Patent Grant
11332740
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 6, 2018, is named 44854-746_301_SL.txt and is 1,585 bytes in size.
De novo nucleic acid synthesis is a powerful tool for basic biological research and biotechnology applications. While various methods are known for the synthesis of relatively short fragments of nucleic acids on a small scale, these techniques suffer from scalability, automation, speed, accuracy, and cost. Thus, a need remains for efficient methods of seamless nucleic acid assembly.
Provided herein are methods for nucleic acid synthesis and assembly, comprising: (a) providing a plurality of polynucleotides; and (b) mixing the plurality of polynucleotides with an exonuclease, a flap endonuclease, a polymerase, and a ligase, wherein the plurality of polynucleotides are annealed in a processive predetermined order based on a complementary sequence between adjacent polynucleotides. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the flap endonuclease 1 is in a range of about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the exonuclease III is in a range of about 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the exonuclease III is in a range of about 1.0 U to about 2.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the polymerase is in a range of about 0.1 U to about 2 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the polymerase is about 0.1 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the polymerase is about 0.2 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the ligase is in a range of about 4.0 U to about 8.0 U.
Provided herein are methods for nucleic acid synthesis and assembly, comprising: (a) providing a first double stranded nucleic acid; (b) providing a second double stranded nucleic acid; (c) providing a third double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a first homology sequence to the first double stranded nucleic acid, a second homology sequence to the second double stranded nucleic acid, and a 3′ flanking adapter sequence; and (d) mixing the first double stranded nucleic acid, the second double stranded nucleic acid, and the third double stranded nucleic acid with a reaction mixture comprising an exonuclease, a flap endonuclease, a polymerase, and a ligase. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid synthesis and assembly, wherein an amount of the flap endonuclease 1 provided is about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein an amount of the flap endonuclease 1 provided is less than about 5.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first homology sequence or the second homology sequence is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first homology sequence and the second homology sequence are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first homology sequence or the second homology sequence is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first homology sequence and the second homology sequence are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first homology sequence or the second homology sequence is about 40 base pairs. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first homology sequence and the second homology sequence are each independently about 40 base pairs. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the exonuclease III is in a range of about 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the exonuclease III is in a range of about 1.0 U to about 2.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the polymerase is present in an amount of about 0.1 U to about 2 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the polymerase is about 0.1 U to about 0.2 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the ligase is in a range of about 4.0 U to about 8.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a concentration of the ligase is in a range of about 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid synthesis and assembly, wherein the first double stranded nucleic acid, the second double stranded nucleic acid, or the third double stranded nucleic acid or any combination thereof is a linear fragment. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a product following step (d) is a linear fragment. Further provided herein are methods for nucleic acid synthesis and assembly, wherein a product following step (d) is a circular fragment.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising an exonuclease, a flap endonuclease, a polymerase, and a ligase. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein an amount of the flap endonuclease 1 provided is about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein an amount of the flap endonuclease 1 provided is less than about 5.0 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 1.0 U to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is present in an amount of about 0.1 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.1 U to about 0.2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is in a range of about 4.0 U to about 8.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is in a range of about 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid assembly, wherein the first double stranded nucleic acid or the second double stranded nucleic acid is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a circular fragment.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising an exonuclease, a flap endonuclease, a polymerase, and a ligase at a temperature of about 30° C. to about 60° C. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the flap endonuclease 1 is in a range of about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 1.0 U to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is in a range of about 0.1 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.1 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is in a range of about 4.0 U to about 8.0 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is in a range of 0.5 U to about 1.0 U. Further provided herein are methods for nucleic acid assembly, wherein the first double stranded nucleic acid or the second double stranded nucleic acid is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a circular fragment.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising, a flap endonuclease, wherein the flap endonuclease results in a 5′ overhang; a polymerase; and a ligase.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising about 0.5 U to about 1.0 U of an exonuclease, about 0.32 U to about 4.8 U of a flap endonuclease, about 0.1 U to about 2 U of a polymerase, and up to about 2.0 U of a ligase.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising about 0.32 U to about 4.8 U of a flap endonuclease, about 0.1 U to about 2 U of a polymerase, and up to about 2.0 U of a ligase.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a plurality of polynucleotides, wherein each of the polynucleotides do not comprise a terminal region of sequence homology to another polynucleotide of the plurality of polynucleotides; and (b) mixing the plurality of polynucleotides with an exonuclease, an endonuclease, a polymerase, and a ligase, wherein the plurality of polynucleotides are annealed in a processive predetermined order based on a complementary sequence between adjacent polynucleotides. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is a flap endonuclease. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the flap endonuclease 1 is in a range of about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is in a range of about 0.01 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.1 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.01 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid; (b) providing a second double stranded nucleic acid; (c) providing a third double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a first homology sequence to the first double stranded nucleic acid, a second homology sequence to the second double stranded nucleic acid, and a 3′ flanking adapter sequence, wherein the first double stranded nucleic acid, the second double stranded nucleic acid, and the third double stranded nucleic acid comprise non-homologous sequences at terminal regions; and (d) mixing the first double stranded nucleic acid, the second double stranded nucleic acid, and the third double stranded nucleic acid with a reaction mixture comprising an exonuclease, an endonuclease, a polymerase, and a ligase. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is a flap endonuclease. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the flap endonuclease 1 provided is about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is flap endonuclease 1 provided in a concentration less than about 5.0 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is in a range of about 0.01 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein the first double stranded nucleic acid, the second double stranded nucleic acid, or the third double stranded nucleic acid, or any combination thereof is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (d) is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (d) is a circular fragment.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising an exonuclease, an endonuclease, a polymerase, and a ligase. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is a flap endonuclease. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the flap endonuclease 1 provided is about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the flap endonuclease 1 provided is less than about 5.0 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is in a range of about 0.1 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.01 U to about 0.2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein the first double stranded nucleic acid or the second double stranded nucleic acid or any combination thereof is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a circular fragment.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising an exonuclease, an endonuclease, a polymerase, and a ligase at a temperature of about 30° C. to about 60° C. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is a flap endonuclease. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the flap endonuclease 1 is in a range of about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is in a range of about 0.01 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.1 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is about 0.01 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U. Further provided herein are methods for nucleic acid assembly, wherein the first double stranded nucleic acid or the second double stranded nucleic acid or any combination thereof is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a linear fragment. Further provided herein are methods for nucleic acid assembly, wherein a product following step (c) is a circular fragment.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising, an endonuclease, wherein the endonuclease results in a 5′ overhang; a polymerase; and a ligase.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising about 0.5 U to about 1.0 U of an exonuclease, about 0.32 U to about 4.8 U of an endonuclease, about 0.01 U to about 2 U of a polymerase, and up to about 2.0 U of a ligase.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising about 0.32 U to about 4.8 U of an endonuclease, about 0.01 U to about 2 U of a polymerase, and up to about 2.0 U of a ligase.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a first double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; (b) providing a second double stranded nucleic acid comprising in 5′ to 3′ order: a 5′ flanking adapter sequence, a homology sequence, an insert sequence, and a 3′ flanking adapter sequence; and (c) mixing the first double stranded nucleic acid and the second double stranded nucleic acid with a reaction mixture comprising at least one enzyme comprising 3′ or 5′ exonuclease activity, a polymerase, and a ligase, wherein the at least one enzyme comprising 3′ or 5′ exonuclease activity removes a 5′ flanking adapter sequence or 3′ flanking adapter sequence. Further provided herein are methods for nucleic acid assembly, wherein the at least one enzyme comprising 3′ or 5′ exonuclease activity is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 40 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 10 to about 100 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid or the homology sequence of the second double stranded nucleic acid is about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein the homology sequence of the first double stranded nucleic acid and the homology sequence of the second double stranded nucleic acid are each independently about 20 to about 80 base pairs. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing at least 10 different fragments, wherein each of the at least 10 different fragments do not comprise a terminal region of sequence homology to another fragment of the at least 10 different fragments; and (b) mixing the at least 10 different fragments with a plurality of enzymes, wherein the plurality of enzymes is selected from an endonuclease, an exonuclease, a polymerase, and a ligase to form a nucleic acid. Further provided herein are methods for nucleic acid assembly, wherein the nucleic acid is attached to a vector sequence. Further provided herein are methods for nucleic acid assembly, wherein the nucleic acid is 50 bases to 200 bases in length. Further provided herein are methods for nucleic acid assembly, wherein the nucleic acid is 100 bases to 2000 bases in length. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is a flap endonuclease. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids.
Provided herein are methods for nucleic acid assembly, comprising: (a) providing a plurality of polynucleotides, wherein each of the polynucleotides do not comprise a terminal region of sequence homology to another polynucleotide of the plurality of polynucleotides; and (b) mixing the plurality of polynucleotides with a 3′ to 5′ exonuclease, a thermostable endonuclease, a high fidelity polymerase, and a thermostable ligase, wherein the plurality of polynucleotides are annealed in a processive predetermined order based on a complementary sequence between adjacent polynucleotides. Further provided herein are methods for nucleic acid assembly, wherein the exonuclease is exonuclease III. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is a flap endonuclease. Further provided herein are methods for nucleic acid assembly, wherein the flap endonuclease is flap endonuclease 1, exonuclease 1, XPG, Dna2, or GEN1. Further provided herein are methods for nucleic acid assembly, wherein the endonuclease is flap endonuclease 1 provided in a concentration of ranging from about 0.32 U to about 4.8 U. Further provided herein are methods for nucleic acid assembly, wherein the polymerase comprises 5′ to 3′ polymerase activity. Further provided herein are methods for nucleic acid assembly, wherein the polymerase is a DNA polymerase. Further provided herein are methods for nucleic acid assembly, wherein the ligase catalyzes joining of at least two nucleic acids. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the exonuclease III is in a range of about 0.1 U to about 10 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the polymerase is in a range of about 0.01 U to about 2 U. Further provided herein are methods for nucleic acid assembly, wherein a concentration of the ligase is up to about 2.0 U.
All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Throughout this disclosure, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention, unless the context clearly dictates otherwise.
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items.
Unless specifically stated or obvious from context, as used herein, the term “nucleic acid” encompasses double- or triple-stranded nucleic acids, as well as single-stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double-stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid sequences, when provided, are listed in the 5′ to 3′ direction, unless stated otherwise. Methods described herein provide for the generation of isolated nucleic acids. Methods described herein additionally provide for the generation of isolated and purified nucleic acids. A “nucleic acid” as referred to herein can comprise at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, or more bases in length. Moreover, provided herein are methods for the synthesis of any number of polypeptide-segments encoding nucleotide sequences, including sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptide-synthetase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins, such as antibodies, polypeptide segments from other protein families, including non-coding DNA or RNA, such as regulatory sequences e.g. promoters, transcription factors, enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived from microRNA, or any functional or structural DNA or RNA unit of interest. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, intergenic DNA, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), small nucleolar RNA, ribozymes, complementary DNA (cDNA), which is a DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification; DNA molecules produced synthetically or by amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. cDNA encoding for a gene or gene fragment referred to herein may comprise at least one region encoding for exon sequences without an intervening intron sequence in the genomic equivalent sequence.
Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers +/−10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.
Primers referred to in the exemplary workflows mentioned herein as “universal primers,” are short polynucleotides that recognize a primer binding site common to multiple DNA fragments. However, these workflows are not limited to only use of universal primers, and fragment-specific primers may be incorporated in addition or alternatively. In addition, while exemplary workflows described herein refer to assembly of gene fragments, they are not limited as such and are applicable to the assembly of longer nucleic acids in general.
Seamless Nucleic Acid Assembly
Provided herein are methods for assembly of nucleic acids with increased efficiency and accuracy. Further provided herein are methods of assembly of nucleic acids into long genes. Polynucleotides described herein are assembled into longer nucleic acids by assembly methods comprising an endonuclease or an exonuclease, optionally in conjunction with additional enzymes.
An exemplary process for assembly of nucleic acids using a flap endonuclease is depicted in
An exemplary process for assembly of nucleic acids using a flap endonuclease and a bridge assembly method is depicted in
Provided herein are methods for enzymatic mediated nucleic acid assembly. In some instances, the enzymatic mediated nucleic acid assembly comprises addition of homologous sequences to gene fragments. In some instances, de novo synthesized gene fragments already comprise homology sequences. In some instances, the enzymatic mediated nucleic acid assembly comprises use of an enzymatic mixture. In some instances, the enzymatic mixture comprises an endonuclease. In some instances, the enzymatic mixture optionally comprises an exonuclease, a polymerase, or a ligase. In some instances, the enzymatic mixture comprises an exonuclease, an endonuclease, a polymerase, and a ligase. In some instances, the enzymatic mixture comprises an endonuclease, a polymerase, and a ligase. In some instances, the endonuclease is a flap endonuclease. In some instances, enzymatic mediated nucleic acid assembly results in improved efficiency. In some instances, the enzymatic mixture comprises enzymes that are not restriction enzymes. In some instances, the enzymatic mixture comprises enzymes that are structure specific enzymes. In some instances, the enzymatic mixture comprises enzymes that are structure specific enzymes and not sequence specific enzymes.
Provided herein are methods where site-specific base excision reagents comprising one or more enzymes are used as cleavage agents that cleave only a single-strand of double-stranded DNA at a cleavage site. A number of repair enzymes are suitable alone or in combination with other agents to generate such nicks. An exemplary list of repair enzymes is provided in Table 1. Homologs or non-natural variants of the repair enzymes, including those in Table 1, are also be used according to various embodiments. Any of the repair enzymes for use according to the methods and compositions described herein may be naturally occurring, recombinant or synthetic. In some instances, a DNA repair enzyme is a native or an in vitro-created chimeric protein with one or more activities. Cleavage agents, in various embodiments, comprise enzymatic activities, including enzyme mixtures, which include one or more of nicking endonucleases, AP endonucleases, glycosylases and lyases involved in base excision repair.
Repair enzymes are found in prokaryotic and eukaryotic cells. Some enzymes having applicability herein have glycosylase and AP endonuclease activity in one molecule. AP endonucleases are classified according to their sites of incision. Class I AP endonucleases and class II AP endonucleases incise DNA at the phosphate groups 3′ and 5′ to the baseless site leaving 3′-OH and 5′-phosphate termini. Class III and class IV AP endonucleases also cleave DNA at the phosphate groups 3′ and 5 ‘to the baseless site, but they generate a 3’-phosphate and a 5′-OH. Examples of polynucleotide cleavage enzymes used include DNA repair enzymes are listed in Table 1.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein gene fragments or genes for assembly comprise a homology sequence. In some instances, the homology sequence comprises at least or about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 base pairs. In some instance, the number of base pairs is 40 base pairs. In some instances, the number of base pairs has a range of about 5 to 100, 10 to 90, 20 to 80, 30 to 70, or 40 to 60 base pairs.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein gene fragments or genes for assembly do not comprise a homology sequence. In some instances, methods for enzymatic mediated nucleic acid assembly of de novo synthesized gene fragments without a homology sequence comprise assembly using a nucleic acid bridge. In some instances, the nucleic acid bridge comprises DNA or RNA. In some instances, the nucleic acid bridge comprises DNA. In some instances, the nucleic acid bridge is double stranded. In some instances, the nucleic acid bridge is single stranded.
Provided herein are methods for enzymatic mediated nucleic acid assembly using a nucleic acid bridge, wherein the nucleic acid bridge comprises one or more universal primer binding sequences. In some instances, the nucleic acid bridge comprises at least or about 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 universal primer binding sequences. In some instances, the nucleic acid bridge further comprises a homology sequence. In some instances, the homology sequence is homologous to a de novo synthesized gene fragment. In some instances, the nucleic acid bridge further comprises one or more homology sequences. For example, the nucleic acid bridge comprises one or more homology sequences that are homologous to different de novo synthesized gene fragments. In some instances, the nucleic acid bridge comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 homology sequences. In some instances, the homology sequence comprises at least or about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 base pairs. In some instances, the number of base pairs is 40 base pairs. In some instance, the number of base pairs is 50 base pairs. In some instances, the number of base pairs has a range of about 5 to 100, 10 to 90, 20 to 80, 30 to 70, or 40 to 60 base pairs.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein a double stranded nucleic acid is contacted with an enzyme comprising exonuclease activity. In some instances, the exonuclease comprises 3′ exonuclease activity. Exemplary exonucleases comprising 3′exonuclease activity include, but are not limited to, exonuclease I, exonuclease III, exonuclease V, exonuclease VII, and exonuclease T. In some instances, the exonuclease comprises 5′ exonuclease activity. Exemplary exonucleases comprising 5′ exonuclease activity include, but are not limited to, exonuclease II, exonuclease IV, exonuclease V, exonuclease VI, exonuclease VII, exonuclease VIII, T5 exonuclease, and T7 exonuclease. In some instances, the exonuclease is exonuclease III (ExoIII). Exonucleases include wild-type exonucleases and derivatives, chimeras, and/or mutants thereof. Mutant exonucleases include enzymes comprising one or more mutations, insertions, deletions or any combination thereof within the amino acid or nucleic acid sequence of an exonuclease.
In some instances, the exonuclease is used at a temperature optimal for enzymatic activity, for example, a temperature in a range of about 25-80° C., 25-70° C., 25-60° C., 25-50° C., or 25-40° C. In some instances, the temperature is about 37° C. In some instances, the temperature is about 50° C. In some instances, the temperature is about 55° C. In some instances, the temperature is about 65° C. In some instances, the temperature is at least or about 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C.
In some instances, methods for enzymatic mediated nucleic acid assembly do not comprise using an exonuclease. In some instances, methods for enzymatic mediated nucleic acid assembly comprise using an exonuclease. In some instances, one or more exonucleases are used. For example, at least or about 1, 2, 3, 4, 5, 6, or more than 6 exonucleases are used. In some instances, the exonuclease comprises 5′ to 3′ exonuclease activity. In some instances, the exonuclease comprises 3′ to 5′ exonuclease activity. In some instances, methods comprise contacting double stranded DNA with an endonuclease. In some instances, the endonuclease is a flap endonuclease. In some instances, methods comprise contacting double stranded DNA with a flap endonuclease, a ligase, or a polymerase. In some instances, the flap endonuclease is flap endonuclease 1.
Provided herein are methods wherein a double stranded nucleic acid is treated with an enzyme comprising endonuclease activity. In some instances, the endonuclease comprises 5′ nuclease activity. In some instances, the endonuclease comprises 3′ nuclease activity. In some instances, the endonuclease is a flap endonuclease. In some instances, the flap endonuclease comprises 5′ nuclease activity. In some instances, the flap endonuclease is a member of a 5′-nuclease family of enzymes. Exemplary 5′-nuclease enzymes include, but are not limited to, flap endonuclease 1, exonuclease 1, xeroderma pigmentosum complementation group G (XPG), Dna2, and gap endonuclease 1 (GEN1). In some instances, the flap endonuclease is flap endonuclease 1. In some instances, the flap endonuclease comprises 3′ nuclease activity. Exemplary flap endonucleases with 3′ nuclease activity include, but are not limited to, RAG1, RAG2, and MUS81. In some instances, the flap endonuclease is an archaeal, bacteria, yeast, plant, or mammalian flap endonuclease. Exemplary 5′-nuclease and 3′ nuclease enzymes are seen in Table 2.
Homo sapiens
Mus musculus
Pyrococcus furiosis
Homo sapiens
Homo sapiens
Homo sapiens
Homo sapiens
Homo sapiens
Homo sapiens
Homo sapiens
In some instances, the endonuclease is used at a temperature optimal for enzymatic activity, for example, a temperature of 25-80° C., 25-70° C., 25-60° C., 25-50° C., or 25-40° C. In some instances, the temperature is about 50° C. In some instances, the temperature is about 55° C. In some instances, the temperature is about 65° C. In some instances, the temperature is at least or about 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C. In some instances, the endonuclease is a thermostable endonuclease. A thermostable endonuclease may include endonucleases that are functional at temperatures at least or about 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C. In some instances, the endonuclease is a flap endonuclease. In some instances, the flap endonuclease is a thermostable flap endonuclease.
Provided herein are methods for nucleic acid assembly, wherein the ratio of the endonuclease to the exonuclease is from about 0.1:1 to about 1:5. In some instances, the endonuclease is a flap endonuclease. In some instances, the ratio of the endonuclease to the exonuclease is at least or about 0.2:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, or more than 1:5. In some instances, the ratio of the endonuclease to the exonuclease is at least or about 1:1, 1:0.9, 1:0.85, 1:0.8, 1:0.75, 1:0.7, 1:0.65, 1:0.6, 1:0.55, 1:0.5, 1:0.45, 1:0.4, 1:0.35, 1:0.3, 1:0.25, 1:0.2, 1:0.15, 1:0.1, or less than 1:0.1.
Provided herein are methods for nucleic acid assembly comprising an exonuclease, wherein the concentration of the exonuclease is from about 0.1 U to about 20 U or more. For example, the concentration of the exonuclease is at least or about 0.1 U, 0.25 U, 0.5 U, 0.75 U, 1 U, 1.6 U, 2 U, 3 U, 4 U, 5 U, 6 U, 7 U, 8 U, 9 U, 10 U, 12 U, 14 U, 16 U, 18 U, 20 U, or more than 20 U. In some instances, the concentration of the exonuclease is in a range of about 0.5 U to about 1.0 U. In some instances, the concentration of the exonuclease is from about 1.0 U to about 2.0 U. In some instances, the concentration of the exonuclease is about 1.6 U. In some instances, the concentration of the exonuclease is about 5.0 U. In some instances, the concentration of the exonuclease ranges from about 0.1 U to 20 U, 0.25 U to 18 U, 0.5 U to 16 U, 0.75 U to 14 U, 1 U to 12 U, 2 U to 10 U, 3 U to 9 U, or 4 U to 8 U.
Methods described herein for enzymatic mediated nucleic acid assembly may comprise an endonuclease, wherein the concentration of the endonuclease is from about 0.25 U to about 12 U or more. In some instances, the endonuclease is a flap endonuclease. Exemplary concentrations of the endonuclease, include, but are not limited to, at least or about 0.25 U, 0.5 U, 0.75 U, 1 U, 2 U, 3 U, 4 U, 5 U, 6 U, 7 U, 8 U, 9 U, 10 U, 11 U, 12 U, or more than 12 U. In some instances, the concentration of the endonuclease is 0.32 U. In some instances, the concentration of the endonuclease is 1.6 U. In some instances, the concentration of the endonuclease is in a range of about 0.32 U to about 4.8 U. In some instances, the concentration of the endonuclease is in a range of about 0.25 U to 12 U, 0.5 U to 11 U, 0.75 U to 10 U, 1 U to 9 U, 2 U to 8 U, 3 U to 7 U, or 4 U to 6 U.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein a double stranded nucleic acid is mixed with a polymerase. In some instances, the polymerase is a DNA polymerase. In some instances, the polymerase is a high fidelity polymerase. A high fidelity polymerase may include polymerases that result in accurate replication or amplification of a template nucleic acid. In some instances, the DNA polymerase is a thermostable DNA polymerase. The DNA polymerase may be from any family of DNA polymerases including, but not limited to, Family A polymerase, Family B polymerase, Family C polymerase, Family D polymerase, Family X polymerase, and Family Y polymerase. In some instances, the DNA polymerase is from a genus including, but not limited to, Thermus, Bacillus, Thermococcus, Pyrococcus, Aeropyrum, Aquifex, Sulfolobus, Pyrolobus, or Methanopyrus.
Polymerases described herein for use in an amplification reaction may comprise various enzymatic activities. Polymerases are used in the methods of the invention, for example, to extend primers to produce extension products. In some instances, the DNA polymerase comprises 5′ to 3′ polymerase activity. In some instances, the DNA polymerase comprises 3′ to 5′ exonuclease activity. In some instances, the DNA polymerase comprises proofreading activity. Exemplary polymerases include, but are not limited to, DNA polymerase (I, II, or III), T4 DNA polymerase, T7 DNA polymerase, Bst DNA polymerase, Bca polymerase, Vent DNA polymerase, Pfu DNA polymerase, and Taq DNA polymerase. Non-limiting examples of thermostable DNA polymerases include, but are not limited to, Taq, Phusion® DNA polymerase, Q5® High Fidelity DNA Polymerase, LongAmp® DNA polymerase, Expand High Fidelity polymerase, HotTub polymerase, Pwo polymerase, Tfl polymerase, Tli polymerase, UlTma polymerase, Pfu polymerase, KOD DNA polymerase, JDF-3 DNA polymerase, PGB-D DNA polymerase, Tgo DNA polymerase, Pyrolobus furmarius DNA polymerase, Vent polymerase, and Deep Vent polymerase.
Described herein are methods comprising a DNA polymerase, wherein a concentration of the DNA polymerase is from about 0.1 U to about 2 U, or more than 2 U. In some instances, the concentration of the DNA polymerase is about 0.1 U. In some instances, the concentration of the DNA polymerase is about 0.2 U. In some instances, the concentration of the DNA polymerase is about 0.01 U. In some instances, the concentration of the DNA polymerase is in a range of at least or about 0.005 U to 2 U, 0.005 U to 1 U, 0.005 U to 0.5 U, 0.01 U to 1 U, 0.1 U to 0.5 U, 0.1 U to 0.5 U, 0.1 U to 1 U, 0.1 U to 1.5 U, 0.1 U to 2 U, 0.5 U to 1.0 U, 0.5 U to 1.5 U, 0.5 U to 2 U, 1 U to 1.5 U, 1.0 U to 2.0 U, or 1.5 U to 2 U.
The DNA polymerase for use in methods described herein are used at a temperature optimal for enzymatic activity, for example, a temperature of 25-80° C., 25-70° C., 25-60° C., 25-50° C., or 25-40° C. In some instances, the temperature is about 50° C. In some instances, the temperature is about 55° C. In some instances, the temperature is about 65° C. In some instances, the temperature is at least or about 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C.
Methods described herein for enzymatic mediated nucleic acid assembly may comprise an amplification reaction, wherein the amplification reaction comprises a universal primer binding sequence. In some instances, the universal primer binding sequence is capable of binding the same 5′ or 3′ primer. In some instances, the universal primer binding sequence is shared among a plurality of target nucleic acids in the amplification reaction.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein a double stranded nucleic acid is treated with a ligase. Ligases as described herein may function to join nucleic acid fragments. For example, the ligase functions to join adjacent 3′-hydroxylated and 5′-phosphorylated termini of DNA. Ligases include, but are not limited to, E. coli ligase, T4 ligase, mammalian ligases (e.g., DNA ligase I, DNA ligase II, DNA ligase III, DNA ligase IV), thermostable ligases, and fast ligases. In some instances, the ligase is a thermostable ligase. In some instances, the ligase is Ampligase.
The concentration of the ligase may vary. In some instances, the concentration of the ligase is in a range of about 0 U to about 2 U. An exemplary concentration of the ligase is about 0.5 U. In some instances, the concentration of the ligase is about 1.0 U. In some instances, the concentration of the ligase is about 5.0 U. In some instances, the concentration of the ligase is in a range of at least or about 0 U to 0.25 U, 0 U to 0.5 U, 0 U to 1 U, 0 U to 1.5 U, 0 U to 2 U, 0.25 U to 0.5 U, 0.25 U to 1.0 U, 0.25 U to 1.5 U, 0.25 U to 2.0 U, 0.5 U to 1.0 U, 0.5 U to 1.5 U, 0.5 U to 2.0 U, 1.0 U to 1.5 U, 1.0 U to 2.0 U, 1.5 U to 2.0 U, 2.0 U to 4.0 U, 4.0 U to 6.0 U, 4.0 U to 8.0 U, 6.0 U to 10.0 U.
In some instances, the ligase is used at a temperature optimal for enzymatic activity, for example, a temperature of 25-80° C., 25-70° C., 25-60° C., 25-50° C., or 25-40° C. In some instances, the temperature is about 50° C. In some instances, the temperature is about 55° C. In some instances, the temperature is about 65° C. In some instances, the temperature is at least or about 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C., 50° C., 55° C., 60° C., 65° C., 70° C., 75° C., 80° C., or more than 80° C.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein a number of gene fragments are assembled. In some instances, the gene fragments are assembled processively or sequentially. In some instances, the gene fragments are assembled into a vector. In some instances, the gene fragments are assembled for long linear gene assembly. In some instances, the number of gene fragments is at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 gene fragments. In some instances, the number of gene fragments is at least or about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 gene fragments. In some instances, the number of gene fragments is in a range of about 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 2 to 3, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9, 2 to 10, 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 3 to 10, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 4 to 10, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 5 to 10, 6 to 7, 6 to 8, 6 to 9, 6 to 10, 7 to 8, 7 to 9, 7 to 10, 8 to 9, 8 to 10, or 9 to 10. In some instances, the number of gene fragments is about 1 to about 20, about 2 to about 18, about 3 to about 17, about 4 to about 16, about 6 to about 14, or about 8 to about 12.
Provided herein are methods for enzymatic mediated nucleic acid assembly, wherein a ratio of gene fragments assembled is about 0.2:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, or more than 1:5. For example, if two gene fragments are assembled, a ratio of the first gene fragment to the second gene fragment is 1:1. In some instances, a ratio of the first gene fragment to the second gene fragment is at least or about 1:1, 1:0.9, 1:0.85, 1:0.8, 1:0.75, 1:0.7, 1:0.65, 1:0.6, 1:0.55, 1:0.5, 1:0.45, 1:0.4, 1:0.35, 1:0.3, 1:0.25, 1:0.2, 1:0.15, 1:0.1, or less than 1:0.1.
Methods as described herein for enzymatic mediated nucleic acid assembly may comprise assembly of one or more gene fragments into a vector, wherein a ratio of the one or more gene fragments to the vector varies. In some instances, a ratio of the one or more gene fragments to the vector is at least or about 0.2:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, or more than 1:5. In some instances, a ratio of the one or more gene fragments to the vector is at least or about 1:1, 1:0.9, 1:0.85, 1:0.8, 1:0.75, 1:0.7, 1:0.65, 1:0.6, 1:0.55, 1:0.5, 1:0.45, 1:0.4, 1:0.35, 1:0.3, 1:0.25, 1:0.2, 1:0.15, 1:0.1, or less than 1:0.1.
Methods as described herein for enzymatic mediated nucleic acid assembly may comprise assembly of oligonucleotide populations for assembly into a vector. In some instances, overlap extension PCR is performed for assembly of oligonucleotide populations. In some instances, the oligonucleotide population comprises at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, or more than 200 oligonucleotides. In some instances, the oligonucleotide population are assembled to generate a long nucleic acid comprising at least or about 50, 100, 200, 250 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases.
Methods as described herein for enzymatic mediated nucleic acid assembly may comprise multiplexed gene assembly. In some instances, multiple sequences are assembled in a single reaction. In some instances, at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, or more than 200 sequences are assembled in a single reaction. Sequences assembled by multiplex gene assembly, in some instances, are inserted into a vector.
Methods for enzymatic mediated nucleic acid assembly may comprise assembly of one or more gene fragments using a nucleic acid bridge, wherein a ratio of the one or more gene fragments to the nucleic acid bridge varies. In some instances, a ratio of the one or more gene fragments to the nucleic acid bridge is at least or about 0.2:1, 0.25:1, 0.5:1, 0.75:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, or more than 1:5. In some instances, a ratio of the one or more gene fragments to the nucleic acid bridge is at least or about 1:1, 1:0.9, 1:0.85, 1:0.8, 1:0.75, 1:0.7, 1:0.65, 1:0.6, 1:0.55, 1:0.5, 1:0.45, 1:0.4, 1:0.35, 1:0.3, 1:0.25, 1:0.2, 1:0.15, 1:0.1, or less than 1:0.1.
Provided herein are methods for enzymatic mediated nucleic acid assembly of gene fragments, wherein a total size of the number of gene fragments that are assembled is at least or about 50, 100, 200, 250 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases. In some instances, a total size of the number of gene fragments that are assembled is in a range of about 300 to 1,000, 300 to 2,000, 300 to 3,000, 300 to 4,000, 300 to 5,000, 300 to 6,000, 300 to 7,000, 300 to 8,000, 300 to 9,000, 300 to 10,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4,000, 1,000 to 5,000, 1,000 to 6,000, 1,000 to 7,000, 1,000 to 8,000, 1,000 to 9,000, 1,000 to 10,000, 2,000 to 3,000, 2,000 to 4,000, 2,000 to 5,000, 2,000 to 6,000, 2,000 to 7,000, 2,000 to 8,000, 2,000 to 9,000, 2,000 to 10,000, 3,000 to 4,000, 3,000 to 5,000, 3,000 to 6,000, 3,000 to 7,000, 3,000 to 8,000, 3,000 to 9,000, 3,000 to 10,000, 4,000 to 5,000, 4,000 to 6,000, 4,000 to 7,000, 4,000 to 8,000, 4,000 to 9,000, 4,000 to 10,000, 5,000 to 6,000, 5,000 to 7,000, 5,000 to 8,000, 5,000 to 9,000, 5,000 to 10,000, 6,000 to 7,000, 6,000 to 8,000, 6,000 to 9,000, 6,000 to 10,000, 7,000 to 8,000, 7,000 to 9,000, 7,000 to 10,000, 8,000 to 9,000, 8,000 to 10,000, or 9,000 to 10,000 bases.
Methods described herein comprising enzymatic mediated nucleic acid assembly result in a high percentage of correct assembly. In some instances, the percentage of correct assembly is at least or about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or more than 99%. In some instances, the percentage of average correct assembly is at least or about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or more than 99%. In some instances, the percentage of correct assembly is 100%.
Methods as described herein comprising enzymatic mediated nucleic acid assembly result in a low percentage of misassembly. In some instances, the percentage misassembly rate is at most 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%. In some instances, the percentage misassembly rate is about 1% to about 25%, about 5% to about 20%, or about 10% to about 15%. In some instances, the average misassembly rate is at most 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60%. In some instances, the average misassembly rate is about 1% to about 25%, about 5% to about 20%, or about 10% to about 15%.
Methods described herein comprising enzymatic mediated nucleic acid assembly result in increased efficiency. In some instances, efficiency is measured by number of colony forming units. In some instances, methods described herein result in at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 12000, 14000, 16000, 18000, 20000, 25000, 30000, 35000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, or more than 100000 colony forming units.
Systems for Synthesis of Nucleic Acids and Seamless Assembly
Polynucleotide Synthesis
Provided herein are methods for seamless assembly of nucleic acids following generation of polynucleotides by de novo synthesis by methods described herein. An exemplary workflow is seen in
Provided herein are systems for seamless assembly of nucleic acids following generation of polynucleotides by de novo synthesis by methods described herein. In some instances, the system comprises a computer, a material deposition device, a surface, and a nucleic acid assembly surface. In some instances, the computer comprises a readable input file with a nucleic acid sequence. In some instances, the computer processes the nucleic acid sequence to generate instructions for synthesis of the polynucleotide sequence or a plurality of polynucleotide sequences collectively encoding for the nucleic acid sequence. In some instances, the computer provides instructions to the material deposition device for the synthesis of the plurality of polynucleotide acid sequences. In some instances, the material deposition device deposits nucleosides on the surface for an extension reaction. In some instances, the surface comprises a locus for the extension reaction. In some instances, the locus is a spot, well, microwell, channel, or post. In some instances, the plurality of polynucleotide acid sequences is synthesized following the extension reaction. In some instances, the plurality of polynucleotide acid sequences is removed from the surface and prepared for nucleic acid assembly. In some instances, the nucleic acid assembly comprises flap endonuclease mediated nucleic acid assembly.
Provided herein are methods for polynucleotide synthesis involving phosphoramidite chemistry. In some instances, polynucleotide synthesis comprises coupling a base with phosphoramidite. In some instances, polynucleotide synthesis comprises coupling a base by deposition of phosphoramidite under coupling conditions, wherein the same base is optionally deposited with phosphoramidite more than once, i.e., double coupling. In some instances, polynucleotide synthesis comprises capping of unreacted sites. In some cases, capping is optional. In some instances, polynucleotide synthesis comprises oxidation. In some instances, polynucleotide synthesis comprises deblocking or detritylation. In some instances, polynucleotide synthesis comprises sulfurization. In some cases, polynucleotide synthesis comprises either oxidation or sulfurization. In some instances, between one or each step during a polynucleotide synthesis reaction, the substrate is washed, for example, using tetrazole or acetonitrile. Time frames for any one step in a phosphoramidite synthesis method include less than about 2 min, 1 min, 50 sec, 40 sec, 30 sec, 20 sec, or 10 sec.
Polynucleotide synthesis using a phosphoramidite method comprises the subsequent addition of a phosphoramidite building block (e.g., nucleoside phosphoramidite) to a growing polynucleotide chain for the formation of a phosphite triester linkage. Phosphoramidite polynucleotide synthesis proceeds in the 3′ to 5′ direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain per synthesis cycle. In some instances, each synthesis cycle comprises a coupling step. Phosphoramidite coupling involves the formation of a phosphite triester linkage between an activated nucleoside phosphoramidite and a nucleoside bound to the substrate, for example, via a linker. In some instances, the nucleoside phosphoramidite is provided to the substrate activated. In some instances, the nucleoside phosphoramidite is provided to the substrate with an activator. In some instances, nucleoside phosphoramidites are provided to the substrate in a 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100-fold excess or more over the substrate-bound nucleosides. In some instances, the addition of nucleoside phosphoramidite is performed in an anhydrous environment, for example, in anhydrous acetonitrile. Following addition of a nucleoside phosphoramidite, the substrate is optionally washed. In some instances, the coupling step is repeated one or more additional times, optionally with a wash step between nucleoside phosphoramidite additions to the substrate. In some instances, a polynucleotide synthesis method used herein comprises 1, 2, 3 or more sequential coupling steps. Prior to coupling, in many cases, the nucleoside bound to the substrate is de-protected by removal of a protecting group, where the protecting group functions to prevent polymerization. A common protecting group is 4,4′-dimethoxytrityl (DMT).
Following coupling, phosphoramidite polynucleotide synthesis methods optionally comprise a capping step. In a capping step, the growing polynucleotide is treated with a capping agent. A capping step is useful to block unreacted substrate-bound 5′-OH groups after coupling from further chain elongation, preventing the formation of polynucleotides with internal base deletions. Further, phosphoramidites activated with 1H-tetrazole may react, to a small extent, with the O6 position of guanosine. Without being bound by theory, upon oxidation with I2/water, this side product, possibly via O6-N7 migration, may undergo depurination. The apurinic sites may end up being cleaved in the course of the final deprotection of the polynucleotide thus reducing the yield of the full-length product. The O6 modifications may be removed by treatment with the capping reagent prior to oxidation with I2/water. In some instances, inclusion of a capping step during polynucleotide synthesis decreases the error rate as compared to synthesis without capping. As an example, the capping step comprises treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. Following a capping step, the substrate is optionally washed.
In some instances, following addition of a nucleoside phosphoramidite, and optionally after capping and one or more wash steps, the substrate bound growing nucleic acid is oxidized. The oxidation step comprises oxidation of the phosphite triester into a tetracoordinated phosphate triester, a protected precursor of the naturally occurring phosphate diester internucleoside linkage. In some cases, oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, collidine). Oxidation may be carried out under anhydrous conditions using, e.g. tert-Butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for substrate drying, as residual water from oxidation that may persist can inhibit subsequent coupling. Following oxidation, the substrate and growing polynucleotide is optionally washed. In some instances, the step of oxidation is substituted with a sulfurization step to obtain polynucleotide phosphorothioates, wherein any capping steps can be performed after the sulfurization. Many reagents are capable of the efficient sulfur transfer, including but not limited to 3-(Dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, also known as Beaucage reagent, and N,N,N′N′-Tetraethylthiuram disulfide (TETD).
In order for a subsequent cycle of nucleoside incorporation to occur through coupling, the protected 5′ end of the substrate bound growing polynucleotide is removed so that the primary hydroxyl group is reactive with a next nucleoside phosphoramidite. In some instances, the protecting group is DMT and deblocking occurs with trichloroacetic acid in dichloromethane. Conducting detritylation for an extended time or with stronger than recommended solutions of acids may lead to increased depurination of solid support-bound polynucleotide and thus reduces the yield of the desired full-length product. Methods and compositions of the invention described herein provide for controlled deblocking conditions limiting undesired depurination reactions. In some cases, the substrate bound polynucleotide is washed after deblocking. In some cases, efficient washing after deblocking contributes to synthesized polynucleotides having a low error rate.
Methods for the synthesis of polynucleotides typically involve an iterating sequence of the following steps: application of a protected monomer to an actively functionalized surface (e.g., locus) to link with either the activated surface, a linker or with a previously deprotected monomer; deprotection of the applied monomer so that it is reactive with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps include oxidation or sulfurization. In some cases, one or more wash steps precede or follow one or all of the steps.
Methods for phosphoramidite based polynucleotide synthesis comprise a series of chemical steps. In some instances, one or more steps of a synthesis method involve reagent cycling, where one or more steps of the method comprise application to the substrate of a reagent useful for the step. For example, reagents are cycled by a series of liquid deposition and vacuum drying steps. For substrates comprising three-dimensional features such as wells, microwells, channels and the like, reagents are optionally passed through one or more regions of the substrate via the wells and/or channels.
Polynucleotides synthesized using the methods and/or substrates described herein comprise at least about 20, 30, 40, 50, 60, 70, 75, 80, 90, 100, 120, 150, 200, 500 or more bases in length. In some instances, at least about 1 pmol, 10 pmol, 20 pmol, 30 pmol, 40 pmol, 50 pmol, 60 pmol, 70 pmol, 80 pmol, 90 pmol, 100 pmol, 150 pmol, 200 pmol, 300 pmol, 400 pmol, 500 pmol, 600 pmol, 700 pmol, 800 pmol, 900 pmol, 1 nmol, 5 nmol, 10 nmol, 100 nmol or more of an polynucleotide is synthesized within a locus. Methods for polynucleotide synthesis on a surface provided herein allow for synthesis at a fast rate. As an example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides per hour, or more are synthesized. Nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or analogs/modified versions thereof. In some instances, libraries of polynucleotides are synthesized in parallel on a substrate. For example, a substrate comprising about or at least about 100; 1,000; 10,000; 100,000; 1,000,000; 2,000,000; 3,000,000; 4,000,000; or 5,000,000 resolved loci is able to support the synthesis of at least the same number of distinct polynucleotides, wherein a polynucleotide encoding a distinct sequence is synthesized on a resolved locus.
Various suitable methods are known for generating high density polynucleotide arrays. In an exemplary workflow, a substrate surface layer is provided. In the example, chemistry of the surface is altered in order to improve the polynucleotide synthesis process. Areas of low surface energy are generated to repel liquid while areas of high surface energy are generated to attract liquids. The surface itself may be in the form of a planar surface or contain variations in shape, such as protrusions or microwells which increase surface area. In the workflow example, high surface energy molecules selected serve a dual function of supporting DNA chemistry, as disclosed in International Patent Application Publication WO/2015/021080, which is herein incorporated by reference in its entirety.
In situ preparation of polynucleotide arrays is generated on a solid support and utilizes a single nucleotide extension process to extend multiple oligomers in parallel. A deposition device, such as a polynucleotide synthesizer, is designed to release reagents in a step wise fashion such that multiple polynucleotides extend, in parallel, one residue at a time to generate oligomers with a predetermined nucleic acid sequence. In some cases, polynucleotides are cleaved from the surface at this stage. Cleavage includes gas cleavage, e.g., with ammonia or methylamine.
Substrates
Devices used as a surface for polynucleotide synthesis may be in the form of substrates which include, without limitation, homogenous array surfaces, patterned array surfaces, channels, beads, gels, and the like. Provided herein are substrates comprising a plurality of clusters, wherein each cluster comprises a plurality of loci that support the attachment and synthesis of polynucleotides. The term “locus” as used herein refers to a discrete region on a structure which provides support for polynucleotides encoding for a single predetermined sequence to extend from the surface. In some instances, a locus is on a two dimensional surface, e.g., a substantially planar surface. In some instances, a locus is on a three-dimensional surface, e.g., a well, microwell, channel, or post. In some instances, a surface of a locus comprises a material that is actively functionalized to attach to at least one nucleotide for polynucleotide synthesis, or preferably, a population of identical nucleotides for synthesis of a population of polynucleotides. In some instances, polynucleotide refers to a population of polynucleotides encoding for the same nucleic acid sequence. In some cases, a surface of a substrate is inclusive of one or a plurality of surfaces of a substrate. The average error rates for polynucleotides synthesized within a library described here using the systems and methods provided are often less than 1 in 1000, less than about 1 in 2000, less than about 1 in 3000 or less often without error correction.
Provided herein are surfaces that support the parallel synthesis of a plurality of polynucleotides having different predetermined sequences at addressable locations on a common support. In some instances, a substrate provides support for the synthesis of more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more non-identical polynucleotides. In some cases, the surfaces provide support for the synthesis of more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000; 5,000; 10,000; 20,000; 50,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; 10,000,000 or more polynucleotides encoding for distinct sequences. In some instances, at least a portion of the polynucleotides have an identical sequence or are configured to be synthesized with an identical sequence. In some instances, the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 bases or more.
Provided herein are methods for polynucleotide synthesis on distinct loci of a substrate, wherein each locus supports the synthesis of a population of polynucleotides. In some cases, each locus supports the synthesis of a population of polynucleotides having a different sequence than a population of polynucleotides grown on another locus. In some instances, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more redundancy across different loci within the same cluster of loci on a surface for polynucleotide synthesis. In some instances, the loci of a substrate are located within a plurality of clusters. In some instances, a substrate comprises at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some instances, a substrate comprises more than 2,000; 5,000; 10,000; 100,000; 200,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,100,000; 1,200,000; 1,300,000; 1,400,000; 1,500,000; 1,600,000; 1,700,000; 1,800,000; 1,900,000; 2,000,000; 300,000; 400,000; 500,000; 600,000; 700,000; 800,000; 900,000; 1,000,000; 1,200,000; 1,400,000; 1,600,000; 1,800,000; 2,000,000; 2,500,000; 3,000,000; 3,500,000; 4,000,000; 4,500,000; 5,000,000; or 10,000,000 or more distinct loci. In some instances, a substrate comprises about 10,000 distinct loci. The amount of loci within a single cluster is varied in different instances. In some cases, each cluster includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more loci. In some instances, each cluster includes about 50-500 loci. In some instances, each cluster includes about 100-200 loci. In some instances, each cluster includes about 100-150 loci. In some instances, each cluster includes about 109, 121, 130 or 137 loci. In some instances, each cluster includes about 19, 20, 61, 64 or more loci.
In some instances, the number of distinct polynucleotides synthesized on a substrate is dependent on the number of distinct loci available on the substrate. In some instances, the density of loci within a cluster of a substrate is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000 or more loci per mm2. In some cases, a substrate comprises 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm2. In some instances, the distance between the centers of two adjacent loci within a cluster is from about 10-500, from about 10-200, or from about 10-100 um. In some instances, the distance between two centers of adjacent loci is greater than about 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 um. In some instances, the distance between the centers of two adjacent loci is less than about 200, 150, 100, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, each locus independently has a width of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 um. In some cases, each locus independently has a width of about 0.5-100, 0.5-50, 10-75, or 0.5-50 um.
In some instances, the density of clusters within a substrate is at least or about 1 cluster per 100 mm2, 1 cluster per 10 mm2, 1 cluster per 5 mm2, 1 cluster per 4 mm2, 1 cluster per 3 mm2, 1 cluster per 2 mm2, 1 cluster per 1 mm2, 2 clusters per 1 mm2, 3 clusters per 1 mm2, 4 clusters per 1 mm2, 5 clusters per 1 mm2, 10 clusters per 1 mm2, 50 clusters per 1 mm2 or more. In some instances, a substrate comprises from about 1 cluster per 10 mm2 to about 10 clusters per 1 mm2. In some instances, the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 um. In some cases, the distance between the centers of two adjacent clusters is between about 50-100, 50-200, 50-300, 50-500, or 100-2000 um. In some cases, the distance between the centers of two adjacent clusters is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster independently has a cross section of about 0.5 to 2, about 0.5 to 1, or about 1 to 2 mm. In some cases, each cluster independently has a cross section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm. In some cases, each cluster independently has an interior cross section of about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mm.
In some instances, a substrate is about the size of a standard 96 well plate, for example between about 100 to about 200 mm by between about 50 to about 150 mm. In some instances, a substrate has a diameter less than or equal to about 1000, 500, 450, 400, 300, 250, 200, 150, 100 or 50 mm. In some instances, the diameter of a substrate is between about 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some instances, a substrate has a planar surface area of at least about 100; 200; 500; 1,000; 2,000; 5,000; 10,000; 12,000; 15,000; 20,000; 30,000; 40,000; 50,000 mm2 or more. In some instances, the thickness of a substrate is between about 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.
Surface Materials
Substrates, devices, and reactors provided herein are fabricated from any variety of materials suitable for the methods, compositions, and systems described herein. In certain instances, substrate materials are fabricated to exhibit a low level of nucleotide binding. In some instances, substrate materials are modified to generate distinct surfaces that exhibit a high level of nucleotide binding. In some instances, substrate materials are transparent to visible and/or UV light. In some instances, substrate materials are sufficiently conductive, e.g., are able to form uniform electric fields across all or a portion of a substrate. In some instances, conductive materials are connected to an electric ground. In some instances, the substrate is heat conductive or insulated. In some instances, the materials are chemical resistant and heat resistant to support chemical or biochemical reactions, for example polynucleotide synthesis reaction processes. In some instances, a substrate comprises flexible materials. For flexible materials, materials can include, without limitation: nylon, both modified and unmodified, nitrocellulose, polypropylene, and the like. In some instances, a substrate comprises rigid materials. For rigid materials, materials can include, without limitation: glass; fuse silica; silicon, plastics (for example polytetraflouroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof, and the like); metals (for example, gold, platinum, and the like). The substrate, solid support or reactors can be fabricated from a material selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamides, polydimethylsiloxane (PDMS), and glass. The substrates/solid supports or the microstructures, reactors therein may be manufactured with a combination of materials listed herein or any other suitable material known in the art.
Surface Architecture
Provided herein are substrates for the methods, compositions, and systems described herein, wherein the substrates have a surface architecture suitable for the methods, compositions, and systems described herein. In some instances, a substrate comprises raised and/or lowered features. One benefit of having such features is an increase in surface area to support polynucleotide synthesis. In some instances, a substrate having raised and/or lowered features is referred to as a three-dimensional substrate. In some cases, a three-dimensional substrate comprises one or more channels. In some cases, one or more loci comprise a channel. In some cases, the channels are accessible to reagent deposition via a deposition device such as a polynucleotide synthesizer. In some cases, reagents and/or fluids collect in a larger well in fluid communication with one or more channels. For example, a substrate comprises a plurality of channels corresponding to a plurality of loci within a cluster, and the plurality of channels are in fluid communication with one well of the cluster. In some methods, a library of polynucleotides is synthesized in a plurality of loci of a cluster.
Provided herein are substrates for the methods, compositions, and systems described herein, wherein the substrates are configured for polynucleotide synthesis. In some instances, the structure is configured to allow for controlled flow and mass transfer paths for polynucleotide synthesis on a surface. In some instances, the configuration of a substrate allows for the controlled and even distribution of mass transfer paths, chemical exposure times, and/or wash efficacy during polynucleotide synthesis. In some instances, the configuration of a substrate allows for increased sweep efficiency, for example by providing sufficient volume for growing a polynucleotide such that the excluded volume by the growing polynucleotide does not take up more than 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1%, or less of the initially available volume that is available or suitable for growing the polynucleotide. In some instances, a three-dimensional structure allows for managed flow of fluid to allow for the rapid exchange of chemical exposure.
Provided herein are substrates for the methods, compositions, and systems relating to enzymatic mediated nucleic acid assembly and polynucleotide synthesis described herein, wherein the substrates comprise structures configured for housing enzymatic reactions described herein. In some instances, segregation is achieved by physical structure. In some instances, segregation is achieved by differential functionalization of the surface generating active and passive regions for polynucleotide synthesis. In some instances, differential functionalization is achieved by alternating the hydrophobicity across the substrate surface, thereby creating water contact angle effects that cause beading or wetting of the deposited reagents. Employing larger structures can decrease splashing and cross-contamination of distinct polynucleotide synthesis locations with reagents of the neighboring spots. In some cases, a device, such as a polynucleotide synthesizer, is used to deposit reagents to distinct polynucleotide synthesis locations. Substrates having three-dimensional features are configured in a manner that allows for the synthesis of a large number of polynucleotides (e.g., more than about 10,000) with a low error rate (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000; 1:3,000; 1:5,000; or 1:10,000). In some cases, a substrate comprises features with a density of about or greater than about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400 or 500 features per mm2.
A well of a substrate may have the same or different width, height, and/or volume as another well of the substrate. A channel of a substrate may have the same or different width, height, and/or volume as another channel of the substrate. In some instances, the diameter of a cluster or the diameter of a well comprising a cluster, or both, is between about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.05-1, 0.05-0.5, 0.05-0.1, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some instances, the diameter of a cluster or well or both is less than or about 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some instances, the diameter of a cluster or well or both is between about 1.0 and about 1.3 mm. In some instances, the diameter of a cluster or well, or both is about 1.150 mm. In some instances, the diameter of a cluster or well, or both is about 0.08 mm. The diameter of a cluster refers to clusters within a two-dimensional or three-dimensional substrate.
In some instances, the height of a well is from about 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 um. In some cases, the height of a well is less than about 1000, 900, 800, 700, or 600 um.
In some instances, a substrate comprises a plurality of channels corresponding to a plurality of loci within a cluster, wherein the height or depth of a channel is 5-500, 5-400, 5-300, 5-200, 5-100, 5-50, or 10-50 um. In some cases, the height of a channel is less than 100, 80, 60, 40, or 20 um.
In some instances, the diameter of a channel, locus (e.g., in a substantially planar substrate) or both channel and locus (e.g., in a three-dimensional substrate wherein a locus corresponds to a channel) is from about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 um, for example, about 90, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, the diameter of a channel, locus, or both channel and locus is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 um. In some instances, the distance between the center of two adjacent channels, loci, or channels and loci is from about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, for example, about 20 um.
Surface Modifications
Provided herein are methods for polynucleotide synthesis on a surface, wherein the surface comprises various surface modifications. In some instances, the surface modifications are employed for the chemical and/or physical alteration of a surface by an additive or subtractive process to change one or more chemical and/or physical properties of a substrate surface or a selected site or region of a substrate surface. For example, surface modifications include, without limitation, (1) changing the wetting properties of a surface, (2) functionalizing a surface, i.e., providing, modifying or substituting surface functional groups, (3) defunctionalizing a surface, i.e., removing surface functional groups, (4) otherwise altering the chemical composition of a surface, e.g., through etching, (5) increasing or decreasing surface roughness, (6) providing a coating on a surface, e.g., a coating that exhibits wetting properties that are different from the wetting properties of the surface, and/or (7) depositing particulates on a surface.
In some cases, the addition of a chemical layer on top of a surface (referred to as adhesion promoter) facilitates structured patterning of loci on a surface of a substrate. Exemplary surfaces for application of adhesion promotion include, without limitation, glass, silicon, silicon dioxide and silicon nitride. In some cases, the adhesion promoter is a chemical with a high surface energy. In some instances, a second chemical layer is deposited on a surface of a substrate. In some cases, the second chemical layer has a low surface energy. In some cases, surface energy of a chemical layer coated on a surface supports localization of droplets on the surface. Depending on the patterning arrangement selected, the proximity of loci and/or area of fluid contact at the loci are alterable.
In some instances, a substrate surface, or resolved loci, onto which nucleic acids or other moieties are deposited, e.g., for polynucleotide synthesis, are smooth or substantially planar (e.g., two-dimensional) or have irregularities, such as raised or lowered features (e.g., three-dimensional features). In some instances, a substrate surface is modified with one or more different layers of compounds. Such modification layers of interest include, without limitation, inorganic and organic layers such as metals, metal oxides, polymers, small organic molecules and the like.
In some instances, resolved loci of a substrate are functionalized with one or more moieties that increase and/or decrease surface energy. In some cases, a moiety is chemically inert. In some cases, a moiety is configured to support a desired chemical reaction, for example, one or more processes in a polynucleotide acid synthesis reaction. The surface energy, or hydrophobicity, of a surface is a factor for determining the affinity of a nucleotide to attach onto the surface. In some instances, a method for substrate functionalization comprises: (a) providing a substrate having a surface that comprises silicon dioxide; and (b) silanizing the surface using, a suitable silanizing agent described herein or otherwise known in the art, for example, an organofunctional alkoxysilane molecule. Methods and functionalizing agents are described in U.S. Pat. No. 5,474,796, which is herein incorporated by reference in its entirety.
In some instances, a substrate surface is functionalized by contact with a derivatizing composition that contains a mixture of silanes, under reaction conditions effective to couple the silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface. Silanization generally covers a surface through self-assembly with organofunctional alkoxysilane molecules. A variety of siloxane functionalizing reagents can further be used as currently known in the art, e.g., for lowering or increasing surface energy. The organofunctional alkoxysilanes are classified according to their organic functions.
Computer Systems
Any of the systems described herein, may be operably linked to a computer and may be automated through a computer either locally or remotely. In some instances, the methods and systems of the invention further comprise software programs on computer systems and use thereof. Accordingly, computerized control for the synchronization of the dispense/vacuum/refill functions such as orchestrating and synchronizing the material deposition device movement, dispense action and vacuum actuation are within the bounds of the invention. The computer systems may be programmed to interface between the user specified base sequence and the position of a material deposition device to deliver the correct reagents to specified regions of the substrate.
The computer system 300 illustrated in
As illustrated in
Software and data are stored in external storage 424 and can be loaded into RAM 410 and/or cache 404 for use by the processor. The system 400 includes an operating system for managing system resources; non-limiting examples of operating systems include: Linux, Windows™, MACOS™, BlackBerry OS™, iOS™, and other functionally-equivalent operating systems, as well as application software running on top of the operating system for managing data storage and optimization in accordance with example embodiments of the present invention. In this example, system 400 also includes network interface cards (NICs) 420 and 421 connected to the peripheral bus for providing network interfaces to external storage, such as Network Attached Storage (NAS) and other computer systems that can be used for distributed parallel processing.
Any of the systems described herein may comprise sequence information stored on non-transitory computer readable storage media. In some instances, any of the systems described herein comprise a computer input file. In some instances, the computer input file comprises sequence information. In some instances, the computer input file comprises instructions for synthesis of a plurality of polynucleotide sequences. In some instances, the instructions are received by a computer. In some instances, the instructions are processed by the computer. In some instances, the instructions are transmitted to a material deposition device. In some instances, the non-transitory computer readable storage media is encoded with a program including instructions executable by the operating system of an optionally networked digital processing device. In some instances, a computer readable storage medium is a tangible component of a digital processing device. In some instances, a computer readable storage medium is optionally removable from a digital processing device. In some instances, a computer readable storage medium includes, by way of non-limiting examples, CD-ROMs, DVDs, flash memory devices, solid state memory, magnetic disk drives, magnetic tape drives, optical disk drives, cloud computing systems and services, and the like. In some instances, the program and instructions are permanently, substantially permanently, semi-permanently, or non-transitorily encoded on the media.
The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.
A substrate was functionalized to support the attachment and synthesis of a library of polynucleotides. The substrate surface was first wet cleaned using a piranha solution comprising 90% H2SO4 and 10% H2O2 for 20 minutes. The substrate was rinsed in several beakers with deionized water, held under a deionized water gooseneck faucet for 5 min, and dried with N2. The substrate was subsequently soaked in NH4OH (1:100; 3 mL:300 mL) for 5 min, rinsed with DI water using a handgun, soaked in three successive beakers with deionized water for 1 min each, and then rinsed again with deionized water using the handgun. The substrate was then plasma cleaned by exposing the substrate surface to O2. A SAMCO PC-300 instrument was used to plasma etch O2 at 250 watts for 1 min in downstream mode.
The cleaned substrate surface was actively functionalized with a solution comprising N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5 to 1 torr, 60 min, 70° C., 135° C. vaporizer. The substrate surface was resist coated using a Brewer Science 200X spin coater. SPR™ 3612 photoresist was spin coated on the substrate at 2500 rpm for 40 sec. The substrate was pre-baked for 30 min at 90° C. on a Brewer hot plate. The substrate was subjected to photolithography using a Karl Suss MA6 mask aligner instrument. The substrate was exposed for 2.2 sec and developed for 1 min in MSF 26A. Remaining developer was rinsed with the handgun and the substrate soaked in water for 5 min. The substrate was baked for 30 min at 100° C. in the oven, followed by visual inspection for lithography defects using a Nikon L200. A cleaning process was used to remove residual resist using the SAMCO PC-300 instrument to O2 plasma etch at 250 watts for 1 min.
The substrate surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL light mineral oil. The substrate was placed in a chamber, pumped for 10 min, and then the valve was closed to the pump and left to stand for 10 min. The chamber was vented to air. The substrate was resist stripped by performing two soaks for 5 min in 500 mL NMP at 70° C. with ultrasonication at maximum power (9 on Crest system). The substrate was then soaked for 5 min in 500 mL isopropanol at room temperature with ultrasonication at maximum power. The substrate was dipped in 300 mL of 200 proof ethanol and blown dry with N2. The functionalized surface was activated to serve as a support for polynucleotide synthesis.
A two dimensional oligonucleotide synthesis device was assembled into a flowcell, which was connected to a flowcell (Applied Biosystems (“ABI394 DNA Synthesizer”)). The two-dimensional oligonucleotide synthesis device was uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE (Gelest) was used to synthesize an exemplary polynucleotide of 50 bp (“50-mer polynucleotide”) using polynucleotide synthesis methods described herein.
The sequence of the 50-mer was as described in SEQ ID NO.: 1. 5′AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT ## TTTTT TTTTT3′ (SEQ ID NO.: 1), where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker enabling the release of polynucleotides from the surface during deprotection.
The synthesis was done using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocol in Table 3 and ABI394 DNA Synthesizer.
The phosphoramidite/activator combination was delivered similar to the delivery of bulk reagents through the flowcell. No drying steps were performed as the environment stays “wet” with reagent the entire time.
The flow restrictor was removed from the ABI394 DNA Synthesizer to enable faster flow. Without flow restrictor, flow rates for amidites (0.1M in ACN), Activator, (0.25M Benzoylthiotetrazole (“BTT”; 30-3070-xx from GlenResearch) in ACN), and Ox (0.02M 12 in 20% pyridine, 10% water, and 70% THF) were roughly ˜100 uL/sec, for acetonitrile (“ACN”) and capping reagents (1:1 mix of CapA and CapB, wherein CapA is acetic anhydride in THF/Pyridine and CapB is 16% 1-methylimidizole in THF), roughly ˜200 uL/sec, and for Deblock (3% dichloroacetic acid in toluene), roughly ˜300 uL/sec (compared to ˜50 uL/sec for all reagents with flow restrictor). The time to completely push out Oxidizer was observed, the timing for chemical flow times was adjusted accordingly and an extra ACN wash was introduced between different chemicals. After polynucleotide synthesis, the chip was deprotected in gaseous ammonia overnight at 75 psi. Five drops of water were applied to the surface to recover polynucleotides. The recovered polynucleotides were then analyzed on a BioAnalyzer small RNA chip (data not shown).
The same process as described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of a 100-mer polynucleotide (“100-mer polynucleotide”; 5′ CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCAT GCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT ## TTTTTTTTTT3′, where # denotes Thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes); SEQ ID NO.: 2) on two different silicon chips, the first one uniformly functionalized with N-(3-TRIETHOXYSILYLPROPYL)-4-HYDROXYBUTYRAMIDE and the second one functionalized with 5/95 mix of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the polynucleotides extracted from the surface were analyzed on a BioAnalyzer instrument (data not shown).
All ten samples from the two chips were further PCR amplified using a forward (5′ATGCGGGGTTCTCATCATC3′; SEQ ID NO.: 3) and a reverse (5′CGGGATCCTTATCGTCATCG3; SEQ ID NO.: 4) primer in a 50 uL PCR mix (25 uL NEB Q5 mastermix, 2.5 uL 10 uM Forward primer, 2.5 uL 10 uM Reverse primer, 1 uL polynucleotide extracted from the surface, and water up to 50 uL) using the following thermalcycling program:
The PCR products were also run on a BioAnalyzer (data not shown), demonstrating sharp peaks at the 100-mer position. Next, the PCR amplified samples were cloned, and Sanger sequenced. Table 4 summarizes the results from the Sanger sequencing for samples taken from spots 1-5 from chip 1 and for samples taken from spots 6-10 from chip 2.
Thus, the high quality and uniformity of the synthesized polynucleotides were repeated on two chips with different surface chemistries. Overall, 89%, corresponding to 233 out of 262 of the 100-mers that were sequenced were perfect sequences with no errors. Table 5 summarizes error characteristics for the sequences obtained from the polynucleotides samples from spots 1-10.
Flap Endonuclease Mediated Nucleic Acid Assembly Reaction
A flap endonuclease mediated nucleic acid assembly reaction was prepared. Water, dNTP's (New England Biolabs), Ampligase buffer (Epicentre), ExoIII (New England Biolabs), Phusion (New England Biolabs), Ampligase (Epicentre), and Fen′ (New England Biolabs) according to the concentrations in Table 6 below were combined and aliquoted into 96 well plates. DNA and vector were added in the concentrations as indicated in Table 6. Plates were sealed, mixed for 30 seconds at 1000 rpm, and briefly centrifuged. Plates were incubated at 50° C. with 105° C. heated lid for 30 minutes and then cooled to 4° C. Reactions were diluted 1:5 in 40 uL of cold buffer.
In Vitro PCR Assay
Following preparation of the flap endonuclease mediated nucleic acid assembly reaction, PCR amplification was performed. A 25 uL PCR reaction was performed according to reaction conditions in Table 7 below and amplified using thermocycler conditions according to Table 8. PCR products were analyzed on a BioAnalyzer (Agilent) (
Transformation
Following the PCR reaction, 2 uL of the diluted reactions were electroporated into 20 uL of electrocompetent cells 10G (Lucigen). Cells were recovered with 600 uL pre-warmed Lucigen recovery media. Samples were serially diluted 1:2 into Lucigen recovery media and 7 uL was spotted onto a Lennox+Carb plate. Plates were grown overnight (about 16 hours) at 37° C. overnight. The reaction efficiency was determined by counting colonies to determine Colony Forming Units (CFU) using the CFU formula: (# of colonies*total reaction volume)/(plating volume*dilution factor).
The colony counts of E. coli transformants is seen in Table 9. The fold change was determined by the number of colonies with insert (1× dilution) compared to the number of colonies with no insert.
A correlation of the in vitro PCR assay (
A flap endonuclease mediated nucleic acid assembly reaction was performed similar to Example 4. Three DNA fragments were inserted into a vector. Following preparation of the flap endonuclease mediated nucleic acid assembly reaction, PCR amplification was performed similar to Example 4. PCR products were analyzed on a BioAnalyzer (Agilent) (
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4. Varying conditions were tested as seen in Table 10.
The number of colonies was counted for each sample as seen in
Colonies were isolated, and assemblies were assayed by colony PCR. Reactions were run on a Fragment Analyzer (capillary gel electrophoresis). Proper assemblies were determined by size of PCR product (data not shown).
Isolated colonies were grown overnight and miniprepped to isolate the assembled vector DNA. Samples were analyzed by next-generation sequencing. The varying Fen′ and ExoIII concentrations resulted in varying amount of correctly assembled constructs as seen in Table 11. All of the universal primer flanking sequences were removed in the passed samples. In the 7/10 samples that had the proper size in the colony PCR, all 7 passed NGS at the homology sites.
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4. Three gene fragments were inserted into a vector. Experiments were performed using reaction conditions according to Table 12 below as a baseline and variations on Phusion, Ampligase, ExoIII, and Fen1 concentrations. The concentrations of Phusion, Ampligase, ExoIII, and Fen1 used are shown in Table 13.
Referring to
Using the different enzyme ratios, there was increased number of CFUs and improved percentage of correct assembly (
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4. Flap endonuclease mediated nucleic acid assembly reactions were performed using enzyme concentrations of 1 U ExoIII, 0.2 U Phusion, 1 U Ampligase, and 0.32 U Fen1 with insert (white bars) and without insert (hashed bars, third bar from left). Flap endonuclease mediated nucleic acid assembly reactions were also tested using enzyme concentrations of 1 U ExoIII, 0.1 U Phusion, 1 U Ampligase, and 0.32 U Fen1 with insert (black bars) and without insert (hashed bars, fourth from left). Colony forming units from spot plates were then measured (Y-axis). Referring to
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4. Different amounts of input DNA or linearized vector on colony forming units (CFU) were assayed. The amount of input DNA tested was 2 nM or 4 nM of linearized vector. Referring to
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4. Experiments were performed using reaction concentrations of the reagents as seen in Table 14. The reactions were prepared on ice, and following addition of the various reagents, the reactions were incubated at 50° C. for 30 minutes. The reactions were then diluted 1:5 and transformed into E. coli.
Colony forming units (CFUs) were then measured. As seen in
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4 and Example 10. The concentration of ExoIII was increased 16 fold as compared to Example 10. The reaction concentrations are seen in Table 15. The reactions were prepared on ice, and following addition of the various reagents, the reactions were incubated at 65° C. for 30 minutes. The reactions were then diluted 1:5 and transformed into E. coli.
Colony forming units were then measured. As seen in
Next generation sequencing (NGS) was also performed. As seen in
The example shows that the flap endonuclease mediated nucleic acid assembly reaction using the described reaction conditions resulted in higher colony forming units and improved assembly fidelity.
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4 and Example 10. The reaction conditions are seen in Table 14. In addition, 40 fmol of a DNA bridge was used.
The various samples included assembly with no bridge (negative control), fragments comprising a 40 base pair homology sequence (positive control), double stranded DNA bridge comprising a 40 base pair homology sequence to each fragment, and a double stranded DNA bridge comprising a 50 base pair homology sequence to each fragment. The reactions were prepared and transformed into E. coli. The number of correct assemblies and percentage of correct assemblies were then determined and are seen in Table 16.
As seen in Table 16, flap endonuclease mediated nucleic acid assembly reaction using a double stranded DNA (dsDNA) bridge of 40 base pairs and 50 base pairs resulted in more than 90% correct assemblies. Further as seen in
CFUs using the bridged assembly method were measured. As seen in
The data indicates that assembly of ssDNA by flap endonuclease mediated nucleic acid assembly using a bridge nucleic acid results in a higher percentage of correct assemblies and higher number of colony forming units.
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4 and Example 10. Multiple fragments were assembled into a vector including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12 fragments. Each DNA fragment was 500 base pairs. Following assembly reactions, the reactions were transformed into E. coli and colony forming units were measured.
Next generation sequencing (NGS) was also performed. As seen in
A flap endonuclease mediated nucleic acid assembly reaction was prepared similarly to Example 4 and Example 10. The concentration of Phusion polymerase was decreased 10 fold as compared to Example 10. The reaction concentrations are seen in Table 17. The reactions were prepared on ice, and following addition of the various reagents, the reactions were incubated at 65° C. for 10-30 minutes. The reactions comprising three fragments were cloned into a plasmid and transformed into E. coli. Colony forming units were measured following 10 minute incubation and 30 minute incubation as seen in
Reaction efficiency of assembly of non-clonal fragments was determined. Reactions were prepared for assembling 2 DNA fragments using Method 2 as seen in Table 15 and Method 3 as seen in Table 17. Reactions were then incubated at 65° C. for 10-30 minutes. Assembly PCR products were analyzed on a BioAnalyzer (
Non-clonal assembly was also determined. Referring to
Flap endonuclease mediated nucleic acid assembly using similar reaction conditions as described in Example 14 was compared to assembly by different comparators. Twelve 500 bp sequences were generated, and a series of constructs for assembly of one to ten DNA fragments into a vector were designed. DNA was assembled with homologous ends using the flap endonuclease mediated nucleic acid assembly method, Comparator 1 method, and Comparator 2 method. Comparator 1 assembly relies on homology at the ends of a construct that is quickly introduced by PCR or through DNA synthesis. Each fragment in Comparator 1 assembly requires a different pair of PCR primers. Comparator 2 method is an assembly method for nucleic acid fragments with varied overlap regions. Effects of multiple homology lengths and incubation times were determined.
Flap endonuclease mediated nucleic acid assembly was performed at 65° C. At 65° C. most secondary structures were eliminated and assembly fidelity was greatly improved (data not shown).
The efficiency and the accuracy of assembly using the flap endonuclease mediated nucleic acid assembly method, Comparator 1 method, and Comparator 2 method were determined. Efficiency was determined by colony forming units (CFUs), and accuracy was determined by next generation sequencing (NGS).
Efficiency using the flap endonuclease mediated nucleic acid assembly method, Comparator 1 method, and Comparator 2 method was determined for double stranded DNA (dsDNA) non-clonal fragments comprising adaptor sequences. The adaptor sequences acted as universal primer pairs. dsDNA comprising homology ends was generated by amplifying dsDNA fragments with primers specific for each construct (“adaptors-off”). Each fragment contained 40 or 25 bp of overlapping homology to their intended destination. One to ten dsDNA fragments were assembled into a linearized plasmid and transformed the reaction into E. coli. For one fragment assemblies, flap endonuclease mediated nucleic acid assembly method, Comparator 1 method, and Comparator 2 method resulted in robust colony forming units. The flap endonuclease mediated nucleic acid assembly method resulted in higher colony forming units regardless of reaction time, homology lengths, and number of pieces assembled (
Efficiency for DNA with buried homology sequences (“adaptors-on”) was determined using the flap endonuclease mediated nucleic acid assembly method, Comparator 1 method, and Comparator 2 method. Forty base pair homologies buried ˜23 bp from the end of the DNA fragment were designed. All methods gave CFUs significantly higher than their respective backgrounds (
Next generation sequencing was performed using plasmids isolated from 8 colonies per reaction. The flap endonuclease mediated nucleic acid assembly and Comparator 2 method resulted in 84% and 86% correct assembly rates, respectively. Each method showed 8% of samples misassembled. Assemblies using Comparator 1 method resulted in 10% misassembly and a 25% SNP rate, resulting in an overall correct assembly rate of 65%. Analyzing the pass and failure rates dependent on the number of inserts assembled, Comparator 1 method resulted in a loss of fidelity at 10 inserts. Most errors were clustered within 25 bp of the fragment junctions for Comparator 1 assembly and Comparator 2 assembly (
Next generation sequencing was used to determine the presence of the 23 bp adaptor. Flap endonuclease mediated nucleic acid assembly resulted in higher correct assembly rates than Comparator 1 and Comparator 2 methods. Across all assembly reactions the average correct assembly rate was 72% for flap endonuclease mediated nucleic acid assembly reactions, compared to 4.5% for Comparator 1 assemblies and 31% for Comparator 2 assemblies. The adaptor sequence was never present in the flap endonuclease mediated nucleic acid assembly samples. In contrast, for full length constructs, 59% of Comparator 1 assemblies and 23% of Comparator 2 assemblies contain partial or full-length adaptor sequences. Constructs assembled by Comparator 1 assembly were more likely to misassembly, with an overall misassembly rate of 63% as compared to 7% for flap endonuclease mediated nucleic acid assembly and 6% for Comparator 2. The misassembly rates increased with the number of fragments in the Comparator 2 assemblies. Further, Comparator 1 assembly had high CFUs in the negative control reactions. Sequencing of the 24 Comparator 1 negative control samples (vector with no inserts) showed that each construct was the vector recombined to itself at various regions of the backbone. See
In Vitro Seamless Assembly
Assembly of DNA fragments was determined using flap endonuclease mediated nucleic acid assembly. Flap endonuclease mediated nucleic acid assembly using similar reaction conditions as described in Example 14 was used to assemble 2, 3, and 4 linear dsDNA fragments together. In reactions comprising the flap endonuclease mediated nucleic acid assembly enzymatic cocktail, unincorporated starting material, partial and full-length constructs were detected (
One Pot Combinatorial Assembly
Specificity of the flap endonuclease mediated nucleic acid assembly was determined. Nine linear DNA fragments comprising the same universal primer tails were used. Forty bp homology sites directed to directionally assemble three different 3-piece constructs into the same vector were designed. The individual cloning efficiencies for each construct to screen for toxicity and establish an assembly baseline were determined. All nine DNA fragments and the destination vector were then used in a single in vitro assembly reaction. After cloning the reaction mixture into E. coli, 192 colonies were picked for mini-prep followed by NGS analysis. Referring to
Referring to
Multiple fragments were assembled into genes. Cloning of amplified oligonucleotide populations was performed similar to Example 17. Overlap extension PCR was performed to generate double stranded DNA (dsDNA) fragments of more than 200 base pairs to assemble into a vector. Reactions were performed at 55° C. for 30 minutes and prepared according to a flap endonuclease mediated nucleic acid assembly method (Method 4) as seen in Table 19.
Next generation sequencing (NGS) was performed on the amplified oligonucleotide population prior to assembly (
Multiplexed gene assembly was performed using a flap endonuclease mediated nucleic acid assembly method. Multiple sequences were assembled into 1 well. The sequences comprised two double stranded DNA (dsDNA) parts that are generated from overlap extension PCR. The reactions were prepared according to Method 4 as described in Table 19 and performed at 55° C. for 30 minutes. Samples were assembled and then cloned in a vector. Three populations were assembled: Population 11, Population 927, and Population 942. Each population comprised 96 individual clones that were Sanger sequenced to determine which gene was present. The quality of the starting DNA material was determined by measuring perfect sequences, sequences with SNPS, truncated material, or sequences with block deletions. As seen in
While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.
This is a continuation application of U.S. patent application Ser. No. 16/006,581, filed Jun. 12, 2018, which claims the benefit of U.S. Provisional Patent Application No. 62/663,089 filed Apr. 26, 2018; and U.S. Provisional Patent Application No. 62/518,496 filed on Jun. 12, 2017, each of which is incorporated herein by reference in its entirety.
| Number | Name | Date | Kind |
|---|---|---|---|
| 3549368 | Robert et al. | Dec 1970 | A |
| 3920714 | Streck | Nov 1975 | A |
| 4123661 | Wolf et al. | Oct 1978 | A |
| 4415732 | Caruthers et al. | Nov 1983 | A |
| 4613398 | Chiong et al. | Sep 1986 | A |
| 4726877 | Fryd et al. | Feb 1988 | A |
| 4808511 | Holmes | Feb 1989 | A |
| 4837401 | Hirose et al. | Jun 1989 | A |
| 4863557 | Kokaku et al. | Sep 1989 | A |
| 4981797 | Jessee et al. | Jan 1991 | A |
| 4988617 | Landegren et al. | Jan 1991 | A |
| 5102797 | Tucker et al. | Apr 1992 | A |
| 5118605 | Urdea | Jun 1992 | A |
| 5137814 | Rashtchian et al. | Aug 1992 | A |
| 5143854 | Pirrung et al. | Sep 1992 | A |
| 5242794 | Whiteley et al. | Sep 1993 | A |
| 5242974 | Holmes | Sep 1993 | A |
| 5288514 | Ellman | Feb 1994 | A |
| 5299491 | Kawada | Apr 1994 | A |
| 5368823 | McGraw et al. | Nov 1994 | A |
| 5384261 | Winkler et al. | Jan 1995 | A |
| 5387541 | Hodge et al. | Feb 1995 | A |
| 5395753 | Prakash | Mar 1995 | A |
| 5431720 | Nagai et al. | Jul 1995 | A |
| 5445934 | Fodor et al. | Aug 1995 | A |
| 5449754 | Nishioka | Sep 1995 | A |
| 5459039 | Modrich et al. | Oct 1995 | A |
| 5474796 | Brennan | Dec 1995 | A |
| 5476930 | Letsinger et al. | Dec 1995 | A |
| 5487993 | Herrnstadt et al. | Jan 1996 | A |
| 5494810 | Barany et al. | Feb 1996 | A |
| 5501893 | Laermer et al. | Mar 1996 | A |
| 5508169 | Deugau et al. | Apr 1996 | A |
| 5510270 | Fodor et al. | Apr 1996 | A |
| 5514789 | Kempe | May 1996 | A |
| 5527681 | Holmes | Jun 1996 | A |
| 5530516 | Sheets | Jun 1996 | A |
| 5556750 | Modrich et al. | Sep 1996 | A |
| 5586211 | Dumitrou et al. | Dec 1996 | A |
| 5641658 | Adams et al. | Jun 1997 | A |
| 5677195 | Winkler et al. | Oct 1997 | A |
| 5679522 | Modrich et al. | Oct 1997 | A |
| 5683879 | Laney et al. | Nov 1997 | A |
| 5688642 | Chrisey et al. | Nov 1997 | A |
| 5700637 | Southern | Dec 1997 | A |
| 5700642 | Monforte et al. | Dec 1997 | A |
| 5702894 | Modrich et al. | Dec 1997 | A |
| 5707806 | Shuber | Jan 1998 | A |
| 5712124 | Walker | Jan 1998 | A |
| 5712126 | Weissman et al. | Jan 1998 | A |
| 5739386 | Holmes | Apr 1998 | A |
| 5750672 | Kempe | May 1998 | A |
| 5780613 | Letsinger et al. | Jul 1998 | A |
| 5830643 | Yamamoto et al. | Nov 1998 | A |
| 5830655 | Monforte et al. | Nov 1998 | A |
| 5830662 | Soares et al. | Nov 1998 | A |
| 5834252 | Stemmer et al. | Nov 1998 | A |
| 5843669 | Kaiser et al. | Dec 1998 | A |
| 5843767 | Beattie | Dec 1998 | A |
| 5846717 | Brow et al. | Dec 1998 | A |
| 5854033 | Lizardi | Dec 1998 | A |
| 5858754 | Modrich et al. | Jan 1999 | A |
| 5861482 | Modrich et al. | Jan 1999 | A |
| 5863801 | Southgate et al. | Jan 1999 | A |
| 5869245 | Yeung | Feb 1999 | A |
| 5877280 | Wetmur | Mar 1999 | A |
| 5882496 | Northrup et al. | Mar 1999 | A |
| 5922539 | Modrich et al. | Jul 1999 | A |
| 5922593 | Livingston | Jul 1999 | A |
| 5928907 | Woudenberg et al. | Jul 1999 | A |
| 5962272 | Chenchik et al. | Oct 1999 | A |
| 5976842 | Wurst | Nov 1999 | A |
| 5976846 | Passmore et al. | Nov 1999 | A |
| 5989872 | Luo et al. | Nov 1999 | A |
| 5994069 | Hall et al. | Nov 1999 | A |
| 6001567 | Brow et al. | Dec 1999 | A |
| 6008031 | Modrich et al. | Dec 1999 | A |
| 6013440 | Lipshutz et al. | Jan 2000 | A |
| 6015674 | Woudenberg et al. | Jan 2000 | A |
| 6017434 | Simpson et al. | Jan 2000 | A |
| 6020481 | Benson et al. | Feb 2000 | A |
| 6027898 | Gjerde et al. | Feb 2000 | A |
| 6028189 | Blanchard | Feb 2000 | A |
| 6028198 | Liu et al. | Feb 2000 | A |
| 6040138 | Lockhart et al. | Mar 2000 | A |
| 6077674 | Schleifer et al. | Jun 2000 | A |
| 6087482 | Teng et al. | Jul 2000 | A |
| 6090543 | Prudent et al. | Jul 2000 | A |
| 6090606 | Kaiser et al. | Jul 2000 | A |
| 6103474 | Dellinger et al. | Aug 2000 | A |
| 6107038 | Choudhary et al. | Aug 2000 | A |
| 6110682 | Dellinger et al. | Aug 2000 | A |
| 6114115 | Wagner, Jr. | Sep 2000 | A |
| 6130045 | Wurst et al. | Oct 2000 | A |
| 6132997 | Shannon | Oct 2000 | A |
| 6136568 | Hiatt et al. | Oct 2000 | A |
| 6171797 | Perbost | Jan 2001 | B1 |
| 6180351 | Cattell | Jan 2001 | B1 |
| 6201112 | Ach | Mar 2001 | B1 |
| 6218118 | Sampson et al. | Apr 2001 | B1 |
| 6221653 | Caren et al. | Apr 2001 | B1 |
| 6222030 | Dellinger et al. | Apr 2001 | B1 |
| 6232072 | Fisher | May 2001 | B1 |
| 6235483 | Wolber et al. | May 2001 | B1 |
| 6242266 | Schleifer et al. | Jun 2001 | B1 |
| 6251588 | Shannon et al. | Jun 2001 | B1 |
| 6251595 | Gordon et al. | Jun 2001 | B1 |
| 6251685 | Dorsel et al. | Jun 2001 | B1 |
| 6258454 | Lefkowitz et al. | Jul 2001 | B1 |
| 6262490 | Hsu et al. | Jul 2001 | B1 |
| 6274725 | Sanghvi et al. | Aug 2001 | B1 |
| 6284465 | Wolber | Sep 2001 | B1 |
| 6287776 | Hefti | Sep 2001 | B1 |
| 6287824 | Lizardi | Sep 2001 | B1 |
| 6297017 | Schmidt et al. | Oct 2001 | B1 |
| 6300137 | Earhart et al. | Oct 2001 | B1 |
| 6306599 | Perbost | Oct 2001 | B1 |
| 6309822 | Fodor et al. | Oct 2001 | B1 |
| 6309828 | Schleifer et al. | Oct 2001 | B1 |
| 6312911 | Bancroft et al. | Nov 2001 | B1 |
| 6319674 | Fulcrand et al. | Nov 2001 | B1 |
| 6323043 | Caren et al. | Nov 2001 | B1 |
| 6329210 | Schleifer | Dec 2001 | B1 |
| 6346423 | Schembri | Feb 2002 | B1 |
| 6365355 | McCutchen-Maloney | Apr 2002 | B1 |
| 6372483 | Schleifer et al. | Apr 2002 | B2 |
| 6375903 | Cerrina et al. | Apr 2002 | B1 |
| 6376285 | Joyner et al. | Apr 2002 | B1 |
| 6384210 | Blanchard | May 2002 | B1 |
| 6387636 | Perbost et al. | May 2002 | B1 |
| 6399394 | Dahm et al. | Jun 2002 | B1 |
| 6399516 | Ayon | Jun 2002 | B1 |
| 6403314 | Lange et al. | Jun 2002 | B1 |
| 6406849 | Dorsel et al. | Jun 2002 | B1 |
| 6406851 | Bass | Jun 2002 | B1 |
| 6408308 | Maslyn et al. | Jun 2002 | B1 |
| 6419883 | Blanchard | Jul 2002 | B1 |
| 6428957 | Delenstarr | Aug 2002 | B1 |
| 6440669 | Bass et al. | Aug 2002 | B1 |
| 6444268 | Lefkowitz et al. | Sep 2002 | B2 |
| 6446642 | Caren et al. | Sep 2002 | B1 |
| 6446682 | Viken | Sep 2002 | B1 |
| 6451998 | Perbost | Sep 2002 | B1 |
| 6458526 | Schembri et al. | Oct 2002 | B1 |
| 6458535 | Hall et al. | Oct 2002 | B1 |
| 6458583 | Bruhn et al. | Oct 2002 | B1 |
| 6461812 | Barth et al. | Oct 2002 | B2 |
| 6461816 | Wolber et al. | Oct 2002 | B1 |
| 6469156 | Schafer et al. | Oct 2002 | B1 |
| 6472147 | Janda et al. | Oct 2002 | B1 |
| 6492107 | Kauffman et al. | Dec 2002 | B1 |
| 6518056 | Schembri et al. | Feb 2003 | B2 |
| 6521427 | Evans | Feb 2003 | B1 |
| 6521453 | Crameri et al. | Feb 2003 | B1 |
| 6555357 | Kaiser et al. | Apr 2003 | B1 |
| 6558908 | Wolber et al. | May 2003 | B2 |
| 6562611 | Kaiser et al. | May 2003 | B1 |
| 6566495 | Fodor et al. | May 2003 | B1 |
| 6582908 | Fodor et al. | Jun 2003 | B2 |
| 6582938 | Su et al. | Jun 2003 | B1 |
| 6586211 | Staehler et al. | Jul 2003 | B1 |
| 6587579 | Bass | Jul 2003 | B1 |
| 6589739 | Fisher | Jul 2003 | B2 |
| 6599693 | Webb | Jul 2003 | B1 |
| 6602472 | Zimmermann et al. | Aug 2003 | B1 |
| 6610978 | Yin et al. | Aug 2003 | B2 |
| 6613513 | Parce et al. | Sep 2003 | B1 |
| 6613523 | Fischer | Sep 2003 | B2 |
| 6613560 | Tso et al. | Sep 2003 | B1 |
| 6613893 | Webb | Sep 2003 | B1 |
| 6621076 | Van De Goor et al. | Sep 2003 | B1 |
| 6630581 | Dellinger et al. | Oct 2003 | B2 |
| 6632641 | Brennan et al. | Oct 2003 | B1 |
| 6635226 | Tso et al. | Oct 2003 | B1 |
| 6642373 | Manoharan et al. | Nov 2003 | B2 |
| 6649348 | Bass et al. | Nov 2003 | B2 |
| 6660338 | Hargreaves | Dec 2003 | B1 |
| 6664112 | Mulligan et al. | Dec 2003 | B2 |
| 6670127 | Evans | Dec 2003 | B2 |
| 6670461 | Wengel et al. | Dec 2003 | B1 |
| 6673552 | Frey | Jan 2004 | B2 |
| 6682702 | Barth et al. | Jan 2004 | B2 |
| 6689319 | Fisher et al. | Feb 2004 | B1 |
| 6692917 | Neri et al. | Feb 2004 | B2 |
| 6702256 | Killeen et al. | Mar 2004 | B2 |
| 6706471 | Brow et al. | Mar 2004 | B1 |
| 6706875 | Goldberg et al. | Mar 2004 | B1 |
| 6709841 | Short | Mar 2004 | B2 |
| 6709852 | Bloom et al. | Mar 2004 | B1 |
| 6709854 | Donahue et al. | Mar 2004 | B2 |
| 6713262 | Gillibolian et al. | Mar 2004 | B2 |
| 6716629 | Hess et al. | Apr 2004 | B2 |
| 6716634 | Myerson | Apr 2004 | B1 |
| 6723509 | Ach | Apr 2004 | B2 |
| 6728129 | Lindsey et al. | Apr 2004 | B2 |
| 6743585 | Dellinger et al. | Jun 2004 | B2 |
| 6753145 | Holcomb et al. | Jun 2004 | B2 |
| 6768005 | Mellor et al. | Jul 2004 | B2 |
| 6770748 | Imanishi et al. | Aug 2004 | B2 |
| 6770892 | Corson et al. | Aug 2004 | B2 |
| 6773676 | Schembri | Aug 2004 | B2 |
| 6773888 | Li et al. | Aug 2004 | B2 |
| 6780982 | Lyamichev et al. | Aug 2004 | B2 |
| 6787308 | Balasubramanian et al. | Sep 2004 | B2 |
| 6789965 | Barth et al. | Sep 2004 | B2 |
| 6790620 | Bass et al. | Sep 2004 | B2 |
| 6794499 | Wengel et al. | Sep 2004 | B2 |
| 6796634 | Caren et al. | Sep 2004 | B2 |
| 6800439 | McGall et al. | Oct 2004 | B1 |
| 6814846 | Berndt | Nov 2004 | B1 |
| 6815218 | Jacobson et al. | Nov 2004 | B1 |
| 6824866 | Glazer et al. | Nov 2004 | B1 |
| 6830890 | Lockhart et al. | Dec 2004 | B2 |
| 6833246 | Balasubramanian | Dec 2004 | B2 |
| 6833450 | McGall et al. | Dec 2004 | B1 |
| 6835938 | Ghosh et al. | Dec 2004 | B2 |
| 6838888 | Peck | Jan 2005 | B2 |
| 6841131 | Zimmermann et al. | Jan 2005 | B2 |
| 6845968 | Killeen et al. | Jan 2005 | B2 |
| 6846454 | Peck | Jan 2005 | B2 |
| 6846922 | Manoharan et al. | Jan 2005 | B1 |
| 6852850 | Myerson et al. | Feb 2005 | B2 |
| 6858720 | Myerson et al. | Feb 2005 | B2 |
| 6879915 | Cattell | Apr 2005 | B2 |
| 6880576 | Karp et al. | Apr 2005 | B2 |
| 6884580 | Caren et al. | Apr 2005 | B2 |
| 6887715 | Schembri | May 2005 | B2 |
| 6890723 | Perbost et al. | May 2005 | B2 |
| 6890760 | Webb | May 2005 | B1 |
| 6893816 | Beattie | May 2005 | B1 |
| 6897023 | Fu et al. | May 2005 | B2 |
| 6900047 | Bass | May 2005 | B2 |
| 6900048 | Perbost | May 2005 | B2 |
| 6911611 | Wong et al. | Jun 2005 | B2 |
| 6914229 | Corson et al. | Jul 2005 | B2 |
| 6916113 | Van De Goor et al. | Jul 2005 | B2 |
| 6916633 | Shannon | Jul 2005 | B1 |
| 6919181 | Hargreaves | Jul 2005 | B2 |
| 6927029 | Lefkowitz et al. | Aug 2005 | B2 |
| 6929951 | Corson et al. | Aug 2005 | B2 |
| 6936472 | Earhart et al. | Aug 2005 | B2 |
| 6938476 | Chesk | Sep 2005 | B2 |
| 6939673 | Bass et al. | Sep 2005 | B2 |
| 6943036 | Bass | Sep 2005 | B2 |
| 6946285 | Bass | Sep 2005 | B2 |
| 6950756 | Kincaid | Sep 2005 | B2 |
| 6951719 | Dupret et al. | Oct 2005 | B1 |
| 6958119 | Yin et al. | Oct 2005 | B2 |
| 6960464 | Jessee et al. | Nov 2005 | B2 |
| 6969449 | Maher et al. | Nov 2005 | B2 |
| 6969488 | Bridgham et al. | Nov 2005 | B2 |
| 6976384 | Hobbs et al. | Dec 2005 | B2 |
| 6977223 | George et al. | Dec 2005 | B2 |
| 6987263 | Hobbs et al. | Jan 2006 | B2 |
| 6989267 | Kim et al. | Jan 2006 | B2 |
| 6991922 | Dupret et al. | Jan 2006 | B2 |
| 7008037 | Caren et al. | Mar 2006 | B2 |
| 7025324 | Slocum et al. | Apr 2006 | B1 |
| 7026124 | Barth et al. | Apr 2006 | B2 |
| 7027930 | Cattell | Apr 2006 | B2 |
| 7028536 | Karp et al. | Apr 2006 | B2 |
| 7029854 | Collins et al. | Apr 2006 | B2 |
| 7034290 | Lu et al. | Apr 2006 | B2 |
| 7041445 | Chenchik et al. | May 2006 | B2 |
| 7045289 | Allawi et al. | May 2006 | B2 |
| 7051574 | Peck | May 2006 | B2 |
| 7052841 | Delenstarr | May 2006 | B2 |
| 7062385 | White et al. | Jun 2006 | B2 |
| 7064197 | Rabbani et al. | Jun 2006 | B1 |
| 7070932 | Leproust et al. | Jul 2006 | B2 |
| 7075161 | Barth | Jul 2006 | B2 |
| 7078167 | Delenstarr et al. | Jul 2006 | B2 |
| 7078505 | Bass et al. | Jul 2006 | B2 |
| 7094537 | Leproust et al. | Aug 2006 | B2 |
| 7097974 | Stahler et al. | Aug 2006 | B1 |
| 7101508 | Thompson et al. | Sep 2006 | B2 |
| 7101986 | Dellinger et al. | Sep 2006 | B2 |
| 7105295 | Bass et al. | Sep 2006 | B2 |
| 7115423 | Mitchell | Oct 2006 | B1 |
| 7122303 | Delenstarr et al. | Oct 2006 | B2 |
| 7122364 | Lyamichev et al. | Oct 2006 | B1 |
| 7125488 | Li | Oct 2006 | B2 |
| 7125523 | Sillman | Oct 2006 | B2 |
| 7128876 | Yin et al. | Oct 2006 | B2 |
| 7129075 | Gerard et al. | Oct 2006 | B2 |
| 7135565 | Dellinger et al. | Nov 2006 | B2 |
| 7138062 | Yin et al. | Nov 2006 | B2 |
| 7141368 | Fisher et al. | Nov 2006 | B2 |
| 7141807 | Joyce et al. | Nov 2006 | B2 |
| 7147362 | Caren et al. | Dec 2006 | B2 |
| 7150982 | Allawi et al. | Dec 2006 | B2 |
| 7153689 | Tolosko et al. | Dec 2006 | B2 |
| 7163660 | Lehmann | Jan 2007 | B2 |
| 7166258 | Bass et al. | Jan 2007 | B2 |
| 7179659 | Stolowitz et al. | Feb 2007 | B2 |
| 7183406 | Belshaw et al. | Feb 2007 | B2 |
| 7192710 | Gellibolian et al. | Mar 2007 | B2 |
| 7193077 | Dellinger et al. | Mar 2007 | B2 |
| 7195872 | Agrawal et al. | Mar 2007 | B2 |
| 7198939 | Dorsel et al. | Apr 2007 | B2 |
| 7202264 | Ravikumar et al. | Apr 2007 | B2 |
| 7202358 | Hargreaves | Apr 2007 | B2 |
| 7205128 | Ilsley et al. | Apr 2007 | B2 |
| 7205400 | Webb | Apr 2007 | B2 |
| 7206439 | Zhou et al. | Apr 2007 | B2 |
| 7208322 | Stolowitz et al. | Apr 2007 | B2 |
| 7217522 | Brenner | May 2007 | B2 |
| 7220573 | Shea et al. | May 2007 | B2 |
| 7221785 | Curry et al. | May 2007 | B2 |
| 7226862 | Staehler et al. | Jun 2007 | B2 |
| 7227017 | Mellor et al. | Jun 2007 | B2 |
| 7229497 | Stott et al. | Jun 2007 | B2 |
| 7247337 | Leproust et al. | Jul 2007 | B1 |
| 7247497 | Dahm et al. | Jul 2007 | B2 |
| 7252938 | Leproust et al. | Aug 2007 | B2 |
| 7269518 | Corson | Sep 2007 | B2 |
| 7271258 | Dellinger et al. | Sep 2007 | B2 |
| 7276336 | Webb et al. | Oct 2007 | B1 |
| 7276378 | Myerson | Oct 2007 | B2 |
| 7276599 | Moore et al. | Oct 2007 | B2 |
| 7282183 | Peck | Oct 2007 | B2 |
| 7282332 | Caren et al. | Oct 2007 | B2 |
| 7282705 | Brennen | Oct 2007 | B2 |
| 7291471 | Sampson et al. | Nov 2007 | B2 |
| 7302348 | Ghosh et al. | Nov 2007 | B2 |
| 7306917 | Prudent et al. | Dec 2007 | B2 |
| 7314599 | Roitman et al. | Jan 2008 | B2 |
| 7323320 | Oleinikov | Jan 2008 | B2 |
| 7344831 | Wolber et al. | Mar 2008 | B2 |
| 7348144 | Minor | Mar 2008 | B2 |
| 7351379 | Schleifer | Apr 2008 | B2 |
| 7353116 | Webb et al. | Apr 2008 | B2 |
| 7361906 | Ghosh et al. | Apr 2008 | B2 |
| 7364896 | Schembri | Apr 2008 | B2 |
| 7368550 | Dellinger et al. | May 2008 | B2 |
| 7371348 | Schleifer et al. | May 2008 | B2 |
| 7371519 | Wolber et al. | May 2008 | B2 |
| 7371580 | Yakhini et al. | May 2008 | B2 |
| 7372982 | Le Cocq | May 2008 | B2 |
| 7384746 | Lyamichev et al. | Jun 2008 | B2 |
| 7385050 | Dellinger et al. | Jun 2008 | B2 |
| 7390457 | Schembri | Jun 2008 | B2 |
| 7393665 | Brenner | Jul 2008 | B2 |
| 7396676 | Robotti et al. | Jul 2008 | B2 |
| 7399844 | Sampson et al. | Jul 2008 | B2 |
| 7402279 | Schembri | Jul 2008 | B2 |
| 7411061 | Myerson et al. | Aug 2008 | B2 |
| 7413709 | Roitman et al. | Aug 2008 | B2 |
| 7417139 | Dellinger et al. | Aug 2008 | B2 |
| 7422911 | Schembri | Sep 2008 | B2 |
| 7427679 | Dellinger et al. | Sep 2008 | B2 |
| 7432048 | Neri et al. | Oct 2008 | B2 |
| 7435810 | Myerson et al. | Oct 2008 | B2 |
| 7439272 | Xu | Oct 2008 | B2 |
| 7476709 | Moody et al. | Jan 2009 | B2 |
| 7482118 | Allawi et al. | Jan 2009 | B2 |
| 7488607 | Tom-Moy et al. | Feb 2009 | B2 |
| 7504213 | Sana et al. | Mar 2009 | B2 |
| 7514369 | Li et al. | Apr 2009 | B2 |
| 7517979 | Wolber | Apr 2009 | B2 |
| 7524942 | Wang et al. | Apr 2009 | B2 |
| 7524950 | Dellinger et al. | Apr 2009 | B2 |
| 7527928 | Neri et al. | May 2009 | B2 |
| 7531303 | Dorsel et al. | May 2009 | B2 |
| 7534561 | Sana et al. | May 2009 | B2 |
| 7534563 | Hargreaves | May 2009 | B2 |
| 7537936 | Dahm et al. | May 2009 | B2 |
| 7541145 | Prudent et al. | Jun 2009 | B2 |
| 7544473 | Brenner | Jun 2009 | B2 |
| 7556919 | Chenchik et al. | Jul 2009 | B2 |
| 7563600 | Oleinikov | Jul 2009 | B2 |
| 7572585 | Wang | Aug 2009 | B2 |
| 7572907 | Dellinger et al. | Aug 2009 | B2 |
| 7572908 | Dellinger et al. | Aug 2009 | B2 |
| 7585970 | Dellinger et al. | Sep 2009 | B2 |
| 7588889 | Wolber et al. | Sep 2009 | B2 |
| 7595350 | Xu | Sep 2009 | B2 |
| 7604941 | Jacobson | Oct 2009 | B2 |
| 7604996 | Stuelpnagel et al. | Oct 2009 | B1 |
| 7608396 | Delenstarr | Oct 2009 | B2 |
| 7618777 | Myerson et al. | Nov 2009 | B2 |
| 7629120 | Bennett et al. | Dec 2009 | B2 |
| 7635772 | McCormac | Dec 2009 | B2 |
| 7648832 | Jessee et al. | Jan 2010 | B2 |
| 7651762 | Xu et al. | Jan 2010 | B2 |
| 7659069 | Belyaev et al. | Feb 2010 | B2 |
| 7678542 | Lyamichev et al. | Mar 2010 | B2 |
| 7682809 | Sampson | Mar 2010 | B2 |
| 7709197 | Drmanac | May 2010 | B2 |
| 7718365 | Wang | May 2010 | B2 |
| 7718786 | Dupret et al. | May 2010 | B2 |
| 7723077 | Young et al. | May 2010 | B2 |
| 7737088 | Stahler et al. | Jun 2010 | B1 |
| 7737089 | Guimil et al. | Jun 2010 | B2 |
| 7741463 | Gormley et al. | Jun 2010 | B2 |
| 7749701 | Leproust et al. | Jul 2010 | B2 |
| 7759471 | Dellinger et al. | Jul 2010 | B2 |
| 7776021 | Borenstein et al. | Aug 2010 | B2 |
| 7776532 | Gibson et al. | Aug 2010 | B2 |
| 7790369 | Stahler et al. | Sep 2010 | B2 |
| 7790387 | Dellinger et al. | Sep 2010 | B2 |
| 7807356 | Sampson et al. | Oct 2010 | B2 |
| 7807806 | Allawi et al. | Oct 2010 | B2 |
| 7811753 | Eshoo | Oct 2010 | B2 |
| 7816079 | Fischer | Oct 2010 | B2 |
| 7820387 | Neri et al. | Oct 2010 | B2 |
| 7829314 | Prudent et al. | Nov 2010 | B2 |
| 7855281 | Dellinger et al. | Dec 2010 | B2 |
| 7862999 | Zheng et al. | Jan 2011 | B2 |
| 7867782 | Barth | Jan 2011 | B2 |
| 7875463 | Adaskin et al. | Jan 2011 | B2 |
| 7879541 | Kincaid | Feb 2011 | B2 |
| 7879580 | Carr et al. | Feb 2011 | B2 |
| 7894998 | Kincaid | Feb 2011 | B2 |
| 7919239 | Wang | Apr 2011 | B2 |
| 7919308 | Schleifer | Apr 2011 | B2 |
| 7927797 | Nobile et al. | Apr 2011 | B2 |
| 7927838 | Shannon | Apr 2011 | B2 |
| 7932025 | Carr et al. | Apr 2011 | B2 |
| 7932070 | Hogrefe et al. | Apr 2011 | B2 |
| 7935800 | Allawi et al. | May 2011 | B2 |
| 7939645 | Borns | May 2011 | B2 |
| 7943046 | Martosella et al. | May 2011 | B2 |
| 7943358 | Hogrefe et al. | May 2011 | B2 |
| 7960157 | Borns | Jun 2011 | B2 |
| 7977119 | Kronick et al. | Jul 2011 | B2 |
| 7979215 | Sampas | Jul 2011 | B2 |
| 7998437 | Berndt et al. | Aug 2011 | B2 |
| 7999087 | Dellinger et al. | Aug 2011 | B2 |
| 8021842 | Brenner | Sep 2011 | B2 |
| 8021844 | Wang | Sep 2011 | B2 |
| 8034917 | Yamada | Oct 2011 | B2 |
| 8036835 | Sampas et al. | Oct 2011 | B2 |
| 8048664 | Guan et al. | Nov 2011 | B2 |
| 8053191 | Blake | Nov 2011 | B2 |
| 8058001 | Crameri et al. | Nov 2011 | B2 |
| 8058004 | Oleinikov | Nov 2011 | B2 |
| 8058055 | Barrett et al. | Nov 2011 | B2 |
| 8063184 | Allawi et al. | Nov 2011 | B2 |
| 8067556 | Hogrefe et al. | Nov 2011 | B2 |
| 8073626 | Troup et al. | Dec 2011 | B2 |
| 8076064 | Wang | Dec 2011 | B2 |
| 8076152 | Robotti | Dec 2011 | B2 |
| 8097711 | Timar et al. | Jan 2012 | B2 |
| 8137936 | Macevicz | Mar 2012 | B2 |
| 8148068 | Brenner | Apr 2012 | B2 |
| 8154729 | Baldo et al. | Apr 2012 | B2 |
| 8168385 | Brenner | May 2012 | B2 |
| 8168388 | Gormley et al. | May 2012 | B2 |
| 8173368 | Staehler et al. | May 2012 | B2 |
| 8182991 | Kaiser et al. | May 2012 | B1 |
| 8194244 | Wang et al. | Jun 2012 | B2 |
| 8198071 | Goshoo et al. | Jun 2012 | B2 |
| 8202983 | Dellinger et al. | Jun 2012 | B2 |
| 8202985 | Dellinger et al. | Jun 2012 | B2 |
| 8206952 | Carr et al. | Jun 2012 | B2 |
| 8213015 | Kraiczek et al. | Jul 2012 | B2 |
| 8242258 | Dellinger et al. | Aug 2012 | B2 |
| 8247221 | Fawcett et al. | Aug 2012 | B2 |
| 8263335 | Carr et al. | Sep 2012 | B2 |
| 8268605 | Sorge et al. | Sep 2012 | B2 |
| 8283148 | Sorge et al. | Oct 2012 | B2 |
| 8288093 | Hall et al. | Oct 2012 | B2 |
| 8298767 | Brenner et al. | Oct 2012 | B2 |
| 8304273 | Stellacci et al. | Nov 2012 | B2 |
| 8309307 | Barrett et al. | Nov 2012 | B2 |
| 8309706 | Dellinger et al. | Nov 2012 | B2 |
| 8309710 | Sierzchala et al. | Nov 2012 | B2 |
| 8314220 | Mullinax et al. | Nov 2012 | B2 |
| 8318433 | Brenner | Nov 2012 | B2 |
| 8318479 | Domansky et al. | Nov 2012 | B2 |
| 8357489 | Chua et al. | Jan 2013 | B2 |
| 8357490 | Froehlich et al. | Jan 2013 | B2 |
| 8367016 | Quan et al. | Feb 2013 | B2 |
| 8367335 | Staehler et al. | Feb 2013 | B2 |
| 8380441 | Webb et al. | Feb 2013 | B2 |
| 8383338 | Kitzman et al. | Feb 2013 | B2 |
| 8415138 | Leproust | Apr 2013 | B2 |
| 8435736 | Gibson et al. | May 2013 | B2 |
| 8445205 | Brenner | May 2013 | B2 |
| 8445206 | Bergmann et al. | May 2013 | B2 |
| 8470996 | Brenner | Jun 2013 | B2 |
| 8476018 | Brenner | Jul 2013 | B2 |
| 8476598 | Pralle et al. | Jul 2013 | B1 |
| 8481292 | Casbon et al. | Jul 2013 | B2 |
| 8481309 | Zhang et al. | Jul 2013 | B2 |
| 8491561 | Borenstein et al. | Jul 2013 | B2 |
| 8497069 | Hutchison et al. | Jul 2013 | B2 |
| 8500979 | Elibol et al. | Aug 2013 | B2 |
| 8501454 | Liu et al. | Aug 2013 | B2 |
| 8507226 | Carr et al. | Aug 2013 | B2 |
| 8507239 | Lubys et al. | Aug 2013 | B2 |
| 8507272 | Zhang et al. | Aug 2013 | B2 |
| 8530197 | Li et al. | Sep 2013 | B2 |
| 8552174 | Dellinger et al. | Oct 2013 | B2 |
| 8563478 | Gormley et al. | Oct 2013 | B2 |
| 8569046 | Love et al. | Oct 2013 | B2 |
| 8577621 | Troup et al. | Nov 2013 | B2 |
| 8586310 | Mitra et al. | Nov 2013 | B2 |
| 8614092 | Zhang et al. | Dec 2013 | B2 |
| 8642755 | Sierzchala et al. | Feb 2014 | B2 |
| 8664164 | Ericsson et al. | Mar 2014 | B2 |
| 8669053 | Stuelpnagel et al. | Mar 2014 | B2 |
| 8679756 | Brenner et al. | Mar 2014 | B1 |
| 8685642 | Sampas | Apr 2014 | B2 |
| 8685676 | Hogrefe et al. | Apr 2014 | B2 |
| 8685678 | Casbon et al. | Apr 2014 | B2 |
| 8715933 | Oliver | May 2014 | B2 |
| 8715967 | Casbon et al. | May 2014 | B2 |
| 8716467 | Jacobson | May 2014 | B2 |
| 8722368 | Casbon et al. | May 2014 | B2 |
| 8722585 | Wang | May 2014 | B2 |
| 8728766 | Casbon et al. | May 2014 | B2 |
| 8741606 | Casbon et al. | Jun 2014 | B2 |
| 8808896 | Choo et al. | Aug 2014 | B2 |
| 8808986 | Jacobson et al. | Aug 2014 | B2 |
| 8815600 | Liu et al. | Aug 2014 | B2 |
| 8889851 | Leproust et al. | Nov 2014 | B2 |
| 8932994 | Gormley et al. | Jan 2015 | B2 |
| 8962532 | Shapiro et al. | Feb 2015 | B2 |
| 8968999 | Gibson et al. | Mar 2015 | B2 |
| 8980563 | Zheng et al. | Mar 2015 | B2 |
| 9018365 | Brenner | Apr 2015 | B2 |
| 9023601 | Oleinikov | May 2015 | B2 |
| 9051666 | Oleinikov | Jun 2015 | B2 |
| 9073962 | Fracchia et al. | Jul 2015 | B2 |
| 9074204 | Anderson et al. | Jul 2015 | B2 |
| 9085797 | Gebeyehu et al. | Jul 2015 | B2 |
| 9133510 | Andersen et al. | Sep 2015 | B2 |
| 9139874 | Myers et al. | Sep 2015 | B2 |
| 9150853 | Hudson et al. | Oct 2015 | B2 |
| 9187777 | Jacobson et al. | Nov 2015 | B2 |
| 9194001 | Brenner | Nov 2015 | B2 |
| 9216414 | Chu | Dec 2015 | B2 |
| 9217144 | Jacobson et al. | Dec 2015 | B2 |
| 9279149 | Efcavitch et al. | Mar 2016 | B2 |
| 9286439 | Shapiro et al. | Mar 2016 | B2 |
| 9295965 | Jacobson et al. | Mar 2016 | B2 |
| 9315861 | Hendricks et al. | Apr 2016 | B2 |
| 9328378 | Earnshaw et al. | May 2016 | B2 |
| 9347091 | Bergmann et al. | May 2016 | B2 |
| 9375748 | Harumoto et al. | Jun 2016 | B2 |
| 9376677 | Mir | Jun 2016 | B2 |
| 9376678 | Gormley et al. | Jun 2016 | B2 |
| 9384320 | Church | Jul 2016 | B2 |
| 9384920 | Bakulich | Jul 2016 | B1 |
| 9388407 | Jacobson | Jul 2016 | B2 |
| 9394333 | Wada et al. | Jul 2016 | B2 |
| 9403141 | Banyai et al. | Aug 2016 | B2 |
| 9409139 | Banyai et al. | Aug 2016 | B2 |
| 9410149 | Brenner et al. | Aug 2016 | B2 |
| 9410173 | Betts et al. | Aug 2016 | B2 |
| 9416411 | Stuelpnagel et al. | Aug 2016 | B2 |
| 9422600 | Ramu et al. | Aug 2016 | B2 |
| 9487824 | Kutyavin | Nov 2016 | B2 |
| 9499848 | Carr et al. | Nov 2016 | B2 |
| 9523122 | Zheng et al. | Dec 2016 | B2 |
| 9528148 | Zheng et al. | Dec 2016 | B2 |
| 9534251 | Young et al. | Jan 2017 | B2 |
| 9555388 | Banyai et al. | Jan 2017 | B2 |
| 9568839 | Stahler et al. | Feb 2017 | B2 |
| 9580746 | Leproust et al. | Feb 2017 | B2 |
| 9670529 | Osborne et al. | Jun 2017 | B2 |
| 9670536 | Casbon et al. | Jun 2017 | B2 |
| 9677067 | Toro et al. | Jun 2017 | B2 |
| 9695211 | Wada et al. | Jul 2017 | B2 |
| 9718060 | Venter et al. | Aug 2017 | B2 |
| 9745573 | Stuelpnagel et al. | Aug 2017 | B2 |
| 9745619 | Rabbani et al. | Aug 2017 | B2 |
| 9765387 | Rabbani et al. | Sep 2017 | B2 |
| 9771576 | Gibson et al. | Sep 2017 | B2 |
| 9833761 | Banyai et al. | Dec 2017 | B2 |
| 9834774 | Carstens | Dec 2017 | B2 |
| 9839894 | Banyai et al. | Dec 2017 | B2 |
| 9879283 | Ravinder et al. | Jan 2018 | B2 |
| 9889423 | Banyai et al. | Feb 2018 | B2 |
| 9895673 | Peck et al. | Feb 2018 | B2 |
| 9925510 | Jacobson et al. | Mar 2018 | B2 |
| 9932576 | Raymond et al. | Apr 2018 | B2 |
| 9981239 | Banyai et al. | May 2018 | B2 |
| 10053688 | Cox | Aug 2018 | B2 |
| 10251611 | Marsh et al. | Apr 2019 | B2 |
| 10272410 | Banyai et al. | Apr 2019 | B2 |
| 10384188 | Banyai et al. | Aug 2019 | B2 |
| 10384189 | Peck | Aug 2019 | B2 |
| 10417457 | Peck | Sep 2019 | B2 |
| 10583415 | Banyai et al. | Mar 2020 | B2 |
| 10632445 | Banyai et al. | Apr 2020 | B2 |
| 10639609 | Banyai et al. | May 2020 | B2 |
| 10669304 | Indermuhle et al. | Jun 2020 | B2 |
| 10969965 | Malina et al. | Apr 2021 | B2 |
| 20010018512 | Blanchard | Aug 2001 | A1 |
| 20010039014 | Bass et al. | Nov 2001 | A1 |
| 20010055761 | Kanemoto et al. | Dec 2001 | A1 |
| 20020012930 | Rothberg et al. | Jan 2002 | A1 |
| 20020025561 | Hodgson | Feb 2002 | A1 |
| 20020076716 | Sabanayagam et al. | Jun 2002 | A1 |
| 20020081582 | Gao et al. | Jun 2002 | A1 |
| 20020094533 | Hess et al. | Jul 2002 | A1 |
| 20020095073 | Jacobs et al. | Jul 2002 | A1 |
| 20020119459 | Griffiths | Aug 2002 | A1 |
| 20020132308 | Liu et al. | Sep 2002 | A1 |
| 20020155439 | Rodriguez et al. | Oct 2002 | A1 |
| 20020160536 | Regnier et al. | Oct 2002 | A1 |
| 20020164824 | Xiao et al. | Nov 2002 | A1 |
| 20030008411 | Van Dam et al. | Jan 2003 | A1 |
| 20030022207 | Balasubramanian et al. | Jan 2003 | A1 |
| 20030022240 | Luo et al. | Jan 2003 | A1 |
| 20030022317 | Jack et al. | Jan 2003 | A1 |
| 20030044781 | Korlach et al. | Mar 2003 | A1 |
| 20030058629 | Hirai et al. | Mar 2003 | A1 |
| 20030064398 | Barnes | Apr 2003 | A1 |
| 20030068633 | Belshaw et al. | Apr 2003 | A1 |
| 20030082719 | Schumacher et al. | May 2003 | A1 |
| 20030100102 | Rothberg et al. | May 2003 | A1 |
| 20030108903 | Wang et al. | Jun 2003 | A1 |
| 20030120035 | Gao et al. | Jun 2003 | A1 |
| 20030130827 | Bentzien et al. | Jul 2003 | A1 |
| 20030138782 | Evans | Jul 2003 | A1 |
| 20030143605 | Lok et al. | Jul 2003 | A1 |
| 20030148291 | Robotti | Aug 2003 | A1 |
| 20030148344 | Rothberg et al. | Aug 2003 | A1 |
| 20030171325 | Gascoyne et al. | Sep 2003 | A1 |
| 20030186226 | Brennan et al. | Oct 2003 | A1 |
| 20030228602 | Parker et al. | Dec 2003 | A1 |
| 20030228620 | Du Breuil Lastrucci | Dec 2003 | A1 |
| 20040009498 | Short | Jan 2004 | A1 |
| 20040043509 | Stahler et al. | Mar 2004 | A1 |
| 20040053362 | De Luca et al. | Mar 2004 | A1 |
| 20040086892 | Crothers et al. | May 2004 | A1 |
| 20040087008 | Schembri | May 2004 | A1 |
| 20040106130 | Besemer et al. | Jun 2004 | A1 |
| 20040106728 | McGall et al. | Jun 2004 | A1 |
| 20040110133 | Xu et al. | Jun 2004 | A1 |
| 20040175710 | Haushalter | Sep 2004 | A1 |
| 20040175734 | Stahler et al. | Sep 2004 | A1 |
| 20040191810 | Yamamoto | Sep 2004 | A1 |
| 20040213795 | Collins et al. | Oct 2004 | A1 |
| 20040219663 | Page et al. | Nov 2004 | A1 |
| 20040236027 | Maeji et al. | Nov 2004 | A1 |
| 20040248161 | Rothberg et al. | Dec 2004 | A1 |
| 20040253242 | Bowdish et al. | Dec 2004 | A1 |
| 20040259146 | Friend et al. | Dec 2004 | A1 |
| 20050022895 | Barth et al. | Feb 2005 | A1 |
| 20050049402 | Babcook et al. | Mar 2005 | A1 |
| 20050049796 | Webb et al. | Mar 2005 | A1 |
| 20050053968 | Bharadwaj et al. | Mar 2005 | A1 |
| 20050079510 | Berka et al. | Apr 2005 | A1 |
| 20050100932 | Lapidus et al. | May 2005 | A1 |
| 20050112608 | Grossman et al. | May 2005 | A1 |
| 20050112636 | Hurt et al. | May 2005 | A1 |
| 20050112679 | Myerson et al. | May 2005 | A1 |
| 20050124022 | Srinivasan et al. | Jun 2005 | A1 |
| 20050137805 | Lewin et al. | Jun 2005 | A1 |
| 20050208513 | Agbo et al. | Sep 2005 | A1 |
| 20050214778 | Peck et al. | Sep 2005 | A1 |
| 20050214779 | Peck et al. | Sep 2005 | A1 |
| 20050227235 | Carr et al. | Oct 2005 | A1 |
| 20050255477 | Carr et al. | Nov 2005 | A1 |
| 20050266045 | Canham et al. | Dec 2005 | A1 |
| 20050277125 | Benn et al. | Dec 2005 | A1 |
| 20050282158 | Landegren | Dec 2005 | A1 |
| 20050287585 | Oleinikov | Dec 2005 | A1 |
| 20060003381 | Gilmore et al. | Jan 2006 | A1 |
| 20060003958 | Melville et al. | Jan 2006 | A1 |
| 20060012784 | Ulmer | Jan 2006 | A1 |
| 20060012793 | Harris | Jan 2006 | A1 |
| 20060019084 | Pearson | Jan 2006 | A1 |
| 20060024678 | Buzby | Feb 2006 | A1 |
| 20060024711 | Lapidus et al. | Feb 2006 | A1 |
| 20060024721 | Pedersen | Feb 2006 | A1 |
| 20060076482 | Hobbs et al. | Apr 2006 | A1 |
| 20060078909 | Srinivasan et al. | Apr 2006 | A1 |
| 20060078927 | Peck et al. | Apr 2006 | A1 |
| 20060078937 | Korlach et al. | Apr 2006 | A1 |
| 20060127920 | Church et al. | Jun 2006 | A1 |
| 20060134638 | Mulligan et al. | Jun 2006 | A1 |
| 20060160138 | Church | Jul 2006 | A1 |
| 20060171855 | Yin et al. | Aug 2006 | A1 |
| 20060202330 | Reinhardt et al. | Sep 2006 | A1 |
| 20060203236 | Ji et al. | Sep 2006 | A1 |
| 20060203237 | Ji et al. | Sep 2006 | A1 |
| 20060207923 | Li | Sep 2006 | A1 |
| 20060219637 | Killeen et al. | Oct 2006 | A1 |
| 20070031857 | Makarov et al. | Feb 2007 | A1 |
| 20070031877 | Stahler et al. | Feb 2007 | A1 |
| 20070043516 | Gustafsson et al. | Feb 2007 | A1 |
| 20070054127 | Hergenrother et al. | Mar 2007 | A1 |
| 20070059692 | Gao et al. | Mar 2007 | A1 |
| 20070087349 | Staehler et al. | Apr 2007 | A1 |
| 20070099196 | Kauppinen et al. | May 2007 | A1 |
| 20070099208 | Drmanac et al. | May 2007 | A1 |
| 20070122817 | Church et al. | May 2007 | A1 |
| 20070128635 | Macevicz | Jun 2007 | A1 |
| 20070141557 | Raab et al. | Jun 2007 | A1 |
| 20070196834 | Cerrina et al. | Aug 2007 | A1 |
| 20070196854 | Stahler et al. | Aug 2007 | A1 |
| 20070207482 | Church et al. | Sep 2007 | A1 |
| 20070207487 | Emig et al. | Sep 2007 | A1 |
| 20070231800 | Roberts et al. | Oct 2007 | A1 |
| 20070233403 | Alwan et al. | Oct 2007 | A1 |
| 20070238104 | Barrett et al. | Oct 2007 | A1 |
| 20070238106 | Barrett et al. | Oct 2007 | A1 |
| 20070238108 | Barrett et al. | Oct 2007 | A1 |
| 20070259344 | Leproust et al. | Nov 2007 | A1 |
| 20070259345 | Sampas | Nov 2007 | A1 |
| 20070259346 | Gordon et al. | Nov 2007 | A1 |
| 20070259347 | Gordon et al. | Nov 2007 | A1 |
| 20070269870 | Church et al. | Nov 2007 | A1 |
| 20080085511 | Peck et al. | Apr 2008 | A1 |
| 20080085514 | Peck et al. | Apr 2008 | A1 |
| 20080087545 | Jensen et al. | Apr 2008 | A1 |
| 20080161200 | Yu et al. | Jul 2008 | A1 |
| 20080182296 | Chanda et al. | Jul 2008 | A1 |
| 20080214412 | Stahler et al. | Sep 2008 | A1 |
| 20080227160 | Kool | Sep 2008 | A1 |
| 20080233616 | Liss | Sep 2008 | A1 |
| 20080287320 | Baynes et al. | Nov 2008 | A1 |
| 20080300842 | Govindarajan et al. | Dec 2008 | A1 |
| 20080308884 | Kalvesten | Dec 2008 | A1 |
| 20080311628 | Shoemaker | Dec 2008 | A1 |
| 20090036664 | Peter | Feb 2009 | A1 |
| 20090053704 | Novoradovskaya et al. | Feb 2009 | A1 |
| 20090062129 | McKernan et al. | Mar 2009 | A1 |
| 20090074771 | Koenig et al. | Mar 2009 | A1 |
| 20090087840 | Baynes et al. | Apr 2009 | A1 |
| 20090088679 | Wood et al. | Apr 2009 | A1 |
| 20090105094 | Heiner et al. | Apr 2009 | A1 |
| 20090170802 | Stahler et al. | Jul 2009 | A1 |
| 20090176280 | Hutchison, III et al. | Jul 2009 | A1 |
| 20090181861 | Li et al. | Jul 2009 | A1 |
| 20090194483 | Robotti et al. | Aug 2009 | A1 |
| 20090230044 | Bek | Sep 2009 | A1 |
| 20090238722 | Mora-Fillat et al. | Sep 2009 | A1 |
| 20090239759 | Balch | Sep 2009 | A1 |
| 20090246788 | Albert et al. | Oct 2009 | A1 |
| 20090263802 | Drmanac | Oct 2009 | A1 |
| 20090285825 | Kini et al. | Nov 2009 | A1 |
| 20090324546 | Notka et al. | Dec 2009 | A1 |
| 20100004143 | Shibahara | Jan 2010 | A1 |
| 20100008851 | Nicolaides et al. | Jan 2010 | A1 |
| 20100009872 | Eid et al. | Jan 2010 | A1 |
| 20100047805 | Wang | Feb 2010 | A1 |
| 20100051967 | Bradley et al. | Mar 2010 | A1 |
| 20100069250 | White, III et al. | Mar 2010 | A1 |
| 20100090341 | Wan et al. | Apr 2010 | A1 |
| 20100099103 | Hsieh et al. | Apr 2010 | A1 |
| 20100111768 | Banerjee et al. | May 2010 | A1 |
| 20100160463 | Wang et al. | Jun 2010 | A1 |
| 20100167950 | Juang et al. | Jul 2010 | A1 |
| 20100173364 | Evans et al. | Jul 2010 | A1 |
| 20100216648 | Staehler et al. | Aug 2010 | A1 |
| 20100256017 | Larman et al. | Oct 2010 | A1 |
| 20100258487 | Zelechonok et al. | Oct 2010 | A1 |
| 20100272711 | Feldman et al. | Oct 2010 | A1 |
| 20100286290 | Lohmann et al. | Nov 2010 | A1 |
| 20100292102 | Nouri | Nov 2010 | A1 |
| 20100300882 | Zhang et al. | Dec 2010 | A1 |
| 20100323404 | Lathrop | Dec 2010 | A1 |
| 20110009607 | Komiyama et al. | Jan 2011 | A1 |
| 20110082055 | Fox et al. | Apr 2011 | A1 |
| 20110114244 | Yoo et al. | May 2011 | A1 |
| 20110114549 | Yin et al. | May 2011 | A1 |
| 20110124049 | Li et al. | May 2011 | A1 |
| 20110124055 | Carr et al. | May 2011 | A1 |
| 20110126929 | Velasquez-Garcia et al. | Jun 2011 | A1 |
| 20110171651 | Richmond | Jul 2011 | A1 |
| 20110172127 | Jacobson et al. | Jul 2011 | A1 |
| 20110201057 | Carr et al. | Aug 2011 | A1 |
| 20110217738 | Jacobson | Sep 2011 | A1 |
| 20110230653 | Novoradovskaya et al. | Sep 2011 | A1 |
| 20110254107 | Bulovic et al. | Oct 2011 | A1 |
| 20110287435 | Grunenwald et al. | Nov 2011 | A1 |
| 20120003713 | Hansen et al. | Jan 2012 | A1 |
| 20120021932 | Mershin et al. | Jan 2012 | A1 |
| 20120027786 | Gupta et al. | Feb 2012 | A1 |
| 20120028843 | Ramu et al. | Feb 2012 | A1 |
| 20120032366 | Ivniski et al. | Feb 2012 | A1 |
| 20120046175 | Rodesch et al. | Feb 2012 | A1 |
| 20120050411 | Mabritto et al. | Mar 2012 | A1 |
| 20120094847 | Warthmann et al. | Apr 2012 | A1 |
| 20120128548 | West et al. | May 2012 | A1 |
| 20120129704 | Gunderson et al. | May 2012 | A1 |
| 20120149602 | Friend et al. | Jun 2012 | A1 |
| 20120164127 | Short et al. | Jun 2012 | A1 |
| 20120164633 | Laffler | Jun 2012 | A1 |
| 20120164691 | Eshoo et al. | Jun 2012 | A1 |
| 20120184724 | Sierzchala et al. | Jul 2012 | A1 |
| 20120220497 | Jacobson et al. | Aug 2012 | A1 |
| 20120231968 | Bruhn et al. | Sep 2012 | A1 |
| 20120238737 | Dellinger et al. | Sep 2012 | A1 |
| 20120258487 | Chang et al. | Oct 2012 | A1 |
| 20120264653 | Carr et al. | Oct 2012 | A1 |
| 20120270750 | Oleinikov | Oct 2012 | A1 |
| 20120270754 | Blake | Oct 2012 | A1 |
| 20120283140 | Chu | Nov 2012 | A1 |
| 20120288476 | Hartmann et al. | Nov 2012 | A1 |
| 20120289691 | Dellinger et al. | Nov 2012 | A1 |
| 20120315670 | Jacobson et al. | Dec 2012 | A1 |
| 20120322681 | Kung et al. | Dec 2012 | A1 |
| 20130005585 | Anderson et al. | Jan 2013 | A1 |
| 20130005612 | Carr et al. | Jan 2013 | A1 |
| 20130014790 | Van Gerpen | Jan 2013 | A1 |
| 20130017642 | Milgrew et al. | Jan 2013 | A1 |
| 20130017977 | Oleinikov | Jan 2013 | A1 |
| 20130017978 | Kavanagh et al. | Jan 2013 | A1 |
| 20130035261 | Sierzchala et al. | Feb 2013 | A1 |
| 20130040836 | Himmler et al. | Feb 2013 | A1 |
| 20130045483 | Treusch et al. | Feb 2013 | A1 |
| 20130053252 | Xie et al. | Feb 2013 | A1 |
| 20130059296 | Jacobson et al. | Mar 2013 | A1 |
| 20130059761 | Jacobson et al. | Mar 2013 | A1 |
| 20130065017 | Sieber | Mar 2013 | A1 |
| 20130109595 | Routenberg | May 2013 | A1 |
| 20130109596 | Peterson et al. | May 2013 | A1 |
| 20130123129 | Zeiner et al. | May 2013 | A1 |
| 20130130321 | Staehler et al. | May 2013 | A1 |
| 20130137161 | Zhang et al. | May 2013 | A1 |
| 20130137173 | Zhang et al. | May 2013 | A1 |
| 20130137174 | Zhang et al. | May 2013 | A1 |
| 20130137861 | Leproust et al. | May 2013 | A1 |
| 20130164308 | Foletti et al. | Jun 2013 | A1 |
| 20130165328 | Previte et al. | Jun 2013 | A1 |
| 20130196864 | Govindarajan et al. | Aug 2013 | A1 |
| 20130225421 | Li et al. | Aug 2013 | A1 |
| 20130244884 | Jacobson et al. | Sep 2013 | A1 |
| 20130252849 | Hudson et al. | Sep 2013 | A1 |
| 20130261027 | Li et al. | Oct 2013 | A1 |
| 20130281308 | Kung et al. | Oct 2013 | A1 |
| 20130289246 | Crowe et al. | Oct 2013 | A1 |
| 20130296192 | Jacobson et al. | Nov 2013 | A1 |
| 20130296194 | Jacobson et al. | Nov 2013 | A1 |
| 20130298265 | Cunnac et al. | Nov 2013 | A1 |
| 20130309725 | Jacobson et al. | Nov 2013 | A1 |
| 20130323725 | Peter et al. | Dec 2013 | A1 |
| 20130330778 | Zeiner et al. | Dec 2013 | A1 |
| 20140011226 | Bernick et al. | Jan 2014 | A1 |
| 20140018441 | Fracchia et al. | Jan 2014 | A1 |
| 20140031240 | Behlke et al. | Jan 2014 | A1 |
| 20140038240 | Temme et al. | Feb 2014 | A1 |
| 20140106394 | Ko et al. | Apr 2014 | A1 |
| 20140141982 | Jacobson et al. | May 2014 | A1 |
| 20140170665 | Hiddessen et al. | Jun 2014 | A1 |
| 20140178992 | Nakashima et al. | Jun 2014 | A1 |
| 20140221250 | Vasquez et al. | Aug 2014 | A1 |
| 20140274729 | Kurn et al. | Sep 2014 | A1 |
| 20140274741 | Hunter et al. | Sep 2014 | A1 |
| 20140303000 | Armour et al. | Oct 2014 | A1 |
| 20140309119 | Jacobson et al. | Oct 2014 | A1 |
| 20140309142 | Tian | Oct 2014 | A1 |
| 20150010953 | Lindstrom et al. | Jan 2015 | A1 |
| 20150012723 | Park et al. | Jan 2015 | A1 |
| 20150031089 | Lindstrom | Jan 2015 | A1 |
| 20150038373 | Banyai et al. | Feb 2015 | A1 |
| 20150056609 | Daum et al. | Feb 2015 | A1 |
| 20150057625 | Coulthard | Feb 2015 | A1 |
| 20150065357 | Fox | Mar 2015 | A1 |
| 20150065393 | Jacobson | Mar 2015 | A1 |
| 20150099870 | Bennett et al. | Apr 2015 | A1 |
| 20150119293 | Short | Apr 2015 | A1 |
| 20150120265 | Amirav-Drory et al. | Apr 2015 | A1 |
| 20150159152 | Allen et al. | Jun 2015 | A1 |
| 20150183853 | Sharma et al. | Jul 2015 | A1 |
| 20150191524 | Smith et al. | Jul 2015 | A1 |
| 20150191719 | Hudson et al. | Jul 2015 | A1 |
| 20150196917 | Kay et al. | Jul 2015 | A1 |
| 20150203839 | Jacobson et al. | Jul 2015 | A1 |
| 20150211047 | Borns | Jul 2015 | A1 |
| 20150225782 | Walder et al. | Aug 2015 | A1 |
| 20150240232 | Zamore et al. | Aug 2015 | A1 |
| 20150240280 | Gibson et al. | Aug 2015 | A1 |
| 20150261664 | Goldman et al. | Sep 2015 | A1 |
| 20150269313 | Church | Sep 2015 | A1 |
| 20150293102 | Shim | Oct 2015 | A1 |
| 20150307875 | Happe et al. | Oct 2015 | A1 |
| 20150321191 | Kendall et al. | Nov 2015 | A1 |
| 20150322504 | Lao et al. | Nov 2015 | A1 |
| 20150344927 | Sampson et al. | Dec 2015 | A1 |
| 20150353921 | Tian | Dec 2015 | A9 |
| 20150353994 | Myers et al. | Dec 2015 | A1 |
| 20150361420 | Hudson et al. | Dec 2015 | A1 |
| 20150361422 | Sampson et al. | Dec 2015 | A1 |
| 20150361423 | Sampson et al. | Dec 2015 | A1 |
| 20150368687 | Saaem et al. | Dec 2015 | A1 |
| 20150376602 | Jacobson et al. | Dec 2015 | A1 |
| 20160001247 | Oleinikov | Jan 2016 | A1 |
| 20160002621 | Nelson et al. | Jan 2016 | A1 |
| 20160002622 | Nelson et al. | Jan 2016 | A1 |
| 20160010045 | Cohen et al. | Jan 2016 | A1 |
| 20160017394 | Liang et al. | Jan 2016 | A1 |
| 20160017425 | Ruvolo et al. | Jan 2016 | A1 |
| 20160019341 | Harris et al. | Jan 2016 | A1 |
| 20160024138 | Gebeyehu et al. | Jan 2016 | A1 |
| 20160024576 | Chee | Jan 2016 | A1 |
| 20160026753 | Krishnaswami et al. | Jan 2016 | A1 |
| 20160026758 | Jabara et al. | Jan 2016 | A1 |
| 20160032396 | Diehn et al. | Feb 2016 | A1 |
| 20160046973 | Efcavitch et al. | Feb 2016 | A1 |
| 20160046974 | Efcavitch et al. | Feb 2016 | A1 |
| 20160082472 | Perego et al. | Mar 2016 | A1 |
| 20160089651 | Banyai | Mar 2016 | A1 |
| 20160090422 | Reif et al. | Mar 2016 | A1 |
| 20160090592 | Banyai et al. | Mar 2016 | A1 |
| 20160096160 | Banyai et al. | Apr 2016 | A1 |
| 20160097051 | Jacobson et al. | Apr 2016 | A1 |
| 20160102322 | Ravinder et al. | Apr 2016 | A1 |
| 20160108466 | Nazarenko et al. | Apr 2016 | A1 |
| 20160122755 | Hall et al. | May 2016 | A1 |
| 20160122800 | Bernick et al. | May 2016 | A1 |
| 20160152972 | Stapleton et al. | Jun 2016 | A1 |
| 20160168611 | Efcavitch et al. | Jun 2016 | A1 |
| 20160184788 | Hall et al. | Jun 2016 | A1 |
| 20160200759 | Srivastava et al. | Jul 2016 | A1 |
| 20160215283 | Braman et al. | Jul 2016 | A1 |
| 20160229884 | Indermuhle et al. | Aug 2016 | A1 |
| 20160230175 | Carstens | Aug 2016 | A1 |
| 20160230221 | Bergmann et al. | Aug 2016 | A1 |
| 20160251651 | Banyai et al. | Sep 2016 | A1 |
| 20160253890 | Rabinowitz et al. | Sep 2016 | A1 |
| 20160256846 | Smith et al. | Sep 2016 | A1 |
| 20160264958 | Toro et al. | Sep 2016 | A1 |
| 20160289758 | Akeson et al. | Oct 2016 | A1 |
| 20160289839 | Harumoto et al. | Oct 2016 | A1 |
| 20160303535 | Banyai et al. | Oct 2016 | A1 |
| 20160304862 | Igawa et al. | Oct 2016 | A1 |
| 20160304946 | Betts et al. | Oct 2016 | A1 |
| 20160310426 | Wu | Oct 2016 | A1 |
| 20160310927 | Banyai et al. | Oct 2016 | A1 |
| 20160318016 | Hou et al. | Nov 2016 | A1 |
| 20160333340 | Wu | Nov 2016 | A1 |
| 20160339409 | Banyai et al. | Nov 2016 | A1 |
| 20160340672 | Banyai et al. | Nov 2016 | A1 |
| 20160348098 | Stuelpnagel et al. | Dec 2016 | A1 |
| 20160354752 | Banyai et al. | Dec 2016 | A1 |
| 20160355880 | Gormley et al. | Dec 2016 | A1 |
| 20170017436 | Church | Jan 2017 | A1 |
| 20170066844 | Glanville | Mar 2017 | A1 |
| 20170067099 | Zheng et al. | Mar 2017 | A1 |
| 20170073664 | McCafferty et al. | Mar 2017 | A1 |
| 20170073731 | Zheng et al. | Mar 2017 | A1 |
| 20170081660 | Cox et al. | Mar 2017 | A1 |
| 20170081716 | Peck | Mar 2017 | A1 |
| 20170088887 | Makarov et al. | Mar 2017 | A1 |
| 20170095785 | Banyai et al. | Apr 2017 | A1 |
| 20170096706 | Behlke et al. | Apr 2017 | A1 |
| 20170114404 | Behlke et al. | Apr 2017 | A1 |
| 20170141793 | Strauss et al. | May 2017 | A1 |
| 20170147748 | Staehler et al. | May 2017 | A1 |
| 20170151546 | Peck et al. | Jun 2017 | A1 |
| 20170159044 | Toro et al. | Jun 2017 | A1 |
| 20170175110 | Jacobson et al. | Jun 2017 | A1 |
| 20170218537 | Olivares | Aug 2017 | A1 |
| 20170233764 | Young et al. | Aug 2017 | A1 |
| 20170247473 | Short | Aug 2017 | A1 |
| 20170249345 | Malik et al. | Aug 2017 | A1 |
| 20170253644 | Steyaert et al. | Sep 2017 | A1 |
| 20170298432 | Holt | Oct 2017 | A1 |
| 20170320061 | Venter et al. | Nov 2017 | A1 |
| 20170327819 | Banyai et al. | Nov 2017 | A1 |
| 20170355984 | Evans et al. | Dec 2017 | A1 |
| 20170357752 | Diggans | Dec 2017 | A1 |
| 20170362589 | Banyai et al. | Dec 2017 | A1 |
| 20180029001 | Banyai et al. | Feb 2018 | A1 |
| 20180051278 | Cox et al. | Feb 2018 | A1 |
| 20180051280 | Gibson et al. | Feb 2018 | A1 |
| 20180068060 | Ceze et al. | Mar 2018 | A1 |
| 20180104664 | Fernandez | Apr 2018 | A1 |
| 20180126355 | Peck et al. | May 2018 | A1 |
| 20180142289 | Zeitoun et al. | May 2018 | A1 |
| 20180171509 | Cox | Jun 2018 | A1 |
| 20180236425 | Banyai et al. | Aug 2018 | A1 |
| 20180253563 | Peck et al. | Sep 2018 | A1 |
| 20180264428 | Banyai et al. | Sep 2018 | A1 |
| 20180273936 | Cox et al. | Sep 2018 | A1 |
| 20180282721 | Cox et al. | Oct 2018 | A1 |
| 20180291445 | Betts et al. | Oct 2018 | A1 |
| 20180312834 | Cox et al. | Nov 2018 | A1 |
| 20180326388 | Banyai et al. | Nov 2018 | A1 |
| 20180334712 | Singer et al. | Nov 2018 | A1 |
| 20180346585 | Zhang et al. | Dec 2018 | A1 |
| 20180355351 | Nugent et al. | Dec 2018 | A1 |
| 20190060345 | Harrison et al. | Feb 2019 | A1 |
| 20190083596 | Orentas et al. | Mar 2019 | A1 |
| 20190118154 | Marsh et al. | Apr 2019 | A1 |
| 20190135926 | Glanville | May 2019 | A1 |
| 20190224711 | Demeris, Jr. | Jul 2019 | A1 |
| 20190240636 | Peck et al. | Aug 2019 | A1 |
| 20190244109 | Bramlett et al. | Aug 2019 | A1 |
| 20190314783 | Banyai et al. | Oct 2019 | A1 |
| 20190318132 | Peck | Oct 2019 | A1 |
| 20190352635 | Toro et al. | Nov 2019 | A1 |
| 20190366293 | Banyai et al. | Dec 2019 | A1 |
| 20190366294 | Banyai et al. | Dec 2019 | A1 |
| 20200017907 | Zeitoun et al. | Jan 2020 | A1 |
| 20200102611 | Zeitoun et al. | Apr 2020 | A1 |
| 20200156037 | Banyai et al. | May 2020 | A1 |
| 20200181667 | Wu et al. | Jun 2020 | A1 |
| 20200222875 | Peck et al. | Jul 2020 | A1 |
| 20200299322 | Indermuhle et al. | Sep 2020 | A1 |
| 20200299684 | Toro et al. | Sep 2020 | A1 |
| 20200308575 | Sato | Oct 2020 | A1 |
| 20200325235 | Tabibiazar et al. | Oct 2020 | A1 |
| 20200342143 | Peck | Oct 2020 | A1 |
| 20210002710 | Gantt et al. | Jan 2021 | A1 |
| 20210040476 | Cox et al. | Feb 2021 | A1 |
| 20210071168 | Nugent et al. | Mar 2021 | A1 |
| 20210102192 | Tabibiazar et al. | Apr 2021 | A1 |
| 20210102195 | Sato et al. | Apr 2021 | A1 |
| 20210102198 | Cox et al. | Apr 2021 | A1 |
| 20210115594 | Cox et al. | Apr 2021 | A1 |
| 20210129108 | Marsh et al. | May 2021 | A1 |
| 20210142182 | Bramlett et al. | May 2021 | A1 |
| 20210147830 | Liss | May 2021 | A1 |
| 20210170356 | Peck et al. | Jun 2021 | A1 |
| 20210179724 | Sato et al. | Jun 2021 | A1 |
| 20210207197 | Gantt et al. | Jul 2021 | A1 |
| 20210332078 | Wu | Oct 2021 | A1 |
| 20210348220 | Zeitoun et al. | Nov 2021 | A1 |
| 20210355194 | Sato et al. | Nov 2021 | A1 |
| Number | Date | Country |
|---|---|---|
| 3157000 | Sep 2000 | AU |
| 2362939 | Aug 2000 | CA |
| 1771336 | May 2006 | CN |
| 101277758 | Oct 2008 | CN |
| 102159726 | Aug 2011 | CN |
| 103907117 | Jul 2014 | CN |
| 104520864 | Apr 2015 | CN |
| 104562213 | Apr 2015 | CN |
| 104734848 | Jun 2015 | CN |
| 105637097 | Jun 2016 | CN |
| 10260805 | Jul 2004 | DE |
| 0090789 | Oct 1983 | EP |
| 0126621 | Aug 1990 | EP |
| 0753057 | Jan 1997 | EP |
| 1314783 | May 2003 | EP |
| 1363125 | Nov 2003 | EP |
| 1546387 | Jun 2005 | EP |
| 1153127 | Jul 2006 | EP |
| 1728860 | Dec 2006 | EP |
| 1072010 | Apr 2010 | EP |
| 2175021 | Apr 2010 | EP |
| 2330216 | Jun 2011 | EP |
| 1343802 | May 2012 | EP |
| 2504449 | Oct 2012 | EP |
| 2751729 | Jul 2014 | EP |
| 2872629 | May 2015 | EP |
| 2928500 | Oct 2015 | EP |
| 2971034 | Jan 2016 | EP |
| 3030682 | Jun 2016 | EP |
| 3044228 | Apr 2017 | EP |
| 2994509 | Jun 2017 | EP |
| 3204518 | Aug 2017 | EP |
| H07505530 | Jun 1995 | JP |
| 2001518086 | Oct 2001 | JP |
| 2002511276 | Apr 2002 | JP |
| 2002536977 | Nov 2002 | JP |
| 2002538790 | Nov 2002 | JP |
| 2006503586 | Feb 2006 | JP |
| 2006238724 | Sep 2006 | JP |
| 2008505642 | Feb 2008 | JP |
| 2008097189 | Apr 2008 | JP |
| 2008523786 | Jul 2008 | JP |
| 2008214343 | Sep 2008 | JP |
| 2009294195 | Dec 2009 | JP |
| 2016527313 | Sep 2016 | JP |
| WO-9015070 | Dec 1990 | WO |
| WO-9210092 | Jun 1992 | WO |
| WO-9210588 | Jun 1992 | WO |
| WO-9309668 | May 1993 | WO |
| WO-9320242 | Oct 1993 | WO |
| WO-9525116 | Sep 1995 | WO |
| WO-9526397 | Oct 1995 | WO |
| WO-9615861 | May 1996 | WO |
| WO-9710365 | Mar 1997 | WO |
| WO-9822541 | May 1998 | WO |
| WO-9841531 | Sep 1998 | WO |
| WO-9942813 | Aug 1999 | WO |
| WO-9953101 | Oct 1999 | WO |
| WO-0013017 | Mar 2000 | WO |
| WO-0018957 | Apr 2000 | WO |
| WO-0042559 | Jul 2000 | WO |
| WO-0042560 | Jul 2000 | WO |
| WO-0042561 | Jul 2000 | WO |
| WO-0049142 | Aug 2000 | WO |
| WO-0053617 | Sep 2000 | WO |
| WO-0156216 | Aug 2001 | WO |
| WO-0210443 | Feb 2002 | WO |
| WO-0156216 | Mar 2002 | WO |
| WO-0220537 | Mar 2002 | WO |
| WO-0224597 | Mar 2002 | WO |
| WO-0227638 | Apr 2002 | WO |
| WO-0233669 | Apr 2002 | WO |
| WO-02072791 | Sep 2002 | WO |
| WO-03040410 | May 2003 | WO |
| WO-03046223 | Jun 2003 | WO |
| WO-03054232 | Jul 2003 | WO |
| WO-03060084 | Jul 2003 | WO |
| WO-03064026 | Aug 2003 | WO |
| WO-03064027 | Aug 2003 | WO |
| WO-03064699 | Aug 2003 | WO |
| WO-03065038 | Aug 2003 | WO |
| WO-03066212 | Aug 2003 | WO |
| WO-03089605 | Oct 2003 | WO |
| WO-03093504 | Nov 2003 | WO |
| WO-03100012 | Dec 2003 | WO |
| WO-2004024886 | Mar 2004 | WO |
| WO-2004029220 | Apr 2004 | WO |
| WO-2004029586 | Apr 2004 | WO |
| WO-2004031351 | Apr 2004 | WO |
| WO-2004031399 | Apr 2004 | WO |
| WO-2004059556 | Jul 2004 | WO |
| WO-03060084 | Aug 2004 | WO |
| WO-2005014850 | Feb 2005 | WO |
| WO-2005051970 | Jun 2005 | WO |
| WO-2005059096 | Jun 2005 | WO |
| WO-2005059097 | Jun 2005 | WO |
| WO-2005093092 | Oct 2005 | WO |
| WO-2006023144 | Mar 2006 | WO |
| WO-2006044956 | Apr 2006 | WO |
| WO-2006076679 | Jul 2006 | WO |
| WO-2006116476 | Nov 2006 | WO |
| WO-2007073171 | Jun 2007 | WO |
| WO-2007109221 | Sep 2007 | WO |
| WO-2007118214 | Oct 2007 | WO |
| WO-2007120627 | Oct 2007 | WO |
| WO-2007137242 | Nov 2007 | WO |
| WO-2008003116 | Jan 2008 | WO |
| WO-2008006078 | Jan 2008 | WO |
| WO-2008027558 | Mar 2008 | WO |
| WO-2008045380 | Apr 2008 | WO |
| WO-2008054543 | May 2008 | WO |
| WO-2008063134 | May 2008 | WO |
| WO-2008063135 | May 2008 | WO |
| WO-2008068280 | Jun 2008 | WO |
| WO-2008103474 | Aug 2008 | WO |
| WO-2008109176 | Sep 2008 | WO |
| WO-2009132876 | Nov 2009 | WO |
| WO-2010001251 | Jan 2010 | WO |
| WO-2010025310 | Mar 2010 | WO |
| WO-2010025566 | Mar 2010 | WO |
| WO-2010027512 | Mar 2010 | WO |
| WO-2010089412 | Aug 2010 | WO |
| WO-2010141249 | Dec 2010 | WO |
| WO-2010141433 | Dec 2010 | WO |
| WO-2011020529 | Feb 2011 | WO |
| WO-2010141433 | Apr 2011 | WO |
| WO-2011053957 | May 2011 | WO |
| WO-2011056644 | May 2011 | WO |
| WO-2011056872 | May 2011 | WO |
| WO-2011066185 | Jun 2011 | WO |
| WO-2011066186 | Jun 2011 | WO |
| WO-2011085075 | Jul 2011 | WO |
| WO-2011103468 | Aug 2011 | WO |
| WO-2011109031 | Sep 2011 | WO |
| WO-2011143556 | Nov 2011 | WO |
| WO-2011150168 | Dec 2011 | WO |
| WO-2011161413 | Dec 2011 | WO |
| WO-2012013913 | Feb 2012 | WO |
| WO-2012061832 | May 2012 | WO |
| WO-2012078312 | Jun 2012 | WO |
| WO-201 2154201 | Nov 2012 | WO |
| WO-2012149171 | Nov 2012 | WO |
| WO-2013010062 | Jan 2013 | WO |
| WO-201 3030827 | Mar 2013 | WO |
| WO-201 3032850 | Mar 2013 | WO |
| WO-201 3036668 | Mar 2013 | WO |
| WO-2013049227 | Apr 2013 | WO |
| WO-201 3101896 | Jul 2013 | WO |
| WO-2013134881 | Sep 2013 | WO |
| WO-201 3154770 | Oct 2013 | WO |
| WO-201 3177220 | Nov 2013 | WO |
| WO-2013170168 | Nov 2013 | WO |
| WO-201 4004393 | Jan 2014 | WO |
| WO-201 4008447 | Jan 2014 | WO |
| WO-2014021938 | Feb 2014 | WO |
| WO-2014035693 | Mar 2014 | WO |
| WO-2014088693 | Jun 2014 | WO |
| WO-2014089160 | Jun 2014 | WO |
| WO-2014093330 | Jun 2014 | WO |
| WO-2014093694 | Jun 2014 | WO |
| WO-2014151117 | Sep 2014 | WO |
| WO-2014151696 | Sep 2014 | WO |
| WO-2014160004 | Oct 2014 | WO |
| WO-2014160059 | Oct 2014 | WO |
| WO-2014206304 | Dec 2014 | WO |
| WO-2015017527 | Feb 2015 | WO |
| WO-2015021080 | Feb 2015 | WO |
| WO-2015021280 | Feb 2015 | WO |
| WO-2015031689 | Mar 2015 | WO |
| WO-2015040075 | Mar 2015 | WO |
| WO-2015054292 | Apr 2015 | WO |
| WO-2015066174 | May 2015 | WO |
| WO-2015081114 | Jun 2015 | WO |
| WO-2015081142 | Jun 2015 | WO |
| WO-2015081440 | Jun 2015 | WO |
| WO-2015090879 | Jun 2015 | WO |
| WO-2015095404 | Jun 2015 | WO |
| WO-2015120403 | Aug 2015 | WO |
| WO-2015136072 | Sep 2015 | WO |
| WO-2015160004 | Oct 2015 | WO |
| WO-2015175832 | Nov 2015 | WO |
| WO-2016007604 | Jan 2016 | WO |
| WO-2016011080 | Jan 2016 | WO |
| WO-2016022557 | Feb 2016 | WO |
| WO-2016053883 | Apr 2016 | WO |
| WO-2016055956 | Apr 2016 | WO |
| WO-2016065056 | Apr 2016 | WO |
| WO-2016126882 | Aug 2016 | WO |
| WO-2016126987 | Aug 2016 | WO |
| WO-2016130868 | Aug 2016 | WO |
| WO-2016161244 | Oct 2016 | WO |
| WO-2016162127 | Oct 2016 | WO |
| WO-2016164779 | Oct 2016 | WO |
| WO-2016172377 | Oct 2016 | WO |
| WO-2016173719 | Nov 2016 | WO |
| WO-2016183100 | Nov 2016 | WO |
| WO-2017049231 | Mar 2017 | WO |
| WO-2017053450 | Mar 2017 | WO |
| WO-2017059399 | Apr 2017 | WO |
| WO-2017095958 | Jun 2017 | WO |
| WO-2017100441 | Jun 2017 | WO |
| WO-2017118761 | Jul 2017 | WO |
| WO-2017158103 | Sep 2017 | WO |
| WO-2017214574 | Dec 2017 | WO |
| WO-2018026920 | Feb 2018 | WO |
| WO-2018038772 | Mar 2018 | WO |
| WO-2018057526 | Mar 2018 | WO |
| WO-2018094263 | May 2018 | WO |
| WO-2018112426 | Jun 2018 | WO |
| WO-2018119246 | Jun 2018 | WO |
| WO-2018156792 | Aug 2018 | WO |
| WO-2018170164 | Sep 2018 | WO |
| WO-2018170169 | Sep 2018 | WO |
| WO-2018170559 | Sep 2018 | WO |
| WO-2018200380 | Nov 2018 | WO |
| WO-2018231872 | Dec 2018 | WO |
| WO-201 9014781 | Jan 2019 | WO |
| WO-201 9051501 | Mar 2019 | WO |
| WO-201 9079769 | Apr 2019 | WO |
| WO-201 9084500 | May 2019 | WO |
| WO-2019136175 | Jul 2019 | WO |
| WO-2019222706 | Nov 2019 | WO |
| WO-2020139871 | Jul 2020 | WO |
| WO-2020176362 | Sep 2020 | WO |
| WO-2020176678 | Sep 2020 | WO |
| WO-2020176680 | Sep 2020 | WO |
| WO-2020257612 | Dec 2020 | WO |
| WO-2021119193 | Jun 2021 | WO |
| Entry |
|---|
| Abudayyeh et al.: C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science, available on line, Jun. 13, 2016, at: http://zlab.mit.edu/assets/reprints/Abudayyeh_OO_Science_2016.pdf, 17 pages. |
| Acevedo-Rocha et al.: Directed evolution of stereoselective enzymes based on genetic selection as opposed to screening systems. J. Biotechnol. 191:3-10 (2014). |
| Adessi et al.: Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms. Nucleic Acids Res. 28(20):E87, 2000. |
| Alberts et al.: Molecular Biology of the Cell. 4th edition. New York: Garland Science; 2002. The Generation of Antibody Diversity. https://www.ncbi.nlm.nih.gov/books/NBK26860/. |
| Alexeyev et al.: Gene synthesis, bacterial expression and purification of the Rickettsia prowazekii ATP/ADP translocase, Biochimica et Biophysics Acta, 1419:299-306, 1999. |
| Al-Housseiny et al.: Control of interfacial instabilities using flow geometry Nature Physics, 8:747-750, 2012. |
| Almagro et al.: Progress and Challenges in the Design and Clinical Development of Antibodies for Cancer Therapy. Frontiers in immunology; 8, 1751 (2018) doi:10.3389/fimmu.2017.01751 https://www.frontiersin.org/articles/10.3389/fimmu.2017.01751/full. |
| Amblard et al.: A magnetic manipulator for studying local rheology and micromechanical properties of biological systems, Rev. Sci. Instrum., 67(3):18-827, 1996. |
| Andoni and Indyk. Near-Optimal Hashing Algorithms for Approximate Nearest Neighbor in High Dimensions, Communications of the ACM, 51(1):117-122, 2008. |
| Arand et al.: Structure of Rhodococcus erythropolis limonene-1,2-epoxide hydrolase reveals a novel active site. EMBO J. 22:2583-2592 (2003). |
| Arkles et al.: The Role of Polarity in the Structure of Silanes Employed in Surface Modification. Silanes and Other Coupling Agents. 5:51-64, 2009. |
| Arkles. Hydrophobicity, Hydrophilicity Reprinted with permission from the Oct. 2006 issue of Paint & Coatings Industry magazine, Retrieved on Mar. 19, 2016, 10 pages. |
| Assembly manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, The Institute for Systems Biology, May 28, 2004 (50 pages). |
| Assi et al.: Massive-parallel adhesion and reactivity—measurements using simple and inexpensive magnetic tweezers. J. Appl. Phys. 92(9):5584-5586 (2002). |
| ATDBio. Nucleic Acid Structure, Nucleic Acids Book, 9 pages, published on Jan. 22, 2005. from: http://www.atdbio.com/content/5/Nucleic-acid-structure. |
| ATDBio. Solid-Phase Oligonucleotide Synthesis, Nucleic Acids Book, 20 pages, Published on Jul. 31, 2011. from: http://www.atdbio.com/content/17/Solid-phase-oligonucleotide-synthesis. |
| Au et al.: Gene synthesis by a LCR-based approach: high level production of Leptin-L54 using synthetic gene in Escherichia coli. Biochemical and Biophysical Research Communications 248:200-203 (1998). |
| Baedeker et al.: Overexpression of a designed 2.2kb gene of eukaryotic phenylalanine ammonialyase in Escherichia coli. FEBS Letters, 457:57-60, 1999. |
| Barbee et al.: Magnetic Assembly of High-Density DNA Arrays for Genomic Analyses. Anal Chem. 80(6):2149-2154, 2008. |
| Barton et al.: A desk electrohydrodynamic jet printing system. Mechatronics, 20:611-616, 2010. |
| Beaucage et al.: Advances in the synthesis of oligonucleotides by the phosphoramidite approach. Tetrahedron. 48:2223-2311, 1992. |
| Beaucage et al.: Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett. 22(20):1859-1862, 1981. |
| Beaucage et al.: The Chemical synthesis of DNA/RNA Chapter 2 in: Encyclopedia of Cell Biology, 1:36-53, 2016. |
| Beaulieu et al.: PCR candidate region mismatch scanning adaptation to quantitative, high-throughput genotyping, Nucleic Acids Research, 29(5): 1114-1124, 2001. |
| Beigelman et al.: Base-modified phosphoramidite analogs of pyrimidine ribonucleosides for RNA structure-activity studies. Methods Enzymol. 317:39-65, 2000. |
| Bethge et al.: Reverse synthesis and 3′-modification of RNA. Jan. 1, 2011, pp. 64-64, XP055353420. Retrieved from the Internet: URL:http://www.is3na.org/assets/events/Category%202-Medicinal %20Chemistry%20of%2001igonucleotides%20%2864-108%29.pdf. |
| Binkowski et al.: Correcting errors in synthetic DNA through consensus shuffling. Nucleic Acids Research, 33(6):e55, 8 pages, 2005. |
| Biswas et al.: Identification and characterization of a thermostable MutS homolog from Thennus aquaticus, The Journal of Biological Chemistry, 271(9):5040-5048, 1996. |
| Biswas et al.: Interaction of MutS protein with the major and minor grooves of a heteroduplex DNA, The Journal of Biological Chemistry, 272(20):1 3355-13364, 1997. |
| Bjornson et al.: Differential and simultaneous adenosine Di- and Triphosphate binding by MutS, The Journal of Biological Chemistry, 278(20):18557-18562, 2003. |
| Blanchard et al.: High-Density Oligonucleotide Arrays, Biosensors & Bioelectronics, 11(6/7):687-690, 1996. |
| Blanchard: Genetic Engineering, Principles and Methods, vol. 20, Ed. J. Sedlow, New York: Plenum Press, p. 111-124, 1979. |
| Blawat et al.: Forward error correction for DNA data storage. Procedia Computer Science, 80:1011-1022, 2016. |
| Bonini and Mondino, Adoptive T-cell therapy for cancer: The era of engineered T cells. European Journal of Immunology, 45:2457-2469, 2015 . |
| Bornholt et al.: A DNA-Based Archival Storage System, in International Conference on Architectural Support for Programming Languages and Operating Systems (ASPLOS), Apr. 2-6, 2016, Atlanta, GA, 2016, 637-649. |
| Borovkov et al.: High-quality gene assembly directly from unpurified mixtures of microassay-synthesized oligonucleotides. Nucleic Acid Research, 38(19):e180, 10 pages, 2010. |
| Brunet: Aims and methods of biosteganography. Journal of Biotechnology, 226:56-64, 2016. |
| Buermans et al.: Next Generation sequencing technology: Advances and applications, Biochimica et Biophysica Acta (BBA)—Molecular Basis of Disease, 1842:1931-1941, 2014. |
| Butler et al.: In situ synthesis of oligonucleotide arrays by using surface tension. J Am Chem Soc. 123(37):8887-94, 2001. |
| Calvert. Lithographically patterned self-assembled films. In: Organic Thin Films and Surfaces: Directions for The Nineties, vol. 20, p. 109, ed. By Abraham Ulman, San Diego: Academic Press, 1995. |
| Cardelli. Two-Domain DNA Strand Displacement, Electron. Proc. Theor. Comput. Sci., 26:47-61, 2010. |
| Carlson. Time for New DNA Synthesis and Sequencing Cost Curves, 2014. [Online], Available: http://www.synthesis.cc/synthesis/2014/02/time_for_new_cost_curves_2014. 10 pages. |
| Carr et al.: Protein-mediated error correction for de novo DNA synthesis. Nucleic Acids Res. 32(20):e162, 9 pages, 2004. |
| Carter and Friedman. DNA synthesis and Biosecurity: Lessons learned and options for the future. J. Craig Venter Institute, La Jolla, CA, 28 pages, Oct. 2015. |
| Caruthers. Chemical synthesis of deoxyoligonucleotides by the phosphoramidite method. In Methods in Enzymology, Chapter 15, 154:287-313, 1987. |
| Caruthers, The Chemical Synthesis of DNA/RNA: Our Gift to Science. J. Biol. Chem., 288(2):1420-1427, 2013. |
| Caruthers. Gene synthesis machines: DNA chemistry and its uses. Science 230(4723):281-285 (1985). |
| Casmiro et al.: PCR-based gene synthesis and protein NMR spectroscopy, Structure, 5(11):1407-1412, 1997. |
| CeGaT. Tech Note available at https://www.cegat.de/web/wp-content/uploads/2018/06/Twist-Exome-Tech-Note.pdf (4 pgs.) (2018). |
| Cello et al.: Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science. 297(5583):1016-8, 2000. |
| Chalmers et al.: Scaling up the ligase chain reaction-based approach to gene synthesis. Biotechniques. 30(2):249-52, 2001. |
| Chan et al.: Natural and engineered nicking endonucleases—from cleavage mechanism to engineering of strand-specificity. Nucleic Acids Res. 39(1):1-18, 2011. |
| Chen et al.: Programmable chemical controllers made from DNA, Nat. Nanotechnol., 8(10):755-762, 2013. |
| Chen et al.: Chemical modification of gene silencing oligonucleotides fordrug discovery and development. Drug Discov Today. 10(8):587-93 2005. |
| Cheng et al.: High throughput parallel synthesis of oligonucleotides with 1536 channel synthesizer. Nucleic Acids Res. 30(18):e93, 2002. |
| Chilamakuri et al.: Performance comparison of four exome capture systems for deep sequencing. BMC Genomics 15(1):449 (2014). |
| Cho et al.: Capillary passive valve in microfluidic systems. NSTI-Nanotech. 2004; 1:263-266. |
| Chrisey et al.: Fabrication of patterned DNA surfaces Nucleic Acids Research, 24(15):3040-3047 (1996). |
| Chung et al.: One-step preparation of competent Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci USA. Apr. 1989;86(7):2172-2175. |
| Church et al.: Next-generation digital information storage in DNA. Science, 337:6102, 1628-1629, 2012. |
| Cleary et al.: Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nature Methods, 1(13):241-248, 2004. |
| Cohen et al.: Human population: The next half century. Science, 302:1172-1175, 2003. |
| CRICK. On protein synthesis. Symp Soc Exp Biol12:138-163,1958. |
| Cruse et al.: Atlas of Immunology, Third Edition. Boca Raton:CRC Press (pp. 282-283) (2010). |
| Cutler et al.: High-throughput variation detection and genotyping using microarrays, Genome Research, vol. 11, 1913-19 (2001). |
| Dahl et al.: Circle-to-circle amplification for precise and sensitive DNA analysis. Proc Natl Acad Sci U S A. Mar. 30, 2004;101(13):4548-53. Epub Mar. 15, 2004. |
| De Mesmaeker et al.: Backbone modifications in oligonucleotides and peptide nucleic acid systems. Curr Opin Struct Biol. Jun. 1995;5(3):343-55. |
| De Silva et al.: New Trends of Digital Data Storage in DNA. BioMed Res Int. 2016:8072463 (2016). |
| Deamer et al.: Characterization of nucleic acids by nanopore analysis, Ace. Cham. Res., vol. 35, No. 10, 817-825 (2002). |
| Deaven. The Human Genome Project: Recombinant clones for mapping and sequencing DNA. Los Alamos Science, 20:218-249, 1992. |
| Deng et al.: Targeted bisulfite sequencing reveals changes in DNA methylation associated with nuclear reprogramming Nature Biotechnology, 27:352-360 (2009). |
| Dietrich et al.: Gene assembly based on blunt-ended double-stranded DNA-modules, Biotechnology Techniques, vol. 12, No. 1, 49-54 (Jan. 1998). |
| Dillon et al.: Exome sequencing has higher diagnostic yield compared to simulated disease-specific panels in children with suspected monogenic disorders. Eur J Hum Genet 26(5):644-651 (2018). |
| Dormitzer et al.: Synthetic generation of influenza vaccine viruses for rapid response to pandemics. Sci Translational Medicine, 5(185):185ra68, 14 pages, 2013. |
| Doudna et al.: Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346(6213):1258096-1-1258096-9, 2014. |
| Douthwaite et al.: Affinity maturation of a novel antagonistic human monoclonal antibody with a long VH CDR3 targeting the Class A GPCR formyl-peptide receptor 1; mAbs, vol. 7, Iss. 1, pp. 152-166 (Jan. 1, 2015). |
| Dower et al.: High efficiency transformation of E.coli by high voltage electroporation. Nucleic Acids Res. 16(13):6127-45 (1988). |
| Dressman et al.: Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations. Proc Natl Acad Sci U S A. Jul. 22, 2003;100(15):8817-22. Epub Jul. 11, 2003. |
| Drmanac et al.: Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays. Science. Jan. 1, 2010;327(5961):78-81. doi: 10.1126/science.1181498. Epub Nov. 5, 2009. |
| Droege and Hill. The Genome Sequencer FLXTM System-Longer reads, more applications, straight forward bioinformatics and more complete data sets Journal of Biotechnology, 136:3-10, 2008. |
| Duffy et al.: Rapid Prototyping of Microfluidic Systems in Poly(dimethylsiloxane). Anal Chem. Dec. 1, 1998;70(23):4974-84. doi: 10.1021/ac980656z. |
| Duggan et al.: Expression profiling using cDNA microarrays. Nat Genet. Jan. 1999;21(1 Suppl):10-4. |
| Dvorsky. Living Bacteria Can Now Store Data. GIZMODO internet publication. Retrieved from https://gizmodo.com/living-bacteria-can-now-store-data-1781773517 (4 pgs) (Jun. 10, 2016). |
| Eadie et al.: Guanine modification during chemical DNA synthesis. Nucleic Acids Res. Oct. 26, 1987;15(20):8333-49. |
| Eisen: A phylogenomic study of the MutS family of proteins, Nucleic Acids Research, vol. 26, No. 18, 4291-4300 (1998). |
| Ellis et al.: DNA assembly for synthetic biology: from parts to pathways and beyond. Integr Biol (Camb). Feb. 2011;3(2):109-18. doi: 10.1039/c0ib00070a. Epub Jan. 19, 2011. |
| El-Sagheer et al.: Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli. Proc Natl Acad Sci USA. Jul. 12, 2011;108(28):11338-43. doi: 10.1073/pnas.1101519108. Epub Jun. 27, 2011. |
| Elsik et al.: The Genome sequence of taurine cattle: A window of ruminant biology and evolution. Science, 324:522-528, 2009. |
| Elsner et al.: 172 nm excimer VUV-triggered photodegradation and micropatterning of aminosilane films, Thin Solid Films, 517:6772-6776 (2009). |
| Engler et al.: A one pot, one step, precision cloning method with high throughput capability. PLoS One. 2008;3(11):e3647. doi: 10.1371/journal.pone.0003647. Epub Nov. 5, 2008. |
| Engler et al.: Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One. 2009;4(5):e5553. doi: 10.1371/journal.pone.0005553. Epub May 14, 2009. |
| Erlich and Zielinski. DNA fountain enables a robust and efficient storage architecture. Science, 355(6328):950-054, 2017. |
| Eroshenko et al.: Gene Assembly from Chip-Synthesized Oligonucleotides; Current Protocols in Chemical biology 4: 1-17 (2012). |
| European Patent Application No. 12827479.2 Extended European Search Report dated May 18, 2015. |
| European Patent Application No. 12827479.2 Partial European Search Report dated Jan. 29, 2015. |
| European Patent Application No. 14834665.3 Communication dated Jan. 16, 2018. |
| European Patent Application No. 14834665.3 extended European Search Report dated Apr. 28, 2017. |
| European Patent Application No. 14834665.3 Further Examination Report dated Nov. 28, 2018. |
| European Patent Application No. 14834665.3 Office Action dated May 2, 2018. |
| European Patent Application No. 16847497.1 Extended European Search Report dated Jan. 9, 2019. |
| European Patent Application No. 16871446.7 European Search Report dated Apr. 10, 2019. |
| European Patent Application No. 16871446.7 First Official Action dated Nov. 13, 2019. |
| European Patent Application No. 17844060.8 Extended Search Report dated Apr. 20, 2020. |
| Evans et al.: DNA Repair Enzymes. Current Protocols in Molecular Biology 84:III:3.9:3.9.1-3.9.12 http://www.ncbi.nlm.nih.gov/pubmed/18972391 (Published online Oct. 1, 2008 Abstract only provided). |
| Fahy et al.: Self-sustained sequence replication (3SR): an isothermal transcription-based amplification system alternative to PCR. PCR Methods Appl. Aug. 1991;1(1):25-33. |
| Fedoryak et al.: Brominated hydroxyquinoline as a photolabile protecting group with sensitivity to multiphoton excitation, Org. Lett., vol. 4, No. 2, 3419-3422 (2002). |
| Ferretti et al.: Total synthesis of a gene for bovine rhodopsin. PNAS, 83:599-603 (1986). |
| Finger et al.: The wonders of Flap Endonucleases: Structure, function, mechanism and regulation. Subcell Biochem., 62:301-326, 2012. |
| Fodor et al.: Light-directed, spatially addressable parallel chemical synthesis. Science. 251(4995):767-773 (1991). |
| Fogg et al.: Structural basis for uracil recognition by archaeal family B DNA polymerases. Nature Structural Biology, 9(12):922-927, 2002. |
| Foldesi et al.: The synthesis of deuterionucleosides. Nucleosides Nucleotides Nucleic Acids. Oct.-Dec. 2000;19(10-12):1615-56. |
| Frandsen et al.: Efficient four fragment cloning for the construction of vectors for targeted gene replacement in filamentous fungi. BMC Molecular Biology 2008, 9:70. |
| Frandsen. Experimental setup. Dec. 7, 2010, 3 pages. http://www.rasmusfrandsen.dk/experimental_setup.htm. |
| Frandsen. The USER Friendly technology. USER cloning. Oct. 7, 2010, 2 pages. http://www.rasmusfrandsen.dk/user_cloning.htm. |
| Fullwood et al.: Next-generation DNA sequencing of paired-end tags [PET] for transcriptome and genome analysis Genome Research, 19:521-532, 2009. |
| Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:1-9 (2017). |
| Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:S1 figure (2017). |
| Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:S1 Table (2017). |
| Galka et al.: QuickLib, a method for building fully synthetic plasmid libraries by seamless cloning of degenerate oligonucleotides. Plos One, 12, e0175146:S2 figure (2017). |
| Galneder et al.: Microelectrophoresis of a bilayer-coated silica bead in an optical trap: application to enzymology. Biophysical Journal, vol. 80, No. 5, 2298-2309 (May 2001). |
| Gao et al.: A method for the generation of combinatorial antibody libraries using pIX phage display. PNAS 99(20):12612-12616 (2002). |
| Gao et al.: A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids. Nucleic Acids Res. Nov. 15, 2001;29(22):4744-50. |
| Gao et al.: Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences. Nucleic Acids Res. Nov. 15, 2003;31(22):e143. |
| Garaj et al.: Graphene as a subnanometre trans-electrode membrane. Nature. Sep. 9, 2010;467(7312):190-3. doi: 10.1038/nature09379. |
| Garbow et al.: Optical tweezing electrophoresisof isolated, highly charged colloidal spheres, Colloids and Surfaces A: Physiochem. Eng. Aspects, vol. 195, 227-241 (2001). |
| GeneArt Seamless Cloning and Assembly Kits. Life Technologies Synthetic Biology. 8 pages, available online Jun. 15, 2012. |
| Genomics 101. An Introduction to the Genomic Workflow. 2016 edition, 64 pages. Available at: http://www.frontlinegenomics.com/magazine/6757/genomics-101/. |
| Geu-Flores et al.: USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic Acids Res. 2007;35(7):e55. Epub Mar. 27, 2007. |
| Gibson Assembly. Product Listing. Application Overview. 2 pages, available online Dec. 16, 2014. |
| Gibson et al.: Creation of a Bacterial Cell Controlled by A Chemically Synthesized Genome. Science 329(5989):52-56 (2010). |
| Gibson et al.: Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science. Feb. 29, 2008;319(5867):1215-20. doi: 10.1126/science.1151721. Epub Jan. 24, 2008. |
| Goldfeder et al.: Medical implications of technical accuracy in genome sequencing. Genome Med 8(1):24 (2016). |
| Goldman et al.: Towards practical, high-capacity, low-maintenance information storage in synthesized DNA, Nature, 494(7435):77-80, 2013. |
| Gosse et al.: Magnetic tweezers: micromanipulation and force measurement at the molecular level, Biophysical Journal, vol. 8, 3314-3329 (Jun. 2002). |
| Grass et al.: Robust chemical preservation of digital information on DNA in silica with error-correcting codes, Angew. Chemie—Int. Ed., 54(8):2552-2555, 2015. |
| Greagg et al.: A read-ahead function in archaeal DNA polymerases detects promutagenic template-strand uracil. Proc. Nat. Acad. Sci. USA, 96:9045-9050, 1999. |
| Grovenor. Microelectronic materials. Graduate Student Series in Materials Science and Engineering. Bristol, England: Adam Hilger, 1989; p. 113-123. |
| Gu et al.: Depletion of abundant sequences by hybridization (DASH): using Cas9 to remove unwanted high-abundance species in sequencing libraries and molecular counting applications. Genome Biology, 17:41, 13 pages, 2016. |
| Haber et al.: Magnetic tweezers for DNA micromanipulation, Rev. Sci. Instrum., vol. 71, No. 12, 4561-4570 (Dec. 2000). |
| Han et al.: Linking T-cell receptor sequence to functional phenotype at the single-cell level. Nat Biotechnol 32(7):684-692 (2014). |
| Hanahan and Cold Spring Harbor Laboratory. Studies on transformation of Escherichia coli with plasmids J. Mol. Biol. 166:557-580 (1983). |
| Hanahan et al.: Plasmid transformation of Escherichia coli and other bacteria. Methods Enzymol, vol. 204, p. 63-113 (1991). |
| Harada et al.: Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection. Nucleic Acids Res. May 25, 1993; 21(10):2287-91. |
| Hauser et al.: Trends in GPCR drug discovery: new agents, targets and indications. Nature Reviews Drug Discovery, 16, 829-842 (2017). doi:10.1038/nrd.2017.178 https://www.nature.com/articles/nrd.2017.178. |
| Heckers et al.: Error analysis of chemically synthesized polynucleotides, BioTechniques, vol. 24, No. 2, 256-260 (1998). |
| Herzer et al.: Fabrication of patterned silane based self-assembled monolayers by photolithography and surface reactions on silicon-oxide substrates Chem. Commun., 46:5634-5652 (2010). |
| Hoover et al.: DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis, Nucleic Acids Research, vol. 30, No. 10, e43, 7 pages (2002). |
| Hosu et al.: Magnetic tweezers for intracellular applications⋅, Rev. Sci. Instrum., vol. 74, No. 9, 4158-4163 (Sep. 2003). |
| Hötzel et al.: A strategy for risk mitigation of antibodies with fast clearance. mAbs, 4(6), 753-760 (2012). doi:10.4161/mabs.22189 https://www.ncbi.nlm.nih.gov/pubmed/23778268. |
| Huang et al.: Three-dimensional cellular deformation analysis with a two-photon magnetic manipulator workstation, Biophysical Journal, vol. 8 2, No. 4, 2211-2223 (Apr. 2002). |
| Hughes et al.: Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer Nat Biotech 4:342-347 (2001). |
| Hughes et al.: Principles of early drug discovery. Br J Pharmacol 162(2):1239-1249, 2011. |
| Hutchison et al.: Cell-free cloning using phi29 DNA polymerase. Proc Natl Acad Sci U S A. Nov. 29, 2005;102(48):17332-6. Epub Nov. 14, 2005. |
| Imgur: The magic of the internet. Uploaded May 10, 2012, 2 pages, retrieved from: https://imgur.com/mEWuW. |
| In-Fusion Cloning: Accuracy, Not Background. Cloning & Competent Cells, ClonTech Laboratories, 3 pages, available online Jul. 6, 2014. |
| International Application No. PCT/US2017/026232 International Preliminary Report on Patentability dated Feb. 26, 2019. |
| International Application No. PCT/US2017/045105 International Preliminary Report on Patentability dated Feb. 5, 2019. |
| International Application No. PCT/US2017/052305 International Preliminary Report on Patentability dated Apr. 30, 2019. |
| International Application No. PCT/US2017/062391 International Preliminary Report on Patentability dated May 21, 2019. |
| International Application No. PCT/US2018/019268 International Preliminary Report on Patentability dated Sep. 6, 2019. |
| International Application No. PCT/US2018/050511 International Search Report and Written Opinion dated Jan. 11, 2019. |
| International Application No. PCT/US2018/057857 International Search Report and Written Opinion dated Mar. 18, 2019. |
| International Application No. PCT/US2019/012218 International Search Report and Written Opinion dated Mar. 21, 2019. |
| International Application No. PCT/US2019/032992 International Search Report and Written Opinion dated Oct. 28, 2019. |
| International Application No. PCT/US2019/032992 Invitation to Pay Additional Fees dated Sep. 6, 2019. |
| Jackson et al.: Recognition of DNA base mismatches by a rhodium intercalator, J. Am. Chem. Soc., vol. 19, 12986-12987 (1997). |
| Jacobs et al.: DNAglycosylases: In DNA repairand beyond. Chromosoma 121:1-20 (2012)—http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3260424/. |
| Acobus et al.: Optimal cloning of PCR fragments by homologous recombination in Escherichia soli. PLoS One 10(3):e0119221 (2015). |
| Jager et al.: Simultaneous Humoral and Cellular: Immune Response against Cancer—Testis Antigen NY-ES0-1: Definition of Human Histocompatibility Leukocyte Antigen (HLA)-A2-binding Peptide Epitopes. J. Exp. Med. 187(2):265-270 (1998). |
| Jinek et al.: A Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337:816-821, 2012. |
| Jo et al.: Engineering therapeutic antibodies targeting G-protein-coupled receptors; Experimental & Molecular Medicine; 48; 9 pages (2016). |
| Karagiannis and El-Osta. RNA interference and potential therapeutic applications of short interfering RNAs Cancer Gene Therapy, 12:787-795, 2005. |
| Ke et al.: Influence of neighboring base pairs on the stability of single base bulges and base pairs in a DNA fragment, Biochemistry, Vo. 34, 4593-4600 (1995). |
| Kelley et al.: Single-base mismatch detection based on charge transduction through DNA, Nucleic Acids Research, vol. 27, No. 24, 4830-4837 (1999). |
| Kim et al.: High-resolution patterns of quantum dots formed by electrohydrodynamic jet printing for light-emitting diodes. Nano Letters, 15:969-973, 2015. |
| Kim et al.: Site specific cleavage of DNA-RNA hybrids by zinc finger/Fok I cleavage domain fusions Gene, vol. 203, 43-49 (1997). |
| Kim et al.: Chimeric restriction endonuclease, Proc. Natl. Acad. Sci. USA, vol. 91, 883-887 (Feb. 1994). |
| Kim, The interaction between Z-ONA and the Zab domain of double-stranded RNA adenosine deaminase characterized using fusion nucleases, The Journal of Biological Chemistry, vol. 274, No. 27, 19081-19086 (1999). |
| Kinde et al.: Detection and quantification of rare mutations with massively parallel sequencing. Proc Natl Acad Sci U S A. Jun. 7, 2011;108(23):9530-5. Epub May 17, 2011. |
| Kodumal et al.: Total synthesis of long DNA sequences: synthesis of a contiguous 32-kb polyketide synthase gene cluster. Proc Natl Acad Sci U S A. Nov. 2, 2004;101(44):15573-8. Epub Oct. 20, 2004. |
| Koike-Yusa et al.: Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nature Biotechnology, 32:267-273, 2014 (with three pages of supplemental Online Methods). |
| Kong et al.: Parallel gene synthesis in a microfluidic device. Nucleic Acids Res., 35(8):e61 (2007). |
| Kong. Microfluidic Gene Synthesis. MIT Thesis. Submitted to the program in Media Arts and Sciences, School of Architecture and Planning, in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Media Arts and Sciences at the Massachusetts Institute of Technology. 143 pages Jun. 2008. |
| Kopp et al.: Chemical amplification: continuous-flow PCR on a chip, Science, vol. 280, 1046-1048 (May 15, 1998). |
| Kosuri and Church. Large-scale de novo DNA synthesis: technologies and applications, Nature Methods, 11:499-507, 2014. Available at: http://www.nature.com/nmeth/journal/v11/n5/full/nmeth.2918.html. |
| Kosuri et al.: A scalable gene synthesis platform using high-fidelity DNA microchips Nat.Biotechnol., 28(12):1295-1299, 2010. |
| Krayden, Inc.: A Guide to Silane Solutions. Silane coupling agents. 7 pages. Published on May 31, 2005 at: http://krayden.com/pdf/xia_silane_chemistry.pdf. |
| Lagally et al.: Single-Molecule DNA Amplification and Analysis in an Integrated Microfluidic Device. Analytical Chemistry. 2001;73(3): 565-570. |
| Lahue et al., DNA mismatch correction in a defined system, Science, vol. 425; No. 4914, 160-164 (Jul. 14, 1989). |
| Lambrinakos, A. et al.: Reactivity of potassium permanganate and tetraethylammonium chloride with mismatched bases and a simple mutation detection protocol,Nucleic Acids Research, vol. 27, No. 8, 1866-1874 (1999). |
| Landegren et al.: A ligase-mediated gene detection technique. Science. Aug. 26, 1988;241(4869):1077-80. |
| Lang, Matthew J. et al.: An automated two-dimensional optical force clamp for single molecule studies, Biophysical Journal, vol. 83, 491-501 (Jul. 2002). |
| Lashkari et al.: An automated multiplex oligonucleotide synthesizer: development of high-throughput, low-cost DNA synthesis. Proc Natl Acad Sci U S A. Aug. 15, 1995;92(17):7912-5. |
| Lausted et al.: POSaM: a fast, flexible, open-source, inkjet oligonucleotide synthesizer and microarrayer, Genome Biology, 5:R58, 17 pages, 2004. available at https://www.ncbi.nlm.nih.gov/pmc/articles/PMC507883/. |
| Leamon et al.: A massively parallel PicoTiterPlate based platform for discrete picoliter-scale polymerase chain reactions. Electrophoresis. Nov. 2003;24(21):3769-77. |
| Lee et al.: Microelectromagnets for the control of magnetic nanoparticles, Appl. Phys. Lett., vol. 79, No. 20, 3308-3310 (Nov. 12, 2001). |
| Lee et al.: A microfluidic oligonucleotide synthesizer. Nucleic Acids Research 2010 vol. 38(8):2514-2521. DOI: 10.1093/nar/gkq092. |
| Lee: Covalent End-Immobilization of Oligonucleotides onto Solid Surfaces; Thesis, Massachusetts Institute of Technology, Aug. 2001 (315 pages). |
| Leproust et al.: Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process, Nucleic Acids Research, 35(8):2522-2540, 2010. |
| Leproust et al.: Agilent's Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements. 2008; 1-12. http://www.miltenyibiotec.eom/˜/media/Files/Navigation/Genomic%20Services/Agilent_DNA_Microarray_Platform.ashx. |
| Lesnikowski et al.: Nucleic acids and nucleosides containing carboranes. J. Organometallic Chem. 1999; 581:156-169. |
| Leumann. DNA analogues: from supramolecular principles to biological properties. Bioorg Med Chem. Apr. 2002;10(4):841-54. |
| Levene et al.: Zero-mode waveguides for single-molecule analysis at high concentrations. Science. Jan. 31, 2003;299(5607):682-6. |
| Lewontin and Harti, Population genetics in forensic DNA typing. Science, 254:1745-1750, 1991. |
| Li et al.: Beating Bias in the Directed Evolution of Proteins: Combining High-Fidelity on-Chip Solid-Phase Gene Synthesis with Efficient Gene Assembly for Combinatorial Library Construction. ChemBioChem 19:221-228 (2018). |
| Li et al.: Beating bias in the directed evolution of proteins: Combining high-fidelity on-chip solid-phase gene synthesis with efficient gene assembly for combinatorial library construction. First published Nov. 24, 2017, 2 pages, retrieved from: https://doi.org/10.1002/cbic.201700540. |
| Light source unit for printable patterning VUV-Aligner/ USHIO Inc., Link here: https://www.ushio.co.jp/en/products/1005.html, published Apr. 25, 2016, printed from the internet on Aug. 2, 2016, 3 pages. |
| Limbachiya et al.: Natural data storage: A review on sending information from now to then via Nature. ACM Journal on Emerging Technologies in Computing Systems, V(N):Article A, May 19, 2015, 17 pages. |
| Link Technologies. Product Guide 2010. Nov. 27, 2009, 136 pages. XP055353191. Retrieved from the Internet: URL:http://www.linktech.co.uk/documents/517/517.pdf. |
| Lipshutz, Robert J. et al.: High density synthetic oligonucleotide arrays, Nature Genetics Supplement, vol. 21, 20-24 (Jan. 1999). |
| Lishanski, Alia et al.: Mutation detection by mismatch binding protein, MutS, in amplified DNA: application to the cystic fibrosis gene, Proc. Natl. Acad. Sci. USA, vol. 91, 2674-2678 (Mar. 1994). |
| Liu et al.: Comparison of Next-Generation Sequencing Systems. J Biomed Biotechnol 2012: 251364 (2012). |
| Liu et al.: Rational design of CXCR4 specific antibodies with elongated CDRs. JACS, 136:10557-10560, 2014. |
| Liu et al.: Enhanced Signals and Fast Nucleic Acid Hybridization By Microfluidic Chaotic Mixing. Angew. Chem. Int. Ed. 2006; 45:3618-3623. |
| Lizardi et al.: Mutation detection and single-molecule counting using isothermal rolling-circle amplification. Nat Genet. Jul. 1998;19(3):225-32. |
| Li et al.: Functional domains in Fok I restriction endonuclease, Proc. Natl. Acad. Sci. USA, 89:4275-4279, 1992. |
| Lu et al.: Methyl-directed repair of DNA base-pair mismatches in vitro, Proc. Natl. Acad. Sci. USA, 80:4639-4643, 1983. |
| Lund et al.: A validated system for ligation-free uracilexcision based assembly of expression vectors for mammalian cell engineering. DTU Systems of Biology. 2011. 1 page. http://www.lepublicsystemepco.com/files/modules/gestion_rubriques/REF-B036-Lund_Anne%20Mathilde.pdf. |
| Ma et al.: Versatile surface functionalization of cyclic olefin copolymer (COC) with sputtered SiO2 thin film for potential BioMEMS applications. Journal of Materials Chemistry, 11 pages, 2009. |
| Ma et al.: DNA synthesis, assembly and application in synthetic biology. Current Opinion in Chemical Biology. 16:260-267, 2012. |
| Mahato et al.: Modulation of gene expression by antisense and antigene oligodeoxynucleotides and small interfering RNA Expert Opin. Drug Delivery, 2(1):3-28, 2005. |
| Margulies et al.: Genome sequencing in open microfabricated high-density picolitre reactors. Nature. 437(7057):376-80, 2005. |
| Martinez-Torrecuadrada et al.: Targeting the Extracellular Domain of Fibroblast Growth Factor Receptor 3 with Human Single-Chain Fv Antibodies Inhibits Bladder Carcinoma Cell Line Proliferation; Clinical Cancer Research; vol. 11; pp. 6282-6290 (2005). |
| Matteucci et al.: Synthesis of deoxyoligonucleotides on a polymer support. J. Am. Chem. Soc. 103(11):3185-3191, 1981. |
| Matzas et al.: Next generation gene synthesis by targeted retrieval of bead-immobilized, sequence verified DNA clones from a high throughput pyrosequencing device. Nat. Biotechnol., 28(12):1291-1294, 2010. |
| Mazor et al.: Isolation of Full-Length IgG Antibodies from Combinatorial Libraries Expressed in Escherichia coli; Antony S. Dimitrov (ed.), Therapeutic Antibodies: Methods and Protocols, vol. 525, Chapter 11, pp. 217-239 (2009). |
| McBride & Caruthers. An investigation of several deoxynucleoside phosphoramidites useful for synthesizing deoxyoligonucleotides. Tetrahedron Lett. 24: 245-248, 1983. |
| McGall et al.: Light-directed synthesis of high-density oligonucleotide arrays using semiconductor photoresists. Proc Natl Acad Sci U S A. 93(24):13555-60, 1996. |
| McGall et al.: The Efficiency of Light-Directed Synthesis of DNA Arrays on Glass Substrates. J. Am. Chem. Soc. 119(22):5081-5090, 1997. |
| Mei et al.: Cell-free protein synthesis in microfluidic array devices Biotechnol. Prog., 23(6):1305-1311,2007. |
| Mendel-Hartvig. Padlock probes and rolling circle amplification. New possibilities for sensitive gene detection. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1175. Uppsala University. 2002, 39 pages, http://www.diva-portal.org/smash/get/diva2:161926/FULLTEXT01. pdf. |
| Meyers and Friedland, Knowledge-based simulation of genetic regulation in bacteriophage lambda. Nucl. Acids Research, 12(1):1-16, 1984. |
| Meynert et al.: Quantifying single nucleotide variant detection sensitivity in exome sequencing. BMC Bioinformatics 14:195 (2013). |
| Meynert et al.: Variant detection sensitivity and biases in whole genome and exome sequencing. BMC Bioinformatics 15:247 (2014). |
| Milo and Phillips. Numbers here reflect the No. of protein coding genes and excludes tRNA and non-coding RNA. Cell Biology by the Numbers, p. 286, 2015. |
| Mitra et al.: In situ localized amplification and contact replication of many individual DNA molecules. Nucleic Acids Res. 27(24):e34, 1999. |
| Morin et al.: Profiling the HeLa S3 transcriptome using randomly primed cDNA and massively parallel short-read sequencing. Biotechniques, 45:81-94, 2008. |
| Morris and Stauss. Optimizing T-cell receptor gene therapy for hematologic malignancies. Blood, 127(26):3305-3311, 2016. |
| Muller et al.: Protection and labelling of thymidine by a fluorescent photolabile group, Helvetica Chimica Acta, vol. 84, 3735-3741 (2001). |
| Mulligan. Commercial Gene Synthesis Technology PowerPoint presentation. BlueHeron® Biotechnology. Apr. 5, 2006 (48 pgs). |
| Nakatani et al.: Recognition of a single guanine bulge by 2-Acylamino-1 ,8-naphthyridine, J. Am. Chem. Soc., vol. 122, 2172-2177 (2000). |
| Neiman M.S.: Negentropy principle in information processing systems. Radiotekhnika, 1966, No. 11, p. 2-9. |
| Neiman M.S.: On the bases of the theory of information retrieval. Radiotekhnika, 1967, No. 5, p. 2-10. |
| Neiman M.S.: On the molecular memory systems and the directed mutations. Radiotekhnika, 1965, No. 6, pp. 1-8. |
| Neiman M.S.: On the relationships between the reliability, performance and degree of microminiaturization at the molecular-atomic level. Radiotekhnika, 1965, No. 1, pp. 1-9. |
| Neiman M.S.: Some fundamental issues of microminiaturization. Radiotekhnika, 1964, No. 1, pp. 3-12. |
| Nishikura. A short primer on RNAi: RNA-directed RNA polymerase acts as a key catalyst Cell, 107:415-418, 2001. |
| Nour-Eldin et al.: USER Cloning and USER Fusion: The Ideal Cloning Techniques for Small and Big Laboratories. Plant Secondary Metabolism Engineering. Methods in Molecular Biology vol. 643, 2010, pp. 185-200. |
| Ochman et al.: Genetic applications of an inverse polymerase chain reaction. Genetics. Nov. 1988;120(3):621-3. |
| Organick et al.: Random access in large-scale DNA data storage. Nature Biotechnology, Advance Online Publication, 8 pages, 2018. |
| Organick et al.: Scaling up DNA data storage and random access retrieval, bioRxiv, preprint first posted online Mar. 7, 2017, 14 pages. |
| Pan et al.: An approach for global scanning of single nucleotide variations. Proc Natl Acad Sci USA. Jul. 9, 2002;99(14):9346-51. |
| Pankiewicz. Fluorinated nucleosides. Carbohydr Res. Jul. 10, 2000;327(1-2):87-105. |
| Paul et al.: Acid binding and detritylation during oligonucleotide synthesis. Nucleic Acids Research. 15. pp. 3048-3052 (1996). |
| PCT/IL2012/000326 International Preliminary Report on Patentability dated Dec. 5, 2013. |
| PCT/IL2012/000326 International Search Report dated Jan. 29, 2013. |
| PCT/US2014/049834 International Preliminary Report on Patentability dated Feb. 18, 2016. |
| PCT/US2014/049834 International Search Report and Written Opinion dated Mar. 19, 2015. |
| PCT/US2014/049834, Invitation to Pay Additional Fees and, where applicable, protest fee, mailed Jan. 5, 2015. |
| PCT/US2015/043605 International Preliminary Report on Patentability dated Feb. 16, 2017. |
| PCT/US2015/043605 International Search Report and Written Opinion dated Jan. 6, 2016. |
| PCT/US2015/043605 Invitation To Pay Additional Fees dated Oct. 28, 2015. |
| PCT/US2016/016459 International Preliminary Report on Patentability dated Aug. 17, 2017. |
| PCT/US2016/016459 International Search Report and Written Opinion dated Apr. 13, 2016. |
| PCT/US2016/016636 International Preliminary Report on Patentability dated Aug. 17, 2017. |
| PCT/US2016/016636 International Search Report and Written Opinion dated May 2, 2016. |
| PCT/US2016/028699 International Preliminary Report on Patentability dated Nov. 2, 2017. |
| PCT/US2016/028699 International Search Report and Written Opinion dated Jul. 29, 2016. |
| PCT/US2016/031674 International Preliminary Report on Patentability dated Nov. 23, 2017. |
| PCT/US2016/031674 International Search Report and Written Opinion dated Aug. 11, 2016. |
| PCT/US2016/052336 International Preliminary Report on Patentability dated Mar. 29, 2018. |
| PCT/US2016/052336 International Search Report and Written Opinion dated Dec. 7, 2016. |
| PCT/US2016/052916 International Preliminary Report on Patentability dated Apr. 5, 2018. |
| PCT/US2016/052916 International Search Report and Written Opinion dated Dec. 30, 2016. |
| PCT/US2016/064270 International Preliminary Report on Patentability dated Jun. 14, 2018. |
| PCT/US2016/064270 International Search Report and Written Opinion dated Apr. 28, 2017. |
| PCT/US2017/026232 International Search Report and Written Opinion dated Aug. 28, 2017. |
| PCT/US2017/036868 International Search Report and Written Opinion dated Aug. 11, 2017. |
| PCT/US2017/045105 International Search Report and Written Opinion dated Oct. 20, 2017. |
| PCT/US2017/052305 International Search Report and Written Opinion dated Feb. 2, 2018. |
| PCT/US2017/062391 International Search Report and Written Opinion dated Mar. 28, 2018. |
| PCT/US2017/066847 International Search Report and Written Opinion dated May 4, 2018. |
| PCT/US2018/022487 International Search Report and Written Opinion dated Aug. 1, 2018. |
| PCT/US2018/022493 International Search Report and Written Opinion dated Aug. 1, 2018. |
| PCT/US2018/037152 International Preliminary Report on Patentability dated Dec. 26, 2019. |
| PCT/US2018/037152 International Search Report and Written Opinion dated Aug. 28, 2018. |
| PCT/US2018/037161 International Preliminary Report on Patentability dated Dec. 17, 2019. |
| PCT/US2018/037161 International Search Report and Written Opinion dated Oct. 22, 2018. |
| PCT/US2018/037161 Invitation to Pay Additional Fees dated Aug. 27, 2018. |
| PCT/US2018/050511 International Preliminary Report on Patentability dated Mar. 26, 2020. |
| PCT/US2018/056783 International Preliminary Report on Patentability dated Apr. 30, 2020. |
| PCT/US2018/056783 International Search Report and Written Opinion of the International Searching Authority dated Dec. 20, 2018. |
| PCT/US2018/057857 International Preliminary Report on Patentability dated Apr. 28, 2020. |
| PCT/US2018/19268 International Search Report and Written Opinion dated Jun. 26, 2018. |
| PCT/US2018/19268 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 2, 2018. |
| PCT/US2018/22487 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018. |
| PCT/US2018/22493 Invitation to Pay Additional Fees and, where applicable, protest fee dated May 31, 2018. |
| PCT/US2019/068435 International Search Report and Written Opinion dated Apr. 23, 2020. |
| PCT/US2020/019986 Invitation to Pay Additional Fees dated Jun. 5, 2020. |
| PCT/US2020/019988 Invitation to Pay Additional Fees dated Jun. 8, 2020. |
| Pease et al.: Light-generated oligonucleotide arrays for rapid DNA sequence analysis. Proc Natl Acad Sci U S A. May 24, 1994;91(11):5022-6. |
| Peisajovich et al.: BBF RFC 28: A method for combinatorial multi-part assembly based on the type-lis restriction enzyme aarl. Sep. 16, 2009, 7 pages. |
| Pellois et al.: Individually addressable parallel peptide synthesis on microchips, Nature Biotechnology, vol. 20 , 922-926 (Sep. 2002). |
| Petersen et al.: LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. Feb. 2003;21(2):74-81. |
| Pierce and Wangh. Linear-after-the-exponential polymerase chain reaction and allied technologies Real-time detection strategies for rapid, reliable diagnosis from single cells Methods Mol. Med. 132:65-85 (2007) (Abstract only). |
| Pierce et al.: Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells. Methods Mol Med. 2007;132:65-85. |
| Pirrung. How to make a DNA chip. Angew. Chem. Int. Ed., 41:1276-1289, 2002. |
| Plesa et al.: Multiplexed gene synthesis in emulsions for exploring protein functional landscapes. Science, 10.1126/science.aao5167, 10 pages, 2018. |
| Pon. Solid-phase supports for oligonucleotide synthesis. Methods Mol Biol. 1993;20:465-96. |
| Poster. Reimagine Genome Scale Research. 2016, 1 page. Available at http://www2.twistbioscience.com/Oligo_Pools_CRISPR_poster. |
| Powers et al.: Optimal strategies for the chemical and enzymatic synthesis of bihelical deoxyribonucleic acids. J Am Chem Soc., 97(4):875-884, 1975. |
| Pray. Discovery of DNA Structure and Function: Watson and Crick, Nature Education, 2008, 6 pages, available at: http://www.nature.com/scitable/topicpage/discovery-of-dna-structure-and-function-watson-397. |
| Prodromou et al.: Recursive PCR: a novel technique for total gene synthesis. Protein Eng. Dec. 1992;5(8):827-9. |
| PubChem Data Sheet Acetonitrile. Printed from website https://pubchem.ncbi.nlm.nig.gov/ pp. 1-124 (2020). |
| PubChem Data Sheet Methylene Chloride. Printed from website https://pubchem.ncbi.nlm.nih.gov/ pp. 1-140 (2020). |
| Puigbo. Optimizer: a web server for optimizing the codon usage of DNA sequences. Nucleic Acid Research, 35(14):126-131, 2007. |
| Qian and Winfree. Scaling up digital circuit computation with DNA strand displacement cascades. Science, 332(6034):196-1201, 2011. |
| Qian, et al.: Neural network computation with DNA strand displacement cascades, Nature, 475(7356):368-372, 2011. |
| Quan et al.: Parallel on-chip gene synthesis and application to optimization of protein expression, Nature Biotechnology, 29(5):449-452, 2011. |
| Rafalski and Morgante. Corn and humans: recombination and linkage disequilibrium in two genomes of similar size. Trends in Genetics, 20(2):103-111, 2004. |
| Raje and Murma, A Review of electrohydrodynamic-inkjet printing technology. International Journal of Emerging Technology and Advanced Engineering, 4(5):174-183, 2014. |
| Rajpal et al.: A general method for greatly improving the affinity of antibodies by using combinatorial libraries. Proc. Natl. Acad. Sci. 102(24):8466-8471 (2005). |
| Rastegari et al.: XNOR-Net: ImageNet Classification Using Binary Convolutional Neural Networks, in ECCV 2016, Part IV, LNCS 9908, p. 525-542, 2016. |
| Reimagine SequenceSpace, Reimagine Research, Twist Bioscience, Product Brochure, Published Apr. 6, 2016 online at: www2.twistbioscience.com/TB_Product_Brochure_04.2016, 8 pages. |
| RF Electric discharge type excimer lamp. Products Catalog. Excimer lamp light source flat excimer, 16 pages dated Jan. 2016. From: http://www.hamamatsu.com/jp/en/product/category/1001/3026/index.html. |
| Richmond et al.: Amplification and assembly ofchip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Res. Sep. 24, 2004;32(17):5011-8. Print 2004. |
| Roche. Restriction Enzymes from Roche Applied Science—A Tradition of Premium Quality and Scientific Support. FAQS and Ordering Guide. Roche Applied Science. Accessed Jan. 12, 2015, 37 pages. |
| Rogozin et al.: Origin and evolution of spliceosomal introns. Biology Direct, 7:11, 2012. |
| Ruminy et al.: Long-range identification of hepatocyte nuclear factor-3 (FoxA) high and low-affinity binding Sites with a chimeric nuclease, J. Mol. Bioi., vol. 310, 523-535 (2001). |
| Saaem et al.: In situ synthesis of DNA microarray on functionalized cyclic olefin copolymer substrate ACS Applied Materials & Interfaces, 2(2):491-497, 2010. |
| Saboulard et al.: High-throughput site-directed mutagenesis using oligonucleotides synthesized on DNA chips. Biotechniques. Sep. 2005;39(3):363-8. |
| Sacconi et al.: Three-dimensional magneto-optic trap for micro-object manipulation, Optics Letters, vol. 26, No. 17, 1359-1361 (Sep. 1, 2001). |
| Saiki et al.: Analysis of enzymatically amplified beta-globin and HLA-DQ alpha DNA with allele-specific oligonucleotide probes. Nature 324:163-166 (1986). |
| Sandhu et al.: Dual asymmetric PCR: one-step construction of synthetic genes. Biotechniques. Jan. 1992;12(1):14-6. |
| Sargolzaei et al.: Extent of linkage disequilibrium in Holstein cattle in North America. J.Dairy Science, 91:2106-2117, 2007. |
| Schaller et al.: Studies on Polynucleotides. XXV.1 The Stepwise Synthesis of Specific Deoxyribopolynucleotides (5). Further Studies on the Synthesis of Internucleotide Bond by the Carbodiimide Method. The Synthesis of Suitably Protected Dinucleotides as Intermediates in the Synthesis of Higher Oligonucleotides. J. Am. Chem. Soc. 1963; 85(23):3828-3835. |
| Schmalzing et al.: Microchip electrophoresis: a method for high-speed SNP detection. Nucleic Acids Res 28(9):E43 (2000). |
| Schmitt et al.: New strategies in engineering T-cell receptor gene-modified T cells to more effectively target malignancies. Clinical Cancer Research, 21(23):5191-5197, 2015. |
| Seelig et al.: Enzyme-Free Nucleic Acid Logic Circuits, Science 314(5805):1585-1588, 2006. |
| Sharan et al.: Recombineering: a homologous recombination-based method of genetic engineering. Nat Profile 4(2):1-37 (originally pp. 206-223) (2009). |
| Sharpe and Mount. Genetically modified T cells in cancer therapy: opportunities and challenges. Disease Models and Mechanisms, 8:337-350, 2015. |
| Sierzchala, Agnieszka B et al.: Solid-phase oligodeoxynucleotide synthesis : a two-step cycle using peroxy anion deprotection, J. Am. Chem. Soc., vol. 125, No. 44, 13427-13441 (2003). |
| Simonyan and Zisserman. Very Deep Convolutional Networks for Large-Scale Image Recognition, Published as a conference paper at Int. Conf. Learn. Represent., pp. 1-14, 2015. |
| Singh-Gasson. Sangeet et al.: Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array, Nature Biotechnology, vol. 17, 974-978 (Oct. 1999). |
| Skerra. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. Nucleic Acids Res. Jul. 25, 1992; 20(14):3551-4. |
| Smith et al.: Removal of Polymerase-Produced mutant sequences from PCR products, Proc. Natl. Acad. Sci. USA, vol. 94, 6847-6850 (Jun. 1997). |
| Smith et al.: Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc Natl Acad Sci U S A. Dec. 23, 2003;100(26):15440-5. Epub Dec. 2, 2003. |
| Smith et al.: Generation of cohesive ends on PCR products by UDG-mediated excision of dU, and application for cloning into restriction digest-linearized vectors. PCR Methods Appl. May 1993;2(4):328-32. |
| Smith et al.: Mutation detection with MutH, MutL, and MutS mismatch repair proteins, Proc. Natl. Acad. Sci. USA, vol. 93, 4374-4379 (Apr. 1996). |
| Smith et al.: Direct mechanical measurements of the elasticity of single DNA molecules using magnetic beads, Science, vol. 258, 1122-1126 (Nov. 13, 1992). |
| Solomon et al.: Genomics at Agilent: Driving Value in DNA Sequencing.https://www.agilent.com/labs/features/2010_genomics.html, 8 pages (Aug. 5, 2010). |
| Soni et al.: Progress toward ultrafast DNA sequencing using solid-state nanopores. Clin Chem. Nov. 2007;53(11):1996-2001. Epub Sep. 21, 2007. |
| Southern et al.: Analyzing and comparing nucleic acid sequences by hybridization to arrays of oligonucleotides: evaluation using experimental models. Genomics. Aug. 1992;13(4):1008-17. |
| Sproat et al.: An efficient method for the isolation and purification of oligoribonucleotides. Nucleosides & Nucleotides. 1995; 14(1&2):255-273. |
| Srivannavit et al.: Design and fabrication of microwell array chips for a solution-based, photogenerated acid-catalyzed parallel oligonuclotide DNA synthesis. Sensors and Actuators A, 116:150-160, 2004. |
| Srivastava et al.: RNA synthesis: phosphoramidites for RNA synthesis in the reverse direction. Highly efficient synthesis and application to convenient introduction of ligands, chromophores and modifications of synthetic RNA at the 3′-end, Nucleic Acids Symposium Series, 52(1):103-104, 2008. |
| Steel. The Flow-Thru Chip A Three-dimensional biochip platform. In: Schena, Microarray Biochip Technology, Chapter 5, Natick, MA: Eaton Publishing, 2000, 33 pages. |
| Stemmer et al.: Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene. Oct. 16, 1995;164(1):49-53. |
| Stryer. DNA Probes and genes can be synthesized by automated solid-phase methods. Biochemistry, 3rd edition, New York: W.H. Freeman and Company, 1988; 123-125. |
| Stutz et al.: Novel fluoride-labile nucleobase-protecting groups for the synthesis of 3′(2′)-O-amino-acylated RNA sequences. Helv. Chim. Acta. 2000; 83(9):2477-2503. |
| Sullivan et al.: Library construction and evaluation for site saturation mutagenesis. Enzyme Microb. Technol. 53:70-77 (2013). |
| Sun et al.: Structure-Guided Triple-Code Saturation Mutagenesis: Efficient Tuning of the Stereoselectivity of an Epoxide Hydrolase. ACS Catal. 6:1590-1597 (2016). |
| Takahashi. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers. Biotechniques. Jul. 2009;47(1):609-15. doi: 10.2144/000113155. |
| Tanase et al.: Magnetic trapping of multicomponent nanowires, The Johns Hopkins University, Baltimore, Maryland, p. 1-3 (Jun. 25, 2001). |
| Taylor et al.: Impact of surface chemistry and blocking strategies on DNA microarrays. Nucleic Acids Research, 31(16):e87, 19 pages, 2003. |
| The Hood Laboratory, Beta Group. Assembly Manual for the POSaM: The ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer, Inkjet Microarrayer Manual Version 1.2, 50 pages, May 28, 2004. |
| The SLIC. Gibson, OPEC and SLiCE assembly methods (and GeneArt Seamless, In-Fusion Cloning). 5 pages, available online Sep. 2, 2010. |
| Tian et al.: Accurate multiplex gene synthesis from programmable DNA microchips. Nature. Dec. 23, 2004;432(7020):1050-4. |
| Tsai et al.: Dimeric CRISPR RNA-guided Fokl nucleases for highly specific genome editing Nat. Biotechnol., 32(6):569-576, 2014. |
| Twist Bioscience | White Paper. DNA-Based Digital Storage. Retrieved from the internet, Twistbioscience.com, Mar. 27, 2018, 5 pages. |
| U.S. Appl. No. 14/241,874 Final Office Action dated Jan. 28, 2019. |
| U.S. Appl. No. 14/241,874 Office Action dated Feb. 27, 2017. |
| U.S. Appl. No. 14/241,874 Office Action dated Jul. 14, 2016. |
| U.S. Appl. No. 14/241,874 Office Action dated May 4, 2018. |
| U.S. Appl. No. 14/452,429 Notice of Allowance dated Jun. 7, 2016. |
| U.S. Appl. No. 14/452,429 Office Action dated Oct. 21, 2015. |
| U.S. Appl. No. 14/452,429 Restriction Requirement dated Dec. 12, 2014. |
| U.S. Appl. No. 14/885,962 Notice of Allowance dated Nov. 8, 2017 and Sep. 29, 2017. |
| U.S. Appl. No. 14/885,962 Office Action dated Dec. 16, 2016. |
| U.S. Appl. No. 14/885,962 Office Action dated Sep. 8, 2016. |
| U.S. Appl. No. 14/885,962 Restriction Requirement dated Mar. 1, 2016. |
| U.S. Appl. No. 14/885,963 Notice of Allowance dated May 24, 2016. |
| U.S. Appl. No. 14/885,963 Office Action dated Feb. 5, 2016. |
| U.S. Appl. No. 14/885,965 Office Action dated Aug. 28, 2018. |
| U.S. Appl. No. 14/885,965 Office Action dated Aug. 30, 2017. |
| U.S. Appl. No. 14/885,965 Office Action dated Feb. 10, 2017. |
| U.S. Appl. No. 14/885,965 Office Action dated Feb. 18, 2016. |
| U.S. Appl. No. 14/885,965 Office Action dated Jan. 4, 2018. |
| U.S. Appl. No. 14/885,965 Office Action dated Jul. 7, 2016. |
| U.S. Appl. No. 15/015,059 Final Office Action dated Jul. 17, 2019. |
| U.S. Appl. No. 15/015,059 Office Action dated Aug. 19, 2019. |
| U.S. Appl. No. 15/015,059 Office Action dated Feb. 7, 2019. |
| U.S. Appl. No. 15/135,434 Notice of Allowance dated Feb. 9, 2018. |
| U.S. Appl. No. 15/135,434 Office Action dated Nov. 30, 2017. |
| U.S. Appl. No. 15/135,434 Restriction Requirement dated Jul. 12, 2017. |
| U.S. Appl. No. 15/151,316 Office Action dated Jun. 7, 2018. |
| U.S. Appl. No. 15/151,316 Office Action dated Oct. 4, 2019. |
| U.S. Appl. No. 15/151,316 Final Office Action dated Feb. 21, 2019. |
| U.S. Appl. No. 15/154,879 Notice of Allowance dated Feb. 1, 2017. |
| U.S. Appl. No. 15/156,134 Final Office Action dated Jan. 3, 2020. |
| U.S. Appl. No. 15/156,134 Office Action dated Apr. 4, 2019. |
| U.S. Appl. No. 15/187,714 Final Office Action dated Sep. 17, 2019. |
| U.S. Appl. No. 15/187,714 Office Action dated Apr. 4, 2019. |
| U.S. Appl. No. 15/187,714 Restriction Requirement dated Sep. 17, 2018. |
| U.S. Appl. No. 15/187,721 Notice of Allowance dated Dec. 7, 2016. |
| U.S. Appl. No. 15/187,721 Office Action dated Oct. 14, 2016. |
| U.S. Appl. No. 15/233,835 Notice of Allowance dated Oct. 4, 2017. |
| U.S. Appl. No. 15/233,835 Office Action dated Feb. 8, 2017. |
| U.S. Appl. No. 15/233,835 Office Action dated Jul. 26, 2017. |
| U.S. Appl. No. 15/233,835 Restriction Requirement dated Nov. 4, 2016. |
| U.S. Appl. No. 15/245,054 Office Action dated Mar. 21, 2017. |
| U.S. Appl. No. 15/245,054 Office Action dated Oct. 19, 2016. |
| U.S. Appl. No. 15/268,422 Final Office Action dated Oct. 3, 2019. |
| U.S. Appl. No. 15/268,422 Office Action dated Mar. 1, 2019. |
| U.S. Appl. No. 15/268,422 Restriction Requirement dated Oct. 4, 2018. |
| U.S. Appl. No. 15/272,004 Office Action dated Jun. 12, 2020. |
| U.S. Appl. No. 15/377,547 Final Office Action dated Feb. 8, 2019. |
| U.S. Appl. No. 15/377,547 Office Action dated Jul. 27, 2018. |
| U.S. Appl. No. 15/377,547 Office Action dated Mar. 24, 2017. |
| U.S. Appl. No. 15/377,547 Office Action dated Nov. 30, 2017. |
| U.S. Appl. No. 15/433,909 Non-Final Office Action dated Feb. 8, 2019. |
| U.S. Appl. No. 15/433,909 Restriction Requirement dated Sep. 17, 2018. |
| U.S. Appl. No. 15/602,991 Final Office Action dated Dec. 13, 2018. |
| U.S. Appl. No. 15/602,991 Notice of Allowance dated Oct. 25, 2017. |
| U.S. Appl. No. 15/602,991 Office Action dated May 31, 2018. |
| U.S. Appl. No. 15/602,991 Office Action dated May 31, 2019. |
| U.S. Appl. No. 15/602,991 Office Action dated Sep. 21, 2017. |
| U.S. Appl. No. 15/603,013 Final Office Action dated Nov. 6, 2019. |
| U.S. Appl. No. 15/603,013 Office Action dated Jan. 30, 2018. |
| U.S. Appl. No. 15/603,013 Office Action dated Jul. 10, 2018. |
| U.S. Appl. No. 15/603,013 Office Action dated Oct. 20, 2017. |
| U.S. Appl. No. 15/619,322 Final Office Action dated Mar. 30, 2020. |
| U.S. Appl. No. 15/619,322 Office Action dated Aug. 14, 2019. |
| U.S. Appl. No. 15/682,100 Office Action dated Jan. 2, 2018. |
| U.S. Appl. No. 15/682,100 Restriction Requirement dated Nov. 8, 2017. |
| U.S. Appl. No. 15/709,274 Notice of Allowance dated Apr. 3, 2019. |
| U.S. Appl. No. 15/729,564 Final Office Action dated Dec. 13, 2018. |
| U.S. Appl. No. 15/729,564 Office Action dated Jan. 8, 2018. |
| U.S. Appl. No. 15/729,564 Office Action dated Jun. 6, 2018. |
| U.S. Appl. No. 15/729,564 Office Action dated May 30, 2019. |
| U.S. Appl. No. 15/816,995 Office Action dated May 19, 2020. |
| U.S. Appl. No. 15/816,995 Office Action dated Sep. 20, 2019. |
| U.S. Appl. No. 15/816,995 Restriction Requirement dated Apr. 4, 2019. |
| U.S. Appl. No. 15/835,342 Office Action dated Dec. 2, 2019. |
| U.S. Appl. No. 15/835,342 Restriction Requirement dated Sep. 10, 2019. |
| U.S. Appl. No. 15/844,395 Office Action dated Jan. 24, 2020. |
| U.S. Appl. No. 15/844,395 Restriction Requirement dated May 17, 2019. |
| U.S. Appl. No. 15/860,445 Final Office Action dated Dec. 13, 2018. |
| U.S. Appl. No. 15/860,445 Office Action dated May 30, 2018. |
| U.S. Appl. No. 15/921,479 Final Office Action dated Jun. 15, 2020. |
| U.S. Appl. No. 15/921,479 Office Action dated Nov. 12, 2019. |
| U.S. Appl. No. 15/921,479 Restriction Requirement dated May 24, 2019. |
| U.S. Appl. No. 15/921,537 Office Action dated Apr. 1, 2020. |
| U.S. Appl. No. 15/960,319 Office Action dated Aug. 16, 2019. |
| U.S. Appl. No. 15/991,992 Office Action dated May 21, 2020. |
| U.S. Appl. No. 15/991,992 Restriction Requirement dated Mar. 10, 2020. |
| U.S. Appl. No. 16/006,581 Office Action dated Sep. 25, 2019. |
| U.S. Appl. No. 16/031,784 Office Action dated May 12, 2020. |
| U.S. Appl. No. 16/039,256 Restriction Requirement dated May 18, 2020. |
| U.S. Appl. No. 16/128,372 Restriction Requirement dated May 18, 2020. |
| U.S. Appl. No. 16/165,952 Office Action dated Mar. 12, 2020. |
| U.S. Appl. No. 16/239,453 Office Action dated May 11, 2020. |
| U.S. Appl. No. 16/239,453 Office Action dated Nov. 7, 2019. |
| U.S. Appl. No. 16/384,678 Office Action dated Jan. 21, 2020. |
| U.S. Appl. No. 16/409,608 Office Action dated Sep. 9, 2019. |
| U.S. Appl. No. 16/530,717 Final Office Action dated Apr. 15, 2020. |
| U.S. Appl. No. 16/530,717 Office Action dated Sep. 6, 2019. |
| U.S. Appl. No. 16/535,777 Office Action dated Jan. 23, 2020. |
| U.S. Appl. No. 16/535,779 First Action Interview dated Feb. 10, 2020. |
| U.S. Appl. No. 14/452,429 Office Action dated Apr. 9, 2015. |
| U.S. Appl. No. 15/603,013 Office Action dated Jun. 26, 2019. |
| Unger et al.: Monolithic microfabricated valves and pumps by multilayer soft lithography. Science. Apr. 7, 2000;288(5463):113-6. |
| Vaijayanthi et al.: Recent advances in oligonucleotide synthesis and their applications. Indian J Biochem Biophys. Dec. 2003;40(6):377-91. |
| Van Den Brulle et al.: A novel solid phase technology for high-throughput gene synthesis. Biotechniques. 2008; 45(3):340-343. |
| Van Der Werf et al.: Limonene-1,2-epoxide hydrolase from Rhodococcus erythropolis DCL14 belongs to a novel class of epoxide hydrolases. J. Bacteriol. 180:5052-5057 (1998). |
| Van Tassell et al.: SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries. Nature Methods, 5:247-252, 2008. |
| Vargeese et al.: Efficient activation of nucleoside phosphoramidites with 4,5-dicyanoimidazole during oligonucleotide synthesis. Nucleic Acids Res. Feb. 15, 1998;26(4):1046-50. |
| Verma et al.: Modified oligonucleotides: synthesis and strategy for users. Annu Rev Biochem 67:99-134 (1998). |
| Vincent et al.: Helicase-dependent isothermal DNA amplification. EMBO Rep. Aug. 2004;5(8):795-800. |
| Visscher et al.: Construction of multiple-beam optical traps with nanometer-resolution position sensing, IEEE Journal of Selected Topics in Quantum Electronics, vol. 2, No. 4, 1066-1076 (Dec. 1996). |
| Voldmans et al.: Holding forces of single-particle dielectrophoretic traps. Biophysical Journal, vol. 80, No. 1, 531-541 (Jan. 2001). |
| Vos et al.: AFLP:A new technique for DNA fingerprinting. Nucleic Acids Res. Nov. 11, 1995;23(21):4407-14. |
| Wagner et al.: Nucleotides, Part LXV, Synthesis of 2′-Deoxyribonucleoside 5′-Phosphoramidites: New Building Blocks for the Inverse (5′-3′)-Oligonucleotide Approach. Helvetica Chimica Acta, 83(8):2023-2035, 2000. |
| Wah et al.: Structure of Fok I has implications for DNA cleavage, Proc. Natl. Acad. Sci. USA, vol. 95, 10564-10569 (Sep. 1998). |
| Wah et al.: Structure of the multimodular endonuclease Fok I bound to DNA, Nature, vol. 388, 97-100 (Jul. 1997). |
| Walker et al.: Strand displacement amplification—an isothermal, in vitro DNA amplification technique. Nucleic Acids Res. Apr. 11, 1992;20(7):1691-6. |
| Wan et al.: Deep Learning for Content-Based Image Retrieval: A comprehensive study, in Proceedings of the 22nd ACM International Conference on Multimedia—Nov. 3-7, 2014, Orlando, FL, p. 157-166, 2014. |
| Warr et al.: Exome Sequencing: current and future perspectives. G3: (Bethesda) 5(8):1543-1550 (2015). |
| Weber et al.: A modular cloning system for standardized assembly of multigene constructs. PLoS One. Feb. 1, 20118;6(2):e16765. doi: 10.1371/journal.pone.0016765. |
| Welz et al.: 5-(Benzylmercapto)-1H-tetrazole as activator for 2′-O-TBDMS phosphoramidite building blocks in RNA synthesis. Tetrahedron Lett. 2002; 43(5):795-797. |
| Westin et al.: Anchored multiplex amplification on a microelectronic chip array Nature Biotechnology, 18:199-202 (2000) (abstract only). |
| Whitehouse et al.: Analysis of the mismatch and insertion/deletion binding properties of Thermus thermophilus, HB8, MutS, Biochemical and Biophysical Research Communications, vol. 233, 834-837 (1997). |
| Wiedenheft et al.: RNA-guided genetic silencing systems in bacteria and archaea. Nature 482:331-338 (2012). |
| Wijshoff. Structure and fluid-dynamics in Piezo inkjet printheads. Thesis. Venio, The Netherlands, published 2008, p. 1-185. |
| Wirtz. Direct measurement of the transport properties of a single DNA molecule, Physical Review Letters, vol. 75, No. 12, 2436-2439 (Sep. 18, 1995). |
| Withers-Martinez et al.: PCR-based gene synthesis as an efficient approach for expression of the A+ T-rich malaria genome, Protein Engineering, vol. 12, No. 12, 1113-1120 (1999). |
| Wood et al.: Human DNA repair genes, Science, vol. 291, 1284-1289 (Feb. 16, 2001). |
| Wosnick et al.: Rapid construction of large synthetic genes: total chemical synthesis of two different versions of the bovine prochymosin gene. Gene. 1987;60(1):115-27. |
| Wright and Church. An open-source oligomicroarray standard for human and mouse. Nature Biotechnology, 20:1082-1083, 2002. |
| Wu et al.: RNA-mediated gene assembly from DNA arrays. Angew Chem Int Ed Engl. May 7, 2012;51(19):4628-32. doi: 10.1002/anie.201109058. |
| Wu et al.: Sequence-Specific Capture of Protein-DNA Complexes for Mass Spectrometric Protein Identification PLoS ONE. Oct. 20, 2011, vol. 6, No. 10. |
| Wu et al.: Specificity of the nick-closing activity of bacteriophage T4 DNA ligase. Gene. 1989;76(2):245-54. |
| Wu et al.: An improvement of the on-line electrophoretic concentration method for capillary electrophoresis of proteins an experimental factors affecting he concentration effect, Analytical Sciences, vol. 16, 329-331 (Mar. 2000). |
| Xiong et al.: Chemical gene synthesis: Strategies, softwares, error corrections, and applications. FEMS Microbiol. Rev., 32:522-540, 2008. |
| Xiong et al.: A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences. Nucleic Acids Res. 2004, 32(12):e98. |
| Xiong et al.: Non-polymerase-cycling-assembly-based chemical gene synthesis: Strategies, methods, and progress. Biotechnology Advances. 26(2):121-134, 2008. |
| Xu et al.: Design of 240,000 orthogonal 25mer DNA barcode probes. PNAS, 106(7):2289-2294, 2009. |
| Yang et al.: Purification, cloning, and characterization of the CEL I nuclease, Biochemistry, 39(13):3533-35, 2000. |
| Yazdi et al.: A Rewritable, Random-Access DNA-Based Storage System, Scientific Reports, 5, Article No. 14138, 27 pages, 2015. |
| Yehezkel et al.: De novo DNA synthesis using single molecule PCR Nucleic Acids Research, 36(17):e107, 2008. |
| Yes HMDS vapor prime process application note Prepared by UC Berkeley and University of Texas at Dallas and re-printed by Yield Engineering Systems, Inc., 6 pages (http://www.yieldengineering.com/Portals/0/HMDS%20Application%20Note.pdf (Published online Aug. 23, 2013). |
| Youil et al.: Detection of 81 of 81 known mouse Beta-Globin promoter mutations with T4 Endonuclease VII—The EMC Method. Genomics, 32:431-435, 1996. |
| Young et al.: Two-step total gene synthesis method. Nucleic Acids Res. 32(7):e59, 2004. |
| Zhang and Seelig. Dynamic DNA nanotechnology using strand-displacement reactions, Nat. Chem., 3(2):103-113, 2011. |
| Zheleznaya et al.: Nicking endonucleases. Biochemistry (Mose). 74(13):1457-66, 2009. |
| Zheng et al.: Manipulating the Stereoselectivity of Limonene Epoxide Hydrolase by Directed Evolution Based on Iterative Saturation Mutagenesis. J. Am. Chem. Soc. 132:15744-15751 (2010). |
| Zhirnov et al.: Nucleic acid memory. Nature Materials, 15:366, 2016. |
| Zhou et al.: Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences Nucleic Acids Research, 32(18):5409-5417, 2004. |
| Zhou et al.: Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane Scientific Reports May 9, 2014, vol. 4, No. 4912. |
| Chervin et al.: Design of T-cell receptor libraries with diverse binding properties to examine adoptive T-cell responses. Gene Therapy. 20(6):634-644 (2012). |
| European Patent Application No. 17881617.9 European Search Report and Written Opinion dated Jul. 2, 2020. |
| Malecek et al.: Engineering improved T cell receptors using an alanine-scan guided T cell display selection system. Journal of Immunological Methods. Elsevier Science Publishers. 392(1):1-11 (2013). |
| PCT/US2019/012218 International Preliminary Report on Patentability dated Jul. 16, 2020. |
| U.S. Appl. No. 15/151,316 Final Office Action dated Jul. 9, 2020. |
| Bai. A Novel Human scFv Library with Non-Combinatorial Synthetic CDR Diversity. PLoS One. 10(10):1-18 (2015). |
| Berg: Biochemistry. 5th ED. New York (2002) 148-149. |
| Borda et al.: Secret writing by DNA hybridization. Acta Technica Napocensis Electronics and Telecommunications. 50(2):21-24 (2008). |
| Cui et al.: Information Security Technology Based on DNA Computing. International Workshop on Anti-Counterfeiting, Security and Identification (ASID); IEEE Xplore 4 pages (2007). |
| Fernández-Quintero et al.: Characterizing the Diversity of the CDR-H3 Loop Conformational Ensembles in Relationship to Antibody Binding Properties. Front. Immunol. 9:1-11 (2019). |
| GE Healthcare. AKTA oligopilot plus. Data File 18-114-66 AD©. 8 pages (2006). |
| GE Healthcare. Robust and cost-efficient oligonucleotide synthesis. Application Note 28-4058-08 AA. 4 pages (2005). |
| Geetha et al.: Survey on Security Mechanisms for Public Cloud Data. 2016 International Conference on Emerging Trends in Engineering, Technology and Science (ICETETS). 8 pages (2016). |
| Goodwin et al.: immunoglobulin heavy chain variable region, partial [Homo sapiens], Genbank entry (online). National Institute of Biotechnology Information. (2018) https://www.ncbi.nim.nih.gov/protein/AXA12486.1. |
| Hopcroft et al.: What is the Young's Modulus of Silicon?. Journal of Microelectromechanical Systems. 19(2):229-238 (2010). |
| Hudson: Matrix Assisted Synthetic Transformations: A Mosaic of Diverse Contributions. Journal of Combinatorial Chemistry. 1(6):403-457 (1999). |
| Jaiswal et al.: An architecture for creating collaborative semantically capable scientific data sharing infrastructures. Proceeding WIDM '06 Proceedings of the 8th annual ACM international workshop on Web information and data management. ACM Digital Library pp. 75-82 (2006). |
| Jang et al.: Characterization of T cell repertoire of blood, tumor, and ascites in ovarian cancer patients using next generation sequencing. Oncoimmunology, 4(11):e1030561:1-10 (2015). |
| Kalva et al.: Gibson Deletion: a novel application of isothermal in vitro recombination. Biological Procedures Online. 20(1):1-10 (2018). |
| Kosuri, et al. A scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 2010; 28:1295-1299. |
| Lebl et al.: Economical Parallel Oligonucleotide and Peptide Synthesizer—Pet Oligator. Int. J. Peptide Res. Ther. 13(1-2):367-376 (2007). |
| MLAB 2321 Molecular Diagnostics for Clinical Laboratory Science. Mar. 6, 2015. |
| Momentiv. Technical Data Sheet. Silquest A-1100. Momentiv. 1-6 (2020). |
| (Novartis Institutes for Biomedical Research) Immunoglobulin Heavy Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1ttps://https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1. |
| (Novartis Institutes for Biomedical Research) Immunoglobulin Lambda Chain [Homo sapiens]. National Center for Biotechnology Information. Genbank Entry, pp. 1-2 (2018) https://www.ncbi.nlm.nih.gov/nuccore/MH975524.1. |
| Nucleic acid thermodynamics. Wikipedia. Feb. 4, 2021. |
| O'Driscoll et al.: Synthetic DNA: The next generation of big data storage. Bioengineered. 4(3):123-125 (2013). |
| Opposition to European Patent No. 3030682 filed Mar. 3, 2021. |
| PCT/US2019/032992 International Preliminary Report on Patentability dated Nov. 24, 2020. |
| PCT/US2019/068435 International Preliminary Report on Patentability dated Jul. 8, 2021. |
| PCT/US2020/019371 International Search Report and Written Opinion dated Jun. 25, 2020. |
| PCT/US2020/019986 International Search Report and Written Opinion dated Jul. 29, 2020. |
| PCT/US2020/019988 International Search Report and Written Opinion dated Jul. 29, 2020. |
| PCT/US2020/038679 International Search Report and Written Opinion dated Oct. 28, 2020. |
| PCT/US2020/052291 International Search Report and Written Opinion dated Mar. 10, 2021. |
| PCT/US2020/052291 Invitation to Pay Additional Fees dated Dec. 31, 2020. |
| PCT/US2020/052306 International Search Report and Written Opinion dated Mar. 2, 2021. |
| PCT/US2020/052306 Invitation to Pay Additional Fees dated Dec. 18, 2020. |
| PCT/US2020/064106 International Search Report and Written Opinion dated Jun. 3, 2021. |
| PCT/US2020/064106 Invitation to Pay Additional Fees dated Apr. 9, 2021. |
| Pigott et al.: The Use of a Novel Discovery Platform to Identify Peptide-Grafted Antibodies that Activate GLP-1 Receptor Signaling. Innovative Targeting Solutions Inc. (2013) XP055327428 retrieved from the internet: http://www.innovativetargeting.com/wo-content/uploads/2013/12/Pigott-et-al-Antibody-Engineering-2013.pdf. |
| Ponsel. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation. Molecules. 16:3675-3700 (2011). |
| PubChem Data Sheet Dichloromethane. Printed from website https://pubchem.ncbi.nlm.nih.gov/compound/Dichloromethane (2020). |
| Regep et al.: The H3 loop of antibodies shows unique structural characteristics. Proteins. 85(7):1311-1318 (2017). |
| Shipman et al.: Molecular recordings by directed CRISPR spacer acquisition. Science. 353(6298):1-16 (2016). |
| U.S. Appl. No. 15/156,134 Final Office Action dated Aug. 18, 2021. |
| U.S. Appl. No. 15/156,134 Office Action dated Nov. 25, 2020. |
| U.S. Appl. No. 15/245,054 Notice of Allowance dated Dec. 14, 2017. |
| U.S. Appl. No. 15/272,004 Final Office Action dated Mar. 18, 2021. |
| U.S. Appl. No. 15/619,322 Final Office Action dated Jul. 9, 2021. |
| U.S. Appl. No. 15/619,322 Office Action dated Nov. 4, 2020. |
| U.S. Appl. No. 15/835,342 Final Office Action dated Sep. 8, 2020. |
| U.S. Appl. No. 15/835,342 Office Action dated Apr. 16, 2021. |
| U.S. Appl. No. 15/902,855 Restriction Requirement dated Apr. 6, 2021. |
| U.S. Appl. No. 15/921,479 Office Action dated Apr. 27, 2021. |
| U.S. Appl. No. 16/039,256 Final Office Action dated Mar. 30, 2021. |
| U.S. Appl. No. 16/039,256 Office Action dated Aug. 20, 2020. |
| U.S. Appl. No. 16/128,372 Final Office Action dated Mar. 18, 2021. |
| U.S. Appl. No. 16/128,372 Office Action dated Oct. 8, 2020. |
| U.S. Appl. No. 16/384,678 Final Office Action dated Oct. 15, 2020. |
| U.S. Appl. No. 16/535,777 Final Office Action dated Oct. 20, 2020. |
| U.S. Appl. No. 16/535,777 Office Action dated Feb. 8, 2021. |
| U.S. Appl. No. 16/712,678 Restriction Requirement dated Aug. 25, 2021. |
| U.S. Appl. No. 16/798,275 Office Action dated Feb. 10, 2021. |
| U.S. Appl. No. 16/854,719 Restriction Requirement dated Jul. 28, 2021. |
| U.S. Appl. No. 16/906,555 Office Action dated Aug. 17, 2021. |
| U.S. Appl. No. 17/154,906 Restriction Requirement dated Jul. 26, 2021. |
| Van der Velde: Thesis. Finding the Strength of Glass. Delft University of Technology. 1-16 (2015). |
| Xu et al.: Coordination between the Polymerase and 5 ′-Nuclease Components of DNA Polymerase I of Escherichia coli. The Journal of Biological Chemistry. 275(27):20949-20955 (2000). |
| Yazdi et al.: DNA-Based Storage: Trends and Methods. IEEE Transactions on Molecular, Biological and Multi-Scale Communications. IEEE. 1(3):230-248 (2016). |
| De Graff et al.: Glucagon-Like Peptide-1 and its Class B G Protein-Coupled Receptors: A Long March to Therapeutic Successes. Pharmacol Rev. 68(4):954-1013 (2016). |
| PCT/US2020/019371 International Preliminary Report on Patentability dated Sep. 2, 2021. |
| PCT/US2020/019986 International Preliminary Report on Patentability dated Sep. 10, 2021. |
| PCT/US2020/019988 International Preliminary Report on Patentability dated Sep. 10, 2021. |
| U.S. Appl. No. 17/154,906 Office Action dated Nov. 10, 2021. |
| U.S. Appl. No. 16/712,678 Office Action dated Nov. 26, 2021. |
| U.S. Appl. No. 16/737,401 Restriction Requirement dated Nov. 15, 2021. |
| U.S. Appl. No. 16/802,439 Restriction Requirement dated Oct. 1, 2021. |
| U.S. Appl. No. 16/854,719 Office Action dated Nov. 24, 2021. |
| U.S. Appl. No. 16/798,275 Final Office Action dated Aug. 30, 2021. |
| Number | Date | Country | |
|---|---|---|---|
| 20200283760 A1 | Sep 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62663089 | Apr 2018 | US | |
| 62518496 | Jun 2017 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 16006581 | Jun 2018 | US |
| Child | 16879705 | US |
