Patent Application
20250101485
The contents of the electronic sequence listing (M065670522W000 -SEQ-KVC.xml; Size: 83,140 bytes; and Date of Creation: Jan. 19, 2023) is herein incorporated by reference in its entirety.
Provided herein are methods and compositions related to producing carotenoids from acid whey.
Acid whey (AW) is a liquid waste by-product whose untreated disposal poses a serious environmental problem due to its high organic content. In the United States it is mainly produced in the manufacture of the increasingly popular Greek yogurt, but there are also other big sources around the world such as the manufacture of paneer. It is estimated that more than 3 million tons of AW are generated in the United States of America each year. This places an economic burden on the dairy industry, but at the same time presents a great opportunity as it can be used for the production of valuable products.
The present disclosure relates, at least in part, to methods and compositions for producing carotenoids from acid whey. Aspects of the present disclosure relate to modified yeast cells capable of producing carotenoids from acid whey. In some embodiments, the present disclosure relates to modified yeast cells capable of converting acid whey to pyruvate, either through lactic acid metabolism, glucose metabolism, or galactose metabolism through the Leloir pathway. In some embodiments, the present disclosure relates to modified yeast cells capable of converting pyruvate to lycopene through the mevalonate pathway. In some embodiments, the present disclosure relates to modified yeast cells capable of converting lycopene to astaxanthin and/or lutein. In some embodiments, the modified yeast cells described herein are modified to overcome substrate inhibition. Aspects of the present disclosure relate to a genetically modified yeast cell (modified cell) comprising: a heterologous gene, wherein the heterologous gene encodes an enzyme having beta-galactosidase (LacA) activity; one or more heterologous genes encoding one or more enzymes capable of converting lactic acid to pyruvate; one or more heterologous genes encoding one or more enzymes of the Leloir pathway; and one or more heterologous genes encoding one or more enzymes of the mevalonate pathway. In some embodiments, the modified cell is an oleaginous yeast cell. In some embodiments, the oleaginous cell is a Yarrowia lipolytica cell.
In some embodiments, the one or more heterologous genes encoding one or more enzymes capable of converting lactic acid to pyruvate is/are selected from the group consisting of a lactate transporter (JEN1) and lactate dehydrogenase (LDH). In some embodiments, the one or more heterologous genes encoding one or more enzymes of the Leloir pathway is/are selected from the group consisting of GAL10M, GAL1, GAL7, and GAL10E. In some embodiments, the one or more heterologous genes encoding one or more enzymes of the mevalonate pathway is/are selected from the group consisting of GGPPS, CarRP, and CarB. In some embodiments, the GGPPS is GGPPSxd derived from Xanthophyllomyces dendrorhous, GGPPSsa derived from Sulfolobus acidocaldarius, GGPPStc derived from Taxus canadensis, GGPPSpa derived from Pantoea agglomerans, GGPPSyl derived from Yarrowia lipolytica.
In some embodiments, the modified cell further comprises a heterologous gene encoding an enzyme having lycopene beta cyclase activity. In some embodiments, the enzyme having lycopene beta cyclase activity comprises an amino acid sequence at least 90% identical to the amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the enzyme having lycopene beta cyclase activity comprises an amino acid sequence set forth in any one of SEQ ID NOs: 2-4. In some embodiments, the modified cell further comprises a heterologous gene encoding tHMGR, ERG12, IDI, and ERG20 of the Mevalonate (MVA) pathway, and/or Choline Kinase (CK) and Isopentenyl Phosphate Kinase (IPK). In some embodiments, the modified cell further comprises: a heterologous gene encoding an enzyme having beta-carotene ketolase (CrtW) activity; and a heterologous gene encoding an enzyme having beta-carotene hydroxylase (CrtZ) activity. In some embodiments, the enzyme having CrtW activity is fused to the enzyme having CrtZ activity. In some embodiments, the CrtW/CrtZ fusion enzyme comprises a localization signal. In some embodiments, the localization signal targets the CrtW/CrtZ fusion enzyme to the endoplasmic reticulum, peroxisome, and/or lipid bodies.
In some embodiments, the modified cell further comprises a heterologous gene encoding an enzyme having lycopene beta cyclase activity and/or a heterologous gene encoding an enzyme having lycopene epsilon cyclase activity. In some embodiments, the enzyme having lycopene beta cyclase activity comprises an amino acid sequence at least 90% identical to the amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the modified cell further comprises a heterologous gene encoding an enzyme having carotenoid hydroxylase 1 (LUT1) activity and/or a heterologous gene encoding an enzyme having carotenoid hydroxylase 5 (LUT5) activity.
In some embodiments, the modified yeast cell described herein in capable of overcoming substrate inhibition. The term “substrate inhibition,” as used herein, refers to the most common deviation from Michaelis-Menten kinetics, occurring in approximately 25% of known enzymes. Substrate inhibition occurs when the concentration of an enzymatic substrate exceeds the optimal parameter and reduces the growth rate of a cell.
Another aspect of the present disclosure relates to a genetically modified yeast cell (modified cell) comprising: a first heterologous gene, wherein the first heterologous gene encodes an enzyme having beta-carotene ketolase (CrtW) activity; and a second heterologous gene, wherein the second heterologous gene encodes an enzyme having beta-carotene hydroxylase (CrtZ) activity; wherein the modified cell produces beta-carotene. In some embodiments, the modified cell is an oleaginous yeast cell. In some embodiments, the oleaginous cell is a Yarrowia lipolytica cell. In some embodiments, the enzyme having CrtW activity is fused to the enzyme having CrtZ activity. In some embodiments, the CrtW/CrtZ fusion enzyme comprises a localization signal. In some embodiments, the localization signal targets the CrtW/CrtZ fusion enzyme to the endoplasmic reticulum, peroxisome, and/or lipid bodies.
Another aspect of the present disclosure relates to a method of converting a carbon source to lycopene and/or beta-carotene, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to lycopene and/or beta-carotene. In some embodiments, the carbon source is acid whey. In some embodiments, the carbon source is converted to lycopene. In some embodiments, the carbon source is converted to beta-carotene.
Another aspect of the present disclosure relates to a method of converting a carbon source to astaxanthin, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to astaxanthin. In some embodiments, the carbon source is acid whey.
Another aspect of the present disclosure relates to a method of converting a carbon source to alpha-carotene, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to alpha-carotene. In some embodiments, the carbon source is acid whey.
Another aspect of the present disclosure relates to a method of converting a carbon source to lutein, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to lutein. In some embodiments, the carbon source is acid whey.
Another aspect of the present disclosure relates to an enzyme having lycopene beta cyclase activity comprising an amino acid sequence set forth in SEQ ID NO: 2. Another aspect of the present disclosure relates to an enzyme having lycopene beta cyclase activity comprising an amino acid sequence set forth in SEQ ID NO: 3. Another aspect of the present disclosure relates to an enzyme having lycopene beta cyclase activity comprising an amino acid sequence set forth in SEQ ID NO: 4.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
This invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of being carried out in various ways. Also, the phraseology and terminology used in this disclosure is for the purpose of description and should not be regarded as limiting. The use of “including,” “comprising,” or “having,” “containing,” “involving,” and variations of thereof in this disclosure, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items. As used in this specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the content clearly dictates otherwise.
The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims.
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented in this disclosure. The accompanying drawings are not intended to be drawn to scale. The drawings are illustrative only and are not required for enablement of the disclosure. For purposes of clarity, not every component may be labeled in every drawing. In the drawings:
The present disclosure relates to a method of converting industry waste (e.g., dairy waste) to valuable food and feed ingredients (e.g. carotenoids) and/or microbial animal feed using engineered yeast cells. These ingredients can be the naturally occurring products that belong to the family of isoprenoids (also known as terpenoids) and are synthesized mainly by plants. Specifically, the present disclosure describes the synthesis of carotenoid compounds, such as lycopene, beta-carotene, and astaxanthin from dairy industry waste, and metabolic and protein engineering strategies for the enhanced synthesis thereof. Other products of the isoprenoid family can be similarly synthesized from acid whey (AW) waste.
Currently, the two most common uses of AW are either as fertilizer directly added to the soil, or mixed with silage to feed livestock. However, in both cases, the amount of AW that can be used is limited, and these are low-value applications. Conversely, treatment of AW in wastewater treatment facilities adds to the cost of production of many food products. Overall, no good solution exists while a large volume of potential fermentable nutrients such as lactose, galactose, and lactic acid remains unutilized (Menchik, et al. 2019). Moreover, this yellowish AW by-product is unappealing to the food industry as its acidic and salty taste, high levels of ash, and low levels of protein limit its food applications (Lievore, et al. 2015).
Dairy industry companies have been trying to develop alternative approaches to handle AW. For instance, Chobani (Norwich, NY) and Commonwealth Dairy (Brattleboro, VT) use a reverse-osmosis filtration system to recover water from AW and reduce transportation costs. Others, such as General Mills (Minneapolis, MN), use anaerobic digestion to convert AW to methane, which can subsequently be used to cover some of the energy needs of the plant, via methane fed electrical generators. However, these are all low-added value processes and the revenue generated by converting AW to methane has been relatively low. General Mills has also developed methods to either neutralize AW to use it in food products as a bulking agent or a nutrient fortifier (U. S. Patent Pub. 2014/0348981), or to produce oligosaccharides that could serve as soluble fiber in cereals or baked goods (U. S. Patent Pub. 2014/0348979). Danone describes a method to generate AW with stable lactose content to enable a more consistent way of isolating lactose (International Patent No. WO 2016/177701 A1). Arla Food Ingredients (Viby, Denmark) and Ultima Foods (Quebec, Canada) utilize protein solutions and ultrafiltration, respectively, in an attempt to minimize AW generation during food production.
Apart from dairy products companies, many research groups have tried to find ways to utilize AW. For instance, a method for producing glucose/galactose syrup and whey protein from AW has been suggested using a combination of ultrafiltration and acid-catalyzed thermal hydrolysis of lactose (Lindsay et al., 2018). However, this approach requires costly ultrafiltration membranes to isolate whey protein, and high temperatures to hydrolyze lactose. Moreover, undesired acid-catalyzed degradation reactions limit product yields, while the value of the final product is low. Medium-chain carboxylic acids (MCCAs), such as n-caproic acid, have been another group of compounds that has been targeted as a product from AW fermentation using microbiomes (Xu et al., 2018). The use of a single bioreactor resulted in low specificity regarding the production of MCCAs; therefore, a more intricate system had to be used, phasing the microbiomes into different operating conditions. This system employing bioreactors in series adds to the process cost and suffers from challenges in scalability. Recently, AW was used as an alternative growth medium for a microalgae aiming to produce the enzyme β-galactosidase (Bentahar et al., 2019). In another work, researchers attempted to convert lactose present in AW into galactooligosaccharides (GOS), using two commercially available β-galactosidases from Aspergillus oryzae and Kluyveromyces lactis achieving low GOS yields.
Furthermore, several reports mention the use of AW in fermented milk beverages to take advantage of the nutrients found in AW and substitute water (Lievore et al., 2015; Skryplonek,] et al, 2019). However, the salty and sour taste of AW compromises the required traits of the fermented beverage in terms of flavor, aroma, and aftertaste. Additionally, the use of AW in fermented milk products has been reported to change the viscosity and thus the texture of the product resulting in lower preference during sensory evaluation (Lievore et al., 2015). Masking the flavor and odor of AW would require the addition of extra ingredients, albeit at increased costs.
Natural products are a rich source of bioactive molecules whose diverse properties have supported numerous applications in the pharmaceutical, food and flavor-fragrance industries (Atanasov et al., 2015; Cragg, 1998; Dhingra et al., 1999; Dzubak et al., 2006; Zhou et al., 2009). Due to their structural complexity and very low content in natural sources, chemical synthesis of these compounds and extraction from plants have presented particular challenges (Chemler and Koffas, 2008; Martin et al., 2003), prompting efforts for their production by engineered microorganisms. Most metabolic engineering efforts for the production of chemical products mainly focus on manipulating functional reconstitution of metabolic pathways in the cytosol. However, this strategy often results in poor yields, or formation of undesirable by-products, because of intricate cellular metabolism involving extensive cross-talk and elaborate regulatory mechanisms (Ajikumar et al., 2010; Martin et al., 2003). In this regard, the natural intracellular compartmentalization of eukaryotic cells can provide inspiration for the type of metabolic engineering that can successfully address these challenges (Hammer and Avalos, 2017).
The present disclosure also relates to the construction of engineered yeast cells by applying metabolic and protein engineering strategies allowing for the production of intracellular carotenoid compounds at high concentrations using either glucose or AW as feedstock. The carotenoid compounds, after a purification step, can be used as antioxidants (food fortification), food colorants, dietary supplements, feed additives, and in cosmetics or personal care products. Another product can be microbial animal feed enriched with carotenoids.
The main advantages of this technology are: (1) no prior treatment of AW is required and the bioprocess can be conducted under non-sterile conditions, (2) complete utilization of AW generating a water stream free from organic compounds, (3) synthesis of high value-added specialty ingredients and co-production of microbial animal feed, favorable to the process economics, (4) capability of using both dilute and concentrated AW, (5) simple and scalable fermentation process, (6) GRAS host microorganism allowing for the safe implementation of the technology into existing creamery facilities, which also means immediate access to feedstock, (7) footprint comparable to the area occupied by AW storage tanks, and (8) significant revenue increase over the production of food products and cutting costs related to waste treatment and transportation of AW to farms, resulting in up to 38% increase in revenues over the current Greek yogurt manufacture, for example.
The present disclosure also relates to methods of compartmentalizing metabolic pathways within subcellular organelles of yeast. Subcellular organelles have been receiving growing attention due to their unique physicochemical environments, and enzymatic, metabolite and cofactor contents that may offer favorable conditions for the functioning of different metabolic pathways (Ayer et al., 2013; Hammer and Avalos, 2017). Assembling pathways within smaller subcellular compartments not only increases local substrate and enzyme concentrations resulting in faster reaction rates, but also prevents diversion of intermediates to competing pathways (Avalos et al., 2013). To date, most explorations of metabolic pathway compartmentalization in yeast were carried out with the model organism Saccharomyces cerevisiae, including harnessing mitochondria for fuels, chemicals and drugs (Avalos et al., 2013; Farhi et al., 2011; Szczebara et al., 2003; Yuan and Ching, 2016), compartmentalizing pathways in peroxisomes (Sheng et al., 2016; Zhou et al., 2016), targeting the ER and Golgi for fuel and drug production (Thodey et al., 2014), and vacuolar compartmentalization (Bayer et al., 2009). Targeting biosynthetic pathways to these subcellular compartments has benefited the production of the desired products in this organism. On the other hand, despite these advantages of organelle engineering, its full potential in the oleaginous yeast Yarrowia lipolytica remains largely unexplored. There is an opportunity to capitalize on the prospect of pathway compartmentalization in this yeast due to its unique ability to accumulate large amounts of intracellular lipids in the form of lipid droplets.
Astaxanthin, a high-valued carotenoid-derivative pigment, has been the subject of growing interest due to its broad applications in the food, animal feed, nutraceuticals, cosmetics, and pharmaceutical industries (Ambati et al., 2014). These applications are due to its strong antioxidant (Hama et al., 2012), anti-inflammatory (Bennedsen et al., 2000), and anti-cancer activity (Chew et al., 1999). Traditional methods of astaxanthin production include chemical synthesis and extraction from natural sources. However, biosafety concerns with chemical routes and the high cost and variability of products made by the extraction route limit its extensive application (Qi et al., 2020). Alternatively, metabolic pathway engineering for astaxanthin biosynthesis has been successfully demonstrated in various host organisms, generally occurring in the cellular cytoplasm (Diao et al., 2020; Gong et al., 2020; Henke et al., 2018; Jiang et al., 2020; Jin et al., 2018; Kildegaard et al., 2017; Lemuth et al., 2011; Li et al., 2020; Lu et al., 2017; Ma et al., 2016; Nogueira et al., 2019; Park et al., 2018; Qi et al., 2020; Scaife et al., 2009; Scaife et al., 2012; Tramontin et al., 2019; Ukibe et al., 2009; Wang et al., 2017; Zhang et al., 2018; Zhou et al., 2019; Zhou et al., 2017; Zhou et al., 2015). Astaxanthin yields in these engineered microbes are rather low for cost-effective commercialization, mainly owing to poor conversion efficiency of the precursor β-carotene to astaxanthin.
Metabolic engineering approaches for the production of high-value chemicals in microorganisms mostly use the cytosol as general reaction vessel. However, sequestration of enzymes and substrates, and metabolic cross-talk frequently prevent efficient synthesis of target compounds in the cytosol. Organelle compartmentalization in eukaryotic cells suggests ways for overcoming these challenges. In some embodiments, the present disclosure relates to expressing the astaxanthin biosynthesis pathway in sub-organelles of the oleaginous yeast Yarrowia lipolytica. In some embodiments, enzymes of the astaxanthin pathway may be fused together to improve substrate activity and reaction efficiency. In some embodiments, the fusion of two enzymes converting β-carotene to astaxanthin, β-carotene ketolase and hydroxylase, performs better than the expression of individual enzymes. In some embodiments, individual or fusion enzymes of the astaxanthin biosynthesis pathway are expressed in compartments of lipid body, endoplasmic reticulum or peroxisome. In some embodiments, targeting the astaxanthin pathway to subcellular organelles not only accelerates the conversion of β-carotene to astaxanthin, but also significantly decreases accumulation of the ketocarotenoid intermediates.
The present disclosure relates, at least in part, to methods and compositions for producing carotenoids from acid whey. Aspects of the present disclosure relate to modified yeast cells (e.g., oleaginous yeast cells) capable of producing carotenoids from acid whey. The term “oleaginous yeast cell,” as used herein, refers to yeast cells rich in membrane structure and subcellular compartments, which provide a hydrophobic environment ideal for metabolic engineering and the production of industrial products. In some embodiments, the oleaginous yeast cells are oleaginous yeast cells that utilize acetate for cell growth and product synthesis. For example, in some embodiments the oleaginous yeast cells are Yarrowia lipolytica cells. Y. lipolytica is a non-pathogenic oleaginous yeast that can use a variety of carbon sources, including organic acids, hydrocarbons and various fats and oils. The term “oleaginous” refers to a microbe that can accumulate more than 20% of its dry cell weight as lipid (see C. Ratledge et al., Microbial routes to lipids. Biochem Soc Trans. 1989 December; 17(6):1139-41). Exemplary oleaginous cells include yeasts such as Yarrowia lipolytica, Candida 107, Rhodotorula glutinis, Rhodosporidium toruloides, Cryptococcus curvatus, Trichosporon pullulan, Lipomyces lipofer, Schwanniomyces occidentalis and other species from among Yarrowia, Lipomyces, Rhodosporidium and Cryptococcus; oleaginous bacteria such as those Rhodococcus, Acinetobacter and Streptomyces; and oleaginous algae and microalgae.
Aspects of the present disclosure relate to a genetically modified yeast cell (modified cell) comprising: a heterologous gene, wherein the heterologous gene encodes an enzyme having beta-galactosidase (LacA) activity; one or more heterologous genes encoding one or more enzymes capable of converting lactic acid to pyruvate; one or more heterologous genes encoding one or more enzymes of the Leloir pathway; and one or more heterologous genes encoding one or more enzymes of the mevalonate pathway. In some embodiments, the modified cell is an oleaginous yeast cell. In some embodiments, the oleaginous cell is a Yarrowia lipolytica cell. In some embodiments, a polynucleotide comprising the gene is delivered to the cell. In some embodiments, the cell comprises a polynucleotide comprising the gene. In some embodiments, the enzyme encoded by the gene is delivered to the cell. In some embodiments, the cell comprises the enzyme encoded by the gene. In some embodiments, the gene is a heterologous gene. In some embodiments, the polynucleotide is a heterologous polynucleotide. In some embodiments, the enzyme is a heterologous enzyme. The term “heterologous,” as may be used herein, is used interchangeably with the term “recombinant” and the term “exogenous.” A heterologous gene, polynucleotide, or enzyme refers to a gene, polynucleotide, or enzyme that has been introduced to or expressed in a host cell. A heterologous gene is a gene that has been introduced to or expressed in a host cell. A heterologous polynucleotide is a polynucleotide that has been introduced to or expressed in a host cell. A heterologous enzyme is an enzyme that has been introduced to or expressed in a host cell. In some embodiments, the heterologous gene, polynucleotide, or enzyme comes from a different organism or species from the host cell. In some embodiments, the heterologous gene, polynucleotide, or enzyme is a synthetic gene, polynucleotide, or enzyme. In some embodiments, the heterologous gene, polynucleotide, or enzyme is an additional copy of a gene, polynucleotide, or enzyme that is endogenously expressed by the host cell. In some embodiments, a heterologous gene may be modified by a mutation. The term “mutation,” as may be used herein, refers to a change, alteration, or modification to a nucleotide in a nucleic acid as compared to its wild-type sequence. For example, without limitation, mutations may include substitutions, insertions, deletions, or any combination of the same. In some embodiments, there at least one mutation. In some embodiments, there are more than one mutation. In some embodiments, where there is more than one mutation, the mutations are distinct (e.g., not of the same type (e.g., substitutions, insertions, deletions)). In some embodiments, where there is more than one mutation, the mutations are the same (e.g., not of the same type (e.g., substitutions, insertions, deletions)). Additionally, in some embodiments, the mutations result in a frameshift.
Mutations, which as described hereinabove, are regions (e.g., sections, portions, nucleobases, nucleosides, nucleotides) of a given nucleic acid (e.g., DNA, RNA) which differ as compared to their wild-type nucleic acid, will most often be reflected in each strand of a nucleic acid. That is to say that, when a mutation is present in a sample it and its complement will be observed in each strand of the nucleic acid when sequenced. This presents a problem however, when considering that a sample may contain single-stranded portions (e.g., gaps, overhangs), or areas which may instigate strand resynthesis (e.g., nicks). This problem presents because if a damaged base is present in such single-stranded region, or other region which is resynthesized, a damaged base may instruct the synthesis of its complementary strand to include a base which was not originally present in the nucleic acid from which the sample was generated (because damaged bases can affect non-canonical base pairings). The same could happen if one strand contains mismatched bases. In such instances, the mismatch will show a paired match in the re-synthesized complement instead of it's native mismatched base. When this happens, a sequencing of both strands will read a mutation in each of the strands, thus show a mutation, however, this mutation may not be a true reflection of the original nucleic acid. Such mutations are termed “false mutations,” herein. False mutations are mutations which result from the resynthesis of complementary strands of nucleic acid, which do not represent the original (e.g., native, wild-type) complementary strand of nucleic acid from which the sample was obtained.
The terms “wild type” and “native,” as may be used interchangeably herein, are terms of art understood by skilled artisans and mean the typical form of an item, organism, strain, gene, or characteristic as it occurs in nature as distinguished from engineered, mutant, or variant forms.
In some embodiments, the one or more heterologous genes encoding one or more enzymes capable of converting lactic acid to pyruvate is/are selected from the group consisting of a lactate transporter (JEN1) and lactate dehydrogenase (LDH). In some embodiments, the one or more heterologous genes encoding one or more enzymes of the Leloir pathway is/are selected from the group consisting of GAL10M, GAL1, GAL7, and GAL10E.
The Leloir pathway is a metabolic pathway that is known in the art. The Leloir pathway is used by cells for the catabolism of D-galactose. The term “catabolism,” as used herein, refers to the metabolic process of breaking down complex molecules (e.g., D-galactose) in living organisms to form simpler ones (e.g., glucose-1-phosphate). As will be known by a person having ordinary skill in the art, the Leloir pathway converts galactose to glucose-1-phosphate, inter alia, through the enzymatic activities of GAL10M, GAL1, GAL7, and GALE. In some embodiments, the Leloir pathway is used in modified cells to produce pyruvate.
In some embodiments, the one or more heterologous genes encoding one or more enzymes of the mevalonate pathway is/are selected from the group consisting of geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase (CarRP), and phytoene desaturase (CarB). In some embodiments, the GGPPS is GGPPSxd derived from Xanthophyllomyces dendrorhous, GGPPSsa derived from Sulfolobus acidocaldarius, GGPPStc derived from Taxus canadensis, GGPPSpa derived from Pantoea agglomerans, GGPPSyl derived from Yarrowia lipolytica.
The mevalonate (MVA) pathway is another metabolic pathway that is known in the art. The MVA pathway, also known as the isoprenoid pathway or HMG-CoA reductase pathway, is an essential metabolic pathway that produces, inter alia, isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAP) from acetyl CoA. In some embodiments, IPP and DMAP in the MVA pathway are further metabolized to farnesyl diphosphate (FPP). In some embodiments, FPP in the MVA pathway is further metabolized to geranylgeranyl pyrophosphate (GGPP) by a GGPPs (e.g. GGPPSxd, GGPPSsa, GGPPStc, GGPPSpa, GGPPSyl). In some embodiments, GGPP in the MVA pathway is further metabolized to phytoene by a CarRP. In some embodiments, phytoene in the MVA pathway is further metabolized to lycopene by a CarB.
In some embodiments, the modified cell further comprises a heterologous gene encoding an enzyme having lycopene beta cyclase activity. The amino acid sequence of the lycopene beta cyclase enzyme is provided here as SEQ ID NO: 1:
In some embodiments, the enzyme having lycopene beta cyclase activity comprises an amino acid sequence at least 90% identical to the amino acid sequence as set forth in SEQ ID NO: 1. The terms “percent identity,” “sequence identity,” “% identity,” “% sequence identity,” and % identical,” as they may be interchangeably used herein, refer to a quantitative measurement of the similarity between two sequences (e.g., nucleic acid or amino acid). The percent identity of genomic DNA sequence, intron and exon sequence, and amino acid sequence between humans and other species varies by species type, with chimpanzee having the highest percent identity with humans of all species in each category.
Calculation of the percent identity of two nucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and second nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; each of which is incorporated herein by reference. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Atschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
When a percent identity is stated, or a range thereof (e.g., at least, more than, etc.), unless otherwise specified, the endpoints shall be inclusive and the range (e.g., at least 70% identity) shall include all ranges within the cited range (e.g., at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 95.5%,at least 96%, at least 96.5%, at least 97%, at least 97.5%, at least 98%, at least 98.5%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% identity) and all increments thereof (e.g., tenths of a percent (e.g., 0.1%), hundredths of a percent (e.g., 0.01%), etc.).
In some embodiments, the lycopene beta cyclase enzyme (SEQ ID NO: 1) is modified or mutated to increase or decrease enzymatic activity. In some embodiments, the In some embodiments, the enzyme having lycopene beta cyclase activity comprises an amino acid sequence set forth in any one of SEQ ID NOs: 2-4. In some embodiments, comprises the following amino acid substitutions relative to SEQ ID NO: 1: Y27R; V175W; T31R; F92W; or T31R and F92W.
The amino acid sequence of one such modified lycopene beta cyclase activity is provided here as SEQ ID NO: 2:
The amino acid sequence of another such modified lycopene beta cyclase activity is provided here as SEQ ID NO: 3:
The amino acid sequence of yet another such modified lycopene beta cyclase activity is provided here as SEQ ID NO: 4:
In some embodiments, the modified cell further comprises a heterologous gene encoding tHMGR, ERG12, IDI, and ERG20 of the Mevalonate (MVA) pathway, and/or Choline Kinase (CK) and Isopentenyl Phosphate Kinase (IPK). In some embodiments, the modified cell further comprises: a heterologous gene encoding an enzyme having beta-carotene ketolase (CrtW) activity; and a heterologous gene encoding an enzyme having beta-carotene hydroxylase (CrtZ) activity. In some embodiments, the enzyme having CrtW activity is fused to the enzyme having CrtZ activity. In some embodiments, the CrtW/CrtZ fusion enzyme comprises a localization signal. In some embodiments, the localization signal targets the CrtW/CrtZ fusion enzyme to the endoplasmic reticulum, peroxisome, and/or lipid bodies. The term “fusion enzyme,” as used herein, refers to an enzymatic protein that comprises two or more separate proteins. In some embodiments, a fusion enzyme is created through the joining of two or more genes that originally encode separate proteins. In some embodiments, two or more genes joined together are translated into a single protein or enzyme. The term “localization signal” refers to a peptide fragment expressed on a protein of interest that mediates the transport of said protein to a target location inside or outside of the cell. In some embodiments, the localization signal is a short peptide fragment. In some embodiments, the localization signal targets the protein to the endoplasmic reticulum. In some embodiments, the localization signal targets the protein to the peroxisome. In some embodiments, the localization signal targets the protein to lipid bodies of the cell.
In some embodiments, the modified cell further comprises a heterologous gene encoding an enzyme having lycopene beta cyclase activity and/or a heterologous gene encoding an enzyme having lycopene epsilon cyclase activity. In some embodiments, the modified cell further comprises a heterologous gene encoding an enzyme having carotenoid hydroxylase 1 (LUT1) activity and/or a heterologous gene encoding an enzyme having carotenoid hydroxylase 5 (LUT5) activity.
Another aspect of the present disclosure relates to a genetically modified yeast cell (modified cell) comprising: a first heterologous gene, wherein the first heterologous gene encodes an enzyme having beta-carotene ketolase (CrtW) activity; and a second heterologous gene, wherein the second heterologous gene encodes an enzyme having beta-carotene hydroxylase (CrtZ) activity; wherein the modified cell produces beta-carotene. In some embodiments, the modified cell is an oleaginous yeast cell. In some embodiments, the oleaginous cell is a Yarrowia lipolytica cell. In some embodiments, the enzyme having CrtW activity is fused to the enzyme having CrtZ activity. In some embodiments, the CrtW/CrtZ fusion enzyme comprises a localization signal. In some embodiments, the localization signal targets the CrtW/CrtZ fusion enzyme to the endoplasmic reticulum, peroxisome, and/or lipid bodies.
Another aspect of the present disclosure relates to a method of converting a carbon source to lycopene and/or beta-carotene, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to lycopene and/or beta-carotene. In some embodiments, the carbon source is acid whey. In some embodiments, the carbon source is converted to lycopene. In some embodiments, the carbon source is converted to beta-carotene. The term “carbon source,” as used herein, relates to any natural or artificial sources of carbon, such as carbon dioxide, methane, or acid whey.
Another aspect of the present disclosure relates to a method of converting a carbon source to astaxanthin, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to astaxanthin. In some embodiments, the carbon source is acid whey.
Another aspect of the present disclosure relates to a method of converting a carbon source to alpha-carotene, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to alpha-carotene. In some embodiments, the carbon source is acid whey.
Another aspect of the present disclosure relates to a method of converting a carbon source to lutein, comprising: contacting a modified cell described herein with a carbon source; and incubating the modified cell with the carbon source for a sufficient time to convert the carbon source to lutein. In some embodiments, the carbon source is acid whey.
Another aspect of the present disclosure relates to an enzyme having lycopene beta cyclase activity comprising an amino acid sequence set forth in SEQ ID NO: 2. Another aspect of the present disclosure relates to an enzyme having lycopene beta cyclase activity comprising an amino acid sequence set forth in SEQ ID NO: 3. Another aspect of the present disclosure relates to an enzyme having lycopene beta cyclase activity comprising an amino acid sequence set forth in SEQ ID NO: 4.
The details of one or more embodiments of the methods and products disclosed herein are set forth in the description below. Other features or advantages of the methods and products disclosed herein will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims.
The terms “approximately” or “about,” as may be used interchangeably herein, and as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction of (i.e., percentage greater than or percentage less than) the stated reference value unless otherwise stated or otherwise evident from the context (for example, when such number would exceed 100% of a possible value).
The phraseology and terminology used in this application is for the purpose of description and should not be regarded as limiting. The use of terms such as “including,” “comprising,” “having,” “containing,” “involving,” and/or variations thereof in this application, is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.
The methods and products disclosed herein is further illustrated by the following Examples, which in no way should be construed as further limiting. The entire contents of all of the references (including literature references, issued patents, published patent applications, and co pending patent applications) cited throughout this application are hereby expressly incorporated by reference.
In order that the methods and products described in the present application may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the systems and methods provided in this disclosure and are not to be construed in any way as limiting their scope.
This Example relates to engineering of the oleaginous yeast Yarrowia lipolytica for carotenoid overproduction from acid whey and/or animal feed with different compositions of oils and proteins according to need. Previously, it was shown that the expression of a secreted extracellular/β-galactosidase along with the expression of genes for the acceleration of the native galactose metabolism pathway, rendered Y. lipolytica capable of consuming all sugars in AW (Mano et al., 2020). Herein, the optimal gene combination for lycopene synthesis and two independent strategies that almost completely circumvented substrate inhibition during beta-carotene synthesis is described. Substrate inhibition was undesirable in industrial applications of microbes used for product synthesis. Although several methods had explored to address this limitation, such as enzyme immobilization, two-phase partitioning bioreactor systems, batch substrate-feeding strategy, and protein engineering, most of these solutions were limited to systems where the inhibition was posed by the starting substrate, and were difficult to apply in the context of microbial engineering for chemical production. It should be noted that strategies were initially demonstrated in carotenoid producing strains of Y. lipolytica using glucose as carbon source. Subsequently, the results informed the engineering of yeast cells for the efficient production of carotenoid compounds from AW.
Biosynthesis of Beta Carotene and Lycopene from Glucose
First, a structure-guided protein design, coupled with phylogenetic information, was used to generate protein variants with reduced inhibition. For instance, a single mutation of a lycopene cyclase gene was identified that completely abolished substrate inhibition without reducing enzyme activity, which resulted in a remarkable increase of β-carotene production. The synthesis of β-carotene in Y. lipolytica required the heterologous expression of three genes that encoded the enzymes phytoene synthase, phytoene dehydrogenase, and lycopene cyclase. The geranylgeranyl diphosphate synthase (GGPPS) was also considered as it controlled the flux directed towards carotenoid instead of sterol synthesis. Relevant genes were sourced from eukaryotic organisms and were introduced into the Y. lipolytica po1f strain with TRP1 disruption.
A second approach resulted in similar titers and selectivity of β-carotene by reducing the carbon flow through the carotenoid pathway and thus prevented inhibitory metabolite accumulation to inhibitory levels, contrary to the traditional paradigms of pathway engineering. This was achieved by establishing a geranylgeranyl pyrophosphate synthase (GGPPS)-mediated metabolic valve that regulated the substrate lycopene formation rate, which effectively alleviated substrate inhibition. While this approach reduced flux through the pathway of interest, the gains from suppressing substrate levels and thus maintaining high enzymatic activity overcompensated for any losses in productivity suffered from the flux diversion.
It was also noted that the product profile of β-carotene versus lycopene could be shifted by varying the in vivo GGPPS activity. The high activity of GGPP can be taken advantage of to reconstitute a dedicated lycopene-producing strain. Combining this idea with a specific lycopene cyclase variant, high concentrations of lycopene were successfully produced with undetectable amounts of β-carotene. An additional increase in lycopene production was achieved by overexpressing the MVA pathway and introducing IUP using glucose as substrate.
Previous studies established that the lipophilic nature of carotenoids promoted their storage in the lipid bodies of the cells. Larroude et al. found that an engineered lipid overproducer strain was capable of producing more β-carotene with a titer of 6.5 g/L, while accompanied with the production of 42.6 g/L lipids (Larroude et al., 2018). While providing compatible compartments for hydrophobic isoprenoid accumulation, the de novo formation of TAGs also consumes large amount of carbon source, resulting in limited acetyl-CoA flux into the MVA, product-forming pathway. In this study it was demonstrated that Y. lipolytica's native capacity for TAG accumulation was sufficient for carotenoid sequestration. By balancing the flux distribution between carotenoid and lipid synthesis through C/N ratio adjustments, a larger portion of the acetyl-CoA pool for carotenoid production was preserved, achieving higher titers and per-cell content.
Moreover, it was demonstrated that the carotenoid biosynthesis during glucose-depleted stationary phase was supported by cellular lipid degradation. During fermentation experiments using glucose as substrate, it was found that the content of β-carotene continued to rise during the stationary phase, even after glucose in the media had been depleted. Throughout the fermentation process, lipid content increased initially, reaching a maximum at day 3, after which it rapidly decreased when glucose was fully consumed. Yet, despite the reduction in lipid content, β-carotene content continued to rise well past the point of glucose depletion, suggesting that TAGs were utilized to sustain metabolic activity and carotenoid synthesis. When glucose was still present during the initial 3 days, lipid droplets within cells progressively agglomerated into lipid bodies that sequestered the produced β-carotene. However, it was also evident that the lipid bodies were no longer visible during the later stages of fermentation due to TAG breakdown, which in turn caused the accumulated β-carotene to be more dispersed throughout the cell. It was demonstrated that the acetyl-CoA formed through β-oxidation can support MVA pathway and eventually contribute to β-carotene formation. Therefore, this is likely the mechanism used by the cells to convert TAGs into carotenoids during the glucose-depleted stationary phase.
Biosynthesis of Beta Carotene and Lycopene from AW
After the results were acquired for carotenoid synthesis using glucose as substrate, a Y. lipolytica strain was constructed that could fully consume all the organic molecules found in AW and produce high concentrations of lycopene. The engineering effort included introducing the genes responsible for lactose degradation, galactose assimilation, a high activity GGPP, a phytoene dehydrogenase, and a bi-functional phytoene synthase/lycopene cyclase of eukaryotic origin bearing a single mutation that abolishes the cyclase activity. The flux distribution between lycopene and lipid synthesis was balanced through C/N ratio adjustments, which achieved a maximum lycopene concentration of about 3 g/L with 0.230 mg of lycopene per gram of dry cell weight using untreated AW as substrate. The engineered strain was also capable of consuming concentrated AW. After 14 days all the sugars and organic acids in AW were entirely consumed resulting in a maximum lycopene concentration of 13.4 g/L.
Another high-valued carotenoid-derivative pigment is astaxanthin. Astaxanthin has been the subject of growing interest due to its broad applications in the food, animal feed, nutraceuticals, cosmetics, and pharmaceutical industries. These applications are due to its strong antioxidant, anti-inflammatory, and anti-cancer activity.
The downstream astaxanthin biosynthetic pathway from β-carotene was constructed by expressing the CrtW gene encoding β-carotene ketolase and the CrtZ gene encoding β-carotene hydroxylase. To further improve the heterologous pathway, β-carotene ketolases and hydroxylases from diverse organisms were sourced. Given that the main natural sources for astaxanthin synthesis are bacteria and alga, additional CrtWs and CrtZs were specifically screened from such organisms and a CrtW/Z pair was identified that maximized microbial astaxanthin production using the β-carotene overproducing strain. Furthermore, it was determined that increasing the physical proximity between CrtW and CrtZ could minimize the substrate-enzyme distance and increased reaction rates. To do that, active fusions between the CrtW and CrtZ enzymes were created, with the goal of enhancing the contact of products/precursors with the corresponding enzymes through the creation of a closer microenvironment. The fused enzymes were more efficient at producing astaxanthin compared to the individual enzymes. Finally, the expression of the fusion enzymes was investigated when targeted to various subcellular compartments. Initially, the fusion enzyme CrtW−Z was targeted to lipid bodies (LB) by linking it with the oleosin sequence, thus providing an alternative biological route for astaxanthin biosynthesis. The LB-targeted strain gave significantly higher titer astaxanthin compared to the control strain expressing the pathway in the cytosol. Targeting the fusion enzyme to other organelles, such as the endoplasmic reticulum and peroxisomes, further improved astaxanthin titers from glucose, with the simultaneous targeting to all three sub-organelles yielding even better results.
The results described herein demonstrated the technology of engineering the oleaginous yeast Y. lipolytica for the biosynthesis of a variety of high added value products. The technology can also be applied for the production of other products from AW, like lutein, alpha carotene and other members of the isoprenoid pathway. Therefore, the present disclosure relates to a general method for the upgrade of the dairy industry waste to a collection of high added value products that have broad use as food ingredients.
Production of Animal Feed from AW
Production of protein is a natural component of the yeast life cycle and can comprise roughly 40% of the dry weight under certain conditions (Yamada et al., 2005). Lipid production, on the other hand, is dependent on certain nutrition cues and is usually growth phase-dependent (Goncalves et al., 2014). Early in the fermentation, most energy and carbon are utilized for growth and cell division, but as essential nutrients begin to run out (notably nitrogen), cells cease to divide and instead begin to store excess carbon in the form of lipids, which are sequestered in large intracellular droplets. Under certain conditions these lipid bodies can represent more than two-thirds of cell dry weight by the end of the fermentation (Qiao et al., 2015). In the case of AW, available nitrogen is primarily in the form of milk protein, and Yarrowia's access to this nitrogen source can be altered to produce a product with a higher or lower percentage of weight that is lipids.
The ratio of lipid to protein was controlled by utilizing engineered strains of Yarrowia. Two strains of Yarrowia were employed; W29 (non-engineered), which produced a mix of lipids and cell mass, as well as an engineered strain designated ACC-DGA. The ACC-DGA strain was designed to produce a greater quantity of lipids via overexpression of native Yarrowia genes which encode enzymes involved in triacylglycerol biosynthesis (Tai et al., 2013; U.S. Patent Application No. US20130143282A1). These strains also differed in their ability to consume the protein present in AW. ACC-DGA was deficient in production of secreted proteases, and thus was unable to degrade milk proteins. Starting with these two strains a product that was either high in fat, high in protein, or a mixture of the two was generated.
To expand AW utilization technology and transform it into a platform forproducing valuable food and feed ingredients, an engineered strain of Y. lipolytica capable of producing lycopene as a model compound of natural products from AW was sought. It was observed that Lycopene could subsequently serve as a precursor to other carotenoids such as α- and β-carotene, lutein, and astaxanthin (
To achieve this goal, first, the best combination of carotenoidbiosynthetic enzymes that will maximize carotenoid production and accumulation in Yarrowia cells will be determined. For further improvement, different sub-cellularlocalization strategies will be employed to identify the optimal enzyme co-localization in sub-cellular organelles like the endoplasmic reticulum, peroxisome, and lipid bodies. Enzymes localized in different subcellular compartments will have higher activity in converting substrates also localized in the same compartment. Finally, the native mevalonate pathway will be engineered by overexpressing well-known rate-limiting enzymes to increase the supply of carotenoid precursors.
Reverse osmosis has been commonly applied to concentrate AW into smaller volumes for cost reduction in waste treatment and transportation. The high concentration of lactic acid in concentrated AW can inhibit the growth of Y. lipolytica. Thus, methods to enhance tolerance of Y. lipolytica to lactic acid by overexpressing enzymes that are involved in lactic acid consumption will be sought. This approach can be complemented by engineering oxidative stress defense pathways based on previous work where lipid synthesis was improved in Y. lipolytica (Xu et al., 2017). All the constructed strains will be validated in larger volume bioreactors of 10 L. Another approach can be to explore the genome-wide response of Y. lipolytica to concentrated AW that will help to understand the genomic basis of tolerance to concentrated AW. Transcriptional analysis will assess the genome-wide response and allow for the identification of genes central to conferring tolerance along with potential mechanisms underlying enhanced strain tolerance. Using the engineered strains described in the previous aims as starting point, genome-wideevolutionary engineering strategies can be applied and mutants with enhanced tolerance can be isolated. The strain-specific genetic and global gene expression differences of the mutants will be identified using multi-omics analyses (genomics and transcriptomics) and inform the rational engineering of the host strain.
Furthermore, TEA will be employed to evaluate the potential feasibility of the proposed bioprocess and to identify process and economic bottlenecks and targetsfor further research and improvement. Assessment of the overall value of the proposed technology will provide useful information to potential investors. Process modeling will be carried out using a process simulator. Environmental assessment of the proposed bioprocess is another aspect that will be considered to identify and focus on environmentally critical bioprocess parameters (Heinzle et al., 1998).
Additional work also includes the optimization of the fermentation process and purification of the carotenoid products. As intracellular products, carotenoids are sequestered inside the cells and have to be extracted and purified from the cell biomass. The extraction method may initially involve a pretreatment step that helps in the disruption of the cell wall. After that, due to their lipophilic nature, carotenoids are conventionally extracted using organic solvents. The process may include washing steps, a crystallization step, and solvent traces removal by vacuum drying. During carotenoid extraction, a challenge is their sensitivity to excess heat, light, acids, and long extraction times. However, it is noted that separation and purification of carotenoids can be performed following established technologies that can be licensed and deployed in an integrated AW-to-carotenoids scheme.
Engineering microbes for overproduction of high-value natural products has largely focused on manipulating metabolic pathways in the cellular cytoplasm. Recently there is a growing interest in channeling metabolic pathways in the subcellular organelles of yeast, thus increasing local substrate and enzyme concentrations, and enhancing the efficiency of compartmentalized pathways and production of end-product (Cao et al., 2020; Hammer and Avalos, 2017). Compared to the conventional model yeast S. cerevisiae, systematic investigation of cellular compartments in the oleaginous yeast Y. lipolytica for natural product biosynthesis has lagged. This is so despite the significant role played by intracellular compartments like LB, ER and peroxisome of this yeast. In the present study, the heterologous metabolic pathway for astaxanthin synthesis was assembled using fusion enzymes CrtW−Z and targeting expression in subcellular organelles of Y. lipolytica. The present disclosure relates to bringing in close proximity the precursor of astaxanthin synthesis with the enzymes catalyzing the pathway reactions. As Y. lipolytica is widely regarded as model organism for production of acetyl-CoA-derived compounds (Abdel-Mawgoud et al., 2018), other products derived from the same precursor could benefit from this study.
The first round of experimentation capitalized on the lipophilic nature of the main precursor of astaxanthin synthesis, β-carotene, and targeted the lipophilic compartment of lipid bodies for expression of the astaxanthin pathway. Following successful implementation of this strategy, the compartment of β-carotene synthesis, ER, was targeted next and this increased production further. Finally, the peroxisome was also targeted for compartmentalization owing to serving as storage for lipophilic compounds as well. Targeting the astaxanthin pathway to all three compartments yielded the best results in terms of product accumulation, suggesting that bringing the astaxanthin pathway in close proximity to β-carotene precursor and providing a suitable vehicle for astaxanthin storage were all important for enhanced product accumulation in Y. lipolytica. The simultaneously targeting of CrtW−Z dependent pathway to LB, ER and peroxisome yielded the highest astaxanthin titer reported so far in yeast. Thus, harnessing subcellular organelles can be a promising approach for further enhancing isoprenoid biosynthesis because of their potential advantage of improving precursor supply and cofactors availability.
Overall, the present disclosure has successfully explored enzyme fusion and its compartmentalization in subcellular organelles, effectively channeling substrate or intermediates to end-product. These approaches represent one of the first in developing yeast subcellular cell factory. Hydrophobicity was explored as key property in engineering the astaxanthin pathway, but other molecular features could be explored as well in designing future applications of organelle engineering.
The astaxanthin biosynthetic pathway has been extensively studied and is well characterized. As shown in
The downstream astaxanthin biosynthetic pathway from β-carotene was constructed by expressing the CrtW gene encoding β-carotene ketolase and the CrtZ gene encoding β-carotene hydroxylase, which perform the addition of two keto moieties and hydroxyl, respectively, changing the colony color from yellow to red (
To further improve the heterologous pathway, β-carotene ketolases and hydroxylases from diverse organisms were sourced. Given that the main natural sources for astaxanthin synthesis are bacteria and alga, two additional CrtWs and two CrtZs were specifically screened from such organisms (Table 1). To identify a CrtW/Z pair that maximizes microbial astaxanthin production, combinatorically screening of the suite of three CrtWs and three CrtZs in the β-carotene overproducing strain was performed. Astaxanthin titers ranging from 3.2-9.9 mg/L were obtained with the various engineered strains (
Depending on the order at which the ketolation and hydroxylation reactions were carried out in the biosynthetic process from β-carotene to astaxanthin, several intermediates were synthesized, forming multiple routes from β-carotene to the end product (
β-carotene ketolase from Paracoccus sp. (PsCrtW) and β-carotene hydroxylase from Haematococcus pluvialis (HpCrtZ) was selected to create fusion enzymes on the basis of their high activity for producing more astaxanthin when expressed individually (
The chromatographic profiles of the carotenoids synthesized by the strain harboring fusion enzyme CrtW−Z (
Lipid bodies (LB) in Y. lipolytica indeed create hydrophobic pockets, which can sequester preferentially lipophilic isoprenoid compounds. As the astaxanthin precursor β-carotene is such a lipophilic molecule, whether its sequestration in LB (
Inspired by these results, the site of β-carotene synthesis in cells was exploited. Prediction of transmembrane helices in the heterologous proteins associated with β-carotene biosynthesis (GGPPsa, CarB and CarRP), revealed that, with exception of GGPPsa, the other two enzymes possess transmembrane helices (
Besides the LB and ER, another organelle potentially impacting intracellular β-carotene accumulation is the peroxisome that also serves as storage compartment for lipophilic compounds (Liu et al., 2020). Thus, the astaxanthin pathway was targeted, as expressed by the fused enzyme CrtW−Z, to the ER, and peroxisome by fusion with well-characterized targeting sequence KDEL and SKL, respectively (
Considering that a considerable fraction of the β-carotene pool resides in the ER, LB and peroxisome, targeting the pathway to more than one compartment was investigated. It was found that when simultaneously targeting the fusion enzyme CrtW−Z to LB and ER, the astaxanthin titer was significantly increased, compared to that of single subcellular compartmentalization (
The effect of medium composition on astaxanthin production was investigated next. Glucose concentration was varied while keeping constant the nitrogen amount, thus effectively varying the medium C/N ratio. Large variations in astaxanthin production were observed depending on the initial glucose concentration. It was found that astaxanthin titer gradually increased with increasing glucose concentration, and reached the highest level with YPD40 medium (
Anchoring enzymes simultaneously to all three organelles yielded the largest increase of astaxanthin synthesis, and ultimately produced 858 mg/L of astaxanthin in fed-batch fermentation (a 141-fold improvement over the initial strain). The methods and products disclosed herein are expected to help unlock the full potential of subcellular compartments and advance LB-based compartmentalized isoprenoid biosynthesis in Y. lipolytica.
As described above, the present disclosure relates to the fusion expression of two key enzymes in the astaxanthin pathway and the performance of the fusion when targeted to various subcellular compartments. The activity of the key enzymes β-carotene ketolase (CrtW) and hydroxylase (CrtZ) from different sources were assessed and it was found that the PsCrtW/HpCrtZ (sourced from Paracoccus sp. and Haematococcus pluvialis, respectively) pair was best for astaxanthin accumulation. The activities of PsCrtW and HpCrtZ were combined through the creation of enzyme fusion in order to overcome leakage of non-endogenous intermediates. Finally, the above astaxanthin biosynthetic pathway of fused enzymes was targeted to the subcellular compartment of lipid body (LB), alone and in combination with compartmentalization in the endoplasmic reticulum (ER) and peroxisome. Relatively to the cytosolic pathway, channeling the astaxanthin pathway to the organelles yielded significant increase in production as well as decrease of intermediate accumulation. Furthermore, simultaneously targeting the astaxanthin pathway to all three LB, ER and peroxisome yielded the highest production of astaxanthin, and ultimately achieved 858 mg/L (16.7 mg/g DCW) in fed-batch fermentation. These results demonstrate the potential of Y. lipolytica for lipophilic metabolite production by targeting pathway expression to subcellular compartments that allow efficient functioning of the biosynthetic pathways.
These strategies described herein were deployed to maximize production of the carotenoid astaxanthin in Y. lipolytica. First, functional fusions of β-carotene ketolase and hydroxylase (CrtW−Z or CrtZ−W) were created and shown to elevate production of astaxanthin over the level achieved by the individually expressed enzymes (CrtW+Z) in Y. lipolytica. The greatest difference between individually expressed and fusion enzymes, in terms of intermediate accumulation, was the profiles of canthaxanthin and zeaxanthin in CrtW+Z strain while 3′-Hydroxyechinenone in CrtW−Z strain. Canthaxanthin or zeaxanthin are synthesized from β-carotene in two enzymatic steps requiring only CrtW or CrtZ, respectively, while the production of 3′-Hydroxyechinenone requires the participation of both enzymes. This quantitative change of intermediate composition between CrtW+Z and CrtW−Z strains could indicate that canthaxanthin and zeaxanthin are more easily converted into downstream metabolites when both enzymes are fused. The reduction of the intermediate leakage and the acceleration of the overall reaction rates highlight the enhancement of the enzymes interaction when fused together.
Escherichia coli DH5α cells were grown in Luria-Bertani (LB) medium (BD bioscience) at 37° C. with constant shaking. Corresponding antibiotics (100 g/mL ampicillin and 50 g/mL kanamycin) were added for plasmid selection. All Y. lipolytica strains were cultivated at 30° C. with shaking at 230 rpm. For Y. lipolytica, YPD medium consisted of 10 g/L yeast extract (BD bioscience), 20 g/L peptone (BD bioscience), and 20 g/L glucose (Sigma-Aldrich) was used. Additionally, YNB medium composed of 1.7 g/L yeast nitrogen base (YNB, VWR Life Science), 20 g/L glucose, 5 g/L ammonium sulfate, 15 g/L agar (BD bioscience), and 0.77 g/L appropriate complete supplement mixture without uracil, leucine, or tryptophan (Sunrise science products) was used for selecting transformed Y. lipolytica strains.
E. coli DH5a was used for cloning and plasmid propagation. The Y. lipolytica po1f strain served as the base strain, and all derivatives and plasmids constructed are listed in Table 2. The primers used for plasmid construction are shown in Table 3. All restriction enzymes were purchased from New England Biolabs (NEB). PCR amplification was performed using Q5 high-fidelity DNA polymerase (NEB) or GoTaq DNA polymerase (Promega). PCR fragments were purified using the ZYMO Fragment Recovery Kit (ZYMO research). Plasmids were then constructed from the purified PCR fragments with Gibson Assembly kit (NEB), transformed into chemically competent E. coli cells by heat shock, and extracted using the QIAprep Spin Miniprep Kit (Qiagen). All procedures were performed according to the manufacturer instructions. All engineered Y. lipolytica strains were constructed by transforming linearized plasmids (Not1 digestion) using the lithium-acetate method. Recombinants were verified by PCR amplification from genomic DNA. The astaxanthin biosynthetic genes evaluated in this study were all codon-optimized towards Y. lipolytica.
Plasmid pYLMA-Cre was transformed into target Y. lipolytica strains to rescue URA3, LEU2 and TRP1 markers. Transformants were selected on YPD agar plate supplemented with a final concentration of 250 mg/L hygromycin B (Sigma-Aldrich). After 2-3 days of cultivation, colonies were transferred onto a new YPD plate containing hygromycin B for 1 more day to allow for more successful marker deletions. Marker curation was confirmed by subculturing the colonies onto YNB-Ura, YNB-Leu, and YNB-Trp agar plates, respectively. Successful removal of all three markers lead to a phenotype conferring uracil, leucine and tryptophan deficiency. Plasmid pYLMA-Cre in cells was then removed by incubating positive strains on YPD agar plates at 30° C. for 24 hours, with 2-3 repeats.
Single colonies of recombinant strains were picked from plate, inoculated into 2 mL YPD medium, and cultivated overnight (16-18 hours) at 30° C. and 230 rpm. The culture was then transferred to a 50 mL shake flask containing 10 mL YPD medium (initial OD600=0.1) and cultivated at 30° C. and 230 rpm for 3 days.
500 L sample was extracted from the culture for residual glucose quantification. The cells were centrifuged at 12,000 rpm for 5 minutes, and then the supernatant was filtered through 0.2 μm syringe filters prior to injection into an Agilent technologies 1260 High-Performance Liquid Chromatography (HPLC) equipped with a refractive index detector. A Bio-Rad HPX-87H column was used for separation with 14 mM sulfuric acid as the mobile phase flowing at a rate of 0.7 mL/minute. The injection volume was 10 μL. The column temperature was 50° C.
Carotenoid extraction was performed as described (Asker, 2017) with the following modification. Briefly, 50˜100 μL culture was centrifuged for 1 minute at 12,000 g, and cell pellets were suspended in 900 μL dimethyl sulfoxide (DMSO) prior to heating at 50° C. for 1 hour until the cells bleached in a water bath. The DMSO extracts were briefly mixed with 450 μL of methanol and centrifuged at 14,000 g for 5 minutes. The resultant supernatants were transferred into glass vials for carotenoid analysis and quantification.
The production of carotenoids was expressed as grams per liter of fermentation broth (g/L) and milligrams per gram of dry cell weight (mg/g DCW). Optical densities were measured at 600 nm with Thermo Spectronic Genesys 20 (Thermo Scientific) and used to calculate cell mass (DCW=0.30×OD600,
The fusion enzyme CrtW−Z dependent astaxanthin biosynthetic pathways were targeted to different subcellular compartments (ER, LB and peroxisome) using specific addressing signals. The enzymes involved in the astaxanthin biosynthetic pathway were directed to the ER by the addition of a C-terminal KDEL utilizing the following nucleotide sequence 5′-AAGGACGAGCTG-3′ (SEQ ID NO: 6) while removing the stop codon to the end of targeting signal. Similarity, peroxisome or LB targeting of proteins was ensured by the addition of SKL (nucleotide sequence 5′-TCCAAGCTG-3′) or oleosin from Zea mays (codon-optimized oleosin sequence are listed in Table 4), as previously performed in other works on Y. lipolytica engineering (Yang et al., 2019). The fusion enzyme CrtW−Z without any target signal were directed to cytoplasm.
Bioreactor fed-batch fermentation was performed in a 3 L fermenter (New Brunswick Bioflo115 system). The initial fermentation was carried out in 1 L of medium containing 100 g/L glucose, 100 g/L peptone, and 50 g/L yeast extract. Temperature was maintained at 30° C. Dissolved oxygen was controlled at 20% of saturation with an agitation cascade of 250˜800 rpm. Air was sparged into the fermenter at 2 vvm. The pH was maintained at 6.8 by feeding 5 M NamH or 5 M HCL. Foam was prevented by the addition of antifoam 204 (Sigma-Aldrich). Fed-batch operation was initiated after 72 hours of cultivation with the 15×YPD medium. Samples were taken every 24 hours to measure OD600, glucose and astaxanthin concentrations. Flask fed-batch fermentation was carried out in 50 mL conical flasks with a working volume of 10 mL YPD medium. 15×YPD medium was fed every 48 hours, and pH was not controlled.
Brevundimonas
Haematococcus pluvialis
Paracoccus sp.
Brevundimonas
Haematococcus pluvialis
Pantoea ananatis
Substrate inhibition of enzymes can be a major obstacle to the production of valuable chemicals in engineered microorganisms. Substrate inhibition of lycopene cyclase was identified as the main limitation in carotenoid biosynthesis in Yarrowia lipolytica. To overcome this bottleneck, two independent approaches were used. Structure-guided protein engineering yielded a variant, Y27R, characterized by complete loss of substrate inhibition without reduction of enzymatic activity. Alternatively, establishing a geranylgeranyl pyrophosphate synthase-mediated flux flow restrictor also prevented the onset of substrate inhibition by diverting metabolic flux away from the inhibitory metabolite while maintaining sufficient flux towards product formation. Both approaches were very effective, resulting in high levels of near-exclusive β-carotene production. Ultimately, strains capable of producing 39.5 g/L β-carotene at a productivity of 0.165 g/L/h in bioreactor fermentations (a 1441-fold improvement over the initial strain) were constructed. The findings described herein provide effective approaches for removing substrate inhibition in engineering pathways for efficient synthesis of natural products.
Engineering microbes for the production of valuable chemical products is an attractive alternative to sourcing these compounds from nature or deriving them from petrochemicals by chemical synthesis (Chen and Nielsen., 2013; Li and Smolke, 2016; Liu and Nielsen, 2019). However, synthetic biology efforts to achieve economically viable and scalable titers and productivities are frequently hindered by undesirable regulatory mechanisms that modulate the activity of enzymes. Such mechanisms have evolved to mediate optimal cellular response to changing physiological conditions, but also represent a major obstacle in redirecting metabolic fluxes toward desired engineered metabolic pathways and away from native growth-optimizing ones. This problem is particularly evident in compounds that require long and complex synthesis pathways (e.g., isoprenoids), frequently giving rise to bottlenecks that may reduce cell fitness and pathway productivity (Wu et al., 2016; Keasling et al., 2010). As such, it is imperative to develop methods that allow us to circumvent the effect of enzyme inhibition in constructing robust strains with high productivity.
Substrate inhibition represents one such enzyme-level regulation deployed in cells to help optimize cellular economy and maximize growth in response to temporal variations of the environment (Reed et al., 2010). Moreover, such mechanism is often used to design therapies for various diseases (Boutin et al., 2005; Belzer et al., 2013). However, it is undesirable in industrial applications of microbes mediated by enzymatic reactions for product synthesis. Enzyme inhibition is typically triggered when substrate concentration exceeds a certain threshold, thus preventing the catalytic conversion of the substrate and limiting the flux through the desired pathway. As such, substrate inhibition is particularly detrimental to the synthesis of end-products of interest when present in the middle of a metabolic pathway, which in turn causes intermediates accumulation, pathway disruption and alteration in the profile of products formed. Although several methods have been explored to address this limitation, such as enzyme immobilization (Singh et al., 2013; Matwo et al., 2004), two-phase partitioning bioreactor systems (Daugulis et al., 2011; Gao et al., 2009; Nielsen et al., 2009), batch substrate-feeding strategy (Kim et al., 2007), and protein engineering (Chen et al., 2014; Shang et al., 2020), most of these solutions are limited to systems where the inhibition is posed by the starting substrate, and difficult to apply in the context of microbial engineering for chemical production.
Using the oleaginous yeast Yarrowia lipolytica for carotenoid overproduction, two independent strategies are demonstrated that nearly completely circumvent substrate inhibition. First, the enzyme lycopene cyclase was identified as the bottleneck in the synthesis of carotenoids due to its strong substrate inhibition by lycopene. This resulted in not only low titers of β-carotene, but also large amounts of accompanying lycopene as byproduct. In light of this, the first strategy was to use a structure-guided protein design, coupled with phylogenetic information, to generate protein variants with reduced inhibition. Of the 50 variants generated, a single mutation Y27R was identified that completely abolished substrate inhibition without reducing enzyme activity, resulting in a remarkable increase of β-carotene production and 98% selectivity (% product vs sum of all carotenoids). Alternatively, in the second approach, similar titers and selectivity of β-carotene were obtained by reducing the carbon flow through the carotenoid pathway and thus preventing inhibitory metabolite accumulation to inhibitory levels, contrary to the traditional paradigms of pathway engineering. This was achieved by establishing a geranylgeranyl pyrophosphate synthase (GGPPS)-mediated metabolic flow restrictor that regulated the substrate lycopene formation rate, thereby effectively alleviating substrate inhibition. While this approach reduces flux through the pathway of interest, the gains from suppressing substrate levels and thus maintaining high enzymatic activity overcompensated for any losses in productivity suffered from the flux diversion. Using the methods outlined above, along with careful partitioning of cellular resources dedicated to carotenoid synthesis versus storage, a strain capable of producing 39.5 g/L β-carotene (98% selectivity) with a 0.165 g/L/h volumetric productivity in bioreactor fermentations was ultimately established. Moreover, by deliberately exploiting the substrate inhibition effect, the product profile was shifted towards lycopene instead, achieving lycopene titers of 17.6 g/L and productivities of 0.073 g/L/h.
Synthesis of β-carotene in Y. lipolytica requires heterologous expression of three genes encoding the enzymes phytoene synthase, phytoene dehydrogenase, and lycopene cyclase (
Although synthesis of β-carotene was observed in YLMA02, the titers were very low, prompting us to investigate the GGPPS step as the next target. Introduction of an additional copy of GGPPS from X. dendrorhous (GGPPxd) into strain YLMA02 significantly increased the titers of β-carotene to 0.48 g/L (
Since lycopene was the only aggregating precursor (
Removing the substrate inhibition effect of lycopene cyclase through protein engineering was evaluated next. As its crystal structure was unavailable, the Transform-restrained Rosetta (TrRosetta) platform (Yang et al., 2020) was used to create a computational model of the R domain (lycopene cyclase) of CarRP (
It was then investigated whether the β-carotene pathway containing variant Y27R was able to maintain its properties of minimal substrate inhibition in the presence of considerably higher precursor/substrate formation rates. To this end, four key enzymes were overexpressed, tHMGR, ERG12, IDI, and ERG20, of the Mevalonate (MVA) pathway (Ro et al., 2006; Westfall et al., 2012) (
Other viable options were also explored that can eliminate the substrate inhibition without the need to modify lycopene cyclase. It was hypothesized that attenuating the formation rate of lycopene relative to its conversion rate could potentially lower the intracellular concentration of lycopene below the inhibitory level. However, this needs to be well-tuned to prevent an overall reduction of the production rate of end-product by attenuating too much the lycopene formation rate. To this end, the branching point at the FPP node was exploited to create a metabolic flow restrictor and regulate flux towards lycopene such as to maintain sub-inhibitory levels, yet high lycopene conversion into β-carotene (
In order to close the gap of β-carotene production between the two engineering strategies that mitigate substrate inhibition (
The product profile of β-carotene versus lycopene can be shifted by varying the in vivo GGPPS activity (
Lipid bodies in Y. lipolytica create hydrophobic pockets that facilitate lipophilic isoprenoid product sequestration and storage (Qiao et al., 2017). However, while increased triacylglycerol (TAG) supply would enhance isoprenoid storage (Ma et al., 2019; Larroude et al., 2018), this comes at the expense of acetyl-CoA, a common precursor for isoprenoid and lipid synthesis (
In the fermentation experiments with strain YLMA15 described herein, it was found that the content of β-carotene continued to rise during the stationary phase, even after glucose in the media had been depleted (
Since TAG degradation occurs primarily through β-oxidation to generate acetyl-CoA (Xu et al., 2016) (
It was finally evaluated the performance of the constructed strains alleviated from substrate inhibition in 3-L fed-batch cultivations. After bioreactor optimizations, strain YLMA15 achieved a total β-carotene titer and content of 39.5 g/L and 494 mg/g DCW, respectively, with a productivity of 0.165 g/L/h (
The present disclosure relates to demonstrating that lycopene cyclase undermines β-carotene production by substrate inhibition, a regulatory effect less reported in the context of microbial synthesis. Substrate inhibition of enzymes could be overcome through modification of the protein structure, a strategy that has been successfully applied to many enzymes (Shang et al., 2020). However, these efforts rely on readily available protein crystal structures, which is not the case for the lycopene cyclase investigated here. Although directed evolution is a powerful method of adapting enzymes to specific tasks (Reetz et al, 2013), it often requires high-throughput detection methods to screen large libraries. In addition, due to lack of crystal structure information, efficient structure-driven design heavily relies on both the quality of computational modeling and the accuracy to dock the substrate to its binding site. Here, combining structure and phylogenetic information, sharpened the search and allowed us to isolate a promising mutant by screening only 50 variants, with 3 of the variants exhibiting diminished or removed substrate inhibition. Furthermore, information from key amino acids could be iteratively fed back into the computational model to further optimize enzyme properties. To understand mechanistically what factor caused the removal of the substrate inhibition would require more thorough investigation that is beyond the scope of this study. The low number of protein variants designed and tested suggests that structure-guided approach coupled with phylogenetic information offers an effective strategy for protein engineering.
The degree of substrate inhibition can also be controlled by tuning the relative rates of up- and downstream pathways forming and consuming the inhibiting substrate. In the case of β-carotene synthesis, selecting GGPPS variants with lower activity reduced the flux through the carotenoid pathway. Yet, the resulting abolishment of substrate inhibition enabled all carotenoid flux to be diverted to β-carotene synthesis, as opposed to a combination of both lycopene and β-carotene. This led to an increased β-carotene production at high specificity (>98%) despite a lower GGPPS activity. On the other hand, substrate inhibition can also be deliberately exploited if lycopene is the desired product. In this case, a highly-efficient GGPPS can cause lycopene formation to outpace its depletion, leading to its accumulation, which then further amplifies the imbalance through substrate inhibition. Correspondingly, the product profile shifts drastically from β-carotene-rich to lycopene-rich. These findings illustrate that engineering proximal enzymes can have profound effects on pathway dynamics, providing a new paradigm for controlling metabolism.
Another important consideration in metabolic engineering is how heterologous pathways interact with the native ones. Designing pathways that are orthogonal to or have minimal impact on the native functions of an organism has been a focal point of many strain engineering efforts (Ro et al., 2006; Tan et al., 2016; Zhao et al., 2018; Brockman et al., 2015). It is well known that the lipophilic nature of carotenoids promotes their storage in the lipid bodies of the cells. Larroude et al. (Larroude et al., 2018) found that an engineered lipid overproducer strain was capable of producing more β-carotene with a titer of 6.5 g/L, while accompanied with the production of 42.6 g/L lipids. While providing compatible compartments for hydrophobic isoprenoid accumulation, the de novo formation of TAGs also consumes large amount of carbon source, resulting in limited acetyl-CoA flux into the MVA and product-forming pathway. Here, it was demonstrated that Y. lipolytica's native capacity for TAG accumulation is sufficient for carotenoid sequestration. By balancing the flux distribution between carotenoid and lipid synthesis through C/N ratio adjustments, a larger portion of the acetyl-CoA pool was preserved for carotenoid production, achieving higher titers and per-cell content.
Escherichia coli DH5α cells were grown in Luria-Bertani (LB) media (BD bioscience) at 37° C. with constant shaking. Corresponding antibiotics (100 μg/mL ampicillin and 50 μg/mL kanamycin) were added for plasmid selection. All Yarrowia lipolytica strains were cultivated at 30° C. with shaking at 230 rpm. For Y. lipolytica, YPD media consisted of 10 g/L yeast extract (BD bioscience), 20 g/L peptone (BD bioscience), and 20 g/L glucose (Sigma-Aldrich) was used. Additionally, YNB media composed of 1.7 g/L yeast nitrogen base (YNB, VWR Life Science), 20 g/L glucose, 5 g/L ammonium sulfate (VWR Life Science), 15 g/L agar (BD bioscience), and 0.77 g/L appropriate complete supplement mixture without uracil, leucine, or tryptophan (Sunrise science products) was used for selecting transformed Y. lipolytica strains.
E. coli DH5a was used for cloning and plasmid propagation. The Y. lipolytica po1f strain served as the base strain, and all derivatives and plasmids constructed in the present study are listed in Table 7. The primers used for plasmid construction are shown in Table 9. All restriction enzymes were purchased from New England Biolabs (NEB). PCR amplification was performed using Q5 high-fidelity DNA polymerase (NEB) or GoTaq DNA polymerase (Promega). PCR fragments were purified using the ZYMO Fragment Recovery Kit (ZYMO research). Plasmids were then constructed from the purified PCR fragments with Gibson Assembly kit (NEB), transformed into chemically competent E. coli cells by heat shock, and extracted using the QIAprep Spin Miniprep Kit (Qiagen). All procedures were performed according to the manufacturer instructions. All engineered Y. lipolytica strains were constructed by transforming linearized plasmids (Not1 digestion) using the lithium-acetate method. Recombinants were verified by PCR amplification from genomic DNA. The carotenoid biosynthetic genes evaluated in this study were all codon-optimized towards Y. lipolytica.
TRP1 Disruption in po1f Strain Using CRISPR-Cas9
For TRP1 disruption, the CRISPR-Cas9 plasmid (Schwartz et al., 2016) containing gRNA (ACGCCGAGGAGTGGTACCGG) (SEQ ID NO: 30) targeting the TRP1 (YALI0B07667g) gene of Y. lipolytica was transformed into strain po1f using Ura3 as the auxotrophic marker. The strain with tryptophan auxotrophy was obtained by selecting on YNB-Ura and YNB-Ura-Trp plates. After that, the positive clones were inoculated onto YPD plates and sub-cultured three times to lose the CRISPR-Cas9 plasmid, resulting in the po1f-T strain (ura3−, leu2−, trp1−).
Plasmid pYLMA-Cre was transformed into target Y. lipolytica strains to rescue URA3, LEU2 and TRP1 markers. Transformants were selected on YPD agar plate supplemented with a final concentration of 250 mg/L hygromycin B (Sigma-Aldrich). After 2-3 days of cultivation, colonies were transferred onto a new YPD plate containing hygromycin B for 1 more day to allow for more successful marker deletions. Markers curation was confirmed by subculturing the colonies onto YNB-Ura, YNB-Leu, and YNB-Trp agar plates, respectively. Successful removal of all three markers will lead to a phenotype conferring uracil, leucine and tryptophan deficiency. Plasmid pYLMA-Cre in cells was then removed by incubating positive strains on YPD agar plates at 30° C. for 24 h, with 2-3 repeats.
Single colonies of recombinant strains were picked from plate, inoculated into 2 mL YPD media, and cultivated overnight (16˜18 h) at 30° C. and 230 rpm. The culture was then transferred to a 50 mL shake flask containing 10 mL YPD media (initial OD600=0.1), and cultivated at 30° C. with shaking at 230 rpm for 3˜5 days. When applicable, 30 mM isoprenol (Sigma-Aldrich) was added into YPD media when glucose of culture was nearly consumed.
Fed-batch fermentations were performed in a 3 L bioreactor (New Brunswick Bioflo115 system). The initial fermentation was completed with 1 L medium containing 100 g/L glucose, 100 g/L peptone, and 50 g/L yeast extract. The temperature was maintained at 30° C. The dissolved oxygen was controlled at 20% with an agitation cascade of 250˜800 rpm. Air was sparged into fermenter at 2 vvm. The pH was maintained at 6.8 by feeding 5 M NaOH or 5 M HCL. Foam was prevented by the addition of antifoam 204 (Sigma-Aldrich). The fed-batch process was initiated after 48 h of cultivation with the 10×Y10P10D50 media consisting of 100 g/L yeast extract, 100 g/L peptone and 500 g/L glucose. Once the media feeding starting, the agitation and aeration was changed and held constantly at 600 rpm and 0.3 vvm, respectively. Samples were taken every 24 h to measure OD600, glucose concentration, and carotenoid titer.
500 μL sample was extracted from the culture for residual glucose quantification. The cells were centrifuged at 12,000 rpm for 5 min, and then the supernatant was filtered through 0.2 μm syringe filters prior to injection into an Agilent technologies 1260 High-Performance Liquid Chromatography (HPLC) equipped with a refractive index detector. A Bio-Rad HPX-87H column was used for separation with 14 mM sulfuric acid as the mobile phase flowing at a rate of 0.7 mL/min. The injection volume was 10 L. The column temperature was 50° C.
The fatty acids synthesized by Y. lipolytica including palmitate (C16:0), palmitoleate (C16:1), stearate (C18:0), oleate (C18:1) and linoleate (C18:2) were quantified using a Gas Chromatography coupled to a Flame Ionization Detector (GC-FID). 0.1˜1 mL cell culture was extracted from each bioreactor such that the sample contained approximately 1 mg biomass. A centrifugation step at 16,000 g for 10 min was performed and the supernatant discarded. 0.5 mL of a 0.5 M sodium hydroxide-methanol solution (20 g/L sodium hydroxide in anhydrous methanol) was mixed with the cell pellets, followed by the addition of 100 L internal standards containing 2 mg/mL methyl tridecanoate (Sigma-Aldrich) and 2 mg/mL glyceryl triheptadecanoate (Sigma-Aldrich) dissolved in hexane. Methyl tridecanoate was used for volume loss correction during sample preparation and glyceryl triheptadecanoate was used for transesterification efficiency correction. The samples were vortexed for 1 h to allow for the transesterification of lipids to fatty acid methyl esters (FAMEs). Afterwards, 40 μL of 98% sulphuric acid (Sigma-Aldrich) was added to neutralize the pH. The FAMEs were then extracted through the addition of 0.5 mL hexane followed by vortexing for 30 min. Centrifugation at 12,000 g for 1 min was then performed to remove cellular debris and the top hexane layer was extracted for analysis. Separation of the FAME species was achieved on an Agilent HP-INNOWax capillary column. The injection volume was 1 μL, split ratio was 10, and injection temperature was 260° C. The column was held at a constant temperature of 200° C. and helium was used as the carrier gas with a flow rate of 1.5 mL/min. The FID was set at a temperature of 260° C. with the flow rates of helium make up gas, hydrogen, and air at 25 mL/min, 30 mL/min, and 300 mL/min, respectively.
To extract intracellular metabolites (e.g. IPP/DMAPP, and GGPP), 1 mL culture was filtered through a 25-mm 0.2 μm nylon filter using vacuum filtration. The cells were washed immediately with 2 mL of water preheated to 30° C., and the filter was submerged in ice-cold extraction buffer (40% methanol+40% acetonitrile+20% water). After incubation at −20° C. for 20 min, the extract solution was centrifuged at 16,000 rpm for 10 min, and the supernatant was transferred to a new tube and dried. The sample was resuspended with 50 μL water, and then centrifuged at 16,000 rpm for 10 min. Metabolites in supernatant were quantified by liquid chromatography-tandem mass spectrometry (LC-MS/MS) comprised of an Agilent 1100 series LC system and an AB Sciex API-4000 MS. 10 μL sample was injected and separation was achieved on a Waters XBridge C-18 column with a mobile phase consisting of solution A (0.1% tributylamine, 0.12% acetic acid, 0.5% 5M NH4OH in water, v/v) and solution B (100% acetonitrile). The flow rate was 0.3 mL/min and the following gradients were used: 0-5 min, 0% B; 5-20 min, 0˜65% B; 20-25 min, 65% B; 25-30 min, 100% B; 30-35 min, 100% B; 35-36 min 100˜0% B, 0% B until 45 min. The analytes were then compared to standard curves generated using chemical standards purchased from Sigma-Aldrich and Cayman Chemicals.
Strains used in labeling studies were revived in YNB media with [U-13C]glucose as the sole carbon source. They were then subcultured in the same media and grown until early stationary phase at 30° C. Samples were taken before the start of the pulse addition of an extra carbon source using the same intercellular metabolite extraction method. Afterwards, 10 mM stearic acid was added to the corresponding cultures, and measurements of metabolite isotopic enrichments were taken at different time points. The optical densities associated with each sample were also recorded. IPP/DMAPP, and GGPP were quantified by LC-MS/MS as previously stated. All MS data from labeling experiments were corrected for natural abundance using IsoCor (Millard et al., 2012).
Carotenoid extraction was performed as described (Asker et al., 2017) with the following modification. Briefly, 100 μL culture was centrifuged for 1 min at 16,000 g, and cell pellets were suspended in 900 μL dimethyl sulfoxide (DMSO, Sigma-Aldrich) prior to heating at 50° C. for 1 h until the cells bleached in a water bath. The DMSO extracts were briefly mixed with 450 μL of methanol and centrifuged at 16,000 g for 5 min. The resultant supernatants were transferred into 96-well assay plates or glass vials for carotenoid analysis and quantification.
The production of carotenoids was expressed as grams per liter of fermentation broth (g/L) and milligrams per gram of dry cell weight (mg/g DCW). Optical densities were measured at 600 nm with Thermo Spectronic Genesys 20 (Thermo Scientific) and used to calculate cell mass (DCW=0.35×OD600 for β-carotene and DCW=0.30×OD600 for lycopene,
Real-time PCR (RT-PCR) was used to estimate the relative gene expression. mRNA extracted by MasterPure™ Yeast RNA purification kit (Lucigen, Wisconsin, USA) was used as the template. RT-PCR was carried out on an iCycler (Bio-Rad, USA) using iScript™ one-step RT-PCR kit with SYBR Green Supermix (Bio-Rad, USA) according to the manufacturer's instructions. ACT1 was used as an internal control gene for normalization. The relative gene expression was calculated using the comparative 2−ΔΔCT or 2−ΔCT method.
Yeast microsomes for in vitro enzymatic assays were prepared as described previously (Pompon et al., 1996). Briefly, strains harboring wild type or mutated CarRP were grown overnight in YNB media at 30° C. and then inoculated into 200 mL YNB media to an initial OD600 of 0.1. After 24 h cultivation, cells were collected by centrifugation at 4,000 rpm for 10 min. Resuspension of the cells in TEK buffer (50 mM Tris-HCl, pH 6.8, 1 mM EDTA, 0.1 M KCl) followed, and the solution was kept at room temperature for 5 min. Afterwards, the cells were recovered by centrifugation, washed in TES buffer (50 mM Tris-HCl, pH 6.8, 1 mM EDTA, 0.6 M sorbitol), resuspended in TESM buffer (50 mM Tris-HCl, pH 6.8, 1 mM EDTA, 0.6 M sorbitol, 14 mM 2-mercaptoethanol), and left at room temperature for 10 min. Then, the cells were recovered once again by centrifugation, washed in extraction buffer (50 mM Tris-HCl, pH 6.8, 1 mM EDTA, 1 mM PMSF), and resuspended in extraction buffer. Glass beads were added to each sample, which were intermittently vortexed for 30 s and placed on ice for 30 s for a total of 15 repeats. The cell pellets were then discarded by centrifugation at 4,000 rpm, 4° C. for 10 min, and the supernatant was transferred to a 50 mL tube. The crude yeast microsomal fraction collected above was used for in vitro assays of lycopene cyclase. Standard enzyme assays were performed in a total volume of 200 μL containing 50 mM Tris-HCl (pH 6.8), 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 mg of microsomal proteins. Serial concentrations of lycopene (50˜350 mol/L) dissolved in dimethyl sulfoxide (DMSO) were used as the substrate. Reactions were initiated by substrate addition, incubated at 30° C. with gentle shaking for 16 h, and then terminated by adding 200 μL ethyl acetate. The solution was vortex for 10 min, and the organic phase was collected by centrifugation and analyzed by HPLC.
The variants were generated by analyzing the amino acid conserved and co-evolutionary information of this protein family from Position Specific Scoring Matrix (PSSM). Here the matrix was generated using psiblast from ncbi-blast-2.7.1+(Altschul et al., 1997) with uniref90 (Suzek et al., 2007) as the database and an E-value of 0.01 running 3 iterations. For all positions in the protein, the PSSM score which represents conservatism of amino acids was calculated for both lycopene cyclase and other homologous proteins of this family. The higher score indicates the more conservative of the amino acid in this position. The substitutions that could be replaced with more conserved amino acids based on the PSSM scores were screened. The different value between the potential substitutions and wild-type amino acids was calculated and the scores were sorted. All glycine substitutions were removed from the scoring. Top 25 scoring substitutions were combined into double substitutions randomly. A distance matrix was computed using the PAM30 substitution matrix and clustered using Agglomerative in sklearn (Pedregosa et al., 2011) into 25 clusters to minimize the number for test. The variants were chosen randomly within each cluster. The ranked 26-50 scoring substitutions were ordered as single mutational variants.
A homology model was generated of the lycopene cyclase using TrRosetta server (Yang et al., 2020) submitted the sequence of the R domain (1-239 amino acids) of CarRP.
The C/N ratio was calculated by referring to the composition ofYeast extract (Bacto™) and Peptone (Bacto™) in the BD Bionutrients™ technical manual (Table 10) (legzacy.bd.com/ds/technicalCenter/misc/lcn01558-bionutrients-manual.pdf). The carbon in Yeast extract and Peptone was ignored because of its extremely lower concentration relative to that of glucose. The total nitrogen in Yeast extract and Peptone is 10.9% and 15.4%, respectively. The C/N ratio was generated with the following formula. X, Y, and Z represent the concentration of glucose, yeast extract and peptone respectively.
Xanthophyllomyces dendrorhous
Mucor circinelloides
Xanthophyllomyces dendrorhous
Mucor circinelloides
Pantoea agglomerans
Taxus canadensis
Sulfolobus acidocaldarius
Xanthophyllomyces dendrorhous
Yarrowia lipolytica
Erwinia uredovora
Pantoea agglomerans
Pseudomonas fulva
Haematococcus pluvialis
Y.
lipolytica
S.
cerevisiae
E. coli
Y.
lipolytica
S.
cerevisiae
E. coli
This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63/304,412, filed Jan. 28, 2022, entitled “METHODS OF PRODUCING CAROTENOIDS FROM ACID WHEY,” the entire disclosure of which is hereby incorporated by reference in its entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2023/061361 | 1/26/2023 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63304412 | Jan 2022 | US |
