The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 7, 2022, is named MRT-1102US6_ST25.txt and is 13 kilobytes in size.
Messenger RNA therapy is becoming an increasingly important approach for the treatment of a variety of diseases. Messenger RNA therapy involves administration of messenger RNA (mRNA) into a patient in need of the therapy and production of the protein encoded by the mRNA within the patient body. Thus, it is important to ensure the production of highly pure and safe mRNA product. Traditionally, RNA purification typically employs spin columns and involves the use of caustic or flammable solvents, such as ethanol, which is undesirable for therapeutic administration and large scale production.
The present invention provides improved methods of purifying mRNA that is suitable for administration as a pharmaceutical product based on tangential flow filtration (TFF). Prior to the present invention, RNA purification typically employs spin columns and involves the use of caustic or flammable solvents, such as ethanol, which is undesirable for therapeutic administration and large scale production. Further, the prior art method typically does not allow for the separation of incomplete transcripts known as premature aborts or “shortmers,” which is reported to be highly immunostimulatory and the presence of which may greatly alter the toxicity and tolerability profile of mRNA as active pharmaceutical ingredient (API). The present invention is, in part, based on the discovery that tangential flow filtration is surprisingly effective to remove reactants, enzymes, by products, in particular, the shortmers, from mRNA production mixture. As described herein, tangential flow filtration, particularly in combination with a pre-treatment using a denaturing agent, can effectively remove reactants, enzymes and byproducts including prematurely aborted RNA sequences (i.e., shortmers), while still maintaining the integrity of mRNA. More surprisingly, the present inventors have demonstrated that tangential flow filtration can be successfully performed using only aqueous buffers as solvents without using any caustic or flammable solvents. Thus, the present invention provides a more effective, reliable, and safer method of purifying mRNA from large scale manufacturing process therapeutic applications.
In one aspect, the present invention provides, among other things, methods of purifying messenger RNA (mRNA) including the steps of (a) subjecting an impure preparation comprising in vitro synthesized mRNA to a denaturing condition, and (b) purifying the mRNA from the impure preparation from step (a) by tangential flow filtration, wherein the mRNA purified front step (b) is substantially free of prematurely aborted RNA sequences and/or enzyme reagents used in in vitro synthesis.
In some embodiments, step (a) comprises adding a protein denaturing agent to the impure preparation. In some embodiments, step (a) comprises incubating the impure preparation with the protein denaturing agent added at room temperature for about 1-10 minutes (e.g., about 2-9, 2-8, 2-7, 3-10, 3-9, 3-8, 3-7, 3-6, 4-10, 4-9, 4-8, 4-7, 4-6 minutes). In some embodiments, step (a) comprises incubating the impure preparation with the protein denaturing agent added at room temperature for about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 minutes. In some embodiments, step (a) comprises incubating the impure preparation with the protein denaturing agent added at room temperature for about 5 minutes. In some embodiments, a suitable protein denaturing agent is selected from the group consisting of urea, guanidinium thiocyanate, KCl, sodium dodecyl sulfate, sarcosyl, other detergents, and combinations thereof.
In sonic embodiments, step (a) comprises adding urea to the impure preparation to achieve a resulting urea concentration of about 1 M or greater. In some embodiments, the resulting urea concentration is about 2 M or greater, 3 M or greater, 4 M or greater, 5 M or greater, 6 M or greater, 7 M or greater, 8 M or greater, 9 M or greater, or 10 M or greater.
In some embodiments, step (a) comprises adding guanidinium thiocyanate to the impure preparation to achieve a resulting guanidinium thiocyanate concentration of about 1 M or greater. In some embodiments, the resulting guanidinium thiocyanate concentration is about 2 M or greater, 3 M or greater, 4 M or greater, 5 M or greater, 6 M or greater, 7 M or greater, 8 M or greater, 9 M or greater, or 10 M or greater.
In some embodiments, step (a) comprises adding KCl to the impure preparation to achieve a resulting KCl concentration of about 1 M or greater. In some embodiments, the resulting KCl concentration is about 2 M or greater, 3 M or greater, 4 M or greater, or 5 M or greater.
In some embodiments, the tangential flow filtration is performed using only aqueous solvents. In some embodiments, the tangential flow filtration is performed using water as solvent. In some embodiments, the tangential flow filtration is performed at a feed rate of approximately 100-200 mL/minute (e.g., approximately 100-180 mL/minute, 100-160 mL/minute, 100-140 mL/minute, 110-190 mL/minute, 110-170 mL/minute, or 110-150 mL/minute) and/or a flow rate of approximately 10-50 mL/minute (e.g., approximately 10-40 mL/minute, 10-30 mL/minute, 20-50 mL/minute, or 20-40 mL/minute). In some embodiments, the tangential flow filtration is performed at a feed rate of approximately 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mL/minute and/or a flow rate of approximately 10, 20, 30, 40, or 50 mL/minute.
In some embodiments, the mRNA purified from step (b) contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) of prematurely aborted RNA sequences and/or enzyme reagents used in in vitro synthesis. In some embodiments, the mRNA purified from step (b) contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) of prematurely aborted RNA sequences and/or enzyme reagents used in in vitro synthesis. In some embodiments, the mRNA purified from step (b) contains less than 0.5% of prematurely aborted RNA sequences and/or enzyme reagents used in in vitro synthesis. In some embodiments, the mRNA purified from step (b) contains less than 0.1% of prematurely, aborted RNA sequences and/or enzyme reagents used in in vitro synthesis. In some embodiments, the mRNA purified from step (b) contains undetectable prematurely aborted RNA sequences and/or enzyme reagents used in in vitro synthesis as determined by eithidium bromide and/or Coomassie staining.
In some embodiments, the prematurely aborted RNA sequences comprise less than 15 bases (e.g., less than 14, 13, 12, 11, 10, 9 or 8 bases). In some embodiments, the prematurely aborted RNA sequences comprise about 8-12 bases.
In some embodiments, the enzyme reagents used in in synthesis comprise T7 RNA polymerase, DNAse I, pyrophosphatase, and/or RNAse inhibitor. In some embodiments, the enzyme reagents used in in vitro synthesis comprise T7 RNA polymerase.
In some embodiments, the tangential flow filtration is performed before a cap and poly-A tail are added to the in vitro synthesized mRNA. In some embodiments, the tangential flow filtration is performed after a cap and poly-A tail are added to the in vitro synthesized mRNA. In some embodiments, the tangential flow filtration is performed both before and after a cap and poly-A tail are added to the in vitro synthesized mRNA.
In some embodiments, the in vitro synthesized mRNA is greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb in length. In some embodiments, the in vitro synthesized mRNA comprises one or more modifications to enhance stability. In some embodiments, the one or more modifications are selected from modified nucleotide, modified sugar phosphate backbones, 5′ and/or 3′ untranslated region. In some embodiments, the in vitro synthesized mRNA is unmodified.
In some embodiments, the mRNA purified from step (b) has an integrity greater than about 95% (e.g., greater than about 96%, 97%, 98%, 99% or more). In some embodiments, the mRNA purified from step (b) has an integrity greater than 98%. In some embodiments, the mRNA purified from step (b) has an integrity greater than 99%. In some embodiments, the mRNA purified from step (b) has an integrity of approximately 100%.
The present invention also provides methods for manufacturing messenger RNA (mRNA) including the steps of synthesizing mRNA in vitro, and purifying the in vitro synthesized mRNA according to methods described herein.
The present invention also provides messenger RNA (mRNA) purified according to the methods described herein.
As used in this application, the terms “about” and “approximately” are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art.
Other features, objects, and advantages of the present invention are apparent in the detailed description that follows. It should be understood, however, that the detailed description, while indicating embodiments of the present invention, is given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description.
The following figures are for illustration purposes only and not for limitation.
In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.
Animal: As used herein, the term “animal” refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.
Approximately or about: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
Biologically active: As used herein, the phrase “biologically active” refers to a characteristic of any agent that has activity in a biological system, and particularly in an organism. For instance, an agent that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active.
Expression: As used herein, “expression” of a nucleic acid sequence refers to translation of an mRNA into a polypeptide (e.g., heavy chain or light chain of antibody), assemble multiple polypeptides (e.g., heavy chain or light chain of antibody) into an intact protein (e.g., antibody) and/or post-translational modification of a polypeptide or fully assembled protein (e.g., antibody). In this application, the terms “expression” and “production,” and grammatical equivalent, are used inter-changeably.
Functional: As used herein, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.
Improve, increase, or reduce: As used herein, the terms “improve,” “increase” or “reduce,” or grammatical equivalents, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control subject (or multiple control subject) in the absence of the treatment described herein. A “control subject” is a subject afflicted with the same form of disease as the subject being treated, who is about the same age as the subject being treated.
Impurities: As used herein, the term “impurities” refers to substances inside a confined amount of liquid, gas, or solid, which differ from the chemical composition of the target material or compound impurities are also referred to as contaminants.
In Vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.
In Vivo: As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).
Isolated: As used herein, the term “isolated” refers to a substance and/or entity, that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated. In some embodiments, isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is “pure” if it is substantially free of other components. As used herein, calculation of percent purity of isolated substances and/or entities should not include excipients (e.g., buffer, solvent, water, etc.).
messenger RNA (mRMA): As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide, mRNA as used herein encompasses both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions.
mRNA integrity: As used herein, the term “mRNA integrity” generally refers to the quality of mRNA. In some embodiments, mRNA integrity refers to the percentage of mRNA that is not degraded after a purification process (e.g., tangential flow filtration). mRNA integrity may be determined using methods well known in the art, for example, by RNA agarose gel electrophoresis (e.g., Ausubel et al., John Weley & Sons, Inc., 1997, Current Protocols in Molecular Biology).
Nucleic acid: As used herein, the term “nucleic acid,” in its broadest sense, refers to any compound and/or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g, nucleotides and/or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In sonic embodiments, “nucleic acid” encompasses RNA as well as single and/or double-stranded DNA and/or cDNA. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. For example, the so-called “peptide nucleic acids,” which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. The term “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and/or encode the same amino acid sequence. Nucleotide sequences that encode proteins and/or RNA may include introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. A nucleic acid sequence is presented in the 5′ to 3′ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2′-fluororibose, ribose 2′-deoxyribose, arabinose, and hexose); and/or modified phosphate groups (e.g., phosphorothioates and 5′-N-phosphoramidite linkages). In some embodiments, the present invention is specifically directed to “unmodified nucleic acids,” meaning nucleic acids (e.g., polynucleotides and residues, including nucleotides and/or nucleosides) that have not been chemically modified in order to facilitate or achieve delivery.
Patient: As used herein, the term “patient” or “subject” refers to any organism to which a provided composition may be administered, e.g., fir experimental, diagnostic, prophylactic, cosmetic, and/or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and/or humans). In some embodiments, a patient is a human. A human includes pre and post natal forms.
Pharmaceutically acceptable: The term “pharmaceutically acceptable” as used herein, refers to substances that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
Prematurely aborted RATA sequences: The term “prematurely aborted RNA sequences”, as used herein, refers to incomplete products of an mRNA synthesis reaction (e.g., an in vitro synthesis reaction). For a variety of reasons, RNA polymerases do not always complete transcription of a DNA template; i.e., RNA synthesis terminates prematurely. Possible causes of premature termination of RNA synthesis include quality of the DNA template, polymerase terminator sequences for a particular polymerase present in the template, degraded buffers, temperature, depletion of ribonucleotides, and mRNA secondary structures. Prematurely aborted RNA sequences may be any length that is less than the intended length of the desired transcriptional product. For example, prematurely aborted mRNA sequences may be less than 1000 bases, less than 500 bases, less than 100 bases, less than 50 bases, less than 40 bases, less than 30 bases, less than 20 bases, less than 15 bases, less than 10 bases or fewer.
Salt: As used herein the terns “salt” refers to an ionic compound that does or may result from a neutralization reaction between an acid and a base.
Subject: As used herein, the term “subject” refers to a human or any non-human (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre- and post-natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient” A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.
Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
Substantially free: As used herein, the term “substantially free” refers to a state in which relatively little or no amount of a substance to be removed (e.g., prematurely aborted RNA sequences) are present. For example, “substantially free of prematurely aborted RNA sequences” means the prematurely aborted RNA sequences are present at a level less than approximately 5%, 4%, 3%, 2%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% or less (w/w) of the impurity. Alternatively, “substantially free of prematurely aborted RNA sequences” means the prematurely aborted RNA sequences are present at a level less than about 100 ng, 90 ng, 80 ng, 70 ng, 60 ng, 50 ng, 40 ng, 30 ng, 20 ng, 10 ηg, 1 ηg, 500 ρg, 100 ρg, 50 ρg, 10 ρg, or less.
The present invention provides, among other things, improved methods for purifying mRNA from an impure preparation (e.g., in vitro synthesis reaction mixture) based on tangential flow filtration. In some embodiments, an inventive method according to the present invention includes steps of (a) subjecting an impure preparation comprising in vitro synthesized mRNA to a denaturing condition, and (b) purifying the mRNA from the impure preparation from step (a) by tangential flow filtration, wherein the mRNA purified from step (b) is substantially free of prematurely aborted. RNA sequences and/or enzyme reagents used in in vitro synthesis.
Various aspects of the invention are described in detail in the following sections. The use of sections is not meant to limit the invention. Each section can apply to any aspect of the invention. In this application, the use of “or” means “and/or” unless stated otherwise.
Synthesis of mRNA
mRNA is typically thought of as the type of RNA that carries information from DNA to the ribosome. The existence of mRNA is typically very brief and includes processing and translation, followed by degradation. Typically, in eukaryotic organisms, mRNA processing comprises the addition of a “cap” on the N-terminal (5′) end, and a “tail” on the C-terminal (3′) end. A typical cap is a 7-methylguanosine cap, which is a guanosine that is linked through a 5′-5′-triphosphate bond to the first transcribed nucleotide. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The tail is typically a polyadenylation event whereby a polyadenylyl moiety is added to the 3′ end of the mRNA molecule. The presence of this “tail” serves to protect the mRNA from exonuclease degradation. Messenger RNA is translated by the ribosomes into a series of amino acids that make up a protein.
mRNAs according to the present invention may be synthesized according to any of a variety of known methods. For example, mRNAs according to the present invention may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, SP6 RNA polymerase), DNAse I, pyrophosphatase, andlor RNAse inhibitor. The exact conditions will vary according to the specific application. The presence of these reagents is undesirable in the final product according to several embodiments and may thus be referred to as impurities and a preparation containing one or more of these impurities may be referred to as an impure preparation.
mRNAs according to the present invention may be purified on a commercial scale. In some embodiments, the mRNA is purified at a scale of or greater than 0.1 grams, 0.5 grams, 1 gram, 2 grams, 3 grams, 4 grams, 5 grams, 6 grams, 7 grams, 8 grams, 9 grams, 10 gram, 20 grams, 30 grams, 40 grams, 50 grams, 60 grams, 70 grams, 80 grams, 90 grams, 100 grams, 200 grams, 300 grams, 400 grams, 500 grams, 600 grams, 700 grams, 800 grams, 900 grams, or 1,000 grams per batch.
According to various embodiments, the present invention may be used to purify in vitro synthesized mRNA of a variety of lengths. In some embodiments, the present invention may be used to purify in vitro synthesized mRNA of greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, or 15 kb in length. In some embodiments, the present invention may be used to purify mRNA containing one or more modifications that typically enhance stability. In some embodiments, one or more modifications are selected from modified nucleotide, modified sugar phosphate backbones, 5′ and/or 3′ untranslated region. In some embodiments, the present invention may, be used to purify in vitro synthesized mRNA that is unmodified.
Typically, mRNAs are modified to enhance stability. Modifications of mRNA can include, for example, modifications of the nucleotides of the RNA. An modified mRNA according to the invention can thus include, for example, backbone modifications, sugar modifications or base modifications. In some embodiments, antibody encoding mRNAs (e.g., heavy chain and light chain encoding mRNAs) may be synthesized from naturally occurring nucleotides and/or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as modified nucleotides analogues or derivatives of purines and pyrimidines, such as e.g. 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5′-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, .beta.-D-mannosyl-queosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine and inosine. The preparation of such analogues is known to a person skilled in the art e.g. from the U.S. Pat. Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642, the disclosure of which is included here in its full scope by reference.
Typically, mRNA synthesis includes the addition of a “cap” on the N-terminal (5′) end, and a “tail” on the C-terminal (3′) end. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of a “tail” serves to protect the mRNA from exonuclease degradation.
Thus, in some embodiments, mRNAs include a 5′ cap structure. A 5′ cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5′ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5′5′5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5′)ppp (5′(A, G(5′)ppp(5′)A and G(5′)ppp(5′)G.
While mRNA provided from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA are contemplated as within the scope of the invention including wild-type mRNA produced front bacteria, fungi, plants, and/or animals.
In some embodiments, mRNAs include a 5′ and/or 3′ untranslated region. In some embodiments, a 5′ untranslated region includes one or more elements that affect an mRNA's stability or translation, for example, an iron responsive element. In some embodiments, a 5′ untranslated region may be between about 50 and 500 nucleotides in length.
In some embodiments, a 3′ untranslated region includes one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA's stability of location in a cell, or one or more binding sites for miRNAs. In some embodiments, a 3′ untranslated region may be between 50 and 500 nucleotides in length or longer.
The present invention may be used to purify mRNAs encoding a variety of proteins. Non-limiting examples of purification of mRNAs encoding firefly luciferase, Factor IX, and CFTR, are described in detail in the Examples section.
Denaturing Conditions and Denaturation Agents
Typically, changing the conformation of a protein or nucleic acid either temporarily or permanently by disrupting intermolecular forces is called denaturation. Denaturation results in structural change and often to a loss of activity. Since the native conformation of a molecule is usually the most water soluble, disrupting the secondary and tertiary structures of a molecule may cause changes in solubility and may result in precipitation of the protein or nucleic acid from solution. Surprisingly, as described herein, using a denaturing condition in combination with tangential flow filtration (TFF) can facilitate mRNA purification while still maintaining the integrity of mRNA.
As used herein, the term “denaturing condition” refers to any chemical or physical conditions that can cause denaturation. Exemplary denaturing conditions include, but are not limited to, chemical reagents, high temperatures, extreme pH, etc.
In some embodiments, a denaturing condition is achieved through adding one or more denaturing agents to an impure preparation containing mRNA to be purified. In some embodiments, a denaturing agent suitable for the present invention is a protein and/or DNA denaturing agent. In some embodiments, a denaturing agent may be: 1) an enzyme (such as a serine proteinase or a DNase), 2) an acid, 3) a solvent, 4) a cross-linking agent, 5) a chaotropic agent, 6) a reducing agent, and/or 7) high ionic strength via high salt concentrations. In some embodiments, a particular agent may fall into more than one of these categories.
In some embodiments, one or more enzymes may be used as denaturing agents to degrade proteins and DNA templates used in mRNA synthesis. In some embodiments, suitable enzymes include, but are not limited to, serine proteases such as chymotrypsin and chymotrypsin-like serine proteases, trypsin and trypsin-like serine proteases, elastase and elastase-like serine proteases, subtilisin and subtilisin-like serine proteases, and combinations thereof, deoxyribonucleases (DNases) such as deoxyribonuclease I, II and/or IV, restriction enzymes such as EcoRI, EcoRII, BamHI, HindIII, SpeI, SphI, StuI, XbaI, and combination thereof.
In some embodiments, an acid may be used as a denaturing agent. In some embodiments, a suitable acid may be acetic acid, formic acid, oxalic acid, citric acid, benzoic acid, chloroacetic acid, dichloroacetic acid, trichloroacetic acid, ascorbic acid, sulfosalicylic acid, and combinations thereof.
In some embodiments, a solvent may be used as a denaturing agent. In some embodiments, a solvent may be isopropyl alcohol, acetone, methyl ethyl ketone, methyl isobutyl ketone, ethanol, methanol, denatoniurn, and combinations thereof.
In some embodiments, a chaotropic agent may be sued as a denaturing agent. Choatropic agents are substances which disrupt the structure of macromolecules such as proteins and nucleic acids by interfering with non-covalent forces such as hydrogen bonds and van der Waals forces. In some embodiments, a chaotropic agent may be urea, thiourea, guanidinium chloride, guanidinium thiocyanate, guanidinium isothiocyanate, lithium acetate, magnesium chloride, sodium dodecyl sulfate, lithium perchlorate and combination thereof.
In some embodiments, an impure preparation containing mRNA to be purified is treated with urea. In some embodiments, an amount of urea is added such that the resulting urea concentration is about 1M or greater. In some embodiments, urea is added such that the resulting urea concentration is about 2 M or greater, 3 M or greater, 4 M or greater, 5 M or greater, 6 M or greater, 7 M or greater, 8 M or greater, 9 M or greater, or 10 M or greater. In some embodiments, an impure preparation containing mRNA to be purified is treated with guanidinium thiocyanate. In some embodiments, an amount of guanidinium thiocyanate is added such that the resulting guanidinium thiocyanate concentration is about 1 M or greater. In some embodiments, guanidinium thiocyanate is added such that the resulting guanidinium thiocyanate concentration is about 2 M or greater, 3 M or greater, 4 M or greater, 5 M or greater, 6 M or greater, 7 M or greater, 8 M or greater, 9 M or greater, or 10 M or greater.
In some embodiments, a reducing agent may be used as a denaturing agent. Reducing agents are compounds that donate an electron to another species, thus becoming oxidized itself. In some embodiments, a reducing agent may be lithium aluminum hydride, sodium amalgam, diborane, sodium borohydride, sulfites, diisobutylaluminum hydride, phosphites, carbon monoxide, 2-mercaptoethanol, dithiothreitol, or tris(2-carboxyethyl)phosphine, and combinations thereof.
In some embodiments, one or more of pH, heat, and/or heavy metals (such as lead, mercury or cadmium) may also be used a denaturing agents. Extremes of pH are known to cause a protein to denature. Although the backbone of a protein chain is neutral, the amino acid residues that comprise the protein often contain acidic and basic groups. These groups are usually charged and can form salt bridges with a group of opposite charge. Accordingly, extremes of pH can change the charges on these acidic and basic groups, disrupting salt bridges.
In some embodiments, less drastic changes in pH may also affect the activity and solubility of a protein. Like individual amino acids, proteins have an isoelectric point at which the number of negative charges equals the number of positive charges. This is frequently the point of minimum water solubility. At the isoelectric pH, there is no net charge on the molecule. Individual molecules have a tendency to approach one another, coagulate, and precipitate out of solution. At a pH above or below the isoelectric pH, the molecules have a net negative or positive charge, respectively. Thus when proteinmolecules approach each other, they have the same overall charge and repulse each other.
In some embodiments, heat may be used as a denaturing agent. Heat can supply kinetic energy to protein molecules, causing their atoms to vibrate more rapidly. In some embodiments, this will disrupt relatively weak forces such as hydrogen bonds and hydrophobic interactions. Heat is also used in sterilization to denature and hence destroy the enzymes in bacteria.
In some embodiments, salts of metal ions such as mercury(II), lead(II), and silver may be used as denaturing agents due to their ability to form strong bonds with disulfide groups and with the carboxylate ions of the acidic amino acids. Thus, they disrupt both disulfide bridges and salt linkages and cause the protein to precipitate out of solution as an insoluble metal-protein salt.
In some embodiments, high concentrations of salt (high salinity) may also be used as a denaturing agent. High concentrations of salts are known to cause both proteins and nucleic acids to precipitate from an aqueous solution. In some embodiments, a high concentration of salt may be between 1M and 10M, inclusive. In some embodiments, a high concentration of salt may be between 2M and 9M, inclusive. In some embodiments, a high concentration of salt may be between 2M and 8M, inclusive. In some embodiments, a high concentration of salt may be between 2M and 5M, inclusive. In some embodiments, a high concentration of salt may be greater than 1M concentration. In some embodiments, a high concentration of salt may be greater than 2M concentration. In some embodiments, a high concentration of salt may be greater than 3M concentration. In some embodiments, a high concentration of salt may be greater than 4M concentration. In some embodiments, a high concentration of salt may be greater than 5M concentration. In some embodiments, a high concentration of salt may be greater than 6M concentration. In some embodiments, a high concentration of salt may be greater than 7M concentration. In some embodiments, a high concentration of salt may be greater than 8M concentration. In some embodiments, a single salt is used as a denaturing agent. In some embodiments, more than one salt is used as a denaturing agent.
In some embodiments, a salt used as a denaturing agent may be a calcium salt, an iron salt, a magnesium salt, a potassium salt, a sodium salt, or a combination thereof. Exemplary specific salts suitable for use as denaturing agents in some embodiments include, but are not limited to, potassium chloride (KCl), sodium chloride (NaCl), lithium chloride (LiCl), calcium chloride (CaCl2), potassium bromide (KBr), sodium bromide (NaBr), lithium bromide (LiBr). In some embodiments, the denaturing agent the impure preparation is subjected to is potassium chloride (KCl). In some embodiments, KCl is added such that the resulting KCl concentration is about 1M or greater. In some embodiments, KCl is added such that the resulting KCl concentration is about 2 M or greater, 3 M or greater, 4 M or greater, or 5 M or greater.
In some embodiments, it may be desirable to incubate the impure preparation with one or more denaturing agents for a period of time. In some embodiments, the impure preparation is incubated with a denaturing agent for less than one minute. In some embodiments, the impure preparation is incubated with a denaturing agent for one minute. In some embodiments, the impure preparation is incubated with a denaturing agent for two minutes. In some embodiments, the impure preparation is incubated with a denaturing agent for three minutes. In some embodiments, the impure preparation is incubated with a denaturing agent for four minutes. In some embodiments, the impure preparation is incubated with a denaturing agent for five minutes. In some embodiments, the impure preparation is incubated with a denaturing agent for ten minutes. In some embodiments, the impure preparation is incubated with a denaturing agent for one hour. In some embodiments, the impure preparation is incubated with a denaturing agent for two hours.
In some embodiments, the impure preparation is incubated with one or more denaturing agents at room temperature (e.g., about 20-25° C.). In some embodiments, the impure preparation is incubated with one or more denaturing agents at a temperature below room temperature. In some embodiments, the impure preparation is incubated with one or more denaturing agents at a temperature above room temperature.
Purification
In several embodiments, before and/or after exposure to a denaturing condition, tangential flow filtration is used to purify the mRNA from an impure preparation. In some embodiments, tangential flow filtration is performed before a cap and poly-A tail are added to the in vitro synthesized mRNA. In some embodiments, tangential flow filtration is performed after a cap and poly-A tail are added to the in vitro synthesized mRNA. In some embodiments, tangential flow filtration is performed both before and after a cap and poly-A tail are added to the in vitro synthesized mRNA.
Traditional Membrane Filtration
Generally, membrane filtration involves separating solids from fluids using one or more interposed permeable membranes. Membrane filtration may also be used to filter particles from a gaseous sample. There are two major forms of membrane filtration, passive filtration which proceeds solely due to solution-diffusion, and active filtration which uses positive pressure or negative pressure (i.e. vacuum) to force the liquid or gas across the membrane.
Traditional membrane filtration is also known as “dead-end” filtration. In this format, the feed is loaded onto a membrane and forced through by positive or negative pressure. Dead-end filtration tends to be inexpensive and simple, with the major drawbacks being fouling or clogging of the membrane with non- or slowly-permeating solute (also referred to as the retentate), and concentration polarization. Generally, membranes tend to clog or foul more rapidly as driving forces increase. As a membrane fouls or clogs, the rate of filtration is reduced and eventually no permeate is able to pass through until the filter is changed or cleaned. Concentration polarization is a phenomenon wherein non-permeable solute collects on the surface of a filter and eventually forms a type of secondary membrane, which further impedes travel of permeable solute across the membrane. As a result, dead-end filtration is typically used in batch type processes.
Tangential Flow Filtration
Tangential flow filtration (TFF), also referred to as cross-flow filtration, is a type of filtration wherein the material to be filtered is passed tangentially across a filter rather than through it. In TFF, undesired permeate passes through the filter, while the desired retentate passes along the filter and is collected downstream. It is important to note that the desired material is typically contained in the retentate in TFF, which is the opposite of what one normally encounters in traditional-dead end filtration.
Depending upon the material to be filtered, TFF is usually used for either microfiltration or ultrafiltration. Microfiltration is typically defined as instances where the filter has a pore size of between 0.05 μm and 1.0 μm, inclusive, while ultrafiltration typically involves filters with a pore size of less than 0.05 μm. Pore size also determines the nominal molecular weight limits (NMWL), also referred to as the molecular weight cut off (MWCO) for a particular filter, with microfiltration membranes typically having NMWLs of greater than 1,000 kilodaltons (kDa) and ultrafiltration filters having NMWLs of between 1 kDa and 1,000 kDa.
A principal advantage of tangential flow filtration is that non-permeable particles that may aggregate in and block the filter (sometimes referred to as “filter cake”) during traditional “dead-end” filtration, are instead carried along the surface of the filter. This advantage allows tangential flow filtration to be widely used in industrial processes requiring continuous operation since down time is significantly reduced because filters do not generally need to be removed and cleaned.
Tangential flow filtration can be used for several purposes including concentration and diafiltration, among others. Concentration is a process whereby solvent is removed from a solution while solute molecules are retained. In order to effectively concentrate a sample, a membrane having a NMWL or MWCO that is substantially lower than the molecular weight of the solute molecules to be retained is used. Generally, one of skill may select a filter having a NMWL or MWCO of three to six times below the molecular weight of the target molecule(s).
Diafiltration is a fractionation process whereby small undesired particles are passed through a filter while larger desired molecules are maintained in the retentate without changing the concentration of those molecules in solution. Diafiltration is often used to remove salts or reaction buffers from a solution. Diafiltration may be either continuous or discontinuous. In continuous diafiltration, a diafiltration solution is added to the sample teed at the same rate that filtrate is generated. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting concentration. Discontinuous diafiltration may be repeated until a desired concentration of the solute molecules is reached.
At least three process variables that are important in a typical TFF process: the transmembrane pressure, feed rate, and flow rate of the permeate. The transmembrane pressure is the force that drives fluid through the fitter, carrying with it permeable molecules. In some embodiments, the transmembrane pressure is between 1 and 30 pounds per square inch (psi), inclusive.
The feed rate (also known as the crossflow velocity) is the rate of the solution flow through the feed channel and across the filter. The feed rate determines the force that sweeps away molecules that may otherwise clog or foul the filter and thereby restrict filtrate flow. In some embodiments, the feed rate is between 50 and 500 mL/minute. In some embodiments, the feed rate is between 50 and 400 mL/minute. In some embodiments, the feed rate is between 50 and 300 mL/minute. In some embodiments, the feed rate is between 50 and 200 mL/minute. In some embodiments, the feed rate is between 75 and 200 mL/minute. In some embodiments, the feed rate is between 100 and 200 mL/minute. In some embodiments, the feed rate is between 125 and 175 mL/minute. In some embodiments, the feed rate is 130 mL/minute. In some embodiments, the feed rate is between 60 mL/min and 220 mL/min. In some embodiments, the feed rate is 60 mL/min or greater. In some embodiments, the feed rate is 100 mL/min or greater. In some embodiments, the feed rate is 150 mL/min or greater. In some embodiments, the feed rate is 200 mL/min or greater. In some embodiments, the feed rate is 220 mL/min or greater.
The flow rate of the permeate is the rate at which the permeate is removed from the system. For a constant feed rate, increasing permeate flow rates can increase the pressure across the filter, leading to enhanced filtration rates while also potentially increasing the risk of filter clogging or fouling. The principles, theory, and devices used for TFF are described in Michaels et al., “Tangential Flow Filtration” in Separations Technology, Pharmaceutical and Biotechnology Applications (W. P. Olson, ed., Interpharm Press, Inc., Buffalo Grove, Ill. 1995). See also U.S. Pat. Nos. 5,256,294 and 5,490,937 for a description of high-pertbrinance tangential flow filtration (HP-TFF), which represents an improvement to TFF. In some embodiments, the flow rate is between 10 and 100 mL/minute. In some embodiments, the flow rate is between 10 and 90 mL/minute. In some embodiments, the flow rate is between 10 and 80 mL/minute. In some embodiments, the flow rate is between 10 and 70 mL/minute. In some embodiments, the flow rate is between 10 and 60 mL/minute. In some embodiments, the flow rate is between 10 and 50 mL/minute. In some embodiments, the flow rate is between 10 and 40 mL/minute. In some embodiments, the flow rate is between 20 and 40 mL/minute. In some embodiments, the flow rate is 30 mL/minute.
Any combinations of various process variables described herein may be used. In some embodiments, the tangential flow filtration is performed at a feed rate of approximately 100-200 mL/minute (e.g., approximately 100-180 mL/minute, 100-160 mL/minute, 100-140 mL/minute, 110-190 mL/minute, 110-170 mL/minute, or 110-150 mL/minute) and/or a flow rate of approximately 10-50 mL/minute (e.g., approximately 10-40 mL/minute, 10-30 mL/minute, 20-50 mL/minute, or 20-40 mL/minute). In some embodiments, the tangential flow filtration is performed at a feed rate of approximately 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 mL/minute and/or a flow rate of approximately 10, 20, 30, 40, or 50 mL/minute.
Further flow rates to accommodate large (commercial) scale purification would entail the tangential flow filtration being performed at a feed rate of approximately 10 L-200 L/minute. (e.g., approximately 10-180 L/minute, 100-160 L/minute, 100-140 L/minute, 110-190 L/minute, 110-170 L/minute, or 110-150 L/minute) and/or a flow rate of approximately 10-50 L/minute (e.g., approximately 10-40 L/minute, 10-30 L/minute, 20-50 L/minute, or 20-40 L/minute). In some embodiments, the tangential flow filtration is performed at a feed rate of approximately 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 L/minute and/or a flow rate of approximately 10, 20, 30, 40, or 50 L/minute.
As described above, filters used in TFF may have any of a variety of pore sizes, and thus NMWLs. In some embodiments, a filter will have a NMWL of between 100 kDa and 1,000 kDa. In some embodiments, a filter will have a NMWL of between 200 kDa and 700 kDa. In some embodiments, a filter will have a NMWL between 200 kDa and 500 kDa. In some embodiments, a filter has a NNTWL of 300 kDa. In some embodiments, a filter has a NMWL of 500 kDa.
In some embodiments, a tangential flow filtration according to the invention is performed using only aqueous solvents. In some embodiments, a tangential flow filtration according to the invention is performed using water as the solvent.
Characterization of Purified mRNA
In various embodiments, mRNA purified according to the present invention is substantially free of impurities from mRNA synthesis process including, but not limited to, prematurely aborted RNA sequences, DNA templates, and/or enzyme reagents used in in vitro synthesis.
A particular advantage provided by the present invention is the ability to remove or eliminate a high degree of prematurely aborted RNA sequences (also known as “shortmers”), In some embodiments, a method according to the invention removes more than about 90%, 95%, 96%, 97%, 98%, 99% or substantially all prematurely aborted RNA sequences. In some embodiments, mRNA purified according to the present invention is substantially free of prematurely aborted RNA sequences. In some embodiments, mRNA purified according to the present invention contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) of prematurely aborted RNA sequences. In some embodiments, mRNA purified according to the present invention contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) of prematurely aborted RNA sequences. In some embodiments, mRNA purified according to the present invention contains contains undetectable prematurely aborted RNA sequences as determined by, e.g., eithidium bromide and/or Coomassic staining. In some embodiments, prematurely aborted RNA sequences comprise less than 15 bases (e.g., less than 14, 13, 12, 11, 10, 9 or 8 bases). In some embodiments, the prematurely aborted RNA sequences comprise about 8-12 bases.
In some embodiments, a method according to the present invention removes or eliminates a high degree of enzyme reagents used in in vitro synthesis including, but not limited to, T7 RNA polymerase, DNAse I, pyrophosphatase, and/or RNAse inhibitor. In some embodiments, the present invention is particularly effective to remove T7 RNA polymerase. In some embodiments, a method according to the invention removes more than about 90%, 95%, 96%, 97%, 98%, 99% or substantially all enzyme reagents used in in vitro synthesis including. In some embodiments, mRNA purified according to the present invention is substantially free of enzyme reagents used in in vitro synthesis including. In some embodiments, mRNA purified according to the present invention contains less than about 5% (e.g., less than about 4%, 3%, 2%, or 1%) of enzyme reagents used in in vitro synthesis including. In some embodiments, mRNA purified according to the present invention contains less than about 1% (e.g., less than about 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%) of enzyme reagents used in in vitro synthesis including. In some embodiments, mRNA purified according to the present invention contains undetectable enzyme reagents used in in vitro synthesis including as determined by, e.g., ethidium bromide and/or Coomassie staining.
In various embodiments, mRNA purified using a method described herein maintain high degree of integrity. As used herein, the term “mRNA integrity” generally refers to the quality of mRNA after purification. In some embodiments, mRNA integrity refers to the percentage of mRNA that is not degraded after tangential flow filtration. mRNA integrity may be determined using methods well known in the art, for example, by RNA agarose gel electrophoresis (e.g., Ausubel et al., John Weley & Sons, Inc., 1997, Current Protocols in Molecular Biology). In some embodiments, mRNA purified according to the present invention has an integrity greater than about 95% (e.g., greater than about 96%, 97%, 98%, 99% or more). In some embodiments, mRNA purified according to the present invention has an integrity greater than 98%. In some embodiments, mRNA purified according to the present invention has an integrity greater than 99%. In some embodiments, mRNA purified according to the present invention has an integrity of approximately 100%.
Synthesis of mRNA
In each of the examples below, the synthesis of mRNA was conducted under complete RNAse-free conditions. All tubes, vials, pipette tips, pipettes, buffers, etc. were required to be nuclease-free, unless explicitly stated otherwise.
In the following examples, unless otherwise described, mRNA was synthesized via in-vitro transcription from a linearized DNA template. To produce the desired mRNA pre-cursor (IVT) construct, a mixture of ˜100 ug of linearized DNA, rNTPs (3.33 mM), DTT (10 mM), T7 RNA polymerase, RNAse inhibitor, Pyrophosphatase and reaction buffer (10×, 800 mM Hepes (pH8.0), 20 mM Spermidine, 250 mM MgCl2, pH 7.7) was prepared with RNase-free water to a final volume of 2.24 mL. The reaction mixture is incubated at 37° C. for a range of time between 20 minutes-120 minutes. Upon completion, the mixture is treated with DNase I for an additional 15 minutes and quenched accordingly.
Addition of 5′ Cap and 3′ Tail
The purified mRNA product from the aforementioned IVT step (and possibly initial TFF filtration as well) was denatured at 65° C. for 10 minutes. Separately, portions of GTP (20 mM), S-adenosyl methionine, RNAse inhibitor, 2′-O-Methyltransferase and guanylyl transferase are mixed together with reaction buffer (10×, 500 mM Tris-HCl (pH8.0), 60 mM KCl, 12.5 mM MgCl2) to a final concentration of 8.3 mL. Upon denaturation, the mRNA is cooled on ice and then added to the reaction mixture. The combined solution is incubated for a range of time at 37° C. for 20-90 minutes. Upon completion, aliquots of ATP (20 mM), PolyA Polymerase and tailing reaction buffer (10×, 500 mM Tris-HCl (pH8.0), 2.5M NaCl, 100 mM MgCl2) are added and the total reaction mixture is further incubated at 37° C. for a range of time from 20-45 minutes. Upon completion, the final reaction mixture is quenched and purified accordingly.
Purification via Tangential Flow Filtration
In the following examples, unless otherwise described, the tangential flow filtration (TFF) system consisted of a filtration membrane and a peristaltic pump (Millipore Labscale TFF system) with tangential circulation of the fluid across the membrane at a feed rate of ˜130 mL/min with a 30 mL/min flow rate for the permeate. The TFF membrane employed was a MidiKros 500 kDa mPES 115 cm2 (Spectrum Labs). Before use, the filter cartridge was washed with nuclease free water and further cleaned with 0.2N NaOH. Finally the system was cleaned with nuclease free water until the pH of permeate and retentate reached a pH
Testing for Presence of Enzymes in Purified mRNA
Unless otherwise described, standard Coomassie-stained protein gels were performed to determine the presence of any residual reagent enzymes present before and after purifications. In some instances, BCA assays were performed as well.
Assessment of mRNA Integrity via Agarose Gel Electrophoresis Assays
Unless otherwise described, messenger RNA size and integrity were assessed gel electrophoresis. Either self-poured 1.0% agarose gel or Invitrogen E-Gel precast 1.2% agarose gels were employed. Messenger RNA was loaded at 1.0-1.5 ug quantities per well. Upon completion, messenger RNA bands were visualized using ethidium bromide.
In Vitro mRNA Integrity Assays
Unless otherwise described, in vitro transfections of firefly luciferase mRNA were performed using HEK293T cells. Transfections of one microgram of each mRNA construct were performed in separate wells using lipofectamine. Cells were harvested at select time points (e.g. 4 hour, 8 hour, etc.) and respective protein production was analyzed. For FFL mRNA, cell lysates were analyzed for luciferase production via bioluminescence assays.
Bioluminescence Analysis
In examples including a fluorescent assessment of provided RNA, the bioluminescence assay was conducted using a Promega Luciferase Assay System (Item #E1500), unless otherwise specified. The Luciferase Assay Reagent was prepared by adding 10 mL of Luciferase Assay Buffer to Luciferase Assay Substrate and mix via vortex. Approximately 20 uL of homogenate samples were loaded onto a 96-well plate followed by 20 uL of plate control to each sample. Separately, 120 uL of Luciferase Assay Reagent (prepared as described above) was added to each well of a 96-well flat bottomed plate. Each plate was then inserted into the appropriate chambers using a Molecular Device Flex Station instrument and measure the luminescence (measured in relative light units (RLU)).
This example illustrates that, according to various embodiments, a combination of tangential flow filtration (TFF) and a denaturing agent may be used according to provided methods to product a highly purified mRNA product. In this example, urea is used as the protein denaturing agent.
In this example, a five milligram batch of firefly luciferase (FFL) RNA (SEQ ID NO: 1, below) was transcribed via the in vitro methods described above to produce the aforementioned intermediate construct with no cap and no polyA tail. This reaction maintained a total volume of 2.24 mL and was quenched upon completion by an equivalent volume of 10 M urea, bringing the final urea concentration to 5M. The resultant solution was incubated for five minutes at room temperature and transferred to the tangential flow filtration (TFF) system reservoir. The sample was diluted to 200 mL with nuclease free water and washed with 1200 mL nuclease free water by ultrafiltration of 200 mL at a time. Following this, the sample was treated with 200 mL 10 mM Sodium Citrate (pH 6.4) followed by 600 ml wash with nuclease free water. Finally the sample was concentrated to ˜2 mL and the final concentration was determined via absorption at 260 nm (λmax).
X
2AUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCA
Approximately 5 mg of TFF-purified firefly luciferase RNA was capped and tailed in a final reaction volume of 9 mL, as described above. A portion of this reaction mixture (6.7 ml) was treated with 5M urea for 5 minutes at morn temperature (RT) and purified using TFF. Approximately 1.5 mg of the cap/tail reaction mixture was purified via TFF using solely water and isolated. Separately, another small portion of the cap/tail reaction mixture was purified using a Qiagen RNeasy Purification kit according to published protocol. The three isolated final mRNA batches were aliquotted and transfected into HEK293T cells as described below. Cell lysates were analyzed for the presence of FFL protein via fluorescence detection (FFL activity).
In this example, in order to remove reaction enzymes in this example, a portion of the FFL mRNA IVT reaction mixture was subjected to 10M urea resulting in a final concentration of 5M urea. This solution was incubated for five minutes at room temperature and then purified via TFF as described above.
After producing the capped and tailed FFL mRNA product, TFF methods were employed further to purify the final target mRNA. Portions of the same cap/tail reaction mixture were separately aliquotted and purified either via TFF with no urea or via spin-column methods (Qiagen RNeasy Kit) for comparison. A comparison of the final mRNA isolated either by TFF or spin column was made using gel electrophoresis and is depicted in
It is apparent that the shortmer band is not present after the cap/tail step when TFF-purified mRNA is employed. While substantial amounts of enzyme reagents can be removed using either purification method, shortmer impurities cannot. This demonstrated that the tangential flow filtration methods described herein are a successful and efficient method for purification of prematurely aborted sequences during mRNA transcription.
In order to determine whether provided mRNA can be translated into the desired protein, a comparison of each of the isolated FFL mRNA constructs (TFF vs spin-column) was made. Each of the three constructs listed below were transfected into HEK293T cells and corresponding FFL protein production was assessed via FFL protein activity in the form of FFL luminescence upon exposure to luciferin (vida supra).
FFL Constructs:
1. FFL IVT purified via TFF (urea) and C/T step via TFF (no urea)
2. FFL IVT purified via TFF (urea) and C/T step via TFF (urea)
3. FFL IVT purified via spin column and C/T step via spin column
A comparison of luminescence output of FFL protein produced from each is represented in
This example further illustrates that, according to various embodiments, a combination of tangential flow filtration (TFF) and a denaturing agent may be used according to provided methods to product a highly purified mRNA product. In this example, guanidinium thiocyanate is used as the protein denaturing agent.
In this example, a second species of mRNA was produced and purified, this time coding for Factor IX (SEQ ID NO: 4, below). Initially, a five milligram batch of Factor IX (FIX) RNA was transcribed via in vitro methods as described above to produce the aforementioned RNA with no cap and no polyA tail. This reaction maintained a total volume of 2.24 mL and was quenched upon completion by the addition of Proteinase K (4 mg/ml IVT reaction) which was incubated in the reaction mixture at 37° C. for 5 minutes. Upon completion, 6M guanidinium thiocyanate (4.3 mL, final ˜4M) was added and the resultant solution was incubated for five minutes at room temperature and transferred to the TFF system reservoir. The sample was diluted to 200 mL nuclease free water and washed with 1600 mL nuclease free water by ultrafiltration of 200 mL at a time. Upon completion, the sample was concentrated to ˜2 mL and the final concentration was determined via absorption at 260 nm (λmax).
X
1AUGCAGCGCGUGAACAUGAUCAUGGCAGAAUCA
The above method was also performed as described above, with the addition of actinomycin D (10 μg/ml IVT reaction) during the Proteinase K step. By quenching the IVT reaction with Proteinase K (with or without actinomycin D), one can also successfully achieve removal of all enzymes (
This example further illustrates that, according to various embodiments, a combination of tangential flow filtration (TFF) and a denaturing agent may be used according to provided methods to product a highly purified mRNA product. In this example, potassium chloride is used as the protein denaturing agent.
In this example, a third species of mRNA was produced and purified, this time coding for the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR, SEQ ID NO: 7, below). Initially, a five milligram batch of CFTR RNA was transcribed via in vitro methods as described above to produce the aforementioned RNA with no cap and no polyA tail. This reaction maintains a total volume of 2.24 mL and was quenched upon completion by addition of 2M KCl (˜200 mL). The resultant solution was incubated for five minutes at room temperature and transferred to the TFF system reservoir. The sample was diafiltrated at a constant volume of 200 mL with 2M KCL in nuclease-free water for three to four diavolumes. After this time, the resultant solution was washed with 400 mL nuclease-free water by ultrafiltration of 200 mL at a time. Following this, the sample was treated with 200 mL 1 mM Sodium Citrate (pH6.4) followed by 600 ml wash with nuclease free water. Finally, the sample was concentrated to ˜2 mL and the final concentration was determined via absorption at 260 nm (λmax).
X
1AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUC
In this example, in order to remove reaction enzymes, 2M KCl diafiltration was used. Exposure to large volumes of 2M KCl resulted in successful removal of all enzymes present in the reaction mixture (including T7 polymerase) as determined via protein gel electrophoresis (
Further, upon capping and tailing of the CFTR IVT construct, one can successfully purify the final CFTR transcript (capped and tailed) via TFF using 2M KCl. When comparing this final isolated product to the same product purified via spin-column methods, one observes a greatly diminished “shortmer” band as determined via gel electrophoresis (
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to he limited to the above Description, but rather is as set forth in the following claims:
This patent application is a continuation application of U.S. patent application Ser. No. 17/103,439, filed Nov. 24, 2020, which is a continuation application of U.S. patent application Ser. No. 15/936,289, filed Mar. 26, 2018, now U.S. Pat. No. 10,876,104, issued Dec. 29, 2020 which is a continuation application of U.S. patent application Ser. No. 14/775,915, filed on Sep. 14, 2015, now U.S. Pat. No. 9,957,499, issued May 1, 2018, which is a 35 U.S.C. § 371 National Stage application of International Application No. PCT/US14/28441, filed Mar. 14, 2014, which claims the benefit of U.S. Provisional Patent Application No. 61/784,996, filed Mar. 14, 2013, the entireties of which are incorporated herein by reference.
| Number | Name | Date | Kind |
|---|---|---|---|
| 2647121 | Jacoby | Jul 1953 | A |
| 2717909 | Kosmin | Sep 1955 | A |
| 2819718 | Goldman | Jan 1958 | A |
| 2844629 | William et al. | Jul 1958 | A |
| 3096560 | Liebig | Jul 1963 | A |
| 3535289 | Yoshihara et al. | Oct 1970 | A |
| 3614954 | Mirowski et al. | Oct 1971 | A |
| 3614955 | Mirowski | Oct 1971 | A |
| 3656185 | Carpentier | Apr 1972 | A |
| 3805301 | Liebig | Apr 1974 | A |
| 3945052 | Liebig | Mar 1976 | A |
| 3995623 | Blake et al. | Dec 1976 | A |
| 4013507 | Rembaum | Mar 1977 | A |
| 4072146 | Howes | Feb 1978 | A |
| 4096860 | McLaughlin | Jun 1978 | A |
| 4099528 | Sorenson et al. | Jul 1978 | A |
| 4106129 | Carpentier et al. | Aug 1978 | A |
| 4134402 | Mahurkar | Jan 1979 | A |
| 4140126 | Choudhury | Feb 1979 | A |
| 4180068 | Jacobsen et al. | Dec 1979 | A |
| 4182833 | Hicks | Jan 1980 | A |
| 4227533 | Godfrey | Oct 1980 | A |
| 4284459 | Patel et al. | Aug 1981 | A |
| 4308085 | Horhold et al. | Dec 1981 | A |
| 4323525 | Bornat | Apr 1982 | A |
| 4335723 | Patel | Jun 1982 | A |
| 4339369 | Hicks et al. | Jul 1982 | A |
| 4355426 | MacGregor | Oct 1982 | A |
| 4375817 | Engle et al. | Mar 1983 | A |
| 4385631 | Uthmann | May 1983 | A |
| 4401472 | Gerber | Aug 1983 | A |
| 4406656 | Hattler et al. | Sep 1983 | A |
| 4475972 | Wong | Oct 1984 | A |
| 4530113 | Matterson | Jul 1985 | A |
| 4550447 | Seiler, Jr. et al. | Nov 1985 | A |
| 4562596 | Kornberg | Jan 1986 | A |
| 4568329 | Mahurkar | Feb 1986 | A |
| 4571241 | Christopher | Feb 1986 | A |
| 4601718 | Possis et al. | Jul 1986 | A |
| 4647416 | Seiler, Jr. et al. | Mar 1987 | A |
| 4662382 | Sluetz et al. | May 1987 | A |
| 4701162 | Rosenberg | Oct 1987 | A |
| 4710169 | Christopher | Dec 1987 | A |
| 4720517 | Ravichandran et al. | Jan 1988 | A |
| 4737323 | Martin et al. | Apr 1988 | A |
| 4762915 | Kung et al. | Aug 1988 | A |
| 4782836 | Alt | Nov 1988 | A |
| 4843155 | Chomczynski et al. | Jun 1989 | A |
| 4856521 | Irnich | Aug 1989 | A |
| 4860751 | Callaghan | Aug 1989 | A |
| 4878908 | Martin et al. | Nov 1989 | A |
| 4892540 | Vallana | Jan 1990 | A |
| 4897355 | Eppstein et al. | Jan 1990 | A |
| 4920016 | Allen et al. | Apr 1990 | A |
| 4946683 | Forssen | Aug 1990 | A |
| 4946857 | Kanehira et al. | Aug 1990 | A |
| 4960409 | Catalano | Oct 1990 | A |
| 4966945 | Drawert et al. | Oct 1990 | A |
| 5024671 | Tu et al. | Jun 1991 | A |
| 5025005 | Nomura et al. | Jun 1991 | A |
| 5047540 | Kamata et al. | Sep 1991 | A |
| 5101824 | Lekholm | Apr 1992 | A |
| 5104399 | Lazarus | Apr 1992 | A |
| 5116360 | Pinchuk et al. | May 1992 | A |
| 5138067 | Kamata et al. | Aug 1992 | A |
| 5151105 | Kwan-Gett | Sep 1992 | A |
| 5171678 | Behr et al. | Dec 1992 | A |
| 5176661 | Evard et al. | Jan 1993 | A |
| 5194654 | Hostetler et al. | Mar 1993 | A |
| 5200395 | Eto et al. | Apr 1993 | A |
| 5223263 | Hostetler et al. | Jun 1993 | A |
| 5261419 | Osypka | Nov 1993 | A |
| 5264618 | Felgner et al. | Nov 1993 | A |
| 5279833 | Rose | Jan 1994 | A |
| 5282824 | Gianturco | Feb 1994 | A |
| 5284491 | Sutton et al. | Feb 1994 | A |
| 5300022 | Klapper et al. | Apr 1994 | A |
| 5314430 | Bardy | May 1994 | A |
| 5330768 | Park et al. | Jul 1994 | A |
| 5334761 | Gebeyehu et al. | Aug 1994 | A |
| 5395619 | Zalipsky et al. | Mar 1995 | A |
| 5405363 | Kroll et al. | Apr 1995 | A |
| 5405379 | Lane | Apr 1995 | A |
| 5455352 | Huellmann et al. | Oct 1995 | A |
| 5464924 | Silvis et al. | Nov 1995 | A |
| 5503852 | Steiner et al. | Apr 1996 | A |
| 5528023 | Butturini et al. | Jun 1996 | A |
| 5552155 | Bailey et al. | Sep 1996 | A |
| 5595756 | Bally et al. | Jan 1997 | A |
| 5607385 | Francischelli et al. | Mar 1997 | A |
| 5609624 | Kalis | Mar 1997 | A |
| 5610283 | Buechler | Mar 1997 | A |
| 5614548 | Piantadosi et al. | Mar 1997 | A |
| 5626869 | Nyqvist et al. | May 1997 | A |
| 5631018 | Zalipsky et al. | May 1997 | A |
| 5670488 | Gregory et al. | Sep 1997 | A |
| 5677124 | DuBois et al. | Oct 1997 | A |
| 5693088 | Lazarus | Dec 1997 | A |
| 5697953 | Kroll et al. | Dec 1997 | A |
| 5700437 | Fujii et al. | Dec 1997 | A |
| 5705188 | Junichi et al. | Jan 1998 | A |
| 5705385 | Bally et al. | Jan 1998 | A |
| 5736573 | Galat | Apr 1998 | A |
| 5744335 | Wolff et al. | Apr 1998 | A |
| 5772694 | Bokros et al. | Jun 1998 | A |
| 5776165 | Ripart | Jul 1998 | A |
| 5776747 | Schinstine et al. | Jul 1998 | A |
| 5783383 | Kondo et al. | Jul 1998 | A |
| 5844107 | Hanson et al. | Dec 1998 | A |
| 5874105 | Watkins et al. | Feb 1999 | A |
| 5885613 | Holland et al. | Mar 1999 | A |
| 5910168 | Myers et al. | Jun 1999 | A |
| 5916208 | Luther et al. | Jun 1999 | A |
| 5965434 | Wolff et al. | Oct 1999 | A |
| 5976567 | Wheeler et al. | Nov 1999 | A |
| 5976569 | Milstein | Nov 1999 | A |
| 5981501 | Wheeler et al. | Nov 1999 | A |
| 6055454 | Heemels | Apr 2000 | A |
| 6067471 | Warren | May 2000 | A |
| 6090384 | Ra et al. | Jul 2000 | A |
| 6096070 | Ragheb et al. | Aug 2000 | A |
| 6096075 | Bokros et al. | Aug 2000 | A |
| 6120799 | McDonald et al. | Sep 2000 | A |
| 6147055 | Hobart et al. | Nov 2000 | A |
| 6152955 | KenKnight et al. | Nov 2000 | A |
| 6165763 | Brown et al. | Dec 2000 | A |
| 6169923 | Kroll | Jan 2001 | B1 |
| 6176877 | Buchanan et al. | Jan 2001 | B1 |
| 6204297 | Tracy et al. | Mar 2001 | B1 |
| 6210892 | Bennett et al. | Apr 2001 | B1 |
| 6214804 | Felgner et al. | Apr 2001 | B1 |
| 6271208 | Bischoff | Aug 2001 | B1 |
| 6271209 | Smith et al. | Aug 2001 | B1 |
| 6287591 | Semple et al. | Sep 2001 | B1 |
| 6299604 | Ragheb et al. | Oct 2001 | B1 |
| 6335199 | Bischoff et al. | Jan 2002 | B1 |
| 6358278 | Brendzel et al. | Mar 2002 | B1 |
| 6370434 | Zhang et al. | Apr 2002 | B1 |
| 6371983 | Lane | Apr 2002 | B1 |
| 6417326 | Cullis et al. | Jul 2002 | B1 |
| 6485726 | Blumberg et al. | Nov 2002 | B1 |
| 6534484 | Wheeler et al. | Mar 2003 | B1 |
| 6585410 | Ryan | Jul 2003 | B1 |
| 6586410 | Wheeler et al. | Jul 2003 | B1 |
| 6670178 | Selden et al. | Dec 2003 | B1 |
| 6696424 | Wheeler | Feb 2004 | B1 |
| 6733777 | Erbacher et al. | May 2004 | B2 |
| 6743823 | Summar et al. | Jun 2004 | B1 |
| 6756055 | McDonald et al. | Jun 2004 | B2 |
| 6790838 | Alison et al. | Sep 2004 | B2 |
| 6815432 | Wheeler et al. | Nov 2004 | B2 |
| 6821530 | Koob et al. | Nov 2004 | B2 |
| 6835395 | Semple et al. | Dec 2004 | B1 |
| 6858224 | Wheeler et al. | Feb 2005 | B2 |
| 6858225 | Semple et al. | Feb 2005 | B2 |
| 6887665 | Trulson et al. | May 2005 | B2 |
| 6986902 | Chen et al. | Jan 2006 | B1 |
| 6998115 | Langer et al. | Feb 2006 | B2 |
| 7022214 | Olech | Apr 2006 | B2 |
| 7067697 | Gao | Jun 2006 | B2 |
| 7084303 | Watanabe et al. | Aug 2006 | B2 |
| 7341738 | Semple et al. | Mar 2008 | B2 |
| 7422902 | Wheeler et al. | Sep 2008 | B1 |
| 7427394 | Anderson et al. | Sep 2008 | B2 |
| 7507859 | Grinstaff et al. | Mar 2009 | B2 |
| 7556684 | Bury et al. | Jul 2009 | B2 |
| 7745651 | Heyes et al. | Jun 2010 | B2 |
| 7767399 | Murphy et al. | Aug 2010 | B2 |
| 7799565 | MacLachlan et al. | Sep 2010 | B2 |
| 7803397 | Heyes et al. | Sep 2010 | B2 |
| 7901708 | MacLachlan et al. | Mar 2011 | B2 |
| 7972435 | Bury et al. | Jul 2011 | B2 |
| 8021686 | Semple et al. | Sep 2011 | B2 |
| 8071082 | Zugates et al. | Dec 2011 | B2 |
| 8075780 | Pearce | Dec 2011 | B2 |
| 8101741 | MacLachlan et al. | Jan 2012 | B2 |
| 8106022 | Manoharan et al. | Jan 2012 | B2 |
| 8158601 | Chen et al. | Apr 2012 | B2 |
| 8188263 | MacLachlan et al. | May 2012 | B2 |
| RE43612 | Anderson et al. | Aug 2012 | E |
| 8236943 | Lee et al. | Aug 2012 | B2 |
| 8278036 | Kariko et al. | Oct 2012 | B2 |
| 8287849 | Langer et al. | Oct 2012 | B2 |
| 8329070 | MacLachlan et al. | Dec 2012 | B2 |
| 8450298 | Mahon et al. | May 2013 | B2 |
| 8450467 | Manoharan et al. | May 2013 | B2 |
| 8470585 | de Vocht et al. | Jun 2013 | B2 |
| 8513403 | MacLachlan et al. | Aug 2013 | B2 |
| 8557231 | Langer et al. | Oct 2013 | B2 |
| 8562966 | Zugates et al. | Oct 2013 | B2 |
| 8569256 | Heyes et al. | Oct 2013 | B2 |
| 8652512 | Schmehl et al. | Feb 2014 | B2 |
| 8691966 | Kariko et al. | Apr 2014 | B2 |
| 8710200 | Schrum et al. | Apr 2014 | B2 |
| 8748089 | Kariko et al. | Jun 2014 | B2 |
| 8802644 | Chen et al. | Aug 2014 | B2 |
| 8808681 | Anderson et al. | Aug 2014 | B2 |
| 8808982 | Dahl et al. | Aug 2014 | B2 |
| 8822663 | Schrum et al. | Sep 2014 | B2 |
| 8828956 | Manoharan et al. | Sep 2014 | B2 |
| 8835108 | Kariko et al. | Sep 2014 | B2 |
| 8846348 | Jendrisak et al. | Sep 2014 | B2 |
| 8853377 | Guild et al. | Oct 2014 | B2 |
| 8859229 | Rabinovich et al. | Oct 2014 | B2 |
| 8883202 | Manoharan et al. | Nov 2014 | B2 |
| 8936942 | Heyes et al. | Jan 2015 | B2 |
| 8969353 | Mahon et al. | Mar 2015 | B2 |
| 8980864 | Hoge et al. | Mar 2015 | B2 |
| 8999351 | Manoharan et al. | Apr 2015 | B2 |
| 8999950 | MacLachlan et al. | Apr 2015 | B2 |
| 9012219 | Kariko et al. | Apr 2015 | B2 |
| 9012498 | Manoharan et al. | Apr 2015 | B2 |
| 9018187 | Heyes et al. | Apr 2015 | B2 |
| 9051567 | Fitzgerald et al. | Jun 2015 | B2 |
| 9061059 | Chakraborty et al. | Jun 2015 | B2 |
| 9074208 | Maclachlan et al. | Jul 2015 | B2 |
| 9089604 | Chakraborty et al. | Jul 2015 | B2 |
| 9095552 | Chakraborty et al. | Aug 2015 | B2 |
| 9107886 | Chakraborty et al. | Aug 2015 | B2 |
| 9114113 | Chakraborty et al. | Aug 2015 | B2 |
| 9181319 | Schrum et al. | Nov 2015 | B2 |
| 9186325 | Manoharan et al. | Nov 2015 | B2 |
| 9186372 | de Fougerolles et al. | Nov 2015 | B2 |
| 9187748 | Geisbert et al. | Nov 2015 | B2 |
| 9192651 | Chakraborty et al. | Nov 2015 | B2 |
| 9220755 | Chakraborty et al. | Dec 2015 | B2 |
| 9220792 | Chakraborty et al. | Dec 2015 | B2 |
| 9233141 | Chakraborty et al. | Jan 2016 | B2 |
| 9295689 | de Fougerolles et al. | Mar 2016 | B2 |
| 9301993 | Chakraborty et al. | Apr 2016 | B2 |
| 9303079 | Chakraborty et al. | Apr 2016 | B2 |
| 9334328 | Schrum et al. | May 2016 | B2 |
| 9345780 | Manoharan et al. | May 2016 | B2 |
| 9352042 | Heyes et al. | May 2016 | B2 |
| 9352048 | Manoharan et al. | May 2016 | B2 |
| 9364435 | Yaworski et al. | Jun 2016 | B2 |
| 9394234 | Chen et al. | Jul 2016 | B2 |
| 9404127 | Yaworski et al. | Aug 2016 | B2 |
| 9428751 | MacDonald et al. | Aug 2016 | B2 |
| 9254311 | Bancel et al. | Sep 2016 | B2 |
| 9464124 | Bancel et al. | Oct 2016 | B2 |
| 9492386 | Maclachlan et al. | Nov 2016 | B2 |
| 9504734 | Bancel et al. | Nov 2016 | B2 |
| 9518272 | Yaworski et al. | Dec 2016 | B2 |
| 9580734 | Shanker et al. | Feb 2017 | B2 |
| 9597413 | Guild et al. | Mar 2017 | B2 |
| 9957499 | Heartlein | May 2018 | B2 |
| 10155785 | DeRosa et al. | Dec 2018 | B2 |
| 10808241 | Abysalh et al. | Oct 2020 | B2 |
| 10876104 | Heartlein et al. | Dec 2020 | B2 |
| 11059841 | DeRosa et al. | Jul 2021 | B2 |
| 20010047091 | Miki | Nov 2001 | A1 |
| 20020022721 | Trulson et al. | Feb 2002 | A1 |
| 20020094528 | Salafsky | Jul 2002 | A1 |
| 20020192651 | Wheeler et al. | Dec 2002 | A1 |
| 20020192721 | Rizzuto et al. | Dec 2002 | A1 |
| 20020193622 | Watanabe et al. | Dec 2002 | A1 |
| 20030082154 | Leamon | May 2003 | A1 |
| 20030083272 | Wiederholt et al. | May 2003 | A1 |
| 20030104044 | Semple et al. | Jun 2003 | A1 |
| 20030181410 | Wheeler et al. | Sep 2003 | A1 |
| 20030186237 | Ginsberg | Oct 2003 | A1 |
| 20030215395 | Yu et al. | Nov 2003 | A1 |
| 20040110709 | Li et al. | Jun 2004 | A1 |
| 20040132683 | Felgner et al. | Jul 2004 | A1 |
| 20040142025 | Maclachlan et al. | Jul 2004 | A1 |
| 20040224912 | Dobie et al. | Nov 2004 | A1 |
| 20040235982 | Rabasco et al. | Nov 2004 | A1 |
| 20050004058 | Benoit et al. | Jan 2005 | A1 |
| 20050008689 | Semple et al. | Jan 2005 | A1 |
| 20050032730 | Von Der Mulbe et al. | Feb 2005 | A1 |
| 20050054026 | Atsushi et al. | Mar 2005 | A1 |
| 20050059005 | Tuschl et al. | Mar 2005 | A1 |
| 20050059024 | Conrad | Mar 2005 | A1 |
| 20050059624 | Hoerr et al. | Mar 2005 | A1 |
| 20050065107 | Hobart et al. | Mar 2005 | A1 |
| 20050069590 | Buehler et al. | Mar 2005 | A1 |
| 20050079212 | Wheeler et al. | Apr 2005 | A1 |
| 20050112755 | Pearce | May 2005 | A1 |
| 20050143332 | Monahan et al. | Jun 2005 | A1 |
| 20050148786 | Ikeda et al. | Jul 2005 | A1 |
| 20050158302 | Faustman et al. | Jul 2005 | A1 |
| 20050226847 | Coffin | Oct 2005 | A1 |
| 20050244961 | Short et al. | Nov 2005 | A1 |
| 20050250723 | Hoerr et al. | Nov 2005 | A1 |
| 20060008910 | MacLachlan et al. | Jan 2006 | A1 |
| 20060051771 | Murphy | Mar 2006 | A1 |
| 20060059576 | Pasinetti et al. | Mar 2006 | A1 |
| 20060069225 | Wintermantel et al. | Mar 2006 | A1 |
| 20060083780 | Heyes et al. | Apr 2006 | A1 |
| 20060172003 | Meers et al. | Aug 2006 | A1 |
| 20060204566 | Smyth-Templeton et al. | Sep 2006 | A1 |
| 20060216343 | Panzner et al. | Sep 2006 | A1 |
| 20060223939 | Lange et al. | Oct 2006 | A1 |
| 20060228404 | Anderson et al. | Oct 2006 | A1 |
| 20060241071 | Grinstaff et al. | Oct 2006 | A1 |
| 20060246434 | Erlander et al. | Nov 2006 | A1 |
| 20070135372 | Maclachlan et al. | Jun 2007 | A1 |
| 20070142628 | Ghoshal et al. | Jun 2007 | A1 |
| 20070172950 | Wheeler et al. | Jul 2007 | A1 |
| 20070252295 | Panzner et al. | Nov 2007 | A1 |
| 20070275923 | Chen et al. | Nov 2007 | A1 |
| 20070281336 | Jendrisak et al. | Dec 2007 | A1 |
| 20080113357 | Baggio | May 2008 | A1 |
| 20080145338 | Anderson et al. | Jun 2008 | A1 |
| 20080160048 | Fuller | Jul 2008 | A1 |
| 20080242626 | Zugates et al. | Oct 2008 | A1 |
| 20080248559 | Inomata et al. | Oct 2008 | A1 |
| 20080260706 | Rabinovich et al. | Oct 2008 | A1 |
| 20090023673 | Manoharan et al. | Jan 2009 | A1 |
| 20090093433 | Woolf et al. | Apr 2009 | A1 |
| 20090163705 | Manoharan et al. | Jun 2009 | A1 |
| 20090186805 | Tabor et al. | Jul 2009 | A1 |
| 20090221684 | Grinstaff et al. | Sep 2009 | A1 |
| 20090263407 | Dande et al. | Oct 2009 | A1 |
| 20090270481 | MacLachlan et al. | Oct 2009 | A1 |
| 20090286852 | Kariko et al. | Nov 2009 | A1 |
| 20090326051 | Corey et al. | Dec 2009 | A1 |
| 20100028943 | Thomas et al. | Feb 2010 | A1 |
| 20100035249 | Hayashizaki et al. | Feb 2010 | A1 |
| 20100036084 | Langer et al. | Feb 2010 | A1 |
| 20100041152 | Wheeler et al. | Feb 2010 | A1 |
| 20100047261 | Hoerr et al. | Feb 2010 | A1 |
| 20100092572 | Kaeuper et al. | Apr 2010 | A1 |
| 20100012012 | Amshev et al. | May 2010 | A1 |
| 20100120129 | Amshey et al. | May 2010 | A1 |
| 20100178699 | Gao et al. | Jul 2010 | A1 |
| 20100189729 | Hoerr et al. | Jul 2010 | A1 |
| 20100267806 | Bumcrot et al. | Oct 2010 | A1 |
| 20100331234 | Mahon et al. | Dec 2010 | A1 |
| 20110009641 | Anderson et al. | Jan 2011 | A1 |
| 20110038941 | Lee et al. | Feb 2011 | A1 |
| 20110092739 | Chen et al. | Apr 2011 | A1 |
| 20110143397 | Kariko et al. | Jun 2011 | A1 |
| 20110159550 | Sanders | Jun 2011 | A1 |
| 20110200582 | Baryza et al. | Aug 2011 | A1 |
| 20110236391 | Mahler et al. | Sep 2011 | A1 |
| 20110244026 | Guild et al. | Oct 2011 | A1 |
| 20110256175 | Hope et al. | Oct 2011 | A1 |
| 20110293703 | Mahon et al. | Dec 2011 | A1 |
| 20110311583 | Manoharan et al. | Dec 2011 | A1 |
| 20120007803 | Takatsuka | Jan 2012 | A1 |
| 20120009222 | Nguyen et al. | Jan 2012 | A1 |
| 20120060237 | Wu et al. | Mar 2012 | A1 |
| 20120065252 | Schrum et al. | Mar 2012 | A1 |
| 20120065358 | Langer et al. | Mar 2012 | A1 |
| 20120114831 | Semple et al. | May 2012 | A1 |
| 20120128760 | Manoharan et al. | May 2012 | A1 |
| 20120129910 | Thompson et al. | May 2012 | A1 |
| 20120142756 | Guild et al. | Jun 2012 | A1 |
| 20120174256 | Kato et al. | Jul 2012 | A1 |
| 20120195936 | Rudolph et al. | Aug 2012 | A1 |
| 20120202871 | Heyes et al. | Aug 2012 | A1 |
| 20120237975 | Schrum et al. | Sep 2012 | A1 |
| 20120251560 | Dahlman et al. | Oct 2012 | A1 |
| 20120251618 | Schrum et al. | Oct 2012 | A1 |
| 20120328668 | Maclachlan et al. | Dec 2012 | A1 |
| 20130004992 | Lin et al. | Jan 2013 | A1 |
| 20130017223 | Hope et al. | Jan 2013 | A1 |
| 20130158021 | Dong et al. | Jun 2013 | A1 |
| 20130195967 | Guild et al. | Aug 2013 | A1 |
| 20130224824 | Shigamor et al. | Aug 2013 | A1 |
| 20130237594 | de Fougerolles et al. | Sep 2013 | A1 |
| 20130259923 | Bancel et al. | Oct 2013 | A1 |
| 20130259924 | Bancel et al. | Oct 2013 | A1 |
| 20130266640 | de Fougerolles et al. | Oct 2013 | A1 |
| 20130302401 | Ma et al. | Nov 2013 | A1 |
| 20130337045 | Bredehorst et al. | Dec 2013 | A1 |
| 20130337528 | Thompson et al. | Dec 2013 | A1 |
| 20130337579 | Lee et al. | Dec 2013 | A1 |
| 20140010861 | Bancel et al. | Jan 2014 | A1 |
| 20140044772 | MacLachlan et al. | Feb 2014 | A1 |
| 20140093952 | Serway | Apr 2014 | A1 |
| 20140094399 | Langer et al. | Apr 2014 | A1 |
| 20140105964 | Bancel et al. | Apr 2014 | A1 |
| 20140105965 | Bancel et al. | Apr 2014 | A1 |
| 20140147432 | Bancel et al. | May 2014 | A1 |
| 20140147454 | Chakraborty et al. | May 2014 | A1 |
| 20140148502 | Bancel et al. | May 2014 | A1 |
| 20140155472 | Bancel et al. | Jun 2014 | A1 |
| 20140155473 | Bancel et al. | Jun 2014 | A1 |
| 20140155474 | Bancel et al. | Jun 2014 | A1 |
| 20140155475 | Bancel et al. | Jun 2014 | A1 |
| 20140161830 | Anderson et al. | Jun 2014 | A1 |
| 20140162897 | Grunenwald et al. | Jun 2014 | A1 |
| 20140171485 | Bancel et al. | Jun 2014 | A1 |
| 20140179756 | Maclachlan et al. | Jun 2014 | A1 |
| 20140179771 | Bancel et al. | Jun 2014 | A1 |
| 20140186432 | Bancel et al. | Jul 2014 | A1 |
| 20140193482 | Bancel et al. | Jul 2014 | A1 |
| 20140194494 | Bancel et al. | Jul 2014 | A1 |
| 20140199371 | Bancel et al. | Jul 2014 | A1 |
| 20140200163 | Mikkelsen et al. | Jul 2014 | A1 |
| 20140200261 | Hoge et al. | Jul 2014 | A1 |
| 20140200262 | Bancel et al. | Jul 2014 | A1 |
| 20140200263 | Bancel et al. | Jul 2014 | A1 |
| 20140200264 | Bancel et al. | Jul 2014 | A1 |
| 20140206752 | Afeyan et al. | Jul 2014 | A1 |
| 20140206753 | Guild et al. | Jul 2014 | A1 |
| 20140206755 | Bancel et al. | Jul 2014 | A1 |
| 20140206852 | Hoge et al. | Jul 2014 | A1 |
| 20140221248 | Jendrisak et al. | Aug 2014 | A1 |
| 20140221465 | Bancel et al. | Aug 2014 | A1 |
| 20140227300 | Chin et al. | Aug 2014 | A1 |
| 20140243399 | Schrum et al. | Aug 2014 | A1 |
| 20140249208 | Bancel et al. | Sep 2014 | A1 |
| 20140255467 | Bancel et al. | Sep 2014 | A1 |
| 20140255468 | Bancel et al. | Sep 2014 | A1 |
| 20140275227 | Hoge et al. | Sep 2014 | A1 |
| 20140275229 | Bancel et al. | Sep 2014 | A1 |
| 20140288160 | Guild et al. | Sep 2014 | A1 |
| 20140294937 | MacLachlan et al. | Oct 2014 | A1 |
| 20140294938 | Guild et al. | Oct 2014 | A1 |
| 20140294939 | Guild et al. | Oct 2014 | A1 |
| 20140294940 | Guild et al. | Oct 2014 | A1 |
| 20140329884 | Dong et al. | Nov 2014 | A1 |
| 20140343129 | de Fougerolles et al. | Nov 2014 | A1 |
| 20140363876 | Jendrisak et al. | Dec 2014 | A1 |
| 20150004217 | Guild et al. | Jan 2015 | A1 |
| 20150005372 | Hoge et al. | Jan 2015 | A1 |
| 20150011615 | Manoharan et al. | Jan 2015 | A1 |
| 20150011633 | Shorr et al. | Jan 2015 | A1 |
| 20150017211 | de Fougerolles et al. | Jan 2015 | A1 |
| 20150038556 | Heartlein et al. | Feb 2015 | A1 |
| 20150038558 | Kariko et al. | Feb 2015 | A1 |
| 20150044277 | Bancel et al. | Feb 2015 | A1 |
| 20150050354 | Bouchon et al. | Feb 2015 | A1 |
| 20150051268 | Bancel et al. | Feb 2015 | A1 |
| 20150056253 | Bancel et al. | Feb 2015 | A1 |
| 20150064235 | Bancel et al. | Mar 2015 | A1 |
| 20150064236 | Bancel et al. | Mar 2015 | A1 |
| 20150064242 | Heyes et al. | Mar 2015 | A1 |
| 20150064725 | Schrum et al. | Mar 2015 | A1 |
| 20150086614 | Bancel et al. | Mar 2015 | A1 |
| 20150110857 | DeRosa et al. | Apr 2015 | A1 |
| 20150110858 | DeRosa et al. | Apr 2015 | A1 |
| 20150110859 | Heartlein et al. | Apr 2015 | A1 |
| 20150111248 | Bancel et al. | Apr 2015 | A1 |
| 20150111945 | Geisbert et al. | Apr 2015 | A1 |
| 20150119444 | Manoharan et al. | Apr 2015 | A1 |
| 20150119445 | Manoharan et al. | Apr 2015 | A1 |
| 20150157565 | Heartlein et al. | Jun 2015 | A1 |
| 20150166465 | Chen et al. | Jun 2015 | A1 |
| 20150190515 | Manoharan et al. | Jul 2015 | A1 |
| 20150265708 | Manoharan et al. | Sep 2015 | A1 |
| 20150315541 | Bancel et al. | Nov 2015 | A1 |
| 20150315584 | MacDonald et al. | Nov 2015 | A1 |
| 20150366997 | Guild et al. | Dec 2015 | A1 |
| 20150376220 | DeRosa et al. | Dec 2015 | A1 |
| 20160024139 | Berlanda Scorza et al. | Jan 2016 | A1 |
| 20160011548 | Maclachlan et al. | Apr 2016 | A1 |
| 20160095924 | Hoge et al. | Apr 2016 | A1 |
| 20160114011 | Bancel et al. | Apr 2016 | A1 |
| 20160115477 | Maclachlan et al. | Apr 2016 | A1 |
| 20160115483 | Maclachlan et al. | Apr 2016 | A1 |
| 20160136236 | Hoge et al. | May 2016 | A1 |
| 20160151284 | Heves et al. | Jun 2016 | A1 |
| 20160158385 | Bancel et al. | Jun 2016 | A1 |
| 20160193299 | de Fougerolles et al. | Jul 2016 | A1 |
| 20160194368 | Hoge et al. | Jul 2016 | A1 |
| 20160194625 | Hoge et al. | Jul 2016 | A1 |
| 20160199485 | Manoharan et al. | Jul 2016 | A1 |
| 20160213785 | Manoharan et al. | Jul 2016 | A1 |
| 20160237108 | Fraley et al. | Aug 2016 | A1 |
| 20160237134 | Hoge et al. | Aug 2016 | A1 |
| 20160250354 | Manoharan et al. | Sep 2016 | A1 |
| 20160251681 | Yaworski et al. | Sep 2016 | A1 |
| 20160256567 | Heyes et al. | Sep 2016 | A1 |
| 20160256568 | Heyes et al. | Sep 2016 | A1 |
| 20160256573 | de Fougerolles et al. | Sep 2016 | A1 |
| 20160264971 | Geisbert et al. | Sep 2016 | A1 |
| 20160264975 | Schrum et al. | Sep 2016 | A1 |
| 20160274089 | Ciufolini et al. | Sep 2016 | A1 |
| 20160304552 | Roy et al. | Oct 2016 | A1 |
| 20160317647 | Ciaramella et al. | Nov 2016 | A1 |
| 20160317676 | Hope et al. | Nov 2016 | A1 |
| 20160331828 | Ciaramella et al. | Nov 2016 | A1 |
| 20160348099 | Roy et al. | Dec 2016 | A1 |
| 20160354490 | Roy et al. | Dec 2016 | A1 |
| 20160354491 | Roy et al. | Dec 2016 | A1 |
| 20160354492 | Roy et al. | Dec 2016 | A1 |
| 20160354493 | Roy et al. | Dec 2016 | A1 |
| 20160367687 | Manoharan et al. | Dec 2016 | A1 |
| 20160367702 | Hoge et al. | Dec 2016 | A1 |
| 20160375134 | Bancel et al. | Dec 2016 | A1 |
| 20160375137 | Manoharan et al. | Dec 2016 | A9 |
| 20170002060 | Bolen et al. | Jan 2017 | A1 |
| 20170007702 | Heyes et al. | Jan 2017 | A1 |
| 20220162586 | Geiger | May 2022 | A1 |
| Number | Date | Country |
|---|---|---|
| 2518132 | Mar 2006 | CA |
| 2807552 | Feb 2012 | CA |
| 1399561 | Feb 2003 | CN |
| 100569877 | Dec 2009 | CN |
| 101863544 | Oct 2010 | CN |
| 24 30 998 | Jan 1975 | DE |
| 2520814 | Nov 1976 | DE |
| 3728917 | Mar 1989 | DE |
| 6 73 637 | Sep 1995 | EP |
| 0783297 | Jul 1997 | EP |
| 0853123 | Jul 1998 | EP |
| 0959092 | Nov 1999 | EP |
| 1519714 | Apr 2005 | EP |
| 1979364 | Oct 2008 | EP |
| 2045251 | Apr 2009 | EP |
| 2338478 | Jun 2011 | EP |
| 2449106 | May 2012 | EP |
| 2532649 | Dec 2012 | EP |
| 2578685 | Apr 2013 | EP |
| 2823809 | Jan 2015 | EP |
| 1 378 382 | Nov 1964 | FR |
| 2 235 112 | Jan 1975 | FR |
| 1072118 | Jun 1967 | GB |
| 1602085 | Nov 1981 | GB |
| H07-053535 | Feb 1955 | JP |
| S48-022365 | Mar 1973 | JP |
| S49-127908 | Dec 1974 | JP |
| S51-023537 | Feb 1976 | JP |
| 51-125144 | Nov 1976 | JP |
| S52-010847 | Jan 1977 | JP |
| S63125144 | May 1988 | JP |
| 63-154788 | Jun 1988 | JP |
| H09-505593 | Jun 1997 | JP |
| H10-197978 | Jul 1998 | JP |
| 11-005786 | Jan 1999 | JP |
| 11-080142 | Mar 1999 | JP |
| 2001-523215 | Nov 2001 | JP |
| 2002-167368 | Jun 2002 | JP |
| 2003-519199 | Jun 2003 | JP |
| 4-108173 | Jun 2008 | JP |
| 2008-247749 | Oct 2008 | JP |
| 2010-053108 | Mar 2010 | JP |
| 50-24216 | Sep 2012 | JP |
| 6586075 | Oct 2019 | JP |
| WO-1992004970 | Apr 1992 | WO |
| WO-9318229 | Sep 1993 | WO |
| WO-9318754 | Sep 1993 | WO |
| WO-9511004 | Apr 1995 | WO |
| WO-9514651 | Jun 1995 | WO |
| WO-9527478 | Oct 1995 | WO |
| WO-9618372 | Jun 1996 | WO |
| WO-9626179 | Aug 1996 | WO |
| WO-9637211 | Nov 1996 | WO |
| WO-9640964 | Dec 1996 | WO |
| WO-9746223 | Dec 1997 | WO |
| WO-1998005673 | Feb 1998 | WO |
| WO-9810748 | Mar 1998 | WO |
| WO-9816202 | Apr 1998 | WO |
| WO-1998030685 | Jul 1998 | WO |
| WO-9851278 | Nov 1998 | WO |
| WO-0003044 | Jan 2000 | WO |
| WO-0062813 | Oct 2000 | WO |
| WO-0064484 | Nov 2000 | WO |
| WO-0069913 | Nov 2000 | WO |
| WO-0105375 | Jan 2001 | WO |
| WO-0107599 | Feb 2001 | WO |
| WO-0222709 | Mar 2002 | WO |
| WO-0231025 | Apr 2002 | WO |
| WO-0234236 | May 2002 | WO |
| WO-0242317 | May 2002 | WO |
| WO 2003033739 | Apr 2003 | WO |
| WO-03040288 | May 2003 | WO |
| WO-03070735 | Aug 2003 | WO |
| WO-2004043588 | May 2004 | WO |
| WO-2004048345 | Jun 2004 | WO |
| WO-2004106411 | Dec 2004 | WO |
| WO-2005026372 | Mar 2005 | WO |
| WO-2005028619 | Mar 2005 | WO |
| WO-2005037226 | Apr 2005 | WO |
| WO 2005058933 | Jun 2005 | WO |
| WO-2005121348 | Dec 2005 | WO |
| WO-2006000448 | Jan 2006 | WO |
| WO-2006016097 | Feb 2006 | WO |
| WO-2006082088 | Aug 2006 | WO |
| WO-2006105043 | Oct 2006 | WO |
| WO-2006138380 | Dec 2006 | WO |
| WO-2007024708 | Mar 2007 | WO |
| WO-2007031091 | Mar 2007 | WO |
| WO-2007120863 | Oct 2007 | WO |
| WO-2007126386 | Nov 2007 | WO |
| WO-2007143659 | Dec 2007 | WO |
| WO-2008011561 | Jan 2008 | WO |
| WO-2008042973 | Apr 2008 | WO |
| WO-2008083949 | Jul 2008 | WO |
| WO-2008113364 | Sep 2008 | WO |
| WO-2009046220 | Apr 2009 | WO |
| WO 2009093142 | Jul 2009 | WO |
| WO-2009127060 | Oct 2009 | WO |
| WO-2009127230 | Oct 2009 | WO |
| WO 2010053108 | Mar 2010 | WO |
| WO-2010042877 | Apr 2010 | WO |
| WO-2010045512 | Apr 2010 | WO |
| WO-2010053572 | May 2010 | WO |
| WO-2010054401 | May 2010 | WO |
| WO-2010054405 | May 2010 | WO |
| WO-2010056403 | May 2010 | WO |
| WO-2010099387 | Sep 2010 | WO |
| WO-2010114789 | Oct 2010 | WO |
| WO-2010119256 | Oct 2010 | WO |
| WO-2010129709 | Nov 2010 | WO |
| WO-2010144740 | Dec 2010 | WO |
| WO-2010147992 | Dec 2010 | WO |
| WO-2010148013 | Dec 2010 | WO |
| WO-2011012746 | Feb 2011 | WO |
| WO-2011039144 | Apr 2011 | WO |
| WO-2011068810 | Jun 2011 | WO |
| WO-2011075656 | Jun 2011 | WO |
| WO-2011141705 | Nov 2011 | WO |
| WO-2012019168 | Feb 2012 | WO |
| WO-2012019630 | Feb 2012 | WO |
| WO-2012019780 | Feb 2012 | WO |
| WO-2012027675 | Mar 2012 | WO |
| WO-2012045075 | Apr 2012 | WO |
| WO-2012045082 | Apr 2012 | WO |
| WO-2012075040 | Jun 2012 | WO |
| WO-2012077080 | Jun 2012 | WO |
| WO-2012133737 | Oct 2012 | WO |
| WO-2012135025 | Oct 2012 | WO |
| WO-2012135805 | Oct 2012 | WO |
| WO-2012170889 | Dec 2012 | WO |
| WO-2012170930 | Dec 2012 | WO |
| WO-2013039857 | Mar 2013 | WO |
| WO-2013039861 | Mar 2013 | WO |
| WO-2013063468 | May 2013 | WO |
| WO-2013090186 | Jun 2013 | WO |
| WO-2013101690 | Jul 2013 | WO |
| WO-2013102203 | Jul 2013 | WO |
| WO-2013126803 | Aug 2013 | WO |
| WO-2013130161 | Sep 2013 | WO |
| WO-2013149140 | Oct 2013 | WO |
| WO-2013149141 | Oct 2013 | WO |
| WO-2013151663 | Oct 2013 | WO |
| WO-2013151664 | Oct 2013 | WO |
| WO-2013151666 | Oct 2013 | WO |
| WO-2013151667 | Oct 2013 | WO |
| WO-2013151668 | Oct 2013 | WO |
| WO-2013151670 | Oct 2013 | WO |
| WO-2013151671 | Oct 2013 | WO |
| WO-2013151672 | Oct 2013 | WO |
| WO-2013151736 | Oct 2013 | WO |
| WO-2013185067 | Dec 2013 | WO |
| WO-2013185069 | Dec 2013 | WO |
| WO-2014028487 | Feb 2014 | WO |
| WO-2014089486 | Jun 2014 | WO |
| WO-2014107571 | Jul 2014 | WO |
| WO-2014113089 | Jul 2014 | WO |
| WO-2014144039 | Sep 2014 | WO |
| WO-2014144196 | Sep 2014 | WO |
| WO-2014144711 | Sep 2014 | WO |
| WO-2014144767 | Sep 2014 | WO |
| WO-2014152027 | Sep 2014 | WO |
| WO-2014152030 | Sep 2014 | WO |
| WO-2014152031 | Sep 2014 | WO |
| WO-2014152211 | Sep 2014 | WO |
| WO-2014152513 | Sep 2014 | WO |
| WO-2014152540 | Sep 2014 | WO |
| WO-2014152659 | Sep 2014 | WO |
| WO-2014152673 | Sep 2014 | WO |
| WO-2014152774 | Sep 2014 | WO |
| WO-2014152940 | Sep 2014 | WO |
| WO-2014152966 | Sep 2014 | WO |
| WO-2014153052 | Sep 2014 | WO |
| WO-2014158795 | Oct 2014 | WO |
| WO-2014159813 | Oct 2014 | WO |
| WO-2014179562 | Nov 2014 | WO |
| WO-2014210356 | Dec 2014 | WO |
| WO-2015006747 | Jan 2015 | WO |
| WO-2015011633 | Jan 2015 | WO |
| WO-2015048744 | Apr 2015 | WO |
| WO-2015051169 | Apr 2015 | WO |
| WO-2015051173 | Apr 2015 | WO |
| WO-2015058069 | Apr 2015 | WO |
| WO-2015085318 | Jun 2015 | WO |
| WO-2015089511 | Jun 2015 | WO |
| WO-2016054421 | Apr 2016 | WO |
| WO-2016071857 | May 2016 | WO |
| WO-2016077123 | May 2016 | WO |
| WO-2016077125 | May 2016 | WO |
| WO-2016118724 | Jul 2016 | WO |
| WO-2016118725 | Jul 2016 | WO |
| WO-2016154127 | Sep 2016 | WO |
| WO-2016164762 | Oct 2016 | WO |
| WO-2016183366 | Nov 2016 | WO |
| WO-2016193206 | Dec 2016 | WO |
| WO-2016197132 | Dec 2016 | WO |
| WO-2016197133 | Dec 2016 | WO |
| WO-2016201377 | Dec 2016 | WO |
| WO-2017149139 | Sep 2017 | WO |
| Entry |
|---|
| Beckert et al. Ch. 3 Synthesis of RNA by in vitro Transcrioptionin RNA, Methods in Molecular Biology pp. 29-41 (Year: 2011)—Cited and provided in U.S. Appl. No. 17/835,710. |
| Beckert et al. Ch. 3 Synthesis of RNA by in vitro Transcription in RNA, Methods in Molecular Biology pp. 29-41 (Year: 2011). |
| Choi et al., “Purifying mRNAs with a high-affinity elF4E mutant identifies the short 3′ poly(A) end phenotype,” PNAS 100(12) : 7033-7038 (Year: 2003). |
| Jacob, “Histone-Gene Reiteration in the Genome of a Mouse,” Euro. J. of Biochemistry, 65, pp. 275-284 (1976). |
| Moss et al., “Histone mRNAs contain blocked and methylated 5′ terminal sequences but lack methylated nucleosides at internal positions,” Cell 10, pp. 113-120 (1977). |
| Ramanathan et al., “Survey and Summary mRNA capping: biological functions and applications,” Nucleic Acids Research, 44(16), pp. 7511-7526 (2016). |
| Shatkin et al., “The ends of the affair: Capping and polyadenylation,” Nature Structural Biology, 7(10), pp. 838-842 (2000). |
| Woo et al., “Physical and Chemical Characterization of Purified Ovalbumin Messenger RNA,” J. of Biological Chemistry, 250(17), pp. 7027-7039 (1975). |
| U.S. Appl. No. 60/083,294, filed Apr. 28, 1998, Chen et al. |
| U.S. Appl. No. 61/494,714, filed Jun. 8, 2011, Guild et al. |
| U.S. Appl. No. 61/494,745, filed Jun. 8, 2011, Guild et al. |
| U.S. Appl. No. 61/494,881, filed Jun. 8, 2011, Guild et al. |
| U.S. Appl. No. 61/494,882, filed Jun. 8, 2011, Zhang et al. |
| Adami, R.C. et al., An amino acid-based amphoteric liposomal delivery system for systemic administration of siRNA. Molecular Therapy 19(6):1141-1151 (2011). |
| Akinc, A. et al., A combinatorial library of lipid-like materials for delivery of RNAi therapeutics. Nature Biotechnology 26(5):561-569 (2008). |
| Akinc, A. et al., Development of lipidoid-siRNA formulations for systemic delivery to the liver. Molecular Therapy 17(5):872-879 (2009). |
| Alton, E.W.F.W. et al., Cationic Lipid-Mediated CFTR Gene Transfer to the Lungs and Nose of Patients with Cystic Fibrosis: a Double-Blind Placebo-Controlled Trial, Lancet, 353:947-954 (1999). |
| Anderson, D.G. et al., Structure/property studies of polymeric gene delivery using a library of poly(beta-amino esters). Molecular Therapy 11(3):426-434 (2005). |
| Anderson, D.M. et al., Stability of mRNA/Cationic Lipid Lipoplexes in Human and Rat Cerebrospinal Fluid: Methods and Evidence for Nonviral mRNA Gene Delivery to the Central Nervous System, Human Gene Therapy, 14:191-202 (2003). |
| Anderson, J. Biological Responses to Materials. Annual Review of Materials Research 31:81-110 (2001). |
| Anderson, W. French, Human gene therapy, Nature, 392, 25-30 (1998). |
| Andries, O. et al., Comparison of the Gene Transfer Efficiency of mRNA/GL67 and pDNA/GL67 Complexes in Respiratory Cells, Mol. Pharmaceut., 9: 2136-2145 (2012). |
| Auffray, C. et al., Purification of Mouse Immunoglubulin Heavy-Chain Messenger RNAs from Total Myeloma Tumor RNA, European Journal of Biochemistry, 107(2):303-314 (1980). |
| Author Unknown, Blood Proteins, published by WikiPedia, San Francisco, CA, 2 pages, <http://en.wikipedia.org/wiki/Biood_proteins> downloaded May 17, 2015. |
| Bahlke, M. A. et al., Progress towards in vivo use of siRNAs, Molecular Therapy, 13:644-670 (2006). |
| Bajaj, A. et al., Synthesis and gene transfection efficacies of PEI-cholesterol-based lipopolymers. Bioconjugate Chemistry 19(8):1640-516511 (2008). |
| Barreau, C. et al., Liposome-mediated RNA transfection should be used with caution, RNA, 12:1790-1793 (2006). |
| Behr, J. et al., Efficient Gene Transfer into Mammalian Primary Endocrine Cells with Lipo Polyamine-Coated DNA, Proc. Nat.'l Acad. Sci., 86: 6982-6986 (1989). |
| Bennett, J. Immune response following intraocular delivery of recombinant viral vectors, Gene Therapy, 10: 977-982 (2003). |
| Bloomfield, V.A., Quasi-Elastic Light Scattering Applications in Biochemistry and Biology, Ann. Rev. Biophys. Bioeng. 10:421-450 (1981). |
| Boussif, O. et al., A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proceedings of the National Academy of Sciences of the USA. 92(16):7297-7301 (1995). |
| Braun, C.S. et al., Structure/function relationships of polyamidoamine/DNA dendrimers as gene delivery vehicles. Journal of Pharmaceutical Sciences 94(2):423-436 (2005). |
| Breunig, M. et al., Breaking up the correlation between efficacy and toxicity for nonviral gene delivery. Proceedings of the National Academy of Sciences of the U S A. 104(36):14454-14459 (2007). |
| Breunig, M. et al., Mechanistic investigation of poly(ethylene imine)-based siRNA delivery: disulfide bonds boost intracellular release of the cargo. Journal of Controlled Release 130(1):57-63 (2008). |
| Brey, D.M. et al., Controlling poly(beta-amino ester) network properties through macromer branching. Acta Biomaterialia 4(2):207-217 (2008). |
| Brey, D.M. et al., Influence of macromer molecular weight and chemistry on poly(beta-amino ester) network properties and initial cell interactions. Journal of Biomedical Materials Research Part A 85(3):731-741 (2007). |
| Budker, V. et al., Protein/Amphipathic Polyamine Complexes Enable Highly Efficient Transfection with Minimal Toxicity, BioTechniques, 23: 139-147 (1997). |
| Burnett, J.C. et al., Current progress of siRNA/shRNA therapeutics in clinical trials. Biotechnology Journal 6(9):1130-1146 (2011). |
| Byk, G. et al., Synthesis, activity, and structure—activity relationship studies of novel cationic lipids for DNA transfer. Journal of Medical Chemistry 41(2):224-235 (1998). |
| Caplen, N.J. et al., In vitro liposome-mediated DNA transfection of epithelial cell lines using the cationic liposome DC-Chol/DOPE, Gene Therapy, 2:603-613 (1995). |
| Cassiman, D. Gene transfer for inborn errors of metabolism of the liver: the clinical perspective, Current Pharmaceutical Design, 17(24):2550-2557 (2011). |
| Castanotto, D. et al., The promises and pitfalls of RNA-interference-based therapeutics. Nature 457(7228):426-433 (2009). |
| Chakraborty, C. Potentiality of Small Interfering RNAs (siRNA) as Recent Therapeutic Targets for Gene-Silencing. Current Drug Targets 8(3):469-82 (2007). |
| Chandler, R. et al., Liver-directed adeno-associated virus serotype 8 gene transfer rescues a lethal murine model of citrullinemmia type 1, Gene Therapy, 20:1188-1191 (2013). |
| Chau, Y. et al., Investigation of targeting mechanism of new dextran-peptide-methotrexate conjugates using biodistribution study in matrix-metalloproteinase-overexpressing tumor xenograft model, J. Pharm. Sci., 95(3): 542-551 (2006). |
| Chen, D. et al., Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation. Journal of the American Chemical Society 134(16):6948-6951 (2012). |
| Chen, Y. and Huang, L., Tumor-targeted delivery of siRNA by non-viral vector: safe and effective cancer therapy. Expert Opinion on Drug Delivery 5(12):1301-1311 (2008). |
| Chiou, H.C. et al., Enhanced resistance to nuclease degradation of nucleic acids complexed to; asialoglycoprotein-polylysine carriers, Nucleic Acids Research, 22(24):5439-5446 (1994). |
| Christensen, U.B. et al., Intercalating nucleic acids containing insertions of 1-O-(1-pyrenylmethyl)glycerol: stabilisation of dsDNA and discrimination of DNA over RNA, Nucl. Acids. Res., 30(22): 4918-4925 (2002). |
| Conese, M. et al., Gene and Cell Therapy for Cystic Fibrosis: From Bench to Bedside, J. Cyst. Fibros., 10 Suppl 2:S114-s128 (2011). |
| Cotten, M. et al., Receptor-mediated transport of DNA into eukaryotic cells. Methods in Enzymology 217 (H):618-644 (1993). |
| Cowling, V.H., Regulation of mRNA cap methylation, Biochemical Journal, 425:295-302 (2010). |
| Creusat, G. et al., Proton sponge trick for pH-sensitive disassembly of polyethylenimine-based siRNA delivery systems. Bioconjugate Chemistry 21(5):994-1002 (2010). |
| Crooke, S.T. Molecular mechanisms of action of antisense drugs. Biochimica et Biophysica Acta 1489(1):31-44. Review (1999). |
| Crystal, R.G. Transfer of genes to humans: early lessons and obstacles to success. Science 270(5235):404-410. Review (1995). |
| Damen, M. et al., Delivery of DNA and siRNA by novel gemini-like amphiphilic peptides. Journal of Controlled Release 145(1):33-39 (2010). |
| Dande, P. et al., Improving RNA interference in mammalian cells by 4′-thio-modified small interfering RNA (siRNA): effect on siRNA activity and nuclease stability when used in combination with 2′-0-alkyl modifications, Journal of Medicinal Chemistry, 49(5):1624-1634 (2006). |
| Davis, M. E., The first targeted delivery of siRNA in humans via a self-assembling, cyclodextrin polymer-based nanoparticle: from concept to clinic. Molecular Pharmacuetics 6(3):659-668 (2009). |
| Davis, M.E. et al., Evidence of RNAi in humans from systemically administered siRNA via targeted nanoparticles. Nature 464(7291):1067-1070 (2010). |
| Debus, H. et al., Delivery of Messenger RNA Using Poly(ethylene imine)-poly(ethylene glycol)-Copolymer Blends for Polyplex Formation: Biophysical Characterization and In Vitro Transfection Properties, J. Control. Rel., 148:334-343 (2010). |
| Decher, G. Fuzzy Nanoassemblies: Toward Layered Polymeric Multicomposites. Science 277: 1232-1237 (1997). |
| Demeshkina, N. et al., Interactions of the ribosome with mRNA and tRNA, Current Opinion in Structural Biology, 20(3):325-332 (2010). |
| Denardo, S.J. et al., Enhanced Therapeutic Index of Radioimmunotherapy (RIT) in Prostate Cancer Patients Comparison of Radiation Dosimetry for 1,4,7,10-Tetraazacyclododecane-N,N′,N″,N′″-Tetraacetic Acid (DOTA)-Peptide versus 2IT-DOTA Monoclonal Antibody Linkage for RIT1, Clin. Cancer Res., 9: 3665s (2003). |
| Dern, R.J. et al., Toxicity studies of pyrimethamine (daraprim). The American Journal of Tropical Medicine and Hygiene 4(2):217-220 (1955). |
| Deshmukh, H. M and Huang, L., Liposome and polylysine mediated gene therapy. New Journal of Chemistry 21:113-124 (1997). |
| Discher, B.M. et al., Polymersomes: tough vesicles made from diblock copolymers. Science 284(5417):1143-1146 (1999). |
| Discher, D.E. and Eisenberg, A., Polymer vesicles. Science 297(5583):967-973. Review (2002). |
| Dong, Y. et al., Lipopeptide nanoparticles for potent and selective siRNA delivery in rodents and nonhuman primates, Proceedings of the National Academy of Sciences, 111(11): 3955-3960 (2014). |
| Drummond, D.C. et al., Optimizing Liposomes for Delivery of Chemotherapeutic Agents to Solid Tumors, Pharmacological Reviews, 51(4): 691-743 (1999). |
| Dwarki, V. et al., Cationic liposome-mediated RNA transfection, Methods in Enzymology, 217:644-654 (1993). |
| Elbashir, S.M. et al., RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes & Development 15: 188-200 (2001). |
| Elton, C., The Next Next Big Thing, Boston Magazine, 106-118 (Mar. 2013). |
| Emlen, W. et al., Effect of DNA size and strandedness on the in vivo clearance and organ localization of DNA, Clinical & Experimental Immunology, 56:185-192 (1984). |
| Eon-Duval, A. et al., Removal of RNA impurities by tangential flow filtration in an RNase-free plasmid DNA purification process, Analytical Biochemistry, 316(1):66-73 (2003). |
| Ernst, N. et al., Interaction of Liposomal and Polycationic Transfection Complexes with Pulmonary Surfactant, J. Gene. Med., 1:331-340 (1999). |
| Estimated Number of Animal and Plant Species on Earth, http://www.factmonster.com/ipka/A0934288.html, 2000-2014, 3 pages, (Retrieved Aug. 2, 2014). |
| Ewert, K. et al., Cationic lipid-DNA complexes for gene therapy: understanding the relationship between complex structure and gene delivery pathways at the molecular level. Current Medicinal Chemistry 11(2): 133-149 (2004). |
| Fath, S. et al., Multiparameter RNA and Codon Optimization: A Standardized Tool to Assess and Enhance Autologous Mammalian Gene Expression, PLoS One, 6(3):e17596 (14 pages) 2011. |
| Fechter, P. and Brownlee, G. G., Recognition of mRNA cap structures by viral and cellular proteins, Journal of General Virology, 86:1239-1249 (2005). |
| Felgner, P.L. and Ringold, G.M., Cationic liposome-mediated transfection, Nature, 337(6205):387-388 (1989). |
| Felgner, P.L. et al., Lipofection: A Highly Efficient, Lipid-Mediated DNA-Transfection Procedure, Proc. Natl. Acad., 84:7413-7417 (1987). |
| Fenske, D.B. and Cullis, P., Liposomal nanomedicines. Expert Opinion on Drug Delivery 5(1):25-44 (2008). |
| Fernandez, V. et al., Cross Flow Filtration of RNA Extracts by Hollow Fiber Membrane, Acta Biotechnologica, 12(1):49-56 (1992). |
| Ferruti, P.F. and Barbucci, R. , Linear amino polymers: Synthesis, protonation and complex formation. Advances in Polymer Science 58:55-92 (1984). |
| Ferruti, P.F. et al., A novel modification of poly(l-lysine) leading to a soluble cationic polymer with reduced toxicity and with potential as a transfection agent. Macromolecular Chemistry and Physics 199:2565-2575 (1998). |
| Fire, A. et al., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391(6669):806-811 (1998). |
| Fischer, D. et al., Effect of poly(ethylene imine) molecular weight and pegylation on organ distribution and pharmacokinetics; of polyplexes with oligodeoxynucleotides in mice, Drug Metabolism and Disposition, 32(9):983-992 (2004). |
| Fumoto, S. et al., Targeted Gene Delivery: Importance of Administration Routes, Novel Gene Therapy Approaches, 3-31 (2013). |
| Furgeson, D.Y. et al., Modified linear polyethylenimine-cholesterol conjugates for DNA complexation. Bioconjugate Chemistry 14(4):840-847 (2003). |
| Furgeson, D.Y. et al., Novel water insoluble lipoparticulates for gene delivery. Pharmaceutical Research 19(4): 382-390 (2002). |
| Galipon, J. et al., Stress-induced lncRNAs evade nuclear degradation and enter the translational machinery, Genes to Cells, 18(5):353-368 (2013). |
| Gao, X. and Huang, L., A novel cationic liposome reagent for efficient transfection of mammalian cells, Biochem. Biophys. Res. Comm., 179(1): 280-285 (1991). |
| Garbuzfnko, O.B. et al., Intratracheal Versus Intravenous Liposomal Delivery of siRNA, Antisense Oligonucleotides and Anticancer Drug, Pharmaceutical Research, 26(2):382-394 (2009). |
| Geraerts, M. et al., Upscaling of lentiviral vector production by tangential flow filtration, Journal of Gene Medicine, 7(10):1299-1310 (2005). |
| Godbey, W.T. et al., Size matters: molecular weight affects the efficiency of poly(ethylenimine) as a gene delivery vehicle. Journal of Biomedical Materials Research 45(3):268-275 (1998). |
| Gonzalez, H. et al., New class of polymers for the delivery of macromolecular therapeutics. Bioconjugate Chemistry 10(6):1068-1074 (1999). |
| Gonzalez-Aseguinolaza, G. et al., Gene therapy of liver diseases: A 2011 perspective, Clinics and Research in Hepatology and Gastroenterology, 35(11):699-708 (2011). |
| Gordon, N. Ornithine transcarbamylase deficiency: a urea cycle defect, European Journal of Paediatric Neurology, 7:115-121 (2003). |
| Grayson, A.C.R. et al., Biophysical and structural characterization of polyethylenimine-mediated siRNA delivery in vitro. Pharmaceutical Research 23(8): 1868-1876 (2006). |
| Grudzien, E. et al., Novel cap analogs for in vitro synthesis of mRNAs with high translational efficiency, RNA Biology, 10(9):1479-1487 (2004). |
| Grunlan, M.A. et al., Synthesis of 1,9-bis[glycidyloxypropyl]penta(1′H, 1′H, 2′H, 2′H-perfluoroalkylmethylsiloxane)s and copolymerization with piperazine. Polymer 45:2517-2523 (2004). |
| Gupta, U. et al., A review of in vitro-in vivo investigations on dendrimers: the novel nanoscopic drug carriers. Nanomedicine: Nanotechnology, Biology, and Medicine 2(2):66-73 (2006). |
| Guttman, M. et al., Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals, Nature, 458:223-227 (2009). |
| Haensler, J. and Szoka, F., Polyamidoamine cascade polymers mediate efficient transfection of cells in culture. Bioconjugate Chemistry 4(5):372-379 (1993). |
| Harada-Shiba, M. et al., Polyion complex micelles as vectors in gene therapy—pharmacokinetics and in vivo; gene transfer, Gene Therapy, 9(6):407-414 (2002). |
| Haskins M., Gene Therapy for Lysosomal Storage Disorders (LDSs) in Large Animal Models, Ilar J., 50(2): 112-121 (2009). |
| Hata, A. et al., Isolation and Characterization of the Human Ornithine Transcarbamylase Gene: Structure of the 5′-End Region, Journal of Biochemistry, 100:717-725 (1986). |
| Hecker, J. et al., Advances in Self-Limited Gene Expression of Protective Intracellular Proteins In-Vivo in Rat Brain Using mRNA / Cationic Lipid Complexes, Anesthesia and Analgesia, 86(2S):346S (1994). |
| Heidenreich, O. et al., High Activity and Stability of Hammerhead Ribozymes Containing 2′-Modified Pyrimidine Nucleosides and Phosphorothioates, The Journal of Biological Chemistry, 269(3):2131-2138 (1994). |
| Henkin, R. I. et al., Inhaled Insulin—Intrapulmonary, intranasal, and other routes of administration: Mechanisms of action, Nutrition, 26: 33-39 (2010). |
| Hess, P. R. et al., Vaccination with mRNAs Encoding Tumor-Associated Antigens and Granulocyte-Macrophage Colony-Stimulating Factor Efficiently Primes CTL Responses, but is Insufficient to Overcome Tolerance to a Model Tumor/Self Antigen, Cancer Immunology, Immunotherapy:CII, 55(6):672-683 (2006). |
| Heyes, J. et al., Cationic Lipid Saturation Influences Intracellular Delivery of Encapsulated Nucleic Acids, J. Controlled Release, 107:276-287 (2005). |
| Higman, M.A. et al., The mRNA (Guanine-7-)methyltransferase Domain of the Vaccinia Virus mRNA Capping Enzyme, The Journal of Biological Chemistry, 269(21):14974-14981 (1994). |
| Hill, I.R.C. et al., In vitro cytotoxicity of poly(amidoamine)s: relevance to DNA delivery. Biochimica et Biophysica Acta 1427: 161-174 (1999). |
| Hill, J.G. et al., Enantioselective Epoxidation of Allylic Alcohols: (2S,3S)-3-Propyloxiranemethanol. Organic Syntheses Collection 7: 461 (1990) and 63: 66 (1985) (8 pages). |
| Hillery, A.M. et al., Drug Delivery and Targeting for Pharmacists and Pharmaceutical Scientists, Taylor and Francis (2005). |
| Hoerr, I. et al., In Vivo Application of RNA Leads to Induction of Specific Cytotoxic T Lymphocytes and Antibodies, European Journal of Immunology, 30(1):1-7 (2000). |
| Hofland, H.E.J et al., Formation of stable cationic lipid/DNA complexes for gene transfer. Proceedings of the National Academy of Sciences of the USA 93 (14): 7305-7309 (1996). |
| Homo sapiens galactosidase, alpha (GLA) mRNA, NCBI Reference Sequence NM_000169.1, Modification Date: Nov. 17, 2006. |
| Hope, M.J. et al., Cationic Lipids, Phosphatidylethanolamine and the Intracellular Delivery of Polymeric, Nucleic Acid-Based Drugs. Molecular Membrane Technology 15:1-14 (1998). |
| Hope, M.J. et al., Reduction of Liposome Size and Preparation of Unilamellar Vesicles by Extrusion Techniques, In: Liposome Technology, 1:123-139 (1993). |
| Hornung, V. et al., Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. The Journal of Immunology 168: 4531-4537 (2002). |
| Horwich, A.L. et al., Structure and Expression of a Complementary DNA for the Nuclear Coded Precursor of Human Mitochondrial Ornithine Transcarbamylase, Science, 224(4653):1068-1074 (1984). |
| Horwich, A.L. et al., Targeting of Pre-Ornithine Transcarbamylase to Mitochondria: Definition of Critical Regions and Residues in the Leader Peptide, Cell, 44:451-459 (1986). |
| Howard, K.A. Delivery of RNA interference therapeutics using polycation-based nanoparticles. Advanced Drug Delivery Reviews 61: 710-720 (2009). |
| Huang, Z. et al., Thiocholesterol-Based Lipids for Ordered Assembly of Bioresponsive Gene Carriers, Molecular Therapy, 11(3):409-417 (2005). |
| Huttenhofer, A. and Noller, H., Footprinting mRNA-ribosome complexes with chemical probes, The EMBO Journal, 13(16):3892-3901 (1994). |
| Incani, V. et al., Lipid and hydrophobic modification of cationic carriers on route to superior gene vectors. Soft Matter 6: 2124-2138 (2010). |
| International Preliminary Report on Patentability for PCT/US2010/058457, 12 pages (dated Jun. 14, 2012). |
| International Search Report for PCT/US2010/058457, 4 pages (dated May 6, 2011). |
| International Search Report for PCT/US2011/062459, 3 pages (dated Apr. 11, 2012). |
| International Search Report for PCT/US2012/041663, 4 pages (dated Oct. 8, 2012). |
| International Search Report for PCT/US2012/041724, 5 pages (dated Oct. 25, 2012). |
| International Search Report for PCT/US2013/034602, 2 pages (dated Jun. 17, 2013). |
| International Search Report for PCT/US2013/034604, 4 pages (dated Jun. 17, 2013). |
| International Search Report for PCT/US2013/044769, 4 pages (dated Nov. 12, 2013). |
| International Search Report for PCT/US2013/044771, 6 pages (dated Nov. 1, 2013). |
| International Search Report for PCT/US2013/073672, 6 pages (dated Mar. 3, 2014). |
| International Search Report for PCT/US2014/027422, 5 pages (dated Jul. 31, 2014). |
| International Search Report for PCT/US2014/027585, 3 pages (dated Jul. 14, 2014). |
| International Search Report for PCT/US2014/027602, 6 pages (dated Jul. 28, 2014). |
| International Search Report for PCT/US2014/027717, 5 pages (dated Jul. 16, 2014). |
| International Search Report for PCT/US2014/028330, 5 pages (dated Jul. 22, 2014). |
| International Search Report for PCT/US2014/028441, 6 pages (dated Jul. 22, 2014). |
| International Search Report for PCT/US2014/028498, 5 pages (dated Jul. 28, 2014). |
| International Search Report for PCT/US2014/061786, 6 pages (dated Feb. 6, 2015). |
| International Search Report for PCT/US2014/061793, 4 pages (dated Feb. 6, 2015). |
| International Search Report for PCT/US2014/061830, 5 pages (dated Feb. 4, 2015). |
| International Search Report for PCT/US2014/061841, 6 pages (dated Feb. 24, 2015). |
| International Search Report for PCT/US2015/21403 (4 pages) dated Jun. 15, 2015. |
| Jakobsen, K. et al., Purification of MRNA Directly From Crude Plant Tissues in 15 Minutes Using Magnetic Oligo DT Microsheres, Nucleic Acids Research, 18(12):3669 (1990). |
| Jeffs, L.B. et al., A scalable, extrusion-free method for efficient liposomal encapsulation of plasmid DNA, Pharmacol. Res., 22(3): 362-372 (2005). |
| Jiang, G. et al., Hyaluronic acid-polyethyleneimine conjugate for target specific intracellular delivery of siRNA. Biopolymers 89 (7): 635-642 (2008). |
| Jiang, M. et al., Electrochemically controlled release of lipid/DNA complexes: a new tool for synthetic gene delivery system. Electrochemistry Communications (6): 576-582 (2004). |
| Jiang, S. and Cao, Z., Ultralow-fouling, functionalizable, and hydrolyzable zwitterionic materials and their derivatives for biological applications. Advanced Materials 22(9):920-932 (2010). |
| Jolck, R.I. et al., Solid-phase synthesis of PEGylated lipopeptides using click chemistry. Bioconjugate Chemistry 21(5):807-810 (2010). |
| Jon, S. et al., Degradable poly(amino alcohol esters) as potential DNA vectors with low cytotoxicity. Biomacromolecules 4(6):1759-1762 (2003). |
| Jones, G. et al., Duplex- and Triplex-Forming Properties of 4′-Thio-Modified Oligodeoxynucleotides, Bioorganic & Medicinal Chemistry Letters, 7(10):1275-1278 (1997). |
| Kabanov, A.V. and Kabanov, V.A., DNA complexes with polycations for the delivery of genetic material into cells. Bioconjugate Chemistry 6(1): 7-20 (1995). |
| Kamath, S. et al., Surface chemistry influences implant-mediated host tissue responses. Journal of Biomedical Materials Research A 86(3):617-626 (2007). |
| Kariko, K. et al., In vivo protein expression from mRNA delivered into adult rat brain, Journal of Neuroscience Methods, 105:77-86 (2001). |
| Kariko, K. et al., Incorporation of Pseudouridine Into mRNA Yields Superior Nonimmunogenic Vector With Increased Translational Capacity and Biological Stability, Molecular Therapy, 16(11): 1833-1840 (2008). |
| Kasuya, T. et al., In Vivo Delivery of Bionanocapsules Displaying Phaseolus vulgaris Agglutinin-L4 Isolectin to Malignant Tumors Overexpressing N-Acetylglucosaminyltransferase V, Human Gene Therapy, 19:887-895 (2008). |
| Kaur, N. et al., A delineation of diketopiperazine self-assembly processes: understanding the molecular events involved in Nepsilon-(fumaroyl)diketopiperazine of L-Lys (FDKP) interactions. Molecular Pharmaceutics 5(2):294-315 (2007). |
| Kaur, T. et al., Addressing the Challenge: Current and Future Directions in Ovarian Cancer THerapy, Current Gene Therapy, 9: 434-458 (2009). |
| Kiew, L.V. et al., Effect of antisense oligodeoxynucleotides for ICAM-1 on renal ischaemia-reperfusion injury in the anaesthetised rat, The Journal of Physiology, 557(3):981-989 (2004). |
| Kim, S.H. et al., Comparative evaluation of target-specific GFP gene silencing efficiencies for antisense ODN, synthetic siRNA, and siRNA plasmid complexed with PEI-PEG-FOL conjugate. Bioconjugate Chemistry 17(1): 241-244 (2006). |
| Kim, T. et al., Synthesis of biodegradable cross-linked poly(beta-amino ester) for gene delivery and its modification, inducing enhanced transfection efficiency and stepwise degradation. Bioconjugate Chemistry 16(5):1140-1148 (2005). |
| Klibanov, A.L. et al., Amphipathic polyethyleneglycols effectively prolong the circulation time of liposomes, FEBS, 268(1): 235-237 (1990). |
| Kober, L. et al., Optimized Signal Peptides for the Development of High Expressing CHO Cell Lines, Biotechnol. Bioeng., 110:1164-1173 (2012). |
| Kodama, K. et al., The Features and Shortcomings for Gene Delivery of Current Non-Viral Carriers, Current Medicinal Chemistry, 13: 2155-2161 (2006). |
| Kormann, M.S.D. et al., Expression of therapeutic proteins after delivery of chemically modified mRNA in mice, Nature Biotechnology, 29(2):154-157 (2011). |
| Kozak, M. An analysis of 5′-noncoding sequences from 699 vertebrate messenger RNAs, Nucleic Acid Research, 15(20):8125-8148 (1987). |
| Krieg, P.A. et al., In vitro RNA synthesis with SP6 RNA polymerase, Methods in Enzymology, 155:397-415 (1987). |
| Kvasnica, M. et al., Platinum(II) complexes with steroidal esters of L-methionine and L-histidine: Synthesis, characterization and cytotoxic activity, Bioorganic & Medicinal Chemistry, 16:3704-3713 (2008). |
| Lam, J.K.W et al., Pulmonary delivery of therapeutic siRNA, Advanced Drug Delivery Reviews (2011). |
| Lasic, D.D. et al., Gelation of liposome interior. A novel method for drug encapsulation, FEBS Letters, 312(2-3):255-258 (1992). |
| Lasic, D.D. Novel applications of liposomes, Trends in Biotechnology, 16:307-321 (1998). |
| Lee, S. et al., Stability and cellular uptake of polymerized siRNA (poly-siRNA)/polyethylenimine (PEI) complexes for efficient gene silencing. Journal of Controlled Release 141: 339-346 (2010). |
| Li, L. et al., Preparation and Gene Delivery of Alkaline Amino Acids-Based Cationic Liposomes, Archives of Pharmaceutical Research, 31(7):924-931 (2008). |
| Li, S. et al., In vivo gene transfer via intravenous administration of cationic lipid-protamine-DNA (LPD) complexes, Gene Therapy, 4:891-900 (1997). |
| Li, W. et al., Lipid-based Nanoparticles for Nucleic Acid Delivery, Pharmaceutical Research, 24(3):438-449 (2007). |
| Liebhaber, S.A. et al., Translation inhibition by an mRNA coding region secondary structure is determined by its proximity to the AUG initiation codon, Journal of Molecular Biology, 226(3):609-621 (1992). |
| Lim, Y. et al., A self-destroying polycationic polymer: biodegradable poly(4-hydroxy-l-proline ester). Journal of American Chemical Society 121: 5633-5639 (1999). |
| Lindgren, V. et al., Human Ornithine Transcarbamylase Locus Mapped to Band Xp21.1 Near the Duchenne Muscular Dystrophy Locus, Science, 226(2675):698-700 (1984). |
| Liu, X. et al., COStar: a D-star Lite-based Dynamic Search Algorithm for Codon Optimization, Journal of Theoretical Biology, 344:19-30 (2014). |
| Liu, Y. and Huang, L., Designer Lipids Advance Systematic siRNA Delivery, Molecular Therapy, 18(4):669-670 (2010). |
| Liu, Y. et al., Factors influencing the efficiency of cationic liposome-mediated intravenous gene delivery, Nature Biotechnology, 15:167-173 (1997). |
| Lo, K-M et al., High level expression and secretion of Fc-X fusion proteins in mammalian cells, Protein Engineering, 11(6):495-500 (1998). |
| Lorenzi, J. C. C. et al., Intranasal Vaccination with Messenger RNA as a New Approach in Gene Therapy: Use Against Tuberculosis, BMC Biotechnology, 10(77):1-11 (2010). |
| Love, K.T. et al., Lipid-like materials for low-dose, in vivo gene silencing, PNAS, 107(5):1864-1869 (2010). |
| Lu, D. et al., Optimization of methods to achieve mRNA-mediated transfection of tumor cells in vitro and in vivo employing cationic liposome vectors, Cancer Gene Therapy, 1(4):245-252 (1994). |
| Lukyanov, A.N. and Torchilin, V.P., Micelles from lipid derivatives of water-soluble polymers as delivery systems for poorly soluble drugs. Advanced Drug Delivery Reviews 56: 1273-1289 (2004). |
| Luo, D. and Saltzman, M., Synthetic DNA delivery systems. Nature Biotechnology 18: 33-37. Review (2000). |
| Lynn, D.M. and Langer, R., Degradable Poly(β-amino esters):? Synthesis, Characterization, and Self-Assembly with Plasmid DNA. Journal of American Chemical Society 122(44): 10761-10768 (2000). |
| Lynn, D.M. et al., Accelerated discovery of synthetic transfection vectors: parallel synthesis and screening of a degradable polymer library. Journal of American Chemical Society 123 (33): 8155-8156 (2001). |
| Lynn, D.M. et al., pH-Responsive Polymer Microspheres: Rapid Release of Encapsulated Material within the Range of Intracellular pH. Angewandte Chemie International Edition 40(9): 1707-1710 (2001). |
| Ma, M. et al., Developlment of Cationic Polymer Coatings to Regulate Foreign Body Responses. Advanced Healthcare Materials 23: H189-H194. Reviews (2011). |
| Maclachlan, I., Lipid nanoparticle-mediated delivery of messenger RNA, 1st International mRNA Health Conference; Tubingen Germany, (Oct. 24, 2013) Retrieved from the Internet: URL: <http://files.shareholder.com/downloads/ABEA-50QJTB/2628241206x0x699789/47543d12-db34-4e6e-88a9-f3ae5d97bld2/MacLachlan_mRNA_Conf_2013>. |
| Maeda-Mamiya, R. et al., In vivo gene delivery by cationic tetraamino; fullerene. Proceedings of National Academy of Sciences U S A, 107(12):5339-5344 (2010). |
| Malone, R.W., et al., Cationic liposome-mediated RNA transfection, PNAS, 86:6077-6081 (1989). |
| Mammal, http://en.wikipedia.org/wiki/Mammal, 2007, Pearson Education, NY, NY, Author unkown (Source: The international union for conservation of nature and natural resources), 2 pages, (Retrieved Aug. 2, 2014). |
| Mansour, H.M. et al., Nanomedicine in pulmonary delivery, International Journal of Nanomedicine, 4:299-319 (2009). |
| Margus, H. et al., Cell-penetrating peptides as versatile vehicles for oligonucleotide delivery. Molecular Therapy 20 (3): 525-533 (2012). |
| Martell, A.E. and Chaberek, S., The Preparation and the Properties of Some N,N′-Disubstituted-ethylenediaminedipropionic Acids. Journal of the American Chemical Society 72: 5357-5361 (1950). |
| Martinon, F. et al., Induction of Virus-Specific Cytotoxic T Lymphocytes in Vivo by Liposome-Entrapped mRNA, European Journal of Immunology, 23(7):1719-1722 (1993). |
| Mathiowitz, E. and Langer, R., Polyanhydride microspheres as drug carriers I. Hot-melt microencapsulation. Journal of Controlled Release 5: 13-22 (1987). |
| Mathiowitz, E. et al., Novel microcapsules for delivery systems. Reactive Polymers 6: 275-283 (1987). |
| Mathiowitz, E. et al., Polyanhydride microspheres as drug carriers II. Microencapsulation by solvent removal. Journal of Applied Polymer Sciences 35: 755-774 (1988). |
| McCracken, S. et al., 5′-Capping Enzymes are Targeted to Pre-MRNA by Binding to the Phosphorylated Carboxy-Terminal Domain of RNA Polymerase II, Genes and Development, 22(24):3306-3318 (1997). |
| McIvor, R. S., Therapeutic Delivery of mRNA: The Medium is the Message, Molecular Therapy, 19(5):822-823 (2011). |
| Melton, D.A. et al., Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from; plasmids containing a bacteriophage SP6 promoter, Nucleic Acids Research, 12(18):7035-7056 (1984). |
| Mendelsohn, J.D. et al., Rational design of cytophilic and cytophobic polyelectrolyte multilayer thin films. Biomacromolecules 4(1): 96-106 (2003). |
| Merkel, O.M. and Kiseel, T., Nonviral Pulmonary Delivery of siRNA, Accounts of Chemical Research, 45(7):961-970 (2012). |
| Merten, O. et al., Large-Scale Manufacture and Characterization of a Lentiviral Vector Produced for Clinical Ex Vivo Gene Therapy Application, Human Gene Therapy, 22(3):343-356 (2011). |
| Miller, A. Cationic Liposomes for Gene Therapy. Angewandte Chemie International Edition 37: 1768-1785 (1998). |
| Monia, B.P. et al., Evaluation of 2′-Modified Oligonucleotides Containing 2′-Deoxy Gaps as Antisense Inhibitors of Gene Epression, The Journal of Biological Chemistry, 268(19):14514-14522 (1993). |
| Morrissey, D.V. et al., Potent and Persistent in vivo Anti-HBV Activity of Chemically Modified siRNAs, Nat. Biotechnol., 23(8): 1003-1007 (2005). |
| Narang, A.S. et al., Cationic lipids with increased DNA binding affinity for nonviral gene transfer in dividing and nondividing cells. Bioconjugate Chemistry 16(1): 156-168 (2005). |
| Navarro, G. et al., Phospholipid-polyethylenimine conjugate-based micelle-like nanoparticles for siRNA delivery. Drug Delivery and Translational Research 1: 25-33 (2011). |
| Neamnark, A. et al., Aliphatic lipid substitution on 2 kDa polyethylenimine improves plasmid delivery and transgene expression. Molecular Pharmaceutics 6(6): 1798-1815 (2009). |
| Ng, J. et al., LincRNAs join the pluripotency alliance, Nature Genetics, 42:1035-1036 (2010). |
| Nguyen, D.N. et al., A novel high-throughput cell-based method for integrated quantification of type I interferons and in vitro screening of immunostimulatory RNA drug delivery. Biotechnology and Bioengineering 103(4): 664-675 (2009). |
| Nguyen, D.N. et al., Drug delivery-mediated control of RNA immunostimulation. Molecular Therapy 17(9): 1555-1562 (2009). |
| Nojima, T. et al., The Interaction between Cap-binding Complex and RNA Export Factor is Required for Intronless mRNA Export, Journal of Biological Chemistry, 282(21):15645-15651 (2007). |
| Nori, A. et al., Tat-conjugated synthetic macromolecules facilitate cytoplasmic drug delivery to human ovarian carcinoma cells, Bioconj. Chem., 14(1): 44-50 (2003). |
| Okumura, K. et al., Bax mRNA therapy using cationic liposomes for human malignant melanoma, The Journal of Gene Medicine, 10:910-917 (2008). |
| Otsuka, Y. et al., Identification of a Cytoplasmic Complex That Adds a Cap onto 5′-Monophosphate RNA, Molecular and Cellular Biology, 29(8):2155-2167 (2009). |
| Ozer, A., Alternative applications for drug delivery: nasal and pulmonary routes, Nanomaterials and Nanosystems for Biomedical Applications, M.R. Mozafari (ed.): 99-112 (2007). |
| Painter, H. et al, Topical Delivery of mRNA to the Murine Lung and Nasal Epithelium, Gene Medicine Group and the Medical Informatics Unit, Nuffield Department of Clinical Laboratory Sciences, University of Oxford, 1 page, (2004). |
| Painter, H. et al., Topical Delivery of mRNA to the Murine Lung and Nasal Epithelium, Molecular Therapy, 9:S187 (2004). |
| Painter, H., An Investigation of mRNA as a Gene Transfer Agent, Gene Medicine Research Group Nuffield Department of Clinical Laboratory Sciences and Merton College, University of Oxford, 1-282 (2007). |
| Painter, H., An Investigation of mRNA as a Gene Transfer Agent, Oxford University GeneMedicine, Abstract Only, 1 page (2007). |
| Parrish, D.A. and Mathias, L.J., Five- and six-membered ring opening of pyroglutamic diketopiperazine. Journal of Organic Chemistry 67(6): 1820-1826 (2002). |
| Patton, J., Market Trends in Pulmonary Therapies, Trends and Opportunities, VI: 372-377. (2006). |
| Paulus, C. and Nevels, M., The Human Cytomegalovirus Major Immediate-Early Proteins as Antagonists of Intrinsic and Innate Antiviral Host Responses, Viruses, 1:760-779 (2009). |
| Peppas, N.A. et al., Hydrogels in Biology and Medicine: From Molecular Principles to Bionanotechnology. Advanced Materials 18: 1345-1360(2006). |
| Philipp, A. et al., Hydrophobically modified oligoethylenimines as highly efficient transfection agents for siRNA delivery. Bioconjugate Chemistry 20(11): 2055-2061 (2009). |
| Pons, M. et al., Liposomes obtained by the ethanol injection method, Int. J. Pharm., 95: 51-56. (1993). |
| Prata, C.A. et al., Lipophilic peptides for gene delivery. Bioconjugate Chemistry 19(2): 418-420 (2008). |
| Probst, J. et al., Spontaneous cellular uptake of exogenous messenger RNA in vivo is nucleic acid-specific, saturable and ion dependent, Gene Therapy, 14:1175-1180 (2007). |
| Promega, PolyATtract mRNA Isolation Systems, Instructions for Use of Products Z5200, Z5210, Z2300 and Z5310, Technical Manual (2012). |
| Putnam, D. Polymers for gene delivery across length scales. Nature Materials 5: 439-451 (2006). |
| Putnam, D. and Langer, R., Poly(4-hydroxy-l-proline ester): Low-Temperature Polycondensation and Plasmid DNA Complexation. Macromolecules 32(11): 3658-3662 (1999). |
| Qiagen, Oligotex Handbook, Second Edition (2002). |
| Rabinovich, P.M. et al., Synthetic Messenger RNA as a Tool for Gene Therapy, Human Gene Therapy, 17:1027-1035 (2006). |
| Raper, S.E. et al., Developing adenoviral-mediated in vivo gene therapy for ornithine transcarbamylase deficiency, Journal of Inherited Metabolic Disease, 21:119-137 (1998). |
| Ratajczak, J. et al., Membrane-derived microvesicles: important and underappreciated mediators of cell-to-cell communication, Leukemia, 20:1487-1495 (2006). |
| Ratner, B.D. and Bryant, S., Biomaterials: where we have been and where we are going. Annual Review of Biomedical Engineering 6: 41-75 (2004). |
| Reddy, A. et al., The Effect of Labour and Placental Separation on the Shedding of Syncytiotrophoblast Microparticles, Cell-free DNA and mRNA in Normal Pregnancy and Pre-eclampsia, Placenta, 29: 942-949 (2008). |
| Rejman, J. et al., Characterization and transfection properties of lipoplexes stabilized with novel exchangeable polyethylene glycol-lipid conjugates, Biochimica et Biophysica Acta, 1660:41-52 (2004). |
| Remington: The Science and Practice of Pharmacy, 21st Edition, Philadelphia, PA. Lippincott Williams & Wilkins (2005). |
| Rosenecker, J. et al., Gene Therapy for Cystic Fibrosis Lung Disease: Current Status and Future Perspectives, Curr. Opin. Mol. Ther., 8:439-445 (2006). |
| Rosenecker, J. et al., Interaction of Bronchoalveolar Lavage Fluid with Polyplexes and Lipoplexes: Analysing the Role of Proteins and Glycoproteins, J. Gene. Med., 5:49-60 (2003). |
| Rowe, S.M. et al., Cystic Fibrosis, New Engl. J. Med. 352:1992-2001 (2005). |
| Ryng, S. et al., Synthesis and structure elucidation of 5-aminomethinimino-3-methyl-4-isoxazolecarboxylic acid phenylamides and their immunological activity. Arch. Pharm. Pharm. Med. Chem 330(11):319-26 (1997). |
| Sahay, G. et al., Endocytosis of nanomedicines. Journal of Controlled Release 145: 182-195 (2010). |
| Sakiyama-Elbert, S.E. and Hubbell, J.A., Functional Biomaterials: Design of Novel Biomaterials. Annual Review of Materials Research 31: 183-201 (2001). |
| Schnierle, B.S. et al., Cap-specific mRNA (nucleoside-O2′-)-methyltransferase and poly(A) polymerase stimulatory activities of vaccinia virus are mediated by a single protein, Proceedings of the National Academy of Sciences, 89:2897-2901 (1992). |
| Schreier, H., The new frontier: gene and oligonucleotide therapy, Pharmaceutica Acta Helvetiae, 68(3):145-159 (1994). |
| Semple, S.C. et al., Rational design of cationic lipids for siRNA delivery, Nature Biotechnology, 28(2): 172-176 (2010). |
| Shchori E., Poly (secondary Amine)s from Diacrylates and Diamines. Journal of Polymer Science 21(6):413-15 (1983). |
| Sherwood, R.F. Advanced drug delivery reviews: enzyme prodrug therapy, Adv. Drug Del. Rev., 22: 269-288 (1996). |
| Shimada, A. et al., Translocation Pathway of the Intratracheally Instilled Ultrafine Particles from the Lung into the Blood Circulation in the Mouse, Toxicologic Pathology, 34:949-957 (2006). |
| Siegwart, D.J. et al., Combinatorial synthesis of chemically diverse core-shell nanoparticles for intracellular delivery. Proceedings of the National Academy of the Sciences of the USA 108(32):12996-123001 (2011). |
| Smisterova, J. et al., Molecular Shape of the Cationic Lipid Controls the Structure of Cationic Lipid/Dioleylphosphatidylethanolamine-DNA Complexes and the Efficiency of Gene Delivery, The Journal of Biological Chemistry, 276(50):47615-47622 (2001). |
| Stern, L. et al., A novel antitumor prodrug platform designed to be cleaved by the endoprotease legumain, Bioconj. Chem., 20: 500-510 (2009). |
| Su, X. et al., Cytosolic Delivery Mediated Via Electrostatic Surface Binding of mRNA To Degradable Lipid-Coated Polymeric Nanoparticles, Polymer Preprints, 51(2):668-669 (2010). |
| Su, X. et al., In Vitro and in Vivo mRNA Delivery Using Lipid-Enveloped pH-Responsive Polymer Nanoparticles, Molecular Pharmaceutics, 8(3):774-787 (2011). |
| Suri, M. et al., Genetics for Pediatricians, Remedica Publishing, (2005). |
| Szoka, F. and Papahadjopoulos, D., Comparative properties and methods of preparation of lipid vesicles (liposomes). Annual Review of Biophysics Bioengineering 9: 467-508 (1980). |
| Tagawa, M. et al., Gene expression and active virus replication in the liver after injection of duck hepatitis B virus DNA into the peripheral vein of ducklings, Journal of Hepatology, 24:328-334 (1996). |
| Takahashi, Y. et al., Development of safe and effective nonviral gene therapy by eliminating CpG motifs from plasmid DNA vector, Frontiers in Bioscience, S4: 133-141 (2012). |
| Tan, S. et al., Engineering Nanocarriers for siRNA Delivery. Small 7(7): 841-856 (2011). |
| Tang, F. and Hughes, J. et al., Introduction of a Disulfide Bond into a Cationic Lipid Enhances Transgene Expression of Plasmid DNA, Biochemical and Biophysical Research Communications, 242(1):141-145 (1998). |
| Tang, M.X. et al., In vitro gene delivery by degraded polyamidoamine dendrimers. Bioconjugate Chemistry 7(6): 703-714 (1996). |
| Tarcha, P.J. et al., Synthesis and characterization of chemically condensed oligoethylenimine containing beta-aminopropionamide linkages for siRNA delivery. Biomaterials 28: 3731-3740 (2007). |
| Tavernier, G. et al., mRNA as gene therapeutic: How to control protein expression, Journal of Controlled Release, 150:238-247 (2011). |
| Third Party Preissuance Submission Under 37 CFR § 1.290 (Oct. 25, 2013). |
| Thomas, C. E. et al., Progress and problems with the use of viral vectors for gene therapy, Nature Reviews/Genetics, 4: 346-358 (2003). |
| Thompson, P.E. et al., Antiamebic action of 5-chloro-7-diethylaminomethyl-8-quinolinol and of other substituted 8-quinolinols in vitro and in experimental animals. American Journal of Tropical Medicine and Hygiene 2(4): 224-248 (1955). |
| Toki, B.E. et al., Protease-mediated fragmentation of p-amidobenzyl ethers: a new strategy for the activation of anticancer prodrugs, J. Org. Chem., 67(6): 1866-1872 (2002). |
| Tranchant, I. et al., Physicochemical optimisation of plasmid delivery by cationic lipids. Journal of Gene Medicine 6: S24-S35 (2004). |
| Tsui, N.B. et al., Stability of endogenous and added RNA in blood specimens, serum, and plasma, Clinical Chemistry, 48(10):1647-1653 (2002). |
| Tsvetkov, D.E. et al., Neoglycoconjugates based on dendrimeric poly(aminoamides). Russian Journal of Bioorganic Chemistry 28(6): 470-486 (2002). |
| Tuschl, T. et al., Targeted mRNA degradation by double-stranded RNA in vitro, Genes and Development, 13(24):3191-3197 (1999). |
| Urban-Klein, B. et al., RNAi-mediated gene-targeting through systemic application of polyethylenimine (PEI)-complexed siRNA in vivo. Gene Therapy 12(5): 461-466 (2005). |
| Van Balen, G.P. et al., Liposome/water lipophilicity: methods, information content, and pharmaceutical applications. Medicinal Research Reviews 24(3): 299-324 (2004). |
| Van De Wetering, P. et al., Structure-activity relationships of water-soluble cationic methacrylate/methacrylamide polymers for nonviral gene delivery. Bioconjugate Chemistry 10(4): 589-597 (1999). |
| Van Der Gun, B.T.F et al., Serum insensitive, intranuclear protein delivery by the multipurpose cationic lipid Saint-2, Journal of Controlled Release, 123:228-238 (2007). |
| Van Tendeloo, V.F.I et al., mRNA-based gene transfer as a tool for gene and cell therapy, Current Opinion in Molecular Therapeutics, 9(5):423-431 (2007). |
| Vandenbroucke, R.E. et al., Prolonged gene silencing in hepatoma cells and primary hepatocytes after small interfering RNA delivery with biodegradable poly(beta-amino esters). Journal of Gene Medicine 10: 783-794 (2008). |
| Varambally, S. et al., Genomic Loss of microRNA-101 Leads to Overexpression of Histone Methyltransferase EZH2 in Cancer, Science, 322:1695-1699 (2008). |
| Veronese, F.M. et al., PEG-doxorubicin conjugates: influence of polymer structure on drug release, in vitro cytotoxicity, biodistribution, and antitumor activity, Bioconj. Chem., 16(4): 775-784 (2005). |
| Viecelli, H. et al., Gene Therapy for Hepatic Diseases Using Non-Viral Minicircle-DNA Vector, Journal of Inherited Metabolic Disease, 35(1):S144 (2012). |
| Viecelli, H. et al., Gene therapy for liver diseases using non-viral minicircle-DNA vector, Human Gene Therapy, 23(10):A145 (2012). |
| Viecelli, H. et al., Gene therapy for liver diseases using non-viral minicircle-DNA vector, Molecular Therapy, 21(1):S136 (2013). |
| Vomelova, I. et al., Methods of RNA Purification. All Ways (Should) Lead to Rome, Folia Biologica, 55(6):242-251 (2009). |
| Von Harpe et al., Characterization of commercially available and synthesized polyethylenimines for gene delivery. Journal of Controlled Release 69(2):309-322 (2000). |
| Walde, P. et al., Preparation of Vesicles (Liposomes). Encyclopedia of Nanoscience and Nanotechnology. Nalwa, ed. American Scientific Publishers, Los Angeles 9:43-79 (2004). |
| Wang, H. et al., N-acetylgalactosamine functionalized mixed micellar nanoparticles for targeted delivery of siRNA to liver, Journal of Controlled Release, 166(2):106-114 (2013). |
| Wang, Y. et al., Systemic delivery of modified mRNA encoding herpes simplex virus 1 thymidine kinase for targeted cancer gene therapy, Molecular Therapy, 21(2):358-367 (2013). |
| Webb, M. et al., Sphinogomyeline-cholesterol liposomes significantly enhance the pharmacokinetic and therapeutic properties of vincristine in murine and human tumour models, British Journal of Cancer, 72(4):896-904 (1995). |
| Werth, S. et al., A low molecular weight fraction of polyethylenimine (PEI) displays increased transfection efficiency of DNA and siRNA in fresh or lyophilized complexes. Journal of Controlled Release 112: 257-270 (2006). |
| Wetzer, B. et al., Reducible cationic lipids for gene transfer, Biochem. J., 356:747-756 (2001). |
| White, J.E. et al., Poly (hydroxyaminoethers): A New Family of Epoxy-Based Thermoplastics. Advanced Materials 12(23): 1791-1800 (2000). |
| White, J.E et al., Step-growth polymerization of 10,11-epoxyundecanoic acid. Synthesis and properties of a new hydroxy-functionalized thermopastic polyester. Advanced Materials 48: 3990-3998 (2007). |
| Whitehead, K.A. et al., Knocking down barriers: advances in siRNA delivery. Nature Reviews Drug Discovery 8(2): 129-139 (2009). |
| Wiehe, J.M. et al., mRNA-mediated gene delivery into human progenitor cells promotes highly efficient protein expression, Journal of Cellular and Molecular Medicine, 11(3):521-530 (2007). |
| Williams, D. et al., A simple, highly efficient method for heterologous expression in mammalian primary neurons using cationic lipid-mediated mRNA transfection, Frontiers in Neuroscience, 4(181):1-20 (2010). |
| Written Opinion for PCT/US2010/058457, 14 pages (dated May 6, 2011). |
| Written Opinion for PCT/US2011/062459, 9 pages (dated Apr. 11, 2012). |
| Written Opinion for PCT/US2012/041663, 7 pages (dated Oct. 8, 2012). |
| Written Opinion for PCT/US2012/041724, 11 pages (dated Oct. 25, 2012). |
| Written Opinion for PCT/US2013/034602, 4 pages (dated Jun. 17, 2013). |
| Written Opinion for PCT/US2013/034604, 9 pages (dated Jun. 17, 2013). |
| Written Opinion for PCT/US2013/044769, 8 pages (dated Nov. 12, 2013). |
| Written Opinion for PCT/US2013/044771, 7 pages (dated Nov. 1, 2013). |
| Written Opinion for PCT/US2013/073672, 7 pages (dated Mar. 3, 2014). |
| Written Opinion for PCT/US2014/027422, 6 pages (dated Jul. 31, 2014). |
| Written Opinion for PCT/US2014/027602, 7 pages (dated Jul. 28, 2014). |
| Written Opinion for PCT/US2014/027717, 5 pages (dated Jul. 16, 2014). |
| Written Opinion for PCT/US2014/028330, 7 pages (dated Jul. 22, 2014). |
| Written Opinion for PCT/US2014/028441, 6 pages (dated Jul. 22, 2014). |
| Written Opinion for PCT/US2014/028498, 6 pages (dated Jul. 28, 2014). |
| Written Opinion for PCT/US2014/061786, 5 pages (dated Feb. 6, 2015). |
| Written Opinion for PCT/US2014/061793, 4 pages (dated Feb. 6, 2015). |
| Written Opinion for PCT/US2014/061830, 7 pages (dated Feb. 4, 2015). |
| Written Opinion for PCT/US2014/061841, 8 pages (dated Feb. 24, 2015). |
| Written Opinion for PCT/US2015/21403 (7 pages) dated Jun. 15, 2015. |
| Wu, J. and Zern, M., Modification of liposomes for liver targeting, Journal of Hepatology, 24(6):757-763 (1996). |
| Wu, J. et al., Cationic lipid polymerization as a novel approach for constructing new DNA delivery agents. Bioconjugate Chemistry 12(2): 251-257 (2001). |
| Wurdinger, T. et al., A secreted luciferase for ex-vivo monitoring of in vivo processes, Nat. Methods, 5(2):171-173 (2008). |
| Yamamoto, A. et al., Current prospects for mRNA gene delivery, European Journal of Pharmaceutics and Biopharmaceutics, 71(3): 484-489 (2009). |
| Yamamoto, Y. et al., Important Role of the Proline Residue in the Signal Sequence that Directs the Secretion of Human Lysozyme in Saccharomyces cerevisiae, Biochemistry, 28:2728-2732 (1989). |
| Yasuda, M. et al., Fabry Disease: Novel [alpha]-Galactosidase A 3-terminal Mutations Result in Multiple Transcripts Due to Aberrant 3-End Formation, American Journal of Human Genetics, 73:162-173 (2003). |
| Ye, X. et al., Nucleic Acids, Protein Synthesis, and Molecular Genetics: Prolonged Metabolic Correction in Adult Ornithine Transcarbamylase-deficient Mice with Adenoviral Vectors, The Journal of Biological Chemistry, 271:3639-3646 (1996). |
| Yokoe, H. et al., Spatial dynamics of GFP-tagged proteins investigated by local fluorescence enhancement, Nature Biotechnology, 14(10):1252-1256 (1996). |
| Yoneda et al., A cell-penetrating peptidic GRP78 ligand for tumor cell-specific prodrug therapy, Bioorg. Med. Chem. Lett., 18(5): 1632-1636 (2008). |
| Yoshioka, Y. and Calvert, P., Epoxy-based Electroactive Polymer Gels. Experimental Mechanics 42(4): 404-408 (2002). |
| Zagridullin, P.H. et al., Monobasic amines. II. Cycloalkylation and hydroxyalkylation of cyclic and acyclic di- and polyamines. Journal of Organic Chemistry26(1):184-88. Russian (1990). |
| Zaugg, H.E. et al., 3-Carboxy-2,5-piperazinedione and Derivatives. Journal of American Chemical Society 78(11):2626-2631 (1956). |
| Zauner, W.et al., Polylysine-based transfection systems utilizing receptor-mediated delivery. Advanced Drug Delivery Reviews 30(1-3):97-113(1998). |
| Zintchenko, A. et al., Simple modifications of branched PEI lead to highly efficient siRNA carriers with low toxicity. Bioconjugate Chemistry 19(7): 1448-1455 (2008). |
| Zou, S. et al., Lipid-mediated delivery of RNA is more efficient than delivery of DNA in non-dividing cells, International Journal of Pharmaceutics, 389(1-2):232-243 (2010). |
| Baboo et al., “‘Dark matter’ worlds of unstable RNA and protein”, Nucleus, 2014, 5:4 281-286. |
| Bhaduri, S. et al., “Procedure for the Preparation of Milligram Quantities of Adenovirus Messenaer Ribonucleic Acid”, Journal of Viroloay, 2(6):1126-1129, (1972). |
| Kariko et al., “Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA”, Nucleic Acids Research, pp. 1-10 (2011). |
| Lee et al., “A Polynucleotide Segment Rich in Adenylie Acid in the Rapidly-Labeled Polyribosomal RNA Component of Mouse Sarcoma 180 Ascites Cells”, PNAS 68(6): 13331-35 (Jun. 1971). |
| Lee et al., “Tiny abortive initiation transcripts exert antitermination activity on an RNA hairpin-dependent intrinsic terminator”, Nucleic Acids Research, 38(18): 6045-53 (2010). |
| Wurm F.M., “Review: Production of recombinant protein therapeutics in cultivated mammalian cells”, Nature Biotechnology, 22(11): 1393-8 (Nov. 2004). |
| Kern et al., “Application of a Fed-Batch System To Produce RNA by In Vitro Transcription”, Biotechnol. Prog. 15 :174 (1999). |
| Chomczynski et al., “Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction”, Analytical Biochemistry 162(1): 156-9 (1987). |
| Cowan et al., Boichem. Cell Biol. 80 745 (2002). |
| Kahn et al., Biotech. Bioeng. 69: 101 (2000). |
| Kariko et al., Modern Therapy 16(11): 1833 (2008). |
| Keith et al., Biotech. Bioeng. 38: 557 (1991). |
| Krieg et al., Nucleic Acids Research 12 (18): 7057 (1984). |
| Kormann et al., Nature Biotechnology 29 (2): 154 (2011). |
| Martin et al., RNA 4:226(1998). |
| Novagen, “Bug Buster Protein Extraction Protocol/Reagent”. downloaded from the internet on Aug. 3, 2017. |
| Schwartz, “Tangential Flow Filtration”, downloaded from the internet on Aug. 3, 2017. |
| Pokroskaya et al., Analytical Biochemistry 220: 420 (1994). |
| Rosemeyer et al., Analytical Biochemistry 224: 446 (1995). |
| You et al., Cell Biology International Reports 16(7): 663 (1992). |
| Ross et al., PNAS 69 (1): 264 (1972). |
| Nakanishi et al., “New Transfection Agents Based on Liposomes ContainingBiosurfactant MEL-A”, Pharmaceuticals, 5(3): 411-420 (2013). |
| Robinson et al., “Lipid Nanoparticle-Delivered Chemically Modified mRNA Restores Chloride Secretion in Cystic Fibrosis”, Molecular Therapy 26(8): 1-13 (2018). |
| B P De et al., “Characterization of an in vitro system for the synthesis of mRNA from human parainfluenza virus type 3,” J Virol. 64(3):1135-42 (1990). |
| Promega, “Riboprobe® in vitro Transcription Systems,” (2001) (24 pages). |
| Number | Date | Country | |
|---|---|---|---|
| 20220411781 A1 | Dec 2022 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61784996 | Mar 2013 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 17103439 | Nov 2020 | US |
| Child | 17835725 | US | |
| Parent | 15936289 | Mar 2018 | US |
| Child | 17103439 | US | |
| Parent | 14775915 | US | |
| Child | 15936289 | US |