Patent Application
20120207753
The present invention is related to pharmaceutical compositions and methods for the treatment of cancers with CD44 fusion proteins and the derivatives of these fusion proteins. In certain aspects, these pharmaceutical compositions and methods include the use of CD44 fusion proteins as single agents and in combinations with other anti-cancer therapeutics to treat cancers, including glioma, and to prevent recurrence of cancers, including that of glioma, after a variety of therapeutic interventions including surgical removal of cancers. In other aspects, these pharmaceutical compositions and methods include the use of CD44 fusion proteins along with, prior to, or after other anti-cancer therapies to treat glioma and other cancer types. CD44 fusion proteins can be used after other therapeutic interventions as a maintenance therapy to block expansion of cancer stem cells and to delay or stop cancer recurrence and metastasis. In another aspect, the combination of pharmaceutical compositions or methods administered along with other anti-cancer therapies provides a synergistic effect on the treatment of glioma and other cancer types. In other aspects, these pharmaceutical compositions and methods include the use of CD44 fusion proteins to detect CD44 ligands, including HA, for early cancer diagnosis and prognosis, and for assessment of patient responses to anti-cancer treatments.
Conventional anti-cancer therapy is primarily directed at tumor cell properties that distinguish them from normal cells, including a generally higher proliferation rate and distinct metabolic requirements. Although beneficial in a selected group of malignancies, conventional chemotherapy has a limited effect on the majority of solid tumors while imposing serious toxicity. More recent targeted therapeutic strategies are designed to target specific hyperactivated oncogenes and kinases in cancer cells. They are generally less toxic than chemotherapy but their efficacies are limited by tumor cell heterogeneity, ability to switch their dependence from one aberrant signaling pathway to an alternative one, and emerging of resistant clones that have acquired new mutations. It is thus becoming increasingly apparent that merely targeting cancer cells is unlikely to cure most solid malignancies (Araujo et al., 2007; Zhang et al., 2009). Accumulating data from numerous recent observations indicate the host microenvironment provides an essential contribution to cancer progression, helps maintain cancer stem cell niches, and modulates the response of cancer cells to treatment, implying that elements within the tumor microenvironment may constitute important targets for anti-cancer therapy (Gilbertson and Rich, 2007; Hideshima et al., 2007; Hoelzinger et al., 2007; Mantovani et al., 2008; Mishra et al., 2009; Podar et al., 2009).
The tumor microenvironment consists of the infiltrating host cells, including endothelial cells, pericytes, leukocytes, and fibroblasts, as well as the components of the extracellular matrix (ECM). Key interactions and cross-talk between tumor cells and their microenvironment are mediated by their surface receptors including cell-cell adhesion and ECM receptors that are potentially attractive therapeutic targets. It has been elegantly shown, for example, that adhesion of multiple myeloma (MM) cells to the ECM confers cell adhesion-mediated drug resistance (CAMDR) (Hideshima et al., 2007). While the molecular basis underlying CAMDR in MM is still being investigated, interactions between the host microenvironment and numerous other cancer types along with the downstream signaling pathways activated by the interactions remain largely under-explored. Identifying key mediators of tumor cell-ECM interactions and the corresponding downstream signaling pathway(s) that promote(s) cancer progression and resistance to therapy are likely to lead to the development of novel and more efficacious therapeutic strategies that target cancer cells and their microenvironment simultaneously.
Gliomas are the most common type of primary brain cancer and constitute a spectrum of tumors of variable degrees of differentiation and malignancy that may arise from the transformation of neural progenitor cells (Giese et al., 2003; Maher et al., 2001). The most malignant of these tumors is grade IV astrocytoma, also known as glioblastoma multiforme (GBM), which displays highly invasive properties and extremely elevated chemoresistance. Despite aggressive multimodal therapy, GBM remains incurable, with an estimated median survival of less than 1 year and with less than 5% of patients surviving longer than 5 years (Davis et al., 1998). Identification of novel therapeutic targets, development of new agents and novel strategies of combinational treatments to reduce the resistance of GBM to chemo- and established targeted therapies are therefore urgently needed.
The central nervous system contains elevated levels of the broadly distributed glycosaminoglycan hyaluronan (HA); also known as hyaluronic acid or hyaluronan (Park et al., 2008). Gliomas express high levels of a major cell surface HA receptor, CD44, which mediates cell-cell and cell-matrix adhesion and promotes cell migration and signaling (Stamenkovic and Yu, 2009). CD44 is a polymorphic cell surface receptor implicated in diverse cellular functions ((Sherman et al., 1994; Stamenkovic, 2000; Stamenkovic I, 2009; Toole, 2004). It is upregulated in a variety of malignant tumors and its elevated expression correlates with poor prognosis of several cancer types (Lim et al., 2008; Matsumura and Tarin, 1992; Pals et al., 1989; Yang et al., 2008). CD44 is believed to play an important role in the growth and progression of melanoma (Ahrens et al., 2001; Guo et al., 1994) and breast cancer (Yu and Stamenkovic, 1999, 2000; Yu et al., 1997) but little is known about its contribution to the progression of malignant glioma and the responses of GBM cells and other types of cancer cells to chemotherapy and targeted therapies.
CD44 has been shown to be associated with several signaling components and to serve as a co-receptor with several receptor tyrosine kinases (RTKs) (Sherman et al., 1994; Stamenkovic, 2000; Toole, 2004) but no single intact signaling pathway regulated by CD44 has been defined to date. The cytoplasmic domain of CD44 interacts with members of the Band 4.1 superfamily, including ezrin-radixin-moesin (ERM) family proteins (Tsukita and Yonemura, 1997) and merlin (Morrison et al., 2001; Sainio et al., 1997), which serve as linkers between cortical actin filaments and the plasma membrane and regulate actin cytoskeleton organization and cell motility (McClatchey and Giovannini, 2005; Okada et al., 2007). In Drosophila, merlin functions upstream of the Hippo (Hpo) signaling pathway, which plays an important role in restraining cell proliferation and promoting apoptosis in differentiating epithelial cells (Hamaratoglu et al., 2006; Huang et al., 2005; Pellock et al., 2007). The Drosophila hpo gene encodes a serine/threonine kinase that phosphorylates and activates the serine/threonine kinase Warts (Wts). Warts phosphorylates and inactivates a co-transcription factor Yorkie (Yki), which results in repression of a common set of downstream target genes, including dIAP and cyclin E (Hamaratoglu et al., 2006; Huang et al., 2005; Matallanas et al., 2008; Pellock et al., 2007). Although still incompletely characterized, the Hippo pathway is believed to be conserved in mammals where several of its components appear to be tumor suppressors (Lau et al., 2008; Zeng and Hong, 2008). Mammalian homologs of Hpo, Wts, Yki, and dIAP are, respectively, Mammalian Sterile Twenty-like (MST) kinase1 and 2 (MST1/2) (Lehtinen et al., 2006; Ling et al., 2008; Matallanas et al., 2008), Large tumor suppressor homolog 1 and 2 (Lats1 and 2) (Hao et al., 2008; Takahashi et al., 2005), Yes-Associated Protein (YAP) (Overholtzer et al., 2006), and cellular Inhibitor of Apoptosis (cIAP1/2) (Srinivasula and Ashwell, 2008). The upstream components of the mammalian Hippo signaling pathway have not been identified.
Efficacies of current available therapies for many malignant cancers, including glioma, are relative low and render patients with these diseases poor prognosis with short life expectancy after the diagnosis. New targets, agents, and combinational therapeutic approaches for treatment are therefore necessary. In addition, it would be particularly helpful to be able to that target the bulk of tumor cells, including glioma, their stem cells, and their microenvironment simultaneously. The present invention provides such methods.
In certain embodiments of the present invention, a method for therapeutic intervention or inhibition of cancer recurrence of a cancer in a mammal is provided, which involves administering to the mammal in need of such treatment an effective amount of a CD44 fusion protein, which includes the constant region of human IgG1 fused to an extracellular domain of CD44, and wherein the cancer is glioma, colon cancer, breast cancer, prostate cancer, ovarian cancer, lung cancer, melanoma, renal cell carcinoma, gastric cancer, esophageal cancer, pancreatic cancer, liver cancer, or head-neck cancer.
In certain aspects of the present invention, a method for treating a cancer in a mammal is provided, which involves administering to the mammal in need of such treatment an effective amount of a CD44 fusion protein, which includes the constant region of human IgG1 fused to an extracellular domain of CD44, and wherein the CD44 fusion protein is administered via a virus carrying an expression vector encoding the CD44 fusion protein and, optionally, a pharmaceutically acceptable carrier or diluent.
In certain aspects of the present invention, a method for treating a cancer in a mammal is provided, which involves administering to the mammal in need of such treatment an effective amount of a CD44 fusion protein, which includes the constant region of human IgG1 fused to an extracellular domain of CD44, and wherein the CD44 fusion protein is administered as purified protein and b) a pharmaceutically acceptable carrier or diluent.
In certain aspects of the present invention, a method for treating a cancer in a mammal is provided, which involves administering to the mammal in need of such treatment an effective amount of a CD44 fusion protein, which includes the constant region of human IgG1 fused to an extracellular domain of CD44, and wherein the extracellular domain of CD44 is CD44s, CD44v3-v10, CD44v8-v10, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44sR41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, or CD44v3R41A.
In other embodiments of the present invention, a pharmaceutical composition is provided, which includes: a) a CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44, wherein the extracellular domain of CD44 is CD44v3-v10, CD44v8-v10, CD44s, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44sR41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, or CD44v3R41A; and b) a pharmaceutically acceptable carrier or diluent.
In other aspects of the present invention, a method for treating a cancer in a mammal is provided, which involves administering to the mammal in need of such treatment an effective amount of a CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44 along with one or more additional anti-cancer therapies.
In certain aspects of the present invention, the additional anti-cancer therapies are surgery, chemotherapy, radiation therapy, targeted therapy, and immunotherapy. In certain aspects of the present invention, the additional anti-cancer therapy is radiation therapy. In other aspects of the present invention, the additional anti-cancer therapy is surgery.
In certain aspects of the present invention, the additional anti-cancer therapy is chemotherapy. In certain aspects of the present invention, the chemotherapy is temozolomide, carmustine, docetaxel, carboplatin, cisplatin, epirubicin, oxaliplatin, cyclophosphamide, methotrexate, fluorouracil, vinblastine, vincristine, mitoxantrone, satraplatin, ixabepilone, pacitaxel, gemcitabine, capecitabine, doxorubicin, etoposide, melphalan, hexamethylamine, irinotecan, or topotecan. In another aspect of the present invention, the chemotherapy is temozolomide or carmustine.
In certain aspects of the present invention, the additional anti-cancer therapy is targeted therapy. In certain embodiment of the present invention, the targeted therapy is a receptor tyrosine inhibitor. In certain embodiment of the present invention, the targeted therapy is an inhibitor of erbB receptor. In certain embodiment of the present invention, the targeted therapy is an inhibitor of c-Met. In certain embodiment of the present invention, the targeted therapy is an inhibitor of VEGFR. In certain embodiment of the present invention, the targeted therapy is an agent that promotes apoptosis and stress responses. In certain embodiment of the present invention, the targeted therapy is an inhibitor of the Wnt signaling pathway. In certain embodiments of the present invention, the targeted therapy is Trastuzumab, cetuximab, panitumumab, gefitinib, erlotinib, lapatinib, BIBW2992, CI-1033, PF-2341066, PF-04217903, AMG 208, JNJ-38877605, MGCD-265, SGX-523, GSK1363089, sunitinib, sorafenib, vandetanib, BIBF1120, pazopanib, bevacizumab, vatalanib, axitinib, E7080, perifosine, MK-2206, temsirolimus, rapamycin, BEZ235, GDC-0941, PLX-4032, imatinib, AZD0530, bortezomib, XAV-939, advexin (Ad5CMV-p53), Genentech—Compound 8/cIAP-XIAP inhibitor, or Abbott Laboratories—Compound 11.
In other embodiments of the present invention, a pharmaceutical composition is provided, which includes: a) a CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44, wherein the extracellular domain of CD44 is a CD44v3-v10, CD44v8-v10, CD44s, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44sR41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, or CD44v3R41A; b) at least one therapeutic agent that causes cytotoxic or cytostatic stress in cancer cells; and c) a pharmaceutically acceptable carrier or diluent.
In another embodiments of the present invention, a pharmaceutical composition is provided, which includes: a) a CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44, wherein the extracellular domain of CD44 is a CD44v3-v10, CD44v8-v10, CD44s, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44sR41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, or CD44v3R41A; b) at least one therapeutic agent that inhibits EGFR/erbB-2/erbB-3/erbB-4/c-Met/VEGFR RTK in cancer cells; and c) a pharmaceutically acceptable carrier or diluent. In certain aspects of the present invention, the inhibitor of EGFR/erbB-2/erbB-4/c-Met/VEGFR RTK includes Trastuzumab, cetuximab, panitumumab, gefitinib, erlotinib, lapatinib, BIBW2992, CI-1033, PF-2341066, PF-04217903, AMG 208, JNJ-38877605, MGCD-265, SGX-523, GSK1363089, sunitinib, sorafenib, vandetanib, BIBF1120, pazopanib, bevacizumab, vatalanib, axitinib, and E7080.
In another embodiments of the present invention, a pharmaceutical composition is provided, which includes: a) a CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44, wherein the extracellular domain of CD44 is a CD44v3-v10, CD44v8-v10, CD44s, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44sR41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, or CD44v3R41A; b) at least one therapeutic agent that inhibits IAPs or promotes stresses in cancer cells; and c) a pharmaceutically acceptable carrier or diluent. In certain aspects of the present invention, the inhibitor of IAPB or promotes stresses includes advexin (Ad5CMV-p53), Genentech—Compound 8/cIAP-XIAP inhibitor, Abbott Laboratories—Compound 11, perifosine, MK-2206, temsirolimus, rapamycin, BEZ235, GDC-0941, PLX-4032, imatinib, AZD0530, bortezomib, or XAV-939.
In other embodiments of the present invention, a pharmaceutical composition is provided, which includes: a) a virus carrying a expression vector encoding a CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44, wherein the extracellular domain of CD44 is CD44v3-v10, CD44v8-v10, CD44s, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44sR41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, or CD44v3R41A; and b) a pharmaceutically acceptable carrier or diluent.
In certain aspects of the above embodiments, the cancer is glioma, colon cancer, breast cancer, prostate cancer, ovarian cancer, lung cancer, melanoma, renal cell carcinoma, gastric cancer, esophageal cancer, pancreatic cancer, liver cancer or head-neck cancer. In certain embodiments of the present invention the glioma is an astrocytoma. In other embodiments of the present invention the glioma is a glioblastoma multiforme. In certain embodiments of the present invention the mammal is a human.
In certain aspects of the above embodiments, the extracellular domain of the CD44 is CD44v3-v10. In other aspects of the above embodiments, the extracellular domain of the CD44 is CD44v8-v10. In another aspect of the above embodiments, the extracellular domain of the CD44 is CD44s. In another aspect of the above embodiments, the extracellular domain of the CD44 is CD44v6-v10.
In other embodiments of the present invention, methods of detecting hyaluronan in a sample are provided, comprising contacting the sample with a labeled CD44 fusion protein comprising the constant region of human IgG1 fused to an extracellular domain of CD44. In certain embodiments, the sample is a cancer biopsy or cancer section. In other embodiments, the sample is a patient fluid sample is blood, serum, plasma, or urine. In other embodiments, the label is biotin, fluorescent labels, alkaline phosphatase, horseradish peroxidase, magnetic beads, or radioactive labels. In yet another embodiment, the methods further comprise incubating the labeled CD44 fusion protein in the sample and quantifying the label bound to hyaluronan. In yet another embodiment, the extracellular domain of CD44 is CD44v3-v10, CD44v8-v10, CD44s, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, or CD44v3.
In other embodiments of the present invention, methods of diagnosing a cancer in a mammal are provided, comprising detecting hyaluronan in a sample from the mammal, wherein the detecting is done according to any of the described methods of detecting hyaluronan, and wherein an increase in the amount of hyaluronan in the sample compared to a normal control sample indicates the presence of cancer. In certain embodiments, the cancer is a glioma, colon cancer, breast cancer, prostate cancer, ovarian cancer, lung cancer, renal cell carcinoma, gastric cancer, esophageal cancer, head-neck cancer, pancreatic cancer, or melanoma. In certain other embodiments, the methods further comprise detecting CD44 in the sample, and wherein an increase in the amount of hyaluronan and CD44 in the sample compared to a normal control sample indicates the presence of cancer.
In other embodiments of the present invention, methods of determining a change in the cancerous state of a mammal are provided, comprising collecting a first sample from the mammal, detecting hyaluronan in the first sample from the mammal, wherein the detecting is done according to any of the described methods of detecting hyaluronan, collecting a second sample from the mammal, detecting hyaluronan in a second sample from the mammal, wherein the detecting is done according to any of the described methods of detecting hyaluronan, wherein a difference in the amount of hyaluronan in the second sample compared to the amount in the first sample indicates a change in the cancerous state of the mammal.
These and others aspects of the present invention will be apparent to those of ordinary skill in the art in light of the present specification, claims, and drawings.
The present invention provides pharmaceutical compositions and methods for treating, preventing, or diagnosing cancers in a mammal. The present invention further provides pharmaceutical compositions and methods for treating or preventing gliomas in a mammal. The present invention provides pharmaceutical compositions and methods for treating or preventing of glioblastoma multiforme and other cancer types in a mammal. The present invention is further directed to pharmaceutical compositions and methods for sensitizing glioma cells and other types of cancer cells to oxidative, cytotoxic, and targeted therapeutic stresses for the treatment of gliomas and other cancer types. Oxidative stresses can be induced by, but not limited to, chemotherapy or radiation therapy. In one aspect, CD44 fusion proteins, acting as CD44 antagonists, are administered to a mammal for the treatment, prevention, or diagnosis of a glioma or other cancer types including colon cancer, breast cancer, prostate cancer, ovarian cancer, lung cancer, melanoma, renal cell carcinoma, gastric cancer, esophageal cancer, pancreatic cancer, liver cancer, and head-neck cancer. In another aspect, CD44 fusion proteins are administered alone and/or in combination with other therapeutic interventions to eliminate and/or suppress cancer stem cells. Targeted therapies can be inhibitors of EGFR, erbB-2, erbB-3, erbB-4 and c-Met receptor kinases or other receptor tyrosine kinases. In another aspect, targeted therapies are inhibitors of IAPs including cIAPs, XIAP, and survivin. In yet another aspect, targeted therapies are enhancers/stimulators/stabilizer of p53, p21, puma, and p38/JNK kinases. In another aspect, targeted therapies are the agents that promote or induce apoptotic stresses to cancer cells including inhibitors of PI3K, mTOR, proteasome inhibitor, and angiogenesis inhibitors. In yet another aspect, targeted therapies are inhibitors of Wnt signaling pathway.
Gliomas are the most common type of primary brain cancer and constitute a spectrum of tumors of variable degrees of differentiation and malignancy that may arise from the transformation of neural progenitor cells (Giese et al., 2003; Maher et al., 2001). The most aggressive of these tumors is grade IV astrocytoma, also known as glioblastoma multiforme (GBM), that by virtue of its resistance to chemotherapy, radiotherapy, and established targeted therapies, is incurable (Davis et al., 1998). As demonstrated in the present Examples, gliomas express elevated levels of a major cell surface HA receptor, CD44.
Resistance to cytotoxic agents, radiation, and targeted therapies constitutes the major obstacle to successful treatment of GBM and other malignant cancers. Increasing evidence suggests the existence of cancer stem cells (CSC), including glioma CSCs, that are highly resistant to chemo- and radiation therapy and are likely to be responsible for the recurrence of malignant cancer, including GBM, following therapeutic intervention (Hambardzumyan et al., 2008; Reya et al., 2001). Although the implication of CD44 in the formation and maintenance glioblastoma CSC is just started to be uncovered, CD44 has been established as a major cell surface CSC marker in numerous tumors including leukemia and cancers of the breast, colon, ovary, prostate, pancreas, and head-neck (Croker and Allan, 2008; Reya et al. 2001; Stamenkovic and Yu, 2009). CD44 has been shown to be required for engraftment of leukemia CSC in the bone marrow (Jin et al., 2006; Krause et al., 2006) and to be functionally relevant for colorectal cancer CSC (Du et al., 2008). These observations suggest a potentially important role of CD44 in CSC maintenance and/or function. The present Examples demonstrate that CD44 attenuates the activation of the Hippo stress/apoptotic signaling pathway in GBM cells and protects GBM cells from temozolomide (TMZ) and oxidative stress in vitro and provides a chemoprotective function in vivo. Furthermore, knockdown of CD44 expression inhibits self-renewal capacity of glioma spheres and expression of CD44 antagonism, hsCD44s-Fc fusion protein inhibits in vivo growth of GBMCSCs, suggesting an important role of CD44 in cancer stem cell maintenance.
Breast cancer is the most common cancer among women in the United States and the second leading cause of cancer related death in women. Due to improved early detection and treatment, breast cancer death rates are going down. However, there are still estimated 40,170 breast cancer related deaths in year 2009 (http://www.cancer.gov/cancertopics/types/breast), which is largely caused by the abilities of breast cancer cells to metastasize and develop resistance to current therapies. This reality urgently begs for more effective and targeted novel therapies that battle these deadly abilities of malignant breast cancer. Recent advances in cancer stem cell (CSC) field have indicated that therapeutic resistance and recurrence of malignant cancers including breast cancer are likely due to existence of a small subset of CSCs including breast CSCs (BCSCs) that are highly resistant to therapeutic interventions (Al-Hajj et al., 2003; Dean et al., 2005; Reya et al., 2001). CSCs are characterized by their ability to self-renew, differentiate into various lineages, and reconstitute the cellular hierarchy of the tumor (Al-Hajj et al., 2003; Reya et al., 2001).
Breast cancers consist of heterogeneous cell populations including tumor cells and host stroma. Much of cancer research has been focus on cancer cells. Increasing evidence has indicated that the host micro-environment plays essential roles in breast cancer progression and regulating their response to therapies (Al-Hajj et al., 2003; Liu et al., 2007). Furthermore, maintenance of BCSCs requires adequate host microenvironment niche. Therefore, it is essential to develop new therapeutic agents that target BCSCs and their microenvironment niche in order to eradicate this deadly disease. Physical interactions and functional cross-talk between tumor cells and their micro-environment are mediated primarily by cell surface receptors that are responsible for the cell-cell and cell-ECM (extracellular matrix) adhesion. CD44 is a major cell surface receptor for hyaluronan (HA), an abundant component of ECM, as well as a key marker for CSCs including BCSCs (Collins et al., 2005; Patrawala et al., 2006; Ponti et al., 2005; Reya et al., 2001). CD44+/CD24− BCSCs display increased tumorigenicity, metastatic potential, and chemoresistance (Collins et al., 2005; Reim et al., 2009; Shipitsin et al., 2007). Accumulation of the CD44 ligand, HA, in breast cancer stroma is correlated with an unfavorable prognosis (Tammi et al., 2008).
Prostate cancer is the second leading cause of cancer-related death in American men. Prognosis for hormone-independent/refractory metastatic prostate cancer (HRPC) is very poor and treatment options for the late stage disease are limited. Therefore, there is an urgent need to develop more effective and targeted novel therapies to combat this deadly disease. To achieve that, it is essential to first identify novel targets that play key roles in prostate cancer progression, metastasis, and resistance to chemotherapy. Recent advances in CSC research demonstrated that CSCs are highly resistant to chemo- and radio-therapy and are believed to be responsible for tumor recurrence following therapeutic intervention (Dean et al., 2005; Reya et al., 2003). CD44 is a predominant cell surface marker for a variety of human cancer stem or initiating cells including that of prostate cancers (Collins et al., 2005; Hurt et al., 2008; Maitland and Collins, 2008).
Current anti-cancer therapeutic strategies and target selection are heavily concentrated on frequently mutated kinases whose activity cancer cells appear to become addicted (Sharma et al., 2007). Although these approaches are conceptually sound and supported by notable successes, they are hampered by the emergence of resistant tumor cells capable of bypassing the targeted signaling pathways through mechanisms that may be related to the mutated nature of the target itself. It is now well accepted that therapeutic interventions targeting only a single signaling pathway, no matter how seemingly important, are relatively easily evaded by cancer cells as they acquire new genetic and epigenetic alterations. An alternative strategy may therefore be to identify versatile molecules that, unlike the key drivers of oncogenesis, are not central to any single functional tumor cell property but participate in multiple functions, including the modulation of diverse signaling pathways as co-receptors, interactions between tumor cells and the host tissue microenvironment, and responses of tumor cells to various forms of stresses. Based on their obvious usefulness for tumor growth and progression, such molecules are likely to be upregulated in malignant tumors but unlikely to be frequently mutated. Selective inhibition of these types of broad-spectrum targets that play essential roles in mediating tumor-host interaction and in modulating activities of several important signaling pathways, especially in combination with chemo- and radiation therapy, and targeted therapies against these essential signaling pathways and/or promote/induce stresses to cancer cells, may therefore overcome the drug resistance obstacle of current cancer treatment and achieve more efficacious and/or longer lasting clinical benefits. The present invention indicates that CD44 is one such target for multiple cancers, and antagonists of CD44, which includes soluble human CD44 fusion proteins such as CD44-Fc fusion proteins, are effective anti-cancer agents. Our preclinical results provide strong support for the therapeutic potential of targeting CD44 in malignant glioma, breast cancer, prostate cancer, melanoma, pancreatic cancer, liver cancer, and head-neck cancer, colon cancer, ovarian cancer, and lung cancer. For example,
Based on the fact that CD44 is up-regulated and/or plays an important role in various cancer types, CD44 may serve as therapeutic target for the following cancers in addition to human gliomas, colon cancer, breast cancer, prostate cancer, lung cancer, ovarian cancer, melanoma (Stamenkovic and Yu, 2009), head-neck carcinoma (Aillles and Prince, 2009; Nelson and Grandis, 2007), pancreatic cancer (Hong et al., 2009; Klingbeil et al., 2009; Lee et al., 2008), and liver cancer (Barbour et al., 2003; Yang et al., 2008), malignant mesothelioma (Ramos-Nino et al., 2007; Tajima et al., 2010), sarcomas (Yoshida et al., 2008), renal-cell carcinoma (FIG. 37-38,) (Lim et al., 2008; Lucin et al., 2004; Yildiz et al., 2004), cancer of the esophagus (
CD44 has been implicated in the modulation of several signaling pathways. It serves as a co-receptor of c-Met (Matzke et al., 2007) and modulates signals from the ErbB family of RTKs (Turley et al., 2002). CD44 activates c-Src and focal adhesion kinase (FAK) (Turley et al., 2002) and promotes cell motility through activation of Rac1 (Murai et al., 2004). However, no single core intact pathway that mediates CD44 derived signal has been established thus far. CD44 interacts with the ERM family proteins (Tsukita and Yonemura, 1997) and merlin (Morrison et al., 2001; Sainio et al., 1997), the product of the neurofibromatosis type 2 (NF2) gene. Merlin mutations or loss of merlin expression cause NF2 disease, characterized by the development of schwannomas, meningiomas, and ependymomas (Gutmann et al., 1997; Kluwe et al., 1996). In Drosophila, merlin functions upstream of the Hippo signaling pathway, but a definitive link between merlin and the mammalian Hippo pathway orthologs has not been fully established. We have shown recently that merlin is a potent inhibitor of human GBM growth and that it functions upstream of MST1/2 by activating MST1/2-Lats2 signaling in glioma cells (Lau et al., 2008). These observations suggest that the mammalian Hippo signaling pathway may play an important role in GBM progression. The present invention demonstrates that cancer cells with depleted endogenous CD44 responded to oxidative and cytotoxic stresses with robust and sustained phosphorylation/activation of MST1/2 and Lats1/2, phosphorylation/inactivation of YAP, and reduced expression of cIAP1/2. These effects correlate with reduced phosphorylation/inactivation of merlin and increased levels of cleaved caspase-3. By contrast, a higher level of endogenous CD44 promotes phosphorylation/inactivation of merlin, inhibits the stress induced activation of the mammalian equivalent of Hippo signaling pathway, and up-regulates cIAP1/2, leading to the inhibition of caspase-3 cleavage which is an indicator of apoptosis. Together, these results place CD44 upstream of the mammalian Hippo signaling pathway (merlin-MST1/2-Lats1/2-YAP-cIAP1/2) and suggest a functional role for CD44 in attenuating tumor cell responses to stress and stress-induced apoptosis.
Furthermore, the present invention demonstrates that knockdown of CD44 results in elevated and sustained activation of p38/JNK stress kinases, known effectors of MST1/2 kinases, in glioma cells exposed to oxidative and cytotoxic stress. In addition, oxidative stress induced a sustained up-regulation of p53, a known downstream effector of JNK/p38, and its target genes p21 and puma in CD44-deficient glioma cells, whereas the GBM cells with high levels of endogenous CD44 attenuated activation of JNK/p38, and inhibited induction of p53, p21, and puma. These mechanistic results suggest that CD44 antagonists, including CD44 fusion proteins, can be used in synergy with pharmacological enhancers/stimulators/stabilizers of p53, p21, puma, and p38/JNK kinases and with inhibitors of IAPs, including cIAPs and XIAP, to achieve a better clinical outcome.
Receptor tyrosine kinases (RTKs) play a central role in a variety of normal cellular functions, transformation, and tumor progression. Hepatocyte growth factor (HGF) and its receptor c-Met are known to promote brain tumor growth and progression (Abounader and Laterra, 2005). Increased expression of HGF and c-Met frequently correlates with glioma grade, blood vessel density, and poor prognosis. Moreover, over expression of HGF and/or c-Met enhances whereas their inhibition blocks gliomagenesis (Abounader and Laterra, 2005). In addition, amplification of the EGFR gene occurs in approximately 40% of GBM cases and constitutes as a predictor of poor prognosis (Voelzke et al., 2008). The present invention demonstrates that depletion of CD44 inhibits Erk1/2 activation induced by EGFR ligands and HGF but not by NGF or fetal bovine serum (FBS;
Because CD44 is a receptor for multiple ligands, the strategy of using fusion proteins of the extracellular domain of CD44 with non-CD44 molecules, such as the constant region of human IgG1 (Fc), is superior to the functional blocking antibodies against CD44. Each blocking antibody of CD44 can only block the interaction of one or a few ligands, whereas CD44-Fc fusion proteins block all the interaction between CD44 and its ligands mediated by the extracellular domain of CD44. In addition, CD44 is shed from the cell surface by proteases, which is thought to be a functionally important process that triggers signaling pathways and regulates CD44-mediated functions (Stamenkovic and Yu, 2009). Soluble CD44 fusion proteins contain the domain that interacts with CD44 sheddase(s); therefore CD44 fusion proteins are capable of blocking shedding as well as sequestering all the CD44 ligands. These characteristics of CD44 fusion proteins provide advantages for antagonizing CD44 function.
CD44-Fc proteins, which are fusion proteins between the different segments of the extracellular domain of CD44 with the constant region of human IgG1 (Fc), act as “trap” type fusion proteins of a multifunctional transmembrane receptor, which not only target bulk of tumors, cancer stem cells, but also tumor microenvironment (such as infiltrating host cells including but not limited to endothelial cells, pericytes, leukocytes, inflammatory cells, and fibroblasts, tumor-host cell interaction, and tumor-host ECM interaction). Key interactions and cross-talk between tumor cells and their microenvironment are mediated by surface receptors including cell-cell adhesion and ECM receptors, which provide potentially attractive therapeutic targets (Marastoni et al., 2008). The expression of CD44 is often higher in tumor cells, cancer stem cells, and tumor microenvironment, but lower in normal tissues; therefore, CD44 serves as an ideal target for cancer therapy.
CD44 protein consists of an extracellular domain with an NH2-terminal HA-binding region and a membrane-proximal region, a transmembrane domain (TM), and a COOH-terminal cytoplasmic tail (CT) (Peach et al., 1993; Stamenkovic et al., 1989). There is a single CD44 gene containing 20 exons. At least 10 of these exons, exons 6-15 or variant exons v1-v10, can be alternatively spliced to give rise to numerous CD44 variants (Screaton et al., 1993; Screaton et al., 1992). The standard form of CD44 (CD44s) is a product of alternative splicing of transcript and consists of all the common exons 1-5, 16-18 and 20.
In one embodiment of the present invention, CD44 fusion proteins, acting as CD44 antagonists, are administered to a mammal for the treatment or prevention of a glioma or other cancer types. In one aspect, CD44 fusion proteins are administered prior to, simultaneously with, or after an additional anti-cancer therapy or surgical removal of tumors including glioma. CD44 is important for cancer stem cells as we have shown that CD44 depletion inhibits the formation of glioma spheres (
The extracellular domain of CD44 is encoded by exon 1-5, v1-v10 (or exon 6-10), exon 16, and exon 17. The extracellular domain of CD44s consists of exon 1-5, 16, and 17. CD44 variants (CD44v2-v10, CD44v3-v10, CD44v8-v10, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, and CD44v2) consist of exon 1-5, different combinations of the variant exons (v2-v10), exon 16, and exon 17 (
sapien
A fusion protein (SEQ ID NO: 3) comprising the constant region (Fc) of immunoglobulin heavy constant gamma 1 (SEQ ID NO: 1) and the CD44 signal peptide (SEQ ID NO: 2) can be used as a negative control for the anti-tumor activity of the CD44-Fc fusion proteins. In some embodiments, the CD44 extracellular domain of the CD44 fusion protein comprises fragments of CD44 extracellular domains, which is encoded by different combinations of the exons 1-17 of the human CD44 gene (
In another aspect, CD44 fusion proteins comprise different segments of the extracellular domain of wild type CD44 or the R41A CD44 mutant fused to another non-CD44 molecule. In some embodiments, the non-CD44 molecule is a toxin, peptide, polypeptide, small molecule, drug, and the like. In some embodiments, the non-CD44 molecule is a 6-His-tag, GST polypeptide, HA-tag, the constant region (Fc) of human IgG1, or v5-tag. In some embodiments, the proteinase cleavage sites will be put before the tag sequences, so that after purification these tags can be removed by proteolytic cleavage.
Human soluble CD44-Fc (hsCD44) fusion proteins are generated as described in the Material and Methods section of the Examples by fusing the extracellular domain of human CD44s (SEQ ID No. 4), CD44v3-v10 (SEQ ID No. 7+SEQ ID No. 8), CD44v8-v10 (SEQ ID No. 7+SEQ ID No. 9), CD44v6-v10 (SEQ ID No.7+SEQ ID No.20), CD44v3-v10R41A (SEQ ID No. 6+SEQ ID No. 8), CD44v8-v10R41A (SEQ ID No.6+No.9), CD44sR41A (SEQ ID No. 5) to the constant region (Fc) of human IgG1. For Example, full-length CD44v3-v10 variant contains exons 1-5, v3-v10, 16-18, and 20. CD44-v8-v10 contains exons 1-5, v8-v10, 16-18, and 20. R41A mutation abolishes the binding capacity of CD44 to one of its major ligands, hyaluronan (Peach et al., 1993), and all CD44 isoforms contain this residue.
Fusion proteins between other CD44 variants and the constant region (Fc) of human IgG1 can work effectively as potent anti-cancer agents in similar fashion as the ones used in the Examples. These fusion proteins include but are not limited to CD44v4-v10-, CD44-5-v10-, CD44v7-v10-, CD44v9-v10-, CD44v10-, CD44v3-, CD44v4-, CD44v5-, CD44v6-, CD44v7-, CD44v8-, and CD44v9-Fc or above CD44 isoforms containing R41A mutation (Peach et al., 1993), and different combinations and/or modifications of different extracellular domains/exons of CD44 fused to the constant region (Fc) of human IgG1. The modifications can be any modifications including, but not limited to, mutations, insertions, substitutions, deletions, and the like. The CD44 extracellular domain can also be derived from different combinations of exons 1-17, different deletions, mutations, duplication, or multiplication of the different segments of the extracellular domain of CD44.
In some embodiments, the nucleic acid molecule encoding a CD44 fusion protein is operably linked to a promoter. In some embodiments, the promoter can facilitate the expression in a prokaryotic cell and/or eukaryotic cell, including COS-7, CHO, 293, human glioblastoma cells, and other human cancer cells. The promoter can be any promoter that can drive the expression of the nucleic acid molecule. Examples of promoters include, but are not limited to, CMV, SV40, pEF, actin promoter, and the like. In some embodiments, the nucleic acid molecule is DNA or RNA. In some embodiments, the nucleic acid molecule is a virus, vector, or plasmid. In some embodiments, the expression of the nucleic acid molecule is regulated such that it can be turned on or off based on the presence or absence of a regulatory substance. Examples of such a system include, but are not limited to a tetracycline-ON/OFF system.
Soluble recombinant CD44 HA-binding domain (CD44-HABD) was found to block angiogenesis in vivo in chick and mouse and inhibited growth of melanoma and pancreatic adenocarcinoma (Pall et al., 2004). Soluble CD44 inhibits melanoma tumor growth by blocking cell surface CD44 binding to hyaluronic acid (Ahrens et al., 2001). CD44-receptor globulin inhibits lung metastasis of B16F10 murine melanoma metastasis and CD44-receptor globulin contains the extracellular part of CD44s or CD44v10 linked to the constant region of the immunoglobulin kappa light chain (Zawadzki et al., 1998). Soluble CD44s-immunoglobulin fusion protein inhibits in vivo growth of human lymphoma Namalwa (Sy et al., 1992).
These CD44-Fc fusion proteins can be modified to improve efficacy. These modifications include inserting multiple repeated domains containing the different ligand binding sites and by fusing the CD44 extracellular domain to the parts of the other proteins such as the coil-coil domain of angiopoietins, which are known to oligomerize the molecules.
CD44R41A Mutant vs. Wild Type CD44 Fusion
CD44's major ligand is hyaluronan (HA). CD44 has other ligands such as osteopontin (Verhulst et al., 2003; Zhu et al., 2004), fibronectin, collagen types I and IV (Ponta et al., 1998), serglycin, laminin (Naor et al., 1997), MMP-9 (Yu and Stamenkovic, 1999, 2000), MMP-7 (Yu et al., 2002), and fibrin (Alves et al., 2008). CD44 also cooperates with several receptor tyrosine kinases (Orian-Rousseau and Ponta, 2008; Ponta et al., 2003), P-selectin (Alves et al., 2008), E-selectin (Dimitroff et al., 2001; Hidalgo et al., 2007; Katayama et al., 2005), death receptor (DR) (Hauptschein et al., 2005), and membrane-type 1 matrix metalloproteinase (MT1MMP) (Kajita et al., 2001).
The CD44 HA-binding site is located in the NH2-terminus (residues 21-178). Modification of CD44 by switching R41 to A abolishes the binding capacity of CD44 to HA (Banerji et al., 2007; Peach et al., 1993). Therefore, modification of CD44-Fc fusion proteins by switching R41 to A can result in CD44-Fc fusion proteins which can effectively trap CD44 ligands other than HA. These mutations are also likely to increase the fusion proteins' bioavailability due to reduced sequestering of these fusion proteins by HA in the extracellular matrix (ECM). These R41A mutations may also result in fusion proteins with a greater capacity for trapping other CD44 ligands and CD44 sheddase(s) due to the increased bioavailability of CD44R41A-Fc fusion proteins, which may be particularly important when the interaction between CD44 and these other ligands or CD44 shedding is driving the progression of particular types of cancer at a particular stage and/or after a particular therapeutic treatment. We have shown that the CD44v3-v10R41A-Fc fusion protein retained a substantial level of anti-GBM activity (
The present invention provides an isolated nucleic acid molecule (polynucleotide) encoding a CD44 fusion protein.
In some embodiments, the nucleic acid molecule is a recombinant viral vector. A “recombinant viral vector” refers to a construct, based upon the genome of a virus that can be used as a vehicle for the delivery of nucleic acids encoding proteins, polypeptides, or peptides of interest. Recombinant viral vectors are well known in the art and are widely reported. Recombinant viral vectors include, but are not limited to, retroviral vectors, adenovirus vectors, adeno-associated virus vectors, and lenti-virus vectors, which are prepared using routine methods and starting materials.
Using standard techniques and readily available starting materials, a nucleic acid molecule may be prepared. The nucleic acid molecule may be incorporated into an expression vector which is then incorporated into a host cell. Host cells for use in well known recombinant expression systems for production of proteins are well known and readily available. Examples of host cells include bacteria cells (e.g. E. coli, yeast cells such as S. cerevisiae), insect cells (e.g., S. frugiperda), non-human mammalian tissue culture cells (e.g., Chinese hamster ovary (CHO) cells and Cos-7 cells), human tissue culture cells (e.g., 293 cells and HeLa cells), glioblastoma cells, and other human cancer cells. All the expression constructs containing nucleic acids encoding CD44 fusion proteins, including CD44-Fc fusion proteins, contain nucleic acids encoding the NH2-terminal signal peptide of CD44, therefore these CD44 fusion proteins are secreted into cell culture media (
Some embodiments involve the insertion of DNA molecules into a commercially available expression vector for use in well-known expression systems. This can be accomplished using techniques known in the art. For example, the commercially available plasmid pSE420 (Invitrogen, San Diego, Calif.) may be used for producing proteins in E. coli. The commercially available plasmid pYES2 (Invitrogen, San Diego, Calif.) may, for example, be used for producing proteins in S. cerevisiae strains of yeast. The commercially available MAXBAC™ complete baculovirus expression system (Invitrogen, San Diego, Calif.) may, for example, be used for producing proteins in insect cells. The commercially available plasmid pcDNAI, pcDNA3, or PEF6/v5-His (Invitrogen, San Diego, Calif.) may, for example, be used for producing proteins in mammalian cells such as Cos-7, CHO, and 293 cells. One having ordinary skill in the art can use these commercial expression vectors and systems or others to produce proteins by routine techniques and readily available starting materials. (See e.g., Sambrook et al., eds., 2001, supra) Thus, the desired proteins or fragments can be prepared in both prokaryotic and eukaryotic systems, resulting in a spectrum of processed forms of the protein or fragments.
One having ordinary skill in the art may use other commercially available expression vectors and systems or produce vectors using well known methods and readily available starting materials. Expression systems containing the requisite control sequences, such as promoters and polyadenylation signals, and preferably enhancers, are readily available and known in the art for a variety of host cells (See e.g., Sambrook et al., eds., 2001).
In some embodiments, the nucleic acid molecules can also be prepared as a genetic construct. “Genetic constructs” include regulatory elements necessary for gene expression of a nucleic acid molecule. The elements include: a promoter, an initiation codon, a stop codon, and a polyadenylation signal. In addition, enhancers can be used for gene expression of the sequence that encodes the protein or fragment. It is necessary that these elements be operably linked to the sequence that encodes the desired polypeptide and that the regulatory elements are operably in the individual or cell to whom they are administered Initiation codons and stop codon are generally considered to be part of a nucleotide sequence that encodes the desired protein. However, it is necessary that these elements are functional in the individual or cell to which the gene construct is administered. The initiation and termination codons must be in frame with the coding sequence. Promoters and polyadenylation signals used must be functional within the cells. Examples of promoters useful to practice the present invention include but are not limited to promoters from Simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus (HIV) such as the HIV Long Terminal Repeat (LTR) promoter, Moloney virus, ALV, Cytomegalovirus (CMV) such as the CMV immediate early promoter, Epstein Barr Virus (EBV), Rous Sarcoma Virus (RSV) as well as promoters from human genes such as human Actin, human Myosin, human Hemoglobin, human muscle creatine and human metallothionein. Examples of polyadenylation signals useful to practice the present invention include but are not limited to SV40 polyadenylation signals and LTR polyadenylation signals. In some embodiments, the SV40 polyadenylation signal, which is in the pCEP4 plasmid (Invitrogen, San Diego Calif.) referred to as the SV40 polyadenylation signal, is used. In addition to the regulatory elements required for DNA expression, other elements may also be included in the DNA molecule. Such additional elements include enhancers. The enhancer may be selected from the group including but not limited to: human Actin, human Myosin, human Hemoglobin, human muscle creatine and viral enhancers such as those from CMV, RSV and EBV. Genetic constructs can be provided with mammalian origin of replication in order to maintain the construct extra chromosomally and produce multiple copies of the construct in the cell. Plasmids pCEP4 and pREP4 from Invitrogen (San Diego, Calif.) contain the Epstein Barr virus origin of replication and nuclear antigen EBNA-1 coding region which produces high copy episomal replication without integration. In some embodiments, the nucleic acid molecule is packaged into infectious viral particles including but not limited to retrovirus, adenovirus, adeno-associated virus, and lenti-virus. In some embodiments, the nucleic acid molecule is free of infectious particles. In some embodiments, the nucleic acid molecule is mixed with and carried by nanoparticles.
CD44 fusion proteins are produced by the cells infected with the expression viral constructs carrying the CD44 fusion cDNA constructs and expressed in the presence of serum free cell culture medium for CD44-Fc fusion proteins or 10% FBS containing medium for all other CD44 fusion proteins. CD44 fusion proteins are purified through affinity columns. For example, CD44-Fc fusion proteins are purified by using protein A column as described (Sy et al., 1992) and soluble CD44 tagged with different epitope tags are purified using affinity column conjugated with the appropriate antibodies.
In one aspect, the CD44 antagonist is a CD44 fusion protein. In another aspect, the CD44 antagonist is a small molecule. In yet another aspect, the CD44 antagonist is a shRNA or siRNA against human CD44 (SEQ ID No. 31-38). In another aspect, shRNAs and/or siRNAs against human CD44 are administrated in the form of a viral vector with or without being packaged into viral particles. In one aspect, the viral particle is a retrovirus, lentivirus, adenovirus, or adeno-associated virus (AAV). In another aspect, the adenovirus is a replication-impaired, non-integrating, serotype 2, 5, 6, 7, or 8 adenoviral vector. In another aspect, an shRNA against human CD44 is administrated together with other carriers including nanoparticles. In another aspect, an shRNA against human CD44 is administrated alone or in combination with other therapies. In another aspect, a shRNA against human CD44 is administrated prior to or after other anti-cancer therapies, including surgical removal of the tumors.
The following definitions are provided for clarity and illustrative purposes only, and are not intended to limit the scope of the invention.
“Cancer” refers to abnormal, malignant proliferations of cells originating from epithelial cell tissue (carcinomas), blood cells (leukemias, lymphomas, and myelomas), connective tissue (sarcomas), or glial or supportive cells (gliomas). For example, the present invention described herein may be used for treating or preventing malignancies of the various organ systems, such as those affecting lung, breast, lymphoid, gastrointestinal (e.g., colon), and genitourinary tract, prostate, ovary, pharynx, and nervous system as well as adenocarcinomas which include but are not limited to malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. Exemplary solid tumors that can be treated include: fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, non-small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, glioblastoma multiforme (GBM), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma, and the like. In one embodiment, the invention relates to the treatment of renal cell carcinoma, mesothelioma, sarcoma, or multiple myeloma. In one embodiment, the invention relates to the treatment of colon cancer. In another embodiment, the invention relates to the treatment of lung cancer. In another embodiment, the invention relates to the treatment of ovarian cancer. In an additional embodiment, the invention relates to the treatment of breast cancer. In another embodiment, the invention relates to the treatment of prostate cancer. In an additional embodiment, the invention relates to the treatment of hepatoma. In an additional embodiment, the invention relates to the treatment of head and neck squamous carcinoma. In an additional embodiment, the invention relates to the treatment of melanoma. In an additional embodiment, the invention relates to the treatment of pancreatic cancer. In yet another embodiment, the invention relates to the treatment of astrocytomas. In a specific embodiment, the invention relates to the treatment of gliomas, including glioblastoma multiforme.
Cancer stem cells (CSCs) or cancer initiating cells (CICs) are a small subset of cancer cells that are capable of self-renewal and have multi-lineage potential. These cells are responsible for the maintenance and repopulation of tumors after therapeutic intervention (Reya et al., 2001). CSCs are also highly resistant to chemo- and radio-therapy, and other forms of cancer therapies. CD44 is a major cell surface marker for many types of CSCs (Stamenkovic and Yu, 2009).
The term “anti-cancer therapies” includes, but not limited to, surgery, chemotherapy, radiation therapy, targeted drug therapy, gene therapy, immunotherapy, and combination therapy that combines at least two single therapies to treat cancers and malignancies.
The term “radiation therapy” or “radiotherapy” refers to use of high-energy radiation to treat cancer. Radiation therapy includes externally administered radiation, e.g., external beam radiation therapy from a linear accelerator, and brachytherapy, in which the source of irradiation is placed close to the surface of the body or within a body cavity. Common radioisotopes used include but are not limited to cesium (137Cs), cobalt (60Co), iodine (131I), phosphorus-32 (32P), gold-198 (198Au), iridium-192 (192Ir), yttrium-90 (90Y), and palladium-109 (109Pd). Radiation is generally measured in Gray units (Gy), where 1 Gy=100 rads.
“Chemotherapy” refers to treatment with anti-cancer drugs. The term encompasses numerous classes of agents including platinum-based drugs, alkylating agents, anti-metabolites, anti-mitotic agents, anti-microtubule agents, plant alkaloids, and anti-tumor antibiotics, kinase inhibitors, proteasome inhibitors, EGFR inhibitors, HER dimerization inhibitors, VEGF inhibitors, antibodies, and antisense nucleotides, siRNA, and shRNAs. Such chemotherapeutic drugs include but are not limited to adriamycin, melphalan, ara-C, carmustine (BCNU), temozolomide, irinotecan, BiCNU, busulfan, CCNU, pentostatin, the platinum-based drugs carboplatin, cisplatin and oxaliplatin, cyclophosphamide, daunorubicin, epirubicin, dacarbazine, 5-fluorouracil (5-FU), leucovorin, fludarabine, hydroxyurea, idarubicin, ifosfamide, methotrexate, altretamine, mithramycin, mitomycin, bleomycin, chlorambucil, mitoxantrone, cytarabine, nitrogen mustard, mercaptopurine, mitozantrone, paclitaxel (Taxol®), docetaxel, topotecan, capecetabine (Xeloda®), raltitrexed, streptozocin, tegafur with uracil, thioguanine, thiotepa, podophyllotoxin, filgristim, profimer sodium, letrozole, amifostine, anastrozole, arsenic trioxide, epithalones A and B tretinioin, leustatin, vinorelbine, vinblastine, vincristine, vindesine, etoposide, gemcitabine, satraplatin, ixabepilone, hexamethylamine, and thalidomide.
Targeted therapeutic agents including but not limited to monoclonal antibodies such as Herceptin® (trastuzumab), Rituxan® (rituximab), Campath® (alemtuzumab), Zevelin® (Ibritumomab, tiuxetan), Alemtuzumab, Gemtuzumab, Bexxar® (Tositumomab), ERBITUX® (Cetuximab), Bevacizumab (Avastin®), Panitumumab (Vectibix®), Gemtuzumab (Mylotarg®). Other targeted therapeutic agents include, but are not limited to, tamoxifen, irinotecan, bortezomib, STI-571 (Gleevac®, Imatinib Mesylate), gefitinib, erlotinib, lapatinib, vandetanib, BIBF1120, pazopanib, neratinib, BIBW2992, CI-1033, PF-2341066, PF-04217903, AMG 208, JNJ-38877605, MGCD-265, SGX-523, GSK1363089, Axitinib, vatalanib, E7080, Sunitinib, Sorafenib, Toceranib, Lestaurtinib, Semaxanib, Cediranib, Nilotinib, Dasatinib, Bosutinib, Lestaurtinib, perifosine, MK-2206, temsirolimus, rapamycin, BEZ235, GDC-0941, PLX-4032, imatinib, AZD0530, bortezomib, XAV-939, advexin (Ad5CMV-p53), Genentech—Compound 8/cIAP-XIAP inhibitor, Abbott Laboratories—Compound 11, interleukins (e.g., 2 and 12) and interferons, e.g., alpha and gamma, huBr-E3, Genasense, Ganite, FIT-3 ligand, MLN491RL, MLN2704, MLN576, and MLN518. Antiangiogenic agents include, but are not limited to, BMS-275291, Dalteparin (Fragmin®) 2-methoxyestradiol (2-ME), thalodmide, CC-5013 (thalidomide analog), maspin, combretastatin A4 phosphate, LY317615, soy isoflavone (genistein; soy protein isolate), AE-941 (Neovastat™; GW786034), anti-VEGF antibody (Bevacizumab; Avastin™), PTK787/ZK 222584, VEGF-trap, ZD6474, EMD 121974, anti-αvβ3 integrin antibody (Medi-522; Vitaxin™), carboxyamidotriazole (CAI), celecoxib (Celebrex®), halofuginone hydrobromide (Tempostatin™), and Rofecoxib (VIOXX®).
The term “gene therapy” includes administration of a vector encoding for a CD44 fusion protein. In some embodiments, the vector carries shRNAs against human CD44 (SEQ ID No.31-38). In some embodiments, the vector is packaged into infectious viral particles including, but not limited to, retrovirus, adenovirus, adeno-associated virus, and lenti-virus. In some embodiments, the vector is free of infectious particles. In some embodiments, the vector is mixed with and carried by nanoparticles. Gene therapy can include the nucleotides encoding CD44-Fc fusion, antisense nucleotides, siRNA, and shRNAs against human CD44.
The term “expression construct” means a nucleic acid sequence comprising a target nucleic acid sequence or sequences whose expression is desired, operatively associated with expression control sequence elements which provide for the proper transcription and translation of the target nucleic acid sequence(s) within the chosen host cells. Such sequence elements may include a promoter, an initiation codon, a stop codon, and a polyadenylation signal. In addition, enhancers can be used for gene expression of the sequence that encodes the protein or fragment. The “expression construct” may further comprise “vector sequences.” By “vector sequences” is meant any of several nucleic acid sequences established in the art which have utility in the recombinant DNA technologies of the invention to facilitate the cloning and propagation of the expression constructs including (but not limited to) plasmids, cosmids, phage vectors, viral vectors, and yeast artificial chromosomes.
Expression constructs of the present invention may comprise vector sequences that facilitate the cloning and propagation of the expression constructs. A large number of vectors, including plasmid, fungal, viral vectors, have been described for replication and/or expression in a variety of eukaryotic and prokaryotic host cells. Standard vectors useful in the current invention are well known in the art and include (but are not limited to) plasmids, cosmids, phage vectors, viral vectors, and yeast artificial chromosomes. The vector sequences may contain a replication origin for propagation in Escherichia coli (E. coli); the SV40 origin of replication; an ampicillin, neomycin, puromycin, hygromycin, and blasticidin resistance gene for selection in host cells; and/or genes (e.g., CD44-Fc fusion gene) that amplify the dominant selectable marker plus the gene of interest. Suitable vectors, which include plasmid vectors and viral vectors such as bacteriophage, baculovirus, retrovirus, lentivirus, adenovirus, vaccinia virus, semliki forest virus and adeno-associated virus vectors, are well known and can be purchased from a commercial source (Promega, Madison Wis.; Stratagene, La Jolla Calif.; GIBCO/BRL, Gaithersburg Md.) or can be constructed by one skilled in the art (see, for example, Sambrook et al., eds., 2001, Meth. Enzymol., Vol. 185, Goeddel, ed. (Academic Press, Inc., 1990); Jolly, Canc. Gene Ther. 1:51-64, 1994; Flotte, J. Bioenerg. Biomemb. 25:37-42, 1993; Kirshenbaum et al., J. Clin. Invest. 92:381-387, 1993).
The terms “express” and “expression” mean allowing or causing the information in a gene or DNA sequence to become manifest, for example producing a protein by activating the cellular functions involved in transcription, translation, and post-translational modification of a corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an “expression product” such as a protein. The expression product itself, e.g., the resulting protein, may also be said to be “expressed” by the cell. An expression product can be characterized as intracellular, extracellular or secreted. The term “intracellular” means something that is inside a cell. The term “extracellular” means something that is outside a cell. A substance is “secreted” by a cell if it appears in significant measure outside the cell, from somewhere on or inside the cell.
The term “transduction” means the introduction of a “foreign” nucleic acid (i.e. extrinsic or extracellular gene, DNA or RNA sequence) in a viral expression vector that has been packaged in a retro- or lenti-virus into a cell. Common techniques in molecular biology are use to achieve virus transduction to the appropriate cells. In one aspect, the cells are Cos-7 and 293 cells. In another aspect the cells are human GBM cells, human colon cancer cells, human prostate cancer cells, human breast cancer cells, human melanoma cells, human lung cancer cells, human ovarian cancer cells, human malignant mesothelioma cells, human sarcoma cells, human pancreatic cancer cells, human hepatoma cells, human head and neck squamous carcinoma cells, and human multiple myeloma cells.
The term “gene” means a DNA sequence that codes for or corresponds to a particular sequence of amino acids which comprise all or part of one or more proteins or enzymes, and may or may not include regulatory DNA sequences, such as promoter and enhancer sequences, which determine for example the conditions under which the gene is expressed.
A coding sequence is “under the control of” or “operatively associated with” expression control sequences in a cell when RNA polymerase transcribes the coding sequence into RNA, particularly mRNA, which is then trans-RNA spliced (if it contains introns) and translated into the protein encoded by the coding sequence.
The term “expression control sequence” refers to a promoter and any enhancer or suppression elements that combine to regulate the transcription of a coding sequence. In a preferred embodiment, the element is an origin of replication.
Antisense Nucleotides, siRNA, and shRNA
Antisense nucleotides are strings of RNA or DNA that are complementary to “sense” strands of nucleotides. They bind to and inactivate these sense strands. shRNAs are used to silence gene expression. Antisense nucleotides can be used in gene therapy.
Small interfering RNA (siRNA) is a class of double-stranded RNA molecules, 20-25 nucleotides in length with 2-nucleotides 3′ overhangs on either end. siRNA functions in RNA interference (RNAi) pathway, in which it interferes with the expression of a specific gene.
A small or short hairpin RNA (shRNA) is a sequence of RNA that forms a tight hairpin turn that can be used to silence gene expression via RNA interference. A shRNA usually contains two inverted repeat sequences derived from its target gene to form sense and antisense strand in a hairpin, which are separated by a short spacer sequence that form a loop in shRNA and ended with a string of T's that served as a transcription termination site. This design produces an RNA transcript that is predicted to fold into a short hairpin RNA. shRNA is introduced into cells using a vector including viral vectors, which can be package into viral particles. The vector carrying shRNAs drives their transcription by U6, H1, or CMV (pGIPZ for shRNAmir from Open Biosystems) promoter. shRNAmir stands for microRNA-adapted shRNA. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves target mRNAs to achieve silencing effect. siRNA and shRNA in a vector or packaged in a virus can be used in gene therapy to knock down the expression of a gene including that of CD44.
The term “about” or “approximately” means within an acceptable range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Unless otherwise stated, the term ‘about’ means within an acceptable error range for the particular value.
As used herein, the terms “include” and “comprise” are used synonymously. It should be understood that the terms “a” and “an” as used herein refer to “one or more” of the enumerated components. The use of the alternative (e.g., “or”) should be understood to mean either one, both, or any combination thereof of the alternatives.
As used herein, the term “isolated” means that the referenced material is removed from the environment in which it is normally found. Thus, an isolated biological material can be free of cellular components, i.e., components of the cells in which the material is found or produced. Isolated nucleic acid molecules include, for example, a PCR product, an isolated mRNA, a cDNA, or a restriction fragment. Isolated nucleic acid molecules also include, for example, sequences inserted into plasmids, cosmids, artificial chromosomes, and the like. An isolated nucleic acid molecule is preferably excised from the genome in which it may be found, and may or may not be joined to non-regulatory sequences, non-coding sequences, or to other genes located upstream or downstream of the nucleic acid molecule when found within the genome. An isolated protein may or may not be associated with other proteins or nucleic acids, or both, with which it associates in the cell, or with cellular membranes if it is a membrane-associated protein.
The term “purified” as used herein refers to material that has been isolated under conditions that reduce or eliminate the presence of unrelated materials, i.e. contaminants, including native materials from which the material is obtained. The isolated material is preferably substantially free of cell or culture components, including tissue culture components, contaminants, and the like. As used herein, the term “substantially free” is used operationally, in the context of analytical testing of the material. Preferably, purified material substantially free of contaminants is at least 50% pure or 60%, 70%, 80% pure, more preferably, 90% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, and other methods known in the art.
A “nucleic acid molecule” or “oligonucleotide” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear (e.g., restriction fragments) or circular DNA molecules, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A “recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
In accordance with the present invention, there may be employed conventional molecular biology, microbiology, recombinant DNA, immunology, cell biology and other related techniques within the skill of the art. See, e.g., Sambrook et al., (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Ausubel et al., eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Bonifacino et al., eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al., eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coico et al., eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al., eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, N.J.; Enna et al., eds. (2005) Current Protocols in Pharmacology John Wiley and Sons, Inc.: Hoboken, N.J.; Hames et al., eds. (1999) Protein Expression: A Practical Approach. Oxford University Press: Oxford; Freshney (2000) Culture of Animal Cells: A Manual of Basic Technique. 4th ed. Wiley-Liss; among others. The Current Protocols listed above are updated several times every year.
In certain embodiments, the present invention relates to pharmaceutical compositions for treating or preventing glioma or other cancer types in a mammal. In yet another embodiment, the present invention relates to pharmaceutical compositions for targeting a variety of cancer stem cells in a mammal. In another embodiment, the invention is further directed to pharmaceutical compositions for sensitizing a variety of cancer cells and cancer stem cells including glioma cells to radiation, cytotoxic, and targeted therapeutic stresses for the treatment of gliomas or other cancer types. In another embodiment, the pharmaceutical composition comprises CD44 fusion proteins, acting as CD44 antagonists for the treatment or prevention of a glioma or other cancer types. In another embodiment, the pharmaceutical composition comprises a CD44-Fc fusion protein with a constant region of human IgG1 fused to an extracellular domain of CD44. In another embodiment, the pharmaceutical composition comprises a CD44-Fc fusion protein with a constant region of human IgG1 fused to the CD44 extracellular domain of CD44s, CD44v2-v10, CD44v3-v10, CD44v8-v10, CD44v4-v10, CD44v5-v10, CD44v6-v10, CD44v7-v10, CD44v9-v10, CD44v10, CD44v9, CD44v8, CD44v7, CD44v6, CD44v5, CD44v4, CD44v3, CD44v2, CD44sR41A, CD44v2-v10R41A, CD44v3-v10R41A, CD44v8-v10R41A, CD44v4-v10R41A, CD44v5-v10R41A, CD44v6-v10R41A, CD44v7-v10R41A, CD44v9-v10R41A, CD44v10R41A, CD44v9R41A, CD44v8R41A, CD44v7R41A, CD44v6R41A, CD44v5R41A, CD44v4R41A, CD44v3R41A, and CD44v2R41A. In another aspect, CD44 fusion protein comprises different segments of the extracellular domain of wild type CD44 or R41A CD44 mutant as described above fused to another non-CD44 molecule. In some embodiments, the non-CD44 molecule is a toxin, peptide, polypeptide, a small molecule, drug, and the like. In some embodiments, the non-CD44 molecule is a 6-His-tag, GST polypeptide, HA-tag, or v5-tag. In some embodiments, proteinase cleavage sites will be put before the tag sequences, so that after purification these tags can be removed by proteolytic cleavage. For example, the HRV 3C (human rhinovirus type 14 3C) protease cleavage site (LEVLFQ↓GP) can be located before the COOH-terminal v5 and His epitope tags. The HRV 3C protease specifically cleaves the sequence LEVLFQ↓GP at 40° C. and were used to efficiently removal the COOH-terminal tags (Novagen).
A pharmaceutical composition of a CD44 antagonist is in one embodiment a purified CD44 fusion protein, including a purified CD44-Fc fusion protein. In another embodiment the pharmaceutical composition is a virus carrying a CD44 fusion protein, including a CD44-Fc fusion protein. In yet another embodiment the pharmaceutical composition is a siRNA/shRNA against human CD44 (e.g., SEQ ID No. 34, 35, and 36). In an additional embodiment the pharmaceutical composition is a small molecule which antagonizes CD44 function.
In some embodiments the glioma is an astrocytoma. In other embodiments the glioma is a glioblastoma multiforme. In other embodiments, the cancer types are colon cancer, breast cancer, prostate cancer, lung cancer, ovarian cancer, pancreatic cancer, melanoma, malignant mesothelioma, sarcoma, kidney cancer, GI track cancer, pancreatic cancer, hepatoma, head and neck squamous carcinoma, and multiple myeloma.
When formulated in a pharmaceutical composition, a therapeutic compound of the present invention can be admixed with a pharmaceutically acceptable carrier or excipient. As used herein, the phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are generally believed to be physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
While it is possible to use a composition provided by the present invention for therapy as is, it may be preferable to administer it in a pharmaceutical formulation, e.g., in admixture with a suitable pharmaceutical excipient, diluent, or carrier selected with regard to the intended route of administration and standard pharmaceutical practice. Accordingly, in one aspect, the present invention provides a pharmaceutical composition or formulation comprising at least one active composition, or a pharmaceutically acceptable derivative thereof, in association with a pharmaceutically acceptable excipient, diluent, and/or carrier. The excipient, diluent and/or carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
The compositions of the invention can be formulated for administration in any convenient way for use in human or veterinary medicine.
The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as saline solution, water, and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin (1990, Mack Publishing Co., Easton, Pa. 18042).
Preparations according to this invention for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, and injectable organic esters such as ethyl oleate. Such dosage forms may also contain adjuvants, preserving, wetting, emulsifying, and dispersing agents. The pharmaceutical compositions may be sterilized by, for example, filtration through a bacteria retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions. They can also be manufactured using sterile water, or some other sterile injectable medium, immediately before use.
In one embodiment, the pharmaceutical composition is administered as a liquid oral formulation. Other oral dosage forms are well known in the art and include tablets, caplets, gelcaps, capsules, pellets, and medical foods. Tablets, for example, can be made by well-known compression techniques using wet, dry, or fluidized bed granulation methods.
Such oral formulations may be presented for use in a conventional manner with the aid of one or more suitable excipients, diluents, and carriers. Pharmaceutically acceptable excipients assist or make possible the formation of a dosage form for a bioactive material and include diluents, binding agents, lubricants, glidants, disintegrants, coloring agents, and other ingredients. Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, ascorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used. An excipient is pharmaceutically acceptable if, in addition to performing its desired function, it is non-toxic, well tolerated upon ingestion, and does not interfere with absorption of bioactive materials.
Acceptable excipients, diluents, and carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins (A. R. Gennaro edit. 2005). The choice of pharmaceutical excipient, diluent, and carrier can be selected with regard to the intended route of administration and standard pharmaceutical practice.
In one embodiment, the pharmaceutical compositions of CD44 antagonists are CD44 fusion proteins. In another embodiment, the pharmaceutical compositions of CD44 antagonists are viruses carrying an expression vector encoding CD44 fusion proteins. In another embodiment, the pharmaceutical compositions are vectors carrying shRNAs against human CD44 with or without being packaged into viral particles. In one aspect, the viral particle is a retrovirus, lentivirus, adenovirus, or adeno-associated virus (AAV). In another aspect, the adenovirus is a replication-impaired, non-integrating, serotype 2, 5, 6, 7, or 8 adenoviral vector.
In another embodiment, the pharmaceutical composition is administered intravenously or intraperitoneal. In yet another embodiment, the pharmaceutical composition is administered by filling a cavity/space left after removal of a tumor with gel matrix-gallocyanine formulations mixed with the pharmaceutical composition.
In certain embodiments, the present invention relates to methods of detecting CD44 ligands, including HA, by using CD44-Fc fusion proteins. These methods are useful for the diagnosis and prognosis of cancer and for the assessment of therapeutic responses of patients.
The present invention described herein can be used to treat cancer or malignancies. In one embodiment, the invention relates to the treatment of prostate cancer, colon cancer, breast cancer, lung cancer, melanoma, head-neck cancer, liver cancer, pancreatic cancer, and ovarian cancer using CD44 fusion compositions alone or in combinations with radiation, chemotherapy, or targeted therapy as defined herein. In another embodiment, the invention relates to the treatment of astrocytomas using CD44 fusion compositions alone or in combinations with radiation, chemotherapy, or targeted therapy. In yet another embodiment, the invention relates to the treatment of malignant mesothelioma, sarcoma, and multiple myeloma using CD44 fusion compositions alone or in combinations with radiation, chemotherapy, or targeted therapy. In a specific embodiment, the invention relates to the treatment of glioblastoma multiforme using CD44 fusion compositions alone or in combinations with radiation, chemotherapy, or targeted therapy. In another specific embodiment, the invention relates to the treatment of glioblastoma multiforme and other cancer types using CD44 fusion compositions alone or in combinations with carmustine (BCNU), temozolomide, docetaxel, carboplatin, cisplatin, epirubicin, oxaliplatin, cyclophosphamide, methotrexate, fluorouracil, vinblastine, vincristine, leucovorin, mitoxantrone, satraplatin, ixabepilone, pacitaxel, gemcitabine, capecitabine, doxorubicin, etoposide, melphalan, hexamethylamine, irinotecan, topotecan, Herceptin® (trastuzumab), ERBITUX® (Cetuximab), Panitumumab (Vectibix®), Bevacizumab (Avastin®), gefitinib, erlotinib, lapatinib, vandetanib, neratinib, BIBW2992, CI-1033, PF-2341066, PF-04217903, AMG 208, JNJ-38877605, MGCD-265, SGX-523, GSK1363089, Sunitinib, Sorafenib, vandetanib, BIBF1120, pazopanib, vatalanib, axitinib, E7080, perifosine, MK-2206, temsirolimus, rapamycin, BEZ235, GDC-0941, PLX-4032, imatinib, AZD0530, bortezomib, XAV-939, cIAP/XIAP inhibitors such as Compound 8 (Genentech)) (Zobel et al., 2006) and Compound 11 (Abbott Laboratories) (Oost et al., 2004), or advexin (Ad5CMV-p53).
“Treating” or “treatment” of a state, disorder or condition includes: (1) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a human or other mammal that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition, (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or subclinical symptom thereof, and/or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms.
An “effective amount” is defined herein in relation to the treatment of cancers is an amount that will decrease, reduce, inhibit, or otherwise abrogate the growth of a cancer cell or tumor by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Thus, an “effective amount” is the quantity of compound in which a beneficial clinical outcome is achieved when the compound is administered to a subject with a cancer. A “beneficial clinical outcome” includes, for example, a reduction in tumor mass, a reduction in metastasis, a reduction in the severity of the symptoms associated with the cancer and/or an increase in the longevity of the mammal compared with the absence of the treatment. It will be appreciated that the amount of CD44 fusion proteins of the invention alone and/or in combinations with chemotherapy or targeted therapy required for use in treatment will vary with the route of administration, the nature of the condition for which treatment is required, and the age, body weight and condition of the patient, and will be ultimately at the discretion of the attendant physician or veterinarian. These compositions will typically contain an effective amount of the compositions of the invention, alone or in combination with an effective amount of any radiation, chemotherapy, or other targeted therapies. Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration can be performed according to art-accepted practices.
The benefit to an individual to be treated is either statistically significant or at least perceptible to the patient or to the physician.
The present invention provides for the use of the pharmaceutical compositions containing CD44 antagonist, such as CD44 fusion proteins, in combination with other anti-cancer therapies, such as but not limited to, surgery, chemotherapy, radiation therapy, targeted therapy, and immunotherapy to treat cancers and malignancies. In a particular embodiment of the present invention, when combined with other anti-cancer therapies, results in a synergistic treatment of the cancer.
The present invention is further directed to pharmaceutical compositions and methods for sensitizing glioma and other cancer cells to cytotoxic or targeted therapeutic stresses for the treatment of gliomas and other cancer types. In one aspect compositions of the present invention are administered prior to, simultaneously with, or after other anti-cancer therapies. In another aspect compositions of the present invention are administered prior to or simultaneously with, or after a treatment which causes oxidative or cytotoxic stresses. In one particular embodiment of the invention, the stresses are caused by radiation therapy. In another particular embodiment of the invention, the stresses are caused by chemotherapy. In another aspect compositions of the present invention are administered after surgical removal of tumors.
In one aspect, the pharmaceutical compositions of CD44 antagonist, such as CD44 fusion proteins, alone or in combinations with radiation, chemotherapy, or other targeted therapies, are mixed with gel matrix-gallocyanine formulations and administered by filling a cavity/space left after surgical removal of a tumor, including a glioma. In another aspect, viruses carrying a viral expression construct of CD44 fusion proteins or shRNAs against human CD44, are mixed with gel matrix-gallocyanine formulations, alone or in combination with radiation, chemotherapy or other targeted therapies, and administered to a mammal by filling the cavity/space left after surgical removal of a tumor, including a glioma.
In one embodiment, the pharmaceutical composition is administered by percutaneous injection or intralesional injection to tumor lesions, residual tumor lesions, or adjacent normal tissues at the surgical edge following a surgical procedure. In another embodiment, an initial intratumoral stereotactic injection of the pharmaceutical composition is administered 10 minutes on day 1. Patients then undergo tumor resection and receive a series of 1-minute injections of the pharmaceutical composition into the resected tumor cavity wall on day 4. In one embodiment, the pharmaceutical composition is administered by intralesional injection around or near cancer tissues that cannot be surgically removed.
For lung cancer, the pharmaceutical composition is administrated by bronchioalveolar lavage or injected directly into an endobronchial lesion via bronchoscopy or into locoregional tumors via multiple percutaneous punctures under fluoroscopic, ultrasonic, or CT scan guidance. In one embodiment, the pharmaceutical composition is delivered to cancer lesions by CD34+ bone marrow progenitor cells, mesenchyal stem cells, or other adult stem cells or induced pluripotent stem cells transduced to express the pharmaceutical composition. In one embodiment, the pharmaceutical composition is administered prior to, together with, or after chemotherapy, radiation therapy, and other targeted therapy.
The CD44 fusion proteins and formulations of the present invention can be administered topically, parenterally, orally, by inhalation, as a suppository, or by other methods known in the art. The term “parenteral” includes injection (for example, intravenous, intraperitoneal, epidural, intrathecal, intramuscular, intraluminal, intratracheal, subcutaneous, intralesional, or intratumoral).
Administration of the compositions of the invention may be once a day, twice a day, or more often, but frequency may be decreased during a maintenance phase of the disease or disorder, e.g., once every second or third day instead of every day or twice a day. The dose and the administration frequency will depend on the clinical signs, which confirm maintenance of the remission phase, with the reduction or absence of at least one or more preferably more than one clinical signs of the acute phase known to the person skilled in the art. More generally, dose and frequency will depend in part on recession of pathological signs and clinical and subclinical symptoms of a disease condition or disorder contemplated for treatment with the present compounds. For example, the present invention can be administered intravenously or intraperitoneally about 1-3 every week at 15 mg/kg.
Keeping the above description in mind, typical dosages of CD44 fusion proteins may range from about 10 mg/kg to about 30 mg/kg. A preferred dose range is on the order of about 10 mg/kg to about 15 mg/kg. In certain embodiments, a patient may receive, for example, once per day intravenously or intraperitoneally for 8 days each month, twice a week, or once a week.
Keeping the above description in mind, typical dosages of viruses carrying expression vectors encoding for CD44 fusion proteins or shRNAs against human CD44 may range from about 5×10e9 cfu to about 10×10e10 cfu. In certain embodiments, a patient may receive a dose of viruses, for example, by intravenous, intratumoral, or peritumoral injection once or twice a week.
Keeping the above description in mind, typical dosages of BCNU may range from about 50 mg/m2 to about 200 mg/m2 given iv on 3 successive days and this course being repeated at intervals of 6 weeks (Pinkerton and Rana, 1976). A preferred dose range is on the order of about 100 mg/m2 to about 150 mg/m2 given iv on 3 successive days and this course being repeated at intervals of 6 weeks.
Keeping the above description in mind, typical dosages of TMZ may range from about 50 mg/m2 to about 200 mg/m2 once daily by intravenous infusion over 90 minutes or the oral capsule formulation. A preferred dose range is on the order of about 75 mg/m2 to about 150 mg/m2 once daily. In certain embodiments, a patient may receive TMZ, for example, once per day intravenously for 5 days each month (http://www.cancer.gov/cancertopics/druginfo/fda-temozolomide).
Keeping the above description in mind, typical dosages of docetaxel may range from about 50 mg/m2 to about 200 mg/m2. A preferred dose range is on the order of about 60 mg/m2 to about 100 mg/m2. In certain embodiments, a patient may receive docetaxel, for example, iv infusion once every three weeks (http://www.drugs.com/ppa/docetaxel.html).
Keeping the above description in mind, typical dosages of carboplatin may range from about 200 mg/m2 to about 400 mg/m2. A preferred dose range is on the order of about 300 mg/m2 to about 400 mg/m2. In certain embodiments, a patient may receive carboplatin, for example, once intravenously for every four weeks (http://www.drugs.com/pro/carboplatin.html#DA).
Keeping the above description in mind, typical dosages of cisplatin may range from about 20 mg/m2 to about 120 mg/m2. A preferred dose range is on the order of about 75 mg to about 100 mg. In certain embodiments, a patient may receive cisplatin, for example, once intravenously per day for 5 days every 3 wk for 3 courses.
Keeping the above description in mind, typical dosages of cyclophosphamide may range from about 1 mg/kg/day to about 5 mg/kg/day. A preferred dose range is on the order of about 2 mg/kg/day to about 5 mg/kg/day. In certain embodiments, a patient may receive cyclophosphamide, for example, once per day intravenously or orally.
Keeping the above description in mind, typical dosages of fluorouracil may range from about 12 mg/kg to about 400 mg. A preferred dose range is on the order of about 15 mg to about 100 mg. In certain embodiments, a patient may receive fluorouracil, for example, once of per day intravenously for 4 successive days
Keeping the above description in mind, typical dosages of mitoxantrone may range from about 10 mg/m2 to about 20 mg/m2 given as a short iv infusion. A preferred dose range is on the order of about 12 mg/m2 to about 14 mg/m2. In certain embodiments, a patient may receive mitoxantrone, for example, once intravenously every 21 days.
Keeping the above description in mind, typical dosages of pacitaxel may range from about 3 hours at a dose of 100 mg/m2 to about 200 mg/m2. A preferred dose range is on the order of about 3 hours at a dose of 175 mg/m2. In certain embodiments, a patient may receive pacitaxel, for example, once intravenously every three months.
Keeping the above description in mind, typical dosages of topotecan may range from about 0.5 mg/m2 to about 2.5 mg/m2 daily. Topotecan can be administered by iv infused over 30 min or taking orally. A preferred dose range is on the order of about 0.75 mg/m2-mg/m2/d.
Keeping the above description in mind, typical dosages of trastuzumab may range from about 2 mg/kg/week to about 8 mg/kg/week. A preferred dose range is on the order of about 2 mg/kg to about 4 mg/kg. In certain embodiments, a patient may receive trastuzumab, for example, one intravenously every week or every three weeks (http://www.drugs.com/ppa/trastuzumab.html).
Keeping the above description in mind, typical dosages of cetuximab may range from about 200 mg/m2 to about 400 mg/m2. A preferred dose range is on the order of about 250 mg/m2 to about 300 mg/m2. In certain embodiments, a patient may receive cetuximab, for example, once intravenously every week (http://www.drugs.com/ppa/cetuximab.html).
Keeping the above description in mind, typical dosages of panitumumab may range from about 2 mg/kg to about 10 mg/kg. A preferred dose range is on the order of about 5 mg/kg to about 6 mg/kg. In certain embodiments, a patient may receive panitumumab, for example, once intravenously every 14 days.
Keeping the above description in mind, typical dosages of gefitinib may range from about 100 mg to about 400 mg. A preferred dose range is on the order of about 250 mg. In certain embodiments, a patient may receive gefitinib, for example, one 250 mg tablet daily.
Keeping the above description in mind, typical dosages of erlotinib may range from about 25 mg to about 300 mg. A preferred dose range is on the order of about 100 mg to about 150 mg. In certain embodiments, a patient may receive, for example erlotinib, one tablet per day orally.
Keeping the above description in mind, typical dosages of lapatinib may range from about 1000 mg/day to about 3000 mg/day. A preferred dose range is on the order of about 1250 mg/day to about 1500 mg/day. In certain embodiments, a patient may receive lapatinib, for example, one tablet per day orally.
Keeping the above description in mind, typical dosages of BIBW2992 may range from about 20 mg/day to about 100 mg/day. A preferred dose range is on the order of about 50 mg/day to about 70 mg/day. In certain embodiments, a patient may receive BIBW2992, for example, once a day orally for 14 days and 14 days off for 4 weeks (Eskens et al., 2008).
Keeping the above description in mind, typical dosages of CI-1033 may range from about 50 mg/day to about 200 mg/day. A preferred dose range is on the order of about 100 mg/day to about 150 mg/day. In certain embodiments, a patient may receive CI-1033, for example, once orally over 21 consecutive days of a 28-day cycle (Campos et al., 2005; Nemunaitis et al., 2005).
Keeping the above description in mind, typical dosages of PF-2341066 may range from about 5 mg/kg/day to about 50 mg/kg/day. A preferred dose range is on the order of about 20 mg/kg/day to about 30 mg/kg/day. In certain embodiments, a patient may receive PF-2341066, for example, once per day orally (Zou et al., 2007).
Keeping the above description in mind, typical dosages of sunitinib may range from about 12 mg to about 80 mg. A preferred dose range is on the order of about 40 mg to about 50 mg. In certain embodiments, a patient may receive sunitinib, for example, once per day on a schedule of 4 wk on treatment followed by 2 wk off treatment.
Keeping the above description in mind, typical dosages of sorafenib may range from about 200 mg to about 400 mg. A preferred dose range is on the order of about 100 mg to about 200 mg. In certain embodiments, a patient may receive sorafenib, for example, twice per day orally.
Keeping the above description in mind, typical dosages of advexin (Ad5CMV-p53) may range from about 1 daily intraperitoneal injection for ovarian cancer for 5 days every 3 weeks. Treatment may be repeated every 21 days. For liver cancer, typical dosages of advexin are about 1 percutaneous injection to a maximum of two lesions on day 1. Treatment is repeated every 28 days for up to 6 courses. For breast cancer, typical dosages of advexin (Ad5CMV-p53) are intralesional injection on days 1 and 2. Treatment repeats every 3 weeks for up to 6 courses. For glioma, an initial intratumoral stereotactic injection of adenovirus p53 (Ad-p53) over 10 minutes on day 1. Patients then undergo tumor resection and receive a series of 1-minute injections of Ad-p53 into the resected tumor cavity wall on day 4. In certain embodiments, advexin is administrated together with or after chemotherapeutic agents or radiation therapy.
Keeping the above description in mind, typical dosages of Genentech—Compound 8/cIAP-XIAP inhibitor (Zobel et al., 2006) may range from about 50 mg to about 400 mg. A preferred dose range is on the order of about 100 mg to about 200 mg. In certain embodiments, a patient may receive, for example 8/cIAP-XIAP inhibitor, once per day intravenously.
Keeping the above description in mind, typical dosages of Abbott Laboratories—Compound 11 (Oost et al., 2004) may range from about 50 mg to about 400 mg. A preferred dose range is on the order of about 100 mg to about 200 mg. In certain embodiments, a patient may receive, for example Compound 11, once per day intravenously.
Keeping the above description in mind, typical starting dosages of epirubicin may range from about 100 to 120 mg/m2 through intravenous infusion. A preferred dose range is on the order of about 75 mg to about 100 mg. In certain embodiments, a patient may receive epirubicin, for example, administered intravenously on Day 1 and repeated every 21 days for 6 cycles.
Keeping the above description in mind, typical dosages of oxaliplatin may range from about 50 mg-200 mg/per treatment through intravenous infusion. A preferred dose range is on the order of about 75 mg to about 150 mg. In certain embodiments, a patient may receive oxaliplatin, for example, administered in combination with 5-FU/LV every 2 weeks. For adjuvant use, treatment is recommended for a total of 6 months (12 cycles. A typical treatment regiment is the following: Day 1, oxaliplatin 85 mg/m2 IV infusion in 250-500 mL 5% Dextrose injection, USP (D5W) and leucovorin 200 mg/m2 IV infusion in D5W both given over 120 minutes at the same time in separate bags using a Y-line, followed by 5-FU 400 mg/m2 IV bolus given over 2-4 minutes, followed by 5-FU 600 mg/m2 IV infusion in 500 mL D5W (recommended) as a 22-hour continuous infusion. Day 2, Leucovorin 200 mg/m2 IV infusion over 120 minutes, followed by 5-FU 400 mg/m2 IV bolus given over 2-4 minutes, followed by 5-FU 600 mg/m2 W infusion in 500 mL D5W (recommended) as a 22-hour continuous infusion.
Keeping the above description in mind, typical dosages of methotrexate may range from about 15 to 30 mg daily administered orally or intramuscularly for a five-day course. Such courses are usually repeated for 3 to 5 times as required. A preferred dose range is on the order of about 20 mg. In certain embodiments, a patient may receive methotrexate in combination with other anticancer agents.
Keeping the above description in mind, typical dosages of vinblastine is the following: initiate therapy for adults by administering a single intravenous dose of 3.7 mg/m2 of body surface area (bsa). A simplified and conservative incremental approach to dosage at weekly intervals for adults may be outlined as follows: First dose at 3.7 mg/m2 bsa, second dose at 5.5 mg/m2 bsa, third dose at 7.4 mg/m2 bsa, fourth dose at 9.25 mg/m2 bsa, and fifth dose at 11.1 mg/m2 bsa. The above-mentioned increases may be used until a maximum dose not exceeding 18.5 mg/m2 bsa for adults is reached. It is recommended that the drug be given no more frequently than once every 7 days.
Keeping the above description in mind, vincristine is administered intravenously once a week. The typical starting dosages of vincristine for pediatric patients is 1.5-2 mg/m2 and for adults is 1.4 mg/m2.
Keeping the above description in mind, typical starting dosages of satraplatin may range from about 100 to 120 mg/m2 once daily for 5 consecutive days every 5 weeks. A preferred dose range is on the order of about 80 mg/m2.
Keeping the above description in mind, typical starting dosages of ixabepilone may range about 40 mg/m2 over 3 h every 3 wk through intravenous infusion. Patients with body surface area more than 2.2 m2 should be calculated based on 2.2 m2. Ixabepilone may be used in combination with capecitabine.
Keeping the above description in mind, typical dosages of gemcitabine may range about 1000 mg/m2 over 30 minutes intravenous infusion on Days 1 and 8 of each 21-day cycle. In certain embodiments, gemcitabine may be used in combination with paclitaxel (breast cancer) and cisplatin (lung cancer).
Keeping the above description in mind, typical dosages of gemcitabine may range about 1000 mg/m2 over 30 minutes intravenous infusion on Days 1 and 8 of each 21-day cycle. In certain embodiments, gemcitabine may be used in combination with paclitaxel (breast cancer) and cisplatin (lung cancer). Keeping the above description in mind, typical dosages of doxorubicin when used as a single agent is 60 to 75 mg/m2 as a single intravenous injection administered at 21-day intervals. The lower dosage should be given to patients with inadequate marrow reserves due to old age, or prior therapy, or neoplastic marrow infiltration. In certain embodiments, doxorubicin may be used concurrently with other approved chemotherapeutic agents. When used in combination with other chemotherapy drugs, the most commonly used dosage of doxorubicin is 40 to 60 mg/m2 given as a single intravenous injection every 21 to 28 days.
Keeping the above description in mind, typical dosages of DOXIL (doxorubicin HCl liposome injection) should be administered intravenously at a dose of 30-50 mg/m2 at an initial rate of 1 mg/min to minimize the risk of infusion reactions. For patients With Multiple Myeloma, Bortezomib is first administered at a dose of 1.3 mg/m2 as intravenous bolus on days 1, 4, 8 and 11, every three weeks. DOXIL 30 mg/m2 should be administered as a 1-hr intravenous infusion on day 4 following bortezomib.
Keeping the above description in mind, typical dosages of etoposide (ETOPOPHOS) should be administered intravenously at a dose of ranges from 35 mg/m2/day for 4 days to 50 mg/m2/day for 5 days. In certain embodiments, etoposide may be used in combination with other anticancer agents.
Keeping the above description in mind, typical dosages of melphalan (ALKERAN Tablets) should be administered orally at a dose about 6 mg (3 tablets) daily. After 2 to 3 weeks of treatment, the drug should be discontinued for up to 4 weeks. In certain embodiments, melphalan may be used in combination with other anticancer agents including bortezomib.
Keeping the above description in mind, hexamethylamine (Hexylen, Altretamine, Hexastat) as HEXALEN® capsules is administered orally. Doses are calculated on the basis of body surface area. HEXALEN® capsules may be administered either for 14 or 21 consecutive days in a 28 day cycle at a dose of 260 mg/m2/day. The total daily dose should be given as 4 divided oral doses after meals and at bedtime. HEXALEN® capsules should be temporarily discontinued (for 14 days or longer) and subsequently restarted at 200 mg/m2/day.
Keeping the above description in mind, irinotecan (CAMPTOSAR) may be used either as a single agent or in combination with fluorouracil and leucovorin at a dosage of 125 mg/m2 intravenously over 90 minutes once a week for four doses or as a single agent at a dosage of 350 mg/m2 intravenously over 90 minutes every three weeks, or in combination with fluorouracil and leucovorin at a dosage of 180 mg/m2 intravenously over 90 minutes every other week for three doses.
Keeping the above description in mind, typical dosages of PF-04217903 may range from about 50 mg to about 1000 mg administrating orally twice a day. A treatment cycle is considered to be 21 days. A preferred dose range is on the order of about 100 mg to about 500 mg.
Keeping the above description in mind, typical dosages of AMG 208 may range from about 10 mg to about 1000 mg administrating orally twice a day. A preferred dose range is on the order of about 100 mg to about 500 mg.
Keeping the above description in mind, typical dosages of JNJ-38877605 may range from about 10 mg to about 1000 mg administrating orally once or twice a day. A treatment cycle is considered to be 21 days. A preferred dose range is on the order of about 100 mg to about 500 mg.
Keeping the above description in mind, typical dosages of MGCD-265 may range from about 24 mg/m2 to about 340 mg/m2 administrating orally and daily with 7 days on/7 days off schedule for a 28-day cycle. A preferred dose range is on the order of about 200 mg to about 500 mg.
Keeping the above description in mind, typical dosages of SGX-523 may range from about 10 mg to about 500 mg administrating orally twice a day on a 14 days on/7 days off therapy schedule, cycling every 21 days. A preferred dose range is on the order of about 100 mg to about 200 mg.
Keeping the above description in mind, typical dosages of GSK1363089 may range at about 240 mg/d on day 1-5 repeated every 14 days with 5 day on/9 day off schedule or at about 80 mg/d daily. The drug will be administrated orally. A preferred dose range is on the order of about 80 mg to about 200 mg.
Keeping the above description in mind, typical dosages of vandetanib may range from about 100 mg to about 500 mg administrating orally once a day. A preferred dose range is on the order of about 100 mg to about 300 mg.
Keeping the above description in mind, typical dosages of BIBF1120 may range from about 100 mg to about 250 mg administrating orally twice a day in a 20-day continuous dosing regimen. A preferred dose range is on the order of about 100 mg to about 200 mg.
Keeping the above description in mind, the recommended dose of VOTRIENT (pazopanib) may range from about 200 mg to about 800 mg orally once daily without food (at least 1 hour before or 2 hours after a meal).
Keeping the above description in mind, typical dosages of bevacizumab may range from about 5 mg-10 mg/kg every 2 weeks; 5 mg/kg or 10 mg/kg every 2 weeks when used in combination with intravenous 5-FU-based chemotherapy; about 15 mg/kg every 3 weeks in combination with carboplatin and paclitaxel; about 10 mg/kg every 2 weeks in combination with interferon alfa; and about 10 mg/kg every 2 weeks in combination with paclitaxel. Bevacizumab should be administrated through intravenous (IV) infusion over 90 minutes in a 20-day continuous dosing regimen. A preferred dose range is on the order of about 100 mg to about 200 mg.
Keeping the above description in mind, typical dosages of vatalanib may range from about 250 mg to about 2000 mg administrating orally daily in a 28-day continuous dosing regimen. A preferred dose range is on the order of about 1000 mg to about 1500 mg.
Keeping the above description in mind, typical dosages of axitinib may range from about 5 mg to about 30 mg twice daily administrating orally daily. A preferred dose range is on the order of about 5 mg to about 10 mg.
Keeping the above description in mind, typical dosages of E7080 may range from about 0.1 mg-12 mg administrating orally continually twice daily for 2-6 cycles of a 28-day cycle. A preferred dose range is on the order of about 5 mg to about 10 mg.
Keeping the above description in mind, typical dosages of perifosine may range from about 100-600 mg/week administrating orally. A preferred dose range is on the order of about 200 mg to about 400 mg.
Keeping the above description in mind, typical dosages of MK-2206 may range from about 30 mg-60 mg administrating orally every other day in a 28-day cycle. A preferred dose range is on the order of about 30 mg to about 50 mg.
Keeping the above description in mind, typical dosages of temsirolimus may range from about 25 mg-about 50 mg administrating through infused over a 30-60 minute period once a week. A preferred dose range is on the order of about 30 mg.
Keeping the above description in mind, typical dosages of rapamycin may range from about 10 mg-40 mg administrating orally daily. A preferred dose range is on the order of about 20 mg to about 30 mg.
Keeping the above description in mind, typical dosages of BEZ235 may range from about 10 mg-45 mg administrating orally once daily on days 1-28 of the first course. Courses will repeat every 28 days. A preferred dose range is on the order of about 20 mg to about 30 mg.
Keeping the above description in mind, typical dosages of GDC-0941 may range from about 60 mg-80 mg administrating orally once daily or twice a day. A preferred dose range is on the order of about 40 mg to about 50 mg.
Keeping the above description in mind, typical dosages of PLX-4032 may range from about 200 mg-960 mg administrating orally twice daily. A preferred dose range is on the order of about 300 mg to about 500 mg.
Keeping the above description in mind, typical dosages of imatinib may range from about 400 mg-800 mg administrating orally daily or twice daily. A preferred dose range is on the order of about 400 mg to about 500 mg.
Keeping the above description in mind, typical dosages of AZD0530 may range from about 100 mg-500 mg/week administrating orally. A preferred dose range is on the order of about 100 mg to about 250 mg.
Keeping the above description in mind, typical dosages of VELCADE (bortezomib) is 1.3 mg/m2 administered as a 3 to 5 second bolus IV injection in combination with oral melphalan and oral prednisone for nine 6-week treatment cycles. In cycles 1 through 4, bortezomib is administered twice weekly (days 1, 4, 8, 11, 22, 25, 29 and 32). In cycles 5 through 9, bortezomib is administered once weekly (days 1, 8, 22 and 29). At least 72 hours should elapse between consecutive doses of bortezomib.
Keeping the above description in mind, typical dosages of XAV-939 may range from about 100 mg-500 mg/week administrating orally. A preferred dose range is on the order of about 100 mg to about 250 mg.
Keeping the above description in mind, the dosage of the chemotherapeutic agent or cytotoxic drug may be less than that normally used when administered in combination with the CD44-Fc fusion protein, as described herein these fusion proteins sensitizes cancer cells to cytotoxic drugs.
The present invention is described further below in working examples which are intended to further describe the invention without limiting the scope therein.
In the examples below, the following materials and methods were used.
The glioma tissues were obtained from Cooperative Human Tissue Network (CHTN) at University of Pennsylvania and The Ohio State University. Human tissues were used in accordance with the approved Human tissue study protocol.
The Oncomine database (www.oncomine.org, Compendia Bioscience, Ann Arbor, Mich.) was searched for CD44 mRNA expression levels in human glioma tissues and other human cancer types compared to their normal counterparts.
Expression Profiling and Real-Time Quantitative PCR (qPCR)
To compare gene expression profiles, human U133v2 gene chips (Affymetrix) were used and the probes derived from three independently transduced and pooled puromycin-resistant U87MG or WM793 cells that re-express merlin (U87MG/Wm793merlin) or were transduced with empty retroviruses (U87MG/WM793 wt) following standard protocols.
Human glioma cells, U138MG, LN118, LN229, and A172 cells (ATCC); SNB19, SNB75, SNB78, U118MG, U87MG, U251, U373MG, SF763, SF767, SF268, SF539, SF188, SF295, and SF242 (UCSF and NCI), and normal human astrocytes (NHAs, ALLCELLS, Inc) were maintained according to the providers' and manufacturers' instructions. Anti-MST1/2, -Lats1/2 (Bethyl Lab), -CD44, -Erk1/2, -AKT, -JNK, -p21, -p38, -p53, -cIAP1/2, and -merlin (Santa Cruz), -actin (Sigma), -nestin (Millipore), -sox-2 (R&D systems), -v5 epitope, -phospho-merlin, -puma (Invitrogen), -cleaved caspase 3, -phospho-Erk1/2, -phospho-AKT, -phospho-JNK, -phospho-p38, -phospho-MST1/2, -phospho-Lats1, -phospho-YAP (Cell signaling), -YAP, -phospho-Lats2 (Abnova) and -heparan sulfate (HS, CalBiochem) antibodies were used in the experiments. Apoptag kit was from Chemicon and anti-Brdu from Roche.
Fresh human glioblastoma, lung cancer, prostate cancer, breast cancer, ovarian cancer, and melanoma tissues were obtained from Cooperative Human Tissue Network (CHTN) at University of Pennsylvania and The Ohio State University. The tissues were dissociated into single cells by 0.4% collagenase type I (Sigma C0130) and plated in ultra-low attachment plates in serum-free cancer stem cell culture medium, which is DMEM/F12 supplemented with B27 (Invitrogen), EGF (10 ng/mL, BD Biosciences), and FGF-2 (20 ng/mL, BD Biosciences). After formation of the initial spheres, cancer spheres, including glioma spheres, were passaged approximately every-two week by dissociating the spheres with 0.05% trypsin-ethylenediamine tetraacetic acid (EDTA).
Human total spleen RNAs were obtained from Clontech. Total RNAs from human skin tissues (CHTN-University of Pennsylvania) and T47D human breast cancer cells (ATCC) were isolated using RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA was synthesized from 5 μg of total RNA using Superscript II RNase H− reverse transcriptase (Invitrogen). Human Fc fragment was obtained by PCR using human spleen cDNAs as templates, Pfu DNA polymerase (Stratagene), and a pair of primers as the following: forward primer, 5′-gacaaaactcacacatgcccaccg-3′ (SEQ ID NO. 71) and reverse primer, 5′ tcatttacccggagacagggagag-3′ (SEQ ID NO. 72). Human skin and T47D human breast cancer cells expressing many CD44 isoforms including human CD44v3-v10, CD44v8-v10, and CD44s were obtained. Human soluble CD44 isoforms were obtained by PCR using mixture of human skin and T47D cDNAs as templates, Pfu DNA polymerase (Stratagene), a pair of primers as the following: forward primer, 5′-acc atg gac aag ttt tgg tgg cac-3′ (SEQ ID NO. 73) and reverse primer, 5′-ttctggaatttggggtgtccttat-3′ (SEQ ID NO. 74). All the resulting PCR products were cloned into pEF6/v5-HisTOPO expression vectors (Invitrogen). The clones with correct human Fc fragment and soluble CD44 were identified. These fragments were then subcloned into the retroviral expression vector pQCXIP (BD Bioscience) to generate human soluble CD44-Fc (hsCD44) fusion expression constructs. The soluble human CD44v3-v10, v8-v10, or soluble CD44s were fused in frame to the human Fc fragment using a MfeI restriction site (CAATTG). Retroviruses were generated using these expression constructs and pVSVG/GP2 in 293 cells following the manufacturer's instructions (BD). All expression constructs were verified by DNA sequencing.
The following soluble human CD44-Fc fusion protein constructs have been generated CD44s-, CD44v3-v10-, CD44v8-v10-, CD44v4-v10-, CD44v6-v10-, CD44v7-v10-, CD44v9-v10-, and CD44v10-Fc. The following soluble human CD44-Fc fusion protein constructs are being generated by deletional mutagenesis: CD44v5-v10-, CD44v9-, CD44v8-, CD44v7-, CD44v6-, CD44v5-, CD44v4-, and CD44v3-Fc. Deletional mutagenesis is performed by using soluble human CD44v3-v10-Fc in the retroviral expression vector pQCXIP (BD Bioscience) as the template together with the ExSite mutagenesis kit (Stratagene), and different pairs of appropriate primers corresponding to the sequences of 24 nucleotides before and after the segments intended to be deleted as described (Bai et al., 2007).
The following soluble human CD44R41A-Fc mutated fusion protein constructs have been generated: CD44sR41A-, CD44v8-v10R41A-, and CD44v3-v10R41A-Fc. The following soluble human CD44R41A-Fc mutated fusion protein constructs will be generated by point mutation: CD44v4-v10R41A-, CD44v5-v10R41A-, CD44v6-v10R41A-, CD44v7-v10R41A-, CD44v9-v10R41A-, CD44v10R41A-, CD44v9R41A-, CD44v8R41A-, CD44v7R41A-, CD44v6R41A-, CD44v5R41A-, CD44v4R41A-, CD44v3R41A-Fc. The point mutation in CD44sR41A-, CD44v8-v10R41A-, and CD44v3-v10R41A-Fc were generated by using soluble human CD44s-, CD44v8-v10-, CD44v3-v10-Fc in retroviral expression vector pQCXIP (BD Bioscience) as the templates together with the QuikChange® II Site-Directed Mutagenesis Kit (Stratagene), and a pairs of appropriate primers: forward, 5′-gtg gag aaa aat ggt gcc tac agc atc tct cgg-3′ (SEQ ID NO. 75) and reverse, 5′-ccg aga gat get gta ggc acc att ttt etc cac-3′ (SEQ ID NO. 76). The retroviruses were generated by using these expression constructs and pVSVG/GP2-293 cells following the manufacturer's instructions (BD Bioscience). Similar procedures will be used to generate additional CD44R41A-Fc constructs.
Cos-7 cells infected with the retroviruses carrying hsCD44v3-v10-Fc, hsCD44v6-v10-FC, hsCD44v8-v10-Fc, hsCD44s-Fc, hsCD44v3-v10R41A-Fc, hsCD44v8-v10R41A-Fc, and hsCD44sR41A-Fc constructs were cultured in RPMI medium containing 10% fetal bovine serum (FBS) to reach confluence then switched to serum free RPMI medium (SFM) to culture for additional three days. The collected SFM was purified through protein A columns (GE Healthcare Biosciences). Before elution from protein A column, some of preparations of the bound CD44-Fc fusion proteins were treated heparinase I (10 units/ml) and heparinase III (2 unit/ml) or at 37° C. for 4 h.
To measure canonical Wnt signaling in U87MGwt and U87MGmerlinS518D, U87MGmerlin, and U87MGmerlinS518A cells, the beta-catenin-responsive luciferase reporter construct (TopFlash, Addgene), which contains TCF/LEF binding sites and a negative control construct, FopFlash, which contains mutated TCF/LEF binding sites, was used. These reporters were transfected transiently into these transduced glioma cells in triplicate. The luciferase activity in these transfected cells were measured 24 hours post-transfection following the manufacturer's instructions (Promega) using a Modulus Microplate Luminometer/Fluorometer (Turner Biosystems).
To knock down human CD44 expression, several shRNAmir (expression Arrest™ microRNA-adapted shRNA) and TRC (the RNAi consortium) constructs against human CD44 and a non-targeting shRNAmir and non-targeting TRC control constructs were obtained from Open Biosystems and Addgene (a non-profit plasmid repository, www.addgene.org). Lentiviruses carrying these shRNAs were generated following the manufacturer's instructions. Expression Arrest™ microRNA-adapted shRNA (shRNAmir) are designed to mimic a natural microRNA primary transcript, enabling specific processing by the endogenous RNAi pathway and producing more effective knockdown. microRNA-30 adapted design contains mir-30 loop and context sequences (Silva et al., 2005)
GCCCTATTAGTGATTTCCAAA CTCGAG
TTTGGAAATCACTAATAGGGC
CGGAAGTGCTACTTCAGACAA CTCGAG
TTGTCTGAAGTAGCACTTCCG
CCTCCCAGTATGACACATATT CTCGAG
AATATGTGTCATACTGGGAGG
CCAACTCTAATGTCAATCGTT CTCGAG
AACGATTGACATTAGAGTTGG
CGCTATGTCCAGAAAGGAGAA CTCGAG
TTCTCCTTTCTGGACATAGCG
AGGTGTAACACCTACACCATTA
TAGTGAAGCCACAGATGTA
TAATGGTGTAGGTGTTACACCC
ACGCAGATCGATTTGAATATAA
TAGTGAAGCCACAGATGTA
TTATATTCAAATCGATCTGCGC
CCCTCCCAGTATGACACATATT
TAGTGAAGCCACAGATGTA
AATATGTGTCATACTGGGAGGT
ACCTCCACCCTCACTCTGCCAT
TAGTGAAGCCACAGATGTA
ATGGCAGAGTGAGGGTGGAGGG
Lenti- and Retroviral Transduction
U87MG and U251 human glioma cells were seeded in 6-well plates and allowed to grow for overnight. The subconfluence U87MG, and U251 cells were first transduced with the retroviruses carrying luciferase with a hygromycin-resistant gene, and then transduced with the retroviruses carrying the empty retroviral expression vector or human soluble (hs) CD44-Fc fusion constructs with a puromycin-resistant gene. The pooled populations of drug resistant cells were expanded, and portions of the cells were used to assess their expression of the transduced gene products. Anti-CD44 and anti-human IgG antibodies were used to detect the expression level of hsCD44-Fc fusion proteins.
CD44 knockdown was accomplished using lentiviruses carrying shRNAs against human CD44 or non-targeting control shRNAs following the manufacturer's instructions. Infected cells were selected for their resistance to hygromycin and puromycin. The pooled populations of the drug resistant cells were expanded and portions of the cells were used to assess the expression level of endogenous CD44. Anti-CD44 antibodies (Santa Cruz) were used for assessing endogenous level of CD44.
Human glioma spheres (HGSs) were disaggregated with 0.05% trypsin-ethylenediamine tetraacetic acid (EDTA, Cellgro®) and seeded on the BD BioCoat™ Matrigel™ Matrix 6-well plates, which are designed to maintain and propagate embryonic stem cells in the absence of feeder layers. These cells were transduced with lentiviruses carrying shRNAs against human CD44. After selection with puromycin, the pooled populations of drug-resistant cells were suspended into single cells and cultured in serum-free cancer stem cell culture medium (DMEM/F12 supplemented with B27 (Invitrogen), EGF (10 ng/mL, BD Biosciences), and FGF-2 (20 ng/mL, BD Biosciences)) in ultra-low attachment plates to re-form spheres.
Cells were extracted with either RIPA buffer (50 mM Tris-HCl (pH7.4) containing 150 mM NaCl, 5 mM EDTA, 1% Triton, 0.1% SDS, 2 mM PMSF, 2 μg/ml leupeptin, and 0.05 U/ml aprotinin) or with 4×SDS Laemmli sample buffer without the dye and protein concentrations were determined using Bio-Rad Dc Protein Assay Reagents. 50-100 μg of extracted proteins were separated by 10% SDS-PAGE. Following electrophoresis, the gels were blotted onto Hybond-ECL membranes (Amersham, Arlington Heights, Ill.). Anti-CD44 antibody (Santa Cruz) was employed to detect CD44.
Glioma cells with or without CD44 knockdown were cultured in 35 mm dishes in the presence of 10% FBS RPMI for 24 hours. The cells were fixed in 3.7% paraformaldehyde, washed with PBS, and blocked with 2% non-fat milk. Anti-CD44 antibody (Santa Cruz) and FITC-conjugated anti-mouse secondary antibody (Sigma) were employed to detect cell surface CD44.
FL-HA binding assay was performed as described previously (Xu and Yu, 2003; Yu and Stamenkovic, 1999). Briefly, a total of 5×105 of the transduced glioma cells were seeded onto 35-mm dishes in the presence of PRMI/10% FBS and puromycin. On the following day, the culture medium was replaced by fresh RPMI/10% FBS containing 20 μg/ml Fl-HA. Twenty-four later, the cells were washed extensively with PBS, fixed in 4% paraformaldehyde, washed, mounted, and observed under a fluorescence microscope.
Mice were used in accordance with the approved IACUC Protocol. Pooled populations of transduced U87MG and U251 glioma cells were used for subcutaneous tumor growth experiments. 2 or 5×106 glioma cells or 5×106 of glioma cells were injected subcutaneously into each immuno-compromised B6.129S7-Rag1tmMom (Rag1, Jackson Lab) mouse. Six mice were used for each type of the infected glioma. After solid tumors became visible (10-15 days after the injection), the longest and shortest diameters of the solid tumors were measured using a digital caliper every third day for five to seven weeks for gliomas. Tumor volumes were calculated using the following formula: tumor volume=½×(shortest diameter)2×longest diameter (mm3). At end of the experiments, tumors were fixed and sectioned for histological and immunohistochemical analyses.
Mice were used in accordance with the approved IACUC Protocol. Pooled populations of the transduced U87MG and U251 cells were used for the intracranial tumor growth experiments. U87MG (4×105 cells in 10 μl HBSS/Rag1 mouse)/U251 cells (2×105 cells in HBSS/Rag1 mouse) were injected at the bregma 2 mm to the right of the sagittal suture and 3 mm below the surface of the skull. Following injection, mice were closely monitored and the duration of their survival was recorded. Mice that showed signs of distress and morbidity were euthanized and considered as if they had died on that day. Number of surviving mice was recorded. The survival rates were calculated as follows: survival rate (%)=(number of mice still alive/total number of experimental mice)×100%. Mice that were free of symptoms 40 or 60 days after intracranial injection were euthanized and the tissues examined.
To monitor the growth of intracranial gliomas in live animal, bioluminescence-imaging approach was used. U87MG and U251 cells were infected with a retroviral-based luciferase expression vector that contains an internal ribosome entry site (IRES) and hygromycin resistance gene. Hygromycin-resistant U87MG-Luc and U251-Luc cells express high levels of luciferase. These cells were then infected with lentiviruses carrying non-targeting shRNAs or shRNAs against human CD44. These double drug resistant cells were injected intracranially into Rag-1 mice at the bregma 2 mm to the right of the sagittal suture and 3 mm below the surface of the skull. 3, 6, 9, 13, 17 days after the injections, bioluminescence images of the intracranial tumors were acquired 12 min after injection of D-luciferin using the same intensity scaling by using IVIS-200 imaging system (Xenogen) at the In Vivo Molecular Imaging Shared Facility at Mount Sinai School of Medicine.
To determine the glioma cell proliferation rate in vivo, 5-Bromo-2′-deoxy-uridine (BrdU) was injected intraperitoneally (i.p.) into mice four hours prior to euthanasia. Tumors including gliomas from the experimental animals were dissected and fixed in formalin (Fisher), washed with PBS, dehydrated through 30%, 70%, 95%, and 100% ethanol and xylene, and embedded in paraffin wax (Fisher). 5-10 μm sections were cut, mounted onto slides and stained with hematoxylin and eosin (Fisher) for histologic analysis. The sections were incubated with anti-BrdU or anti-Ki67 antibodies to detect proliferating cells or with the Apoptag kit to detect apoptotic cells in situ (Lau et al. 2008).
U87MG-NT cells (U87MG cells infected with a mixture lentiviruses carrying non-targeting TRC-NT and shRNAmir-NT constructs) and U87MGshRNA-CD44 cells (U87MG cells infected with a mixture lentiviruses carrying shRNAs against human CD44, TRC-CD44#3 and shRNAmir-CD44#1) were treated with vehicle, 60 μm H2O2 or 40 μg/ml TMZ for 30 min, 2 h, 24 h, 48 h, and 72 h. The cells were lysed using 4×SDS Laemmli sample buffer without the dye. Protein concentrations were determined using Bio-Rad Dc Protein Assay Reagents. 100 μg of total protein was loaded in each lane. Actin was included as an internal control for protein loading. The antibodies used against the different signaling mediators are indicated in the figures.
Western blots were also performed using cell lysates derived from U87MG-TN and U87MGshRNA-CD44 cells treated with different growth factors. 2×105 of the glioma cells were seeded into 6-well plates for 24 hours and switched to serum free medium and cultured for additional 72 hours. The serum starved U87MG cells were treated with or without FBS, NGF (10 ng/ml), EGF (2 ng/ml), HB-EGF (5 ng/ml), betacellulin (BTC, 5 ng/ml), epiregulin (Epr, 5 ng/ml), amphiregulin (AR, 5 ng/ml), or HGF (20 ng/ml) for 12 h. The cells were lysed using 4×SDS Laemmli sample buffer without the dye and protein concentrations were determined using Bio-Rad Dc Protein Assay Reagents. 100 μg of total protein were loaded in each lane. Actin was included as an internal control for protein loading. The antibodies used against the different signaling mediators are indicated in the figures.
H2O2 was added into serum-free glioma culture medium (RPMI) to reach a final concentration of 60 μM. The glioma cells were cultured in the presence of 60 μm H2O2 for 30 min, 2 h, 24 h, 48 h, and 72 h.
TMZ was added into the serum-free glioma culture medium (RPMI) to reach a final concentration of 40 μg/ml. The glioma cells were cultured in the presence of 40 μg/ml TMZ for 30 min, 2 h, 24 h, 48 h, and 72 h.
Purified CD44-Fc fusion proteins (hsCD44s-Fc, hsCD44v8-v10-Fc, and hsCD44v3-v10-Fc) were labeled with biotin using EZ-Link Biotinylation Kits (Thermo Scientific) following the manufacturer's instruction. Human tumor paraffin sections were deparaffinized and rehydrated. After blocking with 2% BSA, the sections were incubated with biotinylated CD44-Fc fusion proteins (1 μg/ml) for overnight at 4 degree. biotinylated CD44-Fc fusion proteins were detected by VECTASTAIN ABC kit.
To detect plasma HA level, at least 200 μl blood from each transgenic mice (MMTV-PyVT and MMTV-ActErbb2, Jackson Lab) bearing breast cancer, Rag-1 mice bearing gliomas derived from MSSM-GBMCSC-1 or Glioma 261 cells, or control health mice were collected. Blood samples from six mouse of each type of mice were collected and plasma samples were generated immediately. 50 μl plasma from each sample was loaded in triplicate into each well of an Elisa plate that has been pre-coated with CD44-Fc fusion proteins. The CD44-Fc bound HA was detected by biotinylated CD44-Fc fusion proteins and AP-conjugated avidin. The developed color was measure by an Elisa machine at 405 nm.
PC3/M human prostate cancer cells, HCT116 and KM20L2 human colon cancer cells, MX-2 and SW613 human breast carcinoma cells, NCI-H125 human non-small cell lung cancer cells, NCIH460, human large cell lung cancer cells, and OVCAR-3 human ovarian cancer cells were transduced with luciferases and shRNAs against human CD44 or control non-targeting shRNAs and selected for their resistance to hygromycin and puromycin. M14 human melanoma cells, SCC-4 human head-neck carcinoma cells, BXPC-3 human pancreatic cancer cells, and SK-Hep-1 human liver cancer cells were transduced with retroviruses carrying CD44s-Fc, CD44v3-v10-Fc, and CD44v8-v10-Fc constructs or empty expression vector. Pooled populations of the drug-resistant cancer cells were used for subcutaneous tumor growth experiments. 5×106 of these cancer cells were injected subcutaneously into each immuno-compromised B6.129S7-Rag1tmMom (Rag1, Jackson Lab) mice. Six mice were used for each type of the infected cancer cells. The longest and shortest diameters of the solid tumors were measured using a digital caliper at the end of the experiments. Tumor volumes were calculated using the following formula: tumor volume=½×(shortest diameter)2×longest diameter (mm3). At end of the experiments, tumors were fixed and sectioned for histological and immunohistochemical analyses.
Xenograft and orthotopical mesothelioma tumor models in Rag-1 mice: 5×106 of human malignant mesothelioma cells, H-MESO-1, H-MESO-1A, and/or MSTO-211H (ATCC and NCI-DCTD Tumor/Cell line repository in Frederick) will be injected subcutaneously and orthotopically into the right pleural cavity immunocompromised Rag 1 mice.
Xenograft melanoma models: 5×106 of human melanoma cells, MEWO, SKMEL5, SKMEL2, and/or A375 (ATCC and NCI-DCTD Tumor/Cell line repository in Frederick), will be injected subcutaneously into immunocompromised Rag 1 mice.
Xenograft sarcoma models: 5×106 of human sarcoma cells, SKN-MC and A673 cell (ATCC), will be injected subcutaneously into immunocompromised Rag 1 mice.
Xenograft pancreatic cancer models: 5×106 of human pancreatic cancer cells, Pane-1, HPAC, MIA PaCa-2, and/or AsPC-1 pancreatic cancer cells, will be injected subcutaneously into immunocompromised Rag 1 mice.
Xenograft hepatoma models: 5×106 of human hepatoma cells, Hep 3B2.1-7 hepatoma cells, will be injected subcutaneously into immunocompromised Rag 1 mice.
Xenograft multiple myeloma models: 5×106 of human multiple myeloma cells, U266 and MC/CAR cells, will be injected subcutaneously into immunocompromised Rag 1 mice.
Ascites ovarian cancer model in Rag-1 mice: 5×106 of human SKOV3ip and OVCAR-3ip human ovarian cancer cells will be injected into Rag-1 mice intraperitoneally (ip).
Xenograft and/or bone metastatic prostate cancer models: 5×106 of human prostate cancer cells, 22Rv1, will be injected into Rag-1 mice subcutaneously or intracardiacally into each Rag-1 mice, respectively.
Xenograft and/or metastatic lung cancer models: 5×106 of human lung cancer cells, A549 and LX529 will be injected into Rag-1 mice subcutaneously or intravenously into Rag-1 mice, respectively.
Xenograft and orthotopical breast cancer models: 5×106 of human breast cancer cells, MX-2 and SW613, will be injected subcutaneously or into Rag-1 mouse mammary fat pad, respectively.
Cancer stem cell models: Fresh human glioblastoma, human melanoma, lung, breast, prostate, ovarian, head-neck, kidney, and colon cancer tissues were obtained from Cooperative Human Tissue Network (CHTN) at University of Pennsylvania and The Ohio State University. The tissues were dissociated into single cells by 0.4% collagenase type I (Sigma C0130) and plated in ultra-low attachment plates in serum-free cancer stem cell culture medium, which is DMEM/F12 supplemented with B27 (Invitrogen), EGF (10 ng/mL, BD Biosciences), and FGF-2 (20 ng/mL, BD Biosciences). After formation of the initial spheres, the tumor spheres were passaged approximately every week by dissociating the spheres with 0.05% trypsin-ethylenediamine tetraacetic acid (EDTA). The tumor spheres were implanted subcutaneously into Rag-1 mice.
Statistics
One-way ANOVA statistic analyses were performed to analyze statistical differences of the tumor volumes and growth rates between the control and experimental groups. LogRank analyses were performed for the survival experiments. Differences were considered statistically significant at p<0.05.
To determine the expression level of CD44 in GBM, available gene expression datasets at www.oncomine.org were mined. In four independent datasets, CD44 transcripts were consistently upregulated in human GBM compared to either normal brain (
To address the role of CD44 in glioma growth and progression, expression levels of the CD44 protein in a variety of human glioma cell lines were analyzed. Human glioma cell lines were derived from ATCC, UCSF, and NCI-DCTD Tumor/Cell line repository in Frederick. The majority of human glioma cells tested express higher levels of CD44 than normal human astrocytes (NHAs) and the standard 85-90 kDa form (CD44s,
To knock down endogenous CD44 expression effectively in U251 and U87MG cells, a set of human CD44-specific TRC-shRNA (shRNA-TRC-CD44#1-#5) and shRNAmir (shRNAmir-CD44#1-#3) constructs (Open Biosystems) were screened. Non-targeting control shRNAs (shRNA-TRC-NT and shRNAmir-NT) were included in the screen as negative controls. These shRNA vectors were lentiviral-based and contained the internal ribosome entry site (IRES)/GFP and/or puromycin-resistance gene located at the 3′-termini of the shRNA inserts. The IRES element in the shRNAmir construct ensures that all the puromycin-resistant cells express the inserted shRNAs and allows use of the GFP expression level as an indicator of the shRNA expression efficiency. Lentiviruses containing these shRNA constructs were used to infect U87MG-Luc and U251-Luc cells that had been transduced with and expressed luciferase. Luciferase activity allowed efficient monitoring of intracranial growth of these cells (Lau et al., 2008). After selection of the infected cells with puromycin, expression levels of endogenous CD44 were assessed in pooled populations of puromycin-resistant GBM cells. Two out of three shRNAmir constructs (shRNAmir-CD44#1 and shRNAmir-CD44#3) and 1-2 TRC-shRNA (shRNA-TRC-CD44#3 and/or shRNA-TRC-CD44#4) knocked down CD44 expression efficiently in these two glioma cell lines, as assessed by real-time qPCRs (data not shown) and Western blot analysis (
Pooled populations of the transduced U87MG and U251 cells that displayed different degrees of CD44 depletion were first used in subcutaneous (s.c.) tumor growth experiments to determine how reduced CD44 expression affects glioma growth in vivo. Reduced CD44 expression in these cells correlated with reduced tumor volumes 5 weeks following injection of the GBM cells (
To determine the effect of CD44 knockdown on intracranial glioma growth, double drug-resistant pooled populations of glioma cells that express high levels of luciferase and display significant CD44 depletion were injected intracranially into immunocompromised Rag-1 mice. Three, six, nine, and thirteen days after injection, bioluminescence images of the intracranial tumors were acquired using an IVIS-200 imaging system (Xenogen,
To confirm the effect of reduced CD44 expression on intracranial glioma growth, an inducible CD44 knockdown system was established in U87MG-luc and U251-Luc cells by using two TRIPZ lentiviral Tet-On shRNAmir constructs (Open Biosystems), which contain two of the effective shRNAs against CD44 (shRMAmir #1 and #3,
The first-line cytotoxic drugs for GBM are temozolomide (TMZ) and carmustine (BCNU). Based on previous observations that CD44 provides essential survival signals to metastatic breast cancer cells (Yu et al., 1997), the possibility that reduced CD44 expression may inhibit survival signaling and sensitize glioma cells to BCNU and TMZ treatment in vivo was addressed. Mice were injected intracranially with U87MG-Luc and U251-Luc cells, depleted or not of endogenous CD44, and treated sequentially with a single dose of BCNU (10 mg/kg, iv) or TMZ (5 mg/kg, ip). BCNU and TMZ displayed a weak and a moderate inhibitory effect on glioma growth, respectively, when used as single agents (
Radiation therapy provides another option for GBM patients. Radiation therapy and some cytotoxic agents generate reactive oxygen species (ROS), which constitute a major inducer of cell death resulting in their anti-glioma effects. To address the molecular mechanisms that underlie the observed chemosensitizing effect of CD44 knockdown on glioma cells, how reduced CD44 expression affects GBM cell response to oxidative stress induced by H2O2 and cytotoxic stress induced by TMZ was investigated. U87MG cells transduced with a mixture of viruses carrying the control non-targeting shRNAmir-NT and TRC-NT or with a mixture of two of most effective shRNAs against CD44 (shRNAmirCD44#1 and TRC-CD44#3,
MST1/2 plays an important role in mediating oxidative-stress-induced apoptosis (Lehtinen et al., 2006), and we have shown that MST1/2 functions downstream of merlin in human GBM cells (Lau et al., 2008). Compared to the GBM cells expressing a high level of endogenous CD44, the cells with depleted endogenous CD44 responded to oxidative stress with robust and sustained phosphorylation/activation of MST1/2 and Lats1/2, phosphorylation/inactivation of YAP, and reduced expression of cIAP1/2 (
Because MST1/2 kinases have multiple downstream effectors and are implicated in several signaling pathways, whether known effectors of MST1/2 also function downstream of this newly established CD44-MST1/2 signaling axis was investigated. These results indicate that knockdown of CD44 results in elevated and sustained activation of JNK and p38 stress kinases in glioma cells exposed to oxidative stress (
Caspase-3 cleavage is an indicator of cellular apoptosis. The in vitro data using H2O2 treatment demonstrates caspases-3 cleavage (
Although H2O2 was not administered in vivo, chemotherapy and radiation therapy act to generate H2O2.
To address the mechanism whereby CD44 depletion sensitizes glioma cells to cytotoxic drugs in vivo (
In vivo results show that CD44 knockdown inhibits proliferation of the GBM cells in vivo (
CD44 and merlin negatively regulate each other function (Bai et al., 2007 and Xu et al., 2010). U87MG cells responded to the growth inhibitory effect of merlin in a dramatic fashion (Lau et al., 2008), suggesting that downstream signaling pathways of merlin are intact in these cells even though merlin expression is down regulated and CD44 expression is up-regulated. This cell model results in an excellent opportunity to identify the differentially expressed genes and the altered signaling pathways in response to merlin re-expression. These differentially expressed gene may represent the essential downstream effectors of merlin and CD44, which are likely either hyperactive or hypoactive when merlin function is lost or impaired and CD44 is up-regulated in human gliomas. Deregulation of these signaling pathways may lead to gliomagenesis and/or devastating progression of this disease.
To identify downstream effectors that mediate the potent anti-glioma effect of merlin, gene expression profiles of three independently-transduced and pooled U87MGmerlin and U87MGwt cells, which express high and low level of merlin, respectively, were compared using human U133v2 gene chips (Affymetrix). The microarray results indicated that the expression of merlin in U87MGmerlin cells is ˜three fold higher than in U87MGwt cells. 362 genes whose expression increased and 364 genes whose expression decreased in U87MGmerlin cells compared to U87MGwt cells were identified. They can be categorized into the genes involved in adhesion, migration, organization of actin-cytoskeleton, cell cycle, survival, and signal transduction. These genes were imported to David Functional Annotation Bioinformatics Microarray Analysis software (http://david.abcc.ncifcrf.gov/home.jsp, NIAID/NIH) to enrich for functionally related gene groups. After classification of these transcripts into functional pathways, we found that merlin re-expression results in increased expression of transcripts that activates Hippo signaling pathway as well as increased expression of molecules that inhibit Wnt signaling pathway and decreased expression of transcripts that activate Wnt and HGF/c-Met and pleiotrophin (PTN)/Anaplastic lymphoma kinase (ALK) signaling pathways (
To establish the common changes in the expression profiles induced by merlin among different tumor types, the effect of merlin on human melanoma growth was investigated. It was determined that merlin expression is down-regulated in human melanoma cell lines and that increased expression of wt merlin significantly inhibits subcutaneous growth of WM793 human melanoma cells in vivo (data not shown). Further assessment of the transcript profiles of WM793wt and WM793merlin cells demonstrated that increased expression of merlin significantly up-regulates 697 genes, many of which display anti-tumor properties, and down-regulates 736 genes, many of which display pro-tumor activity (data not shown). These significantly up- and down-regulated genes were imported to David Functional Annotation Bioinformatics Microarray Analysis software to enrich functional-related genes and generate the signaling pathways that are significantly affected by increased expression of merlin. These outputted data were then compared with that derived from U87MG glioma cells and the common alterations induced by merlin were identified. Together, these data indicated that increased expression of merlin activates Hippo and inhibits Wnt and c-Met signaling pathways (
These merlin-induced changes of expression were then investigated at the functional level. Since canonical Wnt signaling regulates gene expression by modulating the levels of beta-catenin expression, a co-activator of the T-cell factor/lymphocyte enhancer factor (TCF/LEF) transcription factors, reporter assays using a beta-catenin-responsive luciferase reporter construct, TopFlash (Addgene), were performed. FopFlash, which contains mutated TCF/LEF binding sites, was used as a negative control. It was found that beta-catenin transcriptional activity is inhibited by wild-type merlin and merlinS518A, but not by merlinS518D (
A working model of CD44 and merlin-mediated signaling events and their potential cross-talk (the components of Drosophila Hippo signaling pathway are underlined): merlin functions upstream of the mammalian Hippo (merlin-MST1/2-LATS1/2-YAP) and JNK/p38 signaling pathways and plays an essential role in regulating the cell response to the stresses and stress-induced apoptosis as well as to proliferation/survival signals. Merlin antagonizes CD44 function and inhibits activities of RTKs and the RTK-derived growth and survival signals. CD44 function upstream of mammalian Hippo signaling pathway and enhances activities of RTKs
To determine whether antagonists of CD44 can be used to inhibit glioma progression in preclinical mouse models, several fusion proteins composed of the constant region of human IgG1 (Fc) (Holash et al., 2002; Kim et al., 2002; Sy et al., 1992) fused to the extracellular domain of CD44v3-v10, CD44v8-v10, CD44s, CD44v3-v10R41A, CD44v8-v10R41A, or CD44sR41A were developed (
Mutating R41 to A abolishes the ability of CD44 to bind to HA. The ability of the mutated CD44 to bind to all other ligands and CD44 sheddases, however, will likely be preserved, which is important because ligands other than HA and the CD44 sheddase are likely to be very important to exert the pro-tumor activity of CD44. While the loss of HA binding may reduce some activity of CD44R41A-Fc against certain cancers, this modification may improve the biodistribution and bioavailability.
The v3 exon of CD44 contains a Ser-Gly-Ser-Gly motif for covalent attachment of heparan sulfate (HS) side chains (Bennett et al., 1995). To assess whether hsCD44v3-v10-Fc proteins are modified by HS, purified hsCD44s-Fc, hsCD44v8-v10-Fc, and hsCD44v3-v10-Fc fusion proteins were treated with or without heparinase I/III before elution from protein A columns. These proteins were then coated on Elisa plates in triplicate. After blocking with BSA, the coated proteins were tested for reactivity with anti-HS antibody. The intensity of the reaction, as assessed by a colorimetric assay, was normalized by the reactivity with anti-CD44 antibody, which provides relative quantity of the coated fusion proteins on the plates. These results showed that only hsCD44v3-v10-Fc was modified by HS and stained positively with anti-HS antibody. The observed reactivity was sensitive to heparinase I/III treatment (
U87MG and U251 cells were transduced with retroviruses carrying the expression constructs encoding these CD44-Fc and CD44R41A-Fc fusion proteins or empty expression vector. Pooled puromycin resistance cells expressed high levels of hsCD44v3-v10-Fc, hsCD44v8-v10-Fc, hsCD44s-Fc, hsCD44v3-v10R41A-Fc, hsCD44v8-v10R41A-Fc, hsCD44sR41A-Fc fusion proteins (FIG. 11A,
CD44 has multiple ligands including HA, osteopontin, heparin binding growth factors, fibronectin, serglycin, laminin, MMP-9, and fibrin (Bennett et al., 1995; Ponta et al., 2003; Stamenkovic, 2000; Stamenkovic and Yu, 2009; Toole, 2004) and cooperates with several RTKs and other cell surface receptors (Orian-Rousseau et al., 2002; Stamenkovic, 2000; Stamenkovic and Yu, 2009). Many of CD44 functions are mediated through its interaction with HA (Toole, 2004), which is abolished by the single R41A mutation (Peach et al., 1993). To determine whether the CD44-HA interaction alone is responsible for the GBM promoting activity of CD44, pooled populations of U87MG and U251 cells expressing hsCD44sR41A-Fc or hsCD44v3-v10R41A-Fc were generated and their anti-GBM effects were compared with that of their wild type counterparts. Unlike wild type CD44-Fc fusion proteins, CD44R41A-Fc proteins are incapable of inhibiting FL-HA binding to the GBM cells (
Finally, the anti-GBM efficacy of purified hsCD44s-Fc fusion proteins in pre-established intracranial gliomas resulting from injection of 5×105 U87MG or U251 cells into Rag-1 mice was assessed. Intracranial tumors were grown for 5 days before the mice were treated by intravenous injection of 0.9% NaCl containing 5 mg/kg human IgG or purified hsCD44s-Fc fusion proteins every third day until completion of the experiments. Systemic delivery of hsCD44s-Fc fusion proteins but not human IgG markedly inhibited intracranial growth of U87MG and U251 cells and significantly (p<0.001) extended median survival of the experimental mice (
As shown in
To determine whether CD44 antagonists, hsCD44s-Fc fusion proteins, sensitize the responses of GBM cells to chemotherapeutic agents and pharmacologic inhibitors of erbB and c-Met RTKs, glioma cell viability assays in the presence or absence of different concentrations of TMZ, inhibitors of erbB and c-Met RTKs with or without purified hsCD44s-Fc fusion proteins or human IgG were performed. The results showed that hsCD44s-Fc fusion proteins but not human IgG sensitize the response of U87MG cells to TMZ, a dual inhibitor of EGFR/erbB-2 (BIBW2992), a pan inhibitor of EGFR/erbB2/4 (CI-1033), and a c-Met inhibitor (PF-2341066, Selleck Chemicals Co.) (
Two important characteristics used to define good cancer therapy targets are high expression of the targets in tumor cells and low or absent expression in normal cells and increased dependency of tumor cells on the target functions. CD44 meets these criteria. To assess potential toxicity of CD44-Fc fusion proteins towards normal cells, cell viability assays using a panel of normal cells in the presence or absence of different amount of purified hsCD44s-Fc fusion proteins were performed. The results demonstrated that CD44-Fc fusion proteins displayed low toxicity towards normal human astrocytes (NHAs), Schwann cells, fibroblasts (HGF-1) and endothelial cells (HUVECs) comparing to U251 GBM cells (
Stem cells exhibit the characteristic of self-renewal. To determine the contribution of CD44 to the self-renewal capacity of glioma CSC spheres, primary human glioma spheres (HGSs) from fresh GBM tissues (CHTN) were established. Human GBMCSC spheres, MSSM-GBMCSC-1 and -2, derived from fresh GBM tissues have self-renewal capacity, express stem cell markers (Sox-2 and nestin), and can be readily transduced using retro- and lenti-viruses to express or to knock down expression of the genes of interests (
To determine the expression level of CD44 in colon cancer, ovarian cancer, head and neck squamous carcinoma, renal cell carcinoma, melanoma, gastric cancer, and esophageal cancer, available gene expression datasets at www.oncomine.org were mined. We found that CD44 transcripts were up regulated in human colon (
In addition, immunohistochemistry analysis of paraffin sections of primary human tumors showed that CD44 is up regulated in malignant/metastatic colon cancer (
To knock down endogenous CD44 expression in HCT116 and KM20L2 human colon cancer cells, PC3/M human prostate cancer cells, MX-2 and SW613 human breast cancer cells, NCI-H125 and NCI-H460 human lung cancer cells, and OVCAR-3 human ovarian cancer cells, a set of human CD44-specific TRC-shRNA (shRNA-TRC-CD44#1-#5) and shRNAmir (shRNAmir-CD44#1-#3) constructs (Open Biosystems) were screened. Non-targeting control shRNAs (shRNA-TRC-NT and shRNAmir-NT) were included in the screen as negative controls. Lenti-viruses containing these shRNA constructs were used to infect the cancer cells. Following selection of the infected cells with puromycin, the expression level of endogenous CD44 was assessed in pooled populations of puromycin-resistant cancer cells. At least two shRNAs effectively knocked down CD44 expression in these cancer cells as assessed by western blot analysis (
CD44 expression by three human prostate cancer cell lines was assessed. It was found that the most aggressive prostate cell line, PC3/M cell, expresses the highest level of CD44 (
To determine the role of CD44 in breast cancer progression and in maintenance of breast cancer stem cell (BCSC), CD44 protein and HA levels in human malignant breast cancer tissues (obtained from CHTN—at University of Pennsylvania) were measured. Compared to normal breast tissues (
Studies have shown that mammospheres are enriched for tumorigenic BCSCs (Al-Hajj et al., 2003; Reya et al., 2001). Three different preparations of primary mammospheres (MSSM-BCSC-1, -2, and -3) derived from fresh malignant human breast cancer tissues were established. These MSSM-BCSCs express high levels of the cancer stem cells marker, CD44, and low levels of CD24 (
To assess the effect of purified hsCD44-Fc fusion proteins on BCSC growth in vivo, 1×106 MSSM-BCSC-1 cells were injected subcutaneously into each Rag-1 mice. The tumors were allowed to growth for three weeks when the tumor volumes reach ˜200 mm3. The mice bearing similar size tumors were separated into 6 groups (6mice/group) and were treated with 4 intratumoral injections of 4 d/injection of 10 mg/ml of hsCD44s-Fc, hsCD44v8-v10-Fc, hsCD44v6-v10-Fc, hsCD44v3-v10-Fc, or human IgG, or 0.9% NaCl (
To determine the contribution of CD44 to the progression of human ovarian cancer, available datasets at www.oncomine.org were mined and it was found that the CD44 transcript is up-regulated in human ovarian cancer comparing to normal ovary (
A series of in vivo selections by intraperitoneal (ip) implantation of parental SKOV3 and OVCAR-3 cells into Rag-1 immunocompromised mice to establish ascites ovarian cancer models were performed. SKOV3ip and OVCAR-3ip cells derived from these selections form subcutaneous as well as ascites tumors in Rag-1 mice (
To determine the contribution of CD44 to the progression of human melanoma, available datasets at www.oncomine.org were mined and it was found that the CD44 transcript is up-regulated in human melanoma comparing to normal skin (
To assess the effects of expression of hsCD44-Fc fusion proteins on melanoma growth in vivo, 2×106 M14 cells expressing different CD44-Fc fusion proteins (hsCD44s-Fc, hsCD44v8-v10-Fc, or hsCD44v3-v10-Fc) or transduced with empty expression vectors were injected subcutaneously into each Rag-1 mice. Tumors were allowed to grow for ˜4 weeks. At the end of experiments, all the tumors were dissected out and weighted. Data is presented as the mean of tumor weight (gram)+/−SD. The results showed that CD44-Fc fusion proteins especially hsCD44v3-v10-Fc significantly inhibited growth of M14 melanoma cells in vivo (
To determine the contribution of CD44 to the progression of human head-neck cancer, available datasets at www.oncomine.org were mined and it was found that the CD44 transcript is up-regulated in human head-neck cancer comparing to their normal counterparts (
To assess the effects of expression of hsCD44-Fc fusion proteins on head-neck cancer cell growth in vivo, 5×106 SCC-4 cells expressing different CD44-Fc fusion proteins (hsCD44s-Fc, hsCD44v8-v10-Fc, or hsCD44v3-v10-Fc) or transduced with empty expression vectors were injected subcutaneously into each Rag-1 mice. Tumors were allowed to grow for ˜2 months. At the end of experiments, all the tumors were dissected out and weighted. Data is presented as the mean of tumor weight (gram)+/−SD. The results showed that CD44-Fc fusion proteins especially hsCD44v3-v10-Fc and hsCD44v8-v10-Fc significantly inhibited growth of SCC-4 cells in vivo (
CD44 expression in human pancreatic and liver carcinoma cells was assessed by Western blotting using anti-CD44 antibody (Santa Cruz). The results showed that BXPC-3, PAN-08-13, PAN-08-27, PAN-10-05 pancreatic cancer cells and SK-HEP-1 liver cancer cells expression several CD44 isoforms (
To assess the effects of expression of hsCD44-Fc fusion proteins on in vivo growth of pancreatic and liver cancer cells, 5×106 BXPC-3 and SK-HEP-1 cells expressing different CD44-Fc fusion proteins (hsCD44s-Fc, hsCD44v8-v10-Fc, or hsCD44v3-v10-Fc) or transduced with empty expression vectors were injected subcutaneously into each Rag-1 mice. Tumors were allowed to grow for ˜5 weeks. At the end of experiments, all the tumors were dissected out and weighted. Data is presented as the mean of tumor weight (gram)+/−SD. The results showed that CD44-Fc fusion proteins significantly inhibited in vivo growth of BXPC-3 and SK-HEP-1 (
Purified CD44-Fc fusion proteins (hsCD44s-Fc, hsCD44v8-v10-Fc, and hsCD44v3-v10-Fc) were labeled with biotin using EZ-Link Biotinylation Kits (Thermo Scientific) following the manufacturer's instruction. Human tumor paraffin sections were deparaffinized and rehydrated. After blocking with 2% BSA, the sections were incubated with biotinylated CD44-Fc fusion proteins (bCD44-Fc, 1 μg/ml) for overnight at 4 degree. Biotinylated CD44-Fc fusion proteins were detected by VECTASTAIN ABC kit. Our results showed that HA is up-regulated in stroma of malignant breast cancer and metastatic ovarian cancer (
It has been well established that HA is up-regulated in many cancer types including breast, ovarian, gladder cancer, and prostate cancers [for review see (Simpson and Lokeshwar, 2008; Tammi et al., 2008; Toole, 2004)](Golshani et al., 2008). HA level is correlated to tumor progression and metastasis (Toole and Hascall, 2002). Increased HA correlates with poor prognosis, disease progression, and shortened overall and disease specific survival in gastrointestinal tract, breast and ovary carcinoma (Anttila et al., 2000; Tammi et al., 2008). A study has shown that urinary HA measurement is an accurate marker for diagnosing bladder cancer (Lokeshwar et al., 2000).
To detect plasma HA level, 200 μl blood from each transgenic mice (MMTV-PyVT and MMTV-ActErbb2, Jackson Lab) bearing breast cancer, each Rag-1 mice bearing gliomas derived from MSSM-GBMCSC-1 or Glioma 261 cells, or each control health mice were collected. Blood samples from six mouse of each type were collected and plasmas were generated immediately. 50 μl plasma from each sample was loaded in triplicate into each well of an Elisa plate that has been pre-coated with CD44-Fc fusion proteins. The CD44-Fc bound HA was detected by biotinylated CD44-Fc fusion proteins and AP-conjugated avidin. The developed color was measure by an Elisa machine at 405 nm. The results showed that HA is up-regulated in the plasma samples derived from mice bearing tumors when compared to the health mice (FIG. 44), demonstrating biotinylated CD44-Fc fusion proteins can be used to detect HA levels in plasma, serum, and urine of cancer patients and serve as diagnostic and prognostic reagent.
The first-line and second-line cytotoxic drugs for prostate cancer are docetaxel, mitoxantrone, satraplatin, and ixabepilone. Mice will be injected subcutaneously with PC3/M-Luc and 22Rv1-Luc cells, depleted or not of endogenous CD44, and will be treated sequentially with docetaxel or mitoxantrone.
To determine whether antagonists of CD44 can be used to inhibit progression of a variety of human cancers in preclinical mouse models, soluble CD44 fusion proteins, such as CD44v3-v10-Fc, CD44v6-v10-Fc, CD44v8-v10-Fc, CD44v6-v10-Fc, or CD44s will be tested in different cancer mouse models.
These CD44-Fc fusion cDNAs have been inserted into retroviral vectors (Clontech) that contain the IRES element positioned between the cDNA inserts and the puromycin-resistance gene, so that all the puromycin-resistant cells are expected to express the inserted fusion genes. Human cancer cells, MEWO and A375 human melanoma cells; Lovo human colon cancer cells; Panc-1, HPAC, MIA PaCa-2, and/or AsPC-1 human pancreatic cancer cells; Hep 3B2.1-7 human hepatoma cells; SCC, -9, -15, and/or -25, human head and neck squamous carcinoma cells; U266 and MC/CAR human multiple myeloma cells; SKOV3ip and OVCAR -3ip human ovarian cancer cells; and 22Rv1 human prostate cancer cells; A549, LX529, NCI-H460, and/or NCI-H125 human lung cancer cells; MX-2 and/or SW613 human breast cancer cells; SKN-MC and A673 human sarcoma; H-MESO-1, H-MESO-1A, or MSTO-211H human malignant mesothelioma cells; and/or human cancer stem cells of different origins, will be transduced with retroviruses carrying the expression constructs encoding these fusion proteins or empty expression vector. After selection of the infected cells with puromycin, the pooled drug-resistant cancer cells will express high levels of CD44 fusion proteins, such as hsCD44v3-v10-Fc, hsCD44v6-v10-Fc, hsCD44v8-v10-Fc, and hsCD44s-Fc. These cells will be used to assess their ability to grow in Rag-1 mice and their response to chemotherapy and other targeted therapies.
Additional in vitro tumor cell viability experiments will be performed using CD44 depletion and/or hsCD44-Fc fusion proteins alone or in combination with the chemotherapeutic agent/RTK inhibitors/IAP inhibitors/p53 activator to determine whether CD44 antagonists sensitize the response of a variety of tumor cells to chemotherapy and other targeted therapies.
In summary, the present Examples and figures demonstrate that CD44 is up-regulated in several human cancer types including human glioblastoma, colon cancer, ovarian cancer, head and neck squamous carcinoma, renal cell carcinoma, breast cancer, prostate cancer, gastric cancer, melanoma, and esophageal cancer. CD44 antagonists including shRNAs against human CD44 and/or a variety of CD44-Fc fusion proteins inhibit in vivo growth of human glioblastoma, colon, breast, prostate, lung, melanoma, pancreatic cancer, liver cancer, head and neck carcinoma, pancreatic, and ovarian cancers in mouse models. Moreover, the Examples demonstrate that CD44 is upregulated in human GBM and that knockdown of CD44 inhibits GBM growth in vivo by inhibiting glioma cell proliferation and promoting apoptosis. In addition, the Examples show for the first time that depletion of CD44 or CD44-Fc fusion proteins sensitizes GBM cells to chemotherapeutic and targeted agents in vivo, rendering it an attractive therapeutic target for gliomas, colon, breast, prostate, lung, melanoma, pancreatic cancer, liver cancer, head and neck carcinoma, and ovarian cancers. CD44 antagonists, in the form of human soluble CD44-Fc fusion proteins, such as hsCD44s-Fc, hsCD44v6-v10-Fc, hsCD44v8-v10-Fc, or hsCD44v3-v10-FC, and CD44-specific shRNAs proved to be effective therapeutic agents in inhibiting growth of human glioblastoma, colon, breast, prostate, lung, melanoma, pancreatic cancer, liver cancer, head and neck carcinoma, and ovarian cancers in mouse models. shRNAs of CD44 can also be used as gene therapy and delivered by nanoparticles.
The present Examples demonstrate for the first time that CD44 functions upstream of mammalian Hippo stress and apoptotic signaling pathway (merlin-MST1/2-Lats1/2-YAP-cIAP1/2) and of two other downstream stress kinases, JNK and/or p38, along with their effectors, p53, and caspases (
These Examples show that depletion of CD44 inhibits Erk1/2 activation induced by EGFR ligands and HGF but not by NGF or FBS (
CD44 antagonists, hsCD44-Fc fusion proteins, and in particular hsCD44s-Fc, hsCD44v8-v10-Fc, or hsCD44v3-v10-Fc constructs, displayed potent activity against GBM, breast cancer, prostate cancer, melanoma, head-neck cancer, liver cancer, and pancreatic cancer in mouse models and inhibited self-renewal of breast and ovarian cancer stem cells, which offers hope for eradicating these deadly cancers in the future. Human sCD44-Fc fusion proteins may not only interfere with the function of CD44 expressed by GBM cells and other cancer cells but also with that expressed by host cells infiltrated the tumors. These host cells likely provide an essential contribution to progression of these cancer types similar to types of the effects of other molecules on cancers (Budhu et al., 2006; Orimo et al., 2005).
Currently available first line treatment options for human GBM are chemo- and radiation therapy, although both are largely palliative (Chamberlain, 2006). Effective treatments for malignant melanoma, lung cancer, and pancreatic cancer are almost not existed. There is also lack of effective treatment for liver cancer, head-neck cancer, late stage colon cancer, late stage/drug-resistant breast and prostate cancer. One hope for a better clinical outcome is to identify targets that play essential roles in mediating the microenvironment-derived survival signal and drug-resistance and that their antagonists can sensitize responses of these tumor cells to radiation, chemotherapeutic and targeted drugs. The Examples show that CD44 plays an important role in protecting cancer cells from oxidative and cytotoxic stress-induced apoptotic signaling while enhancing RTK signaling suggesting that CD44 may serve as an ideal therapeutic target to sensitize malignant glioma and other types of cancer cells to radiation, chemotherapy, and targeted therapies.
These Examples and Figures indicated that CD44 is a prime target for a variety of human cancer types including but not limited to human glioblastoma, colon cancer, breast cancer, prostate cancer, lung cancer, melanoma, head-neck cancer, liver cancer, pancreatic cancer, and ovarian cancer that CD44 antagonists including CD44-Fc fusion proteins and shRNAs are potent anti-cancer agents when used as single agents and in combinations with chemo- and/or radiation therapy, and the targeted therapies against erbB receptors, c-Met, IAPs, and activating p53. These Examples and Figures also demonstrate that CD44-Fc fusion proteins sensitize cancer cells to such cytotoxic agents such as chemo- and/or radiation therapies. Therefore, these fusion proteins are particularly amenable to being combined with such agents that will induce and/or promote stresses in tumor cells.
These Examples and Figures also show that these CD44-Fc fusion proteins bind specifically to HA and therefore can be used to detect HA in tissues section and in body fluids (blood, plasma, serum, and urine) for example in cancerous tissue. As a result, these fusion proteins can be used to diagnose cancers in which HA levels are elevated, which may lead to earlier detection of cancer then currently available methods and save lives. These fusion proteins can also be used to detect elevated HA levels, which will valuable in prognosis and early assessments of efficacy of therapeutic treatments, likely leading to more effective personalized treatment plans that increase overall survival of patients. The level of CD44 in these tumor samples and body fluid samples can be assessed in conjunction with HA levels to achieve more accurate predictions. Measuring HA and CD44 levels can be done using standard immunological techniques and detection methods.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
It is further to be understood that all values are approximate, and are provided for description.
Patents, patent applications, publications, product descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.
This application claims priority to U.S. provisional application Ser. No. 61/274,813, filed Aug. 21, 2009, which is herein incorporated by reference in its entirety.
The United States Government has certain rights to this invention by virtue of funding received from the Department of Defense, Army Medical Research, Grant No. W81XWH-06-1-0246 and National Institute of Health, National Cancer Institute Research, Grant No. R01CA135158-01A1.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/US10/45635 | 8/16/2010 | WO | 00 | 5/7/2012 |
| Number | Date | Country | |
|---|---|---|---|
| 61274813 | Aug 2009 | US |
