The invention relates to a method of increasing seed yield in a plant, the method comprising increasing the permease activity of an amino acid permease (AAP). The invention also relates to a method of making such plants as well as plants that display an increase in seed yield.
Seed size and weight are associated with seed yield, thereby determining seed production in crops. Seed size is also recognized as a critical factor for evolutionary adaption. Seedlings from large seeds have been proposed to possess stronger ability to survive under stress conditions, while plant species with small seeds have been suggested to have a better ability to propagate progeny. A mature seed contains the maternal integuments, the endosperm and the embryo. The complex interactions between the maternal tissues, the endosperm and the embryo regulate seed growth and determine seed size and weight in plants.
The analysis of seed mutants has identified several important regulators of seed size in Arabidopsis. Several of these regulators have been reported to regulate seed size by influencing cell proliferation in maternal tissues, such as KLU/CYTOCHROME P450 78A5 (CYP78A5), ubiquitin-dependent protease DA1, E3 ubiquitin ligases BIG BROTHER (BB) and DA2, transcription factors AUXIN RESPONSE FACTOR 2 (ARF2) and NGAL2, and UBIQUITIN SPECIFIC PROTEASE 15 (UBP15). By contrast, transcription factors TESTA GLABRA 2 (TTG2) and APETALA2 (AP2) may act maternally to regulate seed size by influencing cell expansion. The development of zygotic tissues also affects seed growth. MINISEED3 (MINI3) and HAIKU (IKU) regulate endosperm cellularization, thereby influencing seed size. SHORT HYPOCOTYL UNDER BLUE1 (SHB1) can bind to the promoters of IKU2 and MINI3 and promotes their expression.
Seed size is often controlled by quantitative trait loci (QTLs) (Alonso-Blanco et al., 1999; Song et al., 2007). In Arabidopsis, several quantitative trait loci (QTLs) for seed size have been mapped, but the genes corresponding to these QTLs have not been cloned so far. Seed quality, and in particular, free amino acid and protein content is an important contributor to seed yield. Increasing grain protein levels has significant value when growing grain crops for animal feed or for use in human consumption (such as bread-making or brewing) However, developing high quality seeds is precluded by the inverse relationship between seed quality (in particular protein content) and size.
The present invention addresses the need to enhance seed size and improve seed quality of commercially value crops, such as wheat, rice and maize, for example.
Here we report a major QTL gene for seed size and weight on chromosome 1 (SSW1) in Arabidopsis, which encodes an amino acid permease (AAP), specifically AtAAP8. Amino acids are an important source of organic nitrogen in most plant species, and the delivery of nitrogen to sinks is crucial for seed development.
Our findings identify the first gene corresponding to the QTL for seed size, weight and quality (SSW1/AAP8) in Arabidopsis and demonstrate that natural allelic variation in SSW1/AAP8 contributes to the amino acid transport activity of SSW1/AAP8, thereby regulating seed size, weight and quality. In particular, Arabidopsis accessions possess three types of natural allelic variation in the SSW1/AAP8 gene, including SSW1Cvi, SSW1Ler and SSW1Col-0 types. The SSW1Cvi allele produces larger and heavier seeds with more free amino acids and storage proteins than the SSW1Ler allele. SSW1Cvi has similar amino acid transport activity to SSW1Col-0 and possesses higher amino acid transport activity than SSW1Ler. We have further found that natural variation in the amino acid (A410V) is predominantly responsible for the observed differences in the amino acid transport activity of the SSW1 types. We have also found that loss of function of SSW1/AAP8 causes small and light seeds.
Our results reveal that AAP8 is an important molecular and genetic basis for natural variation in seed size, weight and quality control, and show that this gene is an important target to improve both seed weight and quality in plants.
Accordingly, in a first aspect of the invention, there is provided a method of increasing seed yield in a plant, the method comprising increasing the activity of amino acid permease (AAP). Preferably, an increase in seed yield comprises an increase in seed size and/or seed quality, preferably an increase in seed size and quality.
In one embodiment, the method comprises increasing the expression of AAP8, wherein the amino acid sequence of AAP8 comprises a sequence as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homologue thereof. Most preferably, the amino acid sequence of AAP8 comprises SEQ ID NO: 4 or a functional variant or homologue thereof.
In one embodiment, the method comprises introducing and expressing a nucleic acid construct, wherein the construct comprises a nucleic sequence encoding an AAP8 polypeptide as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homologue thereof. Preferably, the nucleic acid sequence is operably linked to a regulatory sequence. More preferably, the regulatory sequence is a constitutive or tissue-specific promoter, such as the MUM4 promoter.
In an alternative embodiment, the method comprises introducing at least one mutation into the plant genome, wherein said mutation increases the activity of an AAP polypeptide. Preferably, the mutation is introduced using targeted genome editing. More preferably, the targeted genome editing is CRISPR.
In one embodiment, the mutation is the insertion of at least one additional copy of a nucleic acid sequence encoding an AAP8 polypeptide or a homolog or functional variant thereof, such that the nucleic acid sequence is operably linked to a regulatory sequence, and wherein the mutation is introduced using targeted genome editing and wherein preferably the nucleic acid sequence encodes an AAP polypeptide as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homolog thereof.
In an alternative embodiment, the method comprises or results in introducing at least one mutation at position 410 of SEQ ID NO: 1 or at a homologous position in a homologous sequence. Preferably, the mutation is a substitution.
In another aspect of the invention, there is provided a genetically altered plant, part thereof or plant product, wherein the plant is characterised by an increase in seed yield.
Preferably, the genetically altered plant, part thereof or plant product has increased activity of an AAP polypeptide.
In one embodiment, the plant expresses a nucleic acid construct comprising a nucleic acid encoding an AAP8 polypeptide as defined in any of SEQ ID NO: 2, 3 or 4 or a functional variant or homologue thereof.
In an alternative embodiment, the plant has at least one mutation in its genome, wherein the mutation increases the activity of AAP8. Preferably, the mutation is introduced by targeted genome editing, preferably CRISPR.
In one embodiment, the mutation is the insertion of at least one or more additional copy of a nucleic acid encoding an AAP8 polypeptide as defined in SEQ ID NO: 2, 3 or 4 or homolog or functional variant thereof. Alternatively, the mutation is at position 410 of SEQ ID NO: 1 or at a homologous position in a homologous sequence.
In another aspect of the invention, there is provided a method of making a transgenic plant having an increase in seed yield, the method comprising introducing and expressing a nucleic acid construct comprising a nucleic acid sequence encoding an AAP8 polypeptide as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homolog thereof.
In a further aspect of the invention, there is provided a method of making a genetically altered plant having an increase in seed yield, the method comprising introducing a mutation into the plant genome to increase the activity of an AAP8 polypeptide. Preferably, the mutation is introduced using targeted genome editing, preferably CRISPR.
In one embodiment, the mutation is the insertion of one or more additional copies of a nucleic acid encoding an AAP8 polypeptide as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homolog thereof, such that the sequence is operably linked to a regulatory sequence. In an alternative embodiment, the method comprises or results in introducing at least one mutation at position 410 of SEQ ID NO: 1 or at a homologous position in a homologous sequence. Preferably, the mutation is a substitution.
In a further aspect of the invention, there is provided a method of screening a population of plants and identifying and/or selecting a plant that has or will have increased activity of a AAP polypeptide, the method comprising detecting in the plant germplasm at least one polymorphism in the nucleic acid encoding an AAP polypeptide or detecting at least one polymorphism in an AAP protein and selecting said plant or progeny thereof.
In one embodiment, the polymorphism is a substitution. Preferably, the substitution is at position 410 of SEQ ID NO: 1, 2, 3 or 4 or position 2635 of SEQ ID NO: 5, 6, 7 or 8 or a homologous substitution in a homologous sequence.
In one embodiment, a “homologous substitution in a homologous sequence” in any of the aspects of the invention described herein, may be selected from one or more of the positions in one of the homologous sequences defined in Table 12.
In a further aspect of the invention there is provided a nucleic acid construct comprising a nucleic acid sequence encoding a AAP8 polypeptide as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homolog thereof. More preferably, the nucleic acid sequence is operably linked to a regulatory sequence, wherein the regulatory sequence is selected from a constitutive promoter or a tissue-specific promoter.
Also provided is a vector comprising the nucleic acid construct described above, as well as a host cell comprising the nucleic acid construct.
In another aspect of the invention, there is provided the use of the nucleic acid construct or vector described above to increase seed yield.
In a final aspect of the invention there is provided a method of producing a food or feed composition, the method comprising
In one embodiment, the plant is a crop plant. In a further embodiment, the crop plant is selected from rice, maize, wheat, soybean, barley, cannabis, pennycress and Brassica. In a preferred embodiment, the plant part is a seed.
In a further aspect of the invention, there is provided a plant or plant progeny obtained or obtainable by any of the methods described above. In another embodiment, there is provided a seed obtained or obtainable by the plants or methods described herein, as well as progeny obtained from those plants and subsequent seeds obtained from the plants.
In a further aspect of the invention, there is provided a method of increasing free amino acid and/or protein content in a plant comprising increasing the activity of amino acid permease (AAP). Preferably, free amino acid and/or protein content is increased in the seed or grain of said plant. In one embodiment, the method comprises increasing the expression and/or activity of AAP8, wherein the amino acid sequence of AAP8 comprises a sequence as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homologue thereof.
The invention is further described in the following non-limiting figures:
(J) The average cotyledon area of 10-d-old seedlings of Ler and NIL-SSW1Cvi. Values in (E) to (J) are given as mean±SE relative to the wild-type values, set at 100%. **, P<0.01 compared with the wild type (Student's t test). Bars=0.5 mm in (A), 0.1 mm in (B), 1 mm in (C) and (D).
(A) Seed area of Ler/Ler F1, SSW1Cvi/SSW1Cvi F1, Ler/SSW1Cvi F1 and SSW1Cvi/Ler F1. (B) Seed area of Ler/Ler F2, SSW1Cvi/SSW1Cvi F2, Ler/SSW1Cvi F2 and SSW1Cvi/Ler F2. (C) and (D) The mature ovules of Ler (C) and SSW1Cvi (D). (E) and (F) The seeds of Ler (E) and SSW1Cvi (F) at 6 DAP (days after pollination). (G) The outer integument length of Ler and SSW1Cvi at 0, 6, 8 DAP. (H) The number of cells in the outer integuments of Ler and SSW1Cvi at 0, 6, 8 DAP. (I) The length of cells in the outer integuments of Ler and SSW1Cvi at 0, 6, 8 DAP. Values in (A) and (B) are given as mean±SE relative to respective wildtype values, set at 100%. Values in (G) to (I) are given as mean±SE. **, P<0.01 compared with the wildtype by Student's t test. Bar=100 μm in (C) to (F).
(E) Distribution of Arabidopsis accessions with SSW1Ler, SSW1Cvi and SSW1Col-0 types, respectively. (F) The schematic diagram of the SSW1/AAP8 protein. Amino acid substitutions are marked as Ler/SSW1Cvi. For example, A/V means alanine in Ler and valine in Cvi and NIL-SSW1Cvi. “Aa_trans motif” represents “amino acid transporter” in Pfam database (PF01490). (G) Seed area and weight of Ler, NIL-SSW1Cvi, gSSW1Cvi-COM #6 (homozygous), gSSW1Cvi-COM #9 (homozygous) and gSSW1Cvi-COM #16 (homozygous). (H) The expression levels of AAP8 in Col-0, aap8-1, and aap8-101.
(I) Seed area and weight of Col-0, aap8-1, and aap8-101. (J) Seed area of Col-0, aap8-1, gSSW1Cvi-COM; aap8-1 #1 (homozygous), gSSW1Cvi-COM; aap8-1 #2 (homozygous) and gSSW1Cvi-COM; aap8-1 #3 (homozygous). Values in (C) and (H) are given as mean±SE. Values in (G) (I) and (J) are given as mean±SE relative to the respective wild-type values, set at 100%. **, P<0.01 compared with the wild-type (Student's t test).
Values in (B) are given as mean±SE.
Values in (A) and (B) are given as mean±SE. Values in (C) is given as mean±SE relative to the respective wild-type values, set at 100%. **, P<0.01 and *, P<0.05 compared to the wildtype by Student's t test. (E) Quantification of the soluble seed proteins in Ler was relative to that in NIL-SSW1Cvi from (D). The ratio values of soluble seed proteins in Ler were set at 1. Values for soluble seed proteins in NIL-SSW1Cvi are given as mean±SD (n=3). **P<0.01 compared with the value for Ler by Student's t-test. Values in (A) and (B) are given as mean±SE. Values in (C) and (E) is given as mean±SE relative to the respective wild-type values, set at 100%. **, P<0.01 and *, P<0.05 compared to the wildtype by Student's t test.
The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology, bioinformatics which are within the skill of the art. Such techniques are explained fully in the literature.
The terms “seed” and “grain” as used herein can be used interchangeably.
As used herein, the words “nucleic acid”, “nucleic acid sequence”, “nucleotide”, “nucleic acid molecule” or “polynucleotide” are intended to include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), natural occurring, mutated, synthetic DNA or RNA molecules, and analogs of the DNA or RNA generated using nucleotide analogs. It can be single-stranded or double-stranded. Such nucleic acids or polynucleotides include, but are not limited to, coding sequences of structural genes, anti-sense sequences, and non-coding regulatory sequences that do not encode mRNAs or protein products. These terms also encompass a gene. The term “gene” or “gene sequence” is used broadly to refer to a DNA nucleic acid associated with a biological function. Thus, genes may include introns and exons as in the genomic sequence, or may comprise only a coding sequence as in cDNAs, and/or may include cDNAs in combination with regulatory sequences.
The terms “polypeptide” and “protein” are used interchangeably herein and refer to amino acids in a polymeric form of any length, linked together by peptide bonds.
The aspects of the invention involve recombination DNA technology and exclude embodiments that are solely based on generating plants by traditional breeding methods.
For the purposes of the invention, a “genetically altered” or “mutant” plant is a plant that has been genetically altered compared to the naturally occurring wild type (WT) plant. In one embodiment, a mutant plant is a plant that has been altered compared to the naturally occurring wild type (WT) plant using a mutagenesis method, such as the mutagenesis methods described herein. In one embodiment, the mutagenesis method is targeted genome modification or genome editing. In one embodiment, the plant genome has been altered compared to wild type sequences using a mutagenesis method. In one example, mutations can be used to insert an AAP gene sequence to increase the activity of AAP. In one example, the AAP sequence is operably linked to an endogenous promoter. Such plants have an altered phenotype as described herein, such as an increased seed yield. Therefore, in this example, increased seed yield is conferred by the presence of an altered plant genome and is not conferred by the presence of transgenes expressed in the plant.
Methods of Increasing Seed Yield
In a first aspect of the invention, there is provided a method of increasing seed yield in a plant, the method comprising increasing the activity of an amino acid permease (AAP) in a plant.
Seed size and weight are the main components contributing to seed yield, however, in one embodiment, the increase in seed yield comprises an increase in at least one yield component trait such as seed length and seed width, including average seed length, width and/or area, seed weight (single seed or thousand grain weight), overall seed yield per plant, and/or seed quality (preferably an increase in storage proteins and/or free amino acids) per seed. In particular, the inventors have found that increasing the activity of an AAP increases at least one of seed weight, seed size and seed quality. Preferably, increasing the activity of an AAP increases seed weight, seed size and seed quality.
The terms “increase”, “improve” or “enhance” as used herein are interchangeably. In one embodiment, seed yield, and preferably seed weight, seed size (e.g. seed length and/or width and/or seed area) and/or seed quality is increased by at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10% 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40% or 50% compared to a control plant. Preferably, seed yield is increased by at least 5%, more preferably between 5 and 30% compared to a control plant. In one embodiment, total free amino acid content in the seeds increased by between 5 and 50%, more preferably between 10 and 40% compared to a control plant.
Thus, according to the invention, seed yield can be measured by assessing one or more of seed weight, seed size and/or protein (or free amino acid) content in the plant. Yield is increased relative to control plants. The skilled person would be able to measure any of the above seed yield parameters using known techniques in the art. Protein or amino acid levels may be measured using standard techniques in the art, such as, but not limited to, infrared radiation analyses and use of the Bradford assay.
Accordingly, in another aspect of the invention, there is provided a method of increasing free amino acid and/or protein content in a plant comprising increasing the activity of amino acid permease (AAP). Preferably, free amino acid and/or protein content is increased in the seed or grain of said plant.
Amino acid permease or AAP is a membrane transport protein that transports amino acids into the cell. By “increase activity” is meant that the ability of the permease to transport amino acids, an in particular, aspartate, into a cell is increased, particularly when compared to a wild-type or control plant.
In one embodiment, the AAP is AAP8 (which is also referred to herein as SSW1). More preferably AAP8 comprises or consists of an amino acid sequence as defined in any one of SEQ ID NO: 1 to 4 or a functional variant or homologue thereof. In a further preferred embodiment, AAP8 comprises or consists of a nucleic acid sequence as defined in any one of SEQ ID NO: 5 to 8 or a functional variant or homologue thereof.
In one embodiment, the activity of an AAP is increased by introducing and expressing a nucleic acid construct where the nucleic acid construct comprises a nucleic acid sequence encoding an AAP8 polypeptide as defined in SEQ ID NO: 2 (the Cvi allele) or 3 (the Col-0 allele) or 4 or a functional variant or homolog thereof. In a further embodiment, the nucleic acid construct comprises a nucleic acid sequence comprising or consisting of a nucleic acid sequence as defined in SEQ ID NO: 6, 7 or 8 or functional variant or homolog thereof.
In a preferred embodiment, the nucleic acid sequence is operably linked to a regulatory sequence. Accordingly, in one embodiment, the nucleic acid sequence may be expressed using a regulatory sequence that drives overexpression. Overexpression according to the invention means that the transgene is expressed or is expressed at a level that is higher than the expression of the endogenous AAP gene whose expression is driven by its endogenous counterpart. In one embodiment, the nucleic acid and regulatory sequence are from the same plant family. In another embodiment, the nucleic acid and regulatory sequence are from a different plant family, genus or species—for example, AtAAP8 is expressed in a plant that is not Arabidopsis.
In one embodiment, the regulatory sequence is a promoter. The term “promoter” typically refers to a nucleic acid control sequence located upstream from the transcriptional start of a gene and which is involved in the binding of RNA polymerase and other proteins, thereby directing transcription of an operably linked nucleic acid. Encompassed by the aforementioned terms are transcriptional regulatory sequences derived from a classical eukaryotic genomic gene (including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence) and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner. Also included within the term is a transcriptional regulatory sequence of a classical prokaryotic gene, in which case it may include a −35 box sequence and/or −10 box transcriptional regulatory sequences.
A “plant promoter” comprises regulatory elements that mediate the expression of a coding sequence segment in plant cells. The promoters upstream of the nucleotide sequences useful in the nucleic acid constructs described herein can also be modified by one or more nucleotide substitution(s), insertion(s) and/or deletion(s) without interfering with the functionality or activity of either the promoters, the open reading frame (ORF) or the 3′-regulatory region such as terminators or other 3′ regulatory regions which are located away from the ORF. It is furthermore possible that the activity of the promoter is increased by modification of their sequence, or that they are replaced completely by more active promoters, even promoters from heterologous organisms. For expression in plants, the AAP nucleic acid sequence is, as described above, preferably linked operably to or comprises a suitable promoter, which expresses the gene at the right point in time and with the required spatial expression pattern.
In one embodiment, overexpression may be driven by a constitutive promoter. A “constitutive promoter” refers to a promoter that is transcriptionally active during most, but not necessarily all, phases of growth and development and under most environmental conditions, in at least one cell, tissue or organ. Examples of constitutive promoters include the cauliflower mosaic virus promoter (CaMV35S or 19S), rice actin promoter, ubiquitin promoter, rubisco small subunit, maize or alfalfa H3 histone, OCS, SAD1 or 2, GOS2 or any promoter that gives enhanced expression
In an alternative embodiment, the promoter is a tissue-specific promoter. Tissue specific promoters are transcriptional control elements that are only active in particular cells or tissues at specific times during plant development. In one example, the tissue-specific promoter is a seed coat-specific promoter, for example, the MUM4 (Mucilage-modified4)0.3Pro, as defined in, for example, SEQ ID NO: 169 or a functional variant thereof.
The term “operably linked” as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
In one embodiment, the progeny plant is stably transformed with the nucleic acid construct described herein and comprises the exogenous polynucleotide, which is heritably maintained in the plant cell. The method may include steps to verify that the construct is stably integrated. The method may also comprise the additional step of collecting seeds from the selected progeny plant.
In an alternative embodiment, the method comprises introducing at least one mutation into the plant genome to increase the activity of an AAP, as defined herein.
In one embodiment, the mutation is the insertion of at least one or more additional copy of an AAP with increased activity as defined herein. For example, the mutation may comprise the insertion of at least one or more additional copy of a nucleic acid encoding an AAP8 polypeptide as defined in SEQ ID NO: 2 (Cvi allele) or 3 (Col-0 allele) or 4 or a functional variant or homolog thereof, such that the sequence is operably linked to a regulatory sequence.
In another embodiment, the method comprises introducing at least one mutation into at least one AAP gene. Preferably, the method comprises introducing at least one mutation into the, preferably endogenous, nucleic acid sequence encoding an AAP polypeptide. As used herein, the term “endogenous” may refer to the native or natural sequence in the plant genome. In one embodiment, the endogenous amino acid sequence of AAP8 is defined in SEQ ID NO: 1 (Ler allele) or a functional variant or homologue thereof. More preferably, the nucleic acid sequence encoding an AAP comprises or consists of SEQ ID NO: 5 (genomic sequence of the Ler allele) or a functional variant or homologue thereof.
The term “functional variant of a nucleic acid sequence” as used herein with reference to any of the sequences described herein refers to a variant gene or amino acid sequence or part of the gene or amino acid sequence that retains the biological function of the full non-variant sequence. A functional variant also comprises a variant of the gene of interest that has sequence alterations that do not affect function, for example in non-conserved residues. Also encompassed is a variant that is substantially identical, i.e. has only some sequence variations, for example in non-conserved residues, compared to the wild type sequences as shown herein and is biologically active. Alterations in a nucleic acid sequence which result in the production of a different amino acid at a given site that do not affect the functional properties of the encoded polypeptide are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.
In one embodiment, a functional variant has at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity to the non-variant nucleic acid or amino acid sequence.
The term homolog, as used herein, also designates an AAP8 gene orthologue from other plant species. A homolog may have, in increasing order of preference, at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity to the amino acid represented by any of SEQ ID NO: 1 to 4 or to the nucleic acid sequences as shown by SEQ ID NOs: 5 to 8. In one embodiment, overall sequence identity is at least 37%. In one embodiment, overall sequence identity is at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, most preferably 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. Functional variants of an AAP8 homolog are also within the scope of the invention.
Examples of AAP8 homologues are described in SEQ ID Nos 9 to 166. Specifically, the amino acid sequence of AAP8 homolog may be selected from one of SEQ ID Nos 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163 or 165 or a functional variant thereof. In a further embodiment, the nucleic acid sequence of an AAP8 homolog may be selected from SEQ ID Nos 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 146, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164 or 166 or a functional variant thereof.
In one embodiment, where the homolog is rice, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 9 or 13 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 10 or 14 or a functional variant thereof.
In a further embodiment, where the homolog is soybean, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 31 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 32 or a functional variant thereof.
In a further embodiment, where the homolog is maize, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 63 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 64 or a functional variant thereof.
In a further embodiment, where the homolog is B. napus, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 123 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 124 or a functional variant thereof.
In a further embodiment, where the homolog is B. rapa, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 139, 141 or 143 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 140, 142 or 144 or a functional variant thereof.
In a further embodiment, where the homolog is B. oleracea, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 157 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 158 or a functional variant thereof.
In a further embodiment, where the homolog is barley, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 131 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 132 or a functional variant thereof.
In a further embodiment, where the homolog is wheat, the amino acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 135 or 136 or a functional variant thereof, and the nucleic acid sequence of the AAP8 homolog comprises or consists of SEQ ID NO: 138 or 140 or a functional variant thereof.
In a further embodiment, the AAP polypeptide of the invention comprises the following conserved motif. Preferably, the at least one mutation is in at least one of these residues, more preferably in the first residue (i.e. the X residue):
wherein X is any amino acid, but preferably is an A, S or G.
In an alternative embodiment, the AAP polypeptide comprises an amino acid transporter motif (referred to herein as “Aa_trans motif”) as defined below or a functional variant thereof and preferably, the at least one mutation is in the amino acid transporter motif.
Accordingly, in one embodiment, there is provided a method of increasing seed yield in a plant as described herein, the method comprising increasing the activity of an AAP polypeptide as described herein, wherein the AAP comprises or consists of one of the following sequences:
In one embodiment, the mutation in the nucleic acid sequence encoding an AAP polypeptide may be selected from one of the following mutation types:
In one embodiment the mutation is a missense mutation (nonsynonymous substitution).
In one embodiment, the one or more mutations in the AAP nucleic acid sequence results in an amino acid substitution at position 410 in SEQ ID NO: 1 or a homologous position in a homologous sequence. Preferably, said mutation arises from a substitution of one or more nucleotides in the nucleic acid sequence of AAP8. In one embodiment, the mutation is at position 2635 of SEQ ID NO: 5 or a homologous position in a homologous sequence.
In a further embodiment, the method may comprise introducing one or more additional mutations, preferably at position 277 and/or 374 of SEQ ID NO: 1 or a homologous position in a homologous sequence.
In a further embodiment, the nonsense mutation in the nucleic acid sequence causes a substitution of one amino acid for another in the resulting amino acid sequence. In one embodiment, the mutation is the substitution of one hydrophobic amino acid for another hydrophobic amino acid. For example, the substituted residue may be selected from alanine, isoleucine, leucine, methionine, phenylalanine, tryptophan, tyrosine and valine. More preferably the substituted residue is selected from valine, isoleucine and alanine. Most preferably the substituted residue is alanine.
“By at least one mutation” is meant that where the AAP gene is present as more than one copy or homologue (with the same or slightly different sequence) there is at least one mutation in at least one gene. Preferably all genes are mutated.
The skilled person would understand that suitable homologues and the homologous positions in these sequences can be identified by sequence comparisons and identifications of conserved domains. There are predictors in the art that can be used to identify such sequences. The function of the homologue can be identified as described herein and a skilled person would thus be able to confirm the function. Homologous positions can thus be determined by performing sequence alignments once the homologous sequence has been identified. For example, AAP8 homologues can be identified using a BLAST search of the plant genome of interest using the Arabidopsis AAP8 as a query.
Identification of the homologous position in any AAP8 homologous sequence can be performed by making a multiple sequence alignment of the candidate sequence with the Arabidopsis AAP8. In particular, the conserved amino acid transporter motif can be aligned using any known multiple sequence alignment program (e.g. DNAMAN) with the corresponding motif in a candidate homologous sequence to identify the homologous position.
Thus, the nucleotide sequences of the invention and described herein can also be used to isolate corresponding sequences from other organisms, particularly other plants, for example crop plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences described herein. Topology of the sequences and the characteristic domain structure can also be considered when identifying and isolating homologs. Sequences may be isolated based on their sequence identity to the entire sequence or to fragments thereof. In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen plant. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labelled with a detectable group, or any other detectable marker. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook, et al., (1989) Molecular Cloning: A Library Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.).
In one embodiment, the homologous position and the homologous amino acid and nucleotide sequence of AtAAP8 is selected from one of the positions and amino acid and nucleotide sequences in the table of
In one embodiment, the mutation is introduced using mutagenesis (i.e. any site-directed mutagenesis method) or targeted genome editing. That is, in one embodiment, the invention relates to a method and plant that has been generated by genetic engineering methods as described above, and does not encompass naturally occurring varieties.
Targeted genome modification or targeted genome editing is a genome engineering technique that uses targeted DNA double-strand breaks (DSBs) to stimulate genome editing through homologous recombination (HR)-mediated recombination events. In one embodiment, the mutation is introduced using ZFNs, TALENs or CRISPR/Cas9.
In a preferred embodiment, the targeted genome editing technique is CRISPR. The use of this technology in genome editing is well described in the art, for example in U.S. Pat. No. 8,697,359 and references cited herein. In short, CRISPR is a microbial nuclease system involved in defence against invading phages and plasmids. CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage (sgRNA). Three types (I-III) of CRISPR systems have been identified across a wide range of bacterial hosts. One key feature of each CRISPR locus is the presence of an array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers). The non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct Cas nucleases to the target site (protospacer). The Type II CRISPR is one of the most well characterized systems and carries out targeted DNA double-strand break in four sequential steps. First, two non-coding RNA, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat regions of the pre-crRNA and mediates the processing of pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA via Watson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates cleavage of target DNA to create a double-stranded break within the protospacer.
One major advantage of the CRISPR-Cas9 system, as compared to conventional gene targeting and other programmable endonucleases is the ease of multiplexing, where multiple positions or sites on genes can be mutated simultaneously simply by using multiple sgRNAs each targeting a different site. In addition, where two sgRNAs are used flanking a genomic region, the intervening section can be deleted or inverted (Wiles et al., 2015). In the present invention, multiple sgRNAs can be used to simultaneously introduce two or more mutations, for example, the specific mutations described above, into the AAP8 gene. In this embodiment, self-cleaving RNAs or cleavable RNA molecules, such as csy4, ribozyme or tRNA sequences can be used to process a single construct into multiple sgRNAs.
Cas9 is thus the hallmark protein of the type II CRISPR-Cas system, and is a large monomeric DNA nuclease guided to a DNA target sequence adjacent to the PAM (protospacer adjacent motif) sequence motif by a complex of two noncoding RNAs: CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The Cas9 protein contains two nuclease domains homologous to RuvC and HNH nucleases. The HNH nuclease domain cleaves the complementary DNA strand whereas the RuvC-like domain cleaves the non-complementary strand and, as a result, a blunt cut is introduced in the target DNA. Heterologous expression of Cas9 together with an sgRNA can introduce site-specific double strand breaks (DSBs) into genomic DNA of live cells from various organisms. Codon optimized versions of Cas9, which is originally from the bacterium Streptococcus pyogenes, can also be used to increase efficiency. Cas9 orthologues may also be used, such as Staphylococcus aureus (SaCas9) or Streptococcus thermophiles (StCas9).
The single guide RNA (sgRNA) is the second component of the CRISPR/Cas system that forms a complex with the Cas9 nuclease. sgRNA is a synthetic RNA chimera created by fusing crRNA with tracrRNA. The sgRNA guide sequence located at its 5′ end confers DNA target specificity. Therefore, by modifying the guide sequence, it is possible to create sgRNAs with different target specificities. The canonical length of the guide sequence is 20 bp. In plants, sgRNAs have been expressed using plant RNA polymerase III promoters, such as U6 and U3. Accordingly, using techniques known in the art it is possible to design sgRNA molecules that targets the AAP gene as described herein. In one embodiment, the method comprises using any of the nucleic acid constructs or sgRNA molecules described herein.
Alternatively, Cpf1, which is another Cas protein, can be used as the endonuclease. Cpf1 differs from Cas9 in several ways: Cpf1 requires a T-rich PAM sequence (TTTV) for target recognition, Cpf1 does not require a tracrRNA, and as such only crRNA is required unlike Cas9 and the Cpf1-cleavage site is located distal and downstream to the PAM sequence in the protospacer sequence (Li et al., 2017). Furthermore, after identification of the PAM motif, Cpf1 introduces a sticky-end-like DNA double-stranded break with several nucleotides of overhang. As such, the CRISPR/CPf1 system consists of a Cpf1 enzyme and a crRNA.
Cas9 and Cpf1 expression plasmids for use in the methods of the invention can be constructed as described in the art. Cas9 or Cpf1 and the one or more sgRNA molecule may be delivered as separate or as a single construct. Where separate constructs are used for the delivery of the CRISPR enzyme (i.e. Cas9 or Cpf1) and the sgRNA molecule(s), the promoters used to drive expression of the CRISPR enzyme/sgRNA molecule may be the same or different. In one embodiment, RNA polymerase (Pol) II-dependent promoters can be used to drive expression of the CRISPR enzyme. In another embodiment, Pol III-dependent promoters, such as U6 or U3, can be used to drive expression of the sgRNA.
In one embodiment, the method uses a sgRNA to introduce a targeted SNP or mutation, in particular one of the substitutions described herein into a AAP gene. As explained below, the introduction of a template DNA strand, following a sgRNA-mediated snip in the double-stranded DNA, can be used to produce a specific targeted mutation (i.e. a SNP) in the gene using homology directed repair. In an alternative embodiment, at least one mutation may be introduced into the AAP gene, particularly at the positions described above, using any CRISPR technique known to the skilled person. In another example, sgRNA (for example, as described herein) can be used with a modified Cas9 protein, such as nickase Cas9 or nCas9 or a “dead” Cas9 (dCas9) or a Cas9 nickase (Cas9n) fused to a “Base Editor”—such as an enzyme, for example a deaminase such as cytidine deaminase, or TadA (tRNA adenosine deaminase) or ADAR or APOBEC. These enzymes are able to substitute one base for another. As a result no DNA is deleted, but a single substitution is made (Kim et al., 2017; Gaudelli et al. 2017).
The genome editing constructs may be introduced into a plant cell using any suitable method known to the skilled person. In an alternative embodiment, any of the nucleic acid constructs described herein may be first transcribed to form a preassembled Cas9-sgRNA ribonucleoprotein and then delivered to at least one plant cell using any of the above described methods, such as lipofection, electroporation, biolistic bombardment or microinjection.
Specific protocols for using the above-described CRISPR constructs would be well known to the skilled person. As one example, a suitable protocol is described in Ma & Liu (“CRISPR/Cas-based multiplex genome editing in monocot and dicot plants”) incorporated herein by reference.
Genetically Altered or Modified Plants and Methods of Producing Such Plants
In another aspect of the invention, there is provided a genetically altered plant, part thereof or plant cell, characterised in that the plant expresses an AAP polypeptide with increased activity. In a further embodiment, the plant is characterised by an increase in seed yield.
In one embodiment, the plant or plant cell may comprise a nucleic acid construct comprising a nucleic acid encoding an AAP8 polypeptide as defined in SEQ ID NO: 2, 3 or 4 or a functional variant or homolog thereof, as defined herein. In one embodiment, the construct is stably incorporated into the genome.
In an alternative embodiment, the plant may be produced by introducing a mutation into the plant genome by any of the above-described methods. In one embodiment, the mutation is the insertion of at least one additional copy of a nucleic acid encoding an AAP with increased activity as defined herein. For example, the mutation may comprise the insertion of at least one or more additional copy of a nucleic acid encoding an AAP8 polypeptide as defined in SEQ ID NO: 2 (Cvi allele) or 3 (Col-0 allele) or 4 or a functional variant or homolog thereof, such that the sequence is operably linked to a regulatory sequence. In an alternative embodiment, the mutation is a substitution at position 410 of SEQ ID NO: 1 or at a homologous position in a homologous sequence, as defined herein. Preferably the mutation is introduced into at least one plant cell and a plant regenerated from the at least one mutated plant cell.
The terms “introduction”, “transfection” or “transformation” as referred to herein encompass the transfer of an exogenous polynucleotide or construct (such as a nucleic acid construct or a genome editing construct as described herein) into a host cell, irrespective of the method used for transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a genetic construct of the present invention and a whole plant regenerated there from. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem). The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.
The transfer of foreign genes into the genome of a plant is called transformation. Transformation of plants is now a routine technique in many species. Any of several transformation methods known to the skilled person may be used to introduce one or more genome editing constructs of interest into a suitable ancestor cell. The methods described for the transformation and regeneration of plants from plant tissues or plant cells may be utilized for transient or for stable transformation.
Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant (microinjection), gene guns (or biolistic particle delivery systems (bioloistics)) as described in the examples, lipofection, transformation using viruses or pollen and microprojection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts, ultrasound-mediated gene transfection, optical or laser transfection, transfection using silicon carbide fibers, electroporation of protoplasts, microinjection into plant material, DNA or RNA-coated particle bombardment, infection with (non-integrative) viruses and the like. Transgenic plants can also be produced via Agrobacterium tumefaciens mediated transformation, including but not limited to using the floral dip/Agrobacterium vacuum infiltration method as described in Clough & Bent (1998) and incorporated herein by reference.
Optionally, to select transformed plants, the plant material obtained in the transformation is, as a rule, subjected to selective conditions so that transformed plants can be distinguished from untransformed plants. For example, the seeds obtained in the above-described manner can be planted and, after an initial growing period, subjected to a suitable selection by spraying. A further possibility is growing the seeds, if appropriate after sterilization, on agar plates using a suitable selection agent so that only the transformed seeds can grow into plants. As described in the examples, a suitable marker can be bar-phosphinothricin or PPT. Alternatively, the transformed plants are screened for the presence of a selectable marker, such as, but not limited to, GFP, GUS (β-glucuronidase). Other examples would be readily known to the skilled person. Alternatively, no selection is performed, and the seeds obtained in the above-described manner are planted and grown and AAP activity levels measured at an appropriate time using standard techniques in the art. This alternative, which avoids the introduction of transgenes, is preferable to produce transgene-free plants.
Following DNA transfer and regeneration, putatively transformed plants may also be evaluated, for instance using PCR to detect the presence of the gene of interest, copy number and/or genomic organisation. Alternatively or additionally, integration and expression levels of the newly introduced DNA may be monitored using Southern, Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.
The method may further comprise selecting one or more mutated plants, preferably for further propagation. The selected plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1) transformed plant may be selfed and homozygous second-generation (or T2) transformants selected, and the T2 plants may then further be propagated through classical breeding techniques. The generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).
In a further related aspect of the invention, there is also provided a method of obtaining a genetically modified plant as described herein, the method comprising
In a further embodiment, the method also comprises the step of screening the genetically modified plant for the introduction of one or more additional copies of an AAP nucleic acid, as described herein, or for the introduction of one or more substitutions into the endogenous AAP genomic sequence. In one embodiment, the method comprises obtaining a DNA sample from a transformed plant and carrying out DNA amplification to detect one of the mutations described above. In a further embodiment, the methods comprise generating stable T2 plants preferably homozygous for the mutation.
A genetically altered plant of the present invention may also be obtained by transference of any of the sequences of the invention by crossing, e.g., using pollen of the genetically altered plant described herein to pollinate a wild-type or control plant, or pollinating the gynoecia of plants described herein with other pollen that does not contain at least one of the above-described mutations. The methods for obtaining the plant of the invention are not exclusively limited to those described in this paragraph; for example, genetic transformation of germ cells from the ear of wheat could be carried out as mentioned, but without having to regenerate a plant afterward.
In a further aspect of the invention there is provided a plant obtained or obtainable by the above-described methods. Also included in the scope of the invention is the progeny obtained from the plants.
The plant according to the various aspects of the invention may be a monocot or a dicot plant. A dicot plant may be selected from the families including, but not limited to Asteraceae, Brassicaceae (eg Brassica napus, Thlaspi arvense), Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae), Malvaceae, Rosaceae or Solanaceae. For example, the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage, tomato, potato, yam, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa, bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species.
A monocot plant may, for example, be selected from the families Arecaceae, Amaryllidaceae or Poaceae. For example, the plant may be a cereal crop, such as wheat, rice, barley, maize, oat, sorghum, rye, millet, buckwheat, turf grass, Italian rye grass, sugarcane or Festuca species, or a crop such as onion, leek, yam or banana.
Preferably, the plant is a crop plant. By crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use. Preferred plants are maize, wheat, rice, oilseed rape, cannabis, sorghum, soybean, pennycress, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
The term “plant” as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, fruit, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, wherein each of the aforementioned comprise the nucleic acid construct as described herein. The term “plant” also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the aforementioned comprises the nucleic acid construct as described herein.
The invention also extends to harvestable parts of a plant of the invention as described herein, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. The aspects of the invention also extend to products derived, preferably directly derived, from a harvestable part of such a plant, such as dry pellets or powders, oil, fat and fatty acids, starch or proteins. Another product that may derived from the harvestable parts of the plant of the invention is biodiesel. The invention also relates to food products and food supplements comprising the plant of the invention or parts thereof. In one embodiment, the food products may be animal feed. In another aspect of the invention, there is provided a product derived from a plant as described herein or from a part thereof.
In a further aspect of the invention there is provided a method for producing a food or feed product with increased protein content, said method comprising
In a preferred embodiment, the plant part or harvestable product is a seed. Therefore, in a further aspect of the invention, there is provided a seed produced from a genetically altered plant as described herein. In an alternative embodiment, the plant part is pollen, a propagule or progeny of the genetically altered plant described herein. Accordingly, in a further aspect of the invention there is provided pollen, a propagule or progeny of the genetically altered plant as described herein.
A control plant as used herein according to all of the aspects of the invention is a plant which has not been modified according to the methods of the invention. Accordingly, in one embodiment, the control plant does not have increased activity of an AAP polypeptide. In an alternative embodiment, the plant been genetically modified, as described above. In one embodiment, the control plant is a wild type plant. The control plant is typically of the same plant species, preferably having the same genetic background as the modified plant.
In another aspect of the invention, there is provided a nucleic acid construct comprising a nucleic acid sequence encoding a AAP8 polypeptide as defined in SEQ ID NO: 2 (the Cvi allele) or 3 (the Col-0 allele) or 4 or a functional variant or homolog thereof (as defined herein). In a further embodiment, the nucleic acid construct comprises a nucleic acid sequence comprising or consisting of a nucleic acid sequence as defined in SEQ ID NO: 6 or 7, or 8 or functional variant or homolog thereof. Preferably, the nucleic acid is operably linked to a regulatory sequence as defined herein.
In a further aspect of the invention, there is provided an isolated cell, preferably a plant cell or an Agrobacterium tumefaciens cell, expressing a nucleic acid construct as described herein. Furthermore, the invention also relates to a culture medium or kit comprising an isolated plant cell or an Agrobacterium tumefaciens cell expressing the nucleic acid construct described herein.
There is also provided the use of the nucleic acid construct described herein to increase seed yield.
Method of Screening Plants for Naturally Occurring High Levels of AAP Activity
In another aspect of the invention, there is provided a method for screening a population of plants and identifying and/or selecting a plant that has increased activity of at least one AAP polypeptide, wherein the method comprises detecting in the plant germplasm at least one polymorphism correlated with increased activity of an AAP polypeptide, as described herein. Preferably, said plant has an increased seed yield.
In one embodiment, the polymorphism is a substitution. In one specific embodiment, said polymorphism may comprise at least one substitution at position 2635 of SEQ ID NO: 5, 6, 7 or 8 or a homologous position in a homologous sequence, as described herein.
In a further embodiment, the method may further comprise detecting one or more additional polymorphisms, wherein preferably the one or more additional polymorphisms are selected from:
Examples of homologous positions in a number of homologous sequences are shown in
Suitable tests for assessing the presence of a polymorphism would be well known to the skilled person, and include but are not limited to, Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length polymorphisms (AFLPs), Simple Sequence Repeats (SSRs-which are also referred to as Microsatellites), and Single Nucleotide Polymorphisms (SNPs). In one embodiment, Kompetitive Allele Specific PCR (KASP) genotyping is used.
In one embodiment, the method comprises
In a further embodiment, the method may further comprise introgressing the chromosomal region comprising an AAP polymorphism into a second plant or plant germplasm to produce an introgressed plant or plant germplasm. Preferably, said second plant will display an increase in seed yield compared to a control or wild-type plant that does not carry the polymorphism.
In a further aspect of the invention there is provided a method for increasing seed yield, the method comprising
While the foregoing disclosure provides a general description of the subject matter encompassed within the scope of the present invention, including methods, as well as the best mode thereof, of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will appreciate that the specifics of these examples should not be read as limiting on the invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.
“and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example “A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.
Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.
The foregoing application, and all documents and sequence accession numbers cited therein or during their prosecution (“appln cited documents”) and all documents cited or referenced in the appln cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
The invention is now described in the following non-limiting example.
To understand natural allelic variation at seed size loci, we sought to identify the QTL genes for seed size in Arabidopsis. Cvi (Cape Verde Islands) and Ler (Landsburg erecta) are two Arabidopsis accessions. Cvi seeds were obviously larger and heavier than Ler seeds (
We next investigated grain size and weight of Ler and NIL-SSW1Cvi. As shown in
The maternal and/or zygotic tissues have been known to determine the size of a seed (Li and Li, 2016), we therefore asked whether SSW1 acts maternally or zygotically. The reciprocal cross experiments between Ler and NIL-SSW1Cvi were conducted. The size of seeds from NIL-SSW1Cvi plants pollinated with Ler pollen or NIL-SSW1Cvi pollen was significantly larger than that from the self-pollinated Ler plants (
The integuments surrounding the ovule have been proposed to affect the final size of a seed after fertilization (Adamski et al., 2009; Du et al., 2014; Garcia et al., 2005; Schruff et al., 2006; Xia et al., 2013). Considering that SSW1 affects seed size through maternal tissues, we examined whether SSW1 could control seed size through the maternal integuments. We firstly observed mature ovules before fertilization. As shown in FIGS. 2C and 2D, the NIL-SSW1Cvi mature ovules were obviously larger than Ler ovules. NIL-SSW1Cvi ovules had longer outer integument than Ler ovules (
Considering that the growth of the integument is influenced by cell division and cell expansion, we investigated cell number and cell size of the outer integuments in Ler and NIL-SSW1Cvi ovules. The outer integument NIL-SSW1Cvi ovules contained more cells than that of Ler ovules (
To identify the QTL gene for seed size and weight (SSW1), we generated large F2 population from a cross between the original line CSSL-LCN1-3-3 and Ler. This QTL locus was mapped into the short arm of the chromosome 1 between markers Cvi-m5 and Cvi-m18. We genotyped 10048 F2 plants using markers Cvi-m5 and Cvi-m18 and identified 867 recombinants. To identify the gene underlying the SSW1 locus, we developed another four markers (Cvi-m40, Cvi-m39, Cvi-m51 and Cvi-m33) in mapping region. We then selected 33 plants with recombinations between these six markers to perform progeny test. Based on progeny test results, we narrowed the candidate gene region containing the SSW1 locus to 21.71 kb between markers Cvi-m51 and Cvi-m33, which contains four genes (At1g10010, At1g10020, At1g10030 and At1g10040) (
To testify whether natural variation in the At1g10010 gene causes large seeds in Cvi, we conducted a genomic complementation test. Our reciprocal crosses revealed that the Cvi allele is a dominant allele and the Ler allele is a recessive allele (
As three nucleotide polymorphisms resulted in amino acid changes between Ler and Cvi (
SSW1 encodes the amino acid permease 8 (AAP8) containing an amino acid transporter motif (
To determine expression of SSW1/AAP8, we conducted quantitative real-time RT-PCR analysis. Relatively higher expression of AAP8 was found in roots, inflorescences, and developing siliques, consistent with a previous study (Okumoto, 2002). AAP8 has been shown to localize in the plasma membrane when SSW1/AAP8-GFP fusion protein was transiently expressed in N. benthamian leaves (Santiago and Tegeder, 2016). However, the subcellular localization of AAP8 in Arabidopsis plants has not been described. We generated 35S:GFP-AAP8 transgenic plants to investigate the subcellular localization of AAP8 in Arabidopsis. GFP signal in 35S:GFP-AAP8 transgenic plants was found at the cell periphery. To examine whether AAP8-GFP was localized in cell walls or the plasma membrane, we used a high concentration of sucrose to induce plasmolysis. GFP signal was detected in the plasma membrane. Thus, these results show that SSW1/AAP8 is a plasma membrane protein in Arabidopsis.
To further investigate the function of loss-of-function of SSW1/AAP8 in seed size, we obtained two mutants (aap8-1/SALK_092908 and app8-101/SALK_122286C) harboring T-DNA insertions in the first intron of the At1g10010 gene, respectively (
We then performed the reciprocal cross experiments between Col-0 and app8-1 by hand pollination. As shown in
As natural allelic variation in SSW1 contributes to seed size and weight differences between Cvi and Ler, we asked whether natural allelic variation in SSW1 influences the amino acid permease activity of SSW1/AAP8. The yeast mutant strain 22Δ8AA can not use γ-aminobutyric acid, arginine, proline, aspartate, glutamate or citrulline as sole nitrogen sources (Okumoto, 2002). AAP8 has been reported to complement the mutant strain 22Δ8AA (Okumoto, 2002). We therefore expressed the SSW1/AAP8 gene from Cvi (pFL61-SSW1Cvi) and Ler (pFL61-SSW1Ler) in the mutant strain 22Δ8AA, respectively. The 22Δ8AA cells with pFL61-SSW1Cvi formed colonies on plates containing 1 mM and 2 mM ASP as sole nitrogen source after 4 days. By contrast, the 22Δ8AA cells with pFL61-SSW1Ler formed colonies on plates containing 3 mM ASP as sole nitrogen source after 4 days. However, the growth vigor of the 22Δ8AA cells with pFL61-SSW1Ler was obviously lower than that of the 22Δ8AA cells with pFL61-SSW1Cvi on plates supplying 1 mM, 2 mM or 3 mM ASP as sole nitrogen source. These results indicate that the SSW1 from Cvi (SSW1Cvi) has higher amino acid permease activity than that from the Ler allele (SSW1Ler).
To quantify the activity differences between SSW1Cvi and SSW1Ler, we cultured the mutant stain 22Δ8AA harboring pFL61, pFL61-SSW1Ler and pFL61-SSW1Cvi constructs in liquid medium with 1 mM ASP as sole nitrogen source and monitored their growth dynamics by measuring the optical density (OD) at 600 nm every 12 hours. As shown in
As SSW1Col-0 has an amino acid change (I374V) compared with SSW1Cvi we investigated the activity of SSW1Col-0 in transporting amino acid in yeast cells (
As there are three amino acid differences between SSW1Ler(A277;V374;V410) and SSW1Cvi (V277;I374;A410), we asked which amino acid plays a predominant role in determining the activity of SSW1. To test this, we generated AL/SSW1Ler(A277;V374;V410), AC/SSW1Cvi (V277;I374;A410), AM1/SSW1(V277;V374;V410), AM2/SSW1(A277;I374;V410), AM3/SSW1(A277;V374;A410), AN1/SSW1(A277;V374;A410), and AN2/SSW1Col-0(V277;V374;A410) constructs and transformed into the yeast mutant strain 22Δ8AA (
As SSW1 encodes an amino acid permease that has been proposed to transport amino acids to developing seeds (Schmidt et al., 2007), we analyzed the content of free amino acids in young siliques and mature seeds of NIL-SSW1Cvi and Ler by Gas Chromatography-Mass Spectrometer (GC-MS). In young siliques, the contents of some free amino acids such as alanine, serine, aspartic acid, asparagine, and glutamic acid were significantly increased in NIL-SSW1Cvi, while the contents of some amino acids remain the same as Ler (
We also assayed the content of free amino acids in young siliques and mature seeds of Col-0 and aap8-1. In young siliques, the contents of some free amino acids such as proline, glycine, aspartic acid, glutamic acid, asparagine and glutamine were significantly decreased in aap8-1, while the contents of some amino acids were similar to those in Col-0. In mature seeds, the contents of several amino acids (e.g. valine, leucine, isoleucine, serine, glycine, threonine, aspartic acid, glutamic acid, phenylalanine and tryptophan) in aap8-1 were significantly decreased compared with that in Col-0. In addition, total amino acid contents in the siliques and seeds of app8-1 were lower than those in wild-type (Col-0) siliques and seeds.
We then analyzed the content of soluble proteins in Ler and NIL-SSW1Cvi dry seeds by SDS-PAGE. The contents of 12S globulin α subunit, 12S globulin β subunit, 2S albumin large subunit and 2S albumin small subunit in NIL-SSW1Cvi seeds were obviously increased compared with those in Ler seeds (
As AAP8/SSW1 exhibits the highest similarity to Arabidopsis AAP1, which has been reported influencing seed weight (Sanders, 2009), we asked whether there are any genetic relationship between aap8-1 and aap1 in seed size control. To test this, we obtained aap1-101 (Salk_078312) (
Discussion
Seed size is an important yield trait and is controlled by quantitative trait loci. Several QTLs for seed size have been mapped in Arabidopsis, but the genes corresponding to these QTLs have not been cloned yet. In this study, we cloned the first QTL gene for seed size and weight (SSW1) in Arabidopsis and find that natural allelic variation in SSW1 contributes to seed size, weight and quality. SSW1 encodes an amino acid permease (AAP8) that transports amino acids into seeds. Natural allelic variation in SSW1 affects the amino acid permease activity, thereby influencing the contents of free amino acids and storage proteins in seeds. Therefore, these results reveal the genetic and molecular basis for natural variation in seed size, weight and quality control, suggesting that it is an important target for improving both seed size and quality in crops.
Several QTL loci for seed size were mapped in different chromosomes of Arabidopsis using the recombinant inbred line population from Ler and Cvi (Alonso-Blanco et al., 1999), but the QTL genes for seed size have not been identified in Arabidopsis. In this study, we fine-mapped a major QTL locus for grain size and weight (SSW1) and cloned the SSW1 gene in Arabidopsis. NIL-SSW1Cvi produced larger and heavier grains than Ler. By contrast, NIL-SSW1Cvi exhibited similar plant architecture, flower size and leaf size to Ler, suggesting that SSW1 mainly controls seed size and weight in Arabidopsis. Cellular observations show that SSW1 controls seed size by promoting cell proliferation during ovule and seed development. SSW1 encodes the amino acid permease AAP8. In Arabidopsis, AAP8 belongs to the AAP family that consists of eight members (AAP1-AAP8) (Okumoto, 2002). The AAP family members have been proposed to participate in a variety of physiological processes in plants, such as amino acid transport and xylem-phloem transfer (Tegeder, 2012). OsAAP6 has been proved to enhance grain protein content and nutritional quality greatly in rice (Peng et al., 2014). In Arabidopsis, AAP8 mediates amino acid uptake into developing seeds, but its role in seed size control has not been characterized in detail. Here we demonstrate natural allelic variations in AAP8 contribute to grain size and weight. AAP8 acts as a positive factor of seed size and weight control in Arabidopsis. Interestingly, a previously study proposed that loss of function of AAP8 resulted in significant seed abortion (Schmidt et al., 2007) and heavy seeds (Santiago and Tegeder, 2016). It is possible that seed abortion might cause heavy seeds.
In this study, we found that the NIL-SSWCvi had a similar ratio of seed abortion to Ler. Similarly, aap8-1 and aap8-101 mutations did not affect seed abortion compared with the wild type Col-0 under our growth conditions. We also have sufficient evidence to demonstrate that SSW1/AAP8 positively influences seed size and weight. Expression of SSW1/AAP8 complemented the small seed phenotype of aap8-1 (
Sequence analyses reveal that Arabidopsis accessions possess three main types of natural allelic variation in the SSW1/AAP8 gene, including SSW1Cvi, SSW1Ler and SSW1Col-0 types. Most Arabidopsis accessions contain the SSW1Col-0 type, 4.37% Arabidopsis accessions are the SSW1Ler type, and 2.47% Arabidopsis accessions belong to the SSW1Cvi type (
The growth of seeds depends on nitrogen and carbon import from the maternal tissues into developing seeds. Amino acids, the important transport form of nitrogen, are mainly assimilated within plant roots or leaves and then transported to developing fruits and seeds. Arabidopsis AAP8 has been reported to transport amino acids from roots to developing seeds (Schmidt et al., 2007). AAP8 was also crucial for the uptake of amino acids into endosperm (Schmidt et al., 2007). AAP8 is expressed in maternal tissues, such as roots, leaves, flower buds, siliques, funiculi and young seeds (Okumoto, 2002). Thus, it is possible that the delivery of amino acids and carbon from maternal tissues (e.g. roots, leaves, flower buds and siliques) to developing seeds is important for seed size and weight control. Consistent with this, reciprocal cross experiments indicate that SSW1 influences seed size through maternal tissues. Similarly, expression of sucrose transporter (AtSUC2) driven by the phloem protein 2 promoter resulted in large grains in rice (Wang et al., 2015). Arabidopsis AAP1, the closest homolog of AAP8, has been reported to regulate import of amino acids into roots and subsequent translocation into the shoots as well as import of amino acids from the endosperm to the embryo (Lee et al., 2007; Sanders, 2009). Our genetic analyses suggest that AAP8 acts, at least in part, genetically with AAP1 to affect seed size and weight. It is possible that AAP8 and AAP1 might act different steps to transport amino acids to seeds (
Materials and Methods
Plant Materials and Growth Conditions
The near isogenic line CSSL-LCN1-3-3 derived from a cross between two Arabidopsis thaliana ecotypes Ler (Landsberg erecta) and Cvi (Cape Verde Islands). The CSSL-LCN1-3-3 line was backcrossed with Ler for five times to generate the near isogenic line NIL-SSWCvi. The aap8-1 (SALK_092908), aap8-101 (SALK_122286C) and aap1-101 (SALK 078312) were obtained from the NASC and backcrossed into Col-0 for three times. Arabidopsis plants were grown in greenhouse under long-day conditions at 22° C.
Map-Based Cloning, Constructs and Plant Transformation
The SSW1 gene was mapped using the F2 population of a cross between CSSL-LCN1-3-3 and Ler. By using this F2 population, we mapped a major QTL locus for grain size and weight (SSW1). This QTL locus was mapped into the short arm of the chromosome 1 between markers Cvi-m5 and Cvi-m18. To identify the gene underlying the SSW1 locus, we genotyped 10048 F2 plants with newly-developed markers in the mapping region. We selected 33 recombinants between these markers to perform progeny test. Based on progeny test results, we narrowed the candidate gene region containing the SSW1 locus to about 21.71 kb between markers Cvi-m51 and Cvi-m33, which contains four genes (At1g10010, At1g10020, At1g10030 and At1g10040).
The 2,631-bp flanking sequence of 5′ UTR, the At1g10010 gene and 671-bp flanking sequence of 3′UTR from SSW1Cvi and SSW1Ler were amplified using the primers SSW1-gP-1F and SSW1-g3U-1R. To generate gSSW1Cvi-COM and gSSW1Ler-COM constructs, we ligased PCR product to pCR8/GW/TOPO vector, and then ligased to the pMDC99 binary vector using LR reaction (Invitrogen). We transformed the plasmids gSSW1Cvi-COM and gSSW1Ler-COM into the Ler using Agrobacterium tumefaciens line GV3101, and then selected transformants using MS medium supplied with hygromycin (30 μg/mL). We transformed the plasmid gSSW1Cvi-COM into the aap8-1 using the same way.
The 1425-bp coding region of SSW1/AAP8 gene from Col-0 was amplified using primers SSW1-cS-F and SSW1-cE-R. To construct p35S:GFP-SSW1Col-0, we subcloned PCR product to pCR8/GW/TOPO vector, and then ligased to the pMDC43 binary vector using LR reaction (Invitrogen). We transformed the plasmid p35S:GFP-SSW1Col-0 into the Col-0 using Agrobacterium tumefaciens line GV3101, and selected transformants using MS medium supplied with hygromycin (30 μg/mL).
Morphological and Cellular Analysis
Mature dry seeds from 3rd-10th siliques of main stems, cotyledons, leaves and floral organs were harvested to measure their sizes as described previously (Zhang et al., 2015). Mature ovules and developing seeds were photographed using differential interference contrast (DIC) microscope (Leica DM2500) to count cells in the outer integument and measure the length of the outer integument by Image J software.
Subcellular Localization
The Zeiss LSM 710 NLO confocal microscope was used to observe GFP fluorescence signals. Petals were treated with 25 μg/μL propidium iodide and 1 μg/mL fm4-64 to stain cell wall and plasma membrane, and treated with 30% sucrose solution for plasmolysis.
RNA Isolation, RT-PCR and Quantitative Real-Time RT-PCR Analysis
RNAprep pure plant kit (Tiangen) was used to extract total RNA. SuperScript III reverse transcriptase (Invitrogen) was used to reversely transcribe into cDNA. The 7500 Real-Time PCR System (Applied Biosystems) was used to conduct Quantitative real-time RT-PCR (QRT-PCR). An internal control is ACTIN2 mRNA.
Protein and Free Amino Acid Analysis
Extraction of soluble protein was conducted according to Sanders et. al. (Sanders, 2009) with modification. A batch of 100 dry mature seeds were grounded in 200 μL extraction buffer [10% (v/v) glycerol, 100 mM Tris-HCl, 2% (v/v) β-mercaptoethanol and pH 8.0, 0.5% (w/v) SDS]. The resulting 40 μL supernatant after centrifugation in 20,000 g for 10 min was moved to a 1.5 mL microfuge tube and again centrifugated in 20,000 g for 5 min. 4 μL loading buffer [10% (v/v) glycerol, 62.5 mM Tris-HCl, β-mercaptoethanol, 8 M Urea and, 2% (w/v) SDS]. 20 μL supernatant was added into 2 μL bromophenol blue, boiled at 98° C. for 15 min and loaded onto a 15% SDS-PAGE for about 130 min at 100 V after a brief centrifugation.
Free amino acid assays were conducted according to a previously report (Tan et al., 2011). The concentration of free amino acids was calculated by internal standard method, and normalized to the unit dry weight of sample.
Yeast Growth Assay
The coding region sequence of SSW1/AAP8 gene was amplified from SSW1Cvi and Ler cDNA library using primers L-cS-pFL61-infu-F1 and L-cE-pFL61-infu-R2, and then subcloned into yeast expression vector pFL61 to generate the AL and AC plasmids, respectively. The AL and AC constructs and the empty vector were transformed into 22Δ8AA. The transformants were selected on SD/-Ura with Agar media (Clontech Cat. No. 630315, Lot. No. 1504553A). Growth assays were performed on M.am media (Jacobs et al., 1980) lacing uracil with 2.5% (w/v) agar and aspartate at concentrations of 1, 2, 3 mM. Monoclonal transformants were incubated in liquid YPDA media and cultured at 30° C., 200 rpm for about 8-12 h until OD600 nm≈1. After centrifugation precipitates were washed with 0.9% NaCl for three times. We equalized OD600 nm of all samples of yeast cells to about 0.5 with sterilized 0.9% NaCl, and then stroke 10 μL mixture onto plates and culture at 30° C. All experiments were repeated three times with independent colonies.
Site-directed mutagenesis PCR products harboring different nucleotide variations were amplified using primers L-cS-pFL61-infu-F1, L-cE-pFL61-infu-R2 and L-M1-R1, L-M1-F2, L-M2-R1, L-M2-F2, L-M3-R1, L-M3-F1, L-N1-R1, L-N1-F2, L-N2-R1, L-N2-F2, by leading false priming into primers, and then PCR products were subcloned in pFL61 to generate plasmids AM1, AM2, AM3, AN1 and AN2. Plasmids AL, AC, AM1, AM2, AM3, AN1, AN2 and empty vector were transformed into yeast strain 22Δ8AA.
For yeast growth dynamics assays, monoclonal transformants were incubated in liquid YPDA media and cultured at 30° C., 200 rpm for about 8-12 h until OD600 nm≈1. Precipitates after centrifugation were washed with 0.9% NaCl for three times. Yeast cells were added into 5 mL M.am media with 1 mM aspartate (the OD600 nm≈0.1), cultured at 30° C., and used to measure the OD600 nm every 12 hours.
Sequence Listing
Examples of suitable mutation positions (in the wild-type sequence) or mutated nucleotides/amino acids (in the mutated sequences) are highlighted. The invention is not limited to these mutation positions.
CTTTATCAGCATTGTTTTTCACAGATTTTTCAGTTTTCTAGACATTTTTTCTCAGATG
AACAAGGATTTTGTTCATTTGATATCATTTAGATTTTGCCTAACTAGTCTCAATTTAC
GACATGTGTTTTGATTTTCTTCCATTTCTGTCACAATGATGATGGCTGGCGAAAGA
AAAAAAATCTGATCTAAAAATATATATTTAATGCTAAGTTGGAATTTGTAAATCTACA
GTATAATTGGCTCATTTCAACAATTTCTTTCCATGTAAATTTGTTGAAGAACATTATT
GTTGTTGAACAATGAAAGAAAAAAATATGGTTGTTAGAAAAAAATGATTTACGATTT
TGCCAAGTGTGCATGCTCTTTCATGGGAAGATATGAATTAATTATCAAAATCTATAT
AAAAAAAAGGAAGATAATCTTCATTCTTTTCATAACTTAGTTAATAAATTAAATTGATT
AGGATTGGTAACATAGTCAATTCAATTTATCCCGTTAAAGAATGTTATAAATTCGAT
TGTTGACCCCTCGTTGAAAATTTGGAATTATGCGGGATGTTTAGAAACTTTGCCAT
AAGACCAAAAGATTGGTAGTATTTGATAGTAGTACAAGAGTAATCATTTTTCTTCTT
TAATAACATAAAACGCAGGTGGTAAAAAGGTTCAGCTATGTGGAGTGGCACAGTA
GTTCTGAATAAAAATTACTAATAATTGTTTGATTGGTGTTTTTGTACGTCTTCGTTAG
CCTTCTTTATCTTAAAACATAGTGGTTTATATGGATGATTCTTCAAAGTTGACACTA
ACCGTGAAAATGGTATACAATATATATGAAAGGTGGGAAGATTGGTAAGACAGAAT
CTTGTTATTATTAATTTCGCCAAAAAGAGGTAAAATAAGAATACCTTGAAGATAAGA
TGTTATTATTGATTAGAAAGGTAGGAAAAAATATAGATGGATGGATGATGGATCAA
ATAGTTTCATATTTTAGATATGTGAAGCTCTAAAGATAGTGACGCTCTAGTAGTATG
TCTTGTTTATTTTGCAGGACACATTGAGATCAAGCCCACCAGAGAACAAAGTGATG
TAACATACATTTACCGTGTTCAAGTTCATTAAAAGTCTCATTATTGTGTTAGAATTTT
TAGCTTTAACAATTCAGAAGATTGTAGAAATGGAGTTATTACTAAATATTGTTTCTA
AAAAATGCTCTTTTTTTTTTTTTATCCCTGTATTATTCGCAGGTGTATGCGCAGCCG
TTATCAGCATTGTTTTTCACAGATTTTTCAGTTTTCTAGACATTTTTTCTCAGATGAA
CAAGGATTTTGTTCATTTGATATCATTTAGATTTTGCCTAACTAGTCTCAATTTAGG
ACATGTGTTTTGATTTTCTTCCATTTCTGTCACAATGATGATGGCTGGCGAAAGAA
AAAAAATCTGATCTAAAAATATATATTTAATGCTAAGTTGGAATTTGTAAATCTACAG
TATAATTGGCTCATTTCAACAATTTTTTACCATGTAAATTTGTTGAAGAACATTATTG
TTGTTGAACAATGAAAGAAAAAAATATGGTTGTTAGAAAAAAATGATTTACGATTTT
GCCAAGTGTGCATGCTCTTTCATGGGAAGATATGAATTAATTATCAAAATCTATATA
AAAAAAAGGAAGATAATCTTCATTCTTTCATAACTTAGTTAATAAATTAAATTGATTA
GGATTGGTAACATAGTCAATTCAATTTATCCCGTTAAAGAATGTTATAAATTCGATT
GTTGACCCCTCGTTGAAAATTTGGAATTATGCGGGATGTTTAGAAACTTTGCCATA
AGACCAAAAGATTGGTAGTATTTGATAGTAGTACAAGAGTAATCATTTTTCTTCTTT
AATAACATAAAACGCAGGTGGTAAAAAGGTTCAGCTATGTGGAGTGGCACAGTAC
GTAAGTCAAAGATTCTGATTTATTTCGATTATTTTGTTATGGTTATACTAACATGTTG
TTCTGAATAAAATTACTAATAATTGTTTGATTGGTGTTTTTGTACGTCTTCGTTAGA
CCTTCTTTATCTTAAAACATAGTGGTTTATATGGATGATTCTTCAAAGTTGACACTA
CTTGTTATTATTAATTTCGCCAAAGAGAGGTAAATAAGAATACCTTGAAGATAAGA
TGTTATTATTAATTAGACAGTTAGGAAAAAATATAGATGGATGGATGATGGATAAAA
ATAGTTTCATATTTTAGATATGTGAAGCTCTAAAGATAGTGACGCTCTAGTAGTATG
TCTTGTTTATTTTGCAGGACACATTGAGATCAAGCCCACCAGAGAACAAAGTGATG
TAACATACATTTACCGTGTTCAAGTTCATTAAAAGTCTCATTATTGTGTTAGAATTTT
TAGCTTTAACAATTCAGAAGATTGTAGAAATGGAGTTATTACTAAATATTGTTTCTA
AAAAATGCTCTTTTTTTTTTTTTATCCCTGTATTATTCGCAGGTGTATGCGCAGCCG
CTTTATCAGCATTGTTTTTCACAGATTTTTCAGTTTTCTAGACATTTTTTCTCAGATG
AACAAGGATTTTGTTCATTTGATATCATTTAGATTTTGCCTAACTAGTCTCAATTTAG
GACATGTGTTTTGATTTTCTTCCATTTCTGTCACAATGATGATGGCTGGCGAAAGA
AAAAAAATCTGATCTAAAAATATATATTTAATGCTAAGTTGGAATTTGTAAATCTACA
GTATAATTGGCTCATTTCAACAATTTTTTACCATGTAAATTTGTTGAAGAACATTATT
GTTGTTGAACAATGAAAGAAAAAAATATGGTTGTTAGAAAAAAATGATTTACGATTT
TGCCAAGTGTGCATGCTCTTTCATGGGAAGATATGAATTAATTATCAAAATCTATAT
AAAAAAAAGGAAGATAATCTTCATTCTTTCATAACTTAGTTAATAAATTAAATTGATT
AGGATTGGTAACATAGTCAATTCAATTTATCCCGTTAAAGAATGTTATAAATTCGAT
TGTTGACCCCTCGTTGAAAATTTGGAATTATGCGGGATGTTTAGAAACTTTGCCAT
AAGACCAAAAGATTGGTAGTATTTGATAGTAGTACAAGAGTAATCATTTTTCTTCTT
TAATAACATAAAACGCAGGTGGTAAAAAGGTTCAGCTATGTGGAGTGGCACAGTA
GTTCTGAATAAAATTACTAATAATTGTTTGATTGGTGTTTTTGTACGTCTTCGTTAG
CCTTCTTTATCTTAAAACATAGTGGTTTATATGGATGATTCTTCAAAGTTGACACTA
ACCGTGAAAATGGTATACAATATATATGAAAGGTGGGAAGATTGGTAAGACAGAAT
CTTGTTATTATTAATTTCGCCAAAGAGAGGTAAAATAAGAATACCTTGAAGATAAGA
ATAGTTTCATATTTTAGATATGTGAAGCTCTAAAGATAGTGACGCTCTAGTAGTATG
TCTTGTTTATTTTGCAGGACACATTGAGATCAAGCCCACCAGAGAACAAAGTGATG
TAACATACATTTACCGTGTTCAAGTTCATTAAAAGTCTCATTATTGTGTTAGAATTTT
TAGCTTTAACAATTCAGAAGATTGTAGAAATGGAGTTATTACTAAATATTGTTTCTA
AAAAATGCTCTTTTTTTTTTTTTATCCCTGTATTATTCGCAGGTGTATGCGCAGCCG
CTTTATCAGCATTGTTTTTCACAGATTTTTCAGTTTTCTAGACATTTTTTCTCAGATG
AACAAGGATTTTGTTCATTTGATATCATTTAGATTTTGCCTAACTAGTCTCAATTTAC
GACATGTGTTTTGATTTTCTTCCATTTCTGTCACAATGATGATGGCTGGCGAAAGA
AAAAAAATCTGATCTAAAAATATATATTTAATGCTAAGTTGGAATTTGTAAATCTACA
GTATAATTGGCTCATTTCAACAATTTCTTTCCATGTAAATTTGTTGAAGAACATTATT
GTTGTTGAACAATGAAAGAAAAAAATATGGTTGTTAGAAAAAAATGATTTACGATTT
TGCCAAGTGTGCATGCTCTTTCATGGGAAGATATGAATTAATTATCAAAATCTATAT
AAAAAAAAGGAAGATAATCTTCATTCTTTCATAACTTAGTTAATAAATTAAATTGATT
AGGATTGGTAACATAGTCAATTCAATTTATCCCGTTAAAGAATGTTATAAATTCGAT
TGTTGACCCCTCGTTGAAAATTTGGAATTATGCGGGATGTTTAGAAACTTTGCCAT
AAGACCAAAAGATTGGTAGTATTTGATAGTAGTACAAGAGTAATCATTTTTCTTCTT
TAATAACATAAAACGCAGGTGGTAAAAAGGTTCAGCTATGTGGAGTGGCACAGTA
GTTCTGAATAAAATTACTAATAATTGTTTGATTGGTGTTTTTGTACGTCTTCGTTAG
CCTTCTTTATCTTAAAACATAGTGGTTTATATGGATGATTCTTCAAAGTTGACACTA
ACCGTGAAAATGGTATACAATATATATGAAAGGTGGGAAGATTGGTAAGACAGAAT
CTTGTTATTATTAATTTCGCCAAAAAGAGGTAAAATAAGAATACCTTGAAGATAAGA
TGTTATTATTGATTAGAAAGGTAGGAAAAAATATAGATGGATGGATGATGGATCAA
ATAGTTTCATATTTTAGATATGTGAAGCTCTAAAGATAGTGACGCTCTAGTAGTATG
TCTTGTTTATTTTGCAGGACACATTGAGATCAAGCCCACCAGAGAACAAAGTGATG
TAACATACATTTACCGTGTTCAAGTTCATTAAAAGTCTCATTATTGTGTTAGAATTTT
TAGCTTTAACAATTCAGAAGATTGTAGAAATGGAGTTATTACTAAATATTGTTTCTA
AAAAATGCTCTTTTTTTTTTTTTATCCCTGTATTATTCGCAGGTGTATGCGCAGCC
RICE
SOYBEAN
MAIZE
BRASSICA NAPUS
BARLEY
WHEAT
BRASSICA RAPA
BRASSICA OLERACEA
BRASSICA CRETICA
Number | Date | Country | Kind |
---|---|---|---|
PCT/CN2019/104566 | Sep 2019 | CN | national |
Filing Document | Filing Date | Country | Kind |
---|---|---|---|
PCT/EP2020/074858 | 9/4/2020 | WO |