Methods for rapid identification of pathogens in humans and animals

Information

  • Patent Grant
  • 9416424
  • Patent Number
    9,416,424
  • Date Filed
    Thursday, June 30, 2011
    14 years ago
  • Date Issued
    Tuesday, August 16, 2016
    8 years ago
Abstract
The present invention provides methods of: identifying pathogens in biological samples from humans and animals, resolving a plurality of etiologic agents present in samples obtained from humans and animals, determining detailed genetic information about such pathogens or etiologic agents, and rapid detection and identification of bioagents from environmental, clinical or other samples.
Description
FIELD OF THE INVENTION

The present invention relates generally to clinical applications of directed to the identification of pathogens in biological samples from humans and animals. The present invention is also directed to the resolution of a plurality of etiologic agents present in samples obtained from humans and animals. The invention is further directed to the determination of detailed genetic information about such pathogens or etiologic agents.


The identification of the bioagent is important for determining a proper course of treatment and/or eradication of the bioagent in such cases as biological warfare and natural infections. Furthermore, the determination of the geographic origin of a selected bioagent will facilitate the identification of potential criminal identity. The present invention also relates to methods for rapid detection and identification of bioagents from environmental, clinical or other samples. The methods provide for detection and characterization of a unique base composition signature (BCS) from any bioagent, including bacteria and viruses. The unique BCS is used to rapidly identify the bioagent.


BACKGROUND OF THE INVENTION

In the United States, hospitals report well over 5 million cases of recognized infectious disease-related illnesses annually. Significantly greater numbers remain undetected, both in the inpatient and community setting, resulting in substantial morbidity and mortality. Critical intervention for infectious disease relies on rapid, sensitive and specific detection of the offending pathogen, and is central to the mission of microbiology laboratories at medical centers. Unfortunately, despite the recognition that outcomes from infectious illnesses are directly associated with time to pathogen recognition, as well as accurate identification of the class and species of microbe, and ability to identify the presence of drug resistance isolates, conventional hospital laboratories often remain encumbered by traditional slow multi-step culture based assays. Other limitations of the conventional laboratory which have become increasingly apparent include: extremely prolonged wait-times for pathogens with long generation time (up to several weeks); requirements for additional testing and wait times for speciation and identification of antimicrobial resistance; diminished test sensitivity for patients who have received antibiotics; and absolute inability to culture certain pathogens in disease states associated with microbial infection.


For more than a decade, molecular testing has been heralded as the diagnostic tool for the new millennium, whose ultimate potential could include forced obsolescence of traditional hospital laboratories. However, despite the fact that significant advances in clinical application of PCR techniques have occurred, the practicing physician still relies principally on standard techniques. A brief discussion of several existing applications of PCR in the hospital-based setting follows.


Generally speaking molecular diagnostics have been championed for identifying organisms that cannot be grown in vitro, or in instances where existing culture techniques are insensitive and/or require prolonged incubation times. PCR-based diagnostics have been successfully developed for a wide variety of microbes. Application to the clinical arena has met with variable success, with only a few assays achieving acceptance and utility.


One of the earliest, and perhaps most widely recognized applications of PCR for clinical practice is in detection of Mycobacterium tuberculosis. Clinical characteristics favoring development of a nonculture-based test for tuberculosis include week to month long delays associated with standard testing, occurrence of drug-resistant isolates and public health imperatives associated with recognition, isolation and treatment. Although frequently used as a diagnostic adjunctive, practical and routine clinical application of PCR remains problematic due to significant inter-laboratory variation in sensitivity, and inadequate specificity for use in low prevalence populations, requiring further development at the technical level. Recent advances in the laboratory suggest that identification of drug resistant isolates by amplification of mutations associated with specific antibiotic resistance (e.g., rpoB gene in rifampin resistant strains) may be forthcoming for clinical use, although widespread application will require extensive clinical validation.


One diagnostic assay, which has gained widespread acceptance, is for C. trachomatis. Conventional detection systems are limiting due to inadequate sensitivity and specificity (direct immunofluorescence or enzyme immunoassay) or the requirement for specialized culture facilities, due to the fastidious characteristics of this microbe. Laboratory development, followed by widespread clinical validation testing in a variety of acute and nonacute care settings have demonstrated excellent sensitivity (90-100%) and specificity (97%) of the PCR assay leading to its commercial development. Proven efficacy of the PCR assay from both genital and urine sampling, have resulted in its application to a variety of clinical setting, most recently including routine screening of patients considered at risk.


While the full potential for PCR diagnostics to provide rapid and critical information to physicians faced with difficult clinical-decisions has yet to be realized, one recently developed assay provides an example of the promise of this evolving technology. Distinguishing life-threatening causes of fever from more benign causes in children is a fundamental clinical dilemma faced by clinicians, particularly when infections of the central nervous system are being considered. Bacterial causes of meningitis can be highly aggressive, but generally cannot be differentiated on a clinical basis from aseptic meningitis, which is a relatively benign condition that can be managed on an outpatient basis. Existing blood culture methods often take several days to turn positive, and are often confounded by poor sensitivity or false-negative findings in patients receiving empiric antimicrobials. Testing and application of a PCR assay for enteroviral meningitis has been found to be highly sensitive. With reporting of results within 1 day, preliminary clinical trials have shown significant reductions in hospital costs, due to decreased duration of hospital stays and reduction in antibiotic therapy. Other viral PCR assays, now routinely available include those for herpes simplex virus, cytomegalovirus, hepatitis and HIV. Each has a demonstrated cost savings role in clinical practice, including detection of otherwise difficult to diagnose infections and newly realized capacity to monitor progression of disease and response to therapy, vital in the management of chronic infectious diseases.


The concept of a universal detection system has been forwarded for identification of bacterial pathogens, and speaks most directly to the possible clinical implications of a broad-based screening tool for clinical use. Exploiting the existence of highly conserved regions of DNA common to all bacterial species in a PCR assay would empower physicians to rapidly identify the presence of bacteremia, which would profoundly impact patient care. Previous empiric decision making could be abandoned in favor of educated practice, allowing appropriate and expeditious decision-making regarding need for antibiotic therapy and hospitalization.


Experimental work using the conserved features of the 16S rRNA common to almost all bacterial species, is an area of active investigation. Hospital test sites have focused on “high yield” clinical settings where expeditious identification of the presence of systemic bacterial infection has immediate high morbidity and mortality consequences. Notable clinical infections have included evaluation of febrile infants at risk for sepsis, detection of bacteremia in febrile neutropenic cancer patients, and examination of critically ill patients in the intensive care unit. While several of these studies have reported promising results (with sensitivity and specificity well over 90%), significant technical difficulties (described below) remain, and have prevented general acceptance of this assay in clinics and hospitals (which remain dependent on standard blood culture methodologies). Even the revolutionary advances of real-time PCR technique, which offers a quantitative more reproducible and technically simpler system, remains encumbered by inherent technical limitations of the PCR assay.


The principle shortcomings of applying PCR assays to the clinical setting include: inability to eliminate background DNA contamination; interference with the PCR amplification by substrates present in the reaction; and limited capacity to provide rapid reliable speciation, antibiotic resistance and subtype identification. Some laboratories have recently made progress in identifying and removing inhibitors; however background contamination remains problematic, and methods directed towards eliminating exogenous sources of DNA report significant diminution in assay sensitivity. Finally, while product identification and detailed characterization has been achieved using sequencing techniques, these approaches are laborious and time-intensive thus detracting from its clinical applicability.


Rapid and definitive microbial identification is desirable for a variety of industrial, medical, environmental, quality, and research reasons. Traditionally, the microbiology laboratory has functioned to identify the etiologic agents of infectious diseases through direct examination and culture of specimens. Since the mid-1980s, researchers have repeatedly demonstrated the practical utility of molecular biology techniques, many of which form the basis of clinical diagnostic assays. Some of these techniques include nucleic acid hybridization analysis, restriction enzyme analysis, genetic sequence analysis, and separation and purification of nucleic acids (See, e.g., J. Sambrook, E. F. Fritsch, and T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). These procedures, in general, are time-consuming and tedious. Another option is the polymerase chain reaction (PCR) or other amplification procedure that amplifies a specific target DNA sequence based on the flanking primers used. Finally, detection and data analysis convert the hybridization event into an analytical result.


Other not yet fully realized applications of PCR for clinical medicine is the identification of infectious causes of disease previously described as idiopathic (e.g. Bartonella henselae in bacillary angiomatosis, and Tropheryma whippellii as the uncultured bacillus associated with Whipple's disease). Further, recent epidemiological studies which suggest a strong association between Chlamydia pneumonia and coronary artery disease, serve as example of the possible widespread, yet undiscovered links between pathogen and host which may ultimately allow for new insights into pathogenesis and novel life sustaining or saving therapeutics.


For the practicing clinician, PCR technology offers a yet unrealized potential for diagnostic omnipotence in the arena of infectious disease. A universal reliable infectious disease detection system would certainly become a fundamental tool in the evolving diagnostic armamentarium of the 21st century clinician. For front line emergency physicians, or physicians working in disaster settings, a quick universal detection system, would allow for molecular triage and early aggressive targeted therapy. Preliminary clinical studies using species specific probes suggest that implementing rapid testing in acute care setting is feasible. Resources could thus be appropriately applied, and patients with suspected infections could rapidly be risk stratified to the different treatment settings, depending on the pathogen and virulence. Furthermore, links with data management systems, locally regionally and nationally, would allow for effective epidemiological surveillance, with obvious benefits for antibiotic selection and control of disease outbreaks.


For the hospitalists, the ability to speciate and subtype would allow for more precise decision-making regarding antimicrobial agents. Patients who are colonized with highly contagious pathogens could be appropriately isolated on entry into the medical setting without delay. Targeted therapy will diminish development of antibiotic resistance. Furthermore, identification of the genetic basis of antibiotic resistant strains would permit precise pharmacologic intervention. Both physician and patient would benefit with less need for repetitive testing and elimination of wait times for test results.


It is certain that the individual patient will benefit directly from this approach. Patients with unrecognized or difficult to diagnose infections would be identified and treated promptly. There will be reduced need for prolonged inpatient stays, with resultant decreases in iatrogenic events.


Mass spectrometry provides detailed information about the molecules being analyzed, including high mass accuracy. It is also a process that can be easily automated. Low-resolution MS may be unreliable when used to detect some known agents, if their spectral lines are sufficiently weak or sufficiently close to those from other living organisms in the sample. DNA chips with specific probes can only determine the presence or absence of specifically anticipated organisms. Because there are hundreds of thousands of species of benign bacteria, some very similar in sequence to threat organisms, even arrays with 10,000 probes lack the breadth needed to detect a particular organism.


Antibodies face more severe diversity limitations than arrays. If antibodies are designed against highly conserved targets to increase diversity, the false alarm problem will dominate, again because threat organisms are very similar to benign ones. Antibodies are only capable of detecting known agents in relatively uncluttered environments.


Several groups have reported detection of PCR products using high resolution electrospray ionization-Fourier transform-ion cyclotron resonance mass spectrometry (ESI-FT-ICR MS). Accurate measurement of exact mass combined with knowledge of the number of at least one nucleotide allowed calculation of the total base composition for PCR duplex products of approximately 100 base pairs. (Aaserud et al., J. Am. Soc. Mass Spec., 1996, 7, 1266-1269; Muddiman et al., Anal. Chem., 1997, 69, 1543-1549; Wunschel et al., Anal. Chem., 1998, 70, 1203-1207; Muddiman et al., Rev. Anal. Chem., 1998, 17, 1-68). Electrospray ionization-Fourier transform-ion cyclotron resistance (ESI-FT-ICR) MS may be used to determine the mass of double-stranded, 500 base-pair PCR products via the average molecular mass (Hurst et al., Rapid Commun. Mass Spec. 1996, 10, 377-382). Use of matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry for characterization of PCR products has been described. (Muddiman et al., Rapid Commun. Mass Spec., 1999, 13, 1201-1204). However, the degradation of DNAs over about 75 nucleotides observed with MALDI limited the utility of this method.


U.S. Pat. No. 5,849,492 reports a method for retrieval of phylogenetically informative DNA sequences which comprise searching for a highly divergent segment of genomic DNA surrounded by two highly conserved segments, designing the universal primers for PCR amplification of the highly divergent region, amplifying the genomic DNA by PCR technique using universal primers, and then sequencing the gene to determine the identity of the organism.


U.S. Pat. No. 5,965,363 reports methods for screening nucleic acids for polymorphisms by analyzing amplified target nucleic acids using mass spectrometric techniques and to procedures for improving mass resolution and mass accuracy of these methods.


WO 99/14375 reports methods, PCR primers and kits for use in analyzing preselected DNA tandem nucleotide repeat alleles by mass spectrometry.


WO 98/12355 reports methods of determining the mass of a target nucleic acid by mass spectrometric analysis, by cleaving the target nucleic acid to reduce its length, making the target single-stranded and using MS to determine the mass of the single-stranded shortened target. Also reported are methods of preparing a double-stranded target nucleic acid for MS analysis comprising amplification of the target nucleic acid, binding one of the strands to a solid support, releasing the second strand and then releasing the first strand which is then analyzed by MS. Kits for target nucleic acid preparation are also provided.


PCT WO97/33000 reports methods for detecting mutations in a target nucleic acid by nonrandomly fragmenting the target into a set of single-stranded nonrandom length fragments and determining their masses by MS.


U.S. Pat. No. 5,605,798 reports a fast and highly accurate mass spectrometer-based process for detecting the presence of a particular nucleic acid in a biological sample for diagnostic purposes.


WO 98/21066 reports processes for determining the sequence of a particular target nucleic acid by mass spectrometry. Processes for detecting a target nucleic acid present in a biological sample by PCR amplification and mass spectrometry detection are reported, as are methods for detecting a target nucleic acid in a sample by amplifying the target with primers that contain restriction sites and tags, extending and cleaving the amplified nucleic acid, and detecting the presence of extended product, wherein the presence of a DNA fragment of a mass different from wild-type is indicative of a mutation. Methods of sequencing a nucleic acid via mass spectrometry methods are also reported.


WO 97/37041, WO 99/31278 and U.S. Pat. No. 5,547,835 report methods of sequencing nucleic acids using mass spectrometry. U.S. Pat. Nos. 5,622,824, 5,872,003 and 5,691,141 report methods, systems and kits for exonuclease-mediated mass spectrometric sequencing.


Thus, there is a need for a method for bioagent detection and identification which is both specific and rapid, and in which no nucleic acid sequencing is required. The present invention addresses this need.


SUMMARY OF THE INVENTION

The present invention is directed towards methods of identifying a pathogen in a biological sample by obtaining nucleic acid from a biological sample, selecting at least one pair of intelligent primers with the capability of amplification of nucleic acid of the pathogen, amplifying the nucleic acid with the primers to obtain at least one amplification product, determining the molecular mass of at least one amplification product from which the pathogen is identified. Further, this invention is directed to methods of epidemic surveillance. By identifying a pathogen from samples acquired from a plurality of geographic locations, the spread of the pathogen to a given geographic location can be determined.


The present invention is also directed to methods of diagnosis of a plurality of etiologic agents of disease in an individual by obtaining a biological sample from an individual, isolating nucleic acid from the biological sample, selecting a plurality of amplification primers with the capability of amplification of nucleic acid of a plurality of etiologic agents of disease, amplifying the nucleic acid with a plurality of primers to obtain a plurality of amplification products corresponding to a plurality of etiologic agents, determining the molecular masses of the plurality of unique amplification products which identify the members of the plurality of etiologic agents.


The present invention is also directed to methods of in silico screening of primer sets to be used in identification of a plurality of bioagents by preparing a base composition probability cloud plot from a plurality of base composition signatures of the plurality of bioagents generated in silico, inspecting the base composition probability cloud plot for overlap of clouds from different bioagents, and choosing primer sets based on minimal overlap of the clouds.


The present invention is also directed to methods of predicting the identity of a bioagent with a heretofore unknown base composition signature by preparing a base composition probability cloud plot from a plurality of base composition signatures of the plurality of bioagents which includes the heretofore unknown base composition, inspecting the base composition probability cloud for overlap of the heretofore unknown base composition with the cloud of a known bioagent such that overlap predicts that the identity of the bioagent with a heretofore unknown base composition signature equals the identity of the known bioagent.


The present invention is also directed to methods for determining a subspecies characteristic for a given pathogen in a biological sample by identifying the pathogen in a biological sample using broad range survey primers or division-wide primers, selecting at least one pair of drill-down primers to amplify nucleic acid segments which provide a subspecies characteristic about the pathogen, amplifying the nucleic acid segments to produce at least one drill-down amplification product and determining the base composition signature of the drill-down amplification product wherein the base composition signature provides a subspecies characteristic about the pathogen.


The present invention is also directed to methods of pharmacogenetic analysis by obtaining a sample of genomic DNA from an individual, selecting a segment of the genomic DNA which provides pharmacogenetic information, using at least one pair of intelligent primers to produce an amplification product which comprises the segment of genomic DNA and determining the base composition signature of the amplification product, wherein the base composition signature provides pharmacogenetic information about said individual.





BRIEF DESCRIPTION OF THE DRAWINGS


FIGS. 1A-1H and FIG. 2 are consensus diagrams that show examples of conserved regions from 16S rRNA (FIGS. 1A-1, 1A-2, 1A-3, 1A-4, and 1A-5), 23S rRNA (3′-half, FIGS. 1B, 1C, and 1D; 5′-half, FIG. 1E-F), 23S rRNA Domain I (FIG. 1G), 23S rRNA Domain IV (FIG. 1H) and 16S rRNA Domain III (FIG. 2) which are suitable for use in the present invention. Lines with arrows are examples of regions to which intelligent primer pairs for PCR are designed. The label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram. Bases in capital letters are greater than 95% conserved; bases in lower case letters are 90-95% conserved, filled circles are 80-90% conserved; and open circles are less than 80% conserved. The label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram. The nucleotide sequence of the 16S rRNA consensus sequence is SEQ ID NO:3 and the nucleotide sequence of the 23S rRNA consensus sequence is SEQ ID NO:4.



FIG. 2 shows a typical primer amplified region from the 16S rRNA Domain III shown in FIG. 1A-1.



FIG. 3 is a schematic diagram showing conserved regions in RNase P. Bases in capital letters are greater than 90% conserved; bases in lower case letters are 80-90% conserved; filled circles designate bases which are 70-80% conserved; and open circles designate bases that are less than 70% conserved.



FIG. 4 is a schematic diagram of base composition signature determination using nucleotide analog “tags” to determine base composition signatures.



FIG. 5 shows the deconvoluted mass spectra of a Bacillus anthracis region with and without the mass tag phosphorothioate A (A*). The two spectra differ in that the measured molecular weight of the mass tag-containing sequence is greater than the unmodified sequence.



FIG. 6 shows base composition signature (BCS) spectra from PCR products from Staphylococcus aureus (S. aureus 16S_1337F) and Bacillus anthracis (B. anthr. 16S_1337F), amplified using the same primers. The two strands differ by only two (AT→CG) substitutions and are clearly distinguished on the basis of their BCS.



FIG. 7 shows that a single difference between two sequences (A14 in B. anthracis vs. A15 in B. cereus) can be easily detected using ESI-TOF mass spectrometry.



FIG. 8 is an ESI-TOF of Bacillus anthracis spore coat protein sspE 56 mer plus calibrant. The signals unambiguously identify B. anthracis versus other Bacillus species.



FIG. 9 is an ESI-TOF of a B. anthracis synthetic 16S_1228 duplex (reverse and forward strands). The technique easily distinguishes between the forward and reverse strands.



FIG. 10 is an ESI-FTICR-MS of a synthetic B. anthracis 16S_1337 46 base pair duplex.



FIG. 11 is an ESI-TOF-MS of a 56 mer oligonucleotide (3 scans) from the B. anthracis saspB gene with an internal mass standard. The internal mass standards are designated by asterisks.



FIG. 12 is an ESI-TOF-MS of an internal standard with 5 mM TBA-TFA buffer showing that charge stripping with tributylammonium trifluoroacetate reduces the most abundant charge state from [M-8H+]8− to [M-3H+]3−.



FIG. 13 is a portion of a secondary structure defining database according to one embodiment of the present invention, where two examples of selected sequences are displayed graphically thereunder.



FIG. 14 is a three dimensional graph demonstrating the grouping of sample molecular weight according to species.



FIG. 15 is a three dimensional graph demonstrating the grouping of sample molecular weights according to species of virus and mammal infected.



FIG. 16 is a three dimensional graph demonstrating the grouping of sample molecular weights according to species of virus, and animal-origin of infectious agent.



FIG. 17 is a figure depicting how a typical triangulation method of the present invention provides for the identification of an unknown bioagent without prior knowledge of the unknown agent. The use of different primer sets to distinguish and identify the unknown is also depicted as primer sets I, II and III within this figure. A three-dimensional graph depicts all of bioagent space (170), including the unknown bioagent, which after use of primer set I (171) according to a method according to the present invention further differentiates and classifies bioagents according to major classifications (176) which, upon further analysis using primer set II (172) differentiates the unknown agent (177) from other, known agents (173) and finally, the use of a third primer set (175) further specifies subgroups within the family of the unknown (174).



FIG. 18 shows a representative base composition probability cloud for a region of the RNA polymerase B gene from a cluster of enterobacteria. The dark spheres represent the actual base composition of the organisms. The lighter spheres represent the transitions among base compositions observed in different isolates of the same species of organism.



FIG. 19 shows resolution of enterobacteriae members with primers targeting RNA polymerase B (rpoB). A single pair of primers targeting a hyper-variable region within rpoB was sufficient to resolve most members of this group at the genus level (Salmonella from Escherichia from Yersinia) as well as the species/strain level (E. coli K12 from 0157). All organisms with the exception of Y. pestis were tested in the lab and the measured base counts (shown with arrow) matched the predictions in every case.



FIG. 20 shows detection of S. aureus in blood. Spectra on the right indicate signals corresponding to S. aureus detection in spiked wells A1 and A4 with no detection in control wells A2 and A3.



FIG. 21 shows a representative base composition distribution of human adenovirus strain types for a single primer pair region on the hexon gene. The circles represent different adenovirus sequences in our database that were used for primer design. Measurement of masses and base counts for each of the unknown samples A, B, C and D matched one or more of the known groups of adenoviruses.



FIG. 22 shows a representative broad range survey/drill-down process as applied to emm-typing of streptococcus pyogenes (Group A Streptococcus: GAS). Genetic material is extracted (201) and amplified using broad range survey primers (202). The amplification products are analyzed (203) to determine the presence and identity of bioagents at the species level. If Streptococcus pyogenes is detected (204), the emm-typing “drill-down” primers are used to reexamine the extract to identify the emm-type of the sample (205). Different sets of drill down primers can be employed to determine a subspecies characteristic for various strains of various bioagents (206).



FIG. 23 shows a representative base composition distribution of bioagents detected in throat swabs from military personnel using a broad range primer pair directed to 16S rRNA.



FIG. 24 shows a representative deconvoluted ESI-FTICR spectra of the PCR products produced by the gtr primer for samples 12 (top) and 10 (bottom) corresponding to emm types 3 and 6, respectively. Accurate mass measurements were obtained by using an internal mass standard and post-calibrating each spectrum; the experimental mass measurement uncertainty on each strand is +0.035 Daltons (1 ppm). Unambiguous base compositions of the amplicons were determined by calculating all putative base compositions of each stand within the measured mass (and measured mass uncertainty) and selecting complementary pairs within the mass measurement uncertainty. In all cases there was only one base composition within 25 ppm. The measured mass difference of 15.985 Da between the strands shown on the left is in excellent agreement with the theoretical mass difference of 15.994 Da expected for an A to G substitution.



FIG. 25 shows representative results of the base composition analysis on throat swab samples using the six primer pairs, 5′-emm gene sequencing and the MLST gene sequencing method of the present invention for an outbreak of Streptococcus pyogenes (group A streptococcus; GAS) at a military training camp.



FIG. 26 shows: a) a representative ESI-FTICR mass spectrum of a restriction digest of a 986 bp region of the 16S ribosomal gene from E. coli K12 digested with a mixture of BstNI, BsmFI, BfaI, and NcoI; b) a deconvoluted representation (neutral mass) of the above spectrum showing the base compositions derived from accurate mass measurements of each fragment; and c) a representative reconstructed restriction map showing complete base composition coverage for nucleotides 1-856. The NcoI did not cut.



FIG. 27 shows a representative base composition distribution of poxviruses for a single primer pair region on the DNA-dependent polymerase B gene (DdDpB). The spheres represent different poxvirus sequences that were used for primer design.





DESCRIPTION OF EMBODIMENTS

The present invention provides, inter alia, methods for detection and identification of bioagents in an unbiased manner using “bioagent identifying amplicons.” “Intelligent primers” are selected to hybridize to conserved sequence regions of nucleic acids derived from a bioagent and which bracket variable sequence regions to yield a bioagent identifying amplicon which can be amplified and which is amenable to molecular mass determination. The molecular mass then provides a means to uniquely identify the bioagent without a requirement for prior knowledge of the possible identity of the bioagent. The molecular mass or corresponding “base composition signature” (BCS) of the amplification product is then matched against a database of molecular masses or base composition signatures. Furthermore, the method can be applied to rapid parallel “multiplex” analyses, the results of which can be employed in a triangulation identification strategy. The present method provides rapid throughput and does not require nucleic acid sequencing of the amplified target sequence for bioagent detection and identification.


In the context of this invention, a “bioagent” is any organism, cell, or virus, living or dead, or a nucleic acid derived from such an organism, cell or virus. Examples of bioagents include, but are not limited, to cells (including, but not limited to, human clinical samples, bacterial cells and other pathogens) viruses, fungi, and protists, parasites, and pathogenicity markers (including, but not limited to, pathogenicity islands, antibiotic resistance genes, virulence factors, toxin genes and other bioregulating compounds). Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered. In the context of this invention, a “pathogen” is a bioagent that causes a disease or disorder.


Despite enormous biological diversity, all forms of life on earth share sets of essential, common features in their genomes. Bacteria, for example have highly conserved sequences in a variety of locations on their genomes. Most notable is the universally conserved region of the ribosome, but there are also conserved elements in other non-coding RNAs, including RNAse P and the signal recognition particle (SRP) among others. Bacteria have a common set of absolutely required genes. About 250 genes are present in all bacterial species (Mushegian et al., Proc. Natl. Acad. Sci. U.S.A., 1996, 93, 10268; and Fraser et al., Science, 1995, 270, 397), including tiny genomes like Mycoplasma, Ureaplasma and Rickettsia. These genes encode proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like. Examples of these proteins are DNA polymerase III beta, elongation factor TU, heat shock protein groEL, RNA polymerase beta, phosphoglycerate kinase, NADH dehydrogenase, DNA ligase, DNA topoisomerase and elongation factor G. Operons can also be targeted using the present method. One example of an operon is the bfp operon from enteropathogenic E. coli. Multiple core chromosomal genes can be used to classify bacteria at a genus or genus species level to determine if an organism has threat potential. The methods can also be used to detect pathogenicity markers (plasmid or chromosomal) and antibiotic resistance genes to confirm the threat potential of an organism and to direct countermeasures.


Since genetic data provide the underlying basis for identification of bioagents by the methods of the present invention, it is prudent to select segments of nucleic acids which ideally provide enough variability to distinguish each individual bioagent and whose molecular mass is amenable to molecular mass determination. In one embodiment of the present invention, at least one polynucleotide segment is amplified to facilitate detection and analysis in the process of identifying the bioagent. Thus, the nucleic acid segments that provide enough variability to distinguish each individual bioagent and whose molecular masses are amenable to molecular mass determination are herein described as “bioagent identifying amplicons.” The term “amplicon” as used herein, refers to a segment of a polynucleotide which is amplified in an amplification reaction. In some embodiments of the present invention, bioagent identifying amplicons comprise from about 45 to about 150 nucleobases (i.e. from about 45 to about 150 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150 nucleobases in length.


As used herein, “intelligent primers” are primers that are designed to bind to highly conserved sequence regions that flank an intervening variable region and yield amplification products which ideally provide enough variability to distinguish each individual bioagent, and which are amenable to molecular mass analysis. By the term “highly conserved,” it is meant that the sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus, design of intelligent primers involves selection of a variable region with appropriate variability to resolve the identity of a particular bioagent. It is the combination of the portion of the bioagent nucleic acid molecule sequence to which the intelligent primers hybridize and the intervening variable region that makes up the bioagent identifying amplicon. Alternately, it is the intervening variable region by itself that makes up the bioagent identifying amplicon.


It is understood in the art that the sequence of a primer need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, a primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). The primers of the present invention can comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence complementarity to the target region within the highly conserved region to which they are targeted. For example, an intelligent primer wherein 18 of 20 nucleobases are complementary to a highly conserved region would represent 90 percent complementarity to the highly conserved region. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a primer which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the highly conserved region would have 77.8% overall complementarity with the highly conserved region and would thus fall within the scope of the present invention. Percent complementarity of a primer with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).


Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some embodiments, complementarity of intelligent primers, is between about 70% and about 80%. In other embodiments, homology, sequence identity or complementarity, is between about 80% and about 90%. In yet other embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.


The intelligent primers of this invention comprise from about 12 to about 35 nucleobases (i.e. from about 12 to about 35 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length.


One having skill in the art armed with the preferred bioagent identifying amplicons defined by the primers illustrated herein will be able, without undue experimentation, to identify additional intelligent primers.


In one embodiment, the bioagent identifying amplicon is a portion of a ribosomal RNA (rRNA) gene sequence. With the complete sequences of many of the smallest microbial genomes now available, it is possible to identify a set of genes that defines “minimal life” and identify composition signatures that uniquely identify each gene and organism. Genes that encode core life functions such as DNA replication, transcription, ribosome structure, translation, and transport are distributed broadly in the bacterial genome and are suitable regions for selection of bioagent identifying amplicons. Ribosomal RNA (rRNA) genes comprise regions that provide useful base composition signatures. Like many genes involved in core life functions, rRNA genes contain sequences that are extraordinarily conserved across bacterial domains interspersed with regions of high variability that are more specific to each species. The variable regions can be utilized to build a database of base composition signatures. The strategy involves creating a structure-based alignment of sequences of the small (16S) and the large (23S) subunits of the rRNA genes. For example, there are currently over 13,000 sequences in the ribosomal RNA database that has been created and maintained by Robin Gutell, University of Texas at Austin, and is publicly available on the Institute for Cellular and Molecular Biology web page on the world wide web of the Internet at, for example, “rna.icmb.utexas.edu/.” There is also a publicly available rRNA database created and maintained by the University of Antwerp, Belgium on the world wide web of the Internet at, for example, “rrna.uia.ac.be.”


These databases have been analyzed to determine regions that are useful as bioagent identifying amplicons. The characteristics of such regions include: a) between about 80 and 100%, or greater than about 95% identity among species of the particular bioagent of interest, of upstream and downstream nucleotide sequences which serve as sequence amplification primer sites; b) an intervening variable region which exhibits no greater than about 5% identity among species; and c) a separation of between about 30 and 1000 nucleotides, or no more than about 50-250 nucleotides, or no more than about 60-100 nucleotides, between the conserved regions.


As a non-limiting example, for identification of Bacillus species, the conserved sequence regions of the chosen bioagent identifying amplicon must be highly conserved among all Bacillus species while the variable region of the bioagent identifying amplicon is sufficiently variable such that the molecular masses of the amplification products of all species of Bacillus are distinguishable.


Bioagent identifying amplicons amenable to molecular mass determination are either of a length, size or mass compatible with the particular mode of molecular mass determination or compatible with a means of providing a predictable fragmentation pattern in order to obtain predictable fragments of a length compatible with the particular mode of molecular mass determination. Such means of providing a predictable fragmentation pattern of an amplification product include, but are not limited to, cleavage with restriction enzymes or cleavage primers, for example.


Identification of bioagents can be accomplished at different levels using intelligent primers suited to resolution of each individual level of identification. “Broad range survey” intelligent primers are designed with the objective of identifying a bioagent as a member of a particular division of bioagents. A “bioagent division” is defined as group of bioagents above the species level and includes but is not limited to: orders, families, classes, clades, genera or other such groupings of bioagents above the species level. As a non-limiting example, members of the Bacillus/Clostridia group or gamma-proteobacteria group may be identified as such by employing broad range survey intelligent primers such as primers that target 16S or 23S ribosomal RNA.


In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species level. One main advantage of the detection methods of the present invention is that the broad range survey intelligent primers need not be specific for a particular bacterial species, or even genus, such as Bacillus or Streptomyces. Instead, the primers recognize highly conserved regions across hundreds of bacterial species including, but not limited to, the species described herein. Thus, the same broad range survey intelligent primer pair can be used to identify any desired bacterium because it will bind to the conserved regions that flank a variable region specific to a single species, or common to several bacterial species, allowing unbiased nucleic acid amplification of the intervening sequence and determination of its molecular weight and base composition. For example, the 16S_971-1062, 16S_1228-1310 and 16S_1100-1188 regions are 98-99% conserved in about 900 species of bacteria (16S=16S rRNA, numbers indicate nucleotide position). In one embodiment of the present invention, primers used in the present method bind to one or more of these regions or portions thereof.


Due to their overall conservation, the flanking rRNA primer sequences serve as good intelligent primer binding sites to amplify the nucleic acid region of interest for most, if not all, bacterial species. The intervening region between the sets of primers varies in length and/or composition, and thus provides a unique base composition signature. Examples of intelligent primers that amplify regions of the 16S and 23S rRNA are shown in FIGS. 1A-1H. A typical primer amplified region in 16S rRNA is shown in FIG. 2. The arrows represent primers that bind to highly conserved regions that flank a variable region in 16S rRNA domain III. The amplified region is the stem-loop structure under “1100-1188.” It is advantageous to design the broad range survey intelligent primers to minimize the number of primers required for the analysis, and to allow detection of multiple members of a bioagent division using a single pair of primers. The advantage of using broad range survey intelligent primers is that once a bioagent is broadly identified, the process of further identification at species and sub-species levels is facilitated by directing the choice of additional intelligent primers.


“Division-wide” intelligent primers are designed with an objective of identifying a bioagent at the species level. As a non-limiting example, a Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis can be distinguished from each other using division-wide intelligent primers. Division-wide intelligent primers are not always required for identification at the species level because broad range survey intelligent primers may provide sufficient identification resolution to accomplishing this identification objective.


“Drill-down” intelligent primers are designed with an objective of identifying a sub-species characteristic of a bioagent. A “sub-species characteristic” is defined as a property imparted to a bioagent at the sub-species level of identification as a result of the presence or absence of a particular segment of nucleic acid. Such sub-species characteristics include, but are not limited to, strains, sub-types, pathogenicity markers such as antibiotic resistance genes, pathogenicity islands, toxin genes and virulence factors. Identification of such sub-species characteristics is often critical for determining proper clinical treatment of pathogen infections.


Chemical Modifications of Intelligent Primers


Ideally, intelligent primer hybridization sites are highly conserved in order to facilitate the hybridization of the primer. In cases where primer hybridization is less efficient due to lower levels of conservation of sequence, intelligent primers can be chemically modified to improve the efficiency of hybridization.


For example, because any variation (due to codon wobble in the 3rd position) in these conserved regions among species is likely to occur in the third position of a DNA triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal base.” For example, under this “wobble” pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C. Other examples of universal bases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog 1-(2-deoxy-β-D-ribofuranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).


In another embodiment of the invention, to compensate for the somewhat weaker binding by the “wobble” base, the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs which bind with greater affinity than the unmodified nucleotide. Examples of these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, propyne T which binds to adenine and propyne C and phenoxazines, including G-clamp, which binds to G. Propynylated pyrimidines are described in U.S. Pat. Nos. 5,645,985, 5,830,653 and 5,484,908, each of which is commonly owned and incorporated herein by reference in its entirety. Propynylated primers are claimed in U.S. Ser. No. 10/294,203 which is also commonly owned and incorporated herein by reference in entirety. Phenoxazines are described in U.S. Pat. Nos. 5,502,177, 5,763,588, and 6,005,096, each of which is incorporated herein by reference in its entirety. G-clamps are described in U.S. Pat. Nos. 6,007,992 and 6,028,183, each of which is incorporated herein by reference in its entirety.


A theoretically ideal bioagent detector would identify, quantify, and report the complete nucleic acid sequence of every bioagent that reached the sensor. The complete sequence of the nucleic acid component of a pathogen would provide all relevant information about the threat, including its identity and the presence of drug-resistance or pathogenicity markers. This ideal has not yet been achieved. However, the present invention provides a straightforward strategy for obtaining information with the same practical value based on analysis of bioagent identifying amplicons by molecular mass determination.


In some cases, a molecular mass of a given bioagent identifying amplicon alone does not provide enough resolution to unambiguously identify a given bioagent. For example, the molecular mass of the bioagent identifying amplicon obtained using the intelligent primer pair “16S_971” would be 55622 Da for both E. coli and Salmonella typhimurium. However, if additional intelligent primers are employed to analyze additional bioagent identifying amplicons, a “triangulation identification” process is enabled. For example, the “16S_1100” intelligent primer pair yields molecular masses of 55009 and 55005 Da for E. coli and Salmonella typhimurium, respectively. Furthermore, the “23S_855” intelligent primer pair yields molecular masses of 42656 and 42698 Da for E. coli and Salmonella typhimurium, respectively. In this basic example, the second and third intelligent primer pairs provided the additional “fingerprinting” capability or resolution to distinguish between the two bioagents.


In another embodiment, the triangulation identification process is pursued by measuring signals from a plurality of bioagent identifying amplicons selected within multiple core genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. In this process, after identification of multiple core genes, alignments are created from nucleic acid sequence databases. The alignments are then analyzed for regions of conservation and variation, and bioagent identifying amplicons are selected to distinguish bioagents based on specific genomic differences. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.


The triangulation identification process can be pursued by characterization of bioagent identifying amplicons in a massively parallel fashion using the polymerase chain reaction (PCR), such as multiplex PCR, and mass spectrometric (MS) methods. Sufficient quantities of nucleic acids should be present for detection of bioagents by MS. A wide variety of techniques for preparing large amounts of purified nucleic acids or fragments thereof are well known to those of skill in the art. PCR requires one or more pairs of oligonucleotide primers that bind to regions which flank the target sequence(s) to be amplified. These primers prime synthesis of a different strand of DNA with synthesis occurring in the direction of one primer towards the other primer. The primers, DNA to be amplified, a thermostable DNA polymerase (e.g. Taq polymerase), the four deoxynucleotide triphosphates, and a buffer are combined to initiate DNA synthesis. The solution is denatured by heating, then cooled to allow annealing of newly added primer, followed by another round of DNA synthesis. This process is typically repeated for about 30 cycles, resulting in amplification of the target sequence.


Although the use of PCR is suitable, other nucleic acid amplification techniques may also be used, including ligase chain reaction (LCR) and strand displacement amplification (SDA). The high-resolution MS technique allows separation of bioagent spectral lines from background spectral lines in highly cluttered environments.


In another embodiment, the detection scheme for the PCR products generated from the bioagent(s) incorporates at least three features. First, the technique simultaneously detects and differentiates multiple (generally about 6-10) PCR products. Second, the technique provides a molecular mass that uniquely identifies the bioagent from the possible primer sites. Finally, the detection technique is rapid, allowing multiple PCR reactions to be run in parallel.


Mass spectrometry (MS)-based detection of PCR products provides a means for determination of BCS that has several advantages. MS is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product is identified by its molecular mass. The current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample. An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons. Intact molecular ions can be generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase. These ionization methods include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB). For example, MALDI of nucleic acids, along with examples of matrices for use in MALDI of nucleic acids, are described in WO 98/54751 (Genetrace, Inc.).


In some embodiments, large DNAs and RNAs, or large amplification products therefrom, can be digested with restriction endonucleases prior to ionization. Thus, for example, an amplification product that was 10 kDa could be digested with a series of restriction endonucleases to produce a panel of, for example, 100 Da fragments. Restriction endonucleases and their sites of action are well known to the skilled artisan. In this manner, mass spectrometry can be performed for the purposes of restriction mapping.


Upon ionization, several peaks are observed from one sample due to the formation of ions with different charges. Averaging the multiple readings of molecular mass obtained from a single mass spectrum affords an estimate of molecular mass of the bioagent. Electrospray ionization mass spectrometry (ESI-MS) is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.


The mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), ion trap, quadrupole, magnetic sector, time of flight (TOF), Q-TOF, and triple quadrupole.


In general, the mass spectrometric techniques which can be used in the present invention include, but are not limited to, tandem mass spectrometry, infrared multiphoton dissociation and pyrolytic gas chromatography mass spectrometry (PGC-MS). In one embodiment of the invention, the bioagent detection system operates continually in bioagent detection mode using pyrolytic GC-MS without PCR for rapid detection of increases in biomass (for example, increases in fecal contamination of drinking water or of germ warfare agents). To achieve minimal latency, a continuous sample stream flows directly into the PGC-MS combustion chamber. When an increase in biomass is detected, a PCR process is automatically initiated. Bioagent presence produces elevated levels of large molecular fragments from, for example, about 100-7,000 Da which are observed in the PGC-MS spectrum. The observed mass spectrum is compared to a threshold level and when levels of biomass are determined to exceed a predetermined threshold, the bioagent classification process described hereinabove (combining PCR and MS, such as FT-ICR MS) is initiated. Optionally, alarms or other processes (halting ventilation flow, physical isolation) are also initiated by this detected biomass level.


The accurate measurement of molecular mass for large DNAs is limited by the adduction of cations from the PCR reaction to each strand, resolution of the isotopic peaks from natural abundance 13C and 15N isotopes, and assignment of the charge state for any ion. The cations are removed by in-line dialysis using a flow-through chip that brings the solution containing the PCR products into contact with a solution containing ammonium acetate in the presence of an electric field gradient orthogonal to the flow. The latter two problems are addressed by operating with a resolving power of >100,000 and by incorporating isotopically depleted nucleotide triphosphates into the DNA. The resolving power of the instrument is also a consideration. At a resolving power of 10,000, the modeled signal from the [M-14H+]14− charge state of an 84 mer PCR product is poorly characterized and assignment of the charge state or exact mass is impossible. At a resolving power of 33,000, the peaks from the individual isotopic components are visible. At a resolving power of 100,000, the isotopic peaks are resolved to the baseline and assignment of the charge state for the ion is straightforward. The [13C,15N]-depleted triphosphates are obtained, for example, by growing microorganisms on depleted media and harvesting the nucleotides (Batey et al., Nucl. Acids Res., 1992, 20, 4515-4523).


While mass measurements of intact nucleic acid regions are believed to be adequate to determine most bioagents, tandem mass spectrometry (MSn) techniques may provide more definitive information pertaining to molecular identity or sequence. Tandem MS involves the coupled use of two or more stages of mass analysis where both the separation and detection steps are based on mass spectrometry. The first stage is used to select an ion or component of a sample from which further structural information is to be obtained. The selected ion is then fragmented using, e.g., blackbody irradiation, infrared multiphoton dissociation, or collisional activation. For example, ions generated by electrospray ionization (ESI) can be fragmented using IR multiphoton dissociation. This activation leads to dissociation of glycosidic bonds and the phosphate backbone, producing two series of fragment ions, called the w-series (having an intact 3′ terminus and a 5′ phosphate following internal cleavage) and the α-Base series (having an intact 5′ terminus and a 3′ furan).


The second stage of mass analysis is then used to detect and measure the mass of these resulting fragments of product ions. Such ion selection followed by fragmentation routines can be performed multiple times so as to essentially completely dissect the molecular sequence of a sample.


If there are two or more targets of similar molecular mass, or if a single amplification reaction results in a product that has the same mass as two or more bioagent reference standards, they can be distinguished by using mass-modifying “tags.” In this embodiment of the invention, a nucleotide analog or “tag” is incorporated during amplification (e.g., a 5-(trifluoromethyl) deoxythymidine triphosphate) which has a different molecular weight than the unmodified base so as to improve distinction of masses. Such tags are described in, for example, PCT WO97/33000, which is incorporated herein by reference in its entirety. This further limits the number of possible base compositions consistent with any mass. For example, 5-(trifluoromethyl)deoxythymidine triphosphate can be used in place of dTTP in a separate nucleic acid amplification reaction. Measurement of the mass shift between a conventional amplification product and the tagged product is used to quantitate the number of thymidine nucleotides in each of the single strands. Because the strands are complementary, the number of adenosine nucleotides in each strand is also determined.


In another amplification reaction, the number of G and C residues in each strand is determined using, for example, the cytidine analog 5-methylcytosine (5-meC) or propyne C. The combination of the A/T reaction and G/C reaction, followed by molecular weight determination, provides a unique base composition. This method is summarized in FIG. 4 and Table 1.
















TABLE 1











Total
Total





Total
Base
Base
base
base





mass
info
info
comp.
comp.



Double strand
Single strand
this
this
other
Top
Bottom


Mass tag
sequence
Sequence
strand
strand
strand
strand
strand







T*.mass
T*ACGT*ACGT*
T*ACGT*ACGT*
3x
3T
3A
3T
3A


(T*-T) = x
AT*GCAT*GCA




2A
2T








2C
2G








2G
2C




AT*GCAT*GCA
2x
2T
2A





C*.mass
TAC*GTAC*GT
TAC*GTAC*GT
2x
2C
2G


(C*-C) = y
ATGC*ATGC*A




ATGC*ATGC*A
2x
2C
2G









The mass tag phosphorothioate A (A*) was used to distinguish a Bacillus anthracis cluster. The B. anthracis (A14G9C14T9) had an average MW of 14072.26, and the B. anthracis (A1A*13G9C14T9) had an average molecular weight of 14281.11 and the phosphorothioate A had an average molecular weight of +16.06 as determined by ESI-TOF MS. The deconvoluted spectra are shown in FIG. 5.


In another example, assume the measured molecular masses of each strand are 30,000.115 Da and 31,000.115 Da respectively, and the measured number of dT and dA residues are (30,28) and (28,30). If the molecular mass is accurate to 100 ppm, there are 7 possible combinations of dG+dC possible for each strand. However, if the measured molecular mass is accurate to 10 ppm, there are only 2 combinations of dG+dC, and at 1 ppm accuracy there is only one possible base composition for each strand.


Signals from the mass spectrometer may be input to a maximum-likelihood detection and classification algorithm such as is widely used in radar signal processing. The detection processing uses matched filtering of BCS observed in mass-basecount space and allows for detection and subtraction of signatures from known, harmless organisms, and for detection of unknown bioagent threats. Comparison of newly observed bioagents to known bioagents is also possible, for estimation of threat level, by comparing their BCS to those of known organisms and to known forms of pathogenicity enhancement, such as insertion of antibiotic resistance genes or toxin genes.


Processing may end with a Bayesian classifier using log likelihood ratios developed from the observed signals and average background levels. The program emphasizes performance predictions culminating in probability-of-detection versus probability-of-false-alarm plots for conditions involving complex backgrounds of naturally occurring organisms and environmental contaminants. Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents. A genomic sequence database (e.g. GenBank) is used to define the mass basecount matched filters. The database contains known threat agents and benign background organisms. The latter is used to estimate and subtract the signature produced by the background organisms. A maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance. Background signal strengths are estimated and used along with the matched filters to form signatures that are then subtracted. The maximum likelihood process is applied to this “cleaned up” data in a similar manner employing matched filters for the organisms and a running-sum estimate of the noise-covariance for the cleaned up data.


Although the molecular mass of amplification products obtained using intelligent primers provides a means for identification of bioagents, conversion of molecular mass data to a base composition signature is useful for certain analyses. As used herein, a “base composition signature” (BCS) is the exact base composition determined from the molecular mass of a bioagent identifying amplicon. In one embodiment, a BCS provides an index of a specific gene in a specific organism.


Base compositions, like sequences, vary slightly from isolate to isolate within species. It is possible to manage this diversity by building “base composition probability clouds” around the composition constraints for each species. This permits identification of organisms in a fashion similar to sequence analysis. A “pseudo four-dimensional plot” can be used to visualize the concept of base composition probability clouds (FIG. 18). Optimal primer design requires optimal choice of bioagent identifying amplicons and maximizes the separation between the base composition signatures of individual bioagents. Areas where clouds overlap indicate regions that may result in a misclassification, a problem which is overcome by selecting primers that provide information from different bioagent identifying amplicons, ideally maximizing the separation of base compositions. Thus, one aspect of the utility of an analysis of base composition probability clouds is that it provides a means for screening primer sets in order to avoid potential misclassifications of BCS and bioagent identity. Another aspect of the utility of base composition probability clouds is that they provide a means for predicting the identity of a bioagent whose exact measured BCS was not previously observed and/or indexed in a BCS database due to evolutionary transitions in its nucleic acid sequence.


It is important to note that, in contrast to probe-based techniques, mass spectrometry determination of base composition does not require prior knowledge of the composition in order to make the measurement, only to interpret the results. In this regard, the present invention provides bioagent classifying information similar to DNA sequencing and phylogenetic analysis at a level sufficient to detect and identify a given bioagent. Furthermore, the process of determination of a previously unknown BCS for a given bioagent (for example, in a case where sequence information is unavailable) has downstream utility by providing additional bioagent indexing information with which to populate BCS databases. The process of future bioagent identification is thus greatly improved as more BCS indexes become available in the BCS databases.


Another embodiment of the present invention is a method of surveying bioagent samples that enables detection and identification of all bacteria for which sequence information is available using a set of twelve broad-range intelligent PCR primers. Six of the twelve primers are “broad range survey primers” herein defined as primers targeted to broad divisions of bacteria (for example, the Bacillus/Clostridia group or gamma-proteobacteria). The other six primers of the group of twelve primers are “division-wide” primers herein defined as primers that provide more focused coverage and higher resolution. This method enables identification of nearly 100% of known bacteria at the species level. A further example of this embodiment of the present invention is a method herein designated “survey/drill-down” wherein a subspecies characteristic for detected bioagents is obtained using additional primers. Examples of such a subspecies characteristic include but are not limited to: antibiotic resistance, pathogenicity island, virulence factor, strain type, sub-species type, and clade group. Using the survey/drill-down method, bioagent detection, confirmation and a subspecies characteristic can be provided within hours. Moreover, the survey/drill-down method can be focused to identify bioengineering events such as the insertion of a toxin gene into a bacterial species that does not normally make the toxin.


The present methods allow extremely rapid and accurate detection and identification of bioagents compared to existing methods. Furthermore, this rapid detection and identification is possible even when sample material is impure. The methods leverage ongoing biomedical research in virulence, pathogenicity, drug resistance and genome sequencing into a method which provides greatly improved sensitivity, specificity and reliability compared to existing methods, with lower rates of false positives. Thus, the methods are useful in a wide variety of fields, including, but not limited to, those fields discussed below.


In other embodiments of the invention, the methods disclosed herein can identify infectious agents in biological samples. At least a first biological sample containing at least a first unidentified infectious agent is obtained. An identification analysis is carried out on the sample, whereby the first infectious agent in the first biological sample is identified. More particularly, a method of identifying an infectious agent in a biological entity is provided. An identification analysis is carried out on a first biological sample obtained from the biological entity, whereby at least one infectious agent in the biological sample from the biological entity is identified. The obtaining and the performing steps are, optionally, repeated on at least one additional biological sample from the biological entity.


The present invention also provides methods of identifying an infectious agent that is potentially the cause of a health condition in a biological entity. An identification analysis is carried out on a first test sample from a first infectious agent differentiating area of the biological entity, whereby at least one infectious agent is identified. The obtaining and the performing steps are, optionally, repeated on an additional infectious agent differentiating area of the biological entity.


Biological samples include, but are not limited to, hair, mucosa, skin, nail, blood, saliva, rectal, lung, stool, urine, breath, nasal, ocular sample, or the like. In some embodiments, one or more biological samples are analyzed by the methods described herein. The biological sample(s) contain at least a first unidentified infectious agent and may contain more than one infectious agent. The biological sample(s) are obtained from a biological entity. The biological sample can be obtained by a variety of manners such as by biopsy, swabbing, and the like. The biological samples may be obtained by a physician in a hospital or other health care environment. The physician may then perform the identification analysis or send the biological sample to a laboratory to carry out the analysis.


Biological entities include, but are not limited to, a mammal, a bird, or a reptile. The biological entity may be a cow, horse, dog, cat, or a primate. The biological entity can also be a human. The biological entity may be living or dead.


An infectious agent differentiating area is any area or location within a biological entity that can distinguish between a harmful versus normal health condition. An infectious agent differentiating area can be a region or area of the biological entity whereby an infectious agent is more likely to predominate from another region or area of the biological entity. For example, infectious agent differentiating areas may include the blood vessels of the heart (heart disease, coronary artery disease, etc.), particular portions of the digestive system (ulcers, Crohn's disease, etc.), liver (hepatitis infections), and the like. In some embodiments, one or more biological samples from a plurality of infectious agent differentiating areas is analyzed the methods described herein.


Infectious agents of the invention may potentially cause a health condition in a biological entity. Health conditions include any condition, syndrome, illness, disease, or the like, identified currently or in the future by medical personnel. Infectious agents include, but are not limited to, bacteria, viruses, parasites, fungi, and the like.


In other embodiments of the invention, the methods disclosed herein can be used to screen blood and other bodily fluids and tissues for pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like. Animal samples, including but not limited to, blood and other bodily fluid and tissue samples, can be obtained from living animals, who are either known or not known to or suspected of having a disease, infection, or condition. Alternately, animal samples such as blood and other bodily fluid and tissue samples can be obtained from deceased animals. Blood samples can be further separated into plasma or cellular fractions and further screened as desired. Bodily fluids and tissues can be obtained from any part of the animal or human body. Animal samples can be obtained from, for example, mammals and humans.


Clinical samples are analyzed for disease causing bioagents and biowarfare pathogens simultaneously with detection of bioagents at levels as low as 100-1000 genomic copies in complex backgrounds with throughput of approximately 100-300 samples with simultaneous detection of bacteria and viruses. Such analyses provide additional value in probing bioagent genomes for unanticipated modifications. These analyses are carried out in reference labs, hospitals and the LRN laboratories of the public health system in a coordinated fashion, with the ability to report the results via a computer network to a common data-monitoring center in real time. Clonal propagation of specific infectious agents, as occurs in the epidemic outbreak of infectious disease, can be tracked with base composition signatures, analogous to the pulse field gel electrophoresis fingerprinting patterns used in tracking the spread of specific food pathogens in the Pulse Net system of the CDC (Swaminathan et al., Emerging Infectious Diseases, 2001, 7, 382-389). The present invention provides a digital barcode in the form of a series of base composition signatures, the combination of which is unique for each known organism. This capability enables real-time infectious disease monitoring across broad geographic locations, which may be essential in a simultaneous outbreak or attack in different cities.


In other embodiments of the invention, the methods disclosed herein can be used for detecting the presence of pathogenic and non-pathogenic bacteria, viruses, parasites, fungi and the like in organ donors and/or in organs from donors. Such examination can result in the prevention of the transfer of, for example, viruses such as West Nile virus, hepatitis viruses, human immunodeficiency virus, and the like from a donor to a recipient via a transplanted organ. The methods disclosed herein can also be used for detection of host versus graft or graft versus host rejection issues related to organ donors by detecting the presence of particular antigens in either the graft or host known or suspected of causing such rejection. In particular, the bioagents in this regard are the antigens of the major histocompatibility complex, such as the HLA antigens. The present methods can also be used to detect and track emerging infectious diseases, such as West Nile virus infection, HIV-related diseases.


In other embodiments of the invention, the methods disclosed herein can be used for pharmacogenetic analysis and medical diagnosis including, but not limited to, cancer diagnosis based on mutations and polymorphisms, drug resistance and susceptibility testing, screening for and/or diagnosis of genetic diseases and conditions, and diagnosis of infectious diseases and conditions. In context of the present invention, pharmacogenetics is defined as the study of variability in drug response due to genetic factors. Pharmacogenetic investigations are often based on correlating patient outcome with variations in genes involved in the mode of action of a given drug. For example, receptor genes, or genes involved in metabolic pathways. The methods of the present invention provide a means to analyze the DNA of a patient to provide the basis for pharmacogenetic analysis.


The present method can also be used to detect single nucleotide polymorphisms (SNPs), or multiple nucleotide polymorphisms, rapidly and accurately. A SNP is defined as a single base pair site in the genome that is different from one individual to another. The difference can be expressed either as a deletion, an insertion or a substitution, and is frequently linked to a disease state. Because they occur every 100-1000 base pairs, SNPs are the most frequently bound type of genetic marker in the human genome.


For example, sickle cell anemia results from an A-T transition, which encodes a valine rather than a glutamic acid residue. Oligonucleotide primers may be designed such that they bind to sequences that flank a SNP site, followed by nucleotide amplification and mass determination of the amplified product. Because the molecular masses of the resulting product from an individual who does not have sickle cell anemia is different from that of the product from an individual who has the disease, the method can be used to distinguish the two individuals. Thus, the method can be used to detect any known SNP in an individual and thus diagnose or determine increased susceptibility to a disease or condition.


In one embodiment, blood is drawn from an individual and peripheral blood mononuclear cells (PBMC) are isolated and simultaneously tested, such as in a high-throughput screening method, for one or more SNPs using appropriate primers based on the known sequences which flank the SNP region. The National Center for Biotechnology Information maintains a publicly available database of SNPs on the world wide web of the Internet at, for example, “ncbi.nlm.nih.gov/SNP/.”


The method of the present invention can also be used for blood typing. The gene encoding A, B or O blood type can differ by four single nucleotide polymorphisms. If the gene contains the sequence CGTGGTGACCCTT (SEQ ID NO:5), antigen A results. If the gene contains the sequence CGTCGTCACCGCTA (SEQ ID NO:6) antigen B results. If the gene contains the sequence CGTGGT-ACCCCTT (SEQ ID NO:7), blood group O results (“−” indicates a deletion). These sequences can be distinguished by designing a single primer pair which flanks these regions, followed by amplification and mass determination.


The method of the present invention can also be used for detection and identification of blood-borne pathogens such as Staphylococcus aureus for example. The method of the present invention can also be used for strain typing of respiratory pathogens in epidemic surveillance. Group A streptococci (GAS), or Streptococcus pyogenes, is one of the most consequential causes of respiratory infections because of prevalence and ability to cause disease with complications such as acute rheumatic fever and acute glomerulonephritis. GAS also causes infections of the skin (impetigo) and, in rare cases, invasive disease such as necrotizing fasciitis and toxic shock syndrome. Despite many decades of study, the underlying microbial ecology and natural selection that favors enhanced virulence and explosive GAS outbreaks is still poorly understood. The ability to detect GAS and multiple other pathogenic and non-pathogenic bacteria and viruses in patient samples would greatly facilitate our understanding of GAS epidemics. It is also essential to be able to follow the spread of virulent strains of GAS in populations and to distinguish virulent strains from less virulent or avirulent streptococci that colonize the nose and throat of asymptomatic individuals at a frequency ranging from 5-20% of the population (Bisno, A. L. (1995) in Principles and Practice of Infectious Diseases, eds. Mandell, G. L., Bennett, J. E. & Dolin, R. (Churchill Livingston, N.Y.), Vol. 2, pp. 1786-1799). Molecular methods have been developed to type GAS based upon the sequence of the emm gene that encodes the M-protein virulence factor (Beall et al., J. Clin. Micro., 1996, 34, 953-958; Beall et al., J. Clin. Micro., 1997, 35, 1231-1235; and Facklam et al., Emerging Infectious Diseases, 1999, 5, 247-253). Using this molecular classification, over 150 different emm-types are defined and correlated with phenotypic properties of thousands of GAS isolates (www.cdc.gov/ncidod/biotech/strep/strepindex.html) (Facklam et al., Clinical Infectious Diseases, 2002, 34, 28-38). Recently, a strategy known as Multi Locus Sequence Typing (MLST) was developed to follow the molecular Epidemiology of GAS. In MLST, internal fragments of seven housekeeping genes are amplified, sequenced, and compared to a database of previously studied isolates (www.test.mlst.net/).


The present invention enables an emm-typing process to be carried out directly from throat swabs for a large number of samples within 12 hours, allowing strain tracking of an ongoing epidemic, even if geographically dispersed, on a larger scale than ever before achievable.


In another embodiment, the present invention can be employed in the serotyping of viruses including, but not limited to, adenoviruses. Adenoviruses are DNA viruses that cause over 50% of febrile respiratory illnesses in military recruits. Human adenoviruses are divided into six major serogroups (A through F), each containing multiple strain types. Despite the prevalence of adenoviruses, there are no rapid methods for detecting and serotyping adenoviruses.


In another embodiment, the present invention can be employed in distinguishing between members of the Orthopoxvirus genus. Smallpox is caused by the Variola virus. Other members of the genus include Vaccinia, Monkeypox, Camelpox, and Cowpox. All are capable of infecting humans, thus, a method capable of identifying and distinguishing among members of the Orthopox genus is a worthwhile objective.


In another embodiment, the present invention can be employed in distinguishing between viral agents of viral hemorrhagic fevers (VHF). VHF agents include, but are not limited to, Filoviridae (Marburg virus and Ebola virus), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito viruses), Bunyaviridae (Crimean-Congo hemorrhagic fever virus (CCHFV), Rift Valley fever virus, and Hanta viruses), and Flaviviridae (yellow fever virus and dengue virus). Infections by VHF viruses are associated with a wide spectrum of clinical manifestations such as diarrhea, myalgia, cough, headache, pneumonia, encephalopathy, and hepatitis. Filoviruses, arenaviruses, and CCHFV are of particular relevance because they can be transmitted from human to human, thus causing epidemics with high mortality rates (Khan et al., Am. J. Trop. Med. Hyg., 1997, 57, 519-525). In the absence of bleeding or organ manifestation, VHF is clinically difficult to diagnose, and the various etiologic agents can hardly be distinguished by clinical tests. Current approaches to PCR detection of these agents are time-consuming, as they include a separate cDNA synthesis step prior to PCR, agarose gel analysis of PCR products, and in some instances a second round of nested amplification or Southern hybridization. PCRs for different pathogens have to be run assay by assay due to differences in cycling conditions, which complicate broad-range testing in a short period. Moreover, post-PCR processing or nested PCR steps included in currently used assays increase the risk of false positive results due to carryover contamination (Kwok et al., Nature, 1989, 339, 237-238).


In another embodiment, the present invention, can be employed in the diagnosis of a plurality of etiologic agents of a disease. An “etiologic agent” is herein defined as a pathogen acting as the causative agent of a disease. Diseases may be caused by a plurality of etiologic agents. For example, recent studies have implicated both human herpesvirus 6 (HHV-6) and the obligate intracellular bacterium Chlamydia pneumoniae in the etiology of multiple sclerosis (Swanborg, Microbes and Infection, 2002, 4, 1327-1333). The present invention can be applied to the identification of multiple etiologic agents of a disease by, for example, the use of broad range bacterial intelligent primers and division-wide primers (if necessary) for the identification of bacteria such as Chlamydia pneumoniae followed by primers directed to viral housekeeping genes for the identification of viruses such as HHV-6, for example.


In other embodiments of the invention, the methods disclosed herein can be used for detection and identification of pathogens in livestock. Livestock includes, but is not limited to, cows, pigs, sheep, chickens, turkeys, goats, horses and other farm animals. For example, conditions classified by the California Department of Food and Agriculture as emergency conditions in livestock (www.cdfa.ca.gov/ahfss/ah/pdfs/CA_reportable_disease_list_05292002.pdf) include, but are not limited to: Anthrax (Bacillus anthracis), Screwworm myiasis (Cochliomyia hominivorax or Chrysomya bezziana), African trypanosomiasis (Tsetse fly diseases), Bovine babesiosis (piroplasmosis), Bovine spongiform encephalopathy (Mad Cow), Contagious bovine pleuropneumonia (Mycoplasma mycoides mycoides small colony), Foot-and-mouth disease (Hoof-and-mouth), Heartwater (Cowdria ruminantium), Hemorrhagic septicemia (Pasteurella multocida serotypes B:2 or E:2), Lumpy skin disease, Malignant catarrhal fever (African type), Rift Valley fever, Rinderpest (Cattle plague), Theileriosis (Corridor disease, East Coast fever), Vesicular stomatitis, Contagious agalactia (Mycoplasma species), Contagious caprine pleuropneumonia (Mycoplasma capricolum capripneumoniae), Nairobi sheep disease, Peste des petits ruminants (Goat plague), Pulmonary adenomatosis (Viral neoplastic pneumonia), Salmonella abortus ovis, Sheep and goat pox, African swine fever, Classical swine fever (Hog cholera), Japanese encephalitis, Nipah virus, Swine vesicular disease, Teschen disease (Enterovirus encephalomyelitis), Vesicular exanthema, Exotic Newcastle disease (Viscerotropic velogenic Newcastle disease), Highly pathogenic avian influenza (Fowl plague), African horse sickness, Dourine (Trypanosoma equiperdum), Epizootic lymphangitis (equine blastomycosis, equine histoplasmosis), Equine piroplasmosis (Babesia equi, B. caballi), Glanders (Farcy) (Pseudomonas mallei), Hendra virus (Equine morbillivirus), Horse pox, Surra (Trypanosoma evansi), Venezuelan equine encephalomyelitis, West Nile Virus, Chronic wasting disease in cervids, and Viral hemorrhagic disease of rabbits (calicivirus)


Conditions classified by the California Department of Food and Agriculture as regulated conditions in livestock include, but are not limited to: rabies, Bovine brucellosis (Brucella abortus), Bovine tuberculosis (Mycobacterium bovis), Cattle scabies (multiple types), Trichomonosis (Tritrichomonas fetus), Caprine and ovine brucellosis (excluding Brucella ovis), Scrapie, Sheep scabies (Body mange) (Psoroptes ovis), Porcine brucellosis (Brucella suis), Pseudorabies (Aujeszky's disease), Ornithosis (Psittacosis or avian chlamydiosis) (Chlamydia psittaci), Pullorum disease (Fowl typhoid) (Salmonella gallinarum and pullorum), Contagious equine metritis (Taylorella equigenitalis), Equine encephalomyelitis (Eastern and Western equine encephalitis), Equine infectious anemia (Swamp fever), Duck viral enteritis (Duck plague), and Tuberculosis in cervids.


Additional conditions monitored by the California Department of Food and Agriculture include, but are not limited to: Avian tuberculosis (Mycobacterium avium), Echinococcosis/Hydatidosis (Echinococcus species), Leptospirosis, Anaplasmosis (Anaplasma marginale or A. centrale), Bluetongue, Bovine cysticercosis (Taenia saginata in humans), Bovine genital campylobacteriosis (Campylobacter fetus venerealis), Dermatophilosis (Streptothricosis, mycotic dermatitis) (Dermatophilus congolensis), Enzootic bovine leukosis (Bovine leukemia virus), Infectious bovine rhinotracheitis (Bovine herpesvirus-1), Johne's disease (Paratuberculosis) (Mycobacterium avium paratuberculosis), Malignant catarrhal fever (North American), Q Fever (Coxiella burnetii), Caprine (contagious) arthritis/encephalitis, Enzootic abortion of ewes (Ovine chlamydiosis) (Chlamydia psittaci), Maedi-Visna (Ovine progressive pneumonia), Atrophic rhinitis (Bordetella bronchiseptica, Pasteurella multocida), Porcine cysticercosis (Taenia solium in humans), Porcine reproductive and respiratory syndrome, Transmissible gastroenteritis (coronavirus), Trichinellosis (Trichinella spiralis), Avian infectious bronchitis, Avian infectious laryngotracheitis, Duck viral hepatitis, Fowl cholera (Pasteurella multocida), Fowl pox, Infectious bursal disease (Gumboro disease), Low pathogenic avian influenza, Marek's disease, Mycoplasmosis (Mycoplasma gallisepticum), Equine influenza Equine rhinopneumonitis (Equine herpesvirus-1), Equine viral arteritis, and Horse mange (multiple types).


A key problem in determining that an infectious outbreak is the result of a bioterrorist attack is the sheer variety of organisms that might be used by terrorists. According to a recent review (Taylor et al., Philos. Trans. R. Soc. Lond. B. Biol. Sci., 2001, 356, 983-989), there are over 1400 organisms infectious to humans; most of these have the potential to be used in a deliberate, malicious attack. These numbers do not include numerous strain variants of each organism, bioengineered versions, or pathogens that infect plants or animals. Paradoxically, most of the new technology being developed for detection of biological weapons incorporates a version of quantitative PCR, which is based upon the use of highly specific primers and probes designed to selectively identify specific pathogenic organisms. This approach requires assumptions about the type and strain of bacteria or virus which is expected to be detected. Although this approach will work for the most obvious organisms, like smallpox and anthrax, experience has shown that it is very difficult to anticipate what a terrorist will do.


The present invention can be used to detect and identify any biological agent, including bacteria, viruses, fungi and toxins without prior knowledge of the organism being detected and identified. As one example, where the agent is a biological threat, the information obtained such as the presence of toxin genes, pathogenicity islands and antibiotic resistance genes for example, is used to determine practical information needed for countermeasures. In addition, the methods can be used to identify natural or deliberate engineering events including chromosome fragment swapping, molecular breeding (gene shuffling) and emerging infectious diseases. The present invention provides broad-function technology that may be the only practical means for rapid diagnosis of disease caused by a biowarfare or bioterrorist attack, especially an attack that might otherwise be missed or mistaken for a more common infection.


Bacterial biological warfare agents capable of being detected by the present methods include, but are not limited to, Bacillus anthracis (anthrax), Yersinia pestis (pneumonic plague), Franciscella tularensis (tularemia), Brucella suis, Brucella abortus, Brucella melitensis (undulant fever), Burkholderia mallei (glanders), Burkholderia pseudomalleii (melioidosis), Salmonella typhi (typhoid fever), Rickettsia typhii (epidemic typhus), Rickettsia prowasekii (endemic typhus) and Coxiella burnetii (Q fever), Rhodobacter capsulatus, Chlamydia pneumoniae, Escherichia coli, Shigella dysenteriae, Shigella flexneri, Bacillus cereus, Clostridium botulinum, Coxiella burnetti, Pseudomonas aeruginosa, Legionella pneumophila, and Vibrio cholerae.


Besides 16S and 23S rRNA, other target regions suitable for use in the present invention for detection of bacteria include, but are not limited to, 5S rRNA and RNase P (FIG. 3).


Fungal biowarfare agents include, but are not limited to, Coccidioides immitis (Coccidioidomycosis), and Magnaporthe grisea.


Biological warfare toxin genes capable of being detected by the methods of the present invention include, but are not limited to, botulinum toxin, T-2 mycotoxins, ricin, staph enterotoxin B, shigatoxin, abrin, aflatoxin, Clostridium perfringens epsilon toxin, conotoxins, diacetoxyscirpenol, tetrodotoxin and saxitoxin.


Parasites that could be used in biological warfare include, but are not limited to: Ascaris suum, Giardia lamblia, Cryptosporidium, and Schistosoma.


Biological warfare viral threat agents are mostly RNA viruses (positive-strand and negative-strand), with the exception of smallpox. Every RNA virus is a family of related viruses (quasispecies). These viruses mutate rapidly and the potential for engineered strains (natural or deliberate) is very high. RNA viruses cluster into families that have conserved RNA structural domains on the viral genome (e.g., virion components, accessory proteins) and conserved housekeeping genes that encode core viral proteins including, for single strand positive strand RNA viruses, RNA-dependent RNA polymerase, double stranded RNA helicase, chymotrypsin-like and papain-like proteases and methyltransferases. “Housekeeping genes” refers to genes that are generally always expressed and thought to be involved in routine cellular metabolism.


Examples of (−)-strand RNA viruses include, but are not limited to, arenaviruses (e.g., sabia virus, lassa fever, Machupo, Argentine hemorrhagic fever, flexal virus), bunyaviruses (e.g., hantavirus, nairovirus, phlebovirus, hantaan virus, Congo-crimean hemorrhagic fever, rift valley fever), and mononegavirales (e.g., filovirus, paramyxovirus, ebola virus, Marburg, equine morbillivirus).


Examples of (+)-strand RNA viruses include, but are not limited to, picornaviruses (e.g., coxsackievirus, echovirus, human coxsackievirus A, human echovirus, human enterovirus, human poliovirus, hepatitis A virus, human parechovirus, human rhinovirus), astroviruses (e.g., human astrovirus), calciviruses (e.g., chiba virus, chitta virus, human calcivirus, norwalk virus), nidovirales (e.g., human coronavirus, human torovirus), flaviviruses (e.g., dengue virus 1-4, Japanese encephalitis virus, Kyanasur forest disease virus, Murray Valley encephalitis virus, Rocio virus, St. Louis encephalitis virus, West Nile virus, yellow fever virus, hepatitis c virus) and togaviruses (e.g., Chikugunya virus, Eastern equine encephalitis virus, Mayaro virus, O'nyong-nyong virus, Ross River virus, Venezuelan equine encephalitis virus, Rubella virus, hepatitis E virus). The hepatitis C virus has a 5′-untranslated region of 340 nucleotides, an open reading frame encoding 9 proteins having 3010 amino acids and a 3′-untranslated region of 240 nucleotides. The 5′-UTR and 3′-UTR are 99% conserved in hepatitis C viruses.


In one embodiment, the target gene is an RNA-dependent RNA polymerase or a helicase encoded by (+)-strand RNA viruses, or RNA polymerase from a (−)-strand RNA virus. (+)-strand RNA viruses are double stranded RNA and replicate by RNA-directed RNA synthesis using RNA-dependent RNA polymerase and the positive strand as a template. Helicase unwinds the RNA duplex to allow replication of the single stranded RNA. These viruses include viruses from the family picornaviridae (e.g., poliovirus, coxsackievirus, echovirus), togaviridae (e.g., alphavirus, flavivirus, rubivirus), arenaviridae (e.g., lymphocytic choriomeningitis virus, lassa fever virus), cononaviridae (e.g., human respiratory virus) and Hepatitis A virus. The genes encoding these proteins comprise variable and highly conserved regions that flank the variable regions.


In one embodiment, the method can be used to detect the presence of antibiotic resistance and/or toxin genes in a bacterial species. For example, Bacillus anthracis comprising a tetracycline resistance plasmid and plasmids encoding one or both anthracis toxins (px01 and/or px02) can be detected by using antibiotic resistance primer sets and toxin gene primer sets. If the B. anthracis is positive for tetracycline resistance, then a different antibiotic, for example quinalone, is used.


While the present invention has been described with specificity in accordance with certain of its embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.


EXAMPLES
Example 1
Nucleic Acid Isolation and PCR

In one embodiment, nucleic acid is isolated from the organisms and amplified by PCR using standard methods prior to BCS determination by mass spectrometry. Nucleic acid is isolated, for example, by detergent lysis of bacterial cells, centrifugation and ethanol precipitation. Nucleic acid isolation methods are described in, for example, Current Protocols in Molecular Biology (Ausubel et al.) and Molecular Cloning; A Laboratory Manual (Sambrook et al.). The nucleic acid is then amplified using standard methodology, such as PCR, with primers which bind to conserved regions of the nucleic acid which contain an intervening variable sequence as described below.


General Genomic DNA Sample Prep Protocol:


Raw samples are filtered using Supor-200 0.2 μm membrane syringe filters (VWR International). Samples are transferred to 1.5 ml eppendorf tubes pre-filled with 0.45 g of 0.7 mm Zirconia beads followed by the addition of 350 μl of ATL buffer (Qiagen, Valencia, Calif.). The samples are subjected to bead beating for 10 minutes at a frequency of 19 l/s in a Retsch Vibration Mill (Retsch). After centrifugation, samples are transferred to an S-block plate (Qiagen) and DNA isolation is completed with a BioRobot 8000 nucleic acid isolation robot (Qiagen).


Swab Sample Protocol:


Allegiance S/P brand culture swabs and collection/transport system are used to collect samples. After drying, swabs are placed in 17×100 mm culture tubes (VWR International) and the genomic nucleic acid isolation is carried out automatically with a Qiagen Mdx robot and the Qiagen QIAamp DNA Blood BioRobot Mdx genomic preparation kit (Qiagen, Valencia, Calif.).


Example 2
Mass Spectrometry

FTICR Instrumentation:


The FTICR instrument is based on a 7 tesla actively shielded superconducting magnet and modified Bruker Daltonics Apex II 70e ion optics and vacuum chamber. The spectrometer is interfaced to a LEAP PAL autosampler and a custom fluidics control system for high throughput screening applications. Samples are analyzed directly from 96-well or 384-well microtiter plates at a rate of about 1 sample/minute. The Bruker data-acquisition platform is supplemented with a lab-built ancillary NT datastation which controls the autosampler and contains an arbitrary waveform generator capable of generating complex rf-excite waveforms (frequency sweeps, filtered noise, stored waveform inverse Fourier transform (SWIFT), etc.) for sophisticated tandem MS experiments. For oligonucleotides in the 20-30-mer regime typical performance characteristics include mass resolving power in excess of 100,000 (FWHM), low ppm mass measurement errors, and an operable m/z range between 50 and 5000 m/z.


Modified ESI Source:


In sample-limited analyses, analyte solutions are delivered at 150 nL/minute to a 30 mm i.d. fused-silica ESI emitter mounted on a 3-D micromanipulator. The ESI ion optics consists of a heated metal capillary, an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode. The 6.2 cm rf-only hexapole is comprised of 1 mm diameter rods and is operated at a voltage of 380 Vpp at a frequency of 5 MHz. A lab-built electro-mechanical shutter can be employed to prevent the electrospray plume from entering the inlet capillary unless triggered to the “open” position via a TTL pulse from the data station. When in the “closed” position, a stable electrospray plume is maintained between the ESI emitter and the face of the shutter. The back face of the shutter arm contains an elastomeric seal that can be positioned to form a vacuum seal with the inlet capillary. When the seal is removed, a 1 mm gap between the shutter blade and the capillary inlet allows constant pressure in the external ion reservoir regardless of whether the shutter is in the open or closed position. When the shutter is triggered, a “time slice” of ions is allowed to enter the inlet capillary and is subsequently accumulated in the external ion reservoir. The rapid response time of the ion shutter (<25 ms) provides reproducible, user defined intervals during which ions can be injected into and accumulated in the external ion reservoir.


Apparatus for Infrared Multiphoton Dissociation:


A 25 watt CW CO2 laser operating at 10.6 μm has been interfaced to the spectrometer to enable infrared multiphoton dissociation (IRMPD) for oligonucleotide sequencing and other tandem MS applications. An aluminum optical bench is positioned approximately 1.5 m from the actively shielded superconducting magnet such that the laser beam is aligned with the central axis of the magnet. Using standard IR-compatible mirrors and kinematic mirror mounts, the unfocused 3 mm laser beam is aligned to traverse directly through the 3.5 mm holes in the trapping electrodes of the FTICR trapped ion cell and longitudinally traverse the hexapole region of the external ion guide finally impinging on the skimmer cone. This scheme allows IRMPD to be conducted in an m/z selective manner in the trapped ion cell (e.g. following a SWIFT isolation of the species of interest), or in a broadband mode in the high pressure region of the external ion reservoir where collisions with neutral molecules stabilize IRMPD-generated metastable fragment ions resulting in increased fragment ion yield and sequence coverage.


Example 3
Identification of Bioagents

Table 2 shows a small cross section of a database of calculated molecular masses for over 9 primer sets and approximately 30 organisms. The primer sets were derived from rRNA alignment. Examples of regions from rRNA consensus alignments are shown in FIGS. 1A-1C. Lines with arrows are examples of regions to which intelligent primer pairs for PCR are designed. The primer pairs are >95% conserved in the bacterial sequence database (currently over 10,000 organisms). The intervening regions are variable in length and/or composition, thus providing the base composition “signature” (BCS) for each organism. Primer pairs were chosen so the total length of the amplified region is less than about 80-90 nucleotides. The label for each primer pair represents the starting and ending base number of the amplified region on the consensus diagram.


Included in the short bacterial database cross-section in Table 2 are many well known pathogens/biowarfare agents (shown in bold/red typeface) such as Bacillus anthracis or Yersinia pestis as well as some of the bacterial organisms found commonly in the natural environment such as Streptomyces. Even closely related organisms can be distinguished from each other by the appropriate choice of primers. For instance, two low G+C organisms, Bacillus anthracis and Staph aureus, can be distinguished from each other by using the primer pair defined by 16S_1337 or 23S_855 (AM of 4 Da).









TABLE 2







Cross Section Of A Database Of Calculated Molecular Masses1









Primer Regions
















Bug Name
16S_971
16S_1100
16S_1337
16S_1294
16S_1228
23S_1021
23S_855
23S_193
23S_115




















Acinetobacter calcoaceticus

55619.1
55004
28446.7
35854.9
51295.4
30299
42654
39557.5
54999



custom character


55005


54388


28448


35238


51296


30295


42651


39560


56850




Bacillus cereus

55622.1
54387.9
28447.6
35854.9
51296.4
30295
42651
39560.5
56850.3



Bordetella bronchiseptica

56857.3
51300.4
28446.7
35857.9
51307.4
30299
42653
39559.5
51920.5



Borrelia burgdorferi

56231.2
55621.1
28440.7
35852.9
51295.4
30297
42029.9
38941.4
52524.6



custom character


58098


55011


28448


35854


50683








custom character

58088.5
54386.9
29061.8
35856.9
50674.3
30294
42032.9
39558.5
45732.5



custom character


55000


55007


29063


35855


50676


30295


42036


38941


56230




custom character


55006


53767


28445


35855


51291


30300


42656


39562


54999




Clostridium difficile

56855.3
54386.9
28444.7
35853.9
51296.4
30294
41417.8
39556.5
55612.2



Enterococcus faecalis

55620.1
54387.9
28447.6
35858.9
51296.4
30297
42652
39559.5
56849.3



custom character


55622


55009


28445


35857


51301


30301


42656


39562


54999




custom character


53769


54385


28445


35856


51298








Haemophilus influenzae

55620.1
55006
28444.7
35855.9
51298.4
30298
42656
39560.5
55613.1



Klebsiella pneumoniae

55622.1
55008
28442.7
35856.9
51297.4
30300
42655
39562.5
55000



custom character


55618


55626


28446


35857


51303








Mycobacterium avium

54390.9
55631.1
29064.8
35858.9
51915.5
30298
42656
38942.4
56241.2



Mycobacterium leprae

54389.9
55629.1
29064.8
35860.9
51917.5
30298
42656
36559.5
56240.2



Mycobacterium tuberculosis

54390.9
55629.1
29064.8
35860.9
51301.4
30299
42656
39560.5
56243.2



Mycoplasma genitalium

53143.7
45115.4
29061.8
35854.9
50671.3
30294
43264.1
39558.5
56842.4



Mycoplasma pneumoniae

53143.7
45118.4
29061.8
35854.9
50673.3
30294
43264.1
39559.5
56843.4



Neisseria gonorrhoeae

55627.1
54389.9
28445.7
35855.9
51302.4
30300
42649
39561.5
55000



custom character


55623


55010


28443


35858


51301


30298


43272


39558


55619




custom character


58093


55621


28448


35853


50677


30293


42650


39559


53139




custom character


58094


55623


28448


35853


50679


30293


42648


39559


53755




custom character


55622


55005


28445


35857


51301


30301


42658






custom character


55623


55009


28444


35857


51301








Staphylococcus aureus

56854.3
54386.9
28443.7
35852.9
51294.4
30298
42655
39559.5
57466.4



Streptomyces

54389.9
59341.6
29063.8
35858.9
51300.4


39563.5
56864.3



Treponema pallidum

56245.2
55631.1
28445.7
35851.9
51297.4
30299
42034.9
38939.4
57473.4



custom character


55625


55626


28443


35857


52536


29063


30303


35241


50675




Vibrio parahaemolyticus

54384.9
55626.1
28444.7
34620.7
50064.2







custom character


55620


55626


28443


35857


51299







1Molecular mass distribution of PCR amplified regions for a selection of organisms (rows) across various primer pairs (columns).



Pathogens are shown in bold.


Empty cells indicate presently incomplete or missing data.







FIG. 6 shows the use of ESI-FT-ICR MS for measurement of exact mass. The spectra from 46 mer PCR products originating at position 1337 of the 16S rRNA from S. aureus (upper) and B. anthracis (lower) are shown. These data are from the region of the spectrum containing signals from the [M-8H+]8− charge states of the respective 5′-3′ strands. The two strands differ by two (AT→CG) substitutions, and have measured masses of 14206.396 and 14208.373+0.010 Da, respectively. The possible base compositions derived from the masses of the forward and reverse strands for the B. anthracis products are listed in Table 3.









TABLE 3







Possible base composition for B. anthracis products











Calc. Mass
Error
Base Comp.







14208.2935
0.079520
A1 G17 C10 T18



14208.3160
0.056980
A1 G20 C15 T10



14208.3386
0.034440
A1 G23 C20 T2



14208.3074
0.065560
A6 G11 C3 T26



14208.3300
0.043020
A6 G14 C8 T18



14208.3525
0.020480
A6 G17 C13 T10



14208.3751
0.002060
A6 G20 C18 T2



14208.3439
0.029060
A11 G8 C1 T26



14208.3665
0.006520
A11 G11 C6 T18




14208.3890


0.016020


A11 G14 C11 T10




14208.4116
0.038560
A11 G17 C16 T2



14208.4030
0.029980
A16 G8 C4 T18



14208.4255
0.052520
A16 G11 C9 T10



14208.4481
0.075060
A16 G14 C14 T2



14208.4395
0.066480
A21 G5 C2 T18



14208.4620
0.089020
A21 G8 C7 T10



14079.2624
0.080600
A0 G14 C13 T19



14079.2849
0.058060
A0 G17 C18 T11



14079.3075
0.035520
A0 G20 C23 T3



14079.2538
0.089180
A5 G5 C1 T35



14079.2764
0.066640
A5 G8 C6 T27



14079.2989
0.044100
A5 G11 C11 T19



14079.3214
0.021560
A5 G14 C16 T11



14079.3440
0.000980
A5 G17 C21 T3



14079.3129
0.030140
A10 G5 C4 T27



14079.3354
0.007600
A10 G8 C9 T19




14079.3579


0.014940


A10 G11 C14 T11




14079.3805
0.037480
A10 G14 C19 T3



14079.3494
0.006360
A15 G2 C2 T27



14079.3719
0.028900
A15 G5 C7 T19



14079.3944
0.051440
A15 G8 C12 T11



14079.4170
0.073980
A15 G11 C17 T3



14079.4084
0.065400
A20 G2 C5 T19



14079.4309
0.087940
A20 G5 C10 T13











Among the 16 compositions for the forward strand and the 18 compositions for the reverse strand that were calculated, only one pair (shown in bold) are complementary, corresponding to the actual base compositions of the B. anthracis PCR products.


Example 4
BCS of Region from Bacillus anthracis and Bacillus cereus

A conserved Bacillus region from B. anthracis (A14G9C14T9) and B. cereus (A15G9C13T9) having a C to A base change was synthesized and subjected to ESI-TOF MS. The results are shown in FIG. 7 in which the two regions are clearly distinguished using the method of the present invention (MW=14072.26 vs. 14096.29).


Example 5
Identification of Additional Bioagents

In other examples of the present invention, the pathogen Vibrio cholera can be distinguished from Vibrio parahemolyticus with ΔM>600 Da using one of three 16S primer sets shown in Table 2 (16S971, 16S1228 or 16S_1294) as shown in Table 4. The two mycoplasma species in the list (M. genitalium and M. pneumoniae) can also be distinguished from each other, as can the three mycobacteriae. While the direct mass measurements of amplified products can identify and distinguish a large number of organisms, measurement of the base composition signature provides dramatically enhanced resolving power for closely related organisms. In cases such as Bacillus anthracis and Bacillus cereus that are virtually indistinguishable from each other based solely on mass differences, compositional analysis or fragmentation patterns are used to resolve the differences. The single base difference between the two organisms yields different fragmentation patterns, and despite the presence of the ambiguous/unidentified base N at position 20 in B. anthracis, the two organisms can be identified.


Tables 4a-b show examples of primer pairs from Table 1 which distinguish pathogens from background.














TABLE 4a







Organism name
23S_855
16S_1337
23S_1021










Bacillus anthracis

42650.98
28447.65
30294.98




Staphylococcus aureus

42654.97
28443.67
30297.96




















TABLE 4b





Organism name
16S_971
16S_1294
16S_1228








Vibrio cholerae

55625.09
35856.87
52535.59



Vibrio parahaemolyticus

54384.91
34620.67
50064.19









Table 5 shows the expected molecular weight and base composition of region 16S_1100-1188 in Mycobacterium avium and Streptomyces sp.













TABLE 5





Region
Organism name
Length
Molecular weight
Base comp.



















16S_1100-1188

Mycobacterium avium

82
25624.1728
A16G32C18T16


16S_1100-1188

Streptomyces sp.

96
29904.871
A17G38C27T14









Table 6 shows base composition (single strand) results for 16S_1100-1188 primer amplification reactions different species of bacteria. Species which are repeated in the table (e.g., Clostridium botulinum) are different strains which have different base compositions in the 16S_1100-1188 region.












TABLE 6







Organism name
Base comp.










Mycobacterium avium

A16G32C18T16




Streptomyces sp.

A17G38C27T14




Ureaplasma urealyticum

A18G30C17T17




Streptomyces sp.

A19G36C24T18




Mycobacterium leprae

A20G32C22T16




custom character


A
20
G
33
C
21
C
16





custom character


A
20
G
33
C
21
C
16





Fusobacterium necroforum

A21G26C22C18




Listeria monocytogenes

A21G27C19C19




Clostridium botulinum

A21G27C19C21




Neisseria gonorrhoeae

A21G28C21C18




Bartonella quintana

A21G30C22C16




Enterococcus faecalis

A22G27C20C19




Bacillus megaterium

A22G28C20C18




Bacillus subtilis

A22G28C21C17




Pseudomonas aeruginosa

A22G29C23C15




Legionella pneumophila

A22G32C20C16




Mycoplasma pneumoniae

A23G20C14C16




Clostridium botulinum

A23G26C20C19




Enterococcus faecium

A23G26C21C18




Acinetobacter calcoaceti

A23G26C21C19




custom character


A
23
G
26
C
24
C
15





custom character


A
23
G
26
C
24
C
15





Clostridium perfringens

A23G27C19C19




custom character


A
23
G
27
C
20
C
18





custom character


A
23
G
27
C
20
C
18





custom character


A
23
G
27
C
20
C
18





Aeromonas hydrophila

A23G29C21CM




Escherichia coli

A23G29C21C16




Pseudomonas putida

A23G29C21C17




custom character


A
23
G
29
C
22
C
15





custom character


A
23
G
29
C
22
C
15





Vibrio cholerae

A23LG30C21T16




custom character


A
23
G
31
C
21
T
15





custom character


A
23
G
31
C
21
T
15





Mycoplasma genitalium

A24G19C12T18




Clostridium botulinum

A24G25C18T20




Bordetella bronchiseptica

A24G26C19T14




Francisella tularensis

A24G26C19T19




custom character


A
24
G
26
C
20
T
18





custom character


A
24
G
26
C
20
T
18





custom character


A
24
G
26
C
20
T
18





Helicobacter pylori

A24G26C20T19




Helicobacter pylori

A24G26C21T18




Moraxella catarrhalis

A24G26C23T16




Haemophilus influenzae Rd

A24G28C20T17




custom character


A
24
G
28
C
21
T
16





custom character


A
24
G
28
C
21
T
16





custom character


A
24
G
28
C
21
T
16





Pseudomonas putida

A24G29C21T16




custom character


A
24
G
30
C
21
T
15





custom character


A
24
G
30
C
21
T
15





custom character


A
24
G
30
C
21
T
15





Clostridium botulinum

A25G24C18T21




Clostridium tetani

A25G25C18T20




Francisella tularensis

A25G25C19T19




Acinetobacter calcoacetic

A25G26C20T19




Bacteriodes fragilis

A25G27C16T22




Chlamydophila psittaci

A25G27C21T16




Borrelia burgdorferi

A25G29C17T19




Streptobacillus monilifor

A26G26C20T16




Rickettsia prowazekii

A26G28C18T18




Rickettsia rickettsii

A26G28C20T16




Mycoplasma mycoides

A28G23C16T20










The same organism having different base compositions are different strains. Groups of organisms which are highlighted or in italics have the same base compositions in the amplified region. Some of these organisms can be distinguished using multiple primers. For example, Bacillus anthracis can be distinguished from Bacillus cereus and Bacillus thuringiensis using the primer 16S_971-1062 (Table 7). Other primer pairs which produce unique base composition signatures are shown in Table 6 (bold). Clusters containing very similar threat and ubiquitous non-threat organisms (e.g. anthracis cluster) are distinguished at high resolution with focused sets of primer pairs. The known biowarfare agents in Table 6 are Bacillus anthracis, Yersinia pestis, Francisella tularensis and Rickettsia prowazekii.












TABLE 7





Organism
16S_971-1062
16S_1228-1310
16S_1100-1188








Aeromonas hydrophila

A21G29C22T20
A22G27C21T13
A23G31C21T15



Aeromonas salmonicida

A21G29C22T20
A22G27C21T13
A23G31C21T15



Bacillus anthracis


A
21
G
27
C
22
T
22

A24G22C19T18
A23G27C20T18



Bacillus cereus

A22G27C21T22
A24G22C19T18
A23G27C20T18



Bacillus thuringiensis

A22G27C21T22
A24G22C19T18
A23G27C20T18



Chlamydia trachomatis


A
22
G
26
C
20
T
23


A
24
G
23
C
19
T
16

A24G28C21T16



Chlamydia pneumoniae AR39

A26G23C20T22
A26G22C16T18
A24G28C21T16



Leptospira borgpetersenii

A22G26C20T21
A22G25C21T15
A23G26C24T15



Leptospira interrogans

A22G26C20T21
A22G25C21T15
A23G26C24T15



Mycoplasma genitalium

A28G23C15T22

A
30
G
18
C
15
T
19


A
24
G
19
C
12
T
18




Mycoplasma pneumoniae

A28G23C15T22

A
27
G
19
C
16
T
20


A
23
G
20
C
14
T
16




Escherichia coli


A
22
G
28
C
20
T
22

A24G25C21T13
A23G29C22T15



Shigella dysenteriae


A
22
G
28
C
21
T
21

A24G25C21T13
A23G29C22T15



Proteus vulgaris


A
23
G
26
C
22
T
21


A
26
G
24
C
19
T
14

A24G30C21T15



Yersinia pestis

A24G25C21T22
A25G24C20T14
A24G30C21T15



Yersinia pseudotuberculosis

A24G25C21T22
A25G24C20T14
A24G30C21T15



Francisella tularensis


A
20
G
25
C
21
T
23


A
23
G
26
C
17
T
17


A
24
G
26
C
19
T
19




Rickettsia prowazekii


A
21
G
26
C
24
T
25


A
24
G
23
C
16
T
19


A
26
G
28
C
18
T
18




Rickettsia rickettsii


A
21
G
26
C
25
T
24


A
24
G
24
C
17
T
17


A
26
G
28
C
20
T
16










The sequence of B. anthracis and B. cereus in region 16S_971 is shown below. Shown in bold is the single base difference between the two species that can be detected using the methods of the present invention. B. anthracis has an ambiguous base at position 20.









B. anthracis_16S_971







(SEQ ID NO: 1)







GCGAAGAACCUUACCAGGUNUUGACAUCCUCUGACAACCCUAGAGAUAGG





GCUUCUCCUUCGGGAGCAGAGUGACAGGUGGUGCAUGGUU





B. cereus_16S_971







(SEQ ID NO: 2)







GCGAAGAACCUUACCAGGUCUUGACAUCCUCUGAAAACCCUAGAGAUAGG





GCUUCUCCUUCGGGAGCAGAGUGACAGGUGGUGCAUGGUU






Example 6
ESI-TOF MS of sspE 56-Mer Plus Calibrant

The mass measurement accuracy that can be obtained using an internal mass standard in the ESI-MS study of PCR products is shown in FIG. 8. The mass standard was a 20-mer phosphorothioate oligonucleotide added to a solution containing a 56-mer PCR product from the B. anthracis spore coat protein sspE. The mass of the expected PCR product distinguishes B. anthracis from other species of Bacillus such as B. thuringiensis and B. cereus.


Example 7

B. anthracis ESI-TOF Synthetic 16S_1228 Duplex

An ESI-TOF MS spectrum was obtained from an aqueous solution containing 5 μM each of synthetic analogs of the expected forward and reverse PCR products from the nucleotide 1228 region of the B. anthracis 16S rRNA gene. The results (FIG. 9) show that the molecular weights of the forward and reverse strands can be accurately determined and easily distinguish the two strands. The [M-21H+]21− and [M-20H+]20− charge states are shown.


Example 8
ESI-FTICR-MS of Synthetic B. anthracis 16S_1337 46 Base Pair Duplex

An ESI-FTICR-MS spectrum was obtained from an aqueous solution containing 5 μM each of synthetic analogs of the expected forward and reverse PCR products from the nucleotide 1337 region of the B. anthracis 16S rRNA gene. The results (FIG. 10) show that the molecular weights of the strands can be distinguished by this method. The [M-16H+]16− through [M-10H+]10− charge states are shown. The insert highlights the resolution that can be realized on the FTICR-MS instrument, which allows the charge state of the ion to be determined from the mass difference between peaks differing by a single 13C substitution.


Example 9
ESI-TOF MS of 56-Mer Oligonucleotide from saspB Gene of B. anthracis with Internal Mass Standard

ESI-TOF MS spectra were obtained on a synthetic 56-mer oligonucleotide (5 μM) from the saspB gene of B. anthracis containing an internal mass standard at an ESI of 1.7 μL/min as a function of sample consumption. The results (FIG. 11) show that the signal to noise is improved as more scans are summed, and that the standard and the product are visible after only 100 scans.


Example 10
ESI-TOF MS of an Internal Standard with Tributylammonium (TBA)-Trifluoroacetate (TFA) Buffer

An ESI-TOF-MS spectrum of a 20-mer phosphorothioate mass standard was obtained following addition of 5 mM TBA-TFA buffer to the solution. This buffer strips charge from the oligonucleotide and shifts the most abundant charge state from [M-8H+]8− to [M-3H+]3− (FIG. 12).


Example 11
Master Database Comparison

The molecular masses obtained through Examples 1-10 are compared to molecular masses of known bioagents stored in a master database to obtain a high probability matching molecular mass.


Example 12
Master Data Base Interrogation Over the Internet

The same procedure as in Example 11 is followed except that the local computer did not store the Master database. The Master database is interrogated over an internet connection, searching for a molecular mass match.


Example 13
Master Database Updating

The same procedure as in example 11 is followed except the local computer is connected to the internet and has the ability to store a master database locally. The local computer system periodically, or at the user's discretion, interrogates the Master database, synchronizing the local master database with the global Master database. This provides the current molecular mass information to both the local database as well as to the global Master database. This further provides more of a globalized knowledge base.


Example 14
Global Database Updating

The same procedure as in example 13 is followed except there are numerous such local stations throughout the world. The synchronization of each database adds to the diversity of information and diversity of the molecular masses of known bioagents.


Example 15
Demonstration of Detection and Identification of Five Species of Bacteria in a Mixture

Broad range intelligent primers were chosen following analysis of a large collection of curated bacterial 16S rRNA sequences representing greater than 4000 species of bacteria. Examples of primers capable of priming from greater than 90% of the organisms in the collection include, but are not limited to, those exhibited in Table 8 wherein Tp=5′propynylated uridine and Cp=5′propynylated cytidine.









TABLE 8







Intelligent Primer Pairs for Identification of Bacteria













Forward

Reverse


Primer
Forward Primer
SEQ ID
Reverse Primer
SEQ ID


Pair Name
Sequence
NO:
Sequence
NO:














16S_EC_1077_1195
GTGAGATGTTGGGTTAAGTCCC
8
GACGTCATCCCCACCTTCCTC
9



GTAACGAG





16S_EC_1082_1197
ATGTTGGGTTAAGTCCCGCAAC
10
TTGACGTCATCCCCACCTTCCTC
11



GAG





16S_EC_1090_1196
TTAAGTCCCGCAACGATCGCAA
12
TGACGTCATCCCCACCTTCCTC
13





16S_EC_1222_1323
GCTACACACGTGCTACAATG
14
CGAGTTGCAGACTGCGATCCG
15





16S_EC_1332_1407
AAGTCGGAATCGCTAGTAATCG
16
GACGGGCGGTGTGTACAAG
17





16S_EC_30_126
TGAACGCTGGTGGCATGCTTAA
18
TACGCATTACTCACCCGTCCGC
19



CAC





16S_EC_38_120
GTGGCATGCCTAATACATGCAA
20
TTACTCACCCGTCCGCCGCT
21



GTCG





16S_EC_49_120
TAACACATGCAAGTCGAACG
22
TTACTCACCCGTCCGCC
23





16S_EC_683_795
GTGTAGCGGTGAAATGCG
24
GTATCTAATCCTGTTTGCTCCC
25





16S_EC_713_809
AGAACACCGATGGCGAAGGC
26
CGTGGACTACCAGGGTATCTA
27





16S_EC_785_897
GGATTAGAGACCCTGGTAGTCC
28
GGCCGTACTCCCCAGGCG
29





16S_EC_785_897_2
GGATTAGATACCCTGGTAGTCC
30
GGCCGTACTCCCCAGGCG
31



ACGC





16S_EC_789_894
TAGATACCCTGGTAGTCCACGC
32
CGTACTCCCCAGGCG
33





16S_EC_960_1073
TTCGATGCAACGCGAAGAACCT
34
ACGAGCTGACGACAGCCATG
35





16S_EC_969_1078
ACGCGAAGAACCTTACC
36
ACGACACGAGCTGACGAC
37





23S_EC_1826_1924
CTGACACCTGCCCGGTGC
38
GACCGTTATAGTTACGGCC
39





23S_EC_2645_2761
TCTGTCCCTAGTACGAGAGGAC
40
TGCTTAGATGCTTTCAGC
41



CGG





23S_EC_2645_2767
CTGTCCCTAGTACGAGAGGACC
42
GTTTCATGCTTAGATGCTTTCA
43



GG

GC





23S_EC_493_571
GGGGAGTGAAAGAGATCCTGAA
44
ACAAAAGGTACGCCGTCACCC
45



ACCG





23S_EC_493_571_2
GGGGAGTGAAAGAGATCCTGAA
46
ACAAAAGGCACGCCATCACCC
47



ACCG





23S_EC_971_1077
CGAGAGGGAAACAACCCAGACC
48
TGGCTGCTTCTAAGCCAAC
49





INFB_EC_1365_1467
TGCTCGTGGTGCACAAGTAACG
50
TGCTGCTTTCGCATGGTTAATT
51



GATATTA

GCTTCAA





RPOC_EC_1018_1124
CAAAACTTATTAGGTAAGCGTG
52
TCAAGCGCCATTTCTTTTGGTA
53



TTGACT

AACCACAT





RPOC_EC_1018_1124_2
CAAAACTTATTAGGTAAGCGTG
54
TCAAGCGCCATCTCTTTCGGTA
55



TTGACT

ATCCACAT





RPOC_EC_114_232
TAAGAAGCCGGAAACCATCAAC
56
GGCGCTTGTACTTACCGCAC
57



TACCG





RPOC_EC_2178_2246
TGATTCTGGTGCCCGTGGT
58
TTGGCCATCAGGCCACGCATAC
59





RPOC_EC_2178_2246_2
TGATTCCGGTGCCCGTGGT
60
TTGGCCATCAGACCACGCATAC
61





RPOC_EC_2218_2337
CTGGCAGGTATGCGTGGTCTGA
62
CGCACCGTGGGTTGAGATGAAG
63



TG

TAC





RPOC_EC_2218_2337_2
CTTGCTGGTATGCGTGGTCTGA
64
CGCACCATGCGTAGAGATGAAG
65



TG

TAC





RPOC_EC_808_889
CGTCGGGTGATTAACCGTAACA
66
GTTTTTCGTTGCGTACGATGAT
67



ACCG

GTC





RPOC_EC_808_891
CGTCGTGTAATTAACCGTAACA
68
ACGTTTTTCGTTTTGAACGATA
69



ACCG

ATGCT





RPOC_EC_993_1059
CAAAGGTAAGCAAGGTCGTTTC
70
CGAACGGCCTGAGTAGTCAACA
71



CGTCA

CG





RPOC_EC_993_1059_2
CAAAGGTAAGCAAGGACGTTTC
72
CGAACGGCCAGAGTAGTCAACA
73



CGTCA

CG





TUFB_EC_239_303
TAGACTGCCCAGGACACGCTG
74
GCCGTCCATCTGAGCAGCACC
75





TUFB_EC_239_303_2
TTGACTGCCCAGGTCACGCTG
76
GCCGTCCATTTGAGCAGCACC
77





TUFB_EC_976_1068
AACTACCGTCCGCAGTTCTACT
78
GTTGTCGCCAGGCATAACCATT
79



TCC

TC





TUFB_EC_976_1068_2
AACTACCGTCCTCAGTTCTACT
80
GTTGTCACCAGGCATTACCATT
81



TCC

TC





TUFB_EC_985_1062
CCACAGTTCTACTTCCGTACTA
82
TCCAGGCATTACCATTTCTACT
83



CTGACG

CCTTCTGG





RPLB_EC_650_762
GACCTACAGTAAGAGGTTCTGT
84
TCCAAGTGCTGGTTTACCCCAT
85



AATGAACC

GG





RPLB_EC_688_757
CATCCACACGGTGGTGGTGAAGG
86
GTGCTGGTTTACCCCATGGAGT
87





RPOC_EC_1036_1126
CGTGTTGACTATTCGGGGCGTT
88
ATTCAAGAGCCATTTCTTTTGG
89



CAG

TAAACCAC





RPOB_EC_3762_3865
TCAACAACCTCTTGGAGGTAAA
90
TTTCTTGAAGAGTATGAGCTGC
91



GCTCAGT

TCCGTAAG





RPLB_EC_688_771
CATCCACACGGTGGTGGTGAAGG
92
TGTTTTGTATCCAAGTGCTGGT
93





TTACCCC





VALS_EC_1105_1218
CGTGGCGGCGTGGTTATCGA
94
CGGTACGAACTGGATGTCGCCG
95





TT





RPOB_EC_1845_1929
TATCGCTCAGGCGAACTCCAAC
96
GCTGGATTCGCCTTTGCTACG
97





RPLB_EC_669_761
TGTAATGAACCCTAATGACCAT
98
CCAAGTGCTGGTTTACCCCATG
99



CCACACGG

GAGTA





RPLB_EC_671_762
TAATGAACCCTAATGACCATCC
100
TCCAAGTGCTGGTTTACCCCAT
101



ACACGGTG

GGAG





RPOB_EC_3775_3858
CTTGGAGGTAAGTCTCATTTTG
102
CGTATAAGCTGCACCATAAGCT
103



GTGGGCA

TGTAATGC





VALS_EC_1833_1943
CGACGCGCTGCGCTTCAC
104
GCGTTCCACAGCTTGTTGCAGA
105





AG





RPOB_EC_1336_1455
GACCACCTCGGCAACCGT
106
TTCGCTCTCGGCCTGGCC
107





TUFB_EC_225_309
GCACTATGCACACGTAGATTGT
108
TATAGCACCATCCATCTGAGCG
109



CCTGG

GCAC





DNAK_EC_428_522
CGGCGTACTTCAACGACAGCCA
110
CGCGGTCGGCTCGTTGATGA
111





VALS_EC_1920_1970
CTTCTGCAACAAGCTGTGGAAC
112
TCGCAGTTCATCAGCACGAAGCG
113



GC





TUFB_EC_757_867
AAGACGACCTGCACGGGC
114
GCGCTCCACGTCTTCACGC
115





23S_EC_2646_2765
CTGTTCTTAGTACGAGAGGACC
116
TTCGTGCTTAGATGCTTTCAG
117





16S_EC_969_1078_3P
ACGCGAAGAACCTTACpC
118
ACGACACGAGCpTpGACGAC
119





16S_EC_972_1075_4P
CGAAGAACpCpTTACC
120
ACACGAGCpTpGAC
121





16S_EC_972_1075
CGAAGAACCTTACC
122
ACACGAGCTGAC
123





23S_EC_-
CCTGATAAGGGTGAGGTCG
124
ACGTCCTTCATCGCCTCTGA
125


347_59





23S_EC_-
GTTGTGAGGTTAAGCGACTAAG
126
CTATCGGTCAGTCAGGAGTAT
127


7_450





23S_EC_-
GTTGTGAGGTTAAGCGACTAAG
128
TTGCATCGGGTTGGTAAGTC
129


7_910





23S_EC_430_1442
ATACTCCTGACTGACCGATAG
130
AACATAGCCTTCTCCGTCC
131





23S_EC_891_1931
GACTTACCAACCCGATGCAA
132
TACCTTAGGACCGTTATAGTTA
133





CG





23S_EC_1424_2494
GGACGGAGAAGGCTATGTT
134
CCAAACACCGCCGTCGATAT
135





23S_EC_1908_2852
CGTAACTATAACGGTCCTAAGG
136
GCTTACACACCCGGCCTATC
137



TA





23S_EC_2475_3209
ATATCGACGGCGGTGTTTGG
138
GCGTGACAGGCAGGTATTC
139





16S_EC_-
AGTCTCAAGAGTGAACACGTAA
140
GCTGCTGGCACGGAGTTA
141


60_525





16S_EC_326_1058
GACACGGTCCAGACTCCTAC
142
CCATGCAGCACCTGTCTC
143





16S_EC_705_1512
GATCTGGAGGAATACCGGTG
144
ACGGTTACCTTGTTACGACT
145





16S_EC_1268_1775
GAGAGCAAGCGGACCTCATA
146
CCTCCTGCGTGCAAAGC
147





GROL_EC_941_1060
TGGAAGATCTGGGTCAGGC
148
CAATCTGCTGACGGATCTGAGC
149





INFB_EC_1103_1191
GTCGTGAAAACGAGCTGGAAGA
150
CATGATGGTCACAACCGG
151





HFLB_EC_1082_1168
TGGCGAACCTGGTGAACGAAGC
152
CTTTCGCTTTCTCGAACTCAAC
153





CAT





INFB_EC_1969_2058
CGTCAGGGTAAATTCCGTGAAG
154
AACTTCGCCTTCGGTCATGTT
155



TTAA





GROL_EC_219_350
GGTGAAAGAAGTTGCCTCTAAA
156
TTCAGGTCCATCGGGTTCATGCC
157



GC





VALS_EC_1105_1214
CGTGGCGGCGTGGTTATCGA
158
ACGAACTGGATGTCGCCGTT
159





16S_EC_556_700
CGGAATTACTGGGCGTAAAG
160
CGCATTTCACCGCTACAC
161





RPOC_EC_1256_1315
ACCCAGTGCTGCTGAACCGTGC
162
GTTCAAATGCCTGGATACCCA
163





16S_EC_774_894
GGGAGCAAACAGGATTAGATAC
164
CGTACTCCCCAGGCG
165





RPOC_EC_1584_1643
TGGCCCGAAAGAAGCTGAGCG
166
ACGCGGGCATGCAGAGATGCC
167





16S_EC_1082_1196
ATGTTGGGTTAAGTCCCGC
168
TGACGTCATCCCCACCTTCC
169





16S_EC_1389_1541
CTTGTACACACCGCCCGTC
170
AAGGAGGTGATCCAGCC
171





16S_EC_1303_1407
CGGATTGGAGTCTGCAACTCG
172
GACGGGCGGTGTGTACAAG
173





23S_EC_23_130
GGTGGATGCCTTGGC
174
GGGTTTCCCCATTCGG
175





23S_EC_187_256
GGGAACTGAAACATCTAAGTA
176
TTCGCTCGCCGCTAC
177





23S_EC_1602_1703
TACCCCAAACCGACACAGG
178
CCTTCTCCCGAAGTTACG
179





23S_EC_1685_1842
CCGTAACTTCGGGAGAAGG
180
CACCGGGCAGGCGTC
181





23S_EC_1827_1949
GACGCCTGCCCGGTGC
182
CCGACAAGGAATTTCGCTACC
183





23S_EC_2434_2511
AAGGTACTCCGGGGATAACAGGC
184
AGCCGACATCGAGGTGCCAAAC
185





23S_EC_2599_2669
GACAGTTCGGTCCCTATC
186
CCGGTCCTCTCGTACTA
187





23S_EC_2653_2758
TAGTACGAGAGGACCGG
188
TTAGATGCTTTCAGCACTTATC
189





23S_BS_-
AAACTAGATAACAGTAGACATC
190
GTGCGCCCTTTCTAACTT
191


68_21
AC





16S_EC_8_358
AGAGTTTGATCATGGCTCAG
192
ACTGCTGCCTCCCGTAG
193





16S_EC_314_575
CACTGGAACTGAGACACGG
194
CTTTACGCCCAGTAATTCCG
195





16S_EC_518_795
CCAGCAGCCGCGGTAATAC
196
GTATCTAATCCTGTTTGCTCCC
197





16S_EC_683_985
GTGTAGCGGTGAAATGCG
198
GGTAAGGTTCTTCGCGTTG
199





16S_EC_937_1240
AAGCGGTGGAGCATGTGG
200
ATTGTAGCACGTGTGTAGCCC
201





16S_EC_1195_1541
CAAGTCATCATGGCCCTTA
202
AAGGAGGTGATCCAGCC
203





16S_EC_8_1541
AGAGTTTGATCATGGCTCAG
204
AAGGAGGTGATCCAGCC
205





23S_EC_1831_1936
ACCTGCCCAGTGCTGGAAG
206
TCGCTACCTTAGGACCGT
207





16S_EC_1387_1513
GCCTTGTACACACCTCCCGTC
208
CACGGCTACCTTGTTACGAC
209





16S_EC_1390_1505
TTGTACACACCGCCCGTCATAC
210
CCTTGTTACGACTTCACCCC
211





16S_EC_1367_1506
TACGGTGAATACGTTCCCGGG
212
ACCTTGTTACGACTTCACCCCA
213





16S_EC_804_929
ACCACGCCGTAAACGATGA
214
CCCCCGTCAATTCCTTTGAGT
215





16S_EC_791_904
GATACCCTGGTAGTCCACACCG
216
GCCTTGCGACCGTACTCCC
217





16S_EC_789_899
TAGATACCCTGGTAGTCCACGC
218
GCGACCGTACTCCCCAGG
219





16S_EC_1092_1195
TAGTCCCGCAACGAGCGC
220
GACGTCATCCCCACCTTCCTCC
221





23S_EC_2586_2677
TAGAACGTCGCGAGACAGTTCG
222
AGTCCATCCCGGTCCTCTCG
223





HEXAMER_EC_61_362
GAGGAAAGTCCGGGCTC
224
ATAAGCCGGGTTCTGTCG
225





RNASEP_BS_43_384
GAGGAAAGTCCATGCTCGC
226
GTAAGCCATGTTTTGTTCCATC
227





RNASEP_EC_61_362
GAGGAAAGTCCGGGCTC
228
ATAAGCCGGGTTCTGTCG
229





YAED_TRNA_ALA-
GCGGGATCCTCTAGAGGTGTTA
230
GCGGGATCCTCTAGAAGACCTC
231


RRNH_EC_513_49
AATAGCCTGGCAG

CTGCGTGCAAAGC





RNASEP_SA_31_379
GAGGAAAGTCCATGCTCAC
232
ATAAGCCATGTTCTGTTCCATC
233





16S_EC_1082_1541
ATGTTGGGTTAAGTCCCGC
234
AAGGAGGTGATCCAGCC
235





16S_EC_556_795
CGGAATTACTGGGCGTAAAG
236
GTATCTAATCCTGTTTGCTCCC
237





16S_EC_1082_1196_10G
ATGTTGGGTTAAGTCCCGC
238
TGACGTCATGCCCACCTTCC
239





16S_EC_1082_1196_10G_11G
ATGTTGGGTTAAGTCCCGC
240
TGACGTCATGGCCACCTTCC
241





TRNA_ILERRNH_ASPRRNH_EC_32_41
GCGGGATCCTCTAGACCTGATA
242
GCGGGATCCTCTAGAGCGTGAC
243



AGGGTGAGGTCG

AGGCAGGTATTC





16S_EC_969_1407
ACGCGAAGAACCTTACC
244
GACGGGCGGTGTGTACAAG
245





16S_EC_683_1323
GTGTAGCGGTGAAATGCG
246
CGAGTTGCAGACTGCGATCCG
247





16S_EC_49_894
TAACACATGCAAGTCGAACG
248
CGTACTCCCCAGGCG
249





16S_EC_49_1078
TAACACATGCAAGTCGAACG
250
ACGACACGAGCTGACGAC
251





CYA_BA_1349_1447
ACAACGAAGTACAATACAAGAC
252
CTTCTACATTTTTAGCCATCAC
253





16S_EC_1090_1196_2
TTAAGTCCCGCAACGAGCGCAA
254
TGACGTCATCCCCACCTTCCTC
255





16S_EC_405_527
TGAGTGATGAAGGCCTTAGGGT
256
CGGCTGCTGGCACGAAGTTAG
257



TGTAAA





GROL_EC_496_59
ATGGACAAGGTTGGCAAGGAAGG
258
TAGCCGCGGTCGAATTGCAT
259





GROL_EC_511_593
AAGGAAGGCGTGATCACCGTTG
260
CCGCGGTCGAATTGCATGCCTTC
261



AAGA





VALS_EC_1835_1928
ACGCGCTGCGCTTCAC
262
TTGCAGAAGTTGCGGTAGCC
263





RPOB_EC_1334_1478
TCGACCACCTGGGCAACC
264
ATCAGGTCGTGCGGCATCA
265





DNAK_EC_420_521
CACGGTGCCGGCGTACT
266
GCGGTCGGCTCGTTGATGAT
267





RPOB_EC_3776_3853
TTGGAGGTAAGTCTCATTTTGG
268
AAGCTGCACCATAAGCTTGTAA
269



TGG

TGC





RPOB_EC_3802_3885
CAGCGTTTCGGCGAAATGGA
270
CGACTTGACGGTTAACATTTCC
271





TG





RPOB_EC_3799_3888
GGGCAGCGTTTCGGCGAAATGGA
272
GTCCGACTTGACGGTCAACATT
273





TCCTG





RPOC_EC_2146_2245
CAGGAGTCGTTCAACTCGATCT
274
ACGCCATCAGGCCACGCAT
275



ACATGAT





ASPS_EC_405_538
GCACAACCTGCGGCTGCG
276
ACGGCACGAGGTAGTCGC
277





RPOC_EC_1374_1455
CGCCGACTTCGACGGTGACC
278
GAGCATCAGCGTGCGTGCT
279





TUFB_EC_957_1058
CCACACGCCGTTCTTCAACAACT
280
GGCATCACCATTTCCTTGTCCT
281





TCG





16S_EC_7_122
GAGAGTTTGATCCTGGCTCAGA
282
TGTTACTCACCCGTCTGCCACT
283



ACGAA





VALS_EC_610_727
ACCGAGCAAGGAGACCAGC
284
TATAACGCACATCGTCAGGGTGA
285









For evaluation in the laboratory, five species of bacteria were selected including three γ-proteobacteria (E. coli, K. pneumoniae and P. auergiosa) and two low G+C gram positive bacteria (B. subtilitis and S. aureus). The identities of the organisms were not revealed to the laboratory technicians.


Bacteria were grown in culture, DNA was isolated and processed, and PCR performed using standard protocols. Following PCR, all samples were desalted, concentrated, and analyzed by Fourier Transform Ion Cyclotron Resonance (FTICR) mass spectrometry. Due to the extremely high precision of the FTICR, masses could be measured to within 1 Da and unambiguously deconvoluted to a single base composition. The measured base compositions were compared with the known base composition signatures in our database. As expected when using broad range survey 16S primers, several phylogenetic near-neighbor organisms were difficult to distinguish from our test organisms. Additional non-ribosomal primers were used to triangulate and further resolve these clusters.


An example of the use of primers directed to regions of RNA polymerase B (rpoB) is shown in FIG. 19. This gene has the potential to provide broad priming and resolving capabilities. A pair of primers directed against a conserved region of rpoB provided distinct base composition signatures that helped resolve the tight enterobacteriae cluster. Joint probability estimates of the signatures from each of the primers resulted in the identification of a single organism that matched the identity of the test sample. Therefore a combination of a small number of primers that amplify selected regions of the 16S ribosomal RNA gene and a few additional primers that amplify selected regions of protein encoding genes provide sufficient information to detect and identify all bacterial pathogens.


Example 16
Detection of Staphylococcus aureus in Blood Samples

Blood samples in an analysis plate were spiked with genomic DNA equivalent of 103 organisms/ml of Staphylococcus aureus. A single set of 16S rRNA primers was used for amplification. Following PCR, all samples were desalted, concentrated, and analyzed by Fourier Transform Ion Cyclotron Resonance (FTICR) mass spectrometry. In each of the spiked wells, strong signals were detected which are consistent with the expected BCS of the S. aureus amplicon (FIG. 20). Furthermore, there was no robotic carryover or contamination in any of the blood only or water blank wells. Methods similar to this one will be applied for other clinically relevant samples including, but not limited to: urine and throat or nasal swabs.


Example 17
Detection and Serotyping of Viruses

The virus detection capability of the present invention was demonstrated in collaboration with Naval health officers using adenoviruses as an example.


All available genomic sequences for human adenoviruses available in public databases were surveyed. The hexon gene was identified as a candidate likely to have broad specificity across all serotypes. Four primer pairs were selected from a group of primers designed to yield broad coverage across the majority of the adenoviral strain types (Table 9) wherein Tp=5′propynylated uridine and Cp=5′propynylated cytidine.









TABLE 9







Intelligent Primer Pairs for Serotyping of Adenoviruses













Forward

Reverse


Primer Pair
Forward Primer
SEQ ID
Reverse Primer
SEQ ID


Name
Sequence
NO:
Sequence
NO:





HEX_HAD7 + 4 + 21_934_995
AGACCCAATTACATTGGCTT
286
CCAGTGCTGTTGTAGTACAT
287





HEX_HAD7 + 4 + 21_976_1050
ATGTACTACAACAGTACTGG
288
CAAGTCAACCACAGCATTCA
289





HEX_HAD7 + 4 + 21_970_1059
GGGCTTATGTACTACAACAG
290
TCTGTCTTGCAAGTCAACCAC
291





HEX_HAD7 + 3_771_827
GGAATTTTTTGATGGTAGAGA
292
TAAAGCACAATTTCAGGCG
293





HEX_HAD4 + 16_746_848
TAGATCTGGCTTTCTTTGAC
294
ATATGAGTATCTGGAGTCTGC
295





HEX_HAD7_509_578
GGAAAGACATTACTGCAGACA
296
CCAACTTGAGGCTCTGGCTG
297





HEX_HAD4_1216_1289
ACAGACACTTACCAGGGTG
298
ACTGTGGTGTCATCTTTGTC
299





HEX_HAD21_515_567
TCACTAAAGACAAAGGTCTTCC
300
GGCTTCGCCGTCTGTAATTTC
301





HEX_HAD_1342_1469
CGGATCCAAGCTAATCTTTGG
302
GGTATGTACTCATAGGTGTTG
303





GTG





HEX_HAD7 + 4 + 21_934_995P
AGACpCpCAATTpACpATpTGG
304
CpCpAGTGCTGTpTpGTAGTA
305



CTT

CAT





HEX_HAD7 + 4 + 21_976_1050P
ATpGTpACTpACAACAGTACpT
306
CAAGTpCpAACCACAGCATpT
307



pGG

pCA





HEX_HAD7 + 4 + 21_970_1059P
GGGCpTpTATpGTpACTACAAC
308
TCTGTpCpTTGCAAGTpCpAA
309



pAG

CCAC





HEX_HAD7 + 3_771_827P
GGAATTpTpTpTpTGATGGTAG
310
TAAAGCACAATpTpTpCpAGG
311



AGA

CG





HEX_HAD4 + 16_746_848P
TAGATCTGGCTpTpTpCpTTTG
312
ATATGAGTATpCpTpGGAGTp
313



AC

CpTGC





HEX_HAD_1342_1469P
CGGATpCCAAGCpTAATCpTpT
314
GGTATGTACTCATAGGTGTpT
315



TGG

pGGTG





HEX_HAD7 + 21 + 3_931_1645
AACAGACCCAATTACATTGGCTT
316
GAGGCACTTGTATGTGGAAAGG
317





HEX_HAD4 + 2_925_1469
ATGCCTAACAGACCCAATTACAT
318
TTCATGTAGTCGTAGGTGTTGG
319





HEX_HAD7 + 21 + 3_384_953
CGCGCCTAATACATCTCAGTGG
320
AAGCCAATGTAATTGGGTCTG
321



AT

TT





HEX_HAD4 + 2_345_947
CTACTCTGGCACTGCCTACAAC
322
ATGTAATTGGGTCTGTTAGGC
323





AT





HEX_HAD2_772_865
CAATCCGTTCTGGTTCCGGATG
324
CTTGCCGGTCGTTCAAAGAGG
325



AA

TAG





HEX_HAD7 + 4 + 21_73_179
AGTCCGGGTCTGGTGCAG
326
CGGTCGGTGGTCACATC
327





HEX_HAD7 + 4 + 21_1_54
ATGGCCACCCCATCGATG
328
CTGTCCGGCGATGTGCATG
329





HEX_HAD7 + 4 + 21_1612_1718
GGTCGTTATGTGCCTTTCCACAT
330
TCCTTTCTGAAGTTCCACTCA
331





TAGG





HEX_HAD7 + 4 + 21_2276_2368
ACAACATTGGCTACCAGGGCTT
332
CCTGCCTGCTCATAGGCTGGA
333





AGTT









These primers also served to clearly distinguish those strains responsible for most disease (types 3, 4, 7 and 21) from all others. DNA isolated from field samples known to contain adenoviruses were tested using the hexon gene PCR primers, which provided unambiguous strain identification for all samples. A single sample was found to contain a mixture of two viral DNAs belonging to strains 7 and 21.


Test results (FIG. 21) showed perfect concordance between predicted and observed base composition signatures for each of these samples. Classical serotyping results confirmed each of these observations. Processing of viral samples directly from collection material such as throat swabs rather than from isolated DNA, will result in a significant increase in throughput, eliminating the need for virus culture.


Example 18
Broad Rapid Detection and Strain Typing of Respiratory Pathogens for Epidemic Surveillance

Genome Preparation:


Genomic materials from culture samples or swabs were prepared using a modified robotic protocol using DNeasy™ 96 Tissue Kit, Qiagen). Cultures of Streptococcus pyogenes were pelleted and transferred to a 1.5 mL tube containing 0.45 g of 0.7 mm Zirconia beads (Biospec Products, Inc.). Cells were lysed by shaking for 10 minutes at a speed of 19 l/s using a MM300 Vibration Mill (Retsch, Germany). The samples were centrifuged for 5 min and the supernatants transferred to deep well blocks and processed using the manufacture's protocol and a Qiagen 8000 BioRobot.


PCR: PCR reactions were assembled using a Packard MPII liquid handling platform and were performed in 50 μL volume using 1.8 units each of Platinum Taq (Invitrogen) and Hotstart PFU Turbo (Stratagene) polymerases. Cycling was performed on a DNA Engine Dyad (MJ Research) with cycling conditions consisting of an initial 2 min at 95° C. followed by 45 cycles of 20 s at 95° C., 15 s at 58° C., and 15 s at 72° C.


Broad-Range Primers:


PCR primer design for base composition analysis from precise mass measurements is constrained by an upper limit where ionization and accurate deconvolution can be achieved. Currently, this limit is approximately 140 base pairs. Primers designed to broadly conserved regions of bacterial ribosomal RNAs (16 and 23S) and the gene encoding ribosomal protein L3 (rpoC) are shown in Table 10.









TABLE 10







Broad Range Primer Pairs














SEQ
Length


Target


ID
of


Gene
Direction
Primer
NO
Amplicon





16S_1
F
GGATTAGAGACCCTGGTAGTCC
334
116


16S_1
R
GGCCGTACTCCCCAGGCG
335
116





16S_2
F
TTCGATGCAACGCGAAGAACCT
336
115


16S_2
R
ACGAGCTGACGACAGCCATG
337
115





23S
F
TCTGTCCCTAGTACGAGAGGAC
338
118




CGG


23S
R
TGCTTAGATGCTTTCAGC
339
118





rpoC
F
CTGGCAGGTATGCGTGGTCTGA
340
121




TG


rpoC
R
CGCACCGTGGGTTGAGATGAAG
341
121




TAC









Emm-Typing Primers:


The allelic profile of a GAS strain by Multilocus Sequencing Technique (MLST) can be obtained by sequencing the internal fragments of seven housekeeping genes. The nucleotide sequences for each of these housekeeping genes, for 212 isolates of GAS (78 distinct emm types), are available (www.mlst.net). This corresponds to one hundred different allelic profiles or unique sequence types, referred to by Enright et al. as ST1-ST100 (Enright et al., Infection and Immunity, 2001, 69, 2416-2427). For each sequence type, we created a virtual transcript by concatenating sequences appropriate to their allelic profile from each of the seven genes. MLST primers were designed using these sequences and were constrained to be within each gene loci. Twenty-four primer pairs were initially designed and tested against the sequenced GAS strain 700294. A final subset of six primer pairs Table 11 was chosen based on a theoretical calculation of minimal number of primer pairs that maximized resolution of between emm types.









TABLE 11







Drill-Down Primer Pairs Used in Determining emm-type











Target


SEQ ID
Length of


Gene
Direction
Primer
NO
Amplicon





gki
F
GGGGATTCAGCCATCAAAGCAGCTATTGAC
342
116


gki
R
CCAACCTTTTCCACAACAGAATCAGC
343
116





gtr
F
CCTTACTTCGAACTATGAATCTTTTGGAAG
344
115


gtr
R
CCCATTTTTTCACGCATGCTGAAAATATC
345
115





murI
F
CGCAAAAAAATCCAGCTATTAGC
346
118


murI
R
AAACTATTTTTTTAGCTATACTCGAACAC
347
118





mutS
F
ATGATTACAATTCAAGAAGGTCGTCACGC
348
121


mutS
R
TTGGACCTGTAATCAGCTGAATACTGG
349
121





xpt
F
GATGACTTTTTAGCTAATGGTCAGGCAGC
350
122


xpt
R
AATCGACGACCATCTTGGAAAGATTTCTC
351
122





yqiL
F
GCTTCAGGAATCAATGATGGAGCAG
352
119


yqiL
R
GGGTCTACACCTGCACTTGCATAAC
353
119









Microbiology:


GAS isolates were identified from swabs on the basis of colony morphology and beta-hemolysis on blood agar plates, gram stain characteristics, susceptibility to bacitracin, and positive latex agglutination reactivity with group A-specific antiserum.


Sequencing:


Bacterial genomic DNA samples of all isolates were extracted from freshly grown GAS strains by using QIAamp DNA Blood Mini Kit (Qiagen, Valencia, Calif.) according to the procedures described by the manufacture. Group A streptococcal cells were subjected to PCR and sequence analysis using emm-gene specific PCR as previously described (Beall et al., J. Clin. Micro., 1996, 34, 953-958; and Facklam et al., Emerg. Infect. Dis., 1999, 5, 247-253). Homology searches on DNA sequences were conducted against known emm sequences present in (www.cdc.gov/ncidod/biotech/infotech_hp.html). For MLST analysis, internal fragments of seven housekeeping genes, were amplified by PCR and analyzed as previously described (Enright et al., Infection and Immunity 2001, 69, 2416-2427). The emm-type was determined from comparison to the MLST database.


Broad Range Survey/Drill-Down Process (100):


For Streptococcus pyogenes, the objective was the identification of a signature of the virulent epidemic strain and determination of its emm-type. Emm-type information is useful both for treatment considerations and epidemic surveillance. A total of 51 throat swabs were taken both from healthy recruits and from hospitalized patients in December 2002, during the peak of a GAS outbreak at a military training camp. Twenty-seven additional isolates from previous infections ascribed to GAS were also examined. Initially, isolated colonies were examined both from throat culture samples and throat swabs directly without the culture step. The latter path can be completed within 6-12 hours providing information on a significant number of samples rapidly enough to be useful in managing an ongoing epidemic.


The process of broad range survey/drill-down (200) is shown in FIG. 22. A clinical sample such as a throat swab is first obtained from an individual (201). Broad range survey primers are used to obtain amplification products from the clinical sample (202) which are analyzed to determine a BCS (203) from which a species is identified (204). Drill-down primers are then employed to obtain PCR products (205) from which specific information is obtained about the species (such as Emm-type) (206).


Broad Range Survey Priming:


Genomic regions targeted by the broad range survey primers were selected for their ability to allow amplification of virtually all known species of bacteria and for their capability to distinguish bacterial species from each other by base composition analysis. Initially, four broad-range PCR target sites were selected and the primers were synthesized and tested. The targets included universally conserved regions of 16S and 23S rRNA, and the gene encoding ribosomal protein L3 (rpoC).


While there was no special consideration of Streptococcus pyogenes in the selection of the broad range survey primers (which were optimized for distinguishing all important pathogens from each other), analysis of genomic sequences showed that the base compositions of these regions distinguished Streptococcus pyogenes from other respiratory pathogens and normal flora, including closely related species of streptococci, staphylococci, and bacilli (FIG. 23).


Drill Down Priming (Emm-Typing):


In order to obtain strain-specific information about the epidemic, a strategy was designed to measure the base compositions of a set of fast clock target genes to generate strain-specific signatures and simultaneously correlate with emm-types. In classic MLST analysis, internal fragments of seven housekeeping genes (gki, gtr, murI, mutS, recP, xpt, yqiL) are amplified, sequenced and compared to a database of previously studied isolates whose emm-types have been determined (Horner et al. Fundamental and Applied Toxicology, 1997, 36, 147). Since the analysis enabled by the present embodiment of the present invention provides base composition data rather than sequence data, the challenge was to identify the target regions that provide the highest resolution of species and least ambiguous emm-classification. The data set from Table 2 of Enright et al. (Enright et al. Infection and Immunity, 2001, 69, 2416-2427) to bioinformatically construct an alignment of concatenated alleles of the seven housekeeping genes from each of 212 previously emm-typed strains, of which 101 were unique sequences that represented 75 distinct emm-types. This alignment was then analyzed to determine the number and location of the optimal primer pairs that would maximize strain discrimination strictly on base composition data.


An example of assignment of BCSs of PCR products is shown in FIG. 24 where PCR products obtained using the gtr primer (a drill-down emm-typing primer) from two different swab samples were analyzed (sample 12—top and sample 10—bottom). The deconvoluted ESI-FCTIR spectra provide accurate mass measurements of both strands of the PCR products, from which a series of candidate BCSs were calculated from the measured mass (and within the measured mass uncertainty). The identification of complementary candidate BCSs from each strand provides a means for unambiguous assignment of the BCS of the PCR product. BCSs and molecular masses for each strand of the PCR product from the two different samples are also shown in FIG. 24. In this case, the determination of BCSs for the two samples resulted in the identification of the emm-type of Streptococcus pyogenes—sample 12 was identified as emm-type 3 and sample 10 was identified as emm-type 6.


The results of the composition analysis using the six primer pairs, 5′-emm gene sequencing and MLST gene sequencing method for the GAS epidemic at a military training facility are compared in FIG. 25. The base composition results for the six primer pairs showed a perfect concordance with 5′-emm gene sequencing and MLST sequencing methods. Of the 51 samples taken during the peak of the epidemic, all but three had identical compositions and corresponded to emm-type 3. The three outliers, all from healthy individuals, probably represent non-epidemic strains harbored by asymptomatic carriers. Samples 52-80, which were archived from previous infections from Marines at other naval training facilities, showed a much greater heterogeneity of composition signatures and emm-types.


Example 19
Base Composition Probability Clouds


FIG. 18 illustrates the concept of base composition probability clouds via a pseudo-four dimensional plot of base compositions of enterobacteria including Y. pestis, Y. psuedotuberculosis, S. typhimurium, S. typhi, Y. enterocolitica, E. coli K12, and E. coli O157:H7. In the plot of FIGS. 18, A, C and G compositions correspond to the x, y and z axes respectively whereas T compositions are represented by the size of the sphere at the junction of the x, y and z coordinates. There is no absolute requirement for having a particular nucleobase composition associated with a particular axis. For example, a plot could be designed wherein G, T and C compositions correspond to the x, y and z axes respectively whereas the A composition corresponds to the size of the sphere at the junction of the x, y and z coordinates. Furthermore, a different representation can be made of the “pseudo fourth” dimension i.e.: other than the size of the sphere at junction of the x, y and z coordinates. For example, a symbol having vector information such as an arrow or a cone can be rotated at an angle that varies proportionally with the composition of the nucleobase corresponding to the pseudo fourth dimension. The choice of axes and pseudo fourth dimensional representation is typically made with the aim of optimal visualization of the data being presented.


A similar base composition probability cloud analysis has been presented for a series of viruses in U.S. provisional patent application Ser. No. 60/431,319, which is commonly owned and incorporated herein by reference in its entirety. In this base composition probability cloud analysis, the closely related Dengue virus types 1-4 are clearly distinguishable from each other. This example is indicative of a challenging scenario for species identification based on BCS analysis because RNA viruses have a high mutation rate, it would be expected to be difficult to resolve closely related species. However, as this example illustrates, BCS analysis, aided by base composition probability cloud analysis is capable of resolution of closely related viral species.


A base composition probability cloud can also be represented as a three dimensional plot instead of a pseudo-four dimensional plot. An example of such a three dimensional plot is a plot of G, A and C compositions correspond to the x, y and z axes respectively, while the composition of T is left out of the plot. Another such example is a plot where the compositions of all four nucleobases is included: G, A and C+T compositions correspond to the x, y and z axes respectively. As for the pseudo-four dimensional plots, the choice of axes for a three dimensional plot is typically made with the aim of optimal visualization of the data being presented.


Example 20
Biochemical Processing of Large Amplification Products for Analysis by Mass Spectrometry

In the example illustrated in FIG. 26, a primer pair which amplifies a 986 bp region of the 16S ribosomal gene in E. coli (K12) was digested with a mixture of 4 restriction enzymes: BstN1, BsmF1, Bfa1, and Nco1. FIG. 26(a) illustrates the complexity of the resulting ESI-FTICR mass spectrum that contains multiple charge states of multiple restriction fragments. Upon mass deconvolution to neutral mass, the spectrum is significantly simplified and discrete oligonucleotide pairs are evident (FIG. 26b). When base compositions are derived from the masses of the restriction fragments, perfect agreement is observed for the known sequence of nucleotides 1-856 (FIG. 26c); the batch of Nco1 enzyme used in this experiment was inactive and resulted in a missed cleavage site and a 197-mer fragment went undetected as it is outside the mass range of the mass spectrometer under the conditions employed. Interestingly however, both a forward and reverse strand were detected for each fragment measured (solid and dotted lines in, respectively) within 2 ppm of the predicted molecular weights resulting in unambiguous determination of the base composition of 788 nucleotides of the 985 nucleotides in the amplicon. The coverage map offers redundant coverage as both 5′ to 3′ and 3′ to 5′ fragments are detected for fragments covering the first 856 nucleotides of the amplicon.


This approach is in many ways analogous to those widely used in MS-based proteomics studies in which large intact proteins are digested with trypsin, or other proteolytic enzyme(s), and the identity of the protein is derived by comparing the measured masses of the tryptic peptides with theoretical digests. A unique feature of this approach is that the precise mass measurements of the complementary strands of each digest product allow one to derive a de novo base composition for each fragment, which can in turn be “stitched together” to derive a complete base composition for the larger amplicon. An important distinction between this approach and a gel-based restriction mapping strategy is that, in addition to determination of the length of each fragment, an unambiguous base composition of each restriction fragment is derived. Thus, a single base substitution within a fragment (which would not be resolved on a gel) is readily observed using this approach. Because this study was performed on a 7 Tesla ESI-FTICR mass spectrometer, better than 2 ppm mass measurement accuracy was obtained for all fragments. Interestingly, calculation of the mass measurement accuracy required to derive unambiguous base compositions from the complementary fragments indicates that the highest mass measurement accuracy actually required is only 15 ppm for the 139 bp fragment (nucleotides 525-663). Most of the fragments were in the 50-70 bp size-range which would require mass accuracy of only ˜50 ppm for unambiguous base composition determination. This level of performance is achievable on other more compact, less expensive MS platforms such as the ESI-TOF suggesting that the methods developed here could be widely deployed in a variety of diagnostic and human forensic arenas.


This example illustrates an alternative approach to derive base compositions from larger PCR products. Because the amplicons of interest cover many strain variants, for some of which complete sequences are not known, each amplicon can be digested under several different enzymatic conditions to ensure that a diagnostically informative region of the amplicon is not obscured by a “blind spot” which arises from a mutation in a restriction site. The extent of redundancy required to confidently map the base composition of amplicons from different markers, and determine which set of restriction enzymes should be employed and how they are most effectively used as mixtures can be determined. These parameters will be dictated by the extent to which the area of interest is conserved across the amplified region, the compatibility of the various restriction enzymes with respect to digestion protocol (buffer, temperature, time) and the degree of coverage required to discriminate one amplicon from another.


Example 21
Identification of Members of the Viral Genus Orthopoxvirus

Primer sites were identified on three essential viral genes—the DNA-dependent polymerase (DdDp), and two sub-units of DNA-dependent RNA polymerases A and B (DdRpA and DdRpB). These intelligent primers designed to identify members of the viral genus Orthopoxvirus are shown in Table 12 wherein Tp=5′propynylated uridine and Cp=5′propynylated cytidine.









TABLE 12







Intelligent Primer Pairs for Identification of


members of the Viral Genus Orthopoxvirus













Forward

Reverse


Primer Pair
Forward Primer
SEQ ID
Reverse Primer
SEQ ID


Name
Sequence
NO:
Sequence
NO:





A25L_NC001611_28_127
GTACTGAATCCGCCTAAG
354
GTGAATAAAGTATCGCCCTAA
355





TA





A18R_NC001611_100_207
GAAGTTGAACCGGGATCA
356
ATTATCGGTCGTTGTTAATGT
357





A18R_NC001611_1348_1445
CTGTCTGTAGATAAACTAGGATT
358
CGTTCTTCTCTGGAGGAT
359





E9L_NC001611_1119_1222
CGATACTACGGACGC
360
CTTTATGAATTACTTTACATAT
361





K8R_NC001611_221_311
CTCCTCCATCACTAGGAA
362
CTATAACATTCAAAGCTTATTG
363





A24R_NC001611_795_878
CGCGATAATAGATAGTGCTAAAC
364
GCTTCCACCAGGTCATTAA
365





A25L_NC001611_28_127P
GTACpTpGAATpCpCpGCpCpT
366
GTGAATAAAGTATpCpGCpCp
367



AAG

CpTpAATA





A18R_NC001611_100_207P
GAAGTpTpGAACpCpGGGATCA
368
ATTATCGGTpCpGTpTpGTpT
369





pAATGT





A18R_NC001611_1348_1445P
CTGTpCpTpGTAGATAAACpTp
370
CGTTCpTpTpCpTpCpTpGGA
371



AGGATT

GGAT





E9L_NC001611_1119_1222P
CGATACpTpACpGGACGC
372
CTTTATGAATpTpACpTpTpT
373





pACATAT





K8R_NC001611_221_311P
CTpCpCpTCpCpATCACpTpAG
374
CTATAACATpTpCpAAAGCpT
375



GAA

pTpATTG





A24R_NC001611_795_878P
CGCGATpAATpAGATAGTpGCp
376
GCTTCpCpACpCAGGTpCATp
377



TpAAAC

TAA









As illustrated in FIG. 27, members of the Orthopoxvirus genus group can be identified, distinguished from one another, and distinguished from other members of the Poxvirus family using a single pair of primers designed against the DdRpB gene.


Since the primers were designed across regions of high conservation within this genus, the likelihood of missed detection due to sequence variations at these sites is minimized. Further, none of the primers is expected to amplify other viruses or any other DNA, based on the data available in GenBank. This method can be used for all families of viral threat agents and is not limited to members of the Orthopoxvirus genus.


Example 22
Identification of Viruses that Cause Viral Hemorrhagic Fevers

In accordance with the present invention an approach of broad PCR priming across several different viral species is employed using conserved regions in the various viral genomes, amplifying a small, yet highly informative region in these organisms, and then analyzing the resultant amplicons with mass spectrometry and data analysis. These regions will be tested with live agents, or with genomic constructs thereof.


Detection of RNA viruses will necessitate a reverse transcription (RT) step prior to the PCR amplification of the TIGER reporter amplicon. To maximize throughput and yield while minimizing the handling of the samples, commercial one-step reverse transcription polymerase chain reaction (RT-PCR) kits will be evaluated for use. If necessary, a one-step RT-PCR mix using our selected DNA polymerase for the PCR portion of the reaction will be developed. To assure there is no variation in our reagent performance all new lots of enzymes, nucleotides and buffers will be individually tested prior to use.


Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference, web site, Genebank accession number, etc. cited in the present application is incorporated herein by reference in its entirety.

Claims
  • 1. A method for identifying two or more bioagents, comprising: a) contacting a sample suspected of containing two or more bioagents with a plurality of primer pairs to simultaneously generate two or more amplicons no more than about 30-250 nucleotides in length, wherein each of said primer pairs hybridize to conserved nucleic acid gene sequences flanking a variable sequence; wherein the primers of a first primer pair of said plurality of primer pairs hybridize to nucleic acid gene sequences that are conserved within a first genus and flank a variable sequence that varies between species within a first genus and generate an amplicon from a first bioagent but not a second bioagent, and the primers of a second primer pair of said plurality of primer pairs hybridize to nucleic acid gene sequences that are conserved within a second genus and flank a variable sequence that varies between species within a second genus and generate an amplicon from said second bioagent but not said first bioagent, wherein said first and second bioagents differ in genus;b) simultaneously determining the mass, base composition, or sequence of said two or more amplicons; andc) simultaneously identifying two or more bioagents in said sample by comparing the determined masses, base compositions, or sequences to a database comprising predetermined masses, base compositions, or sequences from a plurality of known organisms.
  • 2. The method of claim 1, wherein said first bioagent and said second bioagent differ in family.
  • 3. The method of claim 1, wherein said first bioagent and said second bioagent differ in order.
  • 4. The method of claim 1, wherein said first bioagent and said second bioagent differ in class.
  • 5. The method of claim 1, wherein said first bioagent is a bacteria and second bioagent is a virus.
  • 6. The method of claim 1, wherein said one or more amplicons are no more than 50 nucleotides in length.
  • 7. The method of claim 1, wherein two or more amplicons are generated from different regions of nucleic acid from each of said first and second bioagents.
  • 8. The method of claim 1, wherein said determining step is conducted without using radioactive of fluorescent labels.
  • 9. The method of claim 1, wherein said amplicons are isolated in the solid phase prior to or during said determining step.
  • 10. The method of claim 9, wherein said amplicons are isolated in wells of a multi-well plate.
  • 11. A method for identifying two or more bioagents, comprising: a) contacting a sample suspected of containing two or more bioagents with two or more primer pairs from said two or more bioagents, wherein each of said primer pairs hybridizes to conserved gene sequences flanking a variable sequence, wherein the primers of a first primer pair of said two or more primer pairs hybridize to gene sequences that are conserved within a first genus and flank a variable sequence that varies between species within a first genus, and the primers of a second primer pair of said two or more primer pairs hybridize to gene sequences that are conserved within a second genus and flank a variable sequence that varies between species within a second genus to simultaneously generate two or more amplicons, said amplicons no more than about 30-250 nucleotides in length;b) simultaneously determining the mass, base composition, or sequence of said amplicons; andc) simultaneously identifying said two or more bioagents by comparing two or more determined masses, base compositions, or sequences to a database comprising predetermined masses, base compositions, or sequences of known organisms.
  • 12. The method of claim 11, wherein said one or more amplicons are no more than 50 nucleotides in length.
  • 13. The method of claim 11, wherein said determining step is conducted without using radioactive of fluorescent labels.
  • 14. The method of claim 11, wherein said amplicons are isolated in the solid phase prior to or during said determining step.
  • 15. The method of claim 14, wherein said amplicons are isolated in wells of a multi-well plate.
  • 16. A method for identifying two or more bioagents, comprising: a) contacting a sample suspected of containing two or more bioagents with a plurality of primer pairs to simultaneously generate one or more amplicons no more than about 30-1000 nucleotides in length, wherein each of said primer pairs hybridize to conserved nucleic acid gene sequences flanking a variable sequence wherein the primers of a first primer pair of said plurality of primer pairs hybridize to nucleic acid gene sequences that are conserved within a first genus and flank a variable sequence that varies between species within a first genus, and the primers of a second primer pair of said plurality of primer pairs hybridize to nucleic acid gene sequences that are conserved within a second genus and flank a variable sequence that varies between species within a second genus;b) simultaneously determining the mass, base composition, or sequence of said two or more amplicons, wherein said amplicons are isolated in the solid phase prior to or during said determining step; andc) simultaneously identifying said two or more bioagents by comparing the determined masses, base compositions, or sequences to a database comprising predetermined masses, base compositions, or sequences from a plurality of known organisms.
  • 17. The method of claim 16, wherein said determining step is conducted without using radioactive or fluorescent labels.
  • 18. The method of claim 16, wherein said amplicons are no more than about 30-250 nucleotides in length.
  • 19. The method of claim 16, wherein said amplicons are no more than 50 nucleotides in length.
CROSS-REFERENCE TO RELATED APPLICATIONS

The present application is a continuation of U.S. application Ser. No. 11/930,002 filed Oct. 30, 2007, which is a continuation of U.S. application Ser. No. 10/728,486 filed Dec. 5, 2003, now U.S. Pat. No. 7,718,354 issued on May 18, 2010, which is a continuation-in-part of U.S. application Ser. No. 10/323,233 filed Dec. 18, 2002, now abandoned, Ser. No. 10/326,051 filed Dec. 18, 2002, now abandoned, Ser. No. 10/325,527 filed Dec. 18, 2002, now abandoned, and Ser. No. 10/325,526 filed Dec. 18, 2002, now abandoned, and claims the benefit of U.S. provisional application Ser. No. 60/431,319 filed Dec. 6, 2002, Ser. No. 60/443,443 filed Jan. 29, 2003, Ser. No. 60/443,788 filed Jan. 30, 2003, Ser. No. 60/447,529 filed Feb. 14, 2003, and Ser. No. 60/501,926 filed Sep. 11, 2003, and is also a continuation-in-part of U.S. application Ser. No. 10/660,122 filed Sep. 11, 2003, now U.S. Pat. No. 7,781,162 issued on Aug. 24, 2010, which is a continuation-in-part of U.S. application Ser. No. 09/798,007 filed Mar. 2, 2001, now abandoned, and is also a continuation-in-part of U.S. application Ser. No. 10/156,608 filed May 24, 2002, now U.S. Pat. No. 7,108,974 issued Sep. 19, 2006, which is a divisional of U.S. application Ser. No. 09/798,007, filed Mar. 2, 2001, now abandoned, each of which is herein incorporated by reference in its entirety.

STATEMENT OF GOVERNMENT SUPPORT

This invention was made with government support under MDA972-00-C-0053 awarded by DARPA. The government has certain rights in the invention.

US Referenced Citations (383)
Number Name Date Kind
4075475 Risby et al. Feb 1978 A
4683195 Mullis et al. Jul 1987 A
4683202 Mullis Jul 1987 A
4965188 Mullis et al. Oct 1990 A
4965190 Woo et al. Oct 1990 A
5015845 Allen et al. May 1991 A
5072115 Zhou Dec 1991 A
5143905 Sivasubramanian et al. Sep 1992 A
5213961 Bunn et al. May 1993 A
5219727 Wang et al. Jun 1993 A
5288611 Kohne Feb 1994 A
5436129 Stapleton Jul 1995 A
5451500 Stapleton Sep 1995 A
5472843 Milliman Dec 1995 A
5476774 Wang et al. Dec 1995 A
5484808 Grinnell Jan 1996 A
5484908 Froehler et al. Jan 1996 A
5502177 Matteucci et al. Mar 1996 A
5503980 Cantor Apr 1996 A
5504327 Sproch et al. Apr 1996 A
5504329 Mann et al. Apr 1996 A
5523217 Lupski et al. Jun 1996 A
5527669 Resnick et al. Jun 1996 A
5527675 Coull et al. Jun 1996 A
5527875 Yokoyama et al. Jun 1996 A
5538897 Yates, III et al. Jul 1996 A
5547835 Koster Aug 1996 A
5567587 Kohne Oct 1996 A
5576204 Blanco et al. Nov 1996 A
5580733 Levis et al. Dec 1996 A
5605798 Koster Feb 1997 A
5608217 Franzen et al. Mar 1997 A
5612179 Simons Mar 1997 A
5622824 Koster Apr 1997 A
5625184 Vestal et al. Apr 1997 A
5639606 Willey Jun 1997 A
5641632 Kohne Jun 1997 A
5645985 Froehler et al. Jul 1997 A
5645994 Huang Jul 1997 A
5683869 Ramsay Shaw et al. Nov 1997 A
5686242 Bruice et al. Nov 1997 A
5691141 Koster Nov 1997 A
5700642 Monforte et al. Dec 1997 A
5702895 Matsunaga et al. Dec 1997 A
5705332 Roll Jan 1998 A
5707802 Sandhu et al. Jan 1998 A
5712125 Uhlen Jan 1998 A
5716825 Hancock et al. Feb 1998 A
5727202 Kucala Mar 1998 A
5745751 Nelson et al. Apr 1998 A
5747246 Pannetier et al. May 1998 A
5747251 Carson et al. May 1998 A
5753467 Jensen et al. May 1998 A
5753489 Kistner et al. May 1998 A
5759771 Tilanus Jun 1998 A
5763169 Sandhu et al. Jun 1998 A
5763588 Matteucci et al. Jun 1998 A
5770367 Southern et al. Jun 1998 A
5777324 Hillenkamp Jul 1998 A
5814442 Natarajan et al. Sep 1998 A
5822824 Dion Oct 1998 A
5828062 Jarrell et al. Oct 1998 A
5830653 Froehler et al. Nov 1998 A
5830655 Monforte et al. Nov 1998 A
5830853 Backstrom et al. Nov 1998 A
5832489 Kucala Nov 1998 A
5834255 Van Gemen et al. Nov 1998 A
5845174 Yasui et al. Dec 1998 A
5849492 Rogan Dec 1998 A
5849497 Steinman Dec 1998 A
5849901 Mabilat et al. Dec 1998 A
5851765 Koster Dec 1998 A
5856174 Lipshutz et al. Jan 1999 A
5864137 Becker et al. Jan 1999 A
5866429 Bloch Feb 1999 A
5869242 Kamb Feb 1999 A
5871697 Rothberg et al. Feb 1999 A
5872003 Koster Feb 1999 A
5876936 Ju Mar 1999 A
5876938 Stolowitz et al. Mar 1999 A
5885775 Haff et al. Mar 1999 A
5900481 Lough et al. May 1999 A
5928905 Stemmer et al. Jul 1999 A
5928906 Koster et al. Jul 1999 A
5965363 Monforte et al. Oct 1999 A
5965383 Vogel et al. Oct 1999 A
5972693 Rothberg et al. Oct 1999 A
5976798 Parker et al. Nov 1999 A
5981176 Wallace Nov 1999 A
5981178 Tsui et al. Nov 1999 A
5981190 Israel Nov 1999 A
5994066 Bergeron et al. Nov 1999 A
6001564 Bergeron et al. Dec 1999 A
6001584 Karin et al. Dec 1999 A
6005096 Matteucci et al. Dec 1999 A
6007690 Nelson et al. Dec 1999 A
6007992 Lin et al. Dec 1999 A
6013438 Didenko et al. Jan 2000 A
6015666 Springer et al. Jan 2000 A
6018713 Coli et al. Jan 2000 A
6024925 Little et al. Feb 2000 A
6028183 Lin et al. Feb 2000 A
6043031 Koster et al. Mar 2000 A
6046005 Ju et al. Apr 2000 A
6051378 Monforte et al. Apr 2000 A
6054278 Dodge et al. Apr 2000 A
6055487 Margery et al. Apr 2000 A
6060246 Summerton et al. May 2000 A
6061686 Gauvin et al. May 2000 A
6063031 Cundari et al. May 2000 A
6074823 Koster Jun 2000 A
6074831 Yakhini et al. Jun 2000 A
6090558 Butler et al. Jul 2000 A
6104028 Hunter et al. Aug 2000 A
6110710 Smith et al. Aug 2000 A
6111251 Hillenkamp Aug 2000 A
6133436 Koster et al. Oct 2000 A
6140053 Koster Oct 2000 A
6146144 Fowler et al. Nov 2000 A
6146854 Koster et al. Nov 2000 A
6153389 Haarer et al. Nov 2000 A
6159681 Zebala Dec 2000 A
6180339 Sandhu et al. Jan 2001 B1
6180372 Franzen Jan 2001 B1
6187842 Kobayashi et al. Feb 2001 B1
6194144 Koster Feb 2001 B1
6197498 Koster Mar 2001 B1
6214555 Leushner et al. Apr 2001 B1
6218118 Sampson et al. Apr 2001 B1
6221587 Ecker et al. Apr 2001 B1
6221598 Schumm et al. Apr 2001 B1
6221601 Koster et al. Apr 2001 B1
6221605 Koster Apr 2001 B1
6225450 Koster May 2001 B1
6235476 Bergmann et al. May 2001 B1
6235478 Koster May 2001 B1
6235480 Shultz et al. May 2001 B1
6238871 Koster May 2001 B1
6238927 Abrams et al. May 2001 B1
6239159 Brown et al. May 2001 B1
6258538 Koster et al. Jul 2001 B1
6261769 Everett et al. Jul 2001 B1
6265716 Hunter et al. Jul 2001 B1
6265718 Park et al. Jul 2001 B1
6266131 Hamada et al. Jul 2001 B1
6266144 Li Jul 2001 B1
6268129 Gut et al. Jul 2001 B1
6268131 Kang et al. Jul 2001 B1
6268144 Koster Jul 2001 B1
6268146 Shultz et al. Jul 2001 B1
6270973 Lewis et al. Aug 2001 B1
6270974 Shultz et al. Aug 2001 B1
6274726 Laugharn, Jr. et al. Aug 2001 B1
6277573 Koster Aug 2001 B1
6277578 Shultz et al. Aug 2001 B1
6277634 McCall et al. Aug 2001 B1
6286146 Rocker Sep 2001 B1
6300076 Koster Oct 2001 B1
6303297 Lincoln et al. Oct 2001 B1
6312893 Van Ness et al. Nov 2001 B1
6312902 Shultz et al. Nov 2001 B1
6322970 Little et al. Nov 2001 B1
6361940 Van Ness et al. Mar 2002 B1
6372424 Brow et al. Apr 2002 B1
6389428 Rigault et al. May 2002 B1
6391551 Shultz et al. May 2002 B1
6393367 Tang et al. May 2002 B1
6419932 Dale Jul 2002 B1
6423966 Hillenkamp et al. Jul 2002 B2
6428955 Koster et al. Aug 2002 B1
6428956 Crooke et al. Aug 2002 B1
6432651 Hughes et al. Aug 2002 B1
6436635 Fu et al. Aug 2002 B1
6436640 Simmons et al. Aug 2002 B1
6453244 Oefner Sep 2002 B1
6458533 Felder et al. Oct 2002 B1
6468743 Romick et al. Oct 2002 B1
6468748 Monforte et al. Oct 2002 B1
6475143 Iliff Nov 2002 B2
6475736 Stanton, Jr. Nov 2002 B1
6475738 Shuber et al. Nov 2002 B2
6479239 Anderson et al. Nov 2002 B1
6500621 Koster Dec 2002 B2
6553317 Lincoln et al. Apr 2003 B1
6558902 Hillenkamp May 2003 B1
6563025 Song et al. May 2003 B1
6566055 Monforte et al. May 2003 B1
6568055 Tang et al. May 2003 B1
6582916 Schmidt et al. Jun 2003 B1
6586584 McMillian et al. Jul 2003 B2
6589485 Koster Jul 2003 B2
6602662 Koster et al. Aug 2003 B1
6605433 Fliss et al. Aug 2003 B1
6610492 Stanton, Jr. et al. Aug 2003 B1
6613509 Chen Sep 2003 B1
6613520 Ashby Sep 2003 B2
6623928 Van Ness et al. Sep 2003 B2
6638714 Linnen et al. Oct 2003 B1
6680476 Hidalgo et al. Jan 2004 B1
6682889 Wang et al. Jan 2004 B1
6705530 Kiekhaefer Mar 2004 B2
6706530 Hillenkamp Mar 2004 B2
6716634 Myerson Apr 2004 B1
6783939 Olmsted et al. Aug 2004 B2
6800289 Nagata et al. Oct 2004 B2
6813615 Colasanti et al. Nov 2004 B1
6836742 Brekenfeld Dec 2004 B2
6852487 Barany et al. Feb 2005 B1
6856914 Pelech Feb 2005 B1
6875593 Froehler et al. Apr 2005 B2
6906316 Sugiyama et al. Jun 2005 B2
6906319 Hoyes Jun 2005 B2
6914137 Baker Jul 2005 B2
6921817 Banerjee Jul 2005 B1
6977148 Dean et al. Dec 2005 B2
6994962 Thilly Feb 2006 B1
7022835 Rauth et al. Apr 2006 B1
7024370 Epler et al. Apr 2006 B2
7108974 Ecker et al. Sep 2006 B2
7198893 Köster et al. Apr 2007 B1
7217510 Ecker et al. May 2007 B2
7226739 Ecker et al. Jun 2007 B2
7255992 Ecker et al. Aug 2007 B2
7285422 Little et al. Oct 2007 B1
7312036 Sampath et al. Dec 2007 B2
7321828 Cowsert et al. Jan 2008 B2
7349808 Kreiswirth et al. Mar 2008 B1
7390458 Burow et al. Jun 2008 B2
7419787 Köster Sep 2008 B2
7501251 Köster et al. Mar 2009 B2
7666588 Ecker et al. Feb 2010 B2
7718354 Ecker et al. May 2010 B2
7741036 Ecker et al. Jun 2010 B2
7781162 Ecker et al. Aug 2010 B2
7956175 Sampath et al. Jun 2011 B2
8017322 Ecker et al. Sep 2011 B2
8017358 Ecker et al. Sep 2011 B2
8017743 Ecker et al. Sep 2011 B2
8026084 Ecker et al. Sep 2011 B2
8046171 Ecker et al. Oct 2011 B2
8057993 Ecker et al. Nov 2011 B2
8071309 Ecker et al. Dec 2011 B2
8073627 Ecker et al. Dec 2011 B2
8158354 Hofstadler et al. Apr 2012 B2
8380442 Ecker et al. Feb 2013 B2
8822156 Ecker et al. Sep 2014 B2
20010039263 Matthes et al. Nov 2001 A1
20020006611 Portugal et al. Jan 2002 A1
20020028923 Cowsert et al. Mar 2002 A1
20020042112 Koster et al. Apr 2002 A1
20020042506 Kristyanne et al. Apr 2002 A1
20020045178 Cantor et al. Apr 2002 A1
20020055101 Bergeron et al. May 2002 A1
20020090320 Burow et al. Jul 2002 A1
20020120408 Kreiswirth et al. Aug 2002 A1
20020137057 Wold et al. Sep 2002 A1
20020138210 Wilkes et al. Sep 2002 A1
20020150903 Koster Oct 2002 A1
20020150927 Matray et al. Oct 2002 A1
20020168630 Fleming et al. Nov 2002 A1
20020187490 Tiedje et al. Dec 2002 A1
20030017487 Xue et al. Jan 2003 A1
20030027135 Ecker et al. Feb 2003 A1
20030039976 Haff Feb 2003 A1
20030050470 An et al. Mar 2003 A1
20030064483 Shaw et al. Apr 2003 A1
20030073112 Zhang et al. Apr 2003 A1
20030082539 Ecker et al. May 2003 A1
20030084483 Simpson et al. May 2003 A1
20030101172 De La Huerga May 2003 A1
20030104410 Mittmann Jun 2003 A1
20030104699 Minamihaba et al. Jun 2003 A1
20030113738 Liu et al. Jun 2003 A1
20030113745 Monforte et al. Jun 2003 A1
20030119018 Omura et al. Jun 2003 A1
20030124556 Ecker et al. Jul 2003 A1
20030125192 Moon Jul 2003 A1
20030129589 Koster et al. Jul 2003 A1
20030134312 Burgoyne Jul 2003 A1
20030148281 Glucksmann Aug 2003 A1
20030148284 Vision et al. Aug 2003 A1
20030167133 Ecker et al. Sep 2003 A1
20030167134 Ecker et al. Sep 2003 A1
20030175695 Ecker et al. Sep 2003 A1
20030175696 Ecker et al. Sep 2003 A1
20030175697 Ecker et al. Sep 2003 A1
20030175729 Van Eijk et al. Sep 2003 A1
20030186247 Smarason et al. Oct 2003 A1
20030187588 Ecker et al. Oct 2003 A1
20030187593 Ecker et al. Oct 2003 A1
20030187615 Epler et al. Oct 2003 A1
20030190605 Ecker et al. Oct 2003 A1
20030190635 McSwiggen Oct 2003 A1
20030194699 Lewis et al. Oct 2003 A1
20030203398 Bramucci et al. Oct 2003 A1
20030220844 Marnellos et al. Nov 2003 A1
20030224377 Wengel et al. Dec 2003 A1
20030225529 Ecker et al. Dec 2003 A1
20030228571 Ecker et al. Dec 2003 A1
20030228597 Cowsert et al. Dec 2003 A1
20030228613 Bornarth et al. Dec 2003 A1
20040005555 Rothman et al. Jan 2004 A1
20040013703 Ralph et al. Jan 2004 A1
20040014957 Eldrup et al. Jan 2004 A1
20040023207 Polansky Feb 2004 A1
20040023209 Jonasson Feb 2004 A1
20040029129 Wang et al. Feb 2004 A1
20040038206 Zhang et al. Feb 2004 A1
20040038208 Fisher et al. Feb 2004 A1
20040038234 Gut et al. Feb 2004 A1
20040038385 Langlois et al. Feb 2004 A1
20040081993 Cantor et al. Apr 2004 A1
20040101809 Weiss et al. May 2004 A1
20040110169 Ecker et al. Jun 2004 A1
20040111221 Beattie et al. Jun 2004 A1
20040117129 Ecker et al. Jun 2004 A1
20040117354 Azzaro et al. Jun 2004 A1
20040121309 Ecker et al. Jun 2004 A1
20040121310 Ecker et al. Jun 2004 A1
20040121311 Ecker et al. Jun 2004 A1
20040121312 Ecker et al. Jun 2004 A1
20040121313 Ecker et al. Jun 2004 A1
20040121314 Ecker et al. Jun 2004 A1
20040121315 Ecker et al. Jun 2004 A1
20040121329 Ecker et al. Jun 2004 A1
20040121335 Ecker et al. Jun 2004 A1
20040121340 Ecker et al. Jun 2004 A1
20040122598 Ecker et al. Jun 2004 A1
20040122857 Ecker et al. Jun 2004 A1
20040126764 Lasken et al. Jul 2004 A1
20040137013 Katinger et al. Jul 2004 A1
20040161770 Ecker et al. Aug 2004 A1
20040180328 Ecker et al. Sep 2004 A1
20040185438 Ecker Sep 2004 A1
20040191769 Marino et al. Sep 2004 A1
20040202997 Ecker et al. Oct 2004 A1
20040209260 Ecker et al. Oct 2004 A1
20040219517 Ecker et al. Nov 2004 A1
20040253583 Ecker et al. Dec 2004 A1
20040253619 Ecker et al. Dec 2004 A1
20050009053 Boecker et al. Jan 2005 A1
20050026147 Walker et al. Feb 2005 A1
20050026641 Hokao Feb 2005 A1
20050027459 Ecker et al. Feb 2005 A1
20050065813 Mishelevich et al. Mar 2005 A1
20050130196 Hofstadler et al. Jun 2005 A1
20050130216 Becker et al. Jun 2005 A1
20050142584 Willson et al. Jun 2005 A1
20050250125 Novakoff Nov 2005 A1
20050266397 Ecker et al. Dec 2005 A1
20050266411 Hofstadler et al. Dec 2005 A1
20060014190 Hennessy Jan 2006 A1
20060020391 Kreiswirth et al. Jan 2006 A1
20060057605 Sampath et al. Mar 2006 A1
20060121520 Ecker et al. Jun 2006 A1
20060172330 Osborn et al. Aug 2006 A1
20060205040 Sampath Sep 2006 A1
20060240412 Hall et al. Oct 2006 A1
20060259249 Sampath et al. Nov 2006 A1
20060275788 Ecker et al. Dec 2006 A1
20070048735 Ecker et al. Mar 2007 A1
20070218467 Ecker et al. Sep 2007 A1
20080160512 Ecker et al. Jul 2008 A1
20080311558 Ecker et al. Dec 2008 A1
20090004643 Ecker et al. Jan 2009 A1
20090023150 Koster et al. Jan 2009 A1
20090042203 Koster Feb 2009 A1
20090092977 Koster Apr 2009 A1
20090125245 Hofstadler et al. May 2009 A1
20090148836 Ecker et al. Jun 2009 A1
20090148837 Ecker et al. Jun 2009 A1
20090182511 Ecker et al. Jul 2009 A1
20090239224 Ecker et al. Sep 2009 A1
20100070194 Ecker et al. Mar 2010 A1
20100145626 Ecker et al. Jun 2010 A1
20100184035 Hall et al. Jul 2010 A1
20110172925 Ecker et al. Jul 2011 A1
20120122086 Ecker et al. May 2012 A1
20120123685 Ecker et al. May 2012 A1
20120164625 Ecker et al. Jun 2012 A1
20120171679 Ecker et al. Jul 2012 A1
20130124099 Ecker et al. May 2013 A1
20130337452 Hofstadler et al. Dec 2013 A1
Foreign Referenced Citations (178)
Number Date Country
1202204 Dec 1998 CN
19732086 Jan 1999 DE
19802905 Jul 1999 DE
19824280 Dec 1999 DE
19852167 May 2000 DE
19943374 Mar 2001 DE
10132147 Feb 2003 DE
281390 Sep 1988 EP
0620862 Oct 1994 EP
633321 Jan 1995 EP
620862 Apr 1998 EP
1035219 Sep 2000 EP
1138782 Oct 2001 EP
1234888 Aug 2002 EP
1308506 May 2003 EP
1310571 May 2003 EP
1333101 Aug 2003 EP
1365031 Nov 2003 EP
1234888 Jan 2004 EP
1748072 Jan 2007 EP
2811321 Jan 2002 FR
2325002 Nov 1998 GB
2339905 Feb 2000 GB
5276999 Oct 1993 JP
11137259 May 1999 JP
24024206 Jan 2004 JP
2004000200 Jan 2004 JP
24201679 Jul 2004 JP
2004201641 Jul 2004 JP
WO8803957 Jun 1988 WO
WO9015157 Dec 1990 WO
WO9205182 Apr 1992 WO
WO9208117 May 1992 WO
WO9209703 Jun 1992 WO
WO9219774 Nov 1992 WO
WO9303186 Feb 1993 WO
WO9305182 Mar 1993 WO
WO9308297 Apr 1993 WO
WO9416101 Jul 1994 WO
WO9419490 Sep 1994 WO
WO9421822 Sep 1994 WO
WO9504161 Feb 1995 WO
WO9511996 May 1995 WO
WO9513395 May 1995 WO
WO9513396 May 1995 WO
WO9531997 Nov 1995 WO
WO9606187 Feb 1996 WO
WO9616186 May 1996 WO
WO9629431 Sep 1996 WO
WO9632504 Oct 1996 WO
WO9635450 Nov 1996 WO
WO9637630 Nov 1996 WO
WO9733000 Sep 1997 WO
WO9734909 Sep 1997 WO
WO9737041 Oct 1997 WO
WO9747766 Dec 1997 WO
WO9803684 Jan 1998 WO
WO9812355 Mar 1998 WO
WO9814616 Apr 1998 WO
WO9815652 Apr 1998 WO
WO9820020 May 1998 WO
WO9820157 May 1998 WO
WO9820166 May 1998 WO
WO9826095 Jun 1998 WO
WO9831830 Jul 1998 WO
WO9835057 Aug 1998 WO
WO9840520 Sep 1998 WO
WO9854571 Dec 1998 WO
WO9854751 Dec 1998 WO
WO9905319 Feb 1999 WO
WO9912040 Mar 1999 WO
WO9913104 Mar 1999 WO
WO9914375 Mar 1999 WO
9916780 Apr 1999 WO
WO9929898 Jun 1999 WO
WO9931278 Jun 1999 WO
WO9957318 Nov 1999 WO
WO9958713 Nov 1999 WO
WO9960183 Nov 1999 WO
WO0032750 Jun 2000 WO
WO0038636 Jul 2000 WO
WO0063362 Oct 2000 WO
WO0066762 Nov 2000 WO
WO0066789 Nov 2000 WO
WO0077260 Dec 2000 WO
WO0100828 Jan 2001 WO
WO0107648 Feb 2001 WO
WO0112853 Feb 2001 WO
WO0120018 Mar 2001 WO
WO0123604 Apr 2001 WO
WO0123608 Apr 2001 WO
WO0127857 Apr 2001 WO
WO0132930 May 2001 WO
WO0140497 Jun 2001 WO
WO0146404 Jun 2001 WO
WO0151661 Jul 2001 WO
WO0151662 Jul 2001 WO
WO0157263 Aug 2001 WO
WO0157518 Aug 2001 WO
WO0173119 Oct 2001 WO
WO0173199 Oct 2001 WO
WO0177392 Oct 2001 WO
WO0196388 Dec 2001 WO
WO0202811 Jan 2002 WO
WO0210186 Feb 2002 WO
WO0210444 Feb 2002 WO
WO0218641 Mar 2002 WO
WO0221108 Mar 2002 WO
WO0222873 Mar 2002 WO
WO0224876 Mar 2002 WO
WO0250307 Jun 2002 WO
WO02057491 Jul 2002 WO
WO02070664 Sep 2002 WO
WO02070728 Sep 2002 WO
WO02070737 Sep 2002 WO
WO02077278 Oct 2002 WO
WO02099034 Dec 2002 WO
WO02099095 Dec 2002 WO
WO02099129 Dec 2002 WO
WO02099130 Dec 2002 WO
WO03001976 Jan 2003 WO
WO03002750 Jan 2003 WO
WO03008636 Jan 2003 WO
WO03012058 Feb 2003 WO
WO03012074 Feb 2003 WO
WO03014382 Feb 2003 WO
WO03016546 Feb 2003 WO
WO03018636 Mar 2003 WO
WO03020890 Mar 2003 WO
WO03033732 Apr 2003 WO
WO03054162 Jul 2003 WO
WO03054755 Jul 2003 WO
WO03060163 Jul 2003 WO
WO03075955 Sep 2003 WO
WO03088979 Oct 2003 WO
WO03093506 Nov 2003 WO
WO03097869 Nov 2003 WO
WO03100035 Dec 2003 WO
WO03100068 Dec 2003 WO
WO03102191 Dec 2003 WO
WO03104410 Dec 2003 WO
WO03106635 Dec 2003 WO
WO2004003511 Jan 2004 WO
WO2004009849 Jan 2004 WO
WO2004011651 Feb 2004 WO
WO2004013357 Feb 2004 WO
WO2004040013 May 2004 WO
WO2004044123 May 2004 WO
WO2004044247 May 2004 WO
WO2004052175 Jun 2004 WO
WO2004053076 Jun 2004 WO
WO2004053141 Jun 2004 WO
WO2004053164 Jun 2004 WO
WO2004060278 Jul 2004 WO
WO2004070001 Aug 2004 WO
WO2004072230 Aug 2004 WO
WO2004072231 Aug 2004 WO
WO2004101809 Nov 2004 WO
WO2005003384 Jan 2005 WO
WO2005009202 Feb 2005 WO
WO2005012572 Feb 2005 WO
WO2005024046 Mar 2005 WO
WO2005036369 Apr 2005 WO
WO2005053141 Jun 2005 WO
WO2005054454 Jun 2005 WO
WO2005075686 Aug 2005 WO
WO2005086634 Sep 2005 WO
WO2005091971 Oct 2005 WO
WO2005098047 Oct 2005 WO
WO2005116263 Dec 2005 WO
WO2006089762 Aug 2006 WO
WO2006094238 Sep 2006 WO
WO2006116127 Nov 2006 WO
WO2006135400 Dec 2006 WO
WO2007014045 Feb 2007 WO
WO2007086904 Aug 2007 WO
WO2008104002 Aug 2008 WO
WO2008118809 Oct 2008 WO
Non-Patent Literature Citations (1266)
Entry
Tran et al. Improved multiplex PCR using conserved and species-specific 16S rRNA gene primers for simultaneous detection of Actinobacillus actinomycetemcomitans, Bacteroides forsythus, and Porphyromonas gingivalis. J. Clinical Microbiology (1999) vol. 37, No. 11, pp. 3504-3508.
Stockton et al. Multiplex PCR for typing and subtying influenza and respiratory syncytial viruses. J. Clin. Microbiol. (1998) vol. 36, No. 10, pp. 2990-2995.
Office Action mailed May 24, 2012 for European Application No. 10179791.8 filed Mar. 4, 2002.
Office Action mailed May 29, 2012 for Indian Application No. IN4504/KOLNP/2007 filed Nov. 22, 2007.
Office Action mailed May 31, 2012 for Canadian Application No. 2616281 filed Jul. 21, 2006.
Notice of Allowance mailed Aug. 3, 2012 for U.S. Appl. No. 11/674,538, filed Feb. 13, 2007.
Notice of Allowance mailed Jul. 24, 2012 for U.S. Appl. No. 11/930,017, filed Oct. 30, 2007.
Office Action mailed Jun. 12, 2012 for Mexican Application No. PAa2003007927 filed Sep. 2, 2003.
Office Action mailed Jul. 25, 2012 for European Application No. 06800205.4 filed Jul. 21, 2006.
Advisory Action mailed Jan. 28, 2009 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Co-pending U.S. Appl. No. 13/243,960, filed Sep. 23, 2011.
Co-pending U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Co-pending U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Ecker Supporting Information [online], May 23, 2005 [retrieved on Jul. 31, 2011]. Retrieved from the Internet:< URL: http://www.pnas.org/content/102/22/8012/suppl/DC1>.
Ex Parte Quayle Action mailed Nov. 21, 2011 for U.S. Appl. No. 12/049,949, filed Mar. 17, 2008.
Final Office Action mailed Oct. 19, 2011 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Final Office Action mailed Jul. 28, 2011 for U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
GenBank, “Mouse Hepatitis Virus Strain MHV-A59 C12 Mutant, Complete Genome,” Accession No. AF029248, Jul. 25, 2000.
Klijn N., et al., “Identification of Mesophilic Lactic Acid Bacteria by using Polymerase Chain Reaction-Amplified Variable Regions of 16S rRNA and Specific DNA Probes,” Applied and Environmental Microbiology, 1991, vol. 57 (11), pp. 3390-3393.
Krenke B.E., et al., “Validation of a 16-Locus Fluorescent Multiplex System,” Journal of Forensic Sciences, 2002, vol. 47 (4), pp. 773-785.
Non-Final Office Action mailed May 2, 2012 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Non-Final Office Action mailed Oct. 11, 2011 for U.S. Appl. No. 12/605,628, filed Oct. 26, 2009.
Non-Final Office Action mailed Dec. 13, 2011 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Non-Final Office Action mailed Oct. 13, 2011 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Non-Final Office Action mailed Dec. 14, 2011 for U.S. Appl. No. 11/682,259, filed Mar. 5, 2007.
Non-Final Office Action mailed Feb. 16, 2012 for U.S. Appl. No. 11/674,538, filed Feb. 13, 2007.
Non-Final Office Action mailed Apr. 18, 2012 for U.S. Appl. No. 12/605,628, filed Oct. 26, 2009.
Non-Final Office Action mailed Mar. 21, 2012 for U.S. Appl. No. 12/616,422, filed Nov. 11, 2009.
Non-Final Office Action mailed Jan. 27, 2012 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Notice of Allowance and Examiner Interview Summary Report mailed Jul. 21, 2011 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Notice of Allowance mailed Apr. 9, 2012 for U.S. Appl. No. 11/929,910, filed Oct. 30, 2007.
Notice of Allowance mailed May 11, 2012 for U.S. Appl. No. 12/049,949, filed Mar. 17, 2008.
Notice of Allowance mailed Mar. 19, 2012 for U.S. Appl. No. 11/930,017, filed Oct. 30, 2007.
Notice of Allowance mailed Nov. 21, 2011 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Notice of Allowance mailed Mar. 22, 2012 for U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
Notice of Allowance mailed Mar. 22, 2012 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Notice of Allowance mailed May 23, 2012 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Notice of Allowance mailed Feb. 29, 2012 for U.S. Appl. No. 11/929,910, filed Oct. 30, 2007.
Office Action mailed Dec. 2, 2011 for European Application No. 10179791.8 filed Mar. 4, 2002.
Office Action mailed Feb. 2, 2012 for Israel Application No. 157661 filed Mar. 4, 2002.
Office Action mailed Aug. 3, 2011 for Canadian Application No. 2439655 filed Mar. 4, 2002.
Office Action mailed Aug. 3, 2011 for European Application No. 08730682.5 filed Feb. 25, 2008.
Office Action mailed Jul. 5, 2011 for Mexican Application No. PAa2003007927 filed Sep. 2, 2003.
Office Action mailed Dec. 6, 2011 for Australian Application No. 2010200893 filed Mar. 10, 2010.
Office Action mailed Feb. 6, 2012 for Australian Application No. 2010202418 filed Jun. 10, 2010.
Office Action mailed Feb. 6, 2012 for European Application No. 06800205.4 filed Jul. 21, 2006.
Office Action mailed Apr. 7, 2009 for Canadian Application No. 2525498 filed May 13, 2004.
Office Action mailed Jan. 10, 2012 for Japanese Application No. 2008522997 filed Jul. 21, 2006.
Office Action mailed Feb. 14, 2012 for Australian Application No. 2010200686 filed Feb. 25, 2010.
Office Action mailed Feb. 14, 2012 for European Application No. 10179789.2 filed Mar. 4, 2002.
Office Action mailed Jan. 19, 2012 for Canadian Application No. 2510007 filed Dec. 5, 2003.
Office Action mailed Oct. 20, 2011 for European Application No. 02709785.6 filed Mar. 4, 2002.
Office Action mailed Mar. 21, 2012 for Japanese Application No. 2009245976 filed Oct. 26, 2009.
Office Action mailed Nov. 30, 2011 for Australian Application No. 2010202418 filed Jun. 10, 2010.
Office Action mailed Sep. 30, 2011 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Final Office Action mailed Oct. 4, 2012 for U.S. Appl. No. 11/682,259, filed Mar. 5, 2007.
Notice of Allowance mailed Oct. 2, 2012 for U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
Office Action mailed Sep. 14, 2012 for Australian Application No. 2010200893 filed Mar. 10, 2010.
Office Action mailed Aug. 29, 2012 for Canadian Application No. 2439655 filed Mar. 4, 2002.
Aaserud D.J., et al., “Accurate Base Composition of Double-Strand DNA by Mass Spectrometry,” American Society for Mass Spectrometry, 1996, vol. 7 (12), pp. 1266-1269.
Aaserud D.J., et al., “DNA Sequencing with Blackbody Infrared Radioactive Dissociation of Electrosprayed Ions,” International Journal of Mass Spectrometry and Icon Processes, 1997, vol. 167/168, pp. 705-712.
Adam E., et al., “Characterization of Intertype Specific Epitopes on Adenovirus Hexons,” Archives of Virology, 1998, vol. 143 (9), pp. 1669-1682.
Adam E., et al., “Intertype Specific Epitope Structure of Adenovirus Hexon,” Acta Microbiologica et Immunologica Hungarica, 1998, vol. 45 (3-4), pp. 311-316.
Adam E., et al., “Molecular Structure of the Two-Dimensional Hexon Crystalline Array and of Adenovirus Capsid,” Acta Microbiologica et Immunologica Hungarica, 1998, vol. 45 (3-4), pp. 305-310.
Adrian T., et al., “DNA Restriction Analysis of Adenovirus Prototypes 1 to 41,” Archives of Virology, 1986, vol. 91 (3-4), pp. 277-290.
Adzhar A., et al., “Universal Oligonucleotides for the Detection of Infectious Bronchitis Virus by Thepolymerase Chain Reaction,” Avian Pathology, 1996, vol. 25 (4), pp. 817-836.
Agostini H.T., et al., “Complete Genome of a JC Virus Genotype Type 6 from the Brain of an African American with Progressive Multifocal Leukoencephalopathy,” Journal of Human Virology, 1998, vol. 1 (4), pp. 267-272.
Aires De Sousa M., et al., “Bridges from Hospitals to the Laboratory: Genetic Portraits of Methicillin-Resistant Staphylococcus aureus Clones,” FEMS Immunology and Medical Microbiology, 2004, vol. 40 (2), pp. 101-111.
Akalu A., et al., “Rapid Identification of Subgenera of Human Adenovirus by Serological and PCR Assays,” Journal of Virological Methods, 1998, vol. 71 (2), pp. 187-196.
Alba M.M., et al., “VIDA: A Virus Database System for the Organization of Animal Virus Genome Open Reading Frames,” Nucleic Acids Research, 2001, vol. 29 (1), pp. 133-136.
Allaouchiche B., et al., “Clinical Impact of Rapid Oxacillin Susceptibility Testing Using a PCR Assay in Staphylococcus aureus Bactaeremia,” The Journal of Infection, 1999, vol. 39 (3), pp. 198-204.
Allawi H.T., et al., “Thermodynamics and NMR of Internal G.T. Mismatches in DNA,” Biochemistry, 1997, vol. 36 (34), pp. 10581-10594.
Altschuel S.F., et al., “Basic Local Alignment Search Tool,” Journal of Molecular Biology, 1990, vol. 215 (3), pp. 403-410.
Altschuel S.F., et al., “Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs,” Nucleic Acids Research, 1997, vol. 25 (17), pp. 3389-3402.
Alves-Silva J., et al., “The Ancestry of Brazilian mtDNA Linages,” The American Journal of Human Genetics, 2000, vol. 67 (2), pp. 444-461.
Amano Y., et al., “Detection of Influenza Virus: Traditional Approaches and Development of Biosensors,” Analytical and Bioanalytical Chemistry, 2005, vol. 381 (1), pp. 156-164.
Amexis G., et al., “Quantitative Mutant Analysis of Viral Quasispecies by Chip-Based Matrix Assisted LaserDesorption Ionization Time-of-Flight Mass Spectrometry,” Proceedings of the National Academy of Sciences, 2001, vol. 98 (21), pp. 12097-12102.
Anderson M.L.M., “Quantitative Filter Hybridization” in: Nucleic Acid Hybridization, Hames B.D., ed., IRL Press, 1985, pp. 73-111.
Anderson S., et al., “Sequence and Organization of the Human Mitochondrial Genome,” Nature, 1981, vol. 290 (5806), pp. 457-465.
Andreasson H., et al., “Mitochondrial Sequence Analysis for Forensic Identification Using Pyrosequencing Technology,” BioTechniques, 2002, vol. 32 (1), pp. 124-133.
Anthony R.M., et al., “Use of the Polymerase Chain Reaction for Rapid Detection of High-Level Mupirocin Resistance in Staphylococci,” European Journal of Clinical Microbiology & Infectious Diseases, 1999, vol. 18 (1), pp. 30-34.
Arbique J., et al., “Comparison of the Velogene Rapid MRSA Identification Assay, Denka MRSAScreen Assay, and BBL Crystal MRSA ID System for Rapid Identification of Methicillin-Resistant Staphylococcus aureus,” Diagnositic Microbiology and Infectious Diseases, 2001, vol. 40 (1-2), pp. 5-10.
Archer G.L., et al., “Detection of Methicillin Resistance in Staphylococci by Using a DNA Probe,” Antimicrobial Agents and Chemotherapy, 1990, vol. 34 (9), pp. 1720-1724.
Armstrong P., et al., “Sensitive and Specific Colorimetric Dot Assay to Detect Eastern Equine Encephalomyelitis Viral RNA in Mosquitoes After PCR Amplification,” Journal of Medicinal Entomology, 1995, vol. 32 (1), pp. 42-52.
Arnal C., et al., “Quantification of Hepatitis A Virus in Shellfish by Competitive Reverse Transcription PCR with Coextraction of Standard RNA,” Applied and Environmental Microbiology, 1999, vol. 65 (1), pp. 322-326.
Aronsson F., et al., “Persistence of the Influenza A/WSN/33 Virus RNA at Midbrain Levels of Immunodefective Mice,” Journal of Neurovirology, 2001, vol. 7 (2), pp. 117-124.
Ausubel F.M., et al., Eds., Current Protocols in Molecular Biology, vol. 1, John Wiley & Sons Inc., 2004, Table of Contents.
Ausubel F.M., et al., eds., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 2nd Edition, John Wiley & Sons, 1992, Units 2.9, 3.4-3.17, 4.6-4.10, and 10.8.
Ausubel F.M., et al., “Unit 2.11 “Synthesis and Purification of Oligonucleotides,” in: Current Protocols in Molecular Biology,” 1998, John Wiley & Sons, Inc., pp. 2.11-2.11.21.
Avellon A., et al., “Rapid and Sensitive Diagnosis of Human Adenovirus Infections by a Generic Polymerase Chain Reaction,” Journal of Virological Methods, 2001, vol. 92 (2), pp. 113-120.
Azevedo A.M., et al., “Detection of Influenza, Parainfluenza, Adenovirus and Respiratory Syncytial Virus during Asthma Attacks in Children Older than 2 Years Old,” Allergologia Immunopathologia, 2003, vol. 31 (6), pp. 311-317.
Baba T., et al., “Genome and Virulence Determinants of High Virulence Community-Acquired MRSA,” Lancet, 2002, vol. 359 (9320), pp. 1819-1827.
Bahrmahd A.R., et al., “Polymerise Chain Reaction of Bacterial Genomes with Single Universal Primer: Application to Distinguishing Mycobacteria Species,” Molecular and Cellular Probes, 1996, vol. 10 (2), pp. 117-122.
Bahrmahd A.R., et al., “Use of Restriction Enzyme Analysis of Amplified DNA Coding for the hsp65 Gene and Polymerase Chain Reaction with Universal Primer for Rapid Differtiation of Mycobacterium Species in the Clinical Laboratory,” Scandinavian Journal of Infectious Diseases, 1998, vol. 30 (5), pp. 477-480.
Bai J., et al., “Matrix-Assisted Laser Desorption/lonization Mass Spectrometry of Restriction Enzyme-Digested Plasmid DNA Using an Active Nafion Substrate,” Rapid Communications in Mass Spectrometry, 1994, vol. 8 (9), pp. 687-691.
Baker G.C., et al., “Review and Re-Analysis of Domain-Specific 16S Primers,” Journal of Microbiological Methods, 2003, vol. 55 (3), pp. 541-555.
Banik U., et al., “Multiplex PCR Assay for Rapid Identification of Oculopathogenic Adenoviruses by Amplification of the Fiber and Hexon Genes,” Journal of Clincal Microbiology, 2005, vol. 43 (3), pp. 1064-1068.
Barbour A.G., et al., “Identification of an Uncultivatable Borrelia Species in the Hard Tick Amblyomma americanum: Possible Agent of a Lyme Disease-Like Illness,” The Journal of Infectious Diseases, 1996, vol. 173 (2), pp. 403-409.
Barns S.M., et al., “Detection of Diverse New Francisella-like Bacteria in Environmental Samples,” Applied and Environmental Microbiology, 2005, vol. 71 (9), pp. 5494-5500.
Baron E.J., “Genetic Aspects of Methicillin Resistance in Staphylococcus aureus and MethodsUsed for its Detection in Clinical Laboratories in the United States,” Journal of Chemotherapy, 1995, vol. 7 (Suppl. 3), pp. 87-92.
Barr I.G., et al., “An Influenza A(H3) Reassortant was Epidemic in Australia and New Zealand in 2003,” Journal of Medical Virology, 2005, vol. 76 (3), pp. 391-397.
Barski P., et al., “Rapid Assay for Detection of Methicillin-Resistant Staphylococcus aureus Using Multiplex PCR,” Molecular and Cellular Probes, 1996, vol. 10 (6), pp. 471-475.
Bastia T., et al., “Organelle DNA Analysis of Solanum and Brassica Somatic Hybrids by PCR with Universal Primers,” Theoretical and Applied Genetics, 2001, vol. 102 (8), pp. 1265-1272.
Batey R.T., et al., “Preparation of Isotopically Labeled Ribonucleotides for Multidimensional NMR Spectroscopy of RNA,” Nucleic Acids Research, 1992, vol. 20 (17), pp. 4515-4523.
Baumer A., et al., “Age-Related Human mtDNA Deletions: A Heterogeneous Set of Deletions Arising at aSingle Pair of Directly Repeated Sequences,” American Journal of Human Jenetics, 1994, vol. 54 (4), pp. 618-630.
Beall B., et al., “Sequencing emm-Specific PCR Products for Routine andAccurate Typing of Group A Streptococci,” Journal of Clincal Microbiology, 1996, vol. 34 (4), pp. 953-958.
Beall B., et al., “Survey of emm Gene Sequences and T-Antigen Types from Systemic Streptococcus pyogenes Infection Isolates Collected in San Francisco, California; Atlanta, Georgia; and Connecticut in 1994 and 1995,” Journal of Clincal Microbiology, 1997, vol. 35 (5), pp. 1231-1235.
Benko, M. et al., “Family Adenoviridae, Virus taxonomy. VIIIth report of the International Committee on Taxonomy of Viruses,” 2004, Academic Press, New York, pp. 213-228.
Benson D.A., et al., “GenBank,” Nucleic Acids Research, 1999, vol. 27 (1), pp. 12-17.
Benson L.M., et al, “Advantages of Thermococcus Kodakaraenis (KOD) DNA Polymerase for PCR-Mass Spectrometry Based Analyses,” American Society for Mass Spectrometry, 2003, vol. 14 (6), pp. 601-604.
Berencsi G., et al., “Molecular Biological Characterization of Adenovirus DNA,” Acta Microbiologica et Immunologica Hungarica, 1998, vol. 45 (3-4), pp. 297-304.
Bishop M.J., et al., “Molecular Sequence Databases” in: Nucleic Acid and Protein Sequence Analysis, 4th Chapter, Bishop M.J., et al., Eds, IRL Press, 1987, pp. 83-113.
Bisno A.L., “Streptococcus pyogenes” in: Infectious Diseases and Their Etiologic Agents, vol. 2, Mandell, Eds., Churchill Livingston, New York, 1995, pp. 1786-1799.
Black R.M., et al., “Detection of Trace Levels of Tricothecene Mycotoxins in Human Urineby Gas Chromatography-Mass Spectrometry,” Journal of Chromatography, 1986, vol. 367 (1), pp. 103-115.
Blaiotta G., et al., “PCR Detection of Staphylococcal Enterotoxin Genes in Staphyiococcus Spp. Strains Isolated from Meat and Dairy Products. Evidence for New Variants of seG and Sel in S. aureus AB-8802,” Journal of Applied Microbiology, 2004, vol. 97 (4), pp. 719-730.
BLAST Search results, Mar. 7, 2006.
Boivin-Jahns V., et al., “Bacterial Diversity in a Deep-Subsurface Clay Environment,” Applied and Environmental Microbiology, 1996, vol. 62 (9), pp. 3405-3412.
Bolton E.T., et al., “A General Method for the Isolation of RNA Complementary to DNA,” Proceedings of the National Academy of Sciences, 1962, vol. 48, pp. 1390-1397.
Bonk T., et al., “Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry-Based Detection of Microsatellite Instabilities in Coding DNA Sequences: A Novel Approach to Identify DNA-Mismatch Repair-Deficient Cancer Cells,” Clinical Chemistry, 2003, vol. 49 (4), pp. 552-561.
Borrow R., et al., “SiaD PCR Elisa for Confirmation and Identification of Serogroup Y and W135 Meningococcal Infections,” FEMS Microbiology Letters, 1998, vol. 159 (2), pp. 209-214.
Boubaker K., et al., “Panton-Valentine Leukocidin and Staphyloccoccal Skin Infections in Schoolchildren,” Emerging Infectious Diseases, 2004, vol. 10 (1), pp. 121-124.
Bowen J.E., et al., “The Native Virulence Plasmid Combination Affects the Segregational Stability of a Thetareplicating Shuttle Vector in Bacillus anthracis Var,” Journal of Applied Microbiology, 1999, vol. 87 (2), pp. 270-278.
Bowers K.M., et al., “Screening for Methicillin Resistance in Staphylococars aureus and Coagulasenegative Staphylococci: Evaluation of Three Selective and Mestalex-MRSA latex Agglutination,” British Journal of Biomedical Science, 2003, vol. 60 (2), pp. 71-74.
Brakstad O.G., et al., “Direct Identification of Staphylococcus aureus in Blood Cultures Bydetection of the Gene, Encoding the Thermostable Nuclease or the Gene Product,” Acta Pathologica, Microbiologica et Immunologica Scandinavica, 1995, vol. 103 (3), pp. 209-218.
Brakstad O.G., et al., “Multiplex Polymerase Chain Reaction for Detection of Genes for Staphylococcus aureus Themonuclease and Methicillin Resistance and Correlation with Oxacillin Resistance,” Acta Pathologica, Microbiologica et Immunologica Scandinavica, 1993, vol. 101 (9), pp. 681-688.
Brandt C.D., et al., “Infections in 18,000 Infants and Children in a Controlled Study of Respiratory Tract Disease. I. Adenovirus Pathogenicity in Relation to Serologic Type and Illness Syndrome,” American Journal of Epidemiology, 1969, vol. 90 (6), pp. 484-500.
Brayshaw D.P., “Methicillin-Resistant Staphylococcus aureus: Evaluation of Detection Techniques on Laboratory-Passaged Organisms,” British Journal of Biomedical Science, 1999, vol. 56 (3), pp. 170-176.
Brightwell G., et al., “Development of Internal Controls for PCR Detection of Bacillus Anthracis,” Molecular and Cellular Probes, 1998, vol. 12 (6), pp. 367-377.
Brightwell G., et al., “Genetic Targets for the Detection and Identifiaction of Venezuelan Equine Encephalitis Viruses,” Archives of Virology, 1998, vol. 143 (4), pp. 731-742.
Bronzoni R.V.M., et al., “Duplex Reverse Transcription-PCR Followed by Nested PCR Assays for Detection and Identification of Brazilian Alphaviruses and Flaviviruses,” Journal of Clincal Microbiology, 2005, vol. 43 (2), pp. 696-702.
Bronzoni R.V.M., et al., “Multiplex Nested PCR for Brazilian Alphavirus Diagnosis,” Transactions of the Royal Society of Tropical Medicine and Hygiene, 2004, vol. 98 (8), pp. 456-461.
Brown I.H., “Advances in Molecular Diagnostics for Avian Influenza,” Developments in Biologicals, 2006, vol. 124, pp. 93-97.
Brownstein M.J., et al., “Modulation of Non-Templated Nucleotide Addition by Taq DNA Polymerase: Primer Modifications that Facilitate Genotyping,” BioTechniques, 1996, vol. 20 (6), pp. 1004-1010.
Brunaud V., et al., “T-DNA Integration into the Arabidopsis Genome Depends on Sequence of Pre-Insertion Sites,” EMBO Reports, 2002, vol. 3 (12), pp. 1152-1157.
Buck G.A., et al., “Design Strategies and Performance of Custom DNA Sequencing Primers,” BioTechniques, 1999, vol. 27 (3), pp. 528-536.
Buetow K.H., et al., “High-Throughput Development and Characterization of a Genomewide Collection of Gene-Based Single Nucleotide Polymorphism Markers by Chip-Based Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry,” Proceedings of the National Academy of Sciences, 2001, vol. 98 (2), pp. 581-584.
Butel J.S., et al., “Cell and Molecular Biology of Simian Virus 40: Implications for Human Infections and Disease,” Journal of the National Cancer Institute, 1999, vol. 91 (2), pp. 119-134.
Butler J., “DNA Profiling and Quantitation of Human DNA,” CCQM Bio Analysis Working Group, 2005.
Butler J.M., et al., High Throughput Genotyping of Forensic STRs and SNPs using Time-of-Flight Mass Spectrometry, 9th International Symposium on Human Identification, 1998, Orlando FL.
Campbell W.P., et al., “Detection of California Serogroup Bunyavirus in Tissue Culture and Mosquito Pools by PCR,” Journal of Virological Methods, 1996, vol. 57 (2), pp. 175-179.
Carracedo A., et al., “DNA Commission of the International Society for Forensic Genetics: Guidelines Formitochondrial DNA Typing,” Forensic Science International, 2000, vol. 110 (2), pp. 79-85.
Carroll K.C., et al., “Rapid Detection of the Staphylococcal mecA Gene from BACTEC BloodCulture Bottles by the Polymerase Chain Reaction,” American Journal of Clincal Pathology, 1996, vol. 106 (5), pp. 600-605.
Case J.T., et al., “Maternal Inheritance of Mitochondrial DNA Polymorphisms in Cultured Human Fibroblasts,” Somatic Cell Genetics, 1981, vol. 7 (1), pp. 103-108.
Cattoli G., et al., “Comparison of Three Rapid Detection Systems for Type A Influenza Virus on Tracheal Swabs of Experimentally and Naturally Infected Birds,” Avian Pathology, 2004, vol. 33 (4), pp. 432-437.
Cavassini M., et al., “Evaluation of MRSA-Screen, a Simple Anti-PBP 2a Slide Latex AgglutinationKit, for Rapid Detection of Methicillin Resistance in Staphylococcus aureus,” Journal of Clincal Microbiology, 1999, vol. 37 (5), pp. 1591-1594.
Certificate of Correction mailed Jan. 6, 2009 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Certificate of Correction mailed Aug. 7, 2007 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Certificate of Correction mailed Dec. 12, 2006 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Certificate of Correction mailed Jul. 17, 2007 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Certificate of Correction mailed Mar. 31, 2008 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Certificate of Correction mailed Mar. 31, 2008 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Certificate of Correction mailed Mar. 31, 2008 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Cespedes A., et al., “Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Analysis of a Short Fragment of the Cytochrome b Gene for Identification of Flatfish Species,” Journal of Food Protection, 1998, vol. 61 (12), pp. 1684-1685.
Chamberlin M., et al., “New RNA Polymerase from Escerichia coli Infected with Bacteriophage T7,” Nature, 1970, vol. 228 (5268), pp. 227-231.
Chandra S., et al., “Virus Reduction in the Preparation and Intravenous Globulin: In Vitro Experiments,” Transfusion, 1999, vol. 39 (3), pp. 249-257.
Chang P.K., et al., “aflT, a MFS Transporter-Encoding Gene Located in the Aflatoxin Gene Cluster, does not have a Significant Role in Aflatoxin Secretion,” Fungal Genetics and Biology, 2004, vol. 41 (10), pp. 911-920.
Chaves F., et al., “Molecular Characterization of Resistance to Mupirocin in Methicillin-Susceptible and -Resistant Isolates of Staphylococcus aureus from Nasal Samples,” Journal of Clincal Microbiology, 2004, vol. 42 (2), pp. 822-824.
Chelly J., et al., “Transcription of the Dystrophin Gene in Human Muscle and Non-Muscle Tissue,” Nature, 1988, vol. 333 (6176), pp. 858-860.
Chen C.A., et al., “Universal Primers for Amplification of Mitochondrial Small Subunit Ribosomal RNA-Encoding Gene in Scleractinian Corals,” Marine Biotechnology, 2000, vol. 2 (2), pp. 146-153.
Chen C.H., et al., Laser Desorption Mass Spectrometry for FastDNA Sequencing [online], Nov. 1994, Retrieved from the Internet:< URL:http://www.ornl.gove/sci/techresources/Human—Genome/publicat/94SANTA/sequencing/seqtoc.shtml>.
Chen J., et al., “A Universal PCR Primer to Detect Members of the Potyviridae and its Use to Examine the Taxonomic Status of Several Members of the Family,” Archives of Virology, 2001, vol. 146 (4), pp. 757-766.
Chen N., et al., “The Genomic Sequence of Ectromelia Virus, the Causative Agent of Mousepox,” Virology, 2003, vol. 317 (1), pp. 165-186.
Chen R., et al., “Trapping, Detection, and Charge and Mass Measurement of Large Individual Ions (up to 1.1×108 Daltons) by Electrospray Ionization FTICR MS,” 42nd ASMS Conference on Mass Spectrometry, 1994.
Chen Y.Z., et al., “A BAC-Based STS-Content Map Spanning a 35-Mb Region of Human Chromosome 1p35-36,” Genomics, 2001, vol. 74 (1), pp. 55-70.
Chen Z., et al., “Genetic Mapping of the Cold-Adapted Phenotype of B/Ann Arbor/1/66, the Master Donor Virus for Live Attenuated Influenza Vaccines (FluMist),” Virology, 2006, vol. 345 (2), pp. 416-423.
Chiu N.H., et al., “Mass Spectrometry of Single-Stranded Restriction Fragments Captured by an Undigested Complementary Sequence,” Nucleic Acids Research, 2000, vol. 28 (8), pp. E31.
Chmielewicz B., et al., “Development of a PCR-Based Assay for Detection, Quantification, and Genotyping of Human Adenoviruses,” Clinical Chemistry, 2005, vol. 51 (8), pp. 1365-1373.
Cho M., et al., “Application of the Ribonuclease P (RNaseP) RNA Gene Sequence for Phylogenetic Analysis of the Genus Saccharomonospora,” International Journal of Systematic Bacteriology, 1998, vol. 48 (4), pp. 1223-1230.
Choi S., et al., “Real-Time PCR Quantification of Human Adenoviruses in Urban Rivers Indicates Genome Prevalence but Low Infectivity,” Applied and Environmental Microbiology, 2005, vol. 71 (11), pp. 7426-7433.
Choi Y.K., et al., “Detection and Subtying of Swine Influenza H1N1, H1 N2 and H3N2 Viruses in Clinical Samples Using Two Multiplex RT-PCR Assays,” Journal of Virological Methods, 2002, vol. 102 (1-2), pp. 53-59.
Christel L.A., et al., “Rapid, Automated Nucleic Acid Probe Assays Using Silicon Microstructures for Nucleic Acid Concentration,” Journal of Biomechanical Engineering, 1999, vol. 121 (1), pp. 22-27.
Claas E.C., et al., “Internally Controlled Real-Time PCT Monitoring of Adenovirus DNA Load inSerum or Plasma of Transplant Recipients,” Journal of Clincal Microbiology, 2005, vol. 43 (4), pp. 1738-1744.
Cloney L., et al., “Rapid Detection of mecA in Methicillin Resistant Staphylococcus aureus Using Cycling Probe Technology,” Molecular and Cellular Probes, 1999, vol. 13 (13), pp. 191-197.
Collins D.W., et al., “Numerical Classification of Coding Sequences,” Nucleic Acids Research, 1992, vol. 20 (6), pp. 1405-1410.
Conrads G., et al., “16S-23S rDNA Internal Transcribed Spacer Sequences for Analysis of the Phylogenetic Relationships Among Species of the Genus Fusobacterium,” International Journal of Systematic and Evolutionary Microbiology, 2002, vol. 52 (2), pp. 493-499.
Contreras-Salazar B., et al., “Up Regulation of the Epstein-Barr Virus (EBV)-Encoded Membrane Protein LMP in the Burkitt's Lymphoma Line Daudi after Exposure to N-Butyrate and after EBV Superinfection,” Journal of Virology, 1990, vol. 64 (11), pp. 5441-5447.
Co-pending U.S. Appl. No. 10/318,463, filed Dec. 13, 2002.
Co-pending U.S. Appl. No. 10/318,681, filed Dec. 13, 2002.
Co-pending U.S. Appl. No. 10/323,186, filed Dec. 18, 2002.
Co-pending U.S. Appl. No. 10/323,187, filed Dec. 18, 2002.
Co-pending U.S. Appl. No. 10/324,721, filed Dec. 18, 2002.
Co-pending U.S. Appl. No. 10/521,662, filed Jul. 21, 2003.
Co-pending U.S. Appl. No. 10/728,486, filed May 12, 2003.
Co-pending U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Co-pending U.S. Appl. No. 10/807,019, filed Mar. 23, 2004.
Co-pending U.S. Appl. No. 10/845,052, filed May 12, 2004.
Co-pending U.S. Appl. No. 10/964,571, filed Oct. 12, 2004.
Co-pending U.S. Appl. No. 11/209,439, filed Aug. 23, 2005.
Co-pending U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Co-pending U.S. Appl. No. 11/674,538, filed Feb. 13, 2007.
Co-pending U.S. Appl. No. 11/682,259, filed Mar. 5, 2007.
Co-pending U.S. Appl. No. 11/929,910, filed Oct. 30, 2007.
Co-pending U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
Co-pending U.S. Appl. No. 11/930,741, filed Oct. 31, 2007.
Co-pending U.S. Appl. No. 90/010,209, filed Jun. 27, 2008.
Co-pending U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Co-pending U.S. Appl. No. 60/639,068, filed Dec. 22, 2004.
Co-pending U.S. Appl. No. 60/648,188, filed Jan. 28, 2005.
Co-pending U.S. Appl. No. 60/369,405, filed Apr. 1, 2002.
Co-pending U.S. Appl. No. 60/397,365, filed Jul. 9, 2002.
Co-pending U.S. Appl. No. 60/431,319, filed Dec. 6, 2002.
Co-pending U.S. Appl. No. 60/443,443, filed Jan. 29, 2003.
Co-pending U.S. Appl. No. 60/443,788, filed Jan. 30, 2003.
Co-pending U.S. Appl. No. 60/447,529, filed Feb. 14, 2003.
Co-pending U.S. Appl. No. 60/453,607, filed Mar. 10, 2003.
Co-pending U.S. Appl. No. 60/461,494, filed Apr. 9, 2003.
Co-pending U.S. Appl. No. 60/470,175, filed May 12, 2003.
Co-pending U.S. Appl. No. 60/501,926, filed Sep. 11, 2003.
Co-pending U.S. Appl. No. 60/509,911, filed Oct. 9, 2003.
Co-pending U.S. Appl. No. 60/604,329, filed Aug. 24, 2004.
Co-pending U.S. Appl. No. 60/615,387, filed Sep. 30, 2004.
Co-pending U.S. Appl. No. 60/632,862, filed Dec. 3, 2004.
Co-pending U.S. Appl. No. 60/658,248, filed Mar. 3, 2005.
Co-pending U.S. Appl. No. 60/701,404, filed Jul. 21, 2005.
Co-pending U.S. Appl. No. 60/705,631, filed Aug. 3, 2005.
Co-pending U.S. Appl. No. 60/720,843, filed Sep. 27, 2005.
Co-pending U.S. Appl. No. 60/747,607, filed May 18, 2006.
Co-pending U.S. Appl. No. 60/771,101, filed Feb. 6, 2006.
Co-pending U.S. Appl. No. 60/773,124, filed Feb. 13, 2006.
Co-pending U.S. Appl. No. 60/891,479, filed Feb. 23, 2007.
Co-pending U.S. Appl. No. 60/941,641, filed Jun. 1, 2007.
Cornel A.J., et al., “Polymerase Chain Reaction Species Diagnostic Assay for Anopheles Quadrimaculatus Cryptic Species (Diptera:Culicidae) Based on Ribosomal DNA ITS2 Sequences,” Journal of Medical Entomology, 1996, vol. 33 (1), pp. 109-116.
Couto I., et al., “Development of Methicillin Resistance in Clinical Isolates of Staphylococcus sciuri by Transcriptional Activation of the mecA Homologue Native to the Species,” Journal of Bacteriology, 2003, vol. 185 (2), pp. 645-653.
Crain P.F., et al., “Applications of Mass Spectrometry to the Characterization of Oligonucleotides and Nucleic Acids,” Current Opinion in Biotechnology, 1998, vol. 9 (1), pp. 25-34.
Crawford-Miksza L., et al., “Analysis of 15 Adenovirus Hexon Proteins Reveals the Location and Structure of Seven Hypervariable Regions Containing Serotype-Specific Residues,” Journal of Virology, 1996, vol. 70 (3), pp. 1836-1844.
Crawford-Miksza L.K., et al., “Adenovirus Serotype Evolution is Driven by Illegitimate Recombination in the Hypervariable Regions of the Hexon Protein,” Virology, 1996, vol. 224 (2), pp. 357-367.
Crawford-Miksza L.K., et al., “Strain Variation in Adenovirus Serotypes 4 and 7a Causing Acute Respiratory Disease,” Journal of Clincal Microbiology, 1999, vol. 37 (4), pp. 1107-1112.
Crespillo M., et al., “Mitochondrial DNA Sequences for 118 Individuals from Northeastern Spain,” International Journal of Legal Medicine, 2000, vol. 114 (1-2), pp. 130-132.
Cui L., et al., “Contribution of a Thickened Cell Wall and Its Glutamine Nonamidated Component to the Vancomycin Resistance Expressed by Staphylococcus aureus Mu50,” Antimicrobial Agents and Chemotherapy, 2000, vol. 44 (9), pp. 2276-2285.
Dasen G., et al., “Classification and Identification of Propiolbacteria based on Ribosomal RNA Genes and PCR,” Systematic and Applied Microbiology, 1998, vol. 21 (2), pp. 251-259.
De Jong J.C., et al., “Adenoviruses from Human Immunodeficiency Virus-Infected Individuals, Including Two Strains that Represent New Candidate Serotypes Ad50 and Ad51 of Species B1 and D, Respectively,” Journal of Clincal Microbiology, 1999, vol. 37 (12), pp. 3940-3945.
De La Puente-Redondo V.A., et al., “Comparison of Different PCR Approaches for Typing of Francisella Tularensis Strains,” Journal of Clinical Microbiology, 2000, vol. 38 (3), pp. 1016-1022.
Deforce D.L., et al., “Analysis of Oligonucleotides by ESI-MS,” Advances in Chromatography, 2000, vol. 40, pp. 539-566.
Deforce D.L.D., et al., “Characterization of DNA Oligonudeotides by Coupling of Capillary zone Electrophoresis to Electrospray Ionization Q-TOF Mass Spectrometry,” Analytical Chemistry, 1998, vol. 70 (14), pp. 3060-3068.
Del Blanco Garcia N., et al., “Genotyping of Francisella Tularensis Strains by Pulsed-field gel Electrophoresis, Amplified Fragment Length Polymorphism Fingerprinting, and 16S rRNA gene Sequencing,” Journal of Clinical Microbiology, 2002, vol. 40 (8), pp. 2964-2972.
Del Vecchio V.G., et al., “Molecular Genotyping of Methicillin-Resistant Staphylococcus aureus via Fluorophore-Enhanced Repetitive-Sequence PCR,” Journal of Clincal Microbiology, 1995, vol. 33 (8), pp. 2141-2144.
Demesure B., et al., “A Set of Universal Primers for Amplification of Polymorphic Non-Coding Regions of Mitochondrial and Chioroplast DNA in Plants,” Molecular Ecology, 1995, vol. 4, pp. 129-131.
Denis M., et al., “Development of a Semiquantitative PCR Assay Using Internal Standard and Colorimetricdetection on Microwell Plate for Pseudorabies Virus,” Molecular and Cellular Probes, 1997, vol. 11 (6), pp. 439-448.
Deurenberg R.H., et al., “Rapid Detection of Panton-Valentine Leukocidin from Clinical Isolates of Staphylococcus aureus Strains by Real-Time PCR,” FEMS Microbiology Letters, 2004, vol. 240 (2), pp. 225-228.
Deurenberg R.H., et al., “The Prevalence of the Staphylococcus aureus tst Gene among Community- and Hospital-Acquired Strains and Isolates from Wegener's Granulomatosis Patients,” FEMS Microbiology Letters, 2005, vol. 245 (1), pp. 185-189.
Deyde V.M., et al., “Genomic Signature-Based Identification of Influenza A Viruses Using RT-PCR/Electro-Spray Ionization Mass Spectrometry (ESI-MS) Technology,” PLoS One, 2010, vol. 5 (10), pp. e13293.
Di Guilmi A.M., et al., “Human Adenovirus Serotype 3 (Ad3) and the Ad3 fiber Protein Bind to a 130-kDa Membrane Protein on HLa Cells,” Virus Research, 1995, vol. 38 (1), pp. 71-81.
Dias Neto E., et al., “Shotgun Sequencing of the Human Transcriptome with ORF Expressed Sequence Tags,” Proceedings of the National Academy of Sciences, 2000, vol. 97 (7), pp. 3491-3496.
Diep B.A., et al., “Complete Genome Sequence of USA300, an Epidemic Clone of Community Acquired Meticillin-Resistant Staphylococcus aureus,” Lancet, 2006, vol. 367 (9512), pp. 731-739.
Dinauer D.M., et al., “Sequence-Based Typing of HLA Class II DQB1,” Tissue Antigens, 2000, vol. 55 (4), pp. 364-368.
Ding C., et al., “A High-Throughput Gene Expression Analysis Technique Using Compettiive PCR and Matrixassisted Laser Desorption Ionization Time-of-Flight MS,” Proceedings of the National Academy of Sciences, 2003, vol. 100 (6), pp. 3059-3064.
Donehower L.A., et al., “The Use of Primers from Highly Conserved Pol Regions to Identify Uncharacterized Retroviruses by the Polymerase Chain Reaction,” Journal of Virological Methods, 1990, vol. 28 (1), pp. 33-46.
Donofrio J.C., et al., “Detection of Influenza A and B in Respiratory Secretions with the Polymerase Chain Reaction,” PCR Methods and Applications, 1992, vol. 1 (4), pp. 263-268.
Doty P., et al., “Strand Separation and Specific Recombination in Deoxyribonucleic Acids: Physical Chemical Studies,” Proceedings of the National Academy of Sciences, 1960, vol. 46 (4), pp. 461-476.
Drosten C., et al., “Identification of a Novel Coronavirus in Patients with Severe Acute Respiratory Syndrome,” New England Journal of Medicine, 2003, vol. 348 (20), pp. 1967-1976.
Dubernet S., et al., “A PCR-Based Method for Identification of Lactobacilli at to Genus Level,” FEMS Microbiology Letters, 2002, vol. 214 (2), pp. 271-275.
Ebner K., et al., “Molecular Detection and Quantitative Analysis of the Entire Spectrum of Human Adenoviruses by a Two-Reaction Real-Time PCR Assay,” Journal of Clinical Microbiology, 2005, vol. 43 (7), pp. 3049-3053.
Ebner K., et al., “Typing of Human Adenoviruses in Specimens from Immunosuppressed Patients by PCR-Fragment Length Analysis and Real-Time Quantitative PCR,” Journal of Clinical Microbiology, 2006, vol. 44 (8), pp. 2808-2815.
Echavarria M., et al., “Detection of Adenoviruses (AdV) in Culture-Negative EnvironmentalSamples by PCR During an AdV-Associated Respiratory Disease Outbreak,” Journal of Clinical Microbiology, 2000, vol. 38 (8), pp. 2982-2984.
Echavarria M., et al., “PCR Method for Detection of Adenovirus in Urine of Healthy and Human Immunodeficiency Virus-Infected Individuals,” Journal of Clinical Microbiology, 1998, vol. 36 (11), pp. 3323-3326.
Echavarria M., et al., “Prediction of Severe Disseminated Adenovirus Infection by Serum PCR,” Lancet, 2001, vol. 358 (9279), pp. 384-385.
Echavarria M., et al., “Rapid Detection of Adenovirus in Throat Swab Specimens by PCR During Respiratory Disease Outbreaks among Military Recruits,” Journal of Clinical Microbiology, 2003, vol. 41 (2), pp. 810-812.
Echavarria M., et al., “Use of PCR to Demonstrate Presence of Adenovirus Species B, C, or F as Well as Coinfection with Two Adenovirus Species in Children with Flu-Like Symptoms,” Journal of Clinical Microbiology, 2006, vol. 44 (2), pp. 625-627.
Ecker D.J., et al., “Ibis T5000: A Universal Biosensor Approach for Microbiology,” Nature Reviews Microbiology, 2008, vol. 6 (7), pp. 553-558.
Ecker D.J., et al., “Rapid Identification and Strain-Typing of Respiratory Pathogens for Epidemic Surveillance,” Proceedings of the National Academy of Sciences, 2005, vol. 102 (22), pp. 8012-8017.
Ecker D.J., et al., “The Ibis T5000 Universal Biosensor. An Automated Platform for Pathogen Identification and Strain Typing,” Journal of the Association for Laboratory Automation, 2006, vol. 11 (6), pp. 341-351.
Edwards K.M., et al., “Adenovirus Infections in Young Children,” Pediatrics, 1985, vol. 76 (3), pp. 420-424.
Ellis J.S., et al., “Molecular Diagnosis of Influenza,” Reviews in Medical Virology, 2002, vol. 12 (6), pp. 375-389.
Ellis J.S., et al., “Multiplex Reverse Transcription-PCR for Surveillance of Influenza A and B Viruses in England and Wales in 1995 and 1996,” Journal of Clinical Microbiology, 1997, vol. 35(8), pp. 2076-2082.
Elnifro E.M., et al., “PCR and Restriction Endonuclease Analysis for Rapid Identification of Adenovirus Subgenera,” Journal of Clinical Microbiology, 2000, vol. 38 (6), pp. 2055-2061.
Elsayed S., et al., “Development and Validation of a Molecular Beacon Probe-Based Real-Time Polymerase Chain Reaction Assay for Rapid Detection of Methicillin Resistance in Staphylococcus aureus,” Archives of Pathology and Laboratory Medicine, 2003, vol. 127 (7), pp. 845-849.
EMBL “Arabidopsis Thaliana T-DNA Flanking Sequence, Left Border, Clone 346C06,” Accession No. AJ552897, Mar. 29, 2003.
EMBL “Dog (Clone: CXX.147) Primer for STS 147, 3″ End, Sequence Tagged Site,” Accession No. L15697, Mar. 4, 2000.
EMBL “Sequence 10 from U.S. Pat. No. 6,563,025,” Accession No. AR321656, Aug. 18, 2003.
EMBL “Human, muscle, Mitochondrial Mutant, 22 nt, segment 2 of 2,” Accession No. S90302, Sep. 1, 2004.
EMBL “Mastadenovirus h7 Hexon Gene,” Accession No. Z48571, Apr. 18, 2005.
EMBL “Synthetic Construct DNA, Reverse Primer for Human STS sts-AA031654 at 1p36” Accession No. AB068711, May 21, 2003.
Enright M.C., et al., “A Multilocus Sequence Typing Scheme for Streptococcus pneumoniae: Identification of Clones Associated with Serious Invasive Disease,” Microbiology, 1998, vol. 144 (Pt 11), pp. 3049-3060.
Enright M.C., et al., “Multilocus Sequence Typing for Characterization of Methicillin-Resistant and Methicillin-Susceptible Clones of Staphylococcus aureus,” Journal of Clinical Microbiology, 2000, vol. 38 (3), pp. 1008-1015.
Enright M.C., et al., “Multilocus Sequence Typing of Streptococcus pyogenes and theRelationships between Emm Type and Clone,” Infection and Immunity, 2001, vol. 69 (4), pp. 2416-2427.
Enright M.C., et al., “The Evolutionary History of Methicillin-Resistant Staphylococcus aureus (MRSA),” Proceedings of the National Academy of Sciences, 2002, vol. 99 (11), pp. 7687-7692.
Enright M.C., “The Evolution of a Resistant Pathogen—the Case of MRSA,” Current Opinion in Pharmacology, 2003, vol. 3 (5), pp. 474-479.
Eremeeva M.E., et al., “Evaluation of a PCR Assay for Quantitation of Rickettsia rickettsii and Closely Related Spotted Fever Group Rickettsiae,” Journal of Clinical Microbiology, 2003, vol. 41 (12), pp. 5466-5472.
Erlich H.A., Ed., PCR Technology: Principles and Applications for DNA Amplification, W.H. Freeman and Company, 1989.
Esmans E.L., et al., “Liquid Chromatography-Mass Spectrometry in Nucleoside, Nucleotide and Modified Nucleotide Characterization,” Journal of Chromatography, 1998, vol. 794, pp. 109-127.
Eugene-Ruellan G., et al., “Detection of Respiratory Syncytial Virus A and B and Parainfluenzavirus 3 Sequences in Respiratory Tracts of Infants by a Single PCR with Primers Targeted to the L-Polymerase Gene and Differential Hybridization,” Journal of Clinical Microbiology, 1998, vol. 36 (3), pp. 796-801.
European Search Report for Application No. EP020002521, mailed on Oct. 27, 2003, 5 pages.
European Search Report for Application No. EP10175659.1, mailed on Feb. 9, 2011, 4 pages.
Evans P., et al., “Practical Algorithms for Universal DNA Primer Design: An Exercise in Algorithm Engineering,” Currents in Computational Molecular Biology, 2001, pp. 25-26.
Ex Parte Re-Examination Certificate for U.S. Appl. No. 90/010,209 mailed Jul. 7, 2009.
Ex Parte Re-Examination Certificate for U.S. Appl. No. 90/010,210, mailed Dec. 28, 2010.
Ex Parte Re-Examination Certificate for U.S. Appl. No. 90/010,447 mailed Feb. 15, 2011.
Examiner Interview Summary Report mailed Oct. 3, 2005 for U.S. Appl. No. 10/326,046, filed Dec. 18, 2002.
Examiner Interview Summary Report mailed Nov. 6, 2008 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Examiner Interview Summary Report mailed Jun. 7, 2011 for U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
Examiner Interview Summary Report mailed Aug. 10, 2004 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Examiner Interview Summary Report mailed Aug. 10, 2004 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Examiner Interview Summary Report mailed Aug. 10, 2004 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Examiner Interview Summary Report mailed Aug. 10, 2004 for U.S. Appl. No. 10/326,642, filed Dec. 18, 2002.
Examiner Interview Summary Report mailed May 19, 2003 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Examiner Interview Summary Report mailed Oct. 24, 2008 for U.S. Appl. No. 11/582,859, filed Oct. 17, 2006.
Examiner Interview Summary Report mailed Oct. 24, 2008 for U.S. Appl. No. 11/582,930, filed Oct. 17, 2006.
Examiner Interview Summary Report mailed Feb. 27, 2006 for U.S. Appl. No. 10/326,644, filed Dec. 18, 2002.
Examiner Interview Summary Report mailed Jan. 27, 2006 for U.S. Appl. No. 10/323,211, filed Dec. 18, 2002.
Examiner Interview Summary Report mailed May 28, 2008 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Examiner Interview Summary Report mailed Oct. 28, 2008 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Examiner Interview Summary Report mailed Oct. 29, 2008 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Examiner Interview Summary Report mailed Oct. 29, 2009 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Examiner Interview Summary Report mailed Jul. 31, 2006 for U.S. Appl. No. 10/326,643, filed Dec. 18, 2002.
Extended European Search Report for Application No. EP10175659.1, mailed on Feb. 21, 2011, 8 pages.
Extended European Search Report for Application No. EP10179789.2, mailed on Mar. 22, 2011, 9 pages.
Extended European Search Report for Application No. EP10179791.8, mailed on Mar. 17, 2011, 7 pages.
Extended European Search Report for Application No. EP10179795.9, mailed on Mar. 22, 2011, 9 pages.
Facklam R., et al., “Emm Typing and Validation of Provisional M Types for Group A Streptococci,” Emerging Infectious Diseases, 1999, vol. 5 (2), pp. 247-253.
Fang H., et al., “Rapid Screening and Identification of Methicillin-Resistant Staphylococcus aureus from Clinical Samples by Selective-Broth and Real-Time PCR Assay,” Journal of Clinical Microbiology, 2003, vol. 41 (7), pp. 2894-2899.
Farlow J., et al., “Francisella Tularensis Strain Typing Using Multiple-Locus, Variable-Number Tandem Repeat Analysis,” Journal of Critical Microbiology, 2001, vol. 39 (9), pp. 3186-3192.
Farrell D.J., “The Reliability of Microscan Conventional and Rapid Panels to Identify Staphylococcus aureus and Detect Methicillin Resistance: An Evaluation Using the Tube Coagulase Test and mecA PCR,” Pathology, 1997, vol. 29 (4), pp. 406-410.
Fedele C.G., et al., “Multiplex Polymerase Chain Reaction for the Simultaneous Detection and Typing of Polyomavirus JC, BK and SV40 DNA in Clinical Samples,” Journal of Virological Methods, 1999, vol. 82 (2), pp. 137-144.
Fedele C.G., et al., “Quantitation of Polyomavirus DNA by a Competitive Nested Polymerase Chain Reaction,” Journal of Virological Methods, 2000, vol. 88 (1), pp. 51-61.
Feng P., “Impact of Molecular Biology on the Detection of Food Pathogens,” Molecular Biotechnology, 1997, vol. 7 (3), pp. 267-278.
Figueiredo L.M., et al., “Identification of Brazilian Flavivirus by a Simplified Reverse Transcription-Polymerase Chain Reaction Method Using Flavivirus Universal Primers,” American Journal of Tropical Medicine and Hygiene, 1998, vol. 59 (3), pp. 357-362.
Final Office Action mailed Aug. 6, 2010 for U.S. Appl. No. 11/929,910, filed Oct. 30, 2007.
Final Office Action mailed Jul. 8, 2010 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Final Office Action mailed May 12, 2010 for U.S. Appl. No. 11/674,538, filed Feb. 13, 2007.
Final Office Action mailed Apr. 14, 2011 for U.S. Appl. No. 12/049,949, filed Mar. 17, 2008.
Final Office Action mailed Jun. 14, 2011 for U.S. Appl. No. 12/616,422, filed Nov. 11, 2009.
Final Office Action mailed Oct. 14, 2009 for U.S. Appl. No. 10/943,344, filed Sep. 17, 2004.
Final Office Action mailed Nov. 17, 2009 for U.S. Appl. No. 11/582,875, filed Oct. 17, 2006.
Final Office Action mailed Feb. 18, 2010 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Final Office Action mailed Nov. 20, 2009 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Final Office Action mailed Jun. 23, 2010 for U.S. Appl. No. 11/930,017, filed Oct. 30, 2007.
Final Office Action mailed Feb. 26, 2009 for U.S. Appl. No. 11/582,863, filed Oct. 17, 2006.
Final Office Action mailed Jan. 30, 2009 for U.S. Appl. No. 10/844,938, filed May 12, 2004.
Final Office Action mailed Jun. 30, 2008 for U.S. Appl. No. 11/070,632, filed Mar. 2, 2005.
Flora J.W., et al, “Dual-Micro-ESI Source for Precise Mass Determination on a Quadrupole Time-of-Flight Mass Spectrometer for Genomic and Proteomic Applications,” Analytical and Bioanalytical Chemistry, 2002, vol. 373 (7), pp. 538-546.
Fong W.K., et al., “Rapid Solid-Phase Immunoassay for Detection of Methicillin-ResistantStaphylococcus aureus Using Cycling Probe Technology,” Journal of Clinical Microbiology, 2000, vol. 38 (7), pp. 2525-2529.
Fox A., et al., “Identification and Detection of Bacteria: Electrospray MS-MS Versus Derivatization/GC-MS,” Proceedings of the ERDEC Scientific Conference on Chemical and Biological Defense Research, Aberdeen Proving Ground, MD, Nov. 15-18, 1994, pp. 39-44.
Fox A., et al., “Report of the Bioterrorism Workshop,” Journal of Microbiological Methods, 2002, vol. 51 (3), pp. 247-254.
Fox J.P., et al., “The Virus Watch Program: A Continuing Surveillance of Viral Infections in Metropolitan New York Families,” American Journal of Epidemiology, 1969, vol. 89 (1), pp. 25-50.
Fox K.F., et al., “Identification of Brucella by Ribosomal-Spacer-Region PCR and Differentiation of Brucell canis from Other Brucella Spp. Pathogenic for Humans by Carbohydrate Profiles,” Journal of Clinical Microbiology, 1998, vol. 36 (11), pp. 3217-3222.
Francois J.C., et al., “Sequence-Specific Recognition and Cleavage of Duplex DNA via Triple-Helix Formation by Oligonucleotides Covalently Linked to a Phenanthroline-Copper Chelate,” Proceedings of the National Academy of Sciences, 1989, vol. 86 (24), pp. 9702-9706.
Francois P., et al., “Rapid Detection of Methicillin-Resistant Staphylococcus aureus Directly from Sterile or Nonsterile Clinical Samples by a New Molecular Assay,” Journal of Clinical Microbiology, 2003, vol. 41 (1), pp. 254-260.
Fraser C.M., et al., “The Mimimal Gene Complement of Mycoplasma Genitalium,” Science, 1995, vol. 270 (5235), pp. 397-403.
Freiberg C., et al., “Genome-Wide mRNA Profiling: Impact on Compound Evaluation and Target Identification in Anti-Bacterial Research,” Targets, 2002, vol. 1 (1), pp. 20-29.
Freymuth F., et al., “Comparison of Multiplex PCR Assays and Conventional Techniques for the Diagnostic of Respiratory Virus Infections in Children Admitted to Hospital With an Acute Respiratory Illness,” Journal of Medical Virology, 2006, vol. 78 (11), pp. 1498-1504.
Freymuth F., et al., “Detection of Respiratory Syncytial Virus, Parainfluenzavirus 3, Adenovirus Andrhinovirus Sequences in Respiratory Tract of Infants by Polymerase Chain Reaction and Hybridization,” Clinical and Diagnostic Virology, 1997, vol. 8 (1), pp. 31-40.
Fuerstenau S.D., et al., “Molecular Weight Determination of Megadalton DNA Electrospray Ions Using Charge Detection Time-of-flight Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1995, vol. 9 (15), pp. 1528-1538.
Fujimoto T., et al., “Single-Tube Multiplex. PCR for Rapid and Sensitive Diagnosis of Subgenus B and Other Subgenera Adenoviruses in Clinical Samples,” Microbiology and Immunology, 2000, vol. 44 (10), pp. 821-826.
Fujimura S., et al., “Characterization of the mupA Gene in Strains of Methicillin-Resistant Staphylococcus aureus with a Low Level of Resistance to Mupirocin,” Antimicrobial Agents and Chemotheraphy, 2001, vol. 45 (2), pp. 641-642.
Fujimura S., et al., “Isoleucyl-tRNA Synthetase Mutations in Staphylococcus aureus Clinicallsolates and In Vitro Selection of Low-Level Mupirocin-Resistant Strains,” Antimicrobial Agents and Chemotheraphy, 2003, vol. 47 (10), pp. 3373-3374.
Fujioka S., et al., “Analysis of Enterovirus Genotypes using Single-Strand Conformation Polymorphisms of Polymerase Chain Reaction Product,” Journal of Virological Methods, 1995, vol. 51 (2-3), pp. 253-258.
Gabriel M.N., et al., “Improved mtDNA Sequence Analysis of Forensic Remains using a “Mini-Primer Set” Amplification Strategy,” Journal of Forensic Sciences, 2001, vol. 46 (2), pp. 247-253.
Gall J.G., et al., “Construction and Characterization of Hexon-Chimeric Adenoviruses: Specification of Adenovirus Serotype,” Journal of Virology, 1998, vol. 72 (12), pp. 10260-10264.
Gammelin M., et al., “Two Subtypes of Nucleoproteins (NP) of Influenza A Viruses,” Virology, 1989, vol. 170 (1), pp. 71-80.
Garcia S., et al., “Quantitative Real-Time PCR Detection of Rift Valley Fever Virus and Its Application to Evaluation of Antiviral Compounds,” Journal of Clinical Microbiology, 2001, vol. 39 (12), pp. 4456-4461.
Garcia-Martinez J., et al., “Use of the 16s-23s Ribosomal Genes Spacer Region in Studies of Prokaryotic Diversity,” Journal of Microbiological Methods, 1999, vol. 36 (1-2), pp. 55-64.
Gattermann N., et al., “Heteroplasmic Point Mutations of Mitochondrial DNA Affecting Subunit I of Cytochrome c Oxidise in Two Patients with Acquired Idiopathic Siderblastic Anemia,” Blood, 1997, vol. 90 (12), pp. 4961-4972.
Gaydos C.A., et al., “Adenovirus Vaccines in the U.S. Military,” Military Medicine, 1995, vol. 160 (6), pp. 300-304.
Geha D.J., et al., “Multiplex PCR for Identification of Methicillin-Resistant Staphylococci in the Clinical Laboratory,” Journal of Clinical Microbiology, 1994, vol. 32 (7), pp. 1768-1772.
GenBank, “Acinetobacter Genomosp. 10 Strain CIP 70.12 RNA Polymerase Subunit B (rpoB) Gene, Complete Cds,” Accession No. 78099429, Mar. 11, 2006.
GenBank, “Bovine Parainfluenza Virus 3 Strain Shipping Fever, Complete Genome,” Accesion No. AF178655, Sep. 19, 2000.
GenBank, “Clostridium Tetani E88, Complete Genome,” Accession No. AE015927.1, Feb. 4, 2003.
GenBank, “{Deletion 6} [Human, Muscle, Mitochondrial Mutant, 22 nt, Segment 2 of 2],” Accession No. S90302.1, Jun. 10, 1992.
GenBank, “E. coli Operon rpoBC Coding for the Beta- and Beta″-Subunits of RNA Polymerase (Genes rpoC and rpoB), and Genes rplL, rlpJ, rplA, and rplK Coding for 50S Ribosomal Subunit Proteins L7/L12, L10, L1, and L11, Respectively. (Map position 89-90 min.),” Accession No. 42813, Feb. 28, 1992.
GenBank, “E.coli 16S Ribosomal RNA,” Accession No. 174375, Aug. 11, 1995.
GenBank, “E.coli Open Reading Frame Upstream of Leu Operon,” Accession No. M21150, Sep. 15, 1990.
GenBank, “E.coli rRNA Operon (rrnB) Coding for Glu-tRNA-2, 5S, 16S and 23S rRNA,” Accession No. 147581, Sep. 14, 1992.
GenBank, “Enterococcus Malodoratus Strain ATCC43197 Elongation Factor Tu (tufA) Gene, Partial Cds,” Accession No. AF274728, Dec. 11, 2000.
GenBank “Escherichia coli str. K-12 substr. MG1655, Complete Genome,” Accession No. NC000913, Oct. 15, 2001.
GenBank, “Homo sapiens Haplotype V Mitochondrion, Complete Genome”, Accession No. AF381990.1, Dec. 28, 2001.
GenBank, “Human Adenovirus Type 4 Hexon Gene,” for Accession No. X84646, Jun. 30, 1995.
GenBank, “Human Coronavirus 229E, Complete Genome,” Accession No. AF304460, Jul. 11, 2001.
GenBank, “Human Isolate L34 Mitochondrion D-loop Region”, Accession No. U08081.1, Aug. 16, 1994.
GenBank, “il11b08.y1 Human insulinoma Homo sapiens cDNA clone IMAGE:6029534 5—similar to SW:COX3—HUMAN P00414 Cytochrome C Oxidase Polypeptide III ;, mRNA sequence”, Accession No. BQ581956.1, Jun. 20, 2002.
GenBank, “Influenza B Virus B/Panama/45/90 Polymerase (PB2) mRNA, Complete Cds”, Accession No. AF005737, Oct. 4, 1997, pp. 1-3.
GenBank, “Mastadenovirus h7 Hexon Gene,” Accession No. Z48571, Apr. 18, 2005.
GenBank, “or72a01.s1 NCI—CGAP—Lu5 Homo sapiens cDNA Clone IMAGE:1601352 3—-similar to SW:COX1—HUMAN P00395 Cytochrome C Oxidase Polypeptide I ;, mRNA sequence”, Accession No. AI002209.1, Jun. 10, 1998.
GenBank “Staphylococcus aureus RN4220 ErmC Gene, Partial Cds,” Accession No. 18542231, Sep. 16, 2003.
GenBank “Staphylococcus aureus Strain MSSA476, Complete Genome,” Accession No. BX571857.1, Jun. 24, 2004.
GenBank, “Staphylococcus aureus Subsp. aureus Mu50, Complete Genome,” Accession No. 15922990, Oct. 4, 2001.
GenBank “Staphylococcus aureus Subsp. aureus MW2, Complete Genome,” Accession No. GI21281729, May 31, 2002.
GenBank, “Staphylococcus epidermidis ATCC 12228, Complete Genome,” Accession No. AE015929.1, Jan. 2, 2003.
GenBank “Streptococcus agalactiae 2603V/R, Complete Genome,” Accession No. AE009948.1, Aug. 28, 2002.
GenBank, “Streptococcus anginosus Elongation Factor Tu (tuf) Gene, Partial cds,” Accession No. AF276257.1, Jul. 1, 2001.
GenBank, “Streptococcus pneumoniae Isolate 95.1In00S DNA Gyrase Subunit B (gyrB) Gene, Complete Cds,” Accession No. 73916349, Sep. 30, 2005.
GenBank, “Streptococcus pyogenes Strain MGAS8232, Complete Genome,” Accession No. AE009949.1, Apr. 3, 2002.
Genbank, “Venezuelan Equine Encephalitis Virus Nonstructural Polyprotein and Structural Polyprotein Genes, Complete Cds,” Accession No. AF375051.1, Jun. 26, 2001.
Gendel S.M., “Computational Analysis of the Specificity of 16S rRNA-Derived Signature Sequencesfor Identifying Food-Related Microbes,” Food Microbiology, 1996, vol. 13, pp. 1-15.
GeneSEQ, “Bacterial DNA PCR primer SEQ ID No. 874”, Accession No. AEM14131, Jan. 11, 2007.
Gibb T.R., et al., “Development and Evaluation of a 5″ Fluorogenic Nuclease Assay to Detect and Differentiate Between Ebola Virus Subtypes Zaire and Sudan,” Journal of Clinical Microbiology, 2001, vol. 39 (11), pp. 4125-4130.
Gilbert N., et al., “Comparison of Commercial Assays for the Quantitation of HBV DNA Load in Healthcare Workers: Calibration Differences,” Journal of Virological Methods, 2002, vol. 100 (1-2), pp. 37-47.
Giles R.E., et al., “Maternal Inheritance of Human Mitochondrial DNA,” Proceedings of the National Academy of Sciences, 1980, vol. 77 (11), pp. 6715-6719.
Gill S.R., et al., “Insights on Evolution of Virulence and Resistance from the Complete Genome Analysis of an Early Methicillin-Resistant Staphylococcus aureus Strain and a Biofilm-Producing Methicillin-Resistant Staphylococcus epidemidis Strain,” Journal of Bacteriology, 2005, vol. 187 (7), pp. 2426-2438.
Gilliland G., et al., “Analysis of Cytokine mRNA and DNA: Detection and Quantitation by Competitive Polymerase Chain Reaction,” Proceedings of the National Academy of Sciences, 1990, vol. 87 (7), pp. 2725-2729.
Ginther C., et al., “Identifying Individuals by Sequencing Mitochondrial DNA from Teeth,” Nature Genetics, 1992, vol. 2 (2), pp. 135-138.
Gjoen K.V., et al., “Specific Detection of Coxsackie Viruses A by the Polymerase Chain Reaction,” Clinical and Diagnostic Virology, 1997, vol. 8 (3), pp. 183-188.
Golden M.R., et al., “Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia Trachomatis,” Journal of Clinical Microbiology, 2003, vol. 41 (5), pp. 2174-2175.
Goto K., et al., “Applications of the Partial 16S rDNA Sequence as an Index for Rapid Identification of Species in the Genus Bacillus,” Journal of General and Applied Microbiology, 2000, vol. 46 (1), pp. 1-8.
Gravet A., et al., “Characterization of a Novel Structural Member, LukE-LukD, of the Bi-Component Staphylococcal Leucotoxins Family,” FEBS Letters, 1998, vol. 436 (2), pp. 202-208.
Gray G.C., et al., “Adult Adenovirus Infections: Loss of Orphaned Vaccines Precipitates Military Respiratory Disease Epidemics,” Clinical Infectious Diseases, 2000, vol. 31, pp. 663-670.
Greenberg B.D., et al., “Intraspecific Nucleotide Sequence Variability Surrounding the Origin of Replicationin Human Mitochondrial DNA,” Gene, 1983, vol. 21, pp. 33-49.
Griffey, et al., “Detection of Base Pair Mismatches in Duplex DNA and RNA Oligonucleotides Using Electrospray Mass Spectrometry,” SPIE, 1997, vol. 2985, pp. 82-86.
Griffin T.J., et al., “Direct Genetic Analysis by Matrix-Assisted Laseer Desorption/Ionization Mass Spectrometry,” Proceedings of the National Academy of Sciences, 1999, vol. 96 (11), pp. 6301-6306.
Griffin T.J., et al., “Single-Nucleotide Polymorphism Analysis by Maldi-TOF Mass Spectrometry,” Trends in Biotechnology, 2000, vol. 18 (2), pp. 77-84.
Grondahl B., et al., “Rapid Identification of Nine Microorganisms Causing Acute Respiratory TractInfections by Single-Tube Multiplex Reverse Transcription-PCR: Feasibility Study,” Journal of Clinical Microbiology, 1999, vol. 37 (1), pp. 1-7.
Grundmann H., et al., “Emergence and Resurgence of Meticillin-Resistant Staphylococcus aureus as a Public-Health Threat,” Lancet, 2006, vol. 368 (9538), pp. 874-885.
Grzybowski T., et al., “Extremely High Levels of Human Mitochondrial DNA Heteroplasmy in Single Hair Roots,” Electrophoresis, 2000, vol. 21 (3), pp. 548-553.
Gu Z., et al., “Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus,” Journal of Clinical Microbiology, 2003, vol. 41 (10), pp. 4636-4641.
Guatelli J.C., et al., “Nucleic Acid Amplification In Vitro: Detection of Sequences with Low Copy Numbers and Application to Diagnosis of Human Immunodeficiency Virus Type 1 Infection,” Clinical Microbiology Reviews, 1989, vol. 2 (2), pp. 217-226.
Haff L.A., et al., “Multiplex Genotyping of PCR Products with Mass Tag-Labeled Primers,” Nucleic Acids Research, 1997, vol. 25 (18), pp. 3749-3750.
Hahner S., et al., “Analysis of Short Tandem Repeat Polymorphisms by Electrospray Ion Trap Mass Spectrometry,” Nucleic Acids Research, 2000, vol. 28 (18), pp. E82.1-E82.8.
Haines J.D., et al., “Medical Response to Bioterrorism: Are We Prepared,” Journal of Oklahoma State Medical Association, 2000, vol. 93, pp. 187-196.
Hall T.A., et al., “Base Composition Analysis of Human Mitochondrial DNA Using Electrospray Ionization Mass Spectrometry: A Novel Tool for the Identification and Differentiation of Humans,” Analytical Biochemistry, 2005, vol. 344 (1), pp. 53-69.
Hamdad F., et al., “Detection of Methicillin/Oxacillin Resistance and Typing in Aminoglycoside-Susceptible Methicillin-Resistant and Kanamycin-Tobramycin-Resistant Methicillin-Susceptible,” Microbial Drug Resistance, 2006, vol. 12 (3), pp. 177-185.
Hamel S., et al., “Consensus PCR and Microarray for Diagnosis of the Genus Staphylococcus, Species, and Methicillin Resistance,” Biotechniques, 2001, vol. 31 (6), pp. 1364-1372.
Hammerle T., et al., “A Sensitive PCR Assay System for the Quantitation of Viral Genome Equivalents:Hepatitis C Virus (HCV),” Archives of Virology, 1996, vol. 141 (11), pp. 2103-2114.
Hannis J.C., et al., “Accurate Characterization of the Tyrosine Hydroxylase Forensic Allele 9.3 through Development of Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1999, vol. 13 (10), pp. 954-962.
Hannis J.C., et al., “Detection of Double-Stranded PCR Amplicons at the Attomole Level Electrosprayed from Low Nanomolar Solutions using FT-ICR Mass Spectrometry,” Fresenius Journal of Analytical Chemistry, 2001, vol. 369 (3-4), pp. 246-251.
Hannis J.C., et al., “Genotyping Complex Short Tandem Repeats Using Electrospray Ionzation Fourier Transform Ion Cyclotron Resonance Multi-Stage Mass Spectrometry,” Proceedings of SPIE, 2000, vol. 3926, pp. 36-47.
Hannis J.C., et al., “Genotyping Short Tandem Repeats Using Flow Injection and Electrospray Ionization, Fourier Transform Ion Cyclotron Resonance Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 2001, vol. 15 (5), pp. 348-350.
Hannis J.C., et al., “Nanoelectrospray Mass Spectrometry Using Non-Metalized, Tapered (50-10 .mu.m) Fused-silica Capillaries,” Rapid Communication in Mass spectrometry, 1998, vol. 12, pp. 443-448.
Hanssen A.M., et al., “Sccmecin Staphylococci: Genes on the Move,” FEMS Immuol Medical Microbiol, 2006, vol. 46, pp. 8-20.
Hasebe F. et al., “Combined Detection and Genotyping of Chikungunya Virus by a Specific Reverse Transcription-Polymerase Chain Reaction,” Journal of Medical Virology, 2002, vol. 67 (3), pp. 370-374.
Hassan A.A., et al., “Inter- and Intraspecies Variations of the 16S-23S rDNA Intergenic Spacer Region of Various Streptococcal Species,” Systematic and Applied Microbiology, 2003, vol. 26 (1), pp. 97-103.
Haugland R.A., et al., “Identification of Putative Sequence Specific PCR Primers for Detection of the Toxygenic Fungal Species Stachybotrys chartarum,” Molecular and Cellular Probes, 1998, vol. 12 (6), pp. 387-396.
Hayashi H., et al., “Phylogenetic Analysis of the Human Gut Microbiota Using 16S rDNA Clone Libraries and Strictly Anaerobic Culture-based Methods,” Journal of Microbiology, Immunology, 2002, vol. 46 (8), pp. 535-548.
He L., et al, “Development of a Capillary High-performance Liquid Chromatography Tandem Mass Spectrometry System Using SWIFT Technology in an Ion Trap/Reflectron Time-of-flight Mass Spetrometer,” Biochemical and Biophysical Research Communications, 1997, vol. 11, pp. 1739-1748.
Heim A., et al., “Rapid and Quantitative Detection of Human Adenovirus DNA by Real-Time PCR,” Journal of Medical Virology, 2003, vol. 70, pp. 228-239.
Henchal E.A., et al., “Sensitivity and Specificity of a Universal Primer Set for the Rapid Diagnosis of Dengue Virus Infections by Polymerase Chain Reaction and Nucleic Acid Hybridization,” American Journal of Tropical Medicine and Hygiene, 1991, vol. 45 (4), pp. 418-428.
Herrmann B., et al., “Differentiation of Chiamydia spp. by Sequence Determination and Restriction Endonuclease Cleavage of RNase P RNA Genes,” Journal of Clinical Microbiology, 1996, vol. 34 (8), pp. 1897-1902.
Higgins G.S., et al., “Competitive Oligonucleotide Single-base Extension Combined with Mass Spectrometric Detection for Mutation Screening,” Biotechniques, 1997, vol. 23 (4), pp. 710-714.
Higgins J.A., et al., “Sensitive and Rapid Identification of Biological Threat Agents,” Annals of the New York Academy of Sciences, 1999, vol. 894, pp. 130-148.
Hill F., et al., “Polymerase Recognition of Synthetic Oligodeoxyribonucleotides Incorporating Degenerate Pyrimidine and Purine Bases,” Proceedings of the National Academy of Sciences, 1998, vol. 95, pp. 4258-4263.
Hiramatsu K., et al., “The Emergence and Evolution of Methicillin-Resistant Staphylococcusaureus,” Trends Microbiology, 2001, vol. 9 (10), pp. 486-493.
Hodgson J.E., et al., “Molecular Characterization of the Gene Encoding High-Level Mupirocin Resistancein Staphylococcus aureus J2870,” Antimicrobial Agents and Chemotherapy, 1994, vol. 38 (5), pp. 1205-1208.
Hoffman E., et al., “Rescue of Influenza B Virus from Eight Plasmids,” Proceedings of the National Academy of Sciences, 2002, vol. 99 (17), pp. 11411-11416.
Hoffmann E., et al., “Universal Primer Set for the Full-Length Amplification of all Influenza A Viruses,” Archives of Virology, 2001, vol. 146 (12), pp. 2275-2289.
Hofstadler S.A., et al., “TIGER: The Universal Biosensor,” International Journal of Mass Spectrometry, 2005, vol. 242, pp. 23-41.
Holden M.T., et al., “Complete Genomes of Two Clinical Staphylocuccus aureus Strain: Evidence for the Rapid Evolution of Virulence and Drug Resistance,” Proceedings of the National Academy of Sciences, 2004, vol. 101 (26), pp. 9786-9791.
Holland M.M., et al., “Mitochondrial DNA Sequence Analsysis—Validation and Use for Forensic Casework,” Forensic Science Review, 1999, vol. 11 (1), pp. 22-50.
Holland M.M., et al., “Mitochondrial DNA Sequence Analysis of Human Skeletal Remains: Identification of Remains from the Vietnam War,” Journal of Forensic Sciences, 1993, vol. 38 (3), pp. 542-553.
Holm L., et al., “Removing Near-Neighbour Redundancy from Large Protein Sequence Collections,” Bioinformatics, 1998, vol. 14 (5), pp. 423-429.
Holmes E.C., et al., “Whole-Genome Analysis of Human Influenza A Virus Reveals Multiple Persistent Lineages and Reassortment among Recent H3N2 Viruses,” Public Library of Science Biology, 2005, vol. 3 (9), pp. 1579-1589.
Honda K., et al., “Universal Method of Hypersensitive Nested PCR Toward Forensic DNA typing,” International Congress Series, 1998, vol. 7, pp. 28-30.
Hongoh Y., et al., “Evaluation of Primers and PCR Conditions for the Analysis of 16s rRNA Genes from a Naturalenvironment,” FEMS Microbiology Letters, 2003, vol. 221 (2), pp. 299-304.
Hood E., et al., “Chemical and Biological Weapons: New Questions, New Answers,” Environmental Health Perspectives, 1999, vol. 107 (12), pp. 931-932.
Houng H.S., et al., “Rapid Type-Specific Diagnosis of Adenovirus Type 4 Infection Using a Hexon-Based Quantitative Fluorogenic PCR,” Diagnostic Microbiology and Infectious Disease, 2002, vol. 42 (4), pp. 227-236.
Howell N., et al., “Persistent Heteroplasmy of a Mutation in the Human mtDNA Control Region: Hypermutation as an Apparent Consequence of Simple-Repeat Expansion/Contraction,” American Journal of Human Genetics, 2000, vol. 66 (5), pp. 1589-1598.
Huber C.G., et al., “On-Line Cation Exchange for Suppression of Adduct Formation in Negative-Ion Electrospray Mass Spectrometry of Nucleic Acids,” Analytical Chemistry, 1998, vol. 70 (24), pp. 5288-5295.
Huletsky A., et al., “New Real-Time PCR Assay for Rapid Detection of Methicillin-ResistantStaphylococcus aureus Directly from Specimens Containing a Mixture of Staphylococci,” Journal of Clinical Microbiology, 2004, vol. 42 (5), pp. 1875-1884.
Hunag C., et al., “Detection of Arboviral RNA Directly from Mosquito Homogenates by Reverse Transcription-Polymerase Chain Reaction,” Journal of Virological Methods, 2001, vol. 94 (1-2), pp. 121-128.
Hung E.C., et al., “Detection of SARS Coronavirus RNA in the Cerebrospinal Fluid of a Patient with Severe Acute Respiratory Syndrome,” Clinical Chemistry, 2003, vol. 49 (12), pp. 2108-2109.
Hurdle J.G., et al., “Analysis of Mupirocin Resistance and Fitness in Staphylococcus aureus by Molecular Genetic and Structural Modeling Techniques,” Antimicrobial Agents and Chemotherapy, 2004, vol. 48 (11), pp. 4366-4376.
Hurst G.B., et al., “Detection of Bacterial DNA Polymerase Chain Reaction Products by Matrix-Assisted Laser Desorptionfionization Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1996, vol. 10 (3), pp. 377-382.
Hurst G.B., et al., “MALDI-TOF Analysis of Polymerase Chain Reaction Products from Methanotrophic Bacteria,” Analytical Chemistry, 1998, vol. 70 (13), pp. 2693-2698.
Hutchison C.A., et al., “Maternal Inheritance of Mammalian Mitochondrial DNA,” Nature, 1974, vol. 251 (5475), pp. 536-538.
Hyde-Deruyscher R., et al., “Polyomavirus Early-Late Switch is not Regulated at the Level of Transcription Initiation and is associated with changes in RNA Processing,” Proceedings of the National Academy of Sciences, 1988, vol. 85, pp. 8993-8997.
Ieven M., et al., “Rapid Detection of Methicillin Resistance in Coagulase-Negative Staphylococci by Commercially Available Fluorescence Test,” Journal of Clinical Microbiology, 1995, vol. 33 (8), pp. 2183-2185.
Ihle O., et al., “Efficient Purification of DNA Fragments using a Protein Binding Membrane,” Nucleic Acids Research, 2000, vol. 28 (16), pp. e76.
Inglis T.J., et al., “Rapid Genotypic Confirmation of Methicillin Resistance,” Pathology, 1996, vol. 28 (3), pp. 259-261.
Ingman M., et al., “Mitochondrial Genome Variation and the Origin of Modern Humans,” Nature, 2000, vol. 408 (6813), pp. 708-713.
International Preliminary Examination Report for Application No. PCT/US2002/06763, mailed on Jun. 11, 2003, 6 pages.
International Preliminary Examination Report for Application No. PCT/US2002/20336, mailed on Apr. 26, 2004, 8 pages.
International Preliminary Examination Report for Application No. PCT/US2003/09802, mailed on Apr. 8, 2005, 7 pages.
International Preliminary Examination Report for Application No. PCT/US2003/22835, mailed on Mar. 5, 2005, 4 pages.
International Preliminary Examination Report for Application No. PCT/US2003/38505, mailed on Mar. 3, 2006, 5 pages.
International Preliminary Examination Report for Application No. PCT/US2003/38757, mailed on Feb. 2, 2007, 5 pages.
International Preliminary Examination Report for Application No. PCT/US2003/38761, mailed on Jun. 27, 2006, 6 pages.
International Preliminary Report on Patentability and Written Opinion for Application No. PCT/US04/007236, mailed on Mar. 16, 2006, 7 pages.
International Preliminary Report on Patentability and Written Opinion for Application No. PCT/US2005/00386, mailed on Jul. 10, 2006, 6 pages.
International Preliminary Report on Patentability and Written Opinion for Application No. PCT/US2005/030058, mailed on Sep. 25, 2007, 6 pages.
International Preliminary Report on Patentability and Written Opinion for Application No. PCT/US2005/033707, mailed on Mar. 20, 2007, 6 pages.
International Preliminary Report on Patentability for Application No. PCT/US2004/033742, mailed on Jun. 20, 2006, 1 page.
International Preliminary Report on Patentability for Application No. PCT/US2005/018031, mailed on Nov. 29, 2006, 1 page.
International Preliminary Report on Patentability for Application No. PCT/US2006/028397, mailed on Jan. 22, 2008, 1 page.
International Preliminary Report on Patentability for Application No. PCT/US2008/054926, mailed on Aug. 26, 2009, 1 page.
International Preliminary Report on Patentability, Written Opinion and International Search Report for Application No. PCT/US2004/015123, mailed on Oct. 3, 2005, 8 pages.
International Search Report and Written Opinion for Application No. PCT/US2005/018031, mailed on Jun. 28, 2006, 14 pages.
International Search Report and Written Opinion for Application No. PCT/US2006/007747, mailed on Sep. 5, 2006, 13 pages.
International Search Report and Written Opinion for Application No. PCT/US2006/015160, mailed on Oct. 10, 2006, 13 pages.
International Search Report and Written Opinion for Application No. PCT/US2006/028397, mailed on Mar. 5, 2007, 14 pages.
International Search Report and Written Opinion for Application No. PCT/US2006/040747, mailed on Mar. 17, 2009, 19 pages.
International Search Report and Written Opinion for Application No. PCT/US2006/061307, mailed on Jan. 9, 2008, 21 pages.
International Search Report and Written Opinion for Application No. PCT/US2007/020045 mailed on Jan. 8, 2009, 17 pages.
International Search Report and Written Opinion for Application No. PCT/US2008/054926, mailed on Jan. 26, 2009, 15 pages.
International Search Report and Written Opinion for Application No. PCT/US2008/057717, mailed on Jan. 13, 2009, 18 pages.
International Search Report and Written Opinion for Application No. PCT/US2008/057901, mailed on Aug. 28, 2008, 14 pages.
International Search Report and Written Opinion for Application No. PCT/US2008/064891, mailed on Jun. 29, 2009, 15 pages.
International Search Report for Application No. PCT/US04/007236, mailed on Feb. 24, 2006, 2 pages.
International Search Report for Application No. PCT/US2002/06763, mailed on Oct. 23, 2002, 2 pages.
International Search Report for Application No. PCT/US2002/20336, mailed on Feb. 3, 2003, 4 pages.
International Search Report for Application No. PCT/US2003/009802, mailed on Aug. 3, 2004, 2 pages.
International Search Report for Application No. PCT/US2003/038505, mailed on Apr. 12, 2005, 2 pages.
International Search Report for Application No. PCT/US2003/038830, mailed on Aug. 25, 2004, 4 pages.
International Search Report for Application No. PCT/US2003/22835, mailed on Dec. 12, 2003, 1 page.
International Search Report for Application No. PCT/US2003/38757, mailed on Jun. 24, 2004, 2 pages.
International Search Report for Application No. PCT/US2003/38761, mailed on Dec. 30, 2005, 5 pages.
International Search Report for Application No. PCT/US2003/38795, mailed on Apr. 19, 2004, 3 pages.
International Search Report for Application No. PCT/US2004/011877, mailed on Apr. 20, 2006, 4 pages.
International Search Report for Application No. PCT/US2004/012671, mailed on Sep. 28, 2007, 2 pages.
International Search Report for Application No. PCT/US2004/015123, mailed on Oct. 3, 2005, 2 pages.
International Search Report for Application No. PCT/US2004/015196, mailed on Jul. 1, 2005, 3 pages.
International Search Report for Application No. PCT/US2004/028869, mailed on Jul. 17, 2006, 4 pages.
International Search Report for Application No. PCT/US2004/033742, mailed on May 15, 2006, 2 pages.
International Search Report for Application No. PCT/US2005/000386, mailed on May 9, 2006, 3 pages.
International Search Report for Application No. PCT/US2005/005356, mailed on Aug. 7, 2007, 4 pages.
International Search Report for Application No. PCT/US2005/006133, mailed on Jul. 26, 2007, 4 pages.
International Search Report for Application No. PCT/US2005/007022, mailed on Oct. 20, 2006, 1 page.
International Search Report for Application No. PCT/US2005/009557, mailed on Sep. 19, 2005, 1 page.
International Search Report for Application No. PCT/US2005/018337, mailed on Oct. 10, 2006, 2 pages.
International Search Report for Application No. PCT/US2005/024799, mailed on Dec. 28, 2006, 4 pages.
International Search Report for Application No. PCT/US2005/030058, mailed on Aug. 20, 2007, 1 page.
International Search Report for Application No. PCT/US2005/033707, mailed on Feb. 6, 2006, 3 pages.
International Search Report for Application No. PCT/US2007/066194, mailed on Jan. 15, 2008, 4 pages.
International Search Report for Application No. PCT/US2008/057717, mailed on Jan. 13, 2009, 5 pages.
International Search Report for Application No. PCT/US2008/057901, mailed on Jun. 29, 2009, 15 pages.
International Search Report for Application No. PCT/US2008/065332, mailed on Nov. 28, 2008, 4 pages.
International Search Report for Application No. PCT/US2009/045635, mailed on Oct. 7, 2009, 9 pages.
Inyaku K., et al., “Rapid Detection and Identification of Mycobacteria in Sputum Samples by NestedPolymerase Chain Reaction and Restriction Fragment Length Polymorphisms of dnaJ Heat Shock Protein Gene,” Journal of Medical Sciences, 1993, vol. 42 (1), pp. 21-31.
Iqbal S.S., et al., “A Review of Molecular Recognition Technologies for Detection of Biological Threat Agents,” Biosensors & Bioelectronics, 2000, vol. 15 (11-12), pp. 549-578.
Isola N.R., et al., “MALDI-TOF Mass Spectrometric Method for Detection of Hybridized DNA Oligomers,” Analytical Chemistry, 2001, vol. 73 (9), pp. 2126-2131.
Iteman I., et al., “Comparison of Conserved Structural and Regulatory Domains within Divergent 16S rRNA-235 rRNA Spacer Sequences of Cyanobacteria,” Microbiology, 2000, vol. 146 (Pt 6), pp. 1275-1286.
Ito T., et al., “Insights on Antibiotic Resistance of Staphylococcus aureus from its Whole Genome: Genomic Island Scc,” Drug Resistance Updates, 2003, vol. 6 (1), pp. 41-52.
Ito T., et al., “Structural Comparison of Three Types of Staphylococcal Cassette Chromosome mecIntegrated in the Chromosome in Methicillin-Resistant Staphylococcus aureus,” Antimicrobial Agents and Chemotherapy, 2001, vol. 45 (5), pp. 1323-1336.
Jackson P.E., et al., “Mass Spectrometry for Genotyping: an Emerging Tool for Molecular Medicine,” Molecular Medicine Today, 2000, vol. 6 (7), pp. 271-276.
James A.M., et al., “Borelia Lonestari Infection after a Bite by an Amblyomma americanum Tick,” The Journal of Infectious Diseases, 2001, vol. 183 (12), pp. 1810-1814.
Jankowski K., et al., “Mass Spectrometry of DNA. Part 2 Quantitative Estimation of Base Composition,” European Journal of Mass Spectrometry, 1980, vol. 1 (1), pp. 45-52.
Jansen R.C., et al., “Genotype-by-environment Interaction in Genetic Mapping of Multiple Quantitative Trait Loci,” Theoretical and Applied Genetics, 1995, vol. 91, pp. 33-37.
Jaulhac B., et al., “Specific Detection of the Toxic Shock Syndrome Toxin-1 Gene Using the Polymerase Chain Reaction,” Molecular and Cellular Probes, 1991, vol. 5, pp. 281-284.
Jaulhac B., et al., “Synthetic DNA Probes for Detection of Genes for Enterotoxins A, B, C, D, E and for Tsst-1 in Staphylococcal Strains,” Journal of Applied Bacterial, 1992, vol. 72 (5), pp. 386-392.
Jensen M.A., et al., “Rapid Identification of Bacteria on the Basis of Polymcrase Chain Reaction-Amplified Ribosomal DNA Spacer Polymorphisms,” Applied and Environmental Microbiology, 1993, vol. 59 (4), pp. 945-952.
Jeong J., et al., “Early Screening of Oxacillin-Resistant Staphylococcus aureus and Staphylococcus epidermidis from Blood Culture,” Journal of Korean Medical Science, 2002, vol. 17, pp. 168-172.
Jiang C., et al., “Multiple Trait Analysis of Genetic Mapping for Quantitative Trait Loci Genetics,” Genetics, 1995, vol. 140 (3), pp. 1111-1127.
Jiang Y., et al., “A Highly Efficient and Automated Method for Purifying and Desalting PCR Products for Analysis by Electrospray Ionization Mass Spectrometry,” Analytical Biochemistry, 2003, vol. 316 (1), pp. 50-57.
Johansson A., et al., “Evaluation of PCR-based Methods for Discrimination of Francisella species and Subspecies and Development of a Specific PCR that Distinguishes the Two Major Subspecies of Francisella tularensis,” Journal of Clinical Microbiology, 2000, vol. 38 (11), pp. 4180-4185.
Johnson W.M., et al., “Detection of Genes for Enterotoxins, Exfoliative Toxins, and Toxic Shock Syndrome Toxin 1 in Staphylococcus aureus by the Polymerase Chain Reaction,” Journal of Clinical Microbiology, 1991, vol. 29 (3), pp. 426-430.
Johnson Y.A., et al., “Precise Molecular Weight Determination of PCR Products of the rRNA Intergenic Spacer Region Using Electrospray Quadrupole Mass Spectrometry for Differentiation of B. Subtilis and B. Atrophaeus, Closely Related Species of Bacilli,” Journal of Microbiological Methods, 2000, vol. 40 (3), pp. 241-254.
Jonas D., et al., “Rapid PCR-Based Identification of Methicillin-Resistant Staphylococcus aureusfrom Screening Swabs,” Journal of Clinical Microbiology, 2002, vol. 40 (5), pp. 1821-1823.
Jurinke C., et al., “Application of Nested PCR and Mass Specctrometry for DNA Based Virus Detection: HBV-DNA Detected in the Majority of Isolated Anti-Hbc Positive Sera,” Genetic Analysis: Biomolecular Engineering, 1998, vol. 14 (3), pp. 97-102.
Jurinke C., et al., “Detection of Hepatitis B: Virus DNA in Serum Samples via Nested PCR and MALDI-TOF Mass Spectrometry,” Genetic Analysis: Biomolecular Engineering, 1996, vol. 13 (3), pp. 67-71.
Jurinke C., et al., “MALDI-TOF Mass Spectrometry. A Versatile Tool for High-Performance DNA Analysis,” Molecular Biotechnology, 2004, vol. 26 (2), pp. 147-163.
Kacian D.L., et al., “A Replicating RNA Molecule Suitable for a Detailed Analysis of Extracellular Evolution and Replication,” Proceeding of the National Academy of Sciences, 1972, vol. 69 (10), pp. 3038-3042.
Kageyama A., et al. “Rapid Detection of Human Fecal Eubacterium Species and Related Genera by Tested PCR Method,” Journal of Microbiology, Immunology, 2001, vol. 45 (4), pp. 315-318.
Kajon A.E., et al., “Genome Type Analysis of Brazilian Adenovirus Strains of Serotypes 1, 2, 3, 5,and 7 Collected Between 1976 and 1995,” Journal of Medical, 1999, vol. 58 (4), pp. 408-412.
Kasai H., et al., “Construction of the gyrB Database for the Identification and Classification of Bacteria,” Genome Informatics. Workshop on Genome Informatics, 1998, pp. 13-21.
Katano H., et al., “Identification of Adeno-Associated Virus Contamination in Cell and Virus Stocks by PCR,” Biotechniques, 2004, vol. 36 (4), pp. 676-680.
Katayama Y., et al., “Genetic Organization of the Chromosome Region Surrounding mecA inClinical Staphylococcal Strains: Role of IS431-Mediated mecI Deletion in Expression of Resistance inmed-Canying, Low-Level Methicillin-Resistant Staphylococcus haemolyticus,” Antimicrobial Agents and Chemotherapy, 2001, vol. 45 (7), pp. 1955-1963.
Ke D., et al., “Development of a PCR Assay for Rapid Detection of Enterococci,” Journal of Clinical Microbiology, 1999, vol. 37 (11), pp. 3497-3503.
Kearns A.M., et al., “Rapid Detection of Methicillin-Resistant Staphylococci by Multiplex PCR,” The Journal of Hospital Inspection, 1999, vol. 43 (1), pp. 33-37.
Keller A., et al., “Empirical Statistical Model to Estimate the Accuracy of Peptide Identifications Made by MS/MS and Database Search,” Analytical Chemistry, 2002, vol. 74 (20), pp. 5383-5392.
Khan A.S., et al., “An Outbreak of Crimean-Congo Haemorrhagic Fever in the United Arab Emirates, 1994-1995,” The American Journal of Tropical Medicine and Hygiene, 1997, vol. 57 (5), pp. 519-525.
Khan S.A., et al., “Simultaneous Detection of Erythromycin-Resistant Methylase Genes ermA and ermC from Staphylococcus Spp. by Multiplex-PCR,” Molecular and Cellular Probes, 1999, vol. 13 (5), pp. 381-387.
Kidd A.H., et al., “Rapid Subgenus Identification of Human Adenovirus Isolates by a General PCR,” Journal of Clinical Microbiology, 1996, vol. 34 (3), pp. 622-627.
Kidd-Ljunggren K., et al., “The Hepatitis B Virus X Gene: Analysis of Functional Domain Variation and Gene Phylogeny using Multiple Sequences,” Journal of General Virology, 1995, vol. 76 (pt 9), pp. 2119-2130.
Kikuchi K., et al., “Restriction Fragment Length Polymorphism Analysis of Clinical Isolates of Mycobacterium haemophilum,” Journal of Clinical Microbiology, 1994, vol. 32 (7), pp. 1763-1767.
Kilbourne E.D., “Influenza Pandemics: Can We Prepare for the Unpredictable,” Viral Immunology, 2004, vol. 17 (3), pp. 350-357.
Kilbourne E.D., “Influenza Pandemics of the 20th Century,” Emerging Infectious Diseases Journal, 2006, vol. 12 (1), pp. 9-14.
Kilpatrick D.R., et al., “Group-Specific Identification of Polioviruses by PCR Using Primer Containing Mixed-Base or Deoxyinosine Residues at Positions of Codon Degeneracy,” Journal of Clinical Microbiology, 1996, vol. 34 (12), pp. 2990-2996.
Kim B.J., et al., “Identification of Mycobacterial Species by Comparative Sequence Analysis of the RNA Polymerase Gene (rpoB),” Journal of Clinical Microbiology, 1999, vol. 37 (6), pp. 1714-1720.
Kinney R.M., et al., “Nucleotide Sequences of the 26S mRNAs of the Viruses Defining the Venezuelan Equine Encephalitis Antigenic Complex,” The American Journal of Tropical Medicine and Hygiene, 1998, vol. 59 (6), pp. 952-964.
Kirpekar F., et al., “Matrix Assisted Laser Desorption/Ionization Mass Spectrometry of Enzymatically Synthesized RNA up to 150 kDa,” Nucleic Acids Research, 1994, vol. 22 (19), pp. 3866-3870.
Kitagawa Y., et al., “Rapid Diagnosis of Methicillin-Resistant Staphylococcus aureus Bacteremia by Nested Polymerase Chain Reaction,” Annals of Surgery, 1996, vol. 224 (5), pp. 665-671.
Knoth K., et al., “Highly Degenerate, Inosine-Containing Primers Specifically Amplify Rare cDNA using the Polymerase Chain Reaction,” Nucleic Acids Research, 1988, vol. 16 (22), pp. 10932.
Kolbert C.P., et al., “Branched-DNA Assay for Detection of the mecA Gene in Oxacillin-Resistant and Oxacillin-Sensitive Staphylococci,” Journal of Clinical Microbiology, 1998, vol. 36 (9), pp. 2640-2644.
Kowalak J.A., et al., “A Novel Method for the Determination of Post-Transcriptional Modification in RNA by Mass Spectrometry,” Nucleic Acids Research, 1993, vol. 21 (19), pp. 4577-4585.
Krafft A.E., et al., “Evaluation of PCR Testing of Ethanol-Fixed Nasal Swab Specimens as anAugmented Surveillance Strategy for Influenza Virus and Adenovirus Identification,” Journal of Clincal Microbiology, 2005, vol. 43 (4), pp. 1768-1775.
Krahmer M.T., et al., “Electrospray Quadrupole Mass Spectrometry Analysis of Model Oligonucleotides and Polymerase Chain Reaction Products: Determination of Base Substitutions, Nucleotide Additions/Deletions, and Chemical Modifications,” Analytical Chemistry, 1999, vol. 71 (14), pp. 2893-2900.
Krahmer M.T., et al, “MS for Identification of Single Nucleotide Polymorphisms and MS/MS for Discrimination of Isomeric PCR Products,” Analytical Chemistry, 2000, vol. 72 (17), pp. 4033-4040.
Kramer L.D., et al., “Dection of Encephalitis Viruses in Mosquitoes (Diptera: Culicidea) and Avian Tissues,” Journal of Medical Entomology, 2002, vol. 39 (2), pp. 312-323.
Kramer L.D., et al., “Dection of St. Louis Encephalitis and Western Equine Encephalomyelitis RNAin Mosquitoes Tested Without Maintainance of a Cold Chain,” Journal of the American Mosquito Control Association, 2001, vol. 17 (4), pp. 213-215.
Kresken M., et al., “Prevalence of Mupirocin Resistance in Clinical Isolates of Staphylococccus aureus and Staphylococcus epidermidis: Results of the Antimicrobial Resistance Surveillance Study of the Paul-Ehrlich-Society for Chemotherapy, 2001,” International Journal of Antimicrobial Agents, 2004, vol. 23 (6), pp. 577-581.
Krishnan P.U., et al., “Detection of Methicillin and Mupirocin Resistance in Staphylococcus aureusisolates Using Conventional and Molecular Methods: A Descriptive Study from a Burns Unit with Highprevalence of MRSA,” Journal of Clinical Pathology, 2002, vol. 55 (10), pp. 745-748.
Kroes I., et al., “Bacterial Diversity Within the Human Subgingival Crevice,” Proceeding of the National Academy of Sciences, 1999, vol. 96 (25), pp. 14547-14552.
Krossoy B., et al., “The Putative Polymerase Sequence of Infectious Salmon Anemia Virus Suggests a New Genus within the Orthomyxoviridae,” Journal of Virology, 1999, vol. 73 (3), pp. 2136-2142.
Ksiazek T.G., et al., “A Novel Coronavirus Associated with Severe Acute Respiratory Syndrome,” The New England Journal of Medicine, 2003, vol. 348 (20), pp. 1953-1966.
Kupke T., et al., “Molecular Characterization of Lantibiotic-Synthesizing Enzyme EpiD Reveals a Function for Bacterial Dfp Proteins in Coenzyme A Biosynthesis,” Journal of Biological Chemistry, 2000, vol. 275 (41), pp. 31838-31846.
Kuroda M., et al., “Whole Genome Sequencing of Meticillin-Resistant Staphylococcus aureus,” The Lancet, 2001, vol. 357 (9264), pp. 1225-1240.
Kwok S., et al., “Avoiding False Positives with PCR,” Nature, 1989, vol. 339 (6221), pp. 237-238.
Labandeira-Rey, M. et al., “Staphylococcus aureus Panton Valentine Leukocidin CausesNecrotizing Pneumonia,” ScienceExpress, 2007, 8 pages.
Lacroix J.M., et al, “PCR-Based Technique for the Detection of Bacteria in Semen and Urine,” Journal of Microbiological Methods, 1996, vol. 26, pp. 61-71.
Lacroix L., et al., “Triplex Formation by Oligonucleotides Containing 5-(1-Propynyl)-2-deoxyuridine: Decreased Magnesium Dependence and Improved Intracellular Gene Targeting,” Biochemistry, 1999, vol. 38 (6), pp. 1893-1901.
Laken S.J., et al., “Genotyping by Mass Spectrometric Analysis of Short DNA Fragments,” Nature Biotechnology, 1998, vol. 16 (13), pp. 1352-1356.
Lamb R.A., et al., “Sequence of Interrupted and Uninterrupted mRNAs and Cloned DNA Coding for the Two Overlapping Nonstructural Proteins of Influenza Virus,” Cell, 1980, vol. 21 (2), pp. 475-485.
Lambert A.J., et al., “Detection of North American Eastern and Western Equine EncephalitisViruses by Nucleic Acid Amplification Assays,” Journal of Clinical Microbiology, 2003, vol. 41 (1), pp. 379-385.
Lau L.T., et al, “A Real-Time PCR for SARS-Coronavirus Incorporating Target Gene Pre-Amplification,” Biochemical and Biophysical Research Communications, 2003, vol. 312 (4), pp. 1290-1296.
Lau L.T., et al., “Nucleic Acid Sequence-Based Amplification Methods to Detect Avian Influenza Virus,” Biochemical and Biophysical Research Communications, 2004, vol. 313 (2), pp. 336-342.
Le Cann P., et al., “Quantification of Human Astroviruses in Sewage Using Real-Time RT-PCR,” Research in Microbiology, 2004, vol. 155 (1), pp. 11-15.
Lebedev Y., et al., “Oligonucleotides Containing 2-Aminoadenine and 5-Methycytosine are More Effective as Primers for PCR Amplification than their Nonmodified Counterparts,” Genetic Analysis: Biomolecular Engineering, 1996, vol. 13 (1), pp. 15-21.
Lednicky J.A., et al., “Polyomaviruses and Human Tumors: A Brief Review of Current Concenpts and Interpretations,” Frontiers Bioscience, 1999, vol. 4, pp. D153-D164.
Lee J.A., et al., “Rapid Identification of Human Adenovirus Types 3 and 7 from Respiratory Specimens via Multiplex Type-Specific PCR,” Journal of Clinical Microbiology, 2005, vol. 43 (11), pp. 5509-5514.
Lee J.H., et al., “Simultaneous Detection of Three Mosquito-Borne Encephalitis Viruses (Eastern equine, La Crosse, and St. Louis) with a Single-Tube Multiplex Reverse Transcriptase Polymerase Chaine Reaction Assay,” Journal of the American Mosquito Control Association, 2002, vol. 18 (1), pp. 26-31.
Leif H., et al., “Isolation and Characterization of the Proton-Translocating NADH: Ubiqu None Oxidoreductase from Escherichia coli,” European Journal of Biochemistry, 1995, vol. 230 (2), pp. 538-548.
Lengyel A., et al., “Characterization of the Main Protein Components of Adenovirus Virion and itsPossible Use in Laboratory Diagnostics,” Acta Microbiologica Immunologica Hungarica, 1998, vol. 43 (3-4), pp. 281-283.
Leroy E.M., et al., “Diagnosis of Ebola Haemorrhagic Fever by RT-PCR in an Epidemic Setting,” Journal of Medicinal Virology, 2000, vol. 60 (4), pp. 463-467.
Levi K., et al., “Evaluation of an Isothermal Signal Amplification Method for Rapid Detection of Methicillin-Resistant Staphylococcus aureus from Patient-Screening Swabs,” Journal of Clinical Microbiology, 2003, vol. 41 (7), pp. 3187-3191.
Levine S.M., et al., “PCR-Based Detection of Bacillus Anthracis in Formalin-Fixed Tissue from a Patient Receiving Ciprofloxacin,” Journal of Clinical Microbiology, 2002, vol. 40 (11), pp. 4360-4362.
Levison P.R., et al., “Recent Developments of Magnetic Beads for Use in Nucleic Acid Purification,” Journal of Chromatography, 1998, vol. A816, pp. 107-111.
Lewers K.S., et al., “Detection of Linked QTL for Soybean Brown Stem Rot Resistance in “BSR 101” as Expressed in a Growth Chamber Environment,” Molecular Breeding, 1999, vol. 5, pp. 33-42.
Li C., et al., “Evolution of H9N2 Influenza Viruses from Domestic Poultry in Mainland China,” Virology, 2005, vol. 340 (1), pp. 70-83.
Li J., et al., “Single Nucleotide Polymorphism Determination Using Primer Extension and Time-of-Flight Mass Spectrometry,” Electrophoresis, 1999, vol. 20 (6), pp. 1258-1265.
Li Q., et al., “Screening of the High Yield Influenza B Virus on MDCK c14d Cloning of its Whole Genome,” International Congress Series, 2004, vol. 1263, pp. 610-614.
Li Q., et al., “Genetic Variability of Hexon Loops 1 and 2 between Seven Genome Types of Adenovirus Serotype 7,” Archives of Virology, 1999, vol. 144 (9), pp. 1739-1749.
Li Q.G., et al., “Analysis of 15 Different Genome Types of Adenovirus Type 7 Isolated on FiveContinents,” Journal of Virology, 1986, vol. 60 (1), pp. 331-335.
Li Q.G., et al., “Comparison of 17 Genome Types of Adenovirus Type 3 Identified among Strains Recovered from Six Continents,” Journal of Clinical Microbiology, 1988, vol. 26 (5), pp. 1009-1015.
Liebermann H., et al., “Mapping of Epitopes on the Fiber Knobs of Human Adenovirus Serotypes 8 and 15,” Intervirology, 2002, vol. 45 (1), pp. 59-66.
Liebermann H., et al., “Mapping of Linear Epitopes on Fibre Knob of Human Adenovirus Serotype 5,” Virus Research, 2001, vol. 73 (2), pp. 145-151.
Lim L.P., et al., “The MicroRNAs of Caenorhabditis Elegans,” Genes and Development, 2003, vol. 17 (8), pp. 991-1008.
Limbach P.A., et al., “Enzymatic Sequencing of Oligonucleotides with Electrospray Mass Spectrometry,” 42nd ASMS Conference on Mass Spectrometry, 1994.
Limoncu M.H., et al., “Emergence of Phenotypic Resistance to Ciprofloxacin and Levofloxacin Inmethicillin-Resistant and Methicillin-Sensitive Staphylococcus aureus Strains,” International Journal of Antimicrobial Agents, 2003, vol. 21 (5), pp. 420-424.
Lin B., et al., “Use of Oligonucleotide Microarrays for Rapid Detection and Serotyping of Acute Respiratory Disease-Associated Adenoviruses,” Journal of Clinical Microbiology, 2004, vol. 42 (7), pp. 3232-3239.
Lin P.H., et al., “Oxidative Damage to Mitochondrial DNA in Atrial Muscle of Patients with Atrial Fibrillation,” Free Radical Biology and Medicine, 2003, vol. 35 (10), pp. 1310-1318.
Lina G., et al., “Bacterial Competition for Human Nasal Cavity Colonization: Role of Staphylococcalagr Alleles,” Applied and Environmental Microbiology, 2003, vol. 69 (1), pp. 18-23.
Lina G., et al., “Involvement of Panton-Valentine Leukocidin-Producing Staphylococcus aureus in Primary Skin Infections and Pneumonia,” Clinical Infectious Diseases, 1999, vol. 29 (5), pp. 1128-1132.
Linssen B., et al., “Development of Reverse Transcription-PCR Assays Specific for Detection of Equine Encephalitis Viruses,” Journal of Clinical Microbiology, 2000, vol. 38 (4), pp. 1527-1535.
Little D.P., et al., “MALDI on a Chip: Analysis of Arrays of Low-Femtomole to Subfemtomole Quantities of Synthetic Oligonucleotides and DNA Diagnostic Products Dispensed by a Piezoelectric Pipet,” Analytical Chemistry, 1997, vol. 69, pp. 4540-4546.
Little D.P., et al, “Rapid Sequencing of Oligonucleotides by High-Resolution Mass Spectrometry,” Journal of the American Chemical Society, 1994, vol. 116 (11), pp. 4893-4897.
Liu C., et al., “Improving the Microdialysis Procedure for Electrospray Ionization Mass Spectrometry of Biological Samples,” Journal of Mass Spectrometry, 1997, vol. 32 (4), pp. 425-431.
Liu J.H., et al., “Interregional Transmission of the Internal Protein Genes of H2 Influenza Virus in Migratory Ducks from North America to Eurasia,” Virus Genes, 2004, vol. 29 (1), pp. 81-86.
Liu Y., et al., “An Unusual Gene Arrangement for the Putative Chromosome Replication Origin and Circadianexpression of dnaN in Synechococcus sp. Strain PCC 7942,” Gene, 1996, vol. 172 (1), pp. 105-109.
Livermore D.M., “The Threat from the Pink Corner,” Annals of Medicine, 2003, vol. 35 (4), pp. 226-234.
Loakes D., et al., “Nitroindoles as Universal Bases,” Nucleosides and Nucleotides, 1995, vol. 14 (3-5), pp. 1001-1003.
Loo J.A., et al., “Applying Charge Discrimination with Electrospray Ionization-Mass Spectrometry to Protein Analysis,” Journal of American Society for Mass Spectrometry, 1995, vol. 6, pp. 1098-1104.
Lott T.J., et al., “Nucleotide Sequence Analysis of the 5-8s rDNA and Adjacent ITS2 Region of Candidaalbicans and Related Species,” Yeast, 1993, vol. 9, pp. 1199-1206.
Louie L., et al., “Evaluation of Three Rapid Methods for Detection of Methicillin Resistance in Staphylococcus aureus,” Journal of Clinical Microbiology, 2000, vol. 38 (6), pp. 2170-2173.
Love B.C., et al., “Cloning and Sequence of the GroESL Heat-Shock Operon of Pasteurella Multocida,” Gene, 1995, vol. 166 (1), pp. 179-180.
Lovseth A., et al., “Modified Multiplex PCR Method for Detection of Pyrogenic Exotoxin Genes in Staphylococcal Isolates,” Journal of Clinical Microbiology, 2004, vol. 42 (8), pp. 3869-3872.
Lowe T., et al., “A Computer Program for Selection of Oligonucleotide Primers for Polymerase Chain Reactions,” Nucleic Acids Research, 1990, vol. 18 (7), pp. 1757-1761.
Lu X., et al., “Molecular Typing of Human Adenoviruses by PCR and Sequencing of a Partial Region of the Hexon Gene,” Archives of Virology, 2006, vol. 151 (8), pp. 1587-1602.
Lubman D.M., Application for Continuation Grant by David Mitchell Lubman dated Jun. 4, 1996 and Jun. 14, 1996.
Lubman D.M., Application for Continuation Grant by David Mitchell Lubman dated Jun. 10, 1994 and Jun. 24, 1994.
Lubman D.M., Application for Grant by David Mitchell Lubman dated Sep. 1, 1994 and Sep. 27, 1994.
Lubman D.M., Application for Grant by David Mitchell Lubman dated Oct. 25, 1992 and Oct. 29, 1992.
Ludwig S.L., et al., “Prevalence of Antibodies to Adenovirus Serotypes 4 and 7 among Unimmunized US Army Trainees: Results of a Retrospective Nationwide Seroprevalence Survey,” The Journal of Infectious Diseases, 1998, vol. 178 (6), pp. 1776-1778.
Ludwig W., et al., “Bacterial Phylogeny Based on 16S and 23S rRNA Sequence Analysis,” FEMS Microbiolofy Reviews, 1994, vol. 15 (2-3), pp. 155-173.
Lukashov V.V., et al., “Evolutionary Relationships among Parvoviruses: Virus-Host Coevolution among Autonomous Primate Parvoviruses and Links between Adeno-Associated and Avian Parvoviruses,” Journal of Virology, 2001, vol. 75 (6), pp. 2729-2740.
Ma X.X., et al., “Novel Type of Staphylococcal Cassette Chromosome Mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains,” Antimicrobial Agents and Chemotherapy, 2002, vol. 46 (4), pp. 1147-1152.
Mack D.H., et al., “A Sensitive Method for the Identification of Uncharacterized Viruses Related to known Virus Groups: Hepadnavirus Model System,” Proceedings of the National Academy of Sciences, 1988, vol. 85 (18), pp. 6977-6981.
Magnuson V.L., et al., “Substrate Nucleotide-Determined Non-Templated Addition of Adenine by Tag DNA Polymerase: Implications for PCR-Based Genotyping and Cloning,” BioTechniques, 1996, vol. 21 (4), pp. 700-709.
Maiwald M., et al., “Characterization of Contaminating DNA in Taq Polymerase which Occurs During Amplification with a Primer Set for Legionella 5S Ribosomal RNA,” Molecular and Cellular Probes, 1994, vol. 8 (1), pp. 11-14.
Malasig M.D., et al., “Simplified Microneutralization Test for Serotyping Adenovirus Isolates,” Journal of Clinical Microbiology, 2001, vol. 39 (8), pp. 2984-2986.
Mangrum J.D., et al., “Solution Composition and Thermal Denaturation for the Production of Single-Stranded PCR Amplicons: Piperidine-Induced Destabilization of the DNA Duplex,” Journal of the American Society for Mass Spectrometry, 2002, vol. 13 (3), pp. 232-240.
Manian F.A., “Asymptomatic Nasal Carriage of Mupirocin-Resistant, Methicillin-Resistant Staphylococcus aureus (MRSA) in a Pet Dog Associated with MRSA Infection in Household Contacts,” Clinical Infectious Diseases, 2003, vol. 36 (2), pp. e26-e28.
Marks F., et al., “Genotyping of Plasmodium Falciparum Pyrimethamine Resistance by Matrix-Assisted Laser Desorption-Ionization Time-of-Flight Mass Spectrometry,” Antimicrobial Agents and Chemotherapy, 2004, vol. 48 (2), pp. 466-472.
Marmur J., et al., “Strand Separation and Specific Recombination in Deoxyribonucleic Acids: Biological Studies,” Proceedings of the National Academy of Sciences, 1960, vol. 46 (4), pp. 453-461.
Martemyanov K.A., et al., “Extremely Thermostable Elongation Factor (3 from Aquifer aeolicus: Cloning, Expression, Purification, and Characterization in a Heterologous Translation System,” Protein Expression and Purification, 2000, vol. 18 (3), pp. 257-261.
Martineau F., et al., “Development of a PCR Assay for Identification of Staphylococci at Genus and Species Levels,” Journal of Clinical Microbiology, 2001, vol. 39 (7), pp. 2541-2547.
Martineau F., et al., “Species-Specific and Ubiquitous-DNA-Based Assays for Rapid Identification of Staphylococcus aureus,” Journal of Clinical Microbiology, 1998, vol. 36 (3), pp. 618-623.
Martin-Lopez J.V., et al., “Simultaneous PCR Detection of Ica Cluster and Methicillin and Mupirocinresistance Genes in Catheter-Isolated Staphylococcus,” International Microbiology, 2004, vol. 7 (1), pp. 63-66.
Mason V.P., et al., “Diversity and linkage of Replication and Mobilisation Genes in Bacillus Rolling Irclereplicating Plasmids from Diverse Geographical Origins,” FEMS Microbiology Ecology, 2002, vol. 42 (2), pp. 235-241.
Matray T.J., et al., “Synthesis and Properties of RNA Analogs—Oligoribonucleotide N3→p5 Phosphoramidates,” Nucleic Acids Research, 1999, vol. 27 (20), pp. 3976-3985.
Matsuoka M., et al., “Characteristic Expression of Three Genes, msr(a), mph(C) and erm(Y), Thatconfer Resistance to Macrolide Antibiotics on Staphylococcus aureus,” FEMS Microbiology Letters, 2003, vol. 220 (2), pp. 287-293.
May A.C., “Percent Sequence Identity: The Need to be Explicit,” Structure, 2004, vol. 12 (5), pp. 737-738.
McCabe K.M., et al., “Bacterial Species Identification After DNA Amplification with a Universal Primer Pair,” Molecular Genetics and Metabolism, 1999, vol. 66 (3), pp. 205-211.
McLafferty F.W., et al., “Comparison of Algorithms and Databases for Matching Unknown Mass Spectra,” Journal of the American Society for Mass Spectrometry, 1998, vol. 9 (1), pp. 92-95.
McLuckey S.A., et al., “Ion Trap Tandem Mass Spectrometry Applied to Small Multiply Charged Oligonucleotides with a Modified Base,” Journal of the American Society for Mass Spectrometry, 1994, vol. 5, pp. 740-747.
Mehrotra M., et al., “Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance,” Journal of Clinical Microbiology, 2000, vol. 38 (3), pp. 1032-1035.
Meiyu F., et al., “Detection of Flaviviruses by Reverse Transcriptase-Polymerase Chain Reaction with the Universal Primer Set,” Microbiology and Immunology, 1997, vol. 41 (3), pp. 209-213.
Mellor J., et al., “Genotype Dependence of Hepatitis C Virus Load Measurement in Commercially Available Quantitative Assays,” Journal of Clinical Microbiology, 1999, vol. 37 (8), pp. 2525-2532.
Merlino J., et al., “New Chromogenic Identification and Detection of Staphylococcus aureus and Methicillin-Resistant S. aureus,” Journal of Clinical Microbiology, 2000, vol. 38 (6), pp. 2378-2380.
Merlino J., et al., “Rapid Detection of Non-Multidrug-Resistant and Multidrug-Resistant Methicillin-Resistant Staphylococcus aureus Using Cycling Probe Technology for the mecA Gene,” European Journal of Clinical Microbiology and Infectious Diseases, 2003, vol. 22 (5), pp. 322-323.
Messmer T.O., et al., “Discrimination of Streptococcus pneumoniae from Other Upper respiratory tract Streptococci by Arbitrary Primed PCR,” Clinical Biochemistry, 1995, vol. 28 (6), pp. 567-572.
Metzgar D., et al., “PCR Analysis of Egyptian Respiratory Adenovirus Isolates, Including Identification of Species, Serotypes and Coinfections,” Journal of Clinical Microbiology, 2005, vol. 43 (11), pp. 5743-5752.
Miller K.W., et al., “A Compendium of Human Mitochondria! DNA Control Region: Development of an International Standard Forensic Database,” Croatian Medical Journal, 2001, vol. 42 (3), pp. 315-327.
Miragaia M., et al., “Genetic Diversity among Methicillin-Resistant Staphylococcus epidemidis(MRSE),” Microbial Drug Resistance, 2005, vol. 11 (2), pp. 83-93.
Miura-Ochiai R., et al., “Quantitative Detection and Rapid Identification of Human Adenoviruses,” Journal of Clinical Microbiology, 2007, vol. 45 (3), pp. 958-967.
Mollet C., et al., “RpoB Sequence Analysis as a Novel Basis for Bacterial Identification,” Molecular Microbiology, 1997, vol. 26 (5), pp. 1005-1011.
Monroy A.M., et al., “Exvaluation of Reverse Transcriptase Polymerase Chain Reaction for the Detection of Eastern Equine Encephalumyelitis Virus during Vector Surveillance,” Journal of Medical Entomology, 1996, vol. 33 (3), pp. 449-457.
Moore C., et al., “Development and Evaluation of a Real-Time Nucleic Acid Sequence Based Amplification Assay for Rapid Detection of Influenza A,” Journal of Medical Virology, 2004, vol. 74 (4), pp. 619-628.
Moricca S., et al., “Detection of Fusarium oxysporum f.sp. vasinfectum in Cotton Tissue by Polymerase Chain Reaction,” Plant Pathology, 1998, vol. 47 (4), pp. 486-494.
Morinaga N., et al., “Purification, Cloning and Charactarizarion of Variant LukE-LukD with Strong Leukocidal Activity of Staphylococcal Bi-Component Leukotoxin Family,” Microbiology and Immunology, 2003, vol. 47 (1), pp. 81-90.
Morse R., et al., “Nucleotide Sequence of Part of the ropC Gene Encoding the B Subunit of DNA Dependent RNA Polymerase from some Gram-Positive Bacteria and Comparative Amino Acid Sequence Analysis,” Systematic and Applied Microbiology, 1996, vol. 19, pp. 150-157.
Muddiman D.C., et al., “Application of Secondary Ion and Matrix-Assisted Laser Desorption-Ionization Time-of-Flight Mass Spectrometry for the Quantitative Analysis of Biological Molecules,” Mass Spectrometry Reviews, 1995, vol. 14 (6), pp. 383-429.
Muddiman D.C., et al., “Characterization of PCR Products from Bacilli Using Electrospray Ionization FTICR Mass Spectrometry,” Analytical Chemistry, 1996, vol. 68 (21), pp. 3705-3712.
Muddiman D.C., et al., “Sequencing and Characterization of Larger Oligonucleotides by Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry,” Reviews in Analytical Chemistry, 1998, vol. 17 (1), pp. 1-68.
Muddiman D.C., et al., “Important Aspects Concerning the Quantification of Biomolecules by Time-of-Flight Secondaryion Mass Spectrometry,” Applied Spectrometry, 1996, vol. 50 (2), pp. 161-166.
Muddiman D.C., et al., “Length and Base Composition of PCR-Amplified Nucleic Acids Using Mass Measurements from Electrospray Ionization Mass Spectrometry,” Analytical Chemistry, 1997, vol. 69 (8), pp. 1543-1549.
Muddiman D.C., et al., “Precise Mass Measurement of a Double-Stranded 500 Base-Pair (309 kDa) Polymerase Chain Reaction Product by Negative Ion Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1999, vol. 13 (2), pp. 1201-1204.
Muhammed W.T., et al., “Electrospray Ionization Quadrupole Time-of-Flight Mass Spectrometry and Guadrupole Mass Spectrometry for Genotyping Single Nucleotide Substitutions in Intact Polymerase Chain Reaction Products in K-Ras and p53,” Rapid Communications in Mass Spectrometry, 2002, vol. 16 (24), pp. 2278-2285.
Murakami K., et al., “Identification of Methicillin-Resistant Strains of Staphylococci by Polymerase Chain Reaction,” Journal of Clinical Microbiology, 1991, vol. 29 (10), pp. 2240-2244.
Mushegian A.R., et al., “A Minimal Gene Set for Cellular Life Derived by Comparison of Complete Bacterial Genomes,” Proceedings of the National Academy of Science, 1996, vol. 93 (19), pp. 10268-10273.
Na B.K., et al., “Detection and Typing of Respiratory Adenoviruses in a Single-Tube Multiplex Polymerase Chain Reaction,” Journal of Medical Virology, 2002, vol. 66 (4), pp. 512-517.
Nagpal M.L., et al., “Utility of 16S-23S rRNA Spacer Region Methodology: How Similar are Interspace Regions within a Genome and Between Strains for Closely Related Organisms”, Journal of Microbiological Methods, 1998, vol. 33, pp. 211-219.
Nagy M., et al., “Sequence Analysis of Porcine Adenovirus Serotype 5 Fibre Gene: Evidence for Recombination,” Virus Genes, 2002, vol. 24 (2), pp. 181-185.
Naito Y., et al., “Molecular Mass Measurement of Polymerase Chain Reaction Products Amplified from Human Blood DNA by Electrospray Ionization Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1995, vol. 9 (15), pp. 1484-1486.
Nakagawa S., et al., “Gene Sequences and Specific Detection for Panton-Valentine Leukocidin,” Biochemical and Biophysical Research Communications, 2005, vol. 328 (4), pp. 995-1002.
Nakao H., et al., “Development of a Direct PCR Assay for Detection of the Diphtheria Toxin Gene,” Journal of Clinical Microbiology, 1997, vol. 35 (7), pp. 1651-1655.
Narita S., et al., “Phage Conversion of Panton-Valentine Leukocidin in Staphylococcus aureus: Molecular Analysis of a PVL-Converting Phage, cpSLT,” Gene, 2001, vol. 268 (1-2), pp. 195-206.
Naumov G.I., et al., “Discrimination Between the Soil Yeast Species Williopsis saturnus and Williopsis suaveolens by the Polymerase Chain Reaction with the Universal Primer N21,” Microbiology, 2000, vol. 69 (2), pp. 229-233.
NEB Catalog, 1998/1999, pp. 1, 79, 121 and 284.
Neumann G., et al., “Host Range Restriction and Pathogenicity in the Context of Influenza Pandemic,” Emerging Infectious Diseases, 2006, vol. 12 (6), pp. 881-886.
Newcombe J., et al., “PCR of Peripheral Blood for Diagnosis of Meningococcal Disease,” Journal of Clinical Microbiology, 1996, vol. 34 (7), pp. 1637-1640.
Ng E.K., et al., “Serial Analysis of the Plasma Concentration of SARS Coronavirus RNA in Pediatric Patients with Severe Acute Respiratory Syndrome,” Clinical Chemistry, 2003, vol. 49 (12), pp. 2085-2088.
Ng E.K., et al., “Quantitative Analysis an Prognostic Implication of SARS Coronavirus RNA in the Plasma and Serum of Patients with Severe Acute Respiratory Syndrome,” Clinical Chemistry, 2003, vol. 49 (12), pp. 1976-1980.
Ni J., et al., “Interpretation of Oligonucleotide Mass Spectra for Determinationof Sequence Using Electrospray Ionization and Tandem Mass Spectrometry,” Analytical Chemistry, 1996, vol. 68 (13), pp. 1989-1999.
Nilsson M., et al., “Evaluation of Mitochondrial DNA Coding Region Assays for Increased Discrimination in Forensic Analysis,” Forensic Science International: Genetics, 2008, vol. 2 (1), pp. 1-8.
Nishikawa T., et al., “Reconstitution of Active Recombinant Ship Toxin (Stc)1 from Recombinant Stxl-A and Sbtl-B Subunits Independently Produced by E. coli Clones,” FEMS Microbiol Letters, 1999, vol. 178 (1), pp. 13-18.
Non-Final Office Action mailed Feb. 2, 2007 for U.S. Appl. No. 10/844,938, filed May 12, 2004.
Non-Final Office Action mailed Oct. 2, 2009 for U.S. Appl. No. 11/929,707, filed Oct. 30, 2007.
Non-Final Office Action mailed Aug. 4, 2010 for U.S. Appl. No. 12/049,949, filed Mar. 17, 2008.
Non-Final Office Action mailed Apr. 6, 2009 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Non-Final Office Action mailed Oct. 6, 2008 for U.S. Appl. No. 11/070,632, filed Mar. 2, 2005.
Non-Final Office Action mailed Apr. 7, 2006 for U.S. Appl. No. 10/964,571, filed Oct. 12, 2004.
Non-Final Office Action mailed Aug. 7, 2007 for U.S. Appl. No. 10/844,938, filed May 12, 2004.
Non-Final Office Action mailed Jun. 10, 2009 for U.S. Appl. No. 10/844,938, filed May 12, 2004.
Non-Final Office Action mailed Jan. 12, 2010 for U.S. Appl. No. 11/491,376, filed Jul. 21, 2006.
Non-Final Office Action mailed Oct. 13, 2010 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Non-Final Office Action mailed Sep. 16, 2009 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Non-Final Office Action mailed Apr. 17, 2009 for U.S. Appl. No. 12/211,641, filed Sep. 16, 2008.
Non-Final Office Action mailed Nov. 19, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Non-Final Office Action mailed Aug. 20, 2007 for U.S. Appl. No. 11/582,863, filed Oct. 17, 2006.
Non-Final Office Action mailed Jun. 20, 2007 for U.S. Appl. No. 11/136,134, filed May 24, 2005.
Non-Final Office Action mailed May 20, 2008 for U.S. Appl. No. 10/844,938, filed May 12, 2004.
Non-Final Office Action mailed Oct. 20, 2004 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Non-Final Office Action mailed Feb. 23, 2009 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Non-Final Office Action mailed Mar. 26, 2008 for U.S. Appl. No. 11/136,134, filed May 24, 2005.
Non-Final Office Action mailed May 26, 2010 for U.S. Appl. No. 11/869,449, filed Oct. 9, 2007.
Non-Final Office Action mailed Jul. 27, 2006 for U.S. Appl. No. 11/209,439, filed Aug. 8, 2005.
Non-Final Office Action mailed Jun. 28, 2010 for U.S. Appl. No. 11/930,002, filed Oct. 30, 2007.
Non-Final Office Action mailed Sep. 28, 2009 for U.S. Appl. No. 11/930,017, filed Oct. 30, 2007.
Non-Final Office Action mailed Dec. 29, 2010 for U.S. Appl. No. 12/616,422, filed Nov. 11, 2009.
Non-Final Office Action mailed Sep. 29, 2009 for U.S. Appl. No. 11/930,002, filed Oct. 30, 2007.
Non-Final Office Action mailed Apr. 30, 2010 for U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
Norder H., et al., “Typing of Hepatitis B Virus Genomes by a Simplified Polymerase Chain Reaction,” Journal of Medical Virology, 1990, vol. 31 (3), pp. 215-221.
Nordhoff E., et al., “Matrix Assisted Laser Desorption/Ionization Mass Spectrometry of Nucleic Acids with Wavelengths in the Ultraviolet and Infrared,” Rapid Communications in Mass Spectrometry, 1992, vol. 6 (12), pp. 771-776.
Notice of Allowance mailed Apr. 1, 2011 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Notice of Allowance mailed Jun. 3, 2009 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Notice of Allowance mailed Aug. 5, 2010 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Notice of Allowance mailed Aug. 6, 2009 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Notice of Allowance mailed Aug. 9, 2011 for U.S. Appl. No. 11/930,002, filed Oct. 30, 2007.
Notice of Allowance mailed Jun. 9, 2011 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Notice of Allowance mailed Jun. 9, 2011 for U.S. Appl. No. 11/491,376, filed Jul. 21, 2006.
Notice of Allowance mailed Dec. 10, 2010 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Notice of Allowance mailed Dec. 10, 2010 for U.S. Appl. No. 11/491,376, filed Jul. 21, 2006.
Notice of Allowance mailed Feb. 12, 2009 for U.S. Appl. No. 11/136,134, filed May 24, 2005.
Notice of Allowance mailed Nov. 12, 2009 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Notice of Allowance mailed Dec. 15, 2008 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Notice of Allowance mailed Sep. 18, 2009 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Notice of Allowance mailed May 21, 2009 for U.S. Appl. No. 11/136,134, filed May 24, 2005.
Notice of Allowance mailed Nov. 24, 2009 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Notice of Allowance mailed May 25, 2011 for U.S. Appl. No. 11/929,707, filed Oct. 30, 2007.
Notice of Allowance mailed Oct. 29, 2009 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Notice of Allowance mailed Oct. 31, 2008 for U.S. Appl. No. 11/136,134, filed May 24, 2005.
Nubel U.,et al., “PCR Primers to Amplify 16S rRNA Genes from Cyanobacteria,” Applied and Environmental Microbiology, 1997, vol. 63 (8), pp. 3327-3332.
Null Allison P., et al., “Enzymatic Strategies for the Characterization of Nucleic Acids by Electrospray Ionization Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 2003, vol. 17 (24), pp. 2699-2706.
Null A.P., et al., “Determination of a Correction to Improve Mass Measurement Accuracy of Isotopically Unresolved Polymerase Chain Reaction Amplicons by Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 2003, vol. 17 (15), pp. 1714-1722.
Null A.P., et al., “Evaluation of Sample Preparation Techniques for Mass Measurements of PCR Products Using ESIFT-ICR Mass Spectrometry,” The American Society for Mass Spectrometry, 2002, vol. 13 (4), pp. 338-344.
Null A.P., et al., “Genotyping of Simple and Compound Short Tandem Repeat Loci Using Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry,” Analytical Chemistry, 2001, vol. 73 (18), pp. 4514-4521.
Null A.P., et al., “Implications of Hydrophobicity and Free Energy of Solvation for Characterization of Nucleic Acids by Electrospray Ionization Mass Spectrometry,” Analytical Chemistry, 2003, vol. 75 (6), pp. 1331-1339.
Null A.P., et al., “Perspectives on the Use of Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry for Short Tandem Repeat Genotyping in the Post Genome Era,” Journal of Mass Spectrometry, 2001, vol. 36 (6), pp. 589-606.
Null A.P., et al., “Preparation of Single-Stranded PCR Products for Electrospray Ionization Mass Spectrometry Using the DNA Repair Enzyme Lambda Exonuclease,” Analyst, 2000, vol. 125 (4), pp. 619-626.
Nunes E.L., et al., “Detection of IleS-2 Gene Encoding Mupirocin Resistance in Methicillin-Resistant Staphylococcus aureus by Multiplex PCR,” Diagnostic Microbiology and Infectious Disease, 1999, vol. 34 (2), pp. 77-81.
Nygren M., et al., “Quantification of HIV-1 Using Multiple Quantitative Polymerase Chain Reaction Standards and Bioluminometric Detection,” Analytical Biochemistry, 2001, vol. 288 (1), pp. 28-38.
Oberacher H., et al., “Analysis of Polymerase Chain Reaction Products by On-Line Liquid Chromatography Mass Spectrometry for Genotyping of Polymeric Short tandem Repeat Loci,” Analytical Chemistry, 2001, vol. 73 (21), pp. 5109-5115.
Oberacher H., et al., “Increased Foresnic Efficiency of DNA Fingerprints Through Simultaneous Resolution of Length and Nucleotide Variability by High-Performance Mass Spectrometry,” Human Mutation, 2008, vol. 29 (3), pp. 427-432.
Oberste M.S., et al., “Improved Molecular Identification of Enteroviruses by RT-PCR and Amplicon Sequencing,” Journal of Clinical Virology, 2003, vol. 26 (3), pp. 375-377.
Oberste M.S., et al., “Molecular Epidemiology and Type-Specific Detection of Echovirus 11 Isolates from the Americas, Europe, Africa, Australia, Southern Asia and the Middle East,” Virus Research, 2003, vol. 91 (2), pp. 241-248.
Oberste M.S., et al., “Molecular Phylogeny and Proposed Classification of the Simian Picornaviruses,” Journal of Virology, 2002, vol. 76 (3), pp. 1244-1251.
Office Action mailed Mar. 23, 2009 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Apr. 1, 2004 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Jul. 1, 2008 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed May 1, 2006 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Feb. 2, 2011 for U.S. Appl. No. 11/869,449, filed Oct. 9, 2007.
Office Action mailed Jan. 2, 2009 for U.S. Appl. No. 11/060,135, filed Feb. 17, 2005.
Office Action mailed Jul. 2, 2009 for U.S. Appl. No. 11/582,930, filed Oct. 17, 2006.
Office Action mailed Jun. 2, 2006 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Jun. 2, 2006 for U.S. Appl. No. 10/933,928, filed Sep. 3, 2004.
Office Action mailed Jun. 2, 2008 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Office Action mailed May 2, 2008 for U.S. Appl. No. 11/582,930, filed Oct. 17, 2006.
Office Action mailed Oct. 2, 2008 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Office Action mailed Oct. 2, 2009 for Japanese Application No. 2005508560 filed Dec. 5, 2003.
Office Action mailed Aug. 3, 2006 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Aug. 3, 2009 for U.S. Appl. No. 11/754,174, filed May 25, 2007.
Office Action mailed Dec. 3, 2003 for U.S. Appl. No. 10/325,527, filed Dec. 18, 2002.
Office Action mailed Feb. 3, 2011 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Office Action mailed Nov. 3, 2008 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Apr. 4, 2008 for U.S. Appl. No. 10/829,826, filed Apr. 22, 2004.
Office Action mailed Dec. 4, 2006 for Indian Application No. 1136KOLNP2003 filed Mar. 4, 2002.
Office Action mailed Feb. 4, 2009 for U.S. Appl. No. 11/404,561, filed Apr. 12, 2006.
Office Action mailed Jun. 4, 2009 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed May 4, 2010 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed May 4, 2010 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Nov. 4, 2009 for European Application No. 02709785.6 filed Mar. 4, 2002.
Office Action mailed Sep. 4, 2008 for Australian Application No. 2003297687 filed Dec. 5, 2003.
Office Action mailed Aug. 5, 2010 for European Application No. 02709785.6 filed Mar. 4, 2002.
Office Action mailed Feb. 5, 2009 for Canadian Application No. 2525498 filed May 13, 2004.
Office Action mailed Sep. 5, 2006 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Office Action mailed Dec. 6, 2007 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Jan. 6, 2011 for Israel Application No. 157661 filed Mar. 4, 2002.
Office Action mailed Jul. 6, 2006 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Jul. 6, 2007 for U.S. Appl. No. 10/829,826, filed Apr. 22, 2004.
Office Action mailed Mar. 6, 2009 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Office Action mailed Nov. 6, 2002 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Apr. 7, 2009 for Canadian Application No. 2567839 filed May 24, 2005.
Office Action mailed Apr. 7, 2009 for European Application No. 07760292.8 filed Apr. 6, 2007.
Office Action mailed Apr. 7, 2009 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Aug. 7, 2007 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Feb. 7, 2008 for European Application No. 03796752.8 filed Dec. 5, 2003.
Office Action mailed Jun. 7, 2010 for European Application No. 06800205.4 filed Jul. 21, 2006.
Office Action mailed Jan. 8, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Jan. 8, 2007 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Jun. 8, 2007 for U.S. Appl. No. 11/210,516, filed Aug. 24, 2005.
Office Action mailed Jun. 8, 2007 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Office Action mailed Mar. 8, 2005 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Mar. 8, 2007 for U.S. Appl. No. 11/060,135, filed Feb. 17, 2005.
Office Action mailed Sep. 8, 2006 for Chinese Application No. 02809122.1 filed Mar. 4, 2002.
Office Action mailed Dec. 9, 2004 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Dec. 9, 2009 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Dec. 9, 2009 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Dec. 9, 2009 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Feb. 9, 2007 for Chinese Application No. 02809122.1 filed Mar. 4, 2002.
Office Action mailed Jan. 9, 2008 for Japanese Application No. 2002570692 filed Mar. 4, 2002.
Office Action mailed Jul. 9, 2008 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Jul. 9, 2008 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Office Action mailed Mar. 9, 2004 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Nov. 9, 2010 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Office Action mailed Apr. 10, 2006 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Dec. 10, 2008 for U.S. Appl. No. 10/829,826, filed Apr. 22, 2004.
Office Action mailed Dec. 10, 2009 for U.S. Appl. No. 11/929,910, filed Oct. 30, 2007.
Office Action mailed Feb. 10, 2005 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Feb. 10, 2006 for Australian Application No. 2002244250 filed Mar. 4, 2002.
Office Action mailed Jul. 10, 2007 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Office Action mailed Jun. 10, 2009 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Jun. 10, 2010 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Jun. 10, 2010 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Oct. 10, 2007 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Sep. 10, 2008 for Australian Application No. 2003302236 filed Dec. 5, 2003.
Office Action mailed Aug. 11, 2005 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Aug. 11, 2010 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Aug. 11, 2010 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Dec. 11, 2007 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Jul. 11, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Jun. 11, 2010 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Mar. 11, 2005 for U.S. Appl. No. 10/325,527, filed Dec. 18, 2002.
Office Action mailed May 11, 2007 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Jul. 12, 2006 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Jul. 12, 2006 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Office Action mailed Jun. 12, 2008 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Jun. 12, 2009 for Chinese Application No. 200480016187.9 filed May 13, 2004.
Office Action mailed Mar. 12, 2008 for European Application No. 06849755.1 filed Apr. 12, 2006.
Office Action mailed May 12, 2002 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Aug. 13, 2009 for U.S. Appl. No. 11/674,538, filed Feb. 13, 2007.
Office Action mailed Jul. 13, 2004 for U.S Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Jul. 13, 2007 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Office Action mailed Jul. 13, 2010 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Office Action mailed Mar. 13, 2006 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Office Action mailed Mar. 13, 2006 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Nov. 13, 2003 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Sep. 13, 2006 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Jul. 14, 2004 for U.S. Appl. No. 10/326,642, filed Dec. 18, 2002.
Office Action mailed Jun. 14, 2004 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Mar. 14, 2011 for U.S. Appl. No. 11/930,002, filed Oct. 30, 2007.
Office Action mailed Oct. 14, 2004 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Sep. 14, 2007 for U.S. Appl. No. 11/582,930, filed Oct. 17, 2006.
Office Action mailed Apr. 15, 2008 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Aug. 15, 2008 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Office Action mailed Dec. 15, 2008 for Israel Application No. 157661 filed Mar. 4, 2002.
Office action mailed Dec. 15, 2010 for Canadian Application No. 2508726 filed Dec. 5, 2003.
Office Action mailed Jan. 15, 2008 for Israel Application No. 157661 filed Mar. 4, 2002.
Office Action mailed Jul. 15, 2009 for U.S. Appl. No. 11/060,135, filed Feb. 17, 2005.
Office Action mailed Mar. 15, 2010 for European Application No. 08730682.5 filed Feb. 25, 2008.
Office Action mailed Nov. 15, 2007 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Office Action mailed Sep. 15, 2005 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Apr. 16, 2002 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Apr. 16, 2008 for U.S. Appl. No. 11/233,630, filed Sep. 21, 2005.
Office Action mailed Apr. 16, 2008 for U.S. Appl. No. 11/409,535, filed Apr. 21, 2006.
Office Action mailed Apr. 16, 2009 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Aug. 16, 2004 for U.S. Appl. No. 10/325,527, filed Dec. 18, 2002.
Office Action mailed Aug. 16, 2010 for U.S. Appl. No. 11/929,707, filed Oct. 30, 2007.
Office Action mailed Feb. 16, 2011 for U.S. Appl. No. 11/929,910, filed Oct. 30, 2007.
Office Action mailed Jan. 16, 2009 for U.S. Appl. No. 11/582,930, filed Oct. 17, 2006.
Office Action mailed Jul. 16, 2007 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Office Action mailed Mar. 16, 2006 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Mar. 16, 2010 for Canadian Application No. 2616281 filed Jul. 21, 2006.
Office Action mailed May 16, 2008 for U.S. Appl. No. 11/404,561, filed Apr. 12, 2006.
Office Action mailed Nov. 16, 2009 for Japanese Application No. 2005508488 filed Dec. 5, 2003.
Office Action mailed Jul. 17, 2009 for U.S. Appl. No. 11/929,707, filed Oct. 30, 2007.
Office Action mailed Jun. 17, 2008 for U.S. Appl. No. 11/582,863, filed Oct. 17, 2006.
Office Action mailed Mar. 17, 2006 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Nov. 17, 2006 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Oct. 17, 2007 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Oct. 17, 2008 for U.S. Appl. No. 11/331,978, filed Jan. 13, 2006.
Office Action mailed Sep. 17, 2008 for European Application No. 03796752.8 filed Dec. 5, 2003.
Office Action mailed Sep. 17, 2008 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Aug. 18, 2009 for U.S. Appl. No. 11/685,598, filed Mar. 13, 2007.
Office Action mailed Dec. 18, 2002 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Feb. 18, 2010 for European Application No. 03814656.9 filed Dec. 5, 2003.
Office Action mailed Jan. 18, 2011 for U.S. Appl. No. 11/930,108, filed Oct. 31, 2007.
Office Action mailed May 18, 2005 for New Zealand Application No. 527857 filed Mar. 4, 2002.
Office Action mailed Sep. 18, 2006 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Office Action mailed Sep. 18, 2008 for Australian Application No. 2003298030 filed Dec. 5, 2003.
Office Action mailed Sep. 18, 2008 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Jan. 19, 2007 for U.S. Appl. No. 11/059,776, filed Feb. 17, 2005.
Office Action mailed May 19, 2005 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Nov. 19, 2004 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Oct. 19, 2007 for U.S. Appl. No. 11/210,516, filed Aug. 24, 2005.
Office Action mailed Sep. 19, 2006 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Sep. 19, 2007 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Apr. 20, 2007 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Apr. 20, 2009 for U.S. Appl. No. 10/891,337, filed Jul. 14, 2004.
Office Action mailed Dec. 20, 2006 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Jul. 20, 2005 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Jun. 20, 2002 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed May 20, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Nov. 20, 2003 for U.S. Appl. No. 10/323,438, filed Dec. 18, 2002.
Office Action mailed Nov. 20, 2006 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Nov. 20, 2006 for European Application No. 02709785.6 filed Mar. 4, 2002.
Office Action mailed Sep. 20, 2010 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Sep. 20, 2010 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Apr. 21, 2009 for U.S. Appl. No. 90/010,209, filed Jun. 27, 2008.
Office Action mailed Dec. 21, 2006 for U.S. Appl. No. 11/060,135, filed Feb. 17, 2005.
Office Action mailed Mar. 21, 2008 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed May 21, 2008 for U.S. Appl. No. 10/943,344, filed Sep. 17, 2004.
Office Action mailed Nov. 21, 2003 for U.S. Appl. No. 10/326,642, filed Dec. 18, 2002.
Office Action mailed Nov. 21, 2006 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Office Action mailed Oct. 21, 2005 for U.S. Appl. No. 10/326,641, filed Dec. 18, 2002.
Office Action mailed Oct. 21, 2009 for U.S. Appl. No. 12/326,800, filed Dec. 2, 2008.
Office Action mailed Apr. 22, 2009 for U.S. Appl. No. 11/491,376, filed Jul. 21, 2006.
Office Action mailed Jul. 22, 2008 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Jul. 22, 2008 for U.S. Appl. No. 90/010,209, filed Jun. 27, 2008.
Office Action mailed Jul. 22, 2008 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Nov. 22, 2006 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Office Action mailed Oct. 22, 2007 for U.S. Appl. No. 11/331,987, filed Jan. 13, 2006.
Office Action mailed Sep. 22, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Sep. 22, 2010 for Canadian Application No. 2510007 filed Dec. 5, 2003.
Office Action mailed Apr. 23, 2010 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Feb. 23, 2009 for U.S. Appl. No. 10/943,344, filed Sep. 17, 2004.
Office Action mailed Jan. 23, 2008 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Jan. 23, 2008 for U.S. Appl. No. 11/059,776, filed Feb. 17, 2005.
Office Action mailed Jul. 23, 2009 for U.S. Appl. No. 11/070,632, filed Mar. 2, 2005.
Office Action mailed May 23, 2003 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed May 23, 2005 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed Oct. 23, 2003 for New Zealand Application No. 527857 filed Mar. 4, 2002.
Office Action mailed Apr. 24, 2009 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Apr. 24, 2009 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Aug. 24, 2010 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Dec. 24, 2004 for New Zealand Application No. 527857 filed Mar. 4, 2002.
Office Action mailed Feb. 24, 2004 for U.S. Appl. No. 10/326,642, filed Dec. 18, 2002.
Office Action mailed Jan. 24, 2005 for U.S. Appl. No. 10/326,642, filed Dec. 18, 2002.
Office Action mailed Jan. 24, 2007 for U.S. Appl. No. 10/660,998, filed Sep. 12, 2003.
Office Action mailed Jul. 24, 2007 for Mexican Application No. PAA2003007927 filed Sep. 2, 2003.
Office Action mailed Jul. 24, 2007 for U.S. Appl. No. 11/060,135, filed Feb. 17, 2005.
Office Action mailed Jul. 24, 2009 for U.S. Appl. No. 11/754,182, filed May 25, 2007.
Office Action mailed Jun. 24, 2008 for European Application No. 06800205.4 filed Jul. 21, 2006.
Office Action mailed Mar. 24, 2011 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Office Action mailed Nov. 24, 2009 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Sep. 24, 2009 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Aug. 25, 2009 for U.S. Appl. No. 11/754,169, filed May 25, 2007.
Office Action mailed Jun. 25, 2009 for U.S. Appl. No. 11/869,449, filed Oct. 9, 2007.
Office Action mailed Jun. 25, 2009 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Mar. 25, 2008 for U.S. Appl. No. 11/060,135, filed Feb. 17, 2005.
Office Action mailed Apr. 26, 2007 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Office Action mailed Aug. 26, 2003 for U.S. Appl. No. 09/891,793, filed Jun. 26, 2001.
Office Action mailed Aug. 26, 2010 for Canadian Application No. 2508584 filed Dec. 5, 2003.
Office Action mailed Jul. 26, 2004 for U.S. Appl. No. 10/323,438, filed Dec. 18, 2002.
Office Action mailed May 26, 2005 for U.S. Appl. No. 10/156,608, filed May 24, 2002.
Office Action mailed May 26, 2006 for U.S. Appl. No. 10/660,997, filed Sep. 12, 2003.
Office Action mailed Feb. 27, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Feb. 27, 2006 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Feb. 27, 2007 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Feb. 27, 2007 for U.S. Appl. No. 10/943,344, filed Sep. 17, 2004.
Office Action mailed Jul. 27, 2006 for U.S. Appl. No. 10/728,486, filed Dec. 5, 2003.
Office Action mailed Jul. 27, 2009 for Canadian Application No. 2439655 filed Mar. 4, 2002.
Office Action mailed Mar. 27, 2007 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Mar. 27, 2009 for U.S. Appl. No. 11/930,002, filed Oct. 30, 2007.
Office Action mailed Aug. 28, 2006 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Feb. 28, 2006 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Office Action mailed Jul. 28, 2009 for U.S. Appl. No. 11/754,163, filed May 25, 2007.
Office Action mailed Jul. 28, 2010 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed May 28, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Mar. 29, 2010 for Australian Application No. 2006272776 filed Jul. 21, 2006.
Office Action mailed May 29, 2007 for U.S. Appl. No. 11/059,776, filed Feb. 17, 2005.
Office Action mailed Oct. 29, 2009 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Oct. 29, 2009 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed Sep. 29, 2005 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Sep. 29, 2009 for U.S. Appl. No. 10/418,514, filed Apr. 18, 2003.
Office Action mailed Aug. 30, 2007 for U.S. Appl. No. 10/754,415, filed Jan. 9, 2004.
Office Action mailed Jul. 30, 2008 for Australian Application No. 2004248107 filed Apr. 23, 2004.
Office Action mailed Jul. 30, 2009 for Japanese Application No. 2002570692 filed Mar. 4, 2002.
Office Action mailed Jun. 30, 2004 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Jun. 30, 2010 for U.S. Appl. No. 90/010,210, filed Jun. 27, 2008.
Office Action mailed Jun. 30, 2010 for U.S. Appl. No. 90/010,447, filed Apr. 9, 2009.
Office Action mailed Jun. 30, 2010 for U.S. Appl. No. 90/010,448, filed Apr. 9, 2009.
Office Action mailed May 30, 2006 for U.S. Appl. No. 10/660,996, filed Sep. 12, 2003.
Office Action mailed Nov. 30, 2009 for U.S. Appl. No. 10/660,122, filed Sep. 11, 2003.
Office Action mailed Sep. 30, 2005 for Chinese Application No. 02809122.1 filed Mar. 4, 2002.
Office Action mailed Jan. 31, 2003 for U.S. Appl. No. 09/798,007, filed Mar. 2, 2001.
Office Action mailed Jan. 31, 2007 for Philippines Application No. PH12003500824 filed Mar. 4, 2002.
Office Action mailed Oct. 31, 2007 for U.S. Appl. No. 11/409,535, filed Apr. 21, 2006.
Office Action mailed Oct. 31, 2008 for U.S. Appl. No. 11/491,376, filed Jul. 21, 2006.
O″Guinn M.L., et al., “Field Detection of Eastern Equine Encephalitis Virus in the Amazon Basin Region of Peru Using Reverse Transcription-Polymerase Chain Reaction Adapted for FieldIdentification of Arthropod-Borne Pathogens,” American Journal of Tropical Medicine and Hygiene, 2004, vol. 70 (2), pp. 164-171.
Oizumi N., et al., “Relationship Between Mutations in the DNA Gyrase and Topoisomerase IV Genes and Nadifloxacin Resistance in Clinically Isolated Quinolone-Resistant Staphylococcus aureus,” Journal of Infection and Chemotherapy, 2001, vol. 7 (3), pp. 191-194.
Okada M., et al., “Detection and Sequence-Based Typing of Human Adenoviruses Using Sensitiveuniversal Primer Sets for the Hexon Gene,” Archives of Virology, 2007, vol. 152 (1), pp. 1-9.
Okuma K., et al., “Dissemination of New Methicillin-Resistant Staphylococcus aureus Clones in the Community,” Journal of Clinical Microbiology, 2002, vol. 40 (11), pp. 4289-4294.
Oliveira D.C., et al., “Genetic Organization of the Downstream Region of the mecA Element inMethicillin-Resistant Staphylococcus aureus Isolates Carrying Different Polymorphisms of This Region,” Antimicrobial Agents and Chemotherapy, 2000, vol. 44 (7), pp. 1906-1910.
Oliveira D.C., et al., “Multiplex PCR Strategy for Rapid Identification of Structural Types and Variants of the mec Element in Methicillin-Resistant Staphylococcus aureus,” Antimicrobial Agents and Chemotherapy, 2002, vol. 46 (7), pp. 2155-2161.
Olsen B., et al., “Transhemispheric Exchange of Lyme Disease Spyrochetes by Seabirds,” Journal of Clinical Microbiology, 1995, vol. 33 (12), pp. 3270-3274.
Osiowy C., et al., “Direct Detection of Respiratory Syncytial Virus, Parainfluenza Virus, and Adenovirus in Clinical Respiratory Specimens by a Multiplex Reverse Transcription-PCR Assay,” Journal of Clinical Microbiology, 1998, vol. 36 (11), pp. 3149-3154.
Ostrander E.A., et al., “Identification and Characterization of Dinucleotide Repeat (CA)n Markers for Genetic Mapping in Dog,” Genomics, 1993, vol. 16 (1), pp. 207-213.
Ounissi H., et al., “Gene Homogeneity for Aminoglycoside-Modifying Enzymes in Gram-PositiveCocci,” Antimicrobial Agents and Chemotherapy, 1990, vol. 34 (11), pp. 2164-2168.
Palys T., et al., “Discovery and Classification of Ecological Diversity in the Bacterial World: the Role of DNA Sequence Data,” International Journal of Systematic Bacteriology, 1997, vol. 47 (4), pp. 1145-1156.
Pan Z.Q., et al., “Oligonucleotide-Targeted Degradation of U1 and U2 snRNAs Reveals Differential Interactions of Simian Virus 40 pre-mRNAs with snRNPs,” Nucleic Acids Research, 1989, vol. 17 (16), pp. 6553-6568.
Pannetier C., et al., “Quantitative Titration of Nucleic Acids by Enzymatic Amplification Reactions Run to Saturation,” Nucleic Acids Research, 1993, vol. 21 (3), pp. 577-583.
Parson W., et al., “Population Data for 101 Austrian Caucasian Mitochondrial DNA d-Loop Sequences: Application of mtDNA Sequence Analysis to a Forensic Case,” International Journal of Legal Medicine, 1998, vol. 111 (3), pp. 124-132.
Partial European Search Report for Application No. EP01106974, mailed on Dec. 16, 2002, 2 pages.
Pastorino B., et al., “Development of a TaqMan PCR Assay Without RNA Extraction Step for the Detection and Quantification of African Chikungunya Viruses,” Journal of Virological Methods, 2005, vol. 124 (1-2), pp. 65-71.
Paterson A.H., et al., “Fine Mapping of Quantitative Trait Loci Using Selected Overlapping Recombinant Chromosomes, in an Interspecies Cross of Tomato,” Genetics, 1990, vol. 124 (3), pp. 735-742.
Pawa A., et al., “Co-Transfer of Plasmids in Association with Conjugative Transfer of Mupirocin or Mupirocin and Penicillin Resistance in Methicillin-Resistant Staphylococcus aureus,” Journal of Medicinal Microbiology, 2000, vol. 49 (12), pp. 1103-1107.
Payne D., et al., “Antimicrobials: The Challenge of Antibiotic Resistant Bacterial Pathogens: The Medical Need, The Market and Prospects for New Antimicrobial Agents,” Current Opinion in Microbiology, 2004, vol. 7, pp. 435-438.
Peng X., et al., “Rapid Detection of Shigella Species in Environmental Sewage by an Immunocapture PCR with Universal Primers,” Applied and Environmental Microbiology, 2002, vol. 68 (5), pp. 2580-2583.
Perez-Roth E., et al., “Multiplex PCR for Simultaneous Identification of Staphylococcus aureus and Detection of Methicillin and Mupirocin Resistance,” Journal of Clinical Microbiology, 2001, vol. 39 (11), pp. 4037-4041.
Peters S.E., et al., “Quantification of the Detection of Pneumocystis Carinii by DNA Amplification,” Molecular and Cellur Probes, 1992, vol. 6 (2), pp. 115-117.
Pfeffer M., et al., “Genus-Specific Detection of Alphaviruses by a Semi-Nested ReverseTranscription-Polymerase Chain Reaction,” American Journal of Tropical Medicine and Hygiene, 1997, vol. 57 (6), pp. 709-718.
Pfeffer M., et al., “Specific Detection of Chikungunya Virus Using a RT-PCR/Nested PCR Combination,” Journal of Veterinary Medicine B, 2002, vol. 49 (1), pp. 49-54.
Pieles U., et al., “Matrix-Assisted Laser Desorption Ionization Time-of-Flight Spectrometry: APowerful Tool for the Mass and Sequence Analysis of Natural and Modified Oligonucleotides,” Nucleic Acids Research, 1993, vol. 21 (14), pp. 3191-3196.
Pillai S.D., et al., “Rapid Molecular Detection of Microbial Pathogens: Breakthroughs and Challenges,” Archives of Virology, 1997, vol. 13, pp. 67-82.
Piper J., et al., “Commercially Available Technique for Rapid Laboratory Detection of MethicillinResistance Among Staphylococcus aureus,” Diagnostic Microbiology and Infectious Disease, 1988, vol. 11 (3), pp. 177-180.
Poddar S.K., et al., “Detection of Adenovirus using PCR and Molecular Beacon,” Journal of Virological Methods, 1999, vol. 82 (1), pp. 19-26.
Pomerantz S.C., et al., “Determination of Oligonucleotide Composition from Mass Spectrometrically Measured Molecular Weight,” Journal of the American Society for Mass Spectrometry, 1993, vol. 4 (3), pp. 204-209.
Pring-Akerblom P., et al., “Multiplex Polymerase Chain Reaction for Subgenus-Specific Detection of Human Adenoviruses in Clinical Samples,” Journal of Medical Virology, 1999, vol. 58 (1), pp. 87-92.
Pring-Akerblom P., et al., “PCR-Based Detection and Typing of Human Adenoviruses in Clinical Samples,” Research in Virology, 1997, vol. 148 (3), pp. 225-231.
Promega. T4 Polynucleotide Kinase, Technical Bulletin No. 519, 2002.
Puthavathana P., et al., “Molecular Characterization of the Complete Genome of Human Influenza H5N1 Virus Isolates from Thailand,” Journal of General Virology, 2005, vol. 86 (2), pp. 423-433.
Qadri S.M., et al., “Rapid Detection of Methicillin-Resistant Staphylococcus aureus by CrystalMRSA ID System,” Journal of Clinical Microbiology, 1994, vol. 32 (7), pp. 1830-1832.
Raaum R.L., et al., “Catarrhine Primate Divergence Dates Estimated from Complete Mitochondria Genomes: Concordance with Fossil and Nuclear DNA Evidence,” Journal of Human Evolution, 2005, vol. 48 (3), pp. 237-257.
Ramisse V., et al., “Identification and Characterization of Bacillus Anthracis by Multiplex PCR Analysis of Sequences on Plasmids pX01 and pX02 and Chromosomal DNA,” FEMS Microbiology Letters, 1996, vol. 145 (1), pp. 9-16.
Reid S.M., et al., “Primary Diagnosis of Foot-and-Mouth Disease by Reverse Transcription Polymerase Chain Reaction,” Journal of Virological Methods, 2000, vol. 89 (1-2), pp. 167-176.
Reilly K., et al., “Design and Use of 16s Ribosomal DNA-Directed Primers in Competitive PCRs to Enumerate Proteolytic Bacteria in the Rumen,” Microbial Ecology, 2002, vol. 43 (2), pp. 259-270.
Reischl U., “Application of Molecular Biology-Based Methods to theDiagnosis of Infectious Diseases 1, e72-e77.,” Frontiers in Bioscience, 1996, vol. 1 (1), pp. e72-e77.
Reischl U., et al., “Rapid Identification of Methicillin-Resistant Staphylococcus aureus and Simultaneous Species Confirmation Using Real-Time Fluorescence PCR,” Journal of Clinical Microbiology, 2000, vol. 38 (6), pp. 2429-2433.
Roberts M.M., et al., “Three-Dimensional Structure of the Adenovirus Major Coat Protein Hexon,” Science, 1986, vol. 232 (4754), pp. 1148-1151.
Roberts M.S., et al., “Recombination and Migration Rates in Natural Populations of Bacillus Subtilis and Bacillus Mojavensis,” Evolution, 1995, vol. 49 (6), pp. 1081-1094.
Robinson D.A., et al., “Multilocus Sequence Typing and the Evolution of Methicillin-Resistant Staphylococcus aureus,” Clinical Microbiology and Infection, 2004, vol. 10, pp. 92-97.
Rong S., et al., “Design and Application of 60mer Oligonucleotide Microarray in SARS Coronavirus Detection,” Chinese Science Bulletin, 2003, vol. 48 (12), pp. 1165-1169.
Ross P., et al., “High Level Multiplex Genotyping by MALDI-TOF Mass Spectrometry,” Nature Biotechnology, 1998, vol. 16 (13), pp. 1347-1351.
Ross P.L., et al., “Analysis of DNA Fragments from Conventional and Microfabricated PCR Devices Using Delayed Extraction MALDI-TOF Mass Spectrometry,” Analytical Chemistry, 1998, vol. 70 (10), pp. 2067-2073.
Ross P.L., et al., “Discrimination of Single-Nucleotide Polymorphisms in Human DNA Using Peptide Nucleic Acid Probes Detected by MALDI-TOF Mass Spectrometry,” Analytical Chemistry, 1997, vol. 69 (20), pp. 4197-4202.
Rota P.A., et al., “Sequencing of a cDNA Clone of the Nucleoprotein Gene of Influenza B/Ann Arbor/1/86,” Nucleic Acids Research, 1989, vol. 17 (9), pp. 3595.
Ruan Y., et al., “Comparative Full-Length Genome Sequence Analysis of 14 SARS Coronavirus Isolates and Common Mutations Associated with the Putative Origins of Infection,” The Lancet, 2003, vol. 361, pp. 1779-1785, 1832.
Ruest A., et al., “Comparison of the Directigen Flu A+B test, the QuickVue Influenza Test, and Clinical Case Definition to Viral Culture and Reverse Transcription-PCR for Rapid Diagnosis of Influenza Virus Infection,” Journal of Clinical Microbiology, 2003, vol. 41 (8), pp. 3487-3493.
Rupf S., et al., “Quantitative Determination of Streptococcus mutans by using Competitive Polymerasechain Reaction,” European Journal of Oral Sciences, 1999, vol. 107 (2), pp. 75-81.
Russell K.L., et al., “Transmission Dynamics and Prospective Environmental Sampling of Adenovirus in a Military Recruit Setting,” Journal of Infectious Diseases, 2006, vol. 194 (7), pp. 877-885.
Sabat A., et al., “Comparison of PCR-Based Methods for Typing Staphylococcus aureus Isolates,” Journal of Clinical Microbiology, 2006, vol. 44 (10), pp. 3804-3807.
Sackesen C., et al., “Use of Polymerase Chain Reaction for Detection of Adenovirus in Children Withor Without Wheezing,” Turkish Journal of Pediatrics, 2005, vol. 47 (3), pp. 227-231.
Sakai H., et al., “Simultaneous Detection of Staphylococcus aureus and Coagulase-Staphylococci in Positive Blood Cultures by Real-Time PCR with Two Fluorescence Resonance Energy Transfer Probe Sets,” Journal of Clinical Microbiology, 2004, vol. 42 (12), pp. 5739-5744.
Sala M., et al., “Ambiguous Base Pairing of the Purine Analogue 1-(2-Deoxy-B-D-Ribofuranosyl)-Imidazole-4-Carboxamide During PCR,” Nucleic Acids Research, 1996, vol. 24 (17), pp. 3302-3306.
Sambrook J., et al., “Molecular Cloning—A Laboratory Manual,” 1989, Cold Spring Harbor Laboratory Press, Table of Contents.
Sampath R., et al., “Global Surveillance of Emerging Influenza Virus Genotypes by Mass Spectrometry,” Plos ONE, 2007, vol. 2 (5), pp. e489.
Sampath R., et al., “Rapid Identification of Emerging Infectious Agents using PCR and Electrospray Ionization Mass Spectrometry,” Annals of the New York Academy of Science, 2007, vol. 1102, pp. 109-120.
Sampath R., et al., “Rapid Identification of Emerging Pathogens: Coronavirus,” Emerging Infectious Diseases, 2005, vol. 11 (3), pp. 373-379.
Sanchez A., et al., “Detection and Molecular Characterization of Ebola Viruses Causing Disease in Human and Nonhuman Primates,” Journal of Infectious Diseases, 1999, vol. 179 (1), pp. S164-S169.
Sanchez J.L., et al., “Epidemic of Adenovirus-Induced Respiratory Illness Among US Military Recruits: Epidemiologic and Immunologic Risk Factors in Healthy, Young adults,” Journal of Medical Virology, 2001, vol. 65 (4), pp. 710-718.
Sanchez-Seco M.P., et al., “A Generic Nested-RT-PCR followed by Sequencing for Detection and Identification of Members of the Alphavirus Genus,” Journal of Virological Methods, 2001, vol. 95 (1-2), pp. 153-161.
Santos S.R., et al., “Identification and Phylogenetic Sorting of Bacterial Lineages with Universally Conserved Genes and Proteins,” Environmental Microbiology, 2004, vol. 6 (7), pp. 754-759.
Sarantis H., et al., “Comprehensive Detection and Serotyping of Human Adenoviruses by PCR and Sequencing,” Journal of Clinical Microbiology, 2004, vol. 42 (9), pp. 3963-3969.
Sauer S., et al., “A Novel Procedure for Efficient Genotyping of Single Nucleotide Polymorphisms,” Nucleic Acids Research, 2000, vol. 28 (5), pp. E13.1-E13.8.
Scaramozzino N., et al., “Comparison of Flavivirus Universal Primer Pairs and Development of a Rapid, Highly Sensitive Heminested Reverse Transcription-PCR Assay for Detection of Flaviviruses Targeted to a Conserved Region of the NS5 Gene Sequences,” Journal of Clinical Microbiology, 2001, vol. 39 (5), pp. 1922-1927.
Schabereiter-Gurtner C., et al., “Application of Broad-Range 16s rRNA PCR Amplification and DGGE Fingerprinting for Detection of Tick-Infecting Bacteria,” The Journal of Microbiological Methods, 2003, vol. 52 (2), pp. 251-260.
Scheffner M., et al., “The E6 Oncoprotein Encoded by Human Papillomavirus Types 16 and 18 Promotes the Degradation of p53,” Cell, 1990, vol. 63 (6), pp. 1129-1136.
Schena M., et al., “Genome Analysis with Gene Expression Microarrays,” Bioessays, 1996, vol. 18 (5), pp. 427-431.
Scheuermann R.H., et al., “Polymerase Chain-Reaction-Based mRNA Quantification Using an Internal Standard: Analysis of Oncogene Expression,” Methods in Enzymology, 1993, vol. 218, pp. 446-473.
Schlecht N.F., et al., “Viral Load as a Predictor of the Risk of Cervical Intraepithelial Neoplasia,” British Journal of Cancer, 2003, vol. 103 (4), pp. 519-524.
Schmidt T.M., et al., “Analysis of a Marine Pikoplankton Community by 16s rRNA Gene Cloning and Sequencing,” Journal of Bacteriology, 1991, vol. 173 (14), pp. 4371-4378.
Schmitz F.J., et al., “Development of a Multiplex-PCR for Direct Detection of the Genes for Enterotoxin B and C, and Toxic Shock Syndrome Toxin-1 in Staphylococcus aureus Isolates,” Journal of Medical Microbiology, 1998, vol. 47 (4), pp. 335-340.
Schmitz F.J., et al., “Development of Resistance to Ciprofloxacin, Rifampin, and Mupirocin in Methicillin-Susceptible and -Resistant Staphylococcus aureus Isolates,” Antimicrobial Agents and Chemotherapy, 2000, vol. 44 (11), pp. 3229-3231.
Schmitz F.J., et al., “Specific Information Concerning Taxonomy, Pathogenicity and Methicillin Esistance of Staphylococci Obtained by a Multiplex PCR,” Journal of Medical Microbiology, 1997, vol. 46 (9), pp. 773-778.
Schram K.H., et al., “Mass Spectrometry of Nucleic Acid Components,” Methods of Biochemical Analysis, 1990, vol. 34, pp. 203-280.
Schultz J.C., et al., “Polymerise Chain Reaction Products Analyzed by Charge Detection Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1999, vol. 13 (1), pp. 15-20.
Schwartz M., et al., “Prenatal Diagnosis of Alpha-1-Antitrypsin Deficiency Using Polymerase Chainreaction (PCR). Comparison of Conventional RFLP Methods with PCR used in Combination with Allelespecific Oligonucleotides or RFLP Analysis,” Clinical Genetics, 1989, vol. 36 (6), pp. 419-426.
Schweiger B., et al., “Application of a Fluorogenic PCR Assay for Typing and Subtyping of Influenza Viruses in Respiratory Samples,” Journal of Clinical Microbiology, 2000, vol. 38 (4), pp. 1552-1558.
Sciacchitano C.J., “Analysis of Polymerase Chain Reaction-Amplified DNA Fragments of Clostridium Botulinum Type E Neurotoxin Gene by High Performance Capillary Electrophoresis,” Journal of Liquid Chromatography & Related Technologies, 1996, vol. 19 (13), pp. 2165-2178.
Scott-Taylor T.H., et al., “Conserved Sequences of the Adenovirus Genome for Detection of all Human Adenovirus Types by Hybridization,” Journal of Clinical Microbiology, 1992, vol. 30 (7), pp. 1703-1710.
Seifarth W., et al., “Rapid Identification of All Known Retroviral Reverse Transcriptase Sequences with a Novel Versatile Detection Assay,” AIDS Research and Human Retroviruses, 2000, vol. 16 (8), pp. 721-729.
Sellner L., et al., “A Single-Tube Nested RT-PCR for the Detection of Ross River Virus,” Methods in Molecular Biology, 1998, vol. 92, pp. 145-152.
Sellner L.N., et al., “Sensitive Detection of Ross River Virus—A One-Tube Nested RT-PCR,” Journal of Virological Methods, 1994, vol. 49 (1), pp. 47-58.
Senko M.W., et al., “Determination of Monoisotopic Masses and Ion Populations for Large Biomoleculesfrom Resolved Isotopic Distributions,” Journal of the American Society for Mass Spectrometry, 1995, vol. 6, pp. 229-233.
Seshadri R., et al., “Differential Expression of Translational Elements by Life Cycle Variants of Coxiella Burnetii,” Infection and Immunity, 1999, vol. 67 (11), pp. 6026-6033.
Shadan F.F., et al., “N-Butyrate, A Cell Cycle Blocker, Inhibits the Replication of Polyomaviruses and Papillomaviruses but Not That of Adenoviruses and Herpesviruses,” Journal of Virology, 1994, vol. 68 (8), pp. 4785-4796.
Shaver Y.J., et al., “Restriction Fragment Length Polymorphism of rRNA Operons for Discrimination and Intergenic Spacer Sequences for Cataloging of Bacilus Subtilis Sub-Groups,” Journal of Microbiological Methods, 2002, vol. 50 (2), pp. 215-223.
Shaver Y.J., et al., “Variation in 16s-23s rRNA Intergenic Spacer Regions Among Bacilus Subtilis 168 Isolates,” Molecular Microbiology, 2001, vol. 42 (1), pp. 101-109.
Shimaoka M., et al., “Detection of the Gene for Toxic Shock Syndrome Toxin 1 in Siaphylococcusaureus by Enzyme-Labelled Oligonucleotideprobes,” Journal of Medical Microbiology, 1996, vol. 44 (3), pp. 215-218.
Shimaoka M., et al., “Development of Enzyme-Labeled Oligonucleotide Probe for Detection of MecA Gene in Methicillin-Resistant Staphylococcus aureus,” Journal of Clinical Microbiology, 1994, vol. 32 (8), pp. 1866-1869.
Shrestha N.K., et al., “Rapid Identification of Staphylococcus aureus and the MecA Gene from BacT/ALERT Blood Culture Bottles by Using the Lightcycler System,” Journal of Clinical Microbiology, 2002, vol. 40 (7), pp. 2659-2661.
Simonsen L., et al., “The Impact of Influenza Epidemics on Hospitalizations,” Journal of Infectious Diseases, 2000, vol. 181 (3), pp. 831-837.
Skov R.L., et al., “Evaluation of a New 3-h Hybridization Method for Detecting the MecA Gene in Staphylococcus aureus and Comparison with Existing Genotypic and Phenotypic Susceptibility Testing Methods,” Journal of Antimicrobial Chemotherapy, 1999, vol. 43 (4), pp. 467-475.
Smirnov I.P., et al., “Application of DNA-Binding Polymers for Preparation of DNA for Analysis by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 2001, vol. 15 (16), pp. 1427-1432.
Smith T.F., “Comparison of Biosequences,” Advances in Applied Mathematics, 1981, vol. 2, pp. 482-489.
Song F., et al., “Identification of cry11-type Genes from Bacilus Thuringiensis Strains and Characterization of a Novel Cry11-Type Gene,” Applied and Environmental Microbiology, 2003, vol. 69, pp. 5207-5211.
Spackman E., et al., “Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenzavirus and the Avian H5 and H7 Hemagglutinin Subtypes,” Journal of Clinical Microbiology, 2002, vol. 40 (9), pp. 3256-3260.
Spiess L., et al., “Trehalose is a Potent PCR Enhancer: Lowering of DNA Melting Temperature and Thermal Stabilization of Taq Polymerase by the Disaccharide Trehalose,” Clinical Chemistry, 2004, vol. 50 (7), pp. 1256-1259.
Srinivasan J.R., et al., “Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry as a Rapid Screening Method to Detect Mutations Causing Tay-Sachs Disease,” Rapid Communications in Mass Spectrometry, 1997, vol. 11 (10), pp. 1144-1150.
Steffens D.L., et al., “Sequence Analysis of Mitochondrial DNA Hypervariable Regions Using Infrared Fluorescence Detection,” BioTechniques, 1998, vol. 24 (6), pp. 1044-1046.
Stephensen C.B., et al., “Phylogenetic Analysis of a Highly Conserved Region of the Poymerase Gene from 11 Coronaviruses and Development of a Consensus Poymerase Chain Reaction Assay,” Virus Research, 1999, vol. 60 (2), pp. 181-189.
Stone B., et al., “Rapid Detection and Simultaneous Subtype Differentiation of Influenza A Viruses by Real Time PCR,” Journal of Virological Methods, 2004, vol. 117 (2), pp. 103-112.
Stoneking M., et al., “Population Variation of Human mtDNA Control Region Sequences Detected by Enzymatic Amplification and Sequence-Specific Oligonucleotide Probes,” American Journal of Human Genetics, 1991, vol. 48 (2), pp. 370-382.
Stratagene Catalog, Gene Characterization Kits, 1988, pp. 39.
Strommenger B., et al., “Multiplex PCR Assay for Simultaneous Detection of Nine Clinically Relevant Antibiotic Resistance Genes in Staphylococcus aureus,” Journal of Clinical Microbiology, 2003, vol. 41 (9), pp. 4089-4094.
Studdert M.J., et al., “Polymerase Chain Reaction Tests for the Identification of Ross River, Kunjinand Murray Valley Encephalitis Virus Infections in Horses,” Australian Veterinary Journal, 2003, vol. 81 (1-2), pp. 76-80.
Stuhlmeier R., et al., “Fast, Simultaneous, and Sensitive Detection of Staphylococci,” Journal of Clinical Pathology, 2003, vol. 56 (10), pp. 782-785.
Sumner J.W., et al., “PCR Amplification and Comparison of Nucleotide Sequences from the groESL Heat Shock Operon of Ehrlichia Species,” Journal of Critical Microbiology, 1997, vol. 35 (8), pp. 2087-2092.
Sundsfjord A., et al., “Genetic Methods for Detection of Antimicrobial Resistance,” APMIS : Acta Pathologica, Microbiologica, et Immunologica Scandinavica, 2004, vol. 112 (11-12), pp. 815-837.
Supplementary European Search Report for Application No. 04775904.8, mailed on Jul. 7, 2008, 8 pages.
Supplementary European Search Report for Application No. EP03796752.8, mailed on Aug. 7, 2007, 3 pages.
Supplementary European Search Report for Application No. EP03810055.8, mailed on Jun. 8, 2007, 4 pages.
Supplementary European Search Report for Application No. EP03814656, mailed on Oct. 16, 2007, 2 pages.
Supplementary European Search Report for Application No. EP04752257.8, mailed on Feb. 15, 2006, 2 pages.
Supplementary European Search Report for Application No. EP05753037, mailed on Aug. 21, 2009, 2 pages.
Supplementary Partial European Search Report for Application No. EP02709785.6, mailed Sep. 1, 2005, 5 pages.
Supplementary Partial European Search Report for Application No. EP05751872.2, mailed on Jan. 28, 2008, 8 pages.
Supplementary Partial European Search Report for Application No. EP05856582.1, mailed on Oct. 27, 2008, 10 pages.
Swaminathan B., et al., “PulseNet: The Molecular Subtyping Network for Foodborne Bacterial Disease Surveillance, United States,” Emerging Infectious Diseases, 2001, vol. 7 (3), pp. 382-389.
Swanborg R.H., et al., “Human Herpesvirus 6 and Chlamydia Pneumoniae as Etiologic Agents in Multiplesclerosis—a Critical Review,” Microbes and Infection / Institut Pasteur, 2002, vol. 4 (13), pp. 1327-1333.
Swenson J.M., et al., “Performance of Eight Methods, Including Two New Rapid Methods, for Detection of Oxacillin Resistance in a Challenge Set of Staphylococcus aureus Organisms,” Journal of Clinical Microbiology, 2001, vol. 39 (10), pp. 3785-3788.
Takagaki Y., et al., “Four Factors are Required for 3″-End Cleavage of Pre-mRNAs,” Genes and Development, 1989, vol. 3 (11), pp. 1711-1724.
Takahashi H., et al., “Characterization of gryA, gryB, grlA and grlB Mutations in Fluoroquinolone-Resistant Clinical Isolates of Staphylococcus aureus,” The Journal of Antimicrobial Chemotherapy, 1998, vol. 41 (1), pp. 49-57.
Takahata M., et al., “Mutations in the GyrA and Gr1A Genes of Quinolone-Resistant Clinical Isolates of Methicillin-Resistant Staphylococcus aureus,” The Journal of Antimicrobial Chemotherapy, 1996, vol. 38 (3), pp. 543-546.
Takayama R., et al., “Quantification of Adenovirus Species B and C Viremia by Real-Time PCR in Adults and Children Undergoing Stem Cell Transplantation,” Journal of Medical Virology, 2007, vol. 79 (3), pp. 278-284.
Takeuchi S., et al., “Serotyping of Adenoviruses on Conjunctival Scrapings by PCR and Sequence Analysis,” Journal of Clinical Microbiology, 1999, vol. 37 (6), pp. 1839-1845.
Talaat A.M., et al., “Genome-Directed Primers for Selective Labeling of Bacterial Transcripts for DNA Microarray Analysis,” Nature Biotechnology, 2000, vol. 18 (6), pp. 679-682.
Tan T.Y., “Use of Molecular Techniques for the Detection of Antibiotic Resistance in Bacteria,” Expert Review of Molecular Diagnostics, 2003, vol. 3 (1), pp. 93-103.
Tanabe F., et al., “The Properties and Mec a Gene of the Methicillin-Resistant Staphylococcus aureus Isolated in Fukushima Medical College Hospital,” Fukushima Journal of Medical Science, 1993, vol. 39 (1), pp. 35-42.
Tang K., et al., “Detection of 500-Nucleotide DNA by Laser Desorption Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1994, vol. 8 (9), pp. 727-730.
Tang K., et al., Double-Stranded DNA Analysis by Matrix Assisted Laser Desorption/lonization, 42nd ASMS Conference on Mass Spectrometry, 1994.
Tang K., et al., “Matrix-Assisted Laser Desorption/Ionization of Restriction Enzyme-Digested DNA,” Rapid Communications in Mass Spectrometry, 1994, vol. 8 (2), pp. 183-186.
Tang K., et al., Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry of Oligonucleotides, Dissertation submitted to the Faculty of Vanderbilt University, 1994.
Tarassishin L., et al., “Adenovirus Core Protein VII Displays a Linear Epitope Conserved in a Range of Human Adenoviruses,” Journal of General Virology, 1999, vol. 80 (Pt 1), pp. 47-50.
Tarassishin L., et al., “An Epitope on the Adenovirus Fibre Tail is Common to all Human Subgroups,” Archives of Virology, 2000, vol. 145 (4), pp. 805-811.
Tatuch Y., et al., “Heteroplasmic mtDNA Mutation (T-G) at 8993 Can Cause Leigh Disease When the Percentage of Abnormal mtDNA is High,” The American Journal of Human Genetics, 1992, vol. 50 (4), pp. 852-858.
Taubenberger J.K., et al., “Characterization of the 1918 Influenza Virus Polymerase Genes,” Nature, 2005, vol. 437 (7060), pp. 889-893.
Taylor L.H., et al., “Risk Factors for Human Disease Emergence,” Philosophical Transactions of the Royal Society of London Series B, Biological Sciences, 2001, vol. 356 (1411), pp. 983-989.
Tenover F.C., et al., “Characterization of a Strain of Community-Associated Methicillin-ResistantSlaphylococcus aureus Widely Disseminated in the United States,” Journal of Clinical Microbiology, 2006, vol. 44 (1), pp. 108-118.
Teramura T., et al., “Quantitative Detection of Serum Adenovirus in a Transplant Recipient,” Lancet, 2002, vol. 359 (9321), pp. 1945.
Thiel V., et al., “Infectious RNA Transcribed in Vitro from a cDNA Copy of the Human Coronavirus Genome Cloned in Vaccinia Virus,” The Journal of General Virology, 2001, vol. 82 (Pt 6), pp. 1273-1281.
Thompson J.D., et al., “Clustal W: Improving the Sensitivity of Progressive Multiple Sequence Alignmen Through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice,” Nucleic Acids Research, 1994, vol. 22 (22), pp. 4673-4680.
Thompson W.W., et al., “Influenza-Associated Hospitalizations in the United States,” The Journal of the American Medical Association, 2004, vol. 292 (11), pp. 1333-1340.
Tokue Y., et al., “Comparison of a Polymerase Chain Reaction Assay and a Conventional Microbiologic Method for Detection of Methicillin-Resistant Slaphylococcus aureus,” Antimicrobial Agents and Chemotherapy, 1992, vol. 36 (1), pp. 6-9.
Tong J., et al., “Ligation Reaction Specificities of an NAD+-Dependent DNA Ligase from the Hyperthermophile Aquifex Aeolicus,” Nucleic Acids Research, 2000, vol. 28 (6), pp. 1447-1454.
Top F.H Jr., “Control of Adenovirus Acute Respiratory Disease in U.S. Army Trainees,” The Yale Journal of Biology and Medicine, 1975, vol. 48 (3), pp. 185-195.
Torroni A., et al., “Classification of European mtDNAs from an Analysis of Three European Populations,” Genetics, 1996, vol. 144 (4), pp. 1835-1850.
Towner K.J., et al., “Development and Evaluation of a PCR-Based Immunoassay for the Rapid Detection of Methicillin-Resistant Staphylococcus aureus,” Journal of Medical Microbiology, 1998, vol. 47 (7), pp. 607-613.
Tsuneyoshi T., et al., “Mass Spectrometric Gene Diagnosis of One-Base Substitution from Polymerase Chain Reaction Amplified Human DNA,” Rapid Communications in Mass Spectomerty, 1997, vol. 11 (7), pp. 719-722.
Tsunoda T., et al., “Time and Memory Efficient Algorithm for Extracting Palindromic and RepetitiveSubsequences in Nucleic Acid Sequences,” Pacific Symposium on Biocomputing, 1999, vol. 4, pp. 202-213.
Udo E.E., et al., “A Chromosomal Location of the MupA Gene in Staphylococcus aureus Expressing High-Level Mupirocin Resistance,” The Journal of Antimicrobial Chemotherapy, 2003, vol. 51 (5), pp. 1283-1286.
Udo E.E., et al., “Genetic Analysis of Methicillin-Resistant Staphylococcus aureus Expressing High- and Low-Level Mupirocin Resistance”, Journal of Medical Microbiology, 2001, vol. 50 (10), pp. 909-915.
Udo E.E., et al., “Rapid Detection of Methicillin Resistance in Staphylococci Using a Slide Latex Agglutination Kit,” International Journal of Antimicrobial Agents, 2000, vol. 15 (1), pp. 19-24.
Unal S., et al., “Detection of Methicillin-Resistant Staphylococci by Using the Polymerase Chain Reaction,” Journal of Clinical Microbiology, 1992, vol. 30 (7), pp. 1685-1691.
Upton A., et al., “Mupirocin and Staphylococcus aureus: A Recent Paradigm of Emerging Antibiotic Resistance,” The Journal of Antimicrobial Chemotherapy, 2003, vol. 51 (3), pp. 613-617.
Vabret A., et al., “Development of a PCR- and Hybridization-Based Assay (PCR Adenovirus Consensus) for the Detection and the Species Identification of Adenoviruses in Respiratory Specimens,” Journal of Clinical Virology, 2004, vol. 31 (2), pp. 116-122.
Van Aerschot A., et al., “In Search of Acyclic Analogues as Universal Nucleosides in Degenerate Probes,” Nucleosides and Nucleotides, 1995, vol. 14 (3-5), pp. 1053-1056.
Van Baar B.L., “Characterisation of Bacteria by Matrix-Assisted Laser Desorption/Ionisation and Electrospray Mass Spectrometry,” FEMS Microbiology Reviews, 2000, vol. 24 (2), pp. 193-219.
Van Camp G., et al., “Amplification and Sequencing of Variable Regions in Bacterial 23s Ribosomal RNA Genes with Conserved Primer Sequences,” Current Microbiology, 1993, vol. 27 (3), pp. 147-151.
Van Der Vossen J.M., et al., “DNA Based Typing Identification and Detection Systems for Food Spoilage Microorganisms: Development and Implementation,” International Journal of Food Microbiology, 1996, vol. 33 (1), pp. 35-49.
Van Der Zee H., et al., “Rapid and Alternative Screening Methods for Microbiological Analysis,” Journal of AOAC International, 1997, vol. 80 (4), pp. 934-940.
Van Dinten L.C., et al., “Proteolytic Processing of the Open Reading Frame Ib-EncodedPart of Arterivirus Replicase Is Mediated by nsp4 Serine Protease and is Essential for Virus Replication,” Journal of Virology, 1999, vol. 73 (3), pp. 2027-2037.
Van Elden L.J., et al., “Clinical Diagnosis of Influenza Virus Infection: Evaluation of Diagnostic Tools in General Practice,” The British Journal of General Practice, 2001, vol. 51 (469), pp. 630-634.
Van Elden L.J., et al., “Simultaneous Detection of Influenza Viruses A and B Using Real-Time Quantitative PCR,” Journal of Clinical Microbiology, 2001, vol. 39 (1), pp. 196-200.
Van Ert M.N., et al., “Mass Spectrometry Provides Accurate Characterization of Two Genetic Marker Types in Bacillus Anthracis,” Bio Techniques, 2004, vol. 37 (4), pp. 642-651.
Van Leeuwen W.B., et al., “Multilocus Sequence Typing of Staphylococcus aureus with DNA Array Technology,” Journal of Clinical Microbiology, 2003, vol. 41 (7), pp. 3323-3326.
Van Leeuwen W.B., et al., “Rapid Detection of Methicillin-Resistance in Staphylococcus aureus Isolates by the MRSA-Screen Latex Agglutination Test,” Journal of Clinical Microbiology, 1999, vol. 37 (9), pp. 3029-3030.
Vanchiere J.A“ ” et al “Detection of BK Virus and Simian Virus 40 in the Urine of Healthy Children,” Journal of Medical Virology, 2005, vol. 75 (3), pp. 447-454.
Vanderhallen H., et al., “Identification of Encephalomyocarditis Virus in Clinical Samples by ReverseTranscription-PCR Followed by Genetic Typing Using Sequence Analysis,” Journal of Clinical Microbiology, 1998, vol. 36 (12), pp. 3463-3467.
Vannuffel P., et al., “Specific Detection of Methicillin-Resistant Staphylococcus Species by Multiplex PCR,” Journal of Clinical Microbiology, 1995, vol. 33 (11), pp. 2864-2867.
Vannuffel P., et al., “Rapid and Specific Molecular Identification of Methicillin-Resistant Staphylococcus aureus in Endotracheal Aspirates from Mechanically Ventilated Patients,” Journal of Clinical Microbiology, 1998, vol. 36 (8), pp. 2366-2368.
Verma S., et al., “Modified Oligonucleotides: Synthesis and Strategy for Users,” Annual Review of Biochemistry, 1998, vol. 67, pp. 99-134.
Videla C., et al., “Genomic Analysis of Adenovirus Isolated from Argentinian Children with Acute Lower Respiratory Infections,” Journal of Clinical Virology, 1999, vol. 14 (1), pp. 67-71.
Vilchez R.A. et al., “Detection of Polyomavirus Simian Virus 40 Tumor Antigen DNA in AIDS-Related Systemic Non-Hodgkin Lymphoma,” Journal of Acquired Immune Deficiency Syndromes, 2002, vol. 29 (2), pp. 109-116.
Voelter C., et al., “Screening Human Tumor Samples with a Broad-Spectrum Polymerase Chain Reaction Method for the Detection of Polyomaviruses,” Virology, 1997, vol. 237 (2), pp. 389-396.
Volokhov D., et al., “Microarray Analysis of Erythromycin Resistance Determinants,” Journal of Applied Microbiology, 2003, vol. 95 (4), pp. 787-798.
Von Eiff C., et al., “Pathogenesis of Infections Due to Coagulase-Negative Staphylococci,” The Lancet Infectious Diseases, 2002, vol. 2 (11), pp. 677-685.
Von Wintzingerode F., et al., “Base-Specific Fragmentation of Amplified 16S rRNA Genes Analyzed by Mass Spectrometry: A Tool for Rapid Bacterial Identification,” Proceedings of the National Academy of Sciences, 2002, vol. 99 (10), pp. 7039-7044.
Walker E.S., et al., “A Decline in Mupirocin Resistance in Methicillin-Resistant Staphylococcus aureus Accompanied Administrative Control of Prescriptions,” Journal of Clinical Microbiology, 2004, vol. 42 (6), pp. 2792-2795.
Wallace S.S., et al., “The Enigma of Endonuclease VIII,” DNA Repair, 2003, vol. 2 (5), pp. 441-453.
Wallet F., et al., “Choice of a Routine Method for Detecting Methicillin-Resistance in Staphylococci,” The Journal of Antimicrobial Chemotherapy, 1996, vol. 37 (5), pp. 901-909.
Walters J.J., et al., “Genotyping Single Nucleotide Polymorphisms Using Intact Polymerase Chain Reaction Products by Electrospray Quadrupole Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 2001, vol. 15 (18), pp. 1752-1759.
Wang G., et al., “Targeted Mutagenesis in Mammalian Cells Mediated by Intracellular Triple Helix Formation,” Molecular and Cellular Biology, 1995, vol. 15 (3), pp. 1759-1768.
Ward C.L., et al., “Design and Performance Testing of Quantitative Real Time PCR Assays for Influenza A and B Viral Load Measurement,” Journal of Clinical Virology, 2004, vol. 29 (3), pp. 179-188.
Watanabe K., et al., “ICB Database: The gyrB Database for Identification and Classification of Bacteria,” Nucleic Acids Research, 2001, vol. 29 (1), pp. 344-345.
Weissenbacher M., et al., “Etiologic and Clinical Evaluation of Acute Lower Respiratory TractInfections in Young Argentinean Children: An Overview,” Reviews of Infectious Diseases, 1990, vol. 12 (Suppl 8), pp. S889-S898.
Welham K.J., et al., “The Characterization of Micro-Organisms by Matrix-Assisted Laser Desorption/Lonization Time-of-Flight Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1998, vol. 12 (4), pp. 176-180.
Wertheim H.F., et al., “Effect of Mupirocin Treatment on Nasal, Pharyngeal, and Perineal Carriage of Staphylococcus aureus in Healthy Adults,” Antimicrobial Agents and Chemotherapy, 2005, vol. 49 (4), pp. 1465-1467.
Westermann P., et al., “Inhibition of Expression of SV40 Virus Large T-Antigen by Antisense Oligodeoxyribonucleotides,” Biomedica Biochimica Acta, 1989, vol. 1, pp. 85-93.
Whiley D.M., et al., “Simultaneous Detection and Differentiation of Human Polyomaviruses JC and BK by a Rapid and Sensitive PCR-ELAHA Assay and a Survey of the JCV Subtypes within an Australian Population,” Journal of Medical Virology, 2004, vol. 72 (3), pp. 467-472.
Wichelhaus T.A., et al., “Rapid Detection of Epidemic Strains of Methicillin-ResistantStaphylococcus aureus,” Journal of Clinical Microbiology, 1999, vol. 37 (3), pp. 690-693.
Wickham T.J., “Targeting Adenovirus,” Gene Therapy, 2000, vol. 7 (2), pp. 110-114.
Widjojoatmodjo M.N., et al., “Rapid Identification of Bacterial by PCR-Single-Strand Conformation Polymorphism,” Journal of Clinical Microbiology, 1994, vol. 32 (12), pp. 3002-3007.
Widjojoatmodjo M.N., et al., “The Magnetic Immuno Polymerase Chain Reaction Assay for Direct Detection of Salmonellae in Fecal Samples,” Journal of Clinical Microbiology, 1992, vol. 30 (12), pp. 3195-3199.
Winger B.E., et al., “High Resolution Accurate Mass Measurements of Biomolecules using a new Electrospray Ionization Ion Cyclotron Resonance Mass Spectrometer,” Journal American Society for Mass Spectrometry, 1993, vol. 4 (7), pp. 566-577.
Wolter A., et al., “Negative Ion FAB Mass Spectrometric Analysis of Non-Charged Key Intermediates in Oligonucleotide Synthesis: Rapid Identification of Partially Protected Dinucleoside Monophosphates,” Biomedical and Environmental Mass Spectrometry, 1987, vol. 14, pp. 111-116.
Woo T.H., et al., “Identification of Leptospira Inadai by Continuous Monitoring of Fluorescence during Rapid Cycle PCR,” Systematic and Applied Microbiology, 1998, vol. 21 (1), pp. 89-96.
Wood S.R., et al., “Rapid Detection and Serotyping of Adenovirus by Direct Immunofluorescence,” Journal of Medical Virology, 1997, vol. 51 (3), pp. 198-201.
Wright K.E., et al., “Typing and Subtyping of Influenza Viruses in Clinical Samples by PCR,” Journal of Clinical Microbiology, 1995, vol. 33 (5), pp. 1180-1184.
Written Opinion for Application No. PCT/US2004/33742, mailed on May 15, 2006, 5 pages.
Wu S., et al., “Genetic Organization of the mecA Region in Methicillin-Susceptible and Methicillin-Resistant Strains of Staphylococcus sciuri,” The Journal of Bacteriology, 1998, vol. 180 (2), pp. 236-242.
Wu X., et al., “Establishment of a Fluorescent Polymerase Chain Reaction Method for the Detection of SARS-Associated Coronavhus and its Clinical Application,” Chinese Medical Journal, 2003, vol. 116 (7), pp. 988-990.
Wunschel D., et al., “Discrimination Among the B. Cereus Group, in Comparison to B. Subtilis, by Structural Carbohydrate Profiles and Ribosomal RNA Spacer Region PCR,” Systematic and Applied Microbiology, 1994, vol. 17, pp. 625-635.
Wunschel D.S., et al., “Analysis of Double-Stranded Polymerase Chain Reaction Products from the Bacilus Cereus Group by Electrospray Lonization Fourier Transform Lon Cyclotron Resonance Mass Spectrometry,” Rapid Communications in Mass Spectrometry, 1996, vol. 10 (1), pp. 29-35.
Wunschel D.S., et al., “Heterogeneity in Bacillus Cereus PCR Products Detected by ESI-FTICR Mass Spectrometry,” Analytical Chemistry, 1998, vol. 70 (6), pp. 1203-1207.
Wunschel D.S., et al., “Mass spectrometric characterization of DNA for molecular biological applications: advances using MALDI and ESI,” Advances in Mass Spectrometry, 1998, vol. 14, Elsevier, pp. 377-406.
Xu L., et al., “Electrophore Mass Tag Dideoxy DNA Sequencing,” Analytical Chemistry, 1997, vol. 69 (17), pp. 3595-3602.
Xu W., et al., “Species-Specific Identification of Human Adenoviruses by a Multiplex PCR Assay,” Journal of Clinical Microbiology, 2000, vol. 38 (11), pp. 4114-4120.
Xu W., et al., “Type-Specific Identification of Human Adenovirus, 3, 7, and 21 by a Multiplex PCR Assay,” Journal of Medical Virology, 2001, vol. 64 (4), pp. 537-542.
Xu X., et al., “Intercontinental Circulation of Human Influenza A(H1N2) Reassortant Viruses During the 2001-2002 Influenza Season,” The Journal of Infectious Diseases, 2002, vol. 186 (10), pp. 1490-1493.
Yao Z.P., et al., “Mass Spectrometry Based Proteolytic Mapping for Rapid Virus Identification,” Analytical Chemistry, 2002, vol. 74 (11), pp. 2529-2534.
Yasui T., et al., “A Specific Oligonucleotide Primer for the Rapid Detection of Lactobacillus Lindneri by Polymerase Chain Reaction,” Canadian Journal of Microbiology, 1997, vol. 43 (2), pp. 157-163.
Ye K., et al., “Three Distinct Promoters Direct Transcription of Different 5″ Untranslated Regions of the Human Interleukin 1 Type 1 Receptor. A Possible Mechanism for Control of Translation,” Cytokine, 1996, vol. 8 (6), pp. 421-429.
Yun H.J., et al., “Increased Antibacterial Activity of OW286, A Novel Fluoronaphthyridone Antibiotic, Against Staphylococcus aureus Strains with Defined Mutations in DNA Gyrase and Toposiomerase IV,” International Journal of Antimicrobial Agents, 2005, vol. 25 (4), pp. 334-337.
Zeng Z.B., “Precision Mapping of Quantitative Trait Loci,” Genetics, 1994, vol. 136 (4), pp. 1457-1468.
Zhang J., et al., “PowerBLAST: A New Network BLAST Application for Interactive or Automated Sequence Analysis and Annotation,” Genome Research, 1997, vol. 7 (6), pp. 649-656.
Zhang K., et al., “New Quadriplex PCR Assay for Detection of Methicillin and Mupirocin Resistance and Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci,” Journal of Clinical Microbiology, 2004, vol. 42 (11), pp. 4947-4955.
Zhang W.D., et al., “Detection and Identification of Human Influenza Viruses by the Polymerase Chain Reaction,” Journal of Virological Methods, 1991, vol. 33 (1-2), pp. 165-189.
Zhang Y.Q., et al., “Genome-Based Analysis of Virulence Genes in a Non-Biofilm-Forming Staphylococcus epidemidis Strain (ATCC 12228),” Molecular Microbiology, 2003, vol. 49 (6), pp. 1577-1593.
Final Office Action mailed Aug. 20, 2013 for U.S. Appl. No. 11/930,741, filed Oct. 31, 2007.
Non-Final Office Action mailed Sep. 19, 2013 for U.S. Appl. No. 12/528,282, filed Mar. 16, 2010.
Co-pending U.S. Appl. No. 13/770,648, filed Feb. 19, 2013.
Co-pending U.S. Appl. No. 13/850,683, filed Mar. 26, 2013.
Final Office Action mailed Dec. 17, 2012 for U.S. Appl. No. 12/616,422, filed Nov. 11, 2009.
Non-Final Office Action mailed Jul. 3, 2013 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Non-Final Office Action mailed Jun. 6, 2013 for U.S. Appl. No. 13/243,960, filed Sep. 23, 2011.
Non-Final Office Action mailed Jan. 22, 2013 for U.S. Appl. No. 11/930,741, filed Oct. 31, 2007.
Non-Final Office Action mailed May 23, 2013 for U.S. Appl. No. 13/663,176, filed Oct. 29, 2012.
Notice of Allowance mailed Apr. 1, 2013 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Notice of Allowance mailed Oct. 12, 2012 for U.S. Appl. No. 12/049,949, filed Mar. 17, 2008.
Notice of Allowance mailed Jun. 14, 2013 for U.S. Appl. No. 11/682,259, filed Mar. 5, 2007.
Notice of Allowance mailed Jan. 22, 2013 for U.S. Appl. No. 12/616,422, filed Nov. 11, 2009.
Notice of Allowance mailed May 22, 2013 for U.S. Appl. No. 12/616,422, filed Nov. 11, 2009.
Notice of Allowance mailed May 28, 2013 for U.S. Appl. No. 11/682,259, filed Mar. 5, 2007.
Office Action mailed Dec. 6, 2012 for European Application No. 10179795.9 filed Mar. 4, 2002.
Office Action mailed Dec. 12, 2012 for European Application No. 10179789.2 filed Mar. 4, 2002.
Office Action mailed Oct. 15, 2012 for European Application No. 10175659.1 filed Dec. 5, 2003.
Office Action mailed Apr. 19, 2013 for Canadian Application No. 2616281 filed Jul. 21, 2006.
Office Action mailed Nov. 21, 2012 for Israel Application No. 157661 filed Mar. 4, 2002.
Office Action mailed Apr. 23, 2013 for Japanese Application No. 2009550634 filed Feb. 25, 2008.
Office Action mailed Sep. 25, 2012 for Japanese Application No. 2008522997 filed Jul. 21, 2006.
Office Action mailed May 29, 2013 for Australian Application No. 2010200893 filed Mar. 10, 2010.
Co-pending U.S. Appl. No. 14/047,414, filed Oct. 7, 2013.
Co-pending U.S. Appl. No. 14/058,723, filed Oct. 21, 2013.
Non-Final Office Action mailed Apr. 21, 2014 for U.S. Appl. No. 13/663,176, filed Oct. 29, 2012.
Notice of Allowance mailed Apr. 3, 2014 for U.S. Appl. No. 11/929,930, filed Oct. 30, 2007.
Notice of Allowance mailed Apr. 11, 2014 for U.S. Appl. No. 11/930,741, filed Oct. 31, 2007.
Notice of Allowance mailed Apr. 24, 2014 for U.S. Appl. No. 13/243,960, filed Sep. 23, 2011.
Non-Final Rejection mailed on May 14, 2014 for U.S. Appl. No. 13/850,683, filed Mar. 26, 2013.
Notice of Allowance mailed Jun. 19, 2014 for U.S. Appl. No. 12/528,282, filed Mar. 16, 2010.
Butler J.M., et al., “Forensic applications of mitochondrial DNA,” Trends in Biotechnology, 1998, vol. 16 (4), pp. 158-162.
Non-Final Office Action mailed Dec. 16, 2014 for U.S. Appl. No. 14/047,414, filed Oct. 7, 2013.
Non-Final Office Action mailed Dec. 31, 2014 for U.S. Appl. No. 13/850,683, filed Mar. 26, 2013.
U.S. Appl. No. 14/473,603, David J. Ecker, filed Aug. 29, 2014.
U.S. Appl. No. 14/586,267, David J. Ecker, filed Dec. 30, 2014.
Ben-Dov E., et al., “Extended Screening by PCR for Seven Cry-Group Genes from Field-Collected Strains of Bacillus thuringiensis,” Applied and Environmental Microbiology, 1997, vol. 63 (12), pp. 4883-4890.
Co-pending U.S. Appl. No. 13/174,254, filed Jun. 30, 2011.
Co-pending U.S. Appl. No. 14/473,603, filed Aug. 29, 2014.
Co-pending U.S. Appl. No. 14/586,267, filed Dec. 30, 2014.
Demirev P.A., et al., “Microorganism Identification by Mass Spectrometry and Protein Database Searches,” Analytical Biochemistry, 1999, vol. 71 (14), pp. 2732-278.
Examination Report for Australian Patent Application No. AU2013231102, mailed on Jul. 24, 2015, 11 pages.
Examiner's Requisition mailed Jul. 9, 2015 for Canadian Application No. 2853831 filed Mar. 4, 2002.
Final Office Action mailed Sep. 17, 2015 for U.S. Appl. No. 13/850,683, filed Mar. 26, 2013.
Final Office Action mailed Jun. 23, 2015 for U.S Appl. No. 14/047,414, filed Oct. 7, 2013.
Final Office Action mailed Sep. 25, 2015 for U.S. Appl. No. 14/473,603, filed Aug. 29, 2014.
First Patent Examination Report mailed Jul. 27, 2015 for Australian Application No. 2013254918 filed Nov. 7, 2013.
Glass N.L., et al., “Development of Primer Sets Designed for Use with the PCR to Amplify Conserved Genes from Filamentous Ascomycetes,” Applied and Environmental Microbiology, 1995, vol. 61 (4), pp. 1323-1330.
Jiang X., et al., “Design and Evaluation of a Primer Pair that Detects Both Norwalk- and Sapporo-Like Caliciviruses by RT-PCR,” Journal of Virological Methods, 1999, vol. 83 (1-2), pp. 145-154.
Non-Final Office Action mailed Sep. 14, 2015 for U.S. Appl. No. 14/456,806, filed Aug. 11, 2014.
Notice of Allowance mailed Oct. 6, 2015 for U.S. Appl. No. 14/047,414, filed Oct. 7, 2013.
Notice of Allowance mailed Aug. 22, 2014 for U.S. Appl. No. 13/663,176, filed Oct. 29, 2012.
Office Action mailed Oct. 12, 2005 for European Application No. 02709785.6 filed Mar. 4, 2002.
Office Action mailed Nov. 23, 2015 for Israel Application No. IL238855 filed May 17, 2015.
Parsons T.J., et al., “Increasing the Forensic Discrimination of Mitochondrial DNA Testing through Analysis of the Entire Mitochondrial DNA Genome,” Forensic Sciences, 2001, vol. 42 (3), pp. 304-309.
Ragimbeau C. et al., “Development of a Multiplex PCR Gene Figerprinting Method using gyrA and pf/A Polymorphisms to Identify Genotypic Relatedness within Campy/obacter jejuni Species,” Journal of Applied Microbiology, 1998, vol. 85 (5), pp. 829-838.
Taylor R.W., et al., “The Determination of Complete Human Mitochondrial DNA Sequences in Single Cells: Implications for the Study of Somatic Mitochondrial DNA Point Mutations,” Nucleic Acids Research, 2001, vol. 29 (15), E74-4.
Third Office Action mailed Mar. 2, 2015 for Chinese Patent Application No. 201210348178.6 filed Mar. 4, 2002.
Final Office Action mailed Apr. 4, 2016 for U.S. Appl. No. 14/456,806, filed Aug. 11, 2014.
Non-Final Office Action mailed Mar. 7, 2016 for U.S. Appl. No. 14/047,414, filed Oct. 7, 2013.
Non-Final Office Action mailed Mar. 28, 2016 for U.S. Appl. No. 14/058,723, filed Oct. 21, 2013.
Related Publications (1)
Number Date Country
20150284778 A1 Oct 2015 US
Provisional Applications (5)
Number Date Country
60431319 Dec 2002 US
60443443 Jan 2003 US
60443788 Jan 2003 US
60447529 Feb 2003 US
60501926 Sep 2003 US
Divisions (1)
Number Date Country
Parent 09798007 Mar 2001 US
Child 10156608 US
Continuations (2)
Number Date Country
Parent 11930002 Oct 2007 US
Child 13174254 US
Parent 10728486 Dec 2003 US
Child 11930002 US
Continuation in Parts (7)
Number Date Country
Parent 10323233 Dec 2002 US
Child 10728486 US
Parent 10326051 Dec 2002 US
Child 10323233 US
Parent 10325527 Dec 2002 US
Child 10326051 US
Parent 10325526 Dec 2002 US
Child 10325527 US
Parent 10660122 Sep 2003 US
Child 10325526 US
Parent 09798007 Mar 2001 US
Child 10660122 US
Parent 10156608 May 2002 US
Child 10728486 US