 10.1111/pbi.12542. |
Plasterk et al., DNA inversions in the chromosome of Escherichia coli and in bacteriophage Mu: relationship to other site-specific recombination systems. Proc Natl Acad Sci U S A. Sep. 1983;80(17):5355-8. |
Pluciennik et al., PCNA function in the activation and strand direction of MutLα endonuclease in mismatch repair. Proc Natl Acad Sci U S A. Sep. 14, 2010;107(37):16066-71. doi: 10.1073/pnas.1010662107. Epub Aug. 16, 2010. |
Prorocic et al., Zinc-finger recombinase activities in vitro. Nucleic Acids Res. Nov. 2011;39(21):9316-28. doi: 10.1093/nar/gkr652. Epub Aug. 17, 2011. |
Prykhozhij et al., CRISPR multitargeter: a web tool to find common and unique CRISPR single guide RNA targets in a set of similar sequences. PLoS One. Mar. 5, 2010;10(3):e0119372. doi: 10.1371/journal.pone.0119372. eCollection 2015. |
Putnam et al., Protein mimicry of DNA from crystal structures of the uracil-DNA glycosylase inhibitor protein and its complex with Escherichia coli uracil-DNA glycosylase. J Mol Biol. Mar. 26, 1999;287(2):331-46. |
Ran et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc. Nov. 2013;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub Oct. 24, 2013. |
Ran et al., In vivo genome editing using Staphylococcus aureus Cas9. Nature. Apr. 9, 2015;520(7546):186-91. doi: 10.1038/nature14299. Epub Apr. 1, 2015. |
Rath et al., Fidelity of end joining in mammalian episomes and the impact of Metnase on joint processing. BMC Mol Biol. Mar. 22, 2014;15:6. doi: 10.1186/1471-2199-15-6. |
Rebuzzini et al., New mammalian cellular systems to study mutations introduced at the break site by non-homologous end-joining. DNA Repair (Amst). May 2, 2005;4(5):546-55. |
Rees et al., Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery. Nat Commun. Jun. 6, 2017;8:15790. doi: 10.1038/ncomms15790. |
Richardson et al., Enhancing homology-directed genome editing by catalytically active and inactive Crispr-Cas9 using asymmetric donor DNA. Nat Biotechnol. Mar. 2016;34(3):339-44. doi: 10.1038/nbt.3481. Epub Jan. 20, 2016. |
Rong et al., Homologous recombination in human embryonic stem cells using CRISPR/Cas9 nickase and a long DNA donor template. Protein Cell. Apr. 2014;5(4):258-60. doi: 10.1007/s13238014-0032-5. |
Rowland et al., Regulatory mutations in Sin recombinase support a structure-based model of the synaptosome. Mol Microbiol. Oct. 2009;74(2):282-98. doi: 10.1111/j.1365-2958.2009.06756.x. Epub Jun. 8, 2009. |
Sadelain et al., Safe harbours for the integration of new DNA in the human genome. Nat Rev Cancer. Dec. 1, 2011;12(1):51-8. doi: 10.1038/nrc3179. |
Sanjana et al., A transcription activator-like effector toolbox for genome engineering. Nat Protoc. Jan. 5, 2012;7(1):171-92. doi: 10.1038/nprot.2011.431. |
Saraconi et al., The RNA editing enzyme APOBEC1 induces somatic mutations and a compatible mutational signature is present in esophageal adenocarcinomas. Genome Biol. Jul. 31, 2014;15(7):417. doi: 10.1186/s13059-014-0417-z. |
Sclimenti et al., Directed evolution of a recombinase for improved genomic integration at a native human sequence. Nucleic Acids Res. Dec. 15, 2001;29(24):5044-51. |
Seripa et al., The missing ApoE allele. Ann Hum Genet. Jul. 2007;71(Pt 4):496-500. Epub Jan. 22, 2007. |
Shah et al., Kinetic control of one-pot trans-splicing reactions by using a wild-type and designed split intein. Angew Chem Int Ed Engl. Jul. 11, 2011;50(29):6511-5. doi: 10.1002/anie.201102909. Epub Jun. 8, 2011. |
Shah et al., Target-specific variants of Flp recombinase mediate genome engineering reactions in mammalian cells. FEBS J. Sep. 2015;282(17):3323-33. doi: 10.1111/febs.13345. Epub Jul. 1, 2015. |
Sharbeen et al., Ectopic restriction of DNA repair reveals that UNG2 excises AID-induced uracils predominantly or exclusively during G1 phase. J Exp Med. May 7, 2012;209(5):965-74. doi: 10.1084/jem.20112379. Epub Apr. 23, 2012. |
Shimantani et al., Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Nat Biotechnol. May 2017;35(5):441-443. doi: 10.1038/nbt.3833. Epub Mar. 27, 2017. |
Shimojima et al., Spinocerebellar ataxias type 27 derived from a disruption of the fibroblast growth factor 14 gene with mimicking phenotype of paroxysmal non-kinesigenic dyskinesia. Brain Dev. Mar. 2012;34(3):230-3. doi: 10.1016/j.braindev.2011.04.014. Epub May 19, 2011. |
Simonelli et al., Base excision repair intermediates are mutagenic in mammalian cells. Nucleic Acids Res. Aug. 2, 2005;33(14):4404-11. Print 2005. |
Sirk et al., Expanding the zinc-finger recombinase repertoire: directed evolution and mutational analysis of serine recombinase specificity determinants. Nucleic Acids Res. Apr. 2014;42(7):4755-66. doi: 10.1093/nar/gkt1389. Epub Jan. 21, 2014. |
Sjoblom et al., the consensus coding sequences of human breast and colorectal cancers. Science. Oct. 13, 2006;314(5797):268-74. Epub Sep. 7, 2006. |
Slaymaker et al., Rationally engineered Cas9 nucleases with improved specificity. Science. Jan. 1, 2016;351(6268):84-8. doi: 10.1126/science.aad5227. Epub Dec. 1, 2015. |
Smith et al., Expression of a dominant negative retinoic acid receptor γ in Xenopus embryos leads to partial resistance to retinoic acid. Roux Arch Dev Biol. Mar. 1994;203(5):254-265. doi: 10.1007/BF00360521. |
Stenglein et al., APOBEC3 proteins mediate the clearance of foreign Dna from human cells. Nat Struct Mol Biol. Feb. 2010;17(2):222-9. doi: 10.1038/nsmb.1744. Epub Jan. 10, 2010. |
Sternberg et al., DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature.Mar. 6, 2014;507(7490):62-7. doi: 10.1038/nature13011. Epub Jan. 29, 2014. |
Swarts et al., Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA. Nucleic Acids Res. May 26, 2015;43(10):5120-9. doi: 10.1093/nar/gkv415. Epub Apr. 29, 2015. |
Swarts et al., DNA-guided DNA interference by a prokaryotic Argonaute. Nature. Mar. 13, 2014;507(7491):258-61. doi: 10.1038/nature12971. Epub Feb. 16, 2014. |
Swarts et al., The evolutionary journey of Argonaute proteins. Nat Struct Mol Biol. Sep. 2014;21(9):743-53. doi: 10.1038/nsmb.2879. |
Tagalakis et al., Lack of RNA-DNA oligonucleotide (chimeraplast) mutagenic activity in mouse embryos. Mol Reprod Dev. Jun. 2005;71(2):140-4. |
Thyagarajan et al., Mammalian genomes contain active recombinase recognition sites. Gene. Feb. 22, 2000;244(1-2):47-54. |
Thyagarajan et al., Site-specific genomic integration in mammalian cells mediated by phage phiC31 integrase. Mol Cell Biol. Jun. 2001;21(12):3926-34. |
Tirumalai et al., Recognition of core-type DNA sites by lambda integrase. J Mol Biol. Jun. 12, 1998;279(3):513-27. |
Truong et al., Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Res. Jul. 27, 2015;43(13):6450-8. doi: 10.1093/nar/gkv601. Epub Jun. 16, 2015. |
Tsai et al., GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol. Feb. 2015;33(2):187-97. doi: 10.1038/nbt.3117. Epub Dec. 16, 2014. |
Turan et al., Recombinase-mediated cassette exchange (RMCE)—a rapidly-expanding toolbox for targeted genomic modifications. Gene. Feb. 15, 2013;515(1):1-27. doi: 10.1016/j.gene.2012.11.016. Epub Nov. 29, 2012. |
Turan et al., Recombinase-mediated cassette exchange (RMCE): traditional concepts and current challenges. J Mol Biol. Mar. 25, 2011;407(2):193-221. doi: 10.1016/j jmb.2011.01.004. Epub Jan. 15, 2011. |
Van Swieten et al., A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia [corrected]. Am J Hum Genet. Jan. 2003;72(1):191-9. Epub Dec. 13, 2002. |
Wang et al., Efficient delivery of genome-editing proteins using bioreducible lipid nanoparticles. Proc Natl Acad Sci U S A. Feb. 29, 2016. pii: 201520244. [Epub ahead of print]. |
Wang et al., Nucleation, propagation and cleavage of target RNAs in Ago silencing complexes. Nature. Oct. 8, 2009;461(7265):754-61. doi: 10.1038/nature08434. |
Wang et al., Uracil-DNA glycosylase inhibitor gene of bacteriophage PBS2 encodes a binding protein specific for uracil-DNA glycosylase. J Biol Chem. Jan. 15, 1989;264(2):1163-71. |
Warren et al., A chimeric Cre recombinase with regulated directionality. Proc Natl Acad Sci U S A. Nov. 25, 2008;105(47):18278-83. doi: 10.1073/pnas.0809949105. Epub Nov. 14, 2008. |
Warren et al., Mutations in the amino-terminal domain of lambda-integrase have differential effects on integrative and excisive recombination. Mol Microbiol. Feb. 2005;55(4):1104-12. |
Wijnker et al., Managing meiotic recombination in plant breeding. Trends Plant Sci. Dec. 2008;13(12):640-6. doi: 10.1016/j.tplants.2008.09.004. Epub Oct. 22, 2008. |
Wu et al., Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat Biotechnol. Jul. 2014;32(7):670-6. doi: 10.1038/nbt.2889. Epub Apr. 20, 2014. |
Xu et al., Sequence determinants of improved CRISPR sgRNA design. Genome Res. Aug. 2015;25(8):1147-57. doi: 10.1101/gr.191452.115. Epub Jun. 10, 2015. |
Yang et al., Genome editing with targeted deaminases. BioRxiv. Preprint. First posted online Jul. 28, 2016. |
Yuen et al., Control of transcription factor activity and osteoblast differentiation in mammalian cells using an evolved small-molecule-dependent intein. J Am Chem Soc. Jul. 12, 2006;128(27):8939-46. |
Zetsche et al., A split-Cas9 architecture for inducible genome editing and transcription modulation. Nat Biotechnol. Feb. 2015;33(2):139-42. doi: 10.1038/nbt.3149. |
Zetsche et al., Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. Oct. 22, 2015;163(3):759-71. doi: 10.1016/j.ce11.2015.09.038. Epub Sep. 25, 2015. |
Zhang et al., Comparison of non-canonical PAMs for CRISPR/Cas9-mediated DNA cleavage in human cells. Sci Rep. Jun. 2014;4:5405. |
Zhang et al., Programmable base editing of zebrafish genome using a modified CRISPR-Cas9 system. Nat Commun. Jul. 25, 2017;8(1):118. doi: 10.1038/s41467-017-00175-6. |
Zong et al., Precise base editing in rice, wheat and maize with a Cas9-cytidine deaminase fusion. Nat Biotechnol. May 2017;35(5):438-440. doi: 10.1038/nbt.3811. Epub Feb. 27, 2017. |
Zuris et al., Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nat Biotechnol. 2015;33:73-80. |
Chaikind et al., A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. Nov. 16, 2016;44(20):9758-9770. Epub Aug. 11, 2016. |
Chew et al., A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. Oct. 2016;13(10):868-74. doi: 10.1038/nmeth.3993. Epub Sep. 5, 2016. |
Fine et al., Trans-spliced Cas9 allows cleavage of HBB and CCR5 genes in human cells using compact expression cassettes. Scientific Reports 2015;5(1):Article No. 10777. doi:10.1038/srep10777. With Supplementary Information. |
Hower et al., Shape-based peak identification for ChIP-Seq. BMC Bioinformatics. Jan. 12, 2011;12:15. doi: 10.1186/1471-2105-12-15. |
International Search Report and Written Opinion for PCT/US2017/045381, dated Oct. 26, 2017. |
International Search Report and Written Opinion for PCT/US2017/046144, dated Oct. 10, 2017. |
International Search Report and Written Opinion for PCT/US2017/48390, dated Jan. 9, 2018. |
Invitation to Pay Additional Fees for PCT/US2017/056671, dated Dec. 21, 2017. |
Invitation to Pay Additional Fees for PCT/US2017/48390, dated Nov. 7, 2017. |
Kleinstiver et al., Monomeric site-specific nucleases for genome editing. Proc Natl Acad Sci U S A. May 22, 2012;109(21):8061-6. doi: 10.1073/pnas.1117984109. Epub May 7, 2012. |
Ravishankar et al., X-ray analysis of a complex of Escherichia coli uracil DNA glycosylase (EcUDG) with a proteinaceous inhibitor. The structure elucidation of a prokaryotic UDG. Nuclei Acids Res. 26 (21): 4880-4887 (1998). |
Shah et al., Inteins: nature's gift to protein chemists. Chem Sci. 2014;5(1):446-461. |
Stevens et al., Design of a Split Intein with Exceptional Protein-Splicing Activity. J Am Chem Soc. Feb. 24, 2016;138(7):2162-5. doi: 10.1021/jacs.5b13528. Epub Feb. 8, 2016. |
Wang et al., Recombinase technology: applications and possibilities. Plant Cell Rep. Mar. 2011;30(3):267-85. doi: 10.1007/s00299-010-0938-1. Epub Oct. 24, 2010. |
Yang et al., Engineering and optimising deaminase fusions for genome editing. Nat Commun. Nov. 2, 2016;7:13330. doi: 10.1038/ncomms13330. |
Yuan et al., Tetrameric structure of a serine integrase catalytic domain. Structure. Aug. 6, 2006;16(8):1275-86. doi: 10.1016/j.str.2008.04.018. |
Zheng et al., DNA editing in DNA/RNA hybrids by adenosine deaminases that act on RNA. Nucleic Acids Res. Apr. 7, 2017;45(6):3369-3377. doi: 10.1093/nar/gkx050. |
U.S. Appl. No. 61/716,256, Jinek et al., filed Oct. 19, 2012. |
U.S. Appl. No. 61/717,324, Cho et al., filed Oct. 23, 2012. |
U.S. Appl. No. 61/734,256, Chen et al., filed Dec. 6, 2012. |
U.S. Appl. No. 61/758,624, Chen et al., filed Jan. 30, 2013. |
U.S. Appl. No. 61/761,046, Knight et al., filed Feb. 5, 2013. |
U.S. Appl. No. 61/794,422, Knight et al., filed Mar. 15, 2013. |
U.S. Appl. No. 61/803,599, Kim et al., filed Mar. 20, 2013. |
U.S. Appl. No. 61/837,481, Cho et al., filed Jun. 20, 2013. |
International Search Report and Written Opinion for PCT/US2012/047778, dated May 30, 2013. |
International Preliminary Report on Patentability for PCT/US2012/047778, dated Feb. 6, 2014. |
Partial Supplementary European Search Report for Application No. EP 12845790.0, dated Mar. 18, 2015. |
Supplementary European Search Report for Application No. EP 12845790.0, dated Oct. 12, 2015. |
International Search Report and Written Opinion for PCT/US2014/052231, dated Dec. 4, 2014. |
International Search Report and Written Opinion for PCT/US2014/052231, dated Jan. 30, 2015 (Corrected Version). |
International Search Report and Written Opinion for PCT/US2014/050283, dated Nov. 6, 2014. |
International Search Report and Written Opinion for PCT/US2014/054247, dated Mar. 27, 2015. |
Invitation to Pay Additional Fees for PCT/US2014/054291, dated Dec. 18, 2014. |
International Search Report and Written Opinion for PCT/US2014/054291, dated Mar. 27, 2015. |
International Search Report and Written Opinion for PCT/US2014/054252, dated Mar. 5, 2015. |
International Search Report and Written Opinion for PCT/US2014/070038, dated Apr. 14, 2015. |
International Search Report for PCT/US2013/032589, dated Jul. 26, 2013. |
No Author Listed, EMBL Accession No. Q99ZW2. Nov. 2012. 2 pages. |
No Author Listed, Invitrogen Lipofectamine™ 2000 product sheets, 2002. 2 pages. |
No Author Listed, Invitrogen Lipofectamine™ 2000 product sheets, 2005. 3 pages. |
No Author Listed, Invitrogen Lipofectamine™ LTX product sheets, 2011. 4 pages. |
No Author Listed, Thermo Fisher Scientific—How Cationic Lipid Mediated Transfection Works, retrieved from the internet Aug. 27, 2015. 2 pages. |
NCBI Reference Sequence: NM_002427.3. Wu et al., May 3, 2014. 5 pages. |
Genbank Submission; NIH/NCBI, Accession No. J04623. Kita et al., Apr. 26, 1993. 2 pages. |
Genbank Submission; NIH/NCBI, Accession No. NC_002737.1. Ferretti et al., Jun. 27, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_015683.1. Trost et al., Jul. 6, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_016782.1. Trost et al., Jun. 11, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_016786.1. Trost et al., Aug. 28, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_017053.1. Fittipaldi et al., Jul. 6, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_017317.1. Trost et al., Jun. 11, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_017861.1. Heidelberg et al., Jun. 11, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_018010.1. Lucas et al., Jun. 11, 2013. 2 pages. |
Genbank Submission; NIH/NCBI, Accession No. NC_018721.1. Feng et al., Jun. 11, 2013. 1 pages. |
Genbank Submission; NIH/NCBI, Accession No. NC_021284.1. Ku et al., Jul. 12, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_021314.1. Zhang et al., Jul. 15, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NC_021846.1. Lo et al., Jul. 22, 2013. 1 page. |
Genbank Submission; NIH/NCBI, Accession No. NP_472073.1. Glaser et al., Jun. 27, 2013. 2 pages. |
Genbank Submission; NIH/NCBI, Accession No. P42212. Prasher et al., Mar. 19, 2014. 7 pages. |
Genbank Submission; NIH/NCBI, Accession No. YP_002342100.1. Bernardini et al., Jun. 10, 2013. 2 pages. |
Genbank Submission; NIH/NCBI, Accession No. YP_002344900.1. Gundogdu et al., Mar. 19, 2014. 2 pages. |
Genbank Submission; NIH/NCBI, Accession No. YP_820832.1. Makarova et al., Aug. 27, 2013. 2 pages. |
UniProt Submission; UniProt, Accession No. P01011. Last modified Jun. 11, 2014, version 2. 15 pages. |
UniProt Submission; UniProt, Accession No. P01011. Last modified Sep. 18, 2013, version 2. 15 pages. |
UniProt Submission; UniProt, Accession No. P04264. Last modified Jun. 11, 2014, version 6. 15 pages. |
Uniprot Submission; UniProt, Accession No. P04275. Last modified Jul. 9, 2014, version 107. 29 pages. |
Akopian et al., Chimeric recombinases with designed DNA sequence recognition. Proc Natl Acad Sci U S A. Jul. 22, 2003;100(15):8688-91. Epub Jul. 1, 2003. |
Alexandrov et al., Signatures of mutational processes in human cancer. Nature. Aug. 22, 2013;500(7463):415-21. doi: 10.1038/nature12477. Epub Aug. 14, 2013. |
Barrangou et al., CRISPR provides acquired resistance against viruses in prokaryotes. Science. Mar. 23, 2007;315(5819):1709-12. |
Barrangou, RNA-mediated programmable DNA cleavage. Nat Biotechnol. Sep. 2012;30(9):836-8. doi: 10.1038/nbt.2357. |
Bedell et al., In vivo genome editing using a high-efficiency TALEN system. Nature. Nov. 1, 2012;491(7422):114-8. Doi: 10.1038/nature11537. Epub Sep. 23, 2012. |
Beumer et al., Efficient gene targeting in Drosophila with zinc-finger nucleases. Genetics. Apr. 2006;172(4):2391-403. Epub Feb. 1, 2006. |
Bibikova et al., Stimulation of homologous recombination through targeted cleavage by chimeric nucleases. Mol Cell Biol. Jan. 2001;21(1):289-97. |
Bibikova et al., Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics. Jul. 2002;161(3):1169-75. |
Boch et al., Breaking the code of DNA binding specificity of Tal-type III effectors. Science. Dec. 11, 2009;326(5959):1509-12. Doi: 10.1126/science.1178811. |
Boch, TALEs of genome targeting. Nat Biotechnol. Feb. 2011;29(2):135-6. Doi: 10.1038/nbt.1767. |
Boeckle et al., Melittin analogs with high lytic activity at endosomal pH enhance transfection with purified targeted PEI polyplexes. J Control Release. May 15, 2006;112(2):240-8. Epub Mar. 20, 2006. |
Branden and Tooze, Introduction to Protein Structure. 1999; 2nd edition. Garland Science Publisher: 3-12. |
Brown et al., Serine recombinases as tools for genome engineering. Methods. Apr. 2011;53(4):372-9. doi: 10.1016/j.ymeth.2010.12.031. Epub Dec. 30, 2010. |
Bulyk et al., Exploring the DNA-binding specificities of zinc fingers with DNA microarrays. Proc Natl Acad Sci U S A. Jun. 19, 2001;98(13):7158-63. Epub Jun. 12, 2001. |
Cade et al., Highly efficient generation of heritable zebrafish gene mutations using homo- and heterodimeric TALENs. Nucleic Acids Res. Sep. 2012;40(16):8001-10. Doi: 10.1093/nar/gks518. Epub Jun. 7, 2012. |
Cameron, Recent advances in transgenic technology. Mol Biotechnol. Jun. 1997;7(3):253-65. |
Caron et al., Intracellular delivery of a Tat-eGFP fusion protein into muscle cells. Mol Ther. Mar. 2001;3(3):310-8. |
Carroll et al., Gene targeting in Drosophila and Caenorhabditis elegans with zinc-finger nucleases. Methods Mol Biol. 2008;435:63-77. doi: 10.1007/978-1-59745-232-8_5. |
Carroll et al., Progress and prospects: zinc-finger nucleases as gene therapy agents. Gene Ther. Nov. 2008;15(22):1463-8. doi: 10.1038/gt.2008.145. Epub Sep. 11, 2008. |
Carroll, A CRISPR approach to gene targeting. Mol Ther. Sep. 2012;20(9):1658-60. doi: 10.1038/mt.2012.171. |
Cermak et al., Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res. Jul. 2011;39(12):e82. Doi: 10.1093/nar/gkr218. Epub Apr. 14, 2011. |
Charpentier et al., Biotechnology: Rewriting a genome. Nature. Mar. 7, 2013;495(7439):50-1. doi: 10.1038/495050a. |
Cho et al., Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases. Genome Res. Jan. 2014;24(1):132-41. doi: 10.1101/gr.162339.113. Epub Nov. 19, 2013. |
Christian et al, Targeting G with TAL effectors: a comparison of activities of TALENs constructed with NN and NK repeat variable di-residues. PLoS One. 2012;7(9):e45383. doi: 10.1371/journal.pone.0045383. Epub Sep. 24, 2012. |
Christian et al., Targeting DNA double-strand breaks with TAL effector nucleases. Genetics. Oct. 2010;186(2):757-61. Doi: 10.1534/genetics.110.120717. Epub Jul. 26, 2010. |
Chung-Il et al., Artificial control of gene expression in mammalian cells by modulating RNA interference through aptamer-small molecule interaction. RNA. May 2006;12(5):710-6. Epub Apr. 10, 2006. |
Chylinski et al., The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems. RNA Biol. May 2013;10(5):726-37. doi: 10.4161/rna.24321. Epub Apr. 5, 2013. |
Cong et al., Comprehensive interrogation of natural TALE DNA-binding modules and transcriptional repressor domains. Nat Commun. Jul. 24, 2012;3:968. doi: 10.1038/ncomms1962. |
Cong et al., Multiplex genome engineering using CRISPR/Cas systems. Science. Feb. 15, 2013;339(6121):819-23. doi: 10.1126/science.1231143. Epub Jan. 3, 2013. |
Cornu et al., DNA-binding specificity is a major determinant of the activity and toxicity of zinc-finger nucleases. Mol Ther. Feb. 2008;16(2):352-8. Epub Nov. 20, 2007. |
Cradick et al., CRISPR/Cas9 systems targeting β-globin and CCR5 genes have substantial off-target activity. Nucleic Acids Res. Nov. 1, 2013;41(20):9584-92. doi: 10.1093/nar/gkt714. Epub Aug. 11, 2013. |
Cradick et al., ZFN-site searches genomes for zinc finger nuclease target sites and off-target sites. BMC Bioinformatics. May 13, 2011;12:152. doi: 10.1186/1471-2105-12-152. |
Cradick et al., Zinc-finger nucleases as a novel therapeutic strategy for targeting hepatitis B virus DNAs. Mol Ther. May 2010;18(5):947-54. Doi: 10.1038/mt.2010.20. Epub Feb. 16, 2010. |
Cui et al., Targeted integration in rat and mouse embryos with zinc-finger nucleases. Nat Biotechnol. Jan. 2011;29(1):64-7. Doi: 10.1038/nbt.1731. Epub Dec. 12, 2010. |
Dahlem et al., Simple methods for generating and detecting locus-specific mutations induced with TALENs in the zebrafish genome. PLoS Genet. 2012;8(8):e1002861. doi: 10.1371/journal.pgen.1002861. Epub Aug. 16, 2012. |
De Souza, Primer: genome editing with engineered nucleases. Nat Methods. Jan. 2012;9(1):27. |
Deltcheva et al., CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature. Mar. 31, 2011;471(7340):602-7. doi: 10.1038/nature09886. |
Dicarlo et al., Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. Apr. 2013;41(7):4336-43. doi: 10.1093/nar/gkt135. Epub Mar. 4, 2013. |
Ding et al., A TALEN genome-editing system for generating human stem cell-based disease models. Cell Stem Cell. Feb. 7, 2013;12(2):238-51. Doi: 10.1016/j.stem.2012.11.011. Epub Dec. 13, 2012. |
Doyon et al., Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures. Nat Methods. Jan. 2011;8(1):74-9. Doi: 10.1038/nmeth.1539. Epub Dec. 5, 2010. |
Doyon et al., Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat Biotechnol. Jun. 2008;26(6):702-8. Doi: 10.1038/nbt1409. Epub May 25, 2008. |
Esvelt et al., Genome-scale engineering for systems and synthetic biology. Mol Syst Biol. 2013;9:641. doi: 10.1038/msb.2012.66. |
Esvelt et al., Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. Nov. 2013;10(11):1116-21. doi: 10.1038/nmeth.2681. Epub Sep. 29, 2013. |
Fu et al., Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol. Mar. 2014;32(3):279-84. doi: 10.1038/nbt.2808. Epub Jan. 26, 2014. |
Fu et al., High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. Sep. 2013;31(9):822-6. doi: 10.1038/nbt.2623. Epub Jun. 23, 2013. |
Fuchs et al., Polyarginine as a multifunctional fusion tag. Protein Sci. Jun. 2005;14(6):1538-44. |
Gabriel et al., An unbiased genome-wide analysis of zinc-finger nuclease specificity. Nat Biotechnol. Aug. 7, 2011;29(9):816-23. doi: 10.1038/nbt.1948. |
Gaj et al., Structure-guided reprogramming of serine recombinase DNA sequence specificity. Proc Natl Acad Sci U S A. Jan. 11, 2011;108(2):498-503. doi: 10.1073/pnas.1014214108. Epub Dec. 27, 2010. |
Gaj et al., ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. Jul. 2013;31(7):397-405. doi: 10.1016/j.tibtech.2013.04.004. Epub May 9, 2013. |
Gao et al., Crystal structure of a TALE protein reveals an extended N-terminal DNA binding region. Cell Res. Dec. 2012;22(12):1716-20. doi: 10.1038/cr.2012.156. Epub Nov. 13, 2012. |
Gasiunas et al., Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci U S A. Sep. 25, 2012;109(39):E2579-86. Epub Sep. 4, 2012. Supplementary materials included. |
Gasiunas et al., RNA-dependent DNA endonuclease Cas9 of the CRISPR system: Holy Grail of genome editing? Trends Microbiol. Nov. 2013;21(11):562-7. doi: 10.1016/j.tim.2013.09.001. Epub Oct. 1, 2013. |
Gilbert et al., CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 2013 154(2):442-51. |
Gilleron et al., Image-based analysis of lipid nanoparticle-mediated siRNA delivery, intracellular trafficking and endosomal escape. Nat Biotechnol. Jul. 2013;31(7):638-46. doi: 10.1038/nbt.2612. Epub Jun. 23, 2013. |
Gordley et al., Evolution of programmable zinc finger-recombinases with activity in human cells. J Mol Biol. Mar. 30, 2007;367(3):802-13. Epub Jan. 12, 2007. |
Guilinger et al., Broad specificity profiling of TALENs results in engineered nucleases with improved DNA-cleavage specificity. Nat Methods. Apr. 2014;11(4):429-35. doi: 10.1038/nmeth.2845. Epub Feb. 16, 2014. |
Guilinger et al., Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat Biotechnol. Jun. 2014;32(6):577-82. doi: 10.1038/nbt.2909. Epub Apr. 25, 2014. |
Guo et al., Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases. J Mol Biol. Jul. 2, 2010;400(1):96-107. doi: 10.1016/j.jmb.2010.04.060. Epub May 4, 2010. |
Guo et al., Protein tolerance to random amino acid change. Proc Natl Acad Sci U S A. Jun. 22, 2004;101(25):9205-10. Epub Jun. 14, 2004. |
Guo et al., Structure of Cre recombinase complexed with DNA in a site-specific recombination synapse. Nature. Sep. 4, 1997;389(6646):40-6. |
Gupta et al., Zinc finger protein-dependent and -independent contributions to the in vivo off-target activity of zinc finger nucleases. Nucleic Acids Res. Jan. 2011;39(1):381-92. doi: 10.1093/nar/gkq787. Epub Sep. 14, 2010. |
Hale et al., RNA-guided Rna cleavage by a CRISPR RNA-Cas protein complex. Cell. Nov. 25, 2009;139(5):945-56. doi: 10.1016/j.ce11.2009.07.040. |
Händel et al., Expanding or restricting the target site repertoire of zinc-finger nucleases: the inter-domain linker as a major determinant of target site selectivity. Mol Ther. Jan. 2009;17(1):104-11. doi: 10.1038/mt.2008.233. Epub Nov. 11, 2008. |
Hartung et al., Cre mutants with altered DNA binding properties. J Biol Chem. Sep. 4, 1998;273(36):22884-91. |
Hasadsri et al., Functional protein delivery into neurons using polymeric nanoparticles. J Biol Chem. Mar. 13, 2009;284(11):6972-81. doi: 10.1074/jbc.M805956200. Epub Jan. 7, 2009. |
Hill et al., Functional analysis of conserved histidines in ADP-glucose pyrophosphorylase from Escherichia coli.Biochem Biophys Res Commun. Mar. 17, 1998;244(2):573-7. |
Hirano et al., Site-specific recombinases as tools for heterologous gene integration. Appl Microbiol Biotechnol. Oct. 2011;92(2):227-39. doi: 10.1007/s00253-011-3519-5. Epub Aug. 7, 2011. Review. |
Hockemeyer et al., Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol. Sep. 2009;27(9):851-7. doi: 10.1038/nbt.1562. Epub Aug. 13, 2009. |
Hockemeyer et al., Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol. Jul. 7, 2011;29(8):731-4. doi: 10.1038/nbt.1927. |
Horvath et al., CRISPR/Cas, the immune system of bacteria and archaea. Science. Jan. 8, 2010;327(5962):167-70. doi: 10.1126/science.1179555. |
Houdebine, The methods to generate transgenic animals and to control transgene expression. J Biotechnol. Sep. 25, 2002;98(2-3):145-60. |
Hsu et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. Sep. 2013;31(9):827-32. doi: 10.1038/nbt.2647. Epub Jul. 21, 2013. |
Huang et al., Heritable gene targeting in zebrafish using customized TALENs. Nat Biotechnol. Aug. 5, 2011;29(8):699-700. doi: 10.1038/nbt.1939. |
Humbert et al., Targeted gene therapies: tools, applications, optimization. Crit Rev Biochem Mol Biol. May-Jun. 2012;47(3):264-81. doi: 10.3109/10409238.2012.658112. |
Hurt et al., Highly specific zinc finger proteins obtained by directed domain shuffling and cell-based selection. Proc Natl Acad Sci U S A. Oct. 14, 2003;100(21):12271-6. Epub Oct. 3, 2003. |
Hwang et al., Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. Mar. 2013;31(3):227-9. doi: 10.1038/nbt.2501. Epub Jan. 29, 2013. |
Jamieson et al., Drug discovery with engineered zinc-finger proteins. Nat Rev Drug Discov. May 2003;2(5):361-8. |
Jiang et al., RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. Mar. 2013;31(3):233-9. doi: 10.1038/nbt.2508. Epub Jan. 29, 2013. |
Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. Aug. 17, 2012;337(6096):816-21. doi: 10.1126/science.1225829. Epub Jun. 28, 2012. |
Jinek et al., RNA-programmed genome editing in human cells. Elife. Jan. 29, 2013;2:e00471. doi: 10.7554/eLife.00471. |
Jinek et al., Structures of Cas9 endonucleases reveal RNA-mediated conformational activation. Science. Mar. 14, 2014;343(6176):1247997. doi: 10.1126/science.1247997. Epub Feb. 6, 2014. |
Jore et al., Structural basis for CRISPR RNA-guided DNA recognition by Cascade. Nat Struct Mol Biol. May 2011;18(5):529-36. doi: 10.1038/nsmb.2019. Epub Apr. 3, 2011. |
Joung et al.,TALENs: a widely applicable technology for targeted genome editing. Nat Rev Mol Cell Biol. Jan. 2013;14(1):49-55. doi: 10.1038/nrm3486. Epub Nov. 21, 2012. |
Kaiser et al., Gene therapy. Putting the fingers on gene repair. Science. Dec. 23, 2005;310(5756):1894-6. |
Kandavelou et al., Targeted manipulation of mammalian genomes using designed zinc finger nucleases. Biochem Biophys Res Commun. Oct. 9, 2009;388(1):56-61. doi: 10.1016/j.bbrc.2009.07.112. Epub Jul. 25, 2009. |
Kappel et al., Regulating gene expression in transgenic animals.Curr Opin Biotechnol. Oct. 1992;3(5):548-53. |
Karpenshif et al., From yeast to mammals: recent advances in genetic control of homologous recombination. DNA Repair (Amst). Oct. 1, 2012;11(10):781-8. doi: 10.1016/j.dnarep.2012.07.001. Epub Aug. 11, 2012. Review. |
Kilbride et al., Determinants of product topology in a hybrid Cre-Tn3 resolvase site-specific recombination system. J Mol Biol. Jan. 13, 2006;355(2):185-95. Epub Nov. 9, 2005. |
Kim et al., A library of TAL effector nucleases spanning the human genome. Nat Biotechnol. Mar. 2013;31(3):251-8. Doi: 10.1038/nbt.2517. Epub Feb. 17, 2013. |
Kim et al., Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. Jun. 2014;24(6):1012-9. doi: 10.1101/gr.171322.113. Epub Apr. 2, 2014. |
Kim et al., Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc Natl Acad Sci U S A. Feb. 6, 1996;93(3):1156-60. |
Kim et al., TALENs and ZFNs are associated with different mutationsignatures. Nat Methods. Mar. 2013;10(3):185. doi: 10.1038/nmeth.2364. Epub Feb. 10, 2013. |
Kim et al., Targeted genome editing in human cells with zinc finger nucleases constructed via modular assembly. Genome Res. Jul. 2009;19(7):1279-88. doi: 10.1101/gr.089417.108. Epub May. 21, 2009. |
Klauser et al., An engineered small RNA-mediated genetic switch based on a ribozyme expression platform. Nucleic Acids Res. May 1, 2013;41(10):5542-52. doi: 10.1093/nar/gkt253. Epub Apr. 12, 2013. |
Klug et al., Zinc fingers: a novel protein fold for nucleic acid recognition. Cold Spring Harb Symp Quant Biol. 1987;52:473-82. |
Krishna et al., Structural classification of zinc fingers: survey and summary. Nucleic Acids Res. Jan. 15, 2003;31(2):532-50. |
Larson et al., CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat Protoc. Nov. 2013;8(11):2180-96. doi: 10.1038/nprot.2013.132. Epub Oct. 17, 2013. |
Lazar et al., Transforming growth factor alpha: mutation of aspartic acid 47 and leucine 48 results in different biological activities. Mol Cell Biol. Mar. 1988;8(3):1247-52. |
Lei et al., Efficient targeted gene disruption in Xenopus embryos using engineered transcription activator-like effector nucleases (TALENs). Proc Natl Acad Sci U S A. Oct. 23, 2012;109(43):17484-9. Doi: 10.1073/pnas.1215421109. Epub Oct. 8, 2012. |
Lewis et al., A serum-resistant cytofectin for cellular delivery of antisense oligodeoxynucleotides and plasmid DNA. Proc Natl Acad Sci U S A. Apr. 16, 1996;93(8):3176-81. |
Li et al., Current approaches for engineering proteins with diverse biological properties. Adv Exp Med Biol. 2007;620:18-33. |
Li et al., Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes. Nucleic Acids Res. Aug. 2011;39(14):6315-25. doi: 10.1093/nar/gkr188. Epub Mar. 31, 2011. |
Li et al., TAL nucleases (TALNs): hybrid proteins composed of Tal effectors and FokI DNA-cleavage domain. Nucleic Acids Res. Jan. 2011;39(1):359-72. doi: 10.1093/nar/gkq704. Epub Aug. 10, 2010. |
Liu et al., Cell-penetrating peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering. PLoS One. Jan. 20, 2014;9(1):e85755. doi: 10.1371/journal.pone.0085755. eCollection 2014. |
Liu et al., Design of polydactyl zinc-finger proteins for unique addressing within complex genomes. Proc Natl Acad Sci U S A. May 27, 1997;94(11):5525-30. |
Liu et al., Fast Colorimetric Sensing of Adenosine and Cocaine Based on a General Sensor Design Involving Aptamers and Nanoparticles. Angew Chem. 2006;118(1):96-100. |
Lombardo et al., Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nat Biotechnol. Nov. 2007;25(11):1298-306. Epub Oct. 28, 2007. |
Lundberg et al., Delivery of short interfering RNA using endosomolytic cell-penetrating peptides. Faseb J. Sep. 2007;21(11):2664-71. Epub Apr. 26, 2007. |
Maeder et al., CRISPR RNA-guided activation of endogenous human genes. Nat Methods. Oct. 2013;10(10):977-9. doi: 10.1038/nmeth.2598. Epub Jul. 25, 2013. |
Maeder et al., Rapid “open-source” engineering of customized zinc-finger nucleases for highly efficient gene modification. Mol Cell. Jul. 25, 2008;31(2):294-301. doi:10.1016/j.molce1.2008.06.016. |
Maeder et al., Robust, synergistic regulation of human gene expression using TALE activators. Nat Methods. Mar. 2013;10(3):243-5. doi: 10.1038/nmeth.2366. Epub Feb. 10, 2013. |
Mahfouz et al., De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks. Proc Natl Acad Sci U S A. Feb. 8, 2011;108(6):2623-8. doi: 10.1073/pnas.1019533108. Epub Jan. 24, 2011. |
Mak et al., The crystal structure of TAL effector PthXo1 bound to its DNA target. Science. Feb. 10, 2012;335(6069):716-9. doi: 10.1126/science.1216211. Epub Jan. 5, 2012. |
Mali et al., Cas9 as a versatile tool for engineeringbiology. Nat Methods. Oct. 2013;10(10):957-63. doi: 10.1038/nmeth.2649. |
Mali et al., CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol. Sep. 2013;31(9):833-8. doi: 10.1038/nbt.2675. Epub Aug. 1, 2013. |
Mali et al., RNA-guided human genome engineering via Cas9. Science. Feb. 15, 2013;339(6121):823-6. doi: 10.1126/science.1232033. Epub Jan. 3, 2013. |
Mani et al., Design, engineering, and characterization of zinc finger nucleases. Biochem Biophys Res Commun. Sep. 23, 2005;335(2):447-57. |
Meckler et al., Quantitative analysis of TALE-DNA interactions suggests polarity effects. Nucleic Acids Res. Apr. 2013;41(7):4118-28. doi: 10.1093/nar/gkt085. Epub Feb. 13, 2013. |
Meng et al., Profiling the DNA-binding specificities of engineered Cys2His2 zinc finger domains using a rapid cell-based method. Nucleic Acids Res. 2007;35(11):e81. Epub May 30, 2007. |
Meng et al., Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases. Nat Biotechnol. Jun. 2008;26(6):695-701. doi: 10.1038/nbt1398. Epub May 25, 2008. |
Miller et al., A TALE nuclease architecture for efficient genome editing. Nat Biotechnol. Feb. 2011;29(2):143-8. doi:10.1038/nbt.1755. Epub Dec. 22, 2010. |
Miller et al., An improved zinc-finger nuclease architecture for highly specific genome editing. Nat Biotechnol. Jul. 2007;25(7):778-85. Epub Jul. 1, 2007. |
Moore et al., Improved somatic mutagenesis in zebrafish using transcription activator-like effector nucleases (TALENs). PloS One. 2012;7(5):e37877. Doi: 10.1371/journal.pone.0037877. Epub May 24, 2012. |
Morbitzer et al., Assembly of custom TALE-type DNA binding domains by modular cloning. Nucleic Acids Res. Jul. 2011;39(13):5790-9. doi: 10.1093/nar/gkr151. Epub Mar. 18, 2011. |
Moscou et al., A simple cipher governs DNA recognition by TAL effectors. Science. Dec. 11, 2009;326(5959):1501. doi: 10.1126/science.1178817. |
Mullins et al., Transgenesis in nonmurine species. Hypertension. Oct. 1993;22(4):630-3. |
Mussolino et al., A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic Acids Res. Nov. 2011;39(21):9283-93. Doi: 10.1093/nar/gkr597. Epub Aug. 3, 2011. |
Mussolino et al., Tale nucleases: tailored genome engineering made easy. Curr Opin Biotechnol. Oct. 2012;23(5):644-50. doi: 10.1016/j.copbio.2012.01.013. Epub Feb. 17, 2012. |
Narayanan et al., Clamping down on weak terminal base pairs: oligonucleotides with molecular caps as fidelity-enhancing elements at the 5′- and 3′-terminal residues. Nucleic Acids Res. May 20, 2004;32(9):2901-11. Print 2004. |
Nishimasu et al., Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell. Feb. 27, 2014;156(5):935-49. doi: 10.1016/j.ce11.2014.02.001. Epub Feb. 13, 2014. |
Nomura et al., Synthetic mammalian riboswitches based on guanine aptazyme. Chem Commun (Camb). Jul. 21, 2012;48(57):7215-7. doi: 10.1039/c2cc33140c. Epub Jun. 13, 2012. |
O'Connell et al., Programmable RNA recognition and cleavage by CRISPR/Cas9. Nature. Dec. 11, 2014;516(7530):263-6. doi: 10.1038/nature13769. Epub Sep. 28, 2014. |
Osborn et al., Talen-based gene correction for epidermolysis bullosa. Mol Ther. Jun. 2013;21(6):1151-9. doi: 10.1038/mt.2013.56. Epub Apr. 2, 2013. |
Pabo et al., Design and selection of novel Cys2His2 zinc finger proteins. Annu Rev Biochem. 2001;70:313-40. |
Pan et al., Biological and biomedical applications of engineered nucleases. Mol Biotechnol. Sep. 2013;55(1):54-62. doi: 10.1007/s12033-012-9613-9. |
Pattanayak et al., Determining the specificities of TALENs, Cas9, and other genome-editing enzymes. Methods Enzymol. 2014;546:47-78. doi: 10.1016/B978-0-12-801185-0.00003-9. |
Pattanayak et al., High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat Biotechnol. Sep. 2013;31(9):839-43. doi: 10.1038/nbt.2673. Epub Aug. 11, 2013. |
Pattanayak et al., Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection. Nat Methods. Aug. 7, 2011;8(9):765-70. doi: 10.1038/nmeth.1670. |
Pavletich et al., Zinc finger-DNA recognition: crystal structure of a Zif268-DNA complex at 2.1 A. Science. May 10, 1991;252(5007):809-17. |
Pennisi et al., The tale of the TALEs. Science. Dec. 14, 2012;338(6113):1408-11. doi: 10.1126/science.338.6113.1408. |
Perez et al., Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases. Nat Biotechnol. Jul. 2008;26(7):808-16. Doi: 10.1038/nbt1410. Epub Jun. 29, 2008. |
Perez-Pinera et al., Advances in targeted genome editing. Curr Opin Chem Biol. Aug. 2012;16(3-4):268-77. doi: 10.1016/j.cbpa.2012.06.007. Epub Jul. 20, 2012. |
Perez-Pinera et al., RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nat Methods. Oct. 2013;10(10):973-6. doi: 10.1038/nmeth.2600. Epub Jul. 25, 2013. |
Petek et al., Frequent endonuclease cleavage at off-target locations in vivo. Mol Ther. May 2010;18(5):983-6. Doi: 10.1038/mt.2010.35. Epub Mar. 9, 2010. |
Phillips, The challenge of gene therapy and DNA delivery. J Pharm Pharmacol. Sep. 2001;53(9):1169-74. |
Porteus, Design and testing of zinc finger nucleases for use in mammalian cells. Methods Mol Biol. 2008;435:47-61. doi: 10.1007/978-1-59745-232-8_4. |
Proudfoot et al., Zinc finger recombinases with adaptable DNA sequence specificity. PLoS One. Apr. 29, 2011;6(4):e19537. doi: 10.1371/journal.pone.0019537. |
Qi et al., Engineering naturally occurring trans-acting non-coding RNAs to sense molecular signals. Nucleic Acids Res. Jul. 2012;40(12):5775-86. doi: 10.1093/nar/gks168. Epub Mar. 1, 2012. |
Qi et al., Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell. Feb. 28, 2013;152(5):1173-83. doi: 10.1016/j.ce11.2013.02.022. |
Ramakrishna et al., Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Res. Jun. 2014;24(6):1020-7. doi: 10.1101/gr.171264.113. Epub Apr. 2, 2014. |
Ramirez et al., Engineered zinc finger nickases induce homology-directed repair with reduced mutagenic effects. Nucleic Acids Res. Jul. 2012;40(12):5560-8. doi: 10.1093/nar/gks179. Epub Feb. 28, 2012. |
Ramirez et al., Unexpected failure rates for modular assembly of engineered zinc fingers. Nat Methods. May 2008;5(5):374-5. Doi: 10.1038/nmeth0508-374. |
Ran et al., Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. Sep. 12, 2013;154(6):1380-9. doi: 10.1016/j.ce11.2013.08.021. Epub Aug. 29, 2013. |
Reyon et al., Flash assembly of TALENs for high-throughput genome editing. Nat Biotechnol. May 2012;30(5):460-5. doi: 10.1038/nbt.2170. |
Saleh-Gohari et al., Conservative homologous recombination preferentially repairs DNA double-strand breaks in the S phase of the cell cycle in human cells. Nucleic Acids Res. Jul. 13, 2004;32(12):3683-8. Print 2004. |
Samal et al., Cationic polymers and their therapeutic potential. Chem Soc Rev. Nov. 7, 2012;41(21):7147-94. doi: 10.1039/c2cs35094g. Epub Aug. 10, 2012. |
Sander et al., CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. Apr. 2014;32(4):347-55. doi: 10.1038/nbt.2842. Epub Mar. 2, 2014. |
Sander et al., In silico abstraction of zinc finger nuclease cleavage profiles reveals an expanded landscape of off-target sites. Nucleic Acids Res. Oct. 2013;41(19):e181. doi: 10.1093/nar/gkt716. Epub Aug. 14, 2013. |
Sander et al., Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nat Biotechnol. Aug. 5, 2011;29(8):697-8. doi: 10.1038/nbt.1934. |
Sang, Prospects for transgenesis in the chick. Mech Dev. Sep. 2004;121(9):1179-86. |
Santiago et al., Targeted gene knockout in mammalian cells by using engineered zinc-finger nucleases. Proc Natl Acad Sci U S A. Apr. 15, 2008;105(15):5809-14. doi: 10.1073/pnas.0800940105. Epub Mar. 21, 2008. |
Sapranauskas et al., The Streptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli. Nucleic Acids Res. Nov. 2011;39(21):9275-82. doi: 10.1093/nar/gkr606. Epub Aug. 3, 2011. |
Sashital et al., Mechanism of foreign DNA selection in a bacterial adaptive immune system. Mol Cell. Jun. 8, 2012;46(5):606-15. doi: 10.1016/j.molcel.2012.03.020. Epub Apr. 19, 2012. |
Schriefer et al., Low pressure DNA shearing: a method for random DNA sequence analysis. Nucleic Acids Res. Dec. 25, 1990;18(24):7455-6. |
Schwank et al., Functional repair of CFTR by CRISPR/Cas9 in intestinal stem cell organoids of cystic fibrosis patients. Cell Stem Cell. Dec. 5, 2013;13(6):653-8. doi:10.1016/j.stem.2013.11.002. |
Schwartz et al., Post-translational enzyme activation in an animal via optimized conditional protein splicing. Nat Chem Biol. Jan. 2007;3(1):50-4. Epub Nov. 26, 2006. |
Schwarze et al., In vivo protein transduction: delivery of a biologically active protein into the mouse. Science. Sep. 3, 1999;285(5433):1569-72. |
Segal et al., Evaluation of a modular strategy for the construction of novel polydactyl zinc finger DNA-binding proteins. Biochemistry. Feb. 25, 2003;42(7):2137-48. |
Segal et al., Toward controlling gene expression at will: selection and design of zinc finger domains recognizing each of the 5′-GNN-3′ DNA target sequences. Proc Natl Acad Sci U S A. Mar. 16, 1999;96(6):2758-63. |
Sells et al., Delivery of protein into cells using polycationic liposomes. Biotechniques. Jul. 1995;19(1):72-6, 78. |
Semenova et al., Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence. Proc Natl Acad Sci U S A. Jun. 21, 2011;108(25):10098-103. doi: 10.1073/pnas.1104144108. Epub Jun. 6, 2011. |
Serganov et al., Structural basis for discriminative regulation of gene expression by adenine-and guanine-sensing mRNAs. Chem Biol. Dec. 2004;11(12):1729-41. |
Sheridan, First CRISPR-Cas patent opens race to stake out intellectual property. Nat Biotechnol. 2014;32(7):599-601. |
Shimizu et al., Adding fingers to an engineered zinc finger nuclease can reduce activity. Biochemistry. Jun. 7, 2011;50(22):5033-41. doi: 10.1021/bi200393g. Epub May 11, 2011. |
Siebert et al., An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res. Mar. 25, 1995;23(6):1087-8. |
Sun et al., Optimized TAL effector nucleases (TALENs) for use in treatment of sickle cell disease. Mol Biosyst. Apr. 2012;8(4):1255-63. doi: 10.1039/c2mb05461b. Epub Feb. 3, 2012. |
Szczepek et al., Structure-based redesign of the dimerization interface reduces the toxicity of zinc-finger nucleases. Nat Biotechnol. Jul. 2007;25(7):786-93. Epub Jul. 1, 2007. |
Tebas et al., Gene editing of CCR5 in autologous CD4 T cells of persons infected with HIV. N Engl J Med. Mar. 6, 2014;370(10):901-10. doi: 10.1056/NEJMoa1300662. |
Thorpe et al., Functional correction of episomal mutations with short DNA fragments and RNA-DNA oligonucleotides. J Gene Med. Mar.-Apr. 2002;4(2):195-204. |
Tsai et al., Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. Jun. 2014;32(6):569-76. doi: 10.1038/nbt.2908. Epub Apr. 25, 2014. |
Urnov et al., Genome editing with engineered zinc finger nucleases. Nat Rev Genet. Sep. 2010;11(9):636-46. doi: 10.1038/nrg2842. |
Urnov et al., Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. Jun. 2, 2005;435(7042):646-51. Epub Apr. 3, 2005. |
Van Duyne et al., Teaching Cre to follow directions. Proc Natl Acad Sci U S A. Jan. 6, 2009;106(1):4-5. doi: 10.1073/pnas.0811624106. Epub Dec. 31, 2008. |
Vanamee et al., FokI requires two specific DNA sites for cleavage. J Mol Biol. May 25, 2001;309(1):69-78. |
Wacey et al., Disentangling the perturbational effects of amino acid substitutions in the DNA-binding domain of p53. Hum Genet. Jan. 1999;104(1):15-22. |
Wadia et al., Modulation of cellular function by TAT mediated transduction of full length proteins. Curr Protein Pept Sci. Apr. 2003;4(2):97-104. |
Wadia et al., Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat Med. Mar. 2004;10(3):310-5. Epub Feb. 8, 2004. |
Wah et al., Structure of FokI has implications for DNA cleavage. Proc Natl Acad Sci U S A. Sep. 1, 1998 ;95(18):10564-9. |
Wang et al., Genetic screens in human cells using the CRISPR-Cas9 system. Science. Jan. 3, 2014;343(6166):80-4. doi: 10.1126/science.1246981. Epub Dec. 12, 2013. |
Wang et al., One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. May 9, 2013;153(4):910-8. doi: 10.1016/j.ce11.2013.04.025. Epub May 2, 2013. |
Wang et al., Targeted gene addition to a predetermined site in the human genome using a ZFN-based nicking enzyme. Genome Res. Jul. 2012;22(7):1316-26. doi: 10.1101/gr.122879.111. Epub Mar. 20, 2012. |
Weber et al., Assembly of designer TAL effectors by Golden Gate cloning. PLoS One. 2011;6(5):e19722. doi:10.1371/journal.pone.0019722. Epub May 19, 2011. |
Wiedenheft et al., RNA-guided genetic silencing systems in bacteria and archaea. Nature. Feb. 15, 2012;482(7385):331-8. doi: 10.1038/nature10886. Review. |
Wolfe et al., Analysis of zinc fingers optimized via phage display: evaluating the utility of a recognition code. J Mol Biol. Feb. 5, 1999;285(5):1917-34. |
Wood et al., Targeted genome editing across species using ZFNs and TALENs. Science. Jul. 15, 2011;333(6040):307. doi: 10.1126/science.1207773. Epub Jun. 23, 2011. |
Wu et al., Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell. Dec. 5, 2013;13(6):659-62. doi: 10.1016/j.stem.2013.10.016. |
Yanover et al., Extensive protein and DNA backbone sampling improves structure-based specificity prediction for C2H2 zinc fingers. Nucleic Acids Res. Jun. 2011;39(11):4564-76. doi: 10.1093/nar/gkr048. Epub Feb. 22, 2011. |
Yin et al., Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nat Biotechnol. Jun. 2014;32(6):551-3. doi: 10.1038/nbt.2884. Epub Mar. 30, 2014. |
Zhang et al., Conditional gene manipulation: Cre-ating a new biological era. J Zhejiang Univ Sci B. Jul. 2012;13(7):511-24. doi: 10.1631/jzus.B1200042. Review. |
Zhang et al., CRISPR/Cas9 for genome editing: progress, implications and challenges. Hum Mol Genet. Sep. 15, 2014;23(R1):R40-6. doi: 10.1093/hmg/ddu125. Epub Mar. 20, 2014. |
Zhang et al., Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol. Feb. 2011;29(2):149-53. doi: 10.1038/nbt.1775. Epub Jan. 19, 2011. |
Zou et al., Gene targeting of a disease-related gene in human induced pluripotent stem and embryonic stem cells. Cell Stem Cell. Jul. 2, 2009;5(1):97-110. doi: 10.1016/j.stem.2009.05.023. Epub Jun. 18, 2009. |
Abudayyeh et al., C2c2 is a single-component programmable RNA-guided RNA-targeting Crispr effector. Science Aug. 2016;353(6299):aaf5573. DOI: 10.1126/science.aaf5573. |
Billon et al., CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. Sep. 21, 2017;67(6):1068-1079.e4. doi: 10.1016/j.molcel.2017.08.008. Epub Sep. 7, 2017. |
Bolotin et al., Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology. Aug. 2005;151(Pt 8):2551-61. |
Brouns et al., Small CRISPR RNAs guide antiviral defense in prokaryotes. Science. Aug. 15, 2008;321(5891):960-4. doi: 10.1126/science.1159689. |
Buchwald et al., Long-term, continuous intravenous heparin administration by an implantable infusion pump in ambulatory patients with recurrent venous thrombosis. Surgery. Oct. 1980;88(4):507-16. |
Burstein et al., New CRISPR-Cas systems from uncultivated microbes. Nature Feb. 2017;542(7640):237-240. |
Covino et al., The CCL2/CCR2 Axis in the Pathogenesis of HIV-1 Infection: A New Cellular Target for Therapy? Current Drug Targets Dec. 2016;17(1):76-110. DOI : 10.2174/138945011701151217110917. |
Dicarlo et al., Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research Apr. 2013;41(7):4336-43. |
Ding et al., Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circ Res. Aug. 15, 2014;115(5):488-92. doi: 10.1161/Circresaha.115.304351. Epub Jun. 10, 2014. |
During et al., Controlled release of dopamine from a polymeric brain implant: in vivo characterization. Ann Neurol. Apr. 1989;25(4):351-6. |
East-Seletsky et al., Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection. Nature Oct. 2016;538(7624):270-3. |
Ferretti et al., Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc Natl Acad Sci U S A. Apr. 10, 2001;98(8):4658-63. |
Fukui et al., DNA Mismatch Repair in Eukaryotes and Bacteria. J Nucleic Acids. Jul. 27, 2010;2010. pii: 260512. doi: 10.4061/2010/260512. |
Garneau et al., The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature. Nov. 4, 2010;468(7320):67-71. doi: 10.1038/nature09523. |
Heller et al., Replisome assembly and the direct restart of stalled replication forks. Nat Rev Mol Cell Biol. Dec. 2006;7(12):932-43. Epub Nov. 8, 2006. |
Howard et al., Intracerebral drug delivery in rats with lesion-induced memory deficits. J Neurosurg. Jul. 1989;71(1):105-12. |
Ishino et al., Nucleotide sequence of the iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol. Dec. 1987;169(12):5429-33. |
Jansen et al., Identification of genes that are associated with DNA repeats in prokaryotes. Mol Microbiol. Mar. 2002;43(6):1565-75. |
Kaya et al., A bacterial Argonaute with noncanonical guide RNA specificity. Proc. Natl. Acad. Sci. USA Apr. 2016;113(15):4057-62. |
Komor et al., Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity. Sci Adv. Aug. 30, 2017;3(8):eaao4774. doi: 10.1126/sciadv.aao4774. eCollection Aug. 2017. |
Kunz et al., DNA Repair in mammalian cells: Mismatched repair: variations on a theme. Cell Mol Life Sci. Mar. 2009;66(6):1021-38. doi: 10.1007/s00018-009-8739-9. |
Langer et al., Chemical and Physical Structure of Polymers as Carriers for Controlled Release of Bioactive Agents: A Review. Journal of Macromolecular Science, 2006;23(1):61-126. DOI: 10.1080/07366578308079439. |
Langer et al., New methods of drug delivery. Science. Sep. 28, 1990;249(4976):1527-33. |
Lau et al., Molecular basis for discriminating between normal and damaged bases by the human alkyladenine glycosylase, AAG. Proc Natl Acad Sci U S A. Dec. 5, 2000;97(25):13573-8. |
Lee et al., Failure to detect DNA-guided genome editing using Natronobacterium gregoryi Argonaute. Nat Biotechnol. Nov. 28, 2016;35(1):17-18. doi: 10.1038/nbt.3753. |
Levy et al., Inhibition of calcification of bioprosthetic heart valves by local controlled-release diphosphonate. Science. Apr. 12, 1985;228(4696):190-2. |
Lieber et al., Mechanism and regulation of human non-homologous DNA end-joining. Nat Rev Mol Cell Biol. Sep. 2003;4(9):712-20. |
Liu et al., C2c1-sgRNA Complex Structure Reveals RNA-Guided DNA Cleavage Mechanism. Molecular Cell Jan. 2017;65(2):310-22. |
Liu et al., Distance determination by GIY-YIG intron endonucleases: discrimination between repression and cleavage functions. Nucleic Acids Res. Mar. 31, 2006;34(6):1755-64. Print 2006. |
Losey et al., Crystal structure of Staphylococcus sureus tRNA adenosine deaminase tadA in complex with RNA. Nature Struct. Mol. Biol. Feb. 2006;13(2):153-9. |
Lyons et al., Efficient Recognition of an Unpaired Lesion by a DNA Repair Glycosylase. J. Am. Chem. Soc., 2009;131(49):17742-3. DOI: 10.1021/ja908378y. |
Makarova et al., Prokaryotic homologs of Argonaute proteins are predicted to function as key components of a novel system of defense against mobile genetic elements. Biology Direct 2009;4:29. |
Makarova et al., An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol. Nov. 2015;13(11):722-36. doi: 10.1038/nrmicro3569. Epub Sep. 28, 2015. |
Makarova et al., Evolution and classification of the CRISPR-Cas systems. Nat Rev Microbiol. Jun. 2011;9(6):467-77. doi: 10.1038/nrmicro2577. Epub May 9, 2011. |
Marraffini et al., CRISPR interference limits horizontal gene transfer in Staphylococci by targeting DNA. Science. Dec. 19, 2008;322(5909):1843-5. doi: 10.1126/science.1165771. |
Mei et al., Recent Progress in CRISPR/Cas9 Technology. J Genet Genomics. Feb. 20, 2016;43(2):63-75. doi: 10.1016/j.jgg.2016.01.001. Epub Jan. 18, 2016. |
Mojica et al., Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements. J Mol Evol. Feb. 2005;60(2):174-82. |
Pourcel et al., CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology. Mar. 2005;151(Pt 3):653-63. |
Prashant et al., CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology 2013;31(9):833-8. |
Ray et al., Homologous recombination: ends as the means. Trends Plant Sci. Oct. 2002;7(10):435-40. |
Richter et al., Function and regulation of clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR associated (Cas) systems. Viruses. Oct. 19, 2012;4(10):2291-311. doi: 10.3390/v4102291. |
Saudek et al., A preliminary trial of the programmable implantable medication system for insulin delivery. N Engl J Med. Aug. 31, 1989;321(9):574-9. |
Sefton et al., Implantable pumps. Crit Rev Biomed Eng. 1987;14(3):201-40. |
Shcherbakova et al., Near-infrared fluorescent proteins for multicolor in vivo imaging. Nat Methods. Aug. 2013;10(8):751-4. doi: 10.1038/nmeth.2521. Epub Jun. 16, 2013. |
Shmakov et al., Discovery and Functional Characterization of Diverse Class 2 CRISPR Cas Systems. Molecular Cell Nov. 2015;60(3):385-97. |
Stephens et al., The landscape of cancer genes and mutational processes in breast cancer. Nature Jun. 2012;486:400-404. doi:10.1038/nature11017. |
Vagner et al., Efficiency of homologous DNA recombination varies along the Bacillus subtilis chromosome. J Bacteriol. Sep. 1988;170(9):3978-82. |
Wang et al., CRISPR-Cas9 Targeting of PCSK9 in Human Hepatocytes In Vivo-Brief Report. Arterioscler Thromb Vasc Biol. May 2016;36(5):783-6. doi: 10.1161/ATVBAHA.116.307227. Epub Mar. 3, 2016. |
Wolf et al., tadA, an essential tRNA-specific adenosine deaminase from Escherichia coli. EMBO J. Jul. 15, 2002;21(14):3841-51. |
Yamano et al., Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA. Cell May 2016;165(4)949-62. |
Yang et al., PAM-dependent Target DNA Recognition and Cleavage by C2C1 CRISPR-Cas endonuclease. Cell Dec. 2016;167(7):1814-28. |
Zhang et al., Stabilized plasmid-lipid particles for regional gene therapy: formulation and transfection properties. Gene Ther. Aug. 1999;6(8):1438-47. |
Aihara et al., A conformational switch controls the DNA cleavage activity of lambda integrase. Mol Cell. 2003 Jul;12(1):187-98. |
Ames et al., A eubacterial riboswitch class that senses the coenzyme tetrahydrofolate. Chem Biol. Jul. 30, 2010;17(7):681-5. doi: 10.1016/j.chembio1.2010.05.020. |
Batey et al., Structure of a natural guanine-responsive riboswitch complexed with the metabolite hypoxanthine. Nature. Nov. 18, 2004;432(7015):411-5. |
Briner et al., Guide RNA functional modules direct Cas9 activity and orthogonality. Mol Cell. Oct. 23, 2014;56(2):333-339. doi: 10.1016/j.molce1.2014.09.019. |
Buskirk et al., Directed evolution of ligand dependence: small-molecule-activated protein splicing. Proc Natl Acad Sci U S A. Jul. 20, 2004;101(29):10505-10. Epub Jul. 9, 2004. |
Chelico et al., Stochastic properties of processive cytidine DNA deaminases AID and APOBEC3G. Philos Trans R Soc Lond B Biol Sci. Mar. 12, 2009;364(1517):583-93. doi: 10.1098/rstb.2008.0195. |
Cobb et al., Directed evolution as a powerful synthetic biology tool. Methods. Mar. 15, 2013;60(1):81-90. doi: 10.1016/j.ymeth.2012.03.009. Epub Mar. 23, 2012. |
Cobb et al., Directed evolution: an evolving and enabling synthetic biology tool. Curr Opin Chem Biol. Aug. 2012;16(3-4):285-91. doi:10.1016/j.cbpa.2012.05.186. Epub Jun. 4, 2012 Review. |
Davis et al., DNA double strand break repair via non-homologous end-joining. Transl Cancer Res. Jun. 2013;2(3):130-143. |
Dixon et al., Reengineering orthogonally selective riboswitches. Proc Natl Acad Sci U S A. Feb. 16, 2010;107(7):2830-5. doi: 10.1073/pnas.0911209107. Epub Jan. 26, 2010. |
Doench et al., Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. Feb. 2016;34(2):184-191. doi: 10.1038/nbt.3437. |
Edwards et al., Crystal structures of the thi-box riboswitch bound to thiamine pyrophosphate analogs reveal adaptive RNA-small molecule recognition. Structure. Sep. 2006;14(9):1459-68. |
Endo et al., Toward establishing an efficient and versatile gene targeting system in higher plants. Biocatalysis and Agricultural Biotechnology 2014;3,(1):2-6. |
Extended European Search Report for EP 15830407.1, dated Mar. 2, 2018. |
Fang et al., Synthetic Studies Towards Halichondrins: Synthesis of the Left Halves of Norhalichondrins and Homohalichondrins. Tetrahedron Letters 1992;33(12):1557-1560. |
Ferry et al., Rational design of inducible CRISPR guide RNAs for de novo assembly of transcriptional programs. Nat Commun. Mar. 3, 2017;8:14633. doi: 10.1038/ncomms14633. |
Fischer et al., Cryptic epitopes induce high-titer humoral immune response in patients with cancer. J Immunol. Sep. 1, 2010;185(5):3095-102. doi: 10.4049/jimmuno1.0902166. Epub Jul. 26, 2010. |
Haeussler et al., Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. Jul. 5, 2016;17(1):148. doi: 10.1186/s13059-016-1012-2. |
Hickford et al., Antitumour polyether macrolides: four new halichondrins from the New Zealand deep-water marine sponge Lissodendoryx sp. Bioorg Med Chem. Mar. 15, 2009;17(6):2199-203. doi: 10.1016/j.bmc.2008.10.093. Epub Nov. 19, 2008. |
Hu et al., Chemical Biology Approaches to Genome Editing: Understanding, Controlling, and Delivering Programmable Nucleases. Cell Chem Biol. Jan. 21, 2016;23(1):57-73. doi: 10.1016/j.chembio1.2015.12.009. |
Hwang et al., Efficient In Vivo Genome Editing Using RNA-Guided Nucleases. Nat Biotechnol. Mar. 31, 2013; 31(3): 227-229. doi: 10.1038/nbt.2501. Epub Jan. 29, 2013. |
International Preliminary Report on Patentability for PCT/US2016/058344, dated May 3, 2018. |
International Search Report and Written Opinion for PCT/US2017/056671, dated Feb. 20, 2018. |
International Search Report and Written Opinion for PCT/US2017/068105, dated Apr. 4, 2018. |
International Search Report and Written Opinion for PCT/US2017/068114, dated Mar. 20, 2018. |
International Search Report for PCT/US2018/021664, dated Jun. 21, 2018. |
International Search Report for PCT/US2018/021878, dated Aug. 20, 2018. |
International Search Report for PCT/US2018/021880, dated Jun. 20, 2018. |
International Search Report for PCT/US2018/024208, dated Aug. 23, 2018. |
International Search Report for PCT/US2018/025887, dated Jun. 21, 2018. |
International Search Report for PCT/US2018/032460, dated Jul. 11, 2018. |
Invitation to Pay Additional Fees for PCT/US2018/021878, dated Jun. 8, 2018. |
Kang et al., Structural Insights into riboswitch control of the biosynthesis of queuosine, a modified nucleotide found in the anticodon of tRNA. Mol Cell. Mar. 27, 2009;33(6):784-90. doi: 10.1016/j.molce1.2009.02.019. Epub Mar. 12, 2009. |
Klein et al., Cocrystal structure of a class I preQ1 riboswitch reveals a pseudoknot recognizing an essential hypermodified nucleobase. Nat Struct Mol Biol. Mar. 2009;16(3):343-4. doi: 10.1038/nsmb.1563.Epub Feb. 22, 2009. |
Kohli et al., Local sequence targeting in the AID/APOBEC family differentially impacts retroviral restriction and antibody diversification. J Biol Chem. Dec. 24, 2010;285(52):40956-64. doi: 10.1074/jbc.M110.177402. Epub Oct. 6, 2010. |
Komor et al., CRISPR-Based Technologies for the Manipulation of Eukaryotic Genomes. Cell. Jan. 12, 2017;168(1-2):20-36. doi: 10.1016/j.ce11.2016.10.044. |
Kouzminova et al., Patterns of chromosomal fragmentation due to uracil-DNA incorporation reveal a novel mechanism of replication-dependent double-stranded breaks. Mol Microbiol. Apr. 2008;68(1):202-15. doi: 10.1111/j.1365-2958.2008.06149.x. |
Kury et al., De Novo Disruption of the Proteasome Regulatory Subunit PSMD12 Causes a Syndromic Neurodevelopmental Disorder. Am J Hum Genet. Feb. 2, 2017;100(2):352-363. doi: 10.1016/j.ajhg.2017.01.003. Epub Jan. 26, 2017. |
Kwon et al., Chemical basis of glycine riboswitch cooperativity. RNA. Jan. 2008;14(1):25-34. Epub Nov. 27, 2007. |
Lee et al., Ribozyme Mediated gRNA Generation for In Vitro and In Vivo CRISPR/Cas9 Mutagenesis. PLoS One. Nov. 10, 2016;11(11):e0166020. doi: 10.1371/journal.pone.0166020. eCollection 2016. |
Lewis et al., Building the Class 2 CRISPR-Cas Arsenal. Mol Cell 2017;65(3);377-379. |
Li et al., Base editing with a Cpfl-cytidine deaminase fusion. Nat Biotechnol. Apr. 2018;36(4):324-327. doi: 10.1038/nbt.4102. Epub Mar. 19, 2018. |
Li et al., Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. Aug. 31, 2013;(8):688-91. doi: 10.1038/nbt.2654. |
Liang et al., Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. Send to; J Biotechnol. Aug 20, 2015;208:44-53. doi: 10.1016/j.jbiotec.2015.04.024. |
Liu et al., Balancing AID and DNA repair during somatic hypermutation. Trends Immunol. Apr. 2009;30(4):173-81. doi: 10.1016/j.it.2009.01.007. |
Meyer et al., Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria. RNA. Apr. 2008;14(4):685-95. doi: 10.1261/rna.937308. Epub Feb. 27, 2008. |
Montange et al., Structure of the S-adenosylmethionine riboswitch regulatory mRNA element. Nature. Jun. 29, 2006;441(7097):1172-5. |
Mootz et al., Conditional protein splicing: a new tool to control protein structure and function in vitro and in vivo. J Am Chem Soc. Sep. 3, 2003;125(35):10561-9. |
Mootz et al., Protein splicing triggered by a small molecule. J Am Chem Soc. Aug. 7, 2002;124(31):9044-5. |
Nahvi et al., Coenzyme B12 riboswitches are widespread genetic control elements in prokaryotes. Nucleic Acids Res. Jan. 2, 2004;32(1):143-50. |
Neel et al., Riboswitches: Classification, function and in silico approach, International Journal of Pharma Sciences and Research. 2010;1(9):409-420. |
Ni et al., Nucleic acid aptamers: clinical applications and promising new horizons. Curr Med Chem. 2011;18(27):4206-14. Review. |
Pearl, Structure and function in the uracil-DNA glycosylase superfamily. Mutat Res. Aug. 30, 2000;460(3-4):165-81. |
Peck et al., Directed evolution of a small-molecule-triggered intein with improved splicing properties in mammalian cells. Chem Biol. May 27, 2011;18(5):619-30. doi: 10.1016/j.chembio1.2011.02.014. |
Plosky et al., CRISPR-Mediated Base Editing without DNA Double-Strand Breaks. Mol Cell. May 19, 2016;62(4):477-8. doi: 10.1016/j.molcel.2016.05.006. |
Roth et al., A riboswitch selective for the queuosine precursor preQ1 contains an unusually small aptamer domain. Nat Struct Mol Biol. Apr. 2007;14(4):308-17. Epub Mar. 25, 2007. |
Serganov et al., Coenzyme recognition and gene regulation by a flavin mononucleotide riboswitch. Nature. Mar. 12, 2009;458(7235):233-7. doi: 10.1038/nature07642. Epub Jan. 25, 2009. |
Serganov et al., Structural basis for gene regulation by a thiamine pyrophosphate-sensing riboswitch. Nature. Jun. 29, 2006;441(7097):1167-71. Epub May 21, 2006. |
Shee et al., Engineered proteins detect spontaneous DNA breakage in human and bacterial cells. Elife. Oct. 29, 2013 2:e01222. doi: 10.7554/eLife.01222. |
Sudarsan et al., an mRNA structure in bacteria that controls gene expression by binding lysine. Genes Dev. Nov. 1, 2003;17(21):2688-97. |
Sudarsan et al., Riboswitches in eubacteria sense the second messenger cyclic di-GMP. Science. Jul. 18, 2008;321(5887):411-3. doi: 10.1126/science.1159519. |
Suess et al., A theophylline responsive riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Res. Mar. 5, 2004;32(4):1610-4. |
Tang et al., Aptazyme-embedded guide RNAs enable ligand-responsive genome editing and transcriptional activation. Nat Commun. Jun. 28, 2017;8:15939. doi: 10.1038/ncomms15939. |
Tourdot et al., A general strategy to enhance immunogenicity of low-affinity HLA-A2. 1-associated peptides: implication in the identification of cryptic tumor epitopes. Eur J Immunol. Dec. 30, 2000;(12):3411-21. |
Trausch et al., The structure of a tetrahydrofolate-sensing riboswitch reveals two ligand binding sites in a single aptamer. Structure. Oct. 12, 2011;19(10):1413-23. doi: 10.1016/j.str.2011.06.019. Epub Sep. 8, 2011. |
Weinberg et al., The aptamer core of SAM-IV riboswitches mimics the ligand-binding site of Sam-I riboswitches. RNA. May 2008;14(5):822-8. doi: 10.1261/rna.988608. Epub Mar. 27, 2008. |
Winkler et al., An mRNA structure that controls gene expression by binding FMN. Proc Natl Acad Sci U S A. Dec. 10, 2002;99(25):15908-13. Epub Nov. 27, 2002. |
Winkler et al., Control of gene expression by a natural metabolite-responsive ribozyme. Nature. Mar. 18, 2004;428(6980):281-6. |
Winkler et al., Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression. Nature. Oct 31, 2002;419(6910):952-6. Epub Oct. 16, 2002. |
Yahata et al., Unified, Efficient, and Scalable Synthesis of Halichondrins: Zirconium/Nickel-Mediated One-Pot Ketone Synthesis as the Final Coupling Reaction. Angew Chem Int Ed Engl. Aug. 28, 2017;56(36):10796-10800. doi: 10.1002/anie.201705523. Epub Jul. 28, 2017. |
Yamamoto et al., Virological and immunological bases for HIV-1 vaccine design. Uirusu 2007;57(2): 133-139. https://doi.org/10.2222/jsv.57.133. |
Yang et al., New CRISPR-Cas systems discovered. Cell Res. Mar. 2017;27(3):313-314. doi: 10.1038/cr.2017.21. Epub Feb. 21, 2017. |
Zimmermann et al., Molecular interactions and metal binding in the theophylline-binding core of an RNA aptamer. RNA. May 2000;6(5):659-67. |
U.S. Appl. No. 61/838,178, filed Jun. 21, 2013, Joung et al. |
Bershtein et al., Advances in laboratory evolution of enzymes. Curr Opin; Chem Biol. Apr. 2008;12(2):151-8. doi: 10.1016/j.cbpa.2008.01.027. Epub Mar. 7, 2008 Review. |
Bogdanove et al., TAL effectors: customizable proteins for DNA targeting. Science. Sep. 30, 2011;333(6051):1843-6. doi: 10.1126/science.1204094. |
Hida et al., Directed evolution for drug and nucleic acid; delivery. Adv Drug Deliv Rev. Dec. 22, 2007;59(15):1562-78. Epub Aug. 28, 2007;Review. |
Husimi, Selection and evolution of bacteriophages in cellstat. Adv Biophys. ; 1989;25:1-43. Review. |
Kakiyama et al., A peptide release system using a photo-cleavable linker in a cell array format for cell-toxicity analysis. Polymer J. Feb. 27, 2013;45:535-9. |
Liu et al., Fast Colorimetric Sensing of Adenosine and Cocaine Based on a General Sensor Design Involving Aptamers and Nanoparticles. Angew Chem. Dec. 16, 2006;45(1):90-4. DOI: 10.1002/anie.200502589. |
Nelson et al., Filamentous phage DNA cloning vectors: a noninfective mutant with a nonpolar deletion in gene III. Virology. 1981; 108(2): 338-50. |
Rakonjac et al., Roles of PIII in filamentous phage assembly. J Mol Biol. 1998; 282(1)25-41. |
Riechmann et al.,. The C-terminal domain of TolA is the coreceptor for filamentous phage infection of E. coli.Cell. 1997; 90(2):351-60. PMID:9244308. |
Smith, Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. Jun. 14, 1985;228(4705):1315-7. |
Yuan et al., Laboratory-directed protein evolution. Microbiol Mol Biol Rev. 2005; 69(3):373-92. PMID: 16148303. |
Extended European Search Report for EP18199195.1, dated Feb. 12, 2019. |
International Preliminary Report on Patentability for PCT/US2014/048390, dated Mar. 7, 2019. |
International Preliminary Report on Patentability for PCT/US2017/046144, dated Feb. 21, 2019. |
International Preliminary Report on Patentability for PCT/US2017/045381, dated Feb. 14, 2019. |
International Preliminary Report on Patentability for PCT/US2017/056671, dated Apr. 25, 2019. |
Office Action, dated Nov. 10, 2014, in connection with U.S. Appl. No. U.S. Appl. No. 14/320,370. |
Office Action, dated Jan. 30, 2015, in connection with U.S. Appl. No. 14/320,370. |
Notice of Allowance and Applicant Initiated Interview Summary, dated Jun. 10, 2015, in connection with U.S. Appl. No. 14/320,370. |
Office Action, dated Dec. 4, 2014, in connection with U.S. Appl. No. 14/320,413. |
Office Action, dated Apr. 1, 2015, in connection with U.S. Appl. No. 14/320,413. |
Advisory Action and Applicant Initiated Interview Summary, dated Jul. 30, 2015, in connection with U.S. Appl. No. 14/320,413. |
Requirement for Restriction/Election, dated Oct. 19, 2017, in connection with U.S. Appl. No. 14/911,117. |
Office Action, dated Mar. 12, 2018, in connection with U.S. Appl. No. 14/911,117. |
Office Action, dated Oct. 15, 2018, in connection with U.S. Appl. No. 14/911,117. |
Office Action, dated May 20, 2019, in connection with U.S. Appl. No. 14/911,117. |
Number | Date | Country | |
---|---|---|---|
20160090622 A1 | Mar 2016 | US |
Number | Date | Country | |
---|---|---|---|
61864289 | Aug 2013 | US |
Number | Date | Country | |
---|---|---|---|
Parent | 14320370 | Jun 2014 | US |
Child | 14874123 | US |