Mitochondrial DNA polymorphisms

Abstract

Compositions and methods based on determination of single nucleotide polymorphisms in mtDNA or homoplasmic mtDNA mutations are provided that are useful for detecting the presence or risk of diseases, determining the haplogroup of an individual, and establishing genetic relationships between individuals for genealogical and forensic purposes.

Description

[0002] The Sequence Listing associated with this application is provided on CD-ROM in lieu of a paper copy, and is hereby incorporated by reference into the specification. Three CD-ROMs are provided, containing identical copies of the sequence listing: CD-ROM No. 1 is labeled COPY 1, contains the file 461.app.txt which is 11.3 MB and created on Nov. 25, 2002; CD-ROM No.2 is labeled COPY 2, contains the file 461.app.txt which is 11.3 MB and created on Nov. 25, 2002; CD-ROM No. 3 is labeled CRF, contains the file 461.app.txt which is 11.3 MB and created on Nov. 25, 2002.

TECHNICAL FIELD

[0003] The present invention relates generally to mitochondrial DNA polymorphisms and, more specifically, to compositions and methods based upon the identification of mitochondrial DNA polymorphisms for use in disease diagnosis, prognosis and treatment; patient and population profiling; pharmacogenomics; phylogenetic and population genetic analysis; genealogy; forensics and paternity testing; and related areas.

BACKGROUND OF THE INVENTION

[0004] Mitochondria are the subcellular organelles that manufacture bioenergetically essential adenosine triphosphate (ATP) by oxidative phosphorylation. Functional mitochondria contain gene products encoded by mitochondrial genes situated in mitochondrial DNA (mtDNA) and by extramitochondrial genes not situated in the circular mitochondrial genome. The 16.5 kb mtDNA encodes 22 tRNAs, two ribosomal RNAs (12s and 16s rRNA) and only 13 enzymes of the electron transport chain (ETC), the elaborate multi-subunit complex mitochondrial assembly where, for example, respiratory oxidative phosphorylation takes place. (See, e.g., Wallace et al., in Mitochondria & Free Radicals in Neurodegenerative Diseases, M. F. Beal, N. Howell and I. Bodis-Wollner, eds., 1997 Wiley-Liss, Inc., New York, pp. 283-307, and references cited therein; see also, e.g., Scheffler, I. E., Mitochondria, 1999 Wiley-Liss, Inc., New York.) More than 5000 copies of the mitochondrial genome may be present within a single cell, due to the presence of numerous mitochondria within a single cell, and of multiple copies of mtDNA within each mitochondrion. Furthermore, since mitochondrial DNA is strictly maternally inherited, all copies of mitochondrial DNA within an individual are generally monoclonal. Finally, certain regions of mtDNA are highly polymorphic. Mitochondrial DNA includes gene sequences encoding a number of ETC components, including seven subunits of NADH dehydrogenase, also known as ETC Complex I (ND1, ND2, ND3, ND4, ND4L, ND5 and ND6); one subunit of Complex III (ubiquinol: cytochrome c oxidoreductase, Cytb); three cytochrome c oxidase (Complex IV) subunits (COX1, COX2 and COX3); and two proton-translocating ATP synthase (Complex V) subunits (ATPase6 and ATPase8).

[0005] The first complete sequence of a human mitochondrial DNA (mtDNA), also referred to as the Cambridge reference sequence (CRS), was originally published in 1981 and was more recently revised (Anderson, S. et al., Nature 290:457-465, 1981; Andrews, R. M. et al., Nature Genetics 23:147, 1999). The mtDNA is strictly maternally inherited and has a mutation rate ten times that of nuclear DNA, with certain regions exhibiting notably high degrees of polymorphism. During human evolution and subsequent colonization of the continents by human subpopulations, the genealogic pattern of mtDNA inheritance indicates divergence of distinct maternal lineages, which are observed to harbor population-specific mtDNA polymorphisms. Thus, nine different European mtDNA haplogroups (e.g., discrete constellations of homoplasmic mtDNA polymorphisms that are highly conserved among members of a common maternal lineage as well as distinct Asian, Native American and African mtDNA haplogroups, have been described on the basis of the presence or absence in mtDNA of one or several restriction endonuclease recognition sites (described in Wallace et al., Gene 238:211-230, 1999; Torroni, A. et al., Genetics 144:1835-1850, 1996).

[0006] A number of degenerative diseases are thought to be caused by, or are associated with, alterations in mitochondrial function. These diseases include Alzheimer's Disease, diabetes mellitus, Parkinson's Disease, Huntington's disease, dystonia, Leber's hereditary optic neuropathy, schizophrenia, and myodegenerative disorders such as “mitochondrial encephalopathy, lactic acidosis, and stroke” (MELAS), and “myoclonic epilepsy ragged red fiber syndrome” (MERRF). Other diseases involving altered metabolism or respiration within cells may also be regarded as diseases associated with altered mitochondrial function. The extensive list of additional diseases associated with altered mitochondrial function continues to expand as aberrant mitochondrial or mitonuclear activities are implicated in particular disease processes.

[0007] There is evidence to suggest that the genetic basis of at least some diseases associated with altered mitochondrial function resides in mitochondrial DNA rather than in extramitochondrial DNA such as that found in the nucleus (e.g., nuclear chromosomal and extrachromosomal DNA). For example, noninsulin dependent diabetes mellitus (NIDDM) exhibits a predominantly maternal pattern of inheritance, and in at least some cases this disease appears to be associated with a mitochondrial DNA (mtDNA) abnormality not found in the CRS or the revised CRS. Thus, for instance, approximately 1.5% of all diabetic individuals harbor a mutation at mtDNA position 3243 in the mitochondrial gene encoding leucyl-tRNA (tRNALeu). This mutation is known as the MELAS (mitochondrial encephalopathy, lactic acidosis and stroke) mutation. (Gerbitz et al., Biochim. Biophys. Acta 1271:253-260, 1995.) Similar theories have been advanced for analogous relationships between mtDNA mutations and other diseases associated with altered mitochondrial function, including but not limited to Alzheimer's Disease (AD), Huntington's Disease (HD), Parkinson's Disease (PD), dystonia, Leber's hereditary optic neuropathy (LHON), schizophrenia, and myoclonic epilepsy ragged red fiber syndrome (MERRF) (See, e.g., Chinnery et al., 1999 J. Med. Genet. 36:425). In addition, a limited number of specific single nucleotide polymorphisms that correlate with Alzheimer's disease or with type 2 diabetes mellitus have been identified (see U.S. patent application Ser. No. 09/551,941; see also co-pending application serial No. 60/333,448). Certain somatic mtDNA sequence changes have also been detected in tissues from colorectal cancer (Polyack et al., (1998) Nature Genetics 20:291-293) and in lung, bladder, and head and neck tumors (Fliss et al., (1999) Science 287:2017-2019). The identification of additional mtDNA mutations associated with diseases may provide targets for the development of diagnostic and/or therapeutic agents.

[0008] As is well known in the art generally, and especially with regard to extramitochondrial DNA such as nuclear chromosomal and/or extrachromosomal DNA, direct (e.g., by nucleotide sequencers) or indirect (e.g., by RFLP, SSCP, etc.) determination of DNA sequence variations in individuals and in populations has been used for a wide range of purposes. For example, identification of variability at specific marker loci is useful in a wide range of genetic studies (e.g., genetic counseling, diagnosis of inherited disorders and/or of cancer, pharmacogenetics, etc.), in commercial breeding, in genotyping of samples (e.g., for transplantation, transfusion, cell or tissue grafting, etc.), forensic analysis, paternity testing and the like.

[0009] Currently available DNA-based identification technology makes use of a variety of DNA fingerprinting techniques (for a discussion of common procedures, see Murch, R. S. and Budowle, B., (1997) Are Developments in Forensic Applications ofDNA Technology Consistent with Privacy Protection? in Genetic Secrets: Protecting Privacy and Confidentiality in the Genetic Era (ed. Mark A. Rothstein), Yale University Press, New Haven, Conn.). DNA fingerprinting includes a variety of methods for assessing sequence differences in DNA isolated from various sources, e.g., by comparing the presence of marker DNA in samples of isolated DNA. Typically, DNA fingerprinting is used to analyze and compare DNA from different species of organisms, or from different individuals of the same species. Many technologies have been used in DNA fingerprinting, including, inter alia, restriction fragment length polymorphism (RFLP; e.g., Bostein et al. (1980) Am. J. Hum. Genet. 32:314-331), single strand conformation polymorphism (SSCP; Fischer et al. (1983) Proc. Natl. Acad. Sci. USA 80:1579-1583; Orita et al. (1989) Genomics 5:874-879), amplified fragment-length polymorphism (AFLP; Vos et al. (1995) Nucleic Acids Res. 23:4407-4414), microsatellite or single-sequence repeat analysis (SSR; Weber J L and May P E (1989) Am. J. Hum. Genet. 44:388-396), rapid-amplified polymorphic DNA analysis (RAPD; Williams et al. (1990) Nucleic Acids Res. 18:6531-6535), sequence tagged site analysis (STS; Olson et al. (1989) Science 245:1434-1435), genetic-bit analysis (GBA; Nikiforov et al. (1994) Nucleic Acids Res 22:4167-4175), allele-specific polymerase chain reaction (ASPCR; Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448; Newton et al. (1989) Nucleic Acids Res. 17:2503-2516), nick-translation PCR (e.g., TaqMan™; Lee et al. (1993) Nucleic Acids Res. 21:3761-3766), and allele-specific hybridization (ASH; Wallace et al. (1979) Nucleic Acids Res. 6:3543-3557; Sheldon et al. (1993) Clinical Chemistry 39(4):718-719) among others.

[0010] According to certain commonly used methods of DNA fingerprinting, variable number tandem repeat (VNTR) regions within genomic DNA are genetically characterized by restriction fragment length polymorphisms (RFLP) analysis. Alternative approaches, for example, those that are generally based upon use of the polymerase chain reaction (PCR), include dot-blot assays, electrophoretic analysis and direct nucleic acid sequencing. By such methods, a variety of genomic DNA sequence polymorphisms can be analyzed, including, for example, polymorphisms in HLA-DQA1 (or other loci of the highly polymorphic major histocompatibility complex (MHC)), low-density lipoprotein receptor (LDL-R), glycophorin A, hemoglobin G gammaglobin, D7S8 and other group-specific components.

[0011] When such techniques are directed to analysis of nuclear (e.g., chromosomal) DNA, however, certain limitations become apparent, including, for instance, (1) the availability of only a limited amount of sample material because there are only two copies of each gene per cell, and (2) the presence in a sample of two different nucleotide sequences at a particular genetic locus where the subject is heterozygous at that locus (e.g., by having inherited different allelic forms of the gene from each parent). Given the devastating consequences of human diseases such as, for example, Alzheimer's disease and type 2 diabetes mellitus, clearly there is a need to develop improved compositions and methods for identifying the presence of, or risk for having, such diseases in individuals. In addition, there is a clear need in the art to develop more sensitive and reliable compositions and methods for use in forensics and in other applications requiring the identification of individuals and/or their genetic relationships to others. The present invention addresses these needs by providing compositions and methods that employ mtDNA as a source of genetic markers for diagnostic, prognostic, pharmacogenetic, evolutionary, forensic and/or genealogic analyses, and offers other related advantages.

SUMMARY OF THE INVENTION

[0012] The present invention is directed in part to compositions and methods that relate to identification of mitochondrial DNA polymorphisms. Accordingly, it is an aspect of the invention to provide a method for determining the mitochondrial haplogroup of a subject, comprising determining, in a biological sample comprising mitochondrial DNA from a subject, the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup. In certain embodiments the mitochondrial DNA is amplified. In certain other embodiments, at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is present in a mitochondrial DNA region that is a D-loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene or a mitochondrial cytochrome b gene.

[0013] In certain other embodiments at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is a haplogroup-specific polymorphism or a haplogroup-associated polymorphism, wherein a mitochondrial single nucleotide polymorphism that is haplogroup-specific is, for A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W or X, located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from:

Nucleotide
Position	GENE	HAPLOGROUP
64	D-LOOP	A
235	D-LOOP	A
663	12S rRNA	A
1598	12S rRNA	A
1736	16S rRNA	A
3316	ND1	A
4248	ND1	A
4824	ND2	A
4970	ND2	A
6308	COI	A
7112	COI	A
7724	COII	A
8794	ATPase6	A
11314	ND4	A
12468	ND5	A
12811	ND5	A
13855	ND5	A
14364	ND6	A
16111	D-LOOP	A
16290	D-LOOP	A
16319	D-LOOP	A
827	12S rRNA	B
3547	ND1	B
4820	ND2	B
4977	ND2	B
6023	COI	B
6216	COI	B
6413	COI	B
6473	COI	B
6755	COI	B
7241	COI	B
9950	COIII	B
11177	ND4	B
15535	CYT B	B
16217	D-LOOP	B
249	D-LOOP	C
289	D-LOOP	C
290	D-LOOP	C
3552	ND1	C
4715	ND2	C
7196	COI	C
7694	COII	C
8584	ATPase6	C
9545	COII	C
10454	tRNA-R	C
12642	ND5	C
12978	ND5	C
14318	ND6	C
15487	CYT B	C
15930	tRNA-T	C
2092	16S rRNA	D
4883	ND2	D
5178	ND2	D
8414	ATPase8	D
11593	ND4	D
14668	ND6	D
3027	16S rRNA	E
3705	ND1	E
4491	ND2	E
7598	COII	E
239	D-LOOP	H
456	D-LOOP	H
477	D-LOOP	H
951	12S rRNA	H
961	12S rRNA	H
3277	tRNA-L	H
3333	ND1	H
3591	ND1	H
3796	ND1	H
3915	ND1	H
3992	ND1	H
4024	ND1	H
4310	tRNA-I	H
4336	tRNA-Q	H
4531	ND2	H
4727	ND2	H
4745	ND2	H
4772	ND2	H
4793	ND2	H
5004	ND2	H
6365	COI	H
6776	COI	H
6869	COI	H
7013	COI	H
8269	COII	H
8448	ATPase8	H
8602	ATPase6	H
8803	ATPase6	H
8839	ATPase6	H
8843	ATPase6	H
8898	ATPase6	H
9123	ATPase6	H
9150	ATPase6	H
9380	COIII	H
9804	COIII	H
10044	tRNA-G	H
11353	ND4	H
11560	ND4	H
12579	ND5	H
13404	ND5	H
13680	ND5	H
13759	ND5	H
14125	ND5	H
14350	ND6	H
14365	ND6	H
14470	ND6	H
14582	ND6	H
14872	CYT B	H
15466	CYT B	H
15789	CYT B	H
15808	CYT B	H
15833	CYT B	H
16162	D-LOOP	H
16293	D-LOOP	H
199	D-LOOP	I
250	D-LOOP	I
3447	ND1	I
3990	ND1	I
4529	ND2	I
6734	COI	I
8616	ATPase6	I
9947	COIII	I
10034	tRNA-G	I
10238	ND3	I
11065	ND4	I
12501	ND5	I
13780	ND5	I
15758	CYT B	I
16391	D-LOOP	I
228	D-LOOP	J
295	D-LOOP	J
462	D-LOOP	J
2158	16S rRNA	J
2387	16S rRNA	J
3394	ND1	J
5198	ND2	J
5633	tRNA-A	J
6464	COI	J
6554	COI	J
6671	COI	J
7476	tRNA-S	J
7711	COII	J
10084	ND3	J
10172	ND3	J
10192	ND3	J
10499	ND4L	J
10598	ND4L	J
10685	ND4L	J
11377	ND4	J
12127	ND4	J
12570	ND5	J
12612	ND5	J
13281	ND5	J
13681	ND5	J
13879	ND5	J
13933	ND5	J
14569	ND6	J
15679	CYT B	J
15812	CYT B	J
16069	D-LOOP	J
16092	D-LOOP	J
16261	D-LOOP	J
114	D-LOOP	K
497	D-LOOP	K
593	tRNA-F	K
1189	12S rRNA	K
2217	16S rRNA	K
2483	16S rRNA	K
3480	ND1	K
4295	tRNA-I	K
4561	ND2	K
5814	tRNA-C	K
6260	COI	K
9006	ATPase6	K
9055	ATPase6	K
9698	COIII	K
9716	COIII	K
9962	COIII	K
10289	ND3	K
10550	ND4L	K
10978	ND4	K
11299	ND4	K
11470	ND4	K
11485	ND4	K
11840	ND4	K
11869	ND4	K
11923	ND4	K
12954	ND5	K
13135	ND5	K
13740	ND5	K
13967	ND5	K
14002	ND5	K
14037	ND5	K
14040	ND5	K
14167	ND6	K
15884	CYT B	K
15946	tRNA-T	K
16224	D-LOOP	K
16234	D-LOOP	K
16463	D-LOOP	K
185	D-LOOP	L1
186	D-LOOP	L1
189	D-LOOP	L1
236	D-LOOP	L1
247	D-LOOP	L1
297	D-LOOP	L1
357	D-LOOP	L1
710	12S rRNA	L1
825	12S rRNA	L1
1048	12S rRNA	L1
1738	16S rRNA	L1
2245	16S rRNA	L1
2395	16S rRNA	L1
2758	16S rRNA	L1
2768	16S rRNA	L1
2885	16S rRNA	L1
3308	ND1	L1
3516	ND1	L1
3666	ND1	L1
3693	ND1	L1
3777	ND1	L1
3796	ND1	L1
3843	ND1	L1
4312	tRNA-I	L1
4586	ND2	L1
5036	ND2	L1
5393	ND2	L1
5442	ND2	L1
5603	tRNA-A	L1
5655	tRNA-A	L1
5913	COI	L1
5951	COI	L1
6071	COI	L1
6150	COI	L1
6185	COI	L1
6253	COI	L1
6548	COI	L1
6827	COI	L1
6989	COI	L1
7055	COI	L1
7076	COI	L1
7146	COI	L1
7337	COI	L1
7389	COI	L1
7867	COII	L1
8248	COII	L1
8428	ATPase8	L1
8655	ATPase6	L1
8784	ATPase6	L1
8877	ATPase6	L1
9042	ATPase6	L1
9072	ATPase6	L1
9347	COIII	L1
9755	COIII	L1
9818	COIII	L1
10321	ND3	L1
10586	ND4L	L1
10589	ND4L	L1
10664	ND4L	L1
10688	ND4L	L1
10792	ND4	L1
10793	ND4	L1
10810	ND4	L1
11176	ND4	L1
11641	ND4	L1
11654	ND4	L1
11899	ND4	L1
12007	ND4	L1
12049	ND4	L1
12519	ND5	L1
12720	ND5	L1
12810	ND5	L1
13149	ND5	L1
13276	ND5	L1
13485	ND5	L1
13506	ND5	L1
13789	ND5	L1
13880	ND5	L1
13980	ND5	L1
14000	ND5	L1
14148	ND5	L1
14178	ND6	L1
14203	ND6	L1
14308	ND6	L1
14560	ND6	L1
14769	CYT B	L1
14911	CYT B	L1
15115	CYT B	L1
15136	CYT B	L1
16148	D-LOOP	L1
16187	D-LOOP	L1
16188	D-LOOP	L1
16230	D-LOOP	L1
16264	D-LOOP	L1
16265	D-LOOP	L1
16360	D-LOOP	L1
16527	D-LOOP	L1
143	D-LOOP	L2
1442	12S rRNA	L2
1706	16S rRNA	L2
2332	16S rRNA	L2
2358	16S rRNA	L2
2416	16S rRNA	L2
2789	16S rRNA	L2
3495	ND1	L2
3918	ND1	L2
4158	ND1	L2
4185	ND1	L2
4370	tRNA-Q	L2
4767	ND2	L2
5027	ND2	L2
5285	ND2	L2
5331	ND2	L2
5581	tRNA-W	L2
5744	NON-CODING	L2
6713	COI	L2
7175	COI	L2
7274	COI	L2
7624	COII	L2
7771	COII	L2
8080	COII	L2
8206	COII	L2
8387	ATPase8	L2
8541	ATPase8	L2
8790	ATPase6	L2
8925	ATPase6	L2
9221	COIII	L2
10115	ND3	L2
11944	ND4	L2
12236	tRNA-S	L2
12630	ND5	L2
12693	ND5	L2
12948	ND5	L2
13803	ND5	L2
14059	ND5	L2
14544	ND6	L2
14566	ND6	L2
14599	ND6	L2
15110	CYT B	L2
15217	CYT B	L2
15229	CYT B	L2
15236	CYT B	L2
15244	CYT B	L2
15391	CYT B	L2
15629	CYT B	L2
15945	tRNA-T	L2
16114	D-LOOP	L2
16213	D-LOOP	L2
16309	D-LOOP	L2
16390	D-LOOP	L2
200	D-LOOP	L3
2000	16S rRNA	L3
3438	ND1	L3
3450	ND1	L3
5773	tRNA-C	L3
6524	COI	L3
6587	COI	L3
6680	COI	L3
7424	COI	L3
7618	COII	L3
8616	ATPase6	L3
8618	ATPase6	L3
8650	ATPase6	L3
9554	COIII	L3
10086	ND3	L3
10373	ND3	L3
10667	ND4L	L3
10819	ND4	L3
11800	ND4	L3
13101	ND5	L3
13886	ND5	L3
13914	ND5	L3
14152	ND6	L3
14212	ND6	L3
14284	ND6	L3
15099	CYT B	L3
15311	CYT B	L3
15670	CYT B	L3
15824	CYT B	L3
15942	tRNA-T	L3
15944	tRNA-T	L3
16124	D-LOOP	L3
16327	D-LOOP	L3
930	12S rRNA	T
2141	16S rRNA	T
2850	16S rRNA	T
4688	ND2	T
4917	ND2	T
5277	ND2	T
6489	COI	T
7022	COI	T
8572	ATPase6	T
8697	ATPase6	T
9117	ATPase6	T
9899	COIII	T
10463	tRNA-R	T
11242	ND4	T
11812	ND4	T
12633	ND5	T
13368	ND5	T
13758	ND5	T
13965	ND5	T
14233	ND6	T
14687	tRNA-E	T
14905	CYT B	T
15028	CYT B	T
15274	CYT B	T
15607	CYT B	T
15928	tRNA-T	T
16163	D-LOOP	T
16182	D-LOOP	T
16186	D-LOOP	T
16294	D-LOOP	T
16296	D-LOOP	T
16324	D-LOOP	T
988	12S rRNA	U
1700	16S rRNA	U
1721	16S rRNA	U
2294	16S rRNA	U
3116	16S rRNA	U
3197	16S rRNA	U
3348	ND1	U
3720	ND1	U
3849	ND1	U
4553	ND2	U
4646	ND2	U
4703	ND2	U
4732	ND2	U
4811	ND2	U
5319	ND2	U
5390	ND2	U
5495	ND2	U
5656	NON-CODING	U
5999	COI	U
6045	COI	U
6047	COI	U
6146	COI	U
6518	COI	U
6629	COI	U
6719	COI	U
7109	COI	U
7385	COI	U
7768	COII	U
7805	COII	U
8473	ATPase8	U
9070	ATPase6	U
9266	COIII	U
9477	COIII	U
9667	COIII	U
10506	ND4L	U
10876	ND4	U
10907	ND4	U
10927	ND4	U
11197	ND4	U
11332	ND4	U
11732	ND4	U
12346	ND5	U
12557	ND5	U
12618	ND5	U
13020	ND5	U
13617	ND5	U
13637	ND5	U
14139	ND5	U
14179	ND6	U
14182	ND6	U
14620	ND6	U
14793	CYT B	U
14866	CYT B	U
15191	CYT B	U
15218	CYT B	U
15454	CYT B	U
15693	CYT B	U
15907	tRNA-T	U
16051	D-LOOP	U
16256	D-LOOP	U
16270	D-LOOP	U
16399	D-LOOP	U
4580	ND2	V
15904	tRNA-T	V
194	D-LOOP	W
1243	12S rRNA	W
1406	12S rRNA	W
3505	ND1	W
6528	COI	W
8994	ATPase6	W
10097	ND3	W
11674	ND4	W
11947	ND4	W
12414	ND5	W
13263	ND5	W
15775	CYT B	W
15884	CYT B	W
16292	D-LOOP	W
225	D-LOOP	X
226	D-LOOP	X
6371	COI	X
8393	ATPase8	X
8705	ATPase6	X
14470	ND6	X
15927	tRNA-T	X
−73	D-LOOP	not present
		in [H]
−7028	COI	not present
		in [H]
−11698	ND4	not present
		in [H]
and 14766,	CYT B	not present
		in [H]

[0014] and wherein a mitochondrial single nucleotide polymorphism that is haplogroup-associated is, for haplogroup A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, W or X, located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from:

Nucleotide
Position	Gene	Haplogroup
16362	D-LOOP	A, C, D, E,
		H, L3
12705	ND5	A, C, D, E,
		I, L1, L2,
		L3, W, X
1888	16S rRNA	A, C, T
13708	ND5	A, J, X
8027	COII	A, L1
153	D-LOOP	A, X
207	D-LOOP	B, I, L2, W
13590	ND5	B, L2
9449	COIII	B, L3
499	D-LOOP	B, U
16325	D-LOOP	C, D
10400	ND3	C, D, E
14783	CYT B	C, D, E
10398	ND3	C, D, E, I,
		J, K, L1,
		L2, L3
15043	CYT B	C, D, E,
		I, T
489	D-LOOP	C, D, E, J
8701	ATPase6	C, D, E, L1,
		L2, L3
9540	COIII	C, D, E, L1,
		L2, L3
10873	ND4	C, D, E, L1,
		L2, L3
15301	CYT B	C, D, E,
		L2, L3
11914	ND4	C, K, L1, L2
16298	D-LOOP	C, V
3010	16S rRNA	D, H, J, U
16311	D-LOOP	H, K, L1, L3
93	D-LOOP	H, L1
16304	D-LOOP	H, T
16291	D-LOOP	H, U
16356	D-LOOP	H, U
16482	D-LOOP	H, U
15924	tRNA-T	I, K, U
10915	ND4	I, L1
204	D-LOOP	I, L2, W
8251	COII	I, W
1719	16S rRNA	I, X
14798	CYT B	J, K
15257	CYT B	J, K
5460	ND2	J, L1, W
185	D-LOOP	J, L3
11002	ND4	J, L3
4216	ND1	J, T
11251	ND4	J, T
15452	CYT B	J, T
16126	D-LOOP	J, T
9548	COIII	J, U
13934	ND5	J, U
5231	ND2	K, L1
709	12S rRNA	K, L1, T, W
1811	16S rRNA	K, U
11467	ND4	K, U
12308	tRNA-L	K, U
12372	ND5	K, U
182	D-LOOP	L1, L2
198	D-LOOP	L1, L2
769	12S rRNA	L1, L2
1018	12S rRNA	L1, L2
3594	ND1	L1, L2
4104	ND1	L1, L2
7256	COI	L1, L2
7521	tRNA-D	L1, L2
13650	ND5	L1, L2
16278	D-LOOP	L1, L2, L3, X
189	D-LOOP	L1, L3
2352	16S rRNA	L1, L3
13105	ND5	L1, L3
5046	ND2	L1, W
6152	COI	L2, U
15784	CYT B	L2, U, W
5147	ND2	L3, T
6221	COI	L3, X
5426	ND2	T, U
13734	ND5	T, U
and 13966.	ND5	T, X

[0015] In certain other embodiments the mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is present in members of only one haplogroup and is a haplogroup-specific polymorphism as just described that is present in members of only one haplogroup

[0016] According to another embodiment of the invention there is provided a method for determining the mitochondrial haplogroup subgroup of a subject, comprising determining, in a biological sample comprising mitochondrial DNA from a subject, the presence or absence of at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup subgroup. In certain other embodiments the mitochondrial haplogroup is haplogroup K, U, J, T, W, I, H, V, X, L1, L2 or L3. In certain other embodiments at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup subgroup is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 3010, 16162, 16189, 16304, 1811, 3197, 9477, 14793, 16256, 13617, 16270, 7768, 14182, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497, 11470, 11914, 15924, 3010, 10398, 12612, 13798, 16069, 295, 489, 228, 462, 16193, 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16189, 16294, 5426, 6489, 11812, 15043, 16298, 12633, 16163 and 16186.

[0017] In another embodiment the invention provides a method for determining a mitochondrial haplogroup subgroup of a subject, comprising determining, in a biological sample comprising mitochondrial DNA from a subject of known mitochondrial haplogroup selected from haplogroups K, U, X, I, J, T, L1, L2 and L3, the presence or absence of a set comprising a plurality of single nucleotide polymorphisms wherein each polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1, the set selected from the group consisting of a first haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311 and 709; a second haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189 and 10398; a third haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398 and 497; a fourth haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497 and 11914; a fifth haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497, 11914, 11470 and 15924; a sixth haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497; 11914, 11470, 15924, 12978 and 12954; a seventh haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497; 11914, 11470, 15924, 12978, 12954 and 114; a first haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372 and 1811; a second haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270; a third haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270, 7768 and 14182; a fourth haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270, 14793 and 16256; a fifth haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270, 14793, 16256 and 15218; a first haplogroup X subgroup comprising a polymorphism at positions 12705, 16223, 1719, 6221, 6371, 13966, 14470, 16278 and 225; a second haplogroup X subgroup comprising a polymorphism at positions 12705, 16223, 1719, 6221, 6371, 13966, 14470, 16278, 225 and 226; a first haplogroup I subgroup comprising a polymorphism at positions 12705, 16223, 1719, 10238, 10398, 12501, 13780 and 15043; a second haplogroup I subgroup comprising a polymorphism at positions 12705, 16223, 1719, 10238, 10398, 12501, 13780, 15043, 250, 4529, 10034, 15924 and 16391; a first haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069 and 16126; a second haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295 and 489; a third haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295, 489 and 15257; a fifth haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295, 489 and 462; a sixth haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295, 489, 462 and 228; a first haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294 and 12633; a second haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 12633, 16163 and 16186; a third haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 11812, 14233 and 16296; a fourth haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 11812, 14233, 16296, 930, 5147 and 16304; a fifth haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 11812, 14233, 16296, 5426, 6489 and 15043; a first haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187 and 16311; a second haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311 and 182; a third haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311, 182, 8027 and 16294; a fourth haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311, 182, 357, 709, 710, 1738, 2352, 2768, 3308, 3693, 5036, 5393, 5655, 6548, 6827, 6989, 7867, 8248, 12519, 13880, 14203, 15115, 16126 and 16264; a fifth haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311, 182, 357, 709, 710, 1738, 2352, 2768, 3308, 3693, 5036, 5393, 5655, 6548, 6827, 6989, 7867, 8248, 12519, 13880, 14203, 15115, 16126, 16264 and 14769; a first haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278 and 16390; a second haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390 and 182; a third haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390, 2789, 7175, 7274, 7771, 11914, 12693, 13803, 14566, 15784 and 16294; a fourth haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390, 2789, 7175, 7274, 7771, 11914, 12693, 13803, 14566, 15784, 16294 and 16309; a fifth haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390, 2789, 7175, 7274, 7771, 11914, 12693, 13803, 14566, 15784, 16294, 16309, 3918, 5285, 15244, 15629; a first haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301; a second haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 13105; a third haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 13105, 3450, 5773, 6221, 9449, 10089, 10373, 13914, 15311, 15824, 15944, 16124, 16278 and 16362; a fourth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783 and 15043; a fifth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 2092, 3010, 4883, 5178, 6578, 14668 and 16325; a sixth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043 and 16362; a seventh haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584 and 16298; an eighth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584, 16298, 249, 3552, 9545, 11914, 13263, 14318, 15487, 16325 and 16327; a ninth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584, 16298, 249, 3552, 9545, 11914, 13263, 14318, 15487, 16325, 16327, 289 and 290; and a tenth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584, 16298, 249, 3552, 9545, 11914, 13263, 14318, 15487, 16325, 16327, 289, 290 and 15930.

[0018] In another embodiment the invention provides a method for determining the genetic relationship between two subjects, comprising determining, in each of a first biological sample comprising mitochondrial DNA from a first subject and a second biological sample comprising mitochondrial DNA from a second subject, the presence or absence of at least one mitochondrial single nucleotide polymorphism, wherein either (i) the presence of at least one mitochondrial single nucleotide polymorphism in both of said first and second biological samples, or (ii) the absence of at least one mitochondrial single nucleotide polymorphism from both of said first and second biological samples, indicates a genetic relationship between the subjects, and therefrom determining the genetic relationship between the subjects. In certain embodiments at least one mitochondrial single nucleotide polymorphism is associated with a mitochondrial haplogroup that is haplogroup A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W or X. In certain further embodiments at least one mitochondrial single nucleotide polymorphism is a haplogroup-specific polymorphism as described above.

[0019] The invention also provides, in other embodiments, a method for determining the genetic relationship between (i) an unknown source or biological subject from which an unidentified sample is obtained, and (ii) a known source or biological subject from an identified sample is obtained, comprising determining the presence or absence of at least one mitochondrial single nucleotide polymorphism, in each of a first biological sample derived from an unknown subject or biological source and a second biological sample derived from a known subject or biological source, wherein said first and second biological samples each comprise mitochondrial DNA, wherein either (i) the presence of at least one mitochondrial single nucleotide polymorphism in both of said first and second biological samples, or (ii) the absence of at least one mitochondrial single nucleotide polymorphism from both of said first and second biological samples, indicates a genetic relationship between the subjects, and therefrom determining the genetic relationship between the biological samples.

[0020] Turning to another embodiment of the present invention, there is provided a method of determining the presence of or the risk for having a disease associated with a mitochondrial DNA single nucleotide polymorphism, comprising (a) identifying at least one haplogroup-associated mitochondrial DNA single nucleotide polymorphism in a biological sample comprising mitochondrial DNA from a subject suspected of having or being at risk for having a disease associated with a mitochondrial DNA single nucleotide polymorphism; and (b) identifying in said sample at least one disease associated mitochondrial DNA single nucleotide polymorphism that is not a haplogroup-associated mitochondrial DNA single nucleotide polymorphism, and therefrom determining the presence or risk of disease. In certain other embodiments the disease associated mitochondrial DNA single nucleotide polymorphism that is not a haplogroup-associated mitochondrial DNA single nucleotide polymorphism is an Alzheimer's disease-associated polymorphism, and in certain other embodiments the disease associated mitochondrial DNA single nucleotide polymorphism that is not a haplogroup-associated mitochondrial DNA single nucleotide polymorphism is a type 2 diabetes-associated polymorphism.

[0021] These and other aspects of the present invention will become apparent upon reference to the following detailed description and attached drawings. All references disclosed herein are hereby incorporated by reference in their entireties as if each was incorporated individually

BRIEF DESCRIPTION OF THE DRAWINGS

[0022] FIG. 1 provides a phylogenetic tree of European mtDNA haplotypes.

[0023] FIG. 2 provides a phylogenetic tree of African mtDNA haplotypes.

[0024] FIGS. 3-6 show reduced median network of the specified mtDNA haplogroups. For reduced median network analysis, see, e.g., Bandelt et al., 1995 Genetics 141:743-753.

[0025] FIG. 3 shows a reduced median network of European mtDNA haplogroups.

[0026] FIG. 4 shows a reduced median network of European H and V mtDNA haplogroups.

[0027] FIG. 5 shows a reduced median network of African mtDNA haplogroups.

[0028] FIG. 6 shows a reduced median network of Asian mtDNA haplogroups.

DETAILED DESCRIPTION OF THE INVENTION

[0029] The present invention provides improved compositions and methods for identifying individuals, subpopulations and populations by determination of mtDNA haplogroup, genealogic, forensic, and related genetic relationships. As described herein, surprising diversity in mtDNA sequences permits expanded definition of mitochondrial polymorphism and redefinition of mtDNA haplogroups and subgroups at a level of refinement not previously recognized. The invention thus exploits the high mutation rate of mitochondrial DNA (mtDNA) to identify individuals, subpopulations and/or populations on the basis of specific mutations associated with particular characteristics such as race, genealogy and/or the presence of, or risk for having, certain diseases. In addition, mtDNA may be used to identify specific individuals. The present invention is directed generally to compositions and methods for identifying mtDNA mutations and thereby diagnosing the risk for having, or presence of, a disease. The invention also permits determination of other characteristics such as genealogy, population, race or ethnic group. In addition, the methods of the present invention are directed to identifying genetic and familial relationships between subjects or biological sources of mitochondrial DNA samples for a variety of purposes including, for instance, maternity testing, forensic studies, genetic counseling and genealogical analysis, and the like.

[0030] Biological samples may be provided by obtaining a blood sample, biopsy specimen, tissue explant, organ culture or any other tissue or cell preparation from a subject or a biological source, and in most preferred embodiments of the invention the biological sample comprises mtDNA. The subject or biological source may be a human or another biological organism, including a genetically engineered organism, such as a non-human animal, a plant, a unicellular organism or a multicellular organism or mitochondria prepared therefrom. The subject or biological source may also be a primary cell culture or culture adapted cell line including but not limited to genetically engineered cell lines that may contain chromosomally integrated or episomal recombinant nucleic acid sequences, immortalized or immortalizable cell lines, somatic cell hybrid or cytoplasmic hybrid “cybrid” cell lines (see, e.g., U.S. Pat. No. 5,888,498), differentiated or differentiatable cell lines, transformed cell lines and the like. A biological sample may, for example, be derived from a recombinant cell line or from a transgenic animal.

[0031] In certain embodiments of the invention, a subject or biological source may be infected with a microorganism such as a DNA virus, a retrovirus, a mycoplasma or a bacterium. In particular embodiments of the invention, for instance, those that relate to forensic sciences, a subject or biological source may provide material comprising mitochondrial DNA that is found at a crime scene or that may be otherwise associated with a person (including, for example, a criminal suspect), place or thing with which a suspect may have come into contact, for use as evidence. In certain related embodiments a biological sample may be derived from an unknown source or biological subject to provide an unidentified sample, which may then be characterized using the compositions and methods described herein. In certain other related embodiments such characterization may be used to determine a mitochondrial genetic relationship between the unknown source or biological subject and one or more of a particular species, a mitochondrial haplogroup, a mitochondrial haplogroup subgroup or a known source or biological subject having at least one mitochondrial single nucleotide polymorphism as provided herein, for instance, to identify the biological subject and/or to determine a genetic relationship between the subject and another individual, population or subpopulation (e.g., a haplogroup, subgroup or family).

[0032] In certain embodiments or the invention, the subject or biological source may be suspected of having or being at risk of having a disease associated with altered mitochondrial function, (e.g., Alzheimer's Disease, type 2 diabetes mellitus), and in certain embodiments of the invention, the subject or biological source may be known to be free of a risk for, or presence of, such a disease, or the risk or presence of a disease may not be known. In other embodiments of the invention, the subject or source may be suspected of being involved in an illegal activity. A subject or sample may be suspected of being genetically related to a specific individual or of belonging to a certain genealogical lineage, race or ethnic group. In other embodiments, the subject or source may not be suspected of being involved in an illegal activity or of being genetically related to a specific individual or of belonging to a certain genealogical lineage, race or ethnic group.

[0033] For example, and according to non-limiting theory, in certain embodiments it may be desirable to use as a subject or biological source a control individual selected according to criteria that will be apparent to a person having ordinary skill in the art based on one or more variables which may require normalization, typically an age- and/or sex-matched individual, a healthy individual or an individual appropriate as a control for a subject suspected of having or being at risk for a particular disease It may also be desirable to use as a subject or biological source a control individual for comparison purposes for maternity or forensic tests. Those having ordinary skill in the art are thus familiar with the design and selection of appropriate controls for different particular purposes. For instance, in certain embodiments it may be desirable to identify such a control individual who is believed to be free of a particular disease, and in certain other embodiments, a control individual may share a mitochondrial genetic relationship to a subject suspected of having a particular disease, such as the mother or sibling of the subject.

[0034] According to the present invention there is provided the unexpected discovery that determination of unprecedented polymorphism in mitochondrial DNA permits refinement of the assignment of individuals to particular mitochondrial haplogroups and haplogroup subgroups as provided herein. Additionally, the present invention exploits the surprising discoveries that in many cases, the haplogroup and/or haplogroup subgroup to which an individual belongs may not be determinative of a presence of a disease or of a risk for having a disease. Rather, as provided by the present disclosure, the improved ability to identify mitochondrial single nucleotide polymorphisms that are associated with particular haplogroups and/or haplogroup subgroups as described herein further permits identification of additional mitochondrial single nucleotide polymorphisms.

[0035] As described in greater detail herein, such additional polymorphisms, which are not definitive for a particular haplogroup and/or haplogroup subgroup, are useful correlates for other purposes, for example, in the identification of unique individuals (e.g., in forensics) and/or for determination of an individual's disease predisposition. Thus, in certain embodiments the present invention provides an improved system for distinguishing individuals belonging to the same mitochondrial haplogroup on the basis of particular mitochondrial DNA polymorphisms described herein. For instance, individuals of a common maternal lineage would fall into a common haplogroup according to standard mitochondrial genotyping methodologies without there being a basis for further differentiation, while the present invention provides one or more mitochondrial single nucleotide polymorphisms that are unique to each individual within a haplogroup (or haplogroup subgroup) thereby permitting such differentiation. These and other embodiments are also described in greater detail below.

[0036] In certain preferred embodiments it may be desirable to determine whether the subject, patient or biological source falls within clinical parameters indicative of a disease such as, but not limited to, Alzheimer's disease (AD) or type 2 diabetes mellitus (type 2 DM). Signs and symptoms of AD accepted by those skilled in the art may be used to so designate a subject or biological source, for example, clinical signs referred to in McKhann et al. (Neurology 34:939, 1984, National Institute of Neurology, Communicative Disorders and Stroke and Alzheimer's Disease and Related Disorders Association Criteria of Probable AD, NINCDS-ADRDA) and references cited therein, or other means known in the art for diagnosing AD. Similarly, signs and symptoms of type 2 diabetes mellitus accepted by those skilled in the art may be used to so designate a subject or biological source, for example, clinical signs referred to in Gavin et al. (Diabetes Care 22 (Suppl. 1):55-519, 1999, American Diabetes Association Expert Committee on the Diagnosis and Classification of Diabetes Mellitus) and references cited therein, or other means known in the art for diagnosis of type 2 diabetes mellitus. Also, by way of illustration and not limitation, accepted criteria such as particular clinical signs and symptoms (or ranges or combinations thereof) will be known to those familiar with the art for any of the other diseases associated with altered mitochondrial function as provided herein. (See, e.g., Chinnery et al., 1999 J. Med. Genet. 36:425)

[0037] For example, according to certain embodiments the present invention provides a method for determining the risk for having, or presence of, a malignant condition in a subject. A malignant condition in a subject, as used herein, refers to the presence of dysplastic, cancerous and/or transformed cells in the subject, including, for example neoplastic, tumor, non-contact inhibited or oncogenically transformed cells, or the like. By way of illustration and not limitation, in the context of the present invention a malignant condition may refer further to the presence in a subject of cancer cells such as colorectal cancer, lung cancer, bladder cancer, or head and neck tumors, as have been described in the context of somatic mtDNA sequence variations distinct from the mitochondrial single nucleotide polymorphisms described herein (cf, Fliss et al., 1999 Science 287:2017; Polyak et al., 1998 Nat. Genet. 20:291).

[0038] In other preferred embodiments, it may be useful to combine the present invention with other procedures for identifying an individual, including methods of analyzing either mtDNA or genomic DNA (e.g., extramitochondrial DNA, i.e., nuclear chromosomal or episomal DNA) such as, for example, RFLP analysis, allele specific oligonucleotide analysis or any other technique for DNA analysis known in the art, including those described above.

[0039] As noted above, a biological sample for use according to the most highly preferred embodiments of the present invention contains mtDNA as provided herein, and may comprise any source of mitochondrial DNA, including any tissue or cell preparation in which mitochondrially derived nucleic acids (e.g., mtDNA) are present. In addition, a source or biological sample comprising mitochondrial DNA may include a source of mtDNA wherein cells or tissues are not present. Biological samples may therefore contain live cells, or dead cells or no cells. Compositions and methods useful for obtaining and detecting mtDNA are provided, for example, in U.S. Pat. Nos. 5,565,323 and 5,840,493. Biological samples may thus be provided by obtaining a sample of blood, hair, scalp, skin or other epithelial cells, bone, saliva, mucous or other secretion, semen, or other forensic sample, biopsy specimen, tissue explant, organ culture or any other tissue, cell preparation or non-cell preparation from a subject or a biological source as provided herein. Thus, for example, in certain specific embodiments, biological samples of the invention may include mtDNA isolated at a crime scene or from another source of forensic evidence. In certain other embodiments, biological samples may include mtDNA isolated from archaeological sites or from human or animal remains.

[0040] Any mtDNA sequence or portion of a mutated mtDNA (e.g., mtDNA that contains at least one single nucleotide polymorphism as provided herein, including mtDNA that contains a plurality of such single nucleotide polymorphisms) sequence that corresponds to the human mtDNA sequence disclosed by Anderson et al. (SEQ ID NO:1, 1981 Nature 290:457; see also Marzuki et al., 1991 Human Genet. 88:139) and revised according to Andrews et al. (1999 Nature Genetics 23:147), or a portion thereof or several portions thereof, may be useful in these embodiments of the invention. Examples of human mtDNA point mutations derived from specific mtDNA sequence regions that are useful in certain embodiments of the invention are disclosed, according to the nucleotide positions at which wildtype and mutant mtDNA differ, in Tables 1 and 2. Those familiar with the art will recognize the established convention for naming regions of the circular mtDNA genome according to the D-loop and the several mtDNA gene loci, including the mitochondrial rRNA genes, the mitochondrial tRNA genes, the mitochondrial NADH dehydrogenase genes, the mitochondrial cytochrome c oxidase genes, the mitochondrial ATP synthase genes and the mitochondrial cytochrome b gene, and the corresponding nucleotide position numbers of SEQ ID NO:1 that are spanned by each of these regions (see, e.g., Scheffler, Mitochondria, 1999 John Wiley & Sons, pages 48-140, and references cited therein; see also “Mitomap” at http://www.gen.emory.edu/mitomap.html). Thus, for example, Table 1 shows mitochondrial single nucleotide polymorphisms that include polymorphisms which have been correlated with Alzheimer's disease, as disclosed in co-pending U.S. patent application Ser. No. 09/551,941 which is hereby incorporated by reference, and Table 2 shows mitochondrial single nucleotide polymorphisms that include polymorphisms which have been correlated with type 2 diabetes in certain mitochondrial haplogroups, as disclosed in the co-pending U.S. Patent application No. 60/333,448, hereby incorporated by reference. Full-length mtDNA sequences from 560 human subjects are disclosed herein in the Sequence Listing and are set forth at SEQ ID NOS:2-561.

TABLE 1
MTDNA SINGLE NUCLEOTIDE POLYMORPHISMS
ASSOCIATED WITH AD
			Nucl.
	Nucleotide	Nucleotide	Substi-	#	Haplo-
Gene	Position	(CRS)	tution	Samples	group
D-LOOP	72	T	C	1	H
D-LOOP	114	C	T	1	K
D-LOOP	146	T	C	2	U, H
D-LOOP	185	G	A	1	J
D-LOOP	189	A	G	1	K, W
D-LOOP	199	T	C	1	I
D-LOOP	204	T	C	1	W
D-LOOP	207	G	A	2	W, I
D-LOOP	228	G	A	1	J
D-LOOP	236	T	C	1	H
D-LOOP	239	T	C	2	H
D-LOOP	456	C	T	1	H
D-LOOP	462	C	T	2	J
D-LOOP	482	T	C	1	J
D-LOOP	489	T	C	2	J
D-LOOP	497	C	T	1	K, K
D-LOOP	500	C	G	5	H, W, J
D-LOOP	516	C	T	1	U
D-LOOP	522	C	DEL	1	H
D-LOOP	523	A	DEL	1	H
D-LOOP	547	A	T	1	I
12S RRNA	593	T	C	1	K
12S RRNA	669	T	C	1	I
12S RRNA	960	C	DEL	1	U
12S RRNA	1007	G	A	1	J
12S RRNA	1243	T	C	1	W
12S RRNA	1393	G	A	1	H
16S RRNA	1719	G	A	1	H, I
16S RRNA	1809	T	C	1	U
16S RRNA	2352	T	C	1	H
16S RRNA	2483	T	C	1	K
16S RRNA	2702	G	A	1	I
16S RRNA	2851	A	G	1	H
16S RRNA	3197	T	C	1	U
ND1	3333	C	T	1	H
ND1	3336	T	C	1	I
ND1	3348	A	G	1	U
ND1	3394	T	C	1	J
ND1	3398	T	C	1	I
ND1	3423	G	T	1	J
ND1	3505	A	G	1	W
ND1	3559	C	T	1	H
ND1	3915	G	A	2	H
ND1	3992	C	T	1	H
ND1	4024	A	G	1	H
ND1	4095	C	T	1	H
ND1	4216	T	C	3	T, J
TRNA-Q	4336	T	C	1	H
ND2	4529	A	T	1	I
ND2	4727	A	G	2	H
ND2	4793	A	G	1	H
ND2	4917	A	G	1	T
ND2	4991	G	A	1	H
ND2	5004	T	C	2	H, W
ND2	5046	G	A	1	W
ND2	5228	C	G	1	H
ND2	5315	A	G	1	I
ND2	5418	T	G	1	J
ND2	5426	T	C	1	T
ND2	5460	G	A	3	H, W
ND2	5461	C	G	1	J
TRNA-W	5516	A	G	1	H
TRNA-W	5554	C	A	1	U
TRNA-A	5634	A	G	1	H
TRNA-A/	5656	A	G	1	U
TRNA-N
TRNA-C	5773	G	A	1	J
CO1	6182	G	A	1	U
CO1	6221	T	C	1	H
CO1	6341	C	T	1	U
CO1	6367	T	C	1	K
CO1	6371	C	T	1	H
CO1	6489	C	A	1	T
CO1	7184	A	G	1	J
CO1	7325	A	G	1	H
CO2	7621	T	C	1	K
CO2	7768	A	G	1	U
CO2	7787	C	T	1	H
CO2	7789	G	A	1	J
CO2	7864	C	T	1	W
CO2	7895	G	A	1	U
CO2	7963	A	G	1	J
CO2	8149	A	G	1	H
CO2	8251	G	A	2	W, I
CO2	8269	G	A	1	H
CO2/	8276-8284		DEL	1	T
TRNA-K
ATPAse 8	8470	A	G	1	H
ATPASE 8	8485	G	A	1	I
ATPASE 8	8508	A	G	1	I
ATPASE 6	8602	T	C	1	H
ATPASE6	8697	G	A	1	T
ATPASE 6	8752	A	G	1	H
ATPASE 6	8901	A	G	1	I
ATPASE 6	8994	G	A	1	W
ATPASE 6	9123	G	A	1	H
CO3	9254	A	G	1	H
CO3	9362	A	G	1	H
CO3	9380	G	A	2	H
CO3	9477	G	A	1	U
CO3	9554	G	A	1	H
CO3	9708	T	C	1	H
CO3	9804	G	A	1	H
CO3	9861	T	C	1	H
TRNA-G	10034	T	C	1	I
TRNA-G	10044	A	G	1	H
ND3	10238	T	C	2	I
TRNA-R	10463	T	C	2	T, J
ND4L	10589	G	A	1	H
ND4	10978	A	G	1	K
ND4	11065	A	G	1	I
ND4	11251	A	G	1	J
ND4	11253	T	C	1	H
ND4	11272	A	G	1	U
ND4	11470	A	G	2	K
ND4	11527	C	T	1	J
ND4	11611	G	A	1	H
ND4	11674	C	T	1	W
ND4	11812	A	G	1	T
ND4	11914	G	A	2	K
ND4	11947	A	G	1	W
ND5	12414	T	C	1	W
ND5	12501	G	A	2	I
ND5	12609	T	C	1	U
ND5	12705	C	T	4	H, W, I
ND5	12954	T	C	1	K
ND5	13111	T	C	1	H
ND5	13194	G	A	2	H, U
ND5	13212	C	T	1	H
ND5	13368	G	A	1	T
ND5	13617	T	C	1	U
ND5	13780	A	G	2	I
ND5	13966	A	G	1	H
ND5	14020	T	C	1	T
ND5	14148	A	G	1	W
ND6	14178	T	C	1	I
ND6	14179	A	G	1	U
ND6	14182	T	C	1	U
ND6	14212	T	C	1	H
ND6	14233	A	G	1	T
ND6	14470	T	C	1	H
ND6	14582	A	G	1	H
CYT.B	14905	G	A	1	T
CYT.B	15028	C	A	1	T
CYT.B	15043	G	A	3	T, I
CYT.B	15191	T	C	1	U
CYT.B	15299	T	C	1	I
CYT.B	15380	A	G	1	U
CYT.B	15553	G	A	1	H
CYT.B	15607	A	G	1	T
CYT.B	15758	A	G	1	I
CYT.B	15790	C	T	1	U
CYT.B	15808	A	G	1	H
CYT.B	15833	C	T	1	H
CYT.B	15884	G	C	1	W
TRNA-T	15924	A	G	3	K, I
TRNA-T	15928	G	A	1	T
D-LOOP	16069	C	T	2	J
D-LOOP	16086	T	C	1	I
D-LOOP	16093	T	C	1	K
D-LOOP	16126	T	C	3	T, J
D-LOOP	16129	G	A	2	H, I
D-LOOP	16145	G	A	1	I
D-LOOP	16147	C	A	1	I
D-LOOP	16172	T	C	1	U
D-LOOP	16174	C	T	1	U
D-LOOP	16182	A	C	1	T
D-LOOP	16183	A	C	4	T, U, H
D-LOOP	16189	T	C	5	T, U, H
D-LOOP	16192	C	T	1	U
D-LOOP	16193	C	T	1	J
D-LOOP	16223	C	T	4	H, W, I
D-LOOP	16224	T	C	3	K
D-LOOP	16234	C	T	1	K
D-LOOP	16235	A	G	1	J
D-LOOP	16239	C	T	1	H
D-LOOP	16248	C	T	1	I
D-LOOP	16256	C	T	1	J
D-LOOP	16261	C	T	1	H
D-LOOP	16270	C	T	1	U
D-LOOP	16278	C	T	2	U, H
D-LOOP	16290	C	T	1	H
D-LOOP	16292	C	T	1	W
D-LOOP	16293	A	G	1	H
D-LOOP	16294	C	T	1	T
D-LOOP	16298	T	C	2	T, H
D-LOOP	16300	A	G	1	J
D-LOOP	16304	T	C	1	H
D-LOOP	16309	A	G	1	J
D-LOOP	16311	T	C	5	H, K, U
D-LOOP	16320	C	T	1	I
D-LOOP	16355	C	T	1	I
D-LOOP	16362	T	C	2	H
D-LOOP	16391	G	A	1	I
D-LOOP	16482	A	G	2	H
D-LOOP	16524	A	G	1	K
D-LOOP	45	C	INS	1	U
D-LOOP	140	C	T	1	H
D-LOOP	188	A	G	2	J
D-LOOP	291	A	INS	1	U
D-LOOP	455	T	DEL	1	U
D-LOOP	500	C	G	2	H
D-LOOP	513	G	DEL	1	H
D-LOOP	514	C	DEL	1	H
D-LOOP	516	C	T	1	U
D-LOOP	527	C	G	2	K, T
D-LOOP	533	A	G	1	I
D-LOOP	568	CCC	INS	1	I
D-LOOP	710	G	A	1	H
12S RRNA	749	A	G	1	K
12S RRNA	960	C	DEL	1	U
12S RRNA	1508	C	T	1	H
16S RRNA	1809	T	C	1	U
16S RRNA	2352	T	C	1	H
16S RRNA	2833	A	G	1	U
ND1	3559	C	T	1	X
ND1	3745	G	A	1	U
ND2	5237	G	A	1	K
ND2	5348	C	T	1	H
TRNA-W	5516	A	G	1	H
TRNA-W	5554	C	A	1	U
TRNA-C	5773	G	A	1	H
CO1	5979	G	A	1	H
CO1	6182	G	A	1	U
CO1	6272	A	G	1	H
CO1	6320	T	C	1	T
CO1	6341	C	T	1	U
CO1	6480	G	A	2	H, T
CO1	6498	C	G	1	U
CO1	6722	G	A	1	B
CO1	6845	C	T	1	K
CO1	6911	T	C	1	U
CO2	7787	C	T	1	X
CO2	7830	G	A	1	H
CO2	7853	G	A	1	T
CO2	7927	C	G	1	H
CO2	7978	C	G	1	H
CO2	7985	C	G	2	H, U
CO2	8149	A	G	1	H
ATPASE 6	8865	G	A	1	U
ATPASE 6	9098	T	C	1	B
CO3	9129	C	T	1	H
CO3	9708	T	C	1	H
CO3	9861	T	C	1	H
ND3	10154	A	G	1	K
ND3	10394	C	T	1	H
TRNA-R	10448	T	C	1	H
ND4L	10724	T	C	1	U
ND4	11272	A	G	1	U
ND4	11590	A	G	1	H
ND4	11824	A	G	1	H
ND4	11893	A	G	1	H
TRNA-S	12217	A	G	1	H
ND5	12471	T	C	1	H
ND5	12609	T	C	1	U
ND5	12738	T	G	1	K
ND5	13194	G	A	1	U
ND5	13212	C	T	1	X
ND5	13351	C	T	1	U
ND5	13746	C	T	1	H
ND5	13889	G	A	1	H
ND5	13943	C	T	1	K
ND5	14133	A	G	1	H
ND6	14323	G	A	1	H
ND6	14512	T	C	1	U
TRNA-E	14684	C	T	1	U
CYB	14869	G	A	1	H
CYB	14978	A	G	1	H
CYB	15295	C	T	1	T
CYB	15380	A	G	1	U
CYB	15734	G	A	1	U
CYB	15790	C	T	1	U
TRNA-T	15947	A	G	1	J
D-LOOP	16136	T	C	1	H
D-LOOP	16168	C	T	1	U
D-LOOP	16174	C	T	1	U
D-LOOP	16209	T	C	1	T
D-LOOP	16219	A	G	1	U
D-LOOP	16239	C	T	1	U
D-LOOP	16260	C	T	1	J
D-LOOP	16263	T	C	1	H
D-LOOP	16295	C	T	1	H
D-LOOP	16343	A	G	1	U
D-LOOP	16524	A	G	1	H
D-LOOP	16526	G	A	1	U

[0041]

TABLE 2
MITOCHONDRIAL SNPS AND HAPLOGROUPS IN NIDDM
			NUCL.
	NUCLEOTIDE	NUCLEOTIDE	SUBSTI-		HAPLO-
GENE	POSITION	(CRS)	TUTION	# SAMPLES	GROUP
D-LOOP	62	G	C	1	B
D-LOOP	62	G	C	1	B
D-LOOP	94	G	A	1	A
D-LOOP	94	G	A	1	A
D-LOOP	95	A	C	1	L1
D-LOOP	114	C	G	1	B
D-LOOP	151	C	T	1	L1
D-LOOP	159	T	C	1	H
D-LOOP	188	A	G	1	J
D-LOOP	198	C	T	1	L2
D-LOOP	215	A	G	1	C
D-LOOP	215	A	G	1	C
D-LOOP	257	A	G	1	H
D-LOOP	267	T	C	1	D
D-LOOP	271	C	T	1	B
D-LOOP	288	A	G	1	A
D-LOOP	317	G	A	1	L1
D-LOOP	317	G	A	1	L1
D-LOOP	320	C	T	1	B
D-LOOP	343	C	T	1	B
D-LOOP	362	A	INS	1	A
D-LOOP	418	C	T	1	L2
D-LOOP	453	T	DEL	1	B
D-LOOP	454	T	DEL	1	B
D-LOOP	466	T	C	1	U
D-LOOP	480	T	C	1	H
D-LOOP	481	C	T	1	B
D-LOOP	481	C	T	1	B
D-LOOP	493	A	G	1	C
D-LOOP	568	C	INS	1	D
D-LOOP	568	C	INS	1	H
D-LOOP	568	C	INS	1	T
D-LOOP	568	CC	INS	1	K
D-LOOP	568	C	INS	1	C
TRNA-F	629	T	C	1	A
12S RRNA	735	A	G	1	H
12S RRNA	921	T	C	1	L3
12S RRNA	956	C	INS	1	B
12S RRNA	956	C	INS	1	A
12S RRNA	956	C	INS	1	B
12S RRNA	960	C	DEL	1	U
12S RRNA	961	T	C	1	A
12S RRNA	961	T	C	1	A
12S RRNA	966	CC	INS	1	A
12S RRNA	966	C	INS	1	A
12S RRNA	1002	C	T	1	B
12S RRNA	1002	C	T	1	B
12S RRNA	1007	G	C	1	L2
12S RRNA	1420	T	C	1	L1
12S RRNA	1462	G	A	1	H
16S RRNA	1766	T	C	1	L1
16S RRNA	2145	G	A	1	H
16S RRNA	2157	A	INS	1	L1
16S RRNA	2735	G	A	1	C
16S RRNA	2755	A	G	1	L1
16S RRNA	2863	T	C	1	L1
16S RRNA	2903	T	C	1	L3
16S RRNA	3203	A	G	1	L3
ND1	3308	T	A	1	A
ND1	3309	C	INS	1	A
ND1	3311	C	T	1	A
ND1	3338	T	C	1	L2
ND1	3338	T	C	1	B
ND1	3513	C	T	1	L1
ND1	3766	T	C	1	B
ND1	3766	T	C	1	B
ND1	3777	T	C	1	L2
ND1	3927	A	G	1	L1
ND1	3936	C	A	1	L2
ND1	4012	A	G	1	B
ND1	4129	A	G	1	T
ND1	4167	C	T	1	B
ND1	4167	C	T	1	B
ND1	4232	T	C	1	B
ND1	4242	C	T	1	C
TRNA-Q	4386	T	C	1	H
TRNA-Q	4392	C	T	1	L3
TRNA-M	4435	A	G	1	D
ND2	4506	A	G	1	L1
ND2	4655	G	A	1	L2
ND2	4733	T	C	1	L3
ND2	4908	C	T	1	U
ND2	5156	A	T	1	H
ND2	5165	C	T	1	A
ND2	5183	A	G	1	A
ND2	5237	G	A	1	L1
ND2	5372	A	G	1	L3
TRNA-W	5463	G	A	1	H
TRNA-C	5824	G	A	1	D
TRNA-Y/CO1	5899	C	DEL	1	B
TRNA-Y/CO1	5900	CC	INS	1	L1
CO1	6026	G	A	1	L2
CO1	6164	C	T	1	B
CO1	6164	C	T	1	L2
CO1	6164	C	T	1	B
CO1	6308	C	T	1	A
CO1	6308	C	T	1	A
CO1	6311	C	T	1	L2
CO1	6340	C	T	1	H
CO1	6378	T	C	1	L1
CO1	6392	T	C	1	T
CO1	6620	T	C	1	A
CO1	6663	A	G	1	L2
CO1	6710	A	G	1	K
CO1	6722	G	A	1	B
CO1	6932	A	G	1	L3
CO1	6951	G	A	1	D
CO1	6951	G	A	1	K
CO1	7158	A	G	1	B
BO1	7158	A	G	1	B
CO1	7202	A	G	1	L1
CO2	7621	T	C	1	H
CO2	7692	T	C	1	L1
CO2	7697	G	A	1	C
CO2	7702	G	A	1	L2
CO2	7853	G	A	1	D
CO2	7978	C	G	1	L3
CO2	7978	C	G	1	L2
CO2	7985	C	G	1	L3
CO2	7985	C	G	1	L2
CO2	8032	C	T	1	A
CO2	8087	T	C	1	L1
CO2	8098	A	G	1	K
CO2	8119	T	C	1	L2
ATPASE 8	8419	T	C	1	L1
ATPASE 8	8460	A	G	1	B
ATPASE 8	8460	A	G	1	B
ATPASE 8	8478	C	T	1	H
ATPASE 8	8530	A	G	1	L3
ATPASE 8	8557	G	A	1	A
ATPASE 6	8574	C	T	1	H
ATPASE 6	8604	T	C	1	L2
ATPASE 6	8679	A	G	1	H
ATPASE 6	8680	C	T	1	D
ATPASE 6	8746	T	G	1	A
ATPASE 6	8856	G	C	1	K
ATPASE 6	8987	T	C	1	L2
ATPASE 6	9017	T	C	1	A
ATPASE 6	9052	A	G	1	L1
ATPASE 6	9097	A	G	1	B
ATPASE 6	9098	T	C	1	B
ATPASE 6	9111	T	C	1	L3
ATPASE 6	9145	G	A	1	W
ATPASE 6	9192	G	A	1	E
ATPASE 6	9198	C	T	1	W
CO3	9254	A	G	1	L3
CO3	9336	A	G	1	L1
CO3	9557	C	T	1	C
CO3	9647	T	C	1	L1
CO3	9813	T	A	1	K
CO3	9836	T	C	1	A
CO3	9903	T	C	1	L2
CO3	9932	G	A	1	L3
CO3	9932	G	A	1	B
TRNA-G	9950	T	C	1	B
TRNA-G	10031	T	C	1	A
ND3	10335	C	T	1	B
ND4L	10654	C	T	1	H
ND4	10834	C	T	1	E
ND4	10853	C	T	1	C
ND4	10920	C	T	1	L2
ND4	11239	A	G	1	L3
ND4	11854	T	C	1	K
ND4	11884	A	G	1	B
ND4	11935	T	C	1	W
ND4	12063	C	T	1	U
ND4	12064	C	T	1	U
ND4	12092	C	T	1	C
TRNA-H	12172	A	G	1	L1
TRNA-H	12172	A	G	1	H
ND5	12453	T	C	1	H
ND5	12454	G	A	1	C
ND5	12477	T	C	1	L1
ND5	12582	A	G	1	U
ND5	12723	A	G	1	K
ND5	12768	A	G	1	L1
ND5	12870	C	T	1	L3
ND5	13254	T	C	1	E
ND5	13263	A	G	1	W
ND5	13269	A	G	1	L3
ND5	13473	A	C	1	U
ND5	13494	C	T	1	E
ND5	13542	A	G	1	L3
ND5	13617	T	C	1	U
ND5	13629	A	G	1	L2
ND5	13707	G	A	1	A
ND5	13711	G	A	1	H
ND5	13749	C	T	1	W
ND5	13781	T	C	1	H
ND5	13924	C	T	1	L2
ND5	14053	A	G	1	L1
ND5	14088	T	C	1	L1
ND6	14173	T	C	1	L2
ND6	14251	A	G	1	H
ND6	14280	A	G	1	A
ND6	14388	A	G	1	HAPLO-
					GROUP
ND6	14460	C	G	1	A
ND6	14548	A	G	1	H
TRNA-E	14693	A	G	1	D
CYT B	14769	A	G	1	L1
CYT B	14974	C	G	1	B
CYT B	15016	C	T	1	L1
CYT B	15043	G	A	1	C
CYT B	15107	C	T	1	A
CYT B	15266	A	G	1	D
CYT B	15317	G	A	1	E
CYT B	15386	C	T	1	A
CYT B	15451	C	T	1	L2
CYT B	15496	A	G	1	L3
CYT B	15508	C	T	1	K
CYT B	15511	T	C	1	U
CYT B	15589	C	A	1	H
CYT B	15616	C	T	1	B
CYT B	15616	C	T	1	B
CYT B	15766	A	G	1	HAPLO-
					GROUP
CYT B	15784	T	C	1	W
TRNA-T	15946	C	T	1	K
D-LOOP	16086	T	C	1	L2
D-LOOP	16086	T	C	1	L2
D-LOOP	16093	T	C	1	L3
D-LOOP	16109	A	C	1	C
D-LOOP	16114	C	T	1	H
D-LOOP	16136	T	C	1	B
D-LOOP	16145	G	A	1	L1
D-LOOP	16147	C	T	1	H
D-LOOP	16153	G	A	1	H
D-LOOP	16163	A	G	1	T
D-LOOP	16166	A	G	1	L3
D-LOOP	16185	C	T	1	L3
D-LOOP	16185	C	T	1	L3
D-LOOP	16188	C	T	1	C
D-LOOP	16213	G	A	1	L1
D-LOOP	16235	A	G	1	H
D-LOOP	16242	C	T	1	H
D-LOOP	16245	C	T	1	W
D-LOOP	16249	T	C	1	B
D-LOOP	16259	C	T	1	T
D-LOOP	16274	G	A	1	D
D-LOOP	16274	G	A	1	L1
D-LOOP	16274	G	A	1	T
D-LOOP	16274	G	A	1	H
D-LOOP	16286	C	G	1	L1
D-LOOP	16295	C	T	1	L2
D-LOOP	16311	T	C	1	C
D-LOOP	16312	A	G	1	B
D-LOOP	16336	G	A	1	A
D-LOOP	16344	C	T	1	B
D-LOOP	16354	C	T	1	D
D-LOOP	16354	C	T	1	H
D-LOOP	16355	C	T	1	L2
D-LOOP	16357	T	C	1	B
D-LOOP	16357	T	C	1	H
D-LOOP	16468	T	C	1	D
D-LOOP	16468	T	C	1	A
D-LOOP	16483	G	A	1	B
D-LOOP	16512	T	C	1	A
D-LOOP	16554	A	G	1	A

[0042] Portions of the mtDNA sequence of SEQ ID NO:1, and portions of a sample mtDNA sequence derived from a biological source or subject as provided herein, are regarded as “corresponding” nucleic acid sequences, regions, fragments or the like, based on the convention for numbering mtDNA nucleic acid positions according to SEQ ID NO:1 (Anderson et al., Nature 290:457, 1981), wherein a sample mtDNA sequence is aligned with the mtDNA sequence of SEQ ID NO:1 such that at least 70%, preferably at least 80% and more preferably at least 90% of the nucleotides in a given sequence of at least 20 consecutive nucleotides of a sequence are identical. For example, a portion of the mtDNA sequence in a biological sample containing mtDNA from a subject suspected of having or being at risk for having AD, or, as another example, a portion of the mtDNA sequence in mtDNA containing at least one mitochondrial single nucleotide polymorphism that is associated with Alzheimer's disease as provided herein (e.g., mutated mtDNA), may be aligned with a corresponding portion of the mtDNA sequence of SEQ ID NO:1 using any of a number of alignment procedures and/or tools with which those having ordinary skill in the art will be familiar (e.g., CLUSTAL W, Thompson et al., 1994 Nucl. Ac. Res. 22:4673; CAP, www.no.embnet.org/clustalw.html: FASTA/FASTP, Pearson, 1990 Proc. Nat. Acad. Sci. USA 85:2444, available from D. Hudson, Univ. of Virginia, Charlottesville, Va.). In certain preferred embodiments, a sample mtDNA sequence is greater than 95% identical to a corresponding mtDNA sequence of SEQ ID NO:1. In certain other preferred embodiments, a sample mtDNA sequence is identical to a corresponding mtDNA sequence of SEQ ID NO:1. Those oligonucleotide probes having sequences that are identical in corresponding regions of the mtDNA sequence of SEQ ID NO:1 and sample mtDNA may be identified and selected following hybridization target DNA sequence analysis, to verify the absence of mutations.

[0043] According to the present invention and as known in the art, the term “haplotype” refers to a particular combination of genetic markers in a defined region of the mitochondrial genome. Such genetic markers include, for example, RFLPs and SNPs. RFLPs (restriction fragment polymorphisms) result from an alteration in a recognition site, often a palindrome, that is specifically cleaved in a site-specific manner by a DNAse known as a restriction enzyme. A SNP (single nucleotide polymorphism) is a change (e.g., a deletion, insertion or substitution) in any single nucleotide base in a region of a genome of interest. In particularly preferred embodiments provided by the instant disclosure, the genome of interest is the mitochondrial genome. Because SNPs vary from individual to individual, they are useful markers for studying the association of a genome. Moreover, because they occur more frequently than other markers such as RFLPs, analysis of SNPs should produce a “higher resolution” picture of disease, haplogroup and individual-associated genetic marker segregation (Weiss, (1998) Genome Res. 8:691-697; Gelbert and Gregg, (1997) Curr. Opin. Biotechnol. 8:669-674).

[0044] The term “haplogroup” refers to a group of haplotypes found in association with one another. Several mitochondrial DNA haplotypes and haplogroups are known in the art, including nine European mtDNA haplogroups as well as discrete Asian, Native American and African mtDNA haplogroups, each identified on the basis of the presence or absence of one or more specific restriction endonuclease recognition sites (see, e.g., Wallace et al., 1999 Gene 238:211; Torroni et al., 1996 Genetics 144:1835). In addition to haplogroups that may be regarded as clusters of haplotypes, designation of individuals as belonging to various nodes or branches within such a cluster, for example, subgroupings, subclusters, subcategories or the like, may be referred to as assignment to a “haplogroup subgroup”, as described, for example, by Macaulay et al. (1999 Am J. Hum. Genet. 64:232-249). As shown in FIGS. 1 and 2, for example, and as provided by the unexpected discovery of the present invention, particular mitochondrial haplogroups (e.g., U, K, J, T, etc.) may be divided and further subdivided into haplogroup subgroups on the basis of polymorphisms detected at nucleotide positions having the indicated numbers corresponding to nucleotide positions in SEQ ID NO:1.

[0045] Nucleic acid sequences within the scope of the invention include isolated DNA and RNA sequences that specifically hybridize under conditions of moderate or high stringency to mtDNA nucleotide sequences, including mtDNA sequences disclosed herein or fragments thereof, and their complements. As used herein, conditions of moderate stringency, as known to those having ordinary skill in the art, and as defined by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), include, for example, the use as a prewashing solution for nitrocellulose filters on which proband nucleic acids have been immobilized of 5× SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of 50% formamide, 6× SSC at 42° C. (or other similar hybridization solution), and washing conditions of about 50-60° C., 0.5× SSC, 0.1% SDS. Conditions of high stringency are defined as hybridization conditions as above, and with washing at 60-68° C., 0.2×SSC, 0.1% SDS. In other embodiments, hybridization to an mtDNA nucleotide sequence may be at normal stringency, which is approximately 25-30° C. below Tm of the native duplex (e.g., 5× SSPE, 0.5% SDS, 5× Denhardt's solution, 50% formamide, at 42° C. or equivalent conditions), at low stringency hybridizations, which utilize conditions approximately 40° C. below Tm, or at high stringency hybridizations, which utilize conditions approximately 110° C. below Tm. The skilled artisan will recognize that the temperature, salt concentration, and/or chaotrope composition of hybridization and wash solutions may be adjusted as necessary according to factors such as the length and nucleotide base composition of the probe. (See also, e.g., Ausubel et al., (1987) Current Protocols in Molecular Biology, Greene Publishing) Thus, desired variations in stringency of hybridization conditions may be achieved by altering the time, temperature and/or concentration of the solutions used for pre-hybridization, hybridization and wash steps. Accordingly, it will be appreciated that suitably stringent conditions can be readily selected without undue experimentation where a desired selectivity of the probe is identified, based on its ability to hybridize to one or more certain proband sequences while not hybridizing to certain other proband sequences.

[0046] An “isolated nucleic acid molecule” refers to a polynucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid construct, that has been separated from its source cell (including the chromosome it normally resides in) at least once, preferably in a substantially pure form. Isolated nucleic acids may be nucleic acids having particular disclosed nucleotide sequences or may be regions, portions or fragments thereof. Those having ordinary skill in the art are able to prepare isolated nucleic acids having the complete nucleotide sequence, or the sequence of any portion of a particular isolated nucleic acid molecule, when provided with the appropriate nucleic acid sequence information as disclosed herein. Nucleic acid molecules may be comprised of a wide variety of nucleotides, including DNA, RNA, nucleotide analogues such as phosphorothioates or peptide nucleic acids, or other analogues with which those skilled in the art will be familiar, or some combination of these.

[0047] The present invention, as described herein, provides mtDNA sequences and isolated mtDNA nucleic acid molecules. mtDNA may be isolated from cellular DNA according to well known methodologies, for example those described in U.S. Pat. No. 5,840,493, which is hereby incorporated by reference in its entirety. The Sequence Listing includes full-length mtDNA sequences from 560 different human subjects, as set forth at SEQ ID NOS:2-561.

[0048] Where it is advantageous to use oligonucleotide primers according to the present invention, such primers may be 10-60 nucleotides in length, preferably 15-35 nucleotides and still more preferably 18-30 nucleotides in length. Primers may be useful in the present invention for quantifying mtDNA mutations, including single nucleotide polymorphisms or homoplasmic mtDNA mutations provided herein, by any of a variety of techniques well known in the art for determining the amount of specific nucleic acid target sequences present in a sample based on specific hybridization of a primer to the target sequence. Optionally, in certain of these techniques, hybridization precedes nucleotide polymerase catalyzed extension of the primer using the strand containing the target sequence as a template, and/or ligation of oligonucleotides hybridized to adjacent target sequences, and embodiments of the invention using primer extension are particularly preferred.

[0049] For examples of references on such quantitative detection techniques, including those that may be used to detect nucleotide insertions, substitutions or deletions in a portion of an mtDNA sequence site near an oligonucleotide primer target hybridization site that corresponds to a portion of the wildtype mtDNA sequence as disclosed in Anderson et al. (1981 Nature 290:457, SEQ ID NO:1) or a mutated site such as may be created by any of the mtDNA point mutations disclosed herein, and further including those that involve primer extension, see U.S. Pat. No. 5,760,205 and the references cited therein, all of which are hereby incorporated by reference, and see also, for example, Botstein et al. (Am. J. Hum. Gen. 32:314, 1980), Gibbs et al. (Nucl. Ac. Res. 17:2437, 1989), Newton et al. (Nucl. Ac. Res. 17:2503, 1989), Grossman et al. (Nucl. Ac. Res. 22:4527, 1994), and Saiki et al. (Proc. Nat. Acad. Sci. 86:6230, 1989), all of which are hereby incorporated by reference. A particularly useful method for this purpose is the primer extension assay disclosed by Fahy et al. (Nucl. Acids Res. 25:3102, 1997) and by Ghosh et al. (Am. J. Hum. Genet. 58:325, 1996), both of which references are hereby incorporated in their entireties, as is Krook et al. (Hum. Molec. Genet. 1:391, 1995) which teaches modification of primer extension reactions to detect multiple nucleotide substitutions, insertions, deletions or other mutations. Other examples of useful techniques for quantifying the presence of specific nucleic acid target sequences in a sample include but need not be limited to labeled probe hybridization to the target nucleic acid sequences with or without first partially separating target nucleic acids from other nucleic acids present in the sample.

[0050] Examples of other useful techniques for determining the amount of specific nucleic acid target sequences present in a sample based on specific hybridization of a primer to the target sequence include specific amplification of target nucleic acid sequences and quantification of amplification products, including but not limited to polymerase chain reaction (PCR; Gibbs et al., (1989) Nucl. Ac. Res. 17:2437), transcriptional amplification systems, strand displacement amplification and self-sustained sequence replication (3SR; Ghosh et al, (1995) in Molecular Methods for Virus Detection, Academic Press, NY, pp. 287-314), the cited references for which are hereby incorporated in their entireties. Examples of other useful techniques include ligase chain reaction, single stranded conformational polymorphism analysis, Q-beta replicase assay, restriction fragment length polymorphism (RFLP; Botstein et al., (1980) Am. J. Hum. Gen. 32:314) analysis and cycled probe technology, as well as other suitable methods that will be known to those familiar with the art.

[0051] In a particularly preferred embodiment of the invention, primer extension is used to quantify mtDNA mutations present in a biological sample. (Ghosh et al., (1996) Am. J. Hum. Genet. 58:325) This embodiment may offer certain advantages by permitting both wildtype and mutant mtDNA to be simultaneously quantified using a single oligonucleotide primer capable of hybridizing to a complementary nucleic acid target sequence that is present in a defined region of wildtype mtDNA and in a corresponding region of a mutated mtDNA sequence. Without wishing to be bound by theory, the use of a single primer for quantification of wildtype and mutated mtDNA is believed to avoid uncertainties associated with potential disparities in the relative hybridization properties of multiple primers and may offer other advantages. Where such a target sequence is situated adjacent to a mutated mtDNA nucleotide sequence position that is a nucleotide substitution, insertion or deletion relative to the corresponding wildtype mtDNA sequence position, primer extension assays may be designed such that oligonucleotide extension products of primers hybridizing to mutated mtDNA are of different lengths than oligonucleotide extension products of primers hybridizing to wildtype mtDNA. Accordingly, the amount of mutant mtDNA in a sample and the amount of wildtype mtDNA in the sample may be determined by quantification of distinct extension products that are separable on the basis of sequence length or molecular mass.

[0052] Sequence length or molecular mass of primer extension assay products may be determined using any known method for characterizing the size of nucleic acid sequences with which those skilled in the art are familiar. In a preferred embodiment, primer extension products are characterized by gel electrophoresis. In another preferred embodiment, primer extension products are characterized by mass spectrometry (MS), which may further include matrix assisted laser desorption ionization/time of flight (MALDI-TOF) analysis or other MS techniques known to those having skill in the art. See, for example, U.S. Pat. No. 5,622,824, U.S. Pat. No. 5,605,798 and U.S. Pat. No. 5,547,835, all of which are hereby incorporated by reference in their entireties. In another preferred embodiment, primer extension products are characterized by liquid or gas chromatography, which may further include high performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS) or other well known chromatographic methodologies.

[0053] In another particularly preferred embodiment of the invention, DNA in a biological sample containing mtDNA is first amplified by methodologies well known in the art, such that the amplification products may be used as templates in a method for detecting single nucleotide polymorphisms or homoplasmic mtDNA mutations present in the sample. Accordingly, it may be desirable to employ oligonucleotide primers that are complementary to target sequences that are identical in, and common to, wildtype and mutant mtDNA, for example PCR amplification templates and primers prepared according to Fahy et al. (Nucl. Acids Res., 25:3102, 1997) and Davis et al. (Proc. Nat. Acad. Sci. USA 94:4526, 1997; see also Hirano et al., Proc. Nat. Acad. Sci. USA 94:14894, 1997, and Wallace et al., Proc. Nat. Acad. Sci. USA 94:14900,1997.)

[0054] In certain other preferred embodiments, mtDNA mutations may be efficiently detected, screened and/or quantified by high throughput hybridization methodologies directed to independently probing a plurality of distinct mtDNAs, or a plurality of distinct oligonucleotide primers as provided herein, that have been immobilized as nucleic acid arrays on a solid phase support. Typically, the solid support may be silica, quartz or glass, or any other material on which nucleic acid may be immobilized in a manner that permits appropriate hybridization, washing and detection steps as known in the art and as provided herein. In preferred embodiments, solid-phase nucleic acid arrays are precisely spatially addressed, as described, for example, U.S. Pat. No. 5,800,992 (see also, e.g., WO 95/21944; Schena et al., 1995 Science 270:467-470, 1995; Pease et al., 1994 Proc. Nat. Acad. Sci. USA 91:5022; Lipshutz et al., 1995 Biotechniques 19: 442-447).

[0055] Detection of hybridized (e.g., duplexed) nucleic acids on the nucleic acid array may be achieved according to any known procedure, for example, by spectrometry or potentiometry (e.g., MALDI-MS). Within certain preferred embodiments the array contains oligonucleotides that are less than 50 bp in length. For high throughput screening of nucleic acid arrays, the format is preferably amenable to automation. It is preferred, for example, that an automated apparatus for use according to high throughput screening embodiments of the present invention is under the control of a computer or other programmable controller. The controller can continuously monitor the results of each step of the nucleic acid deposition, washing, hybridization, detection and related processes, and can automatically alter the testing paradigm in response to those results.

[0056] The present invention also provides compositions and methods that are useful in pharmacogenomics, for the classification and/or stratification of a subject or a patient population. Such stratification may involve, for example, correlation of single nucleotide polymorphisms or homoplasmic mtDNA mutations as provided herein with, for instance, one or more particular traits in a subject, such as, for example, indicators of the responsiveness to, or efficacy of, a particular therapeutic treatment or characteristic genomic DNA alterations, mutations, deletions, insertions or polymorphisms.

[0057] As described herein, determination of specific single nucleotide polymorphisms or homoplasmic mtDNA mutations may be used to stratify a patient population. Accordingly, in another preferred embodiment of the invention, determination of such mutations in a biological sample from a subject diagnosed with a disease may provide a useful correlative indicator for that subject. A disease subject so classified on the basis of one or more specific mutations may then be monitored using clinical parameters referred to above and known on the art, such that correlation between particular mtDNA mutations and any particular clinical score used to evaluate a disease may be monitored. For example, stratification of an AD patient population according to at least one of the single nucleotide polymorphisms or homoplasmic mtDNA mutations provided herein may provide a useful marker with which to correlate the efficacy of any candidate therapeutic agent being used in AD subjects. In a further preferred embodiment of this aspect of the invention, determination of one or more specific mtDNA mutations in concert with determination of an AD subject's APOE genotype may also be useful. These and related advantages will be appreciated by those familiar with the art.

[0058] In particularly preferred embodiments, oligonucleotide primers will be employed that permit specific detection of the single nucleotide polymorphisms or homoplasmic mtDNA point mutations disclosed in Table 3, wherein specific substitution and deletion mutations in mitochondrial genes including, for example, those encoding 12S rRNA, 16S rRNA, several tRNAs, COX1, COX2, COX3, cytochrome b, ATPase 8, ATPase 6, ND1, ND2, ND4 and ND5 are disclosed, as are numerous mutations in the mtDNA D-loop region. Each mutation listed in Table 3 is designated with (i) the identity of the particular nucleotide position of the mutation according to the wildtype human mtDNA sequence (Anderson et al., 1981 Nature 290:457; see also Andrews et al., 1999 Nature Genetics 23:147 and references cited therein), (ii) the mitochondrial gene region according to the convention of Anderson et al. (1981) and (iii) if the mutation is not a transition (purine-to-purine or pyrimidine-to-pyrimidine), the identity of the mutated nucleotide at that position in the case of a transversion (purine-to-pyrimidine or pyrimidine-to-purine), identified as disclosed herein, or of a deletion or insertion mutation. Thus, for example, the purine nucleotide G (guanine) situated at position 3010 of the wildtype mtDNA 16S rRNA gene is mutated to the purine nucleotide A (adenosine) in mtDNA analyzed from a substantial number of haplogroup H samples (see Table 3).

TABLE 3
HAPLOGROUP-SPECIFIC AND HAPLOGROUP-ASSOCIATED
MITOCHONDRIAL SINGLE NUCLEOTIDE POLYMORPHISMS
IN MTDNA OF 560 UNRELATED INDIVIDUALS
NP	GENE	TV/DEL/INS	HAPLOGROUP
A. Haplogroup-specific polymorphism
64	D-LOOP		A
235	D-LOOP		A
663	12S rRNA		A
1598	12S rRNA		A
1736	16S rRNA		A
3316	ND1		A
4248	ND1		A
4824	ND2		A
4970	ND2		A
6308	COI		A
7112	COI		A
7724	COII	A> T	A
8794	ATPase6		A
11314	ND4		A
12468	ND5		A
12811	ND5		A
13855	ND5		A
14364	ND6		A
16111	D-LOOP		A
16290	D-LOOP		A
16319	D-LOOP		A
827	12S rRNA		B
3547	ND1		B
4820	ND2		B
4977	ND2		B
6023	COI		B
6216	COI		B
6413	COI		B
6473	COI		B
6755	COI		B
7241	COI		B
9950	COIII		B
11177	ND4		B
15535	CYT B		B
16217	D-LOOP		B
249	D-LOOP	DEL	C
289	D-LOOP	DEL	C
290	D-LOOP	DEL	C
3552	ND1		C
4715	ND2		C
7196	COI	C> A	C
7694	COIII		C
8584	ATPase6		C
9545	COIII		C
10454	tRNA-R		C
12642	ND5		C
12978	ND5		C
14318	ND6		C
15487	CYT B	A> T	C
15930	tRNA-T		C
2092	16S rRNA		D
4883	ND2		D
5178	ND2	C> A	D
8414	ATPase8		D
11593	ND4	A> T	D
14668	ND6		D
3027	16S rRNA		E
3705	ND1		E
4491	ND2		E
7598	COII		E
239	D-LOOP		H
456	D-LOOP		H
477	D-LOOP		H
951	12S rRNA		H
961	12S rRNA		H
3277	tRNA-L		H
3333	ND1		H
3591	ND1		H
3796	ND1		H
3915	ND1		H
3992	ND1		H
4024	ND1		H
4310	tRNA-I		H
4336	tRNA-Q		H
4531	ND2		H
4727	ND2		H
4745	ND2		H
4772	ND2		H
4793	ND2		H
5004	ND2		H
6365	COI		H
6776	COI		H
6869	COI		H
7013	COI		H
8269	COII		H
8448	ATPase8		H
8602	ATPase6		H
8803	ATPase6		H
8839	ATPase6		H
8843	ATPase6		H
8898	ATPase6		H
9123	ATPase6		H
9150	ATPase6		H
9380	COIII		H
9804	COIII		H
10044	tRNA-G		H
11353	ND4		H
11560	ND4		H
12579	ND5		H
13404	ND5		H
13680	ND5		H
13759	ND5		H
14125	ND5		H
14350	ND6		H
14365	ND6		H
14470	ND6	T> A	H
14582	ND6		H
14872	CYT B		H
15466	CYT B		H
15789	CYT B		H
15808	CYT B		H
15833	CYT B		H
16162	D-LOOP		H
16293	D-LOOP		H
199	D-LOOP		I
250	D-LOOP		I
3447	ND1		I
3990	ND1		I
4529	ND2	A> T	I
6734	COI		I
8616	ATPase6	G> T	I
9947	COIII		I
10034	tRNA-G		I
10238	ND3		I
11065	ND4		I
12501	ND5		I
13780	ND5		I
15758	CYT B		I
16391	D-LOOP		I
228	D-LOOP		J
295	D-LOOP		J
462	D-LOOP		J
2158	16S rRNA		J
2387	16S rRNA		J
3394	ND1		J
5198	ND2		J
5633	tRNA-A		J
6464	COI	C> A	J
6554	COI		J
6671	COI		J
7476	tRNA-S		J
7711	COII		J
10084	ND3		J
10172	ND3		J
10192	ND3		J
10499	ND4L		J
10598	ND4L		J
10685	ND4L		J
11377	ND4		J
12127	ND4		J
12570	ND5		J
12612	ND5		J
13281	ND5		J
13681	ND5		J
13879	ND5		J
13933	ND5		J
14569	ND6		J
15679	CYT B		J
15812	CYT B		J
16069	D-LOOP		J
16092	D-LOOP		J
16261	D-LOOP		J
114	D-LOOP		K
497	D-LOOP		K
593	tRNA-F		K
1189	12S rRNA		K
2217	16S rRNA		K
2483	16S rRNA		K
3480	ND1		K
4295	tRNA-I		K
4561	ND2		K
5814	tRNA-C		K
6260	COI		K
9006	ATPase6		K
9055	ATPase6		K
9698	COIII		K
9716	COIII		K
9962	COIII		K
10289	ND3		K
10550	ND4L		K
10978	ND4		K
11299	ND4		K
11470	ND4		K
11485	ND4		K
11840	ND4		K
11869	ND4	C> A	K
11923	ND4		K
12954	ND5		K
13135	ND5		K
13740	ND5		K
13967	ND5		K
14002	ND5		K
14037	ND5		K
14040	ND5		K
14167	ND6		K
15884	CYT B		K
15946	tRNA-T		K
16224	D-LOOP		K
16234	D-LOOP		K
16463	D-LOOP		K
185	D-LOOP	G> T	L1
186	D-LOOP		L1
189	D-LOOP		L1
236	D-LOOP		L1
247	D-LOOP		L1
297	D-LOOP		L1
357	D-LOOP		L1
710	12S rRNA		L1
825	12S rRNA		L1
1048	12S rRNA		L1
1738	16S rRNA		L1
2245	16S rRNA		L1
2395	16S rRNA	DEL	L1
2758	16S rRNA		L1
2768	16S rRNA		L1
2885	16S rRNA		L1
3308	ND1		L1
3516	ND1	C> A	L1
3666	ND1		L1
3693	ND1		L1
3777	ND1		L1
3796	ND1	A> T	L1
3843	ND1		L1
4312	tRNA-I		L1
4586	ND2		L1
5036	ND2		L1
5393	ND2		L1
5442	ND2		L1
5603	tRNA-A		L1
5655	tRNA-A		L1
5913	COI		L1
5951	COI		L1
6071	COI		L1
6150	COI		L1
6185	COI		L1
6253	COI		L1
6548	COI		L1
6827	COI		L1
6989	COI		L1
7055	COI		L1
7076	COI		L1
7146	COI		L1
7337	COI		L1
7389	COI		L1
7867	COII		L1
8248	COII		L1
8428	ATPase8		L1
8655	ATPase6		L1
8784	ATPase6		L1
8877	ATPase6		L1
9042	ATPase6		L1
9072	ATPase6		L1
9347	COIII		L1
9755	COIII		L1
9818	COIII		L1
10321	ND3		L1
10586	ND4L		L1
10589	ND4L		L1
10664	ND4L		L1
10688	ND4L		L1
10792	ND4		L1
10793	ND4		L1
10810	ND4		L1
11176	ND4		L1
11641	ND4		L1
11654	ND4		L1
11899	ND4		L1
12007	ND4		L1
12049	ND4		L1
12519	ND5		L1
12720	ND5		L1
12810	ND5		L1
13149	ND5		L1
13276	ND5		L1
13485	ND5		L1
13506	ND5		L1
13789	ND5		L1
13880	ND5	C> A	L1
13980	ND5		L1
14000	ND5	T> A	L1
14148	ND5		L1
14178	ND6		L1
14203	ND6		L1
14308	ND6		L1
14560	ND6		L1
14769	CYT B		L1
14911	CYT B		L1
15115	CYT B		L1
15136	CYT B		L1
16148	D-LOOP		L1
16187	D-LOOP		L1
16188	D-LOOP	C> G	L1
16230	D-LOOP		L1
16264	D-LOOP		L1
16265	D-LOOP		L1
16360	D-LOOP		L1
16527	D-LOOP		L1
143	D-LOOP		L2
1442	12S rRNA		L2
1706	16S rRNA		L2
2332	16S rRNA		L2
2358	16S rRNA		L2
2416	16S rRNA		L2
2789	16S rRNA		L2
3495	ND1	C> A	L2
3918	ND1		L2
4158	ND1		L2
4185	ND1		L2
4370	tRNA-Q		L2
4767	ND2		L2
5027	ND2		L2
5285	ND2		L2
5331	ND2	C> A	L2
5581	tRNA-W		L2
5744	NON-CODING		L2
6713	COI		L2
7175	COI		L2
7274	COI		L2
7624	COII	T> A	L2
7771	COII		L2
8080	COII		L2
8206	COII		L2
8387	ATPase8		L2
8541	ATPase8		L2
8790	ATPase6		L2
8925	ATPase6		L2
9221	COIII		L2
10115	ND3		L2
11944	ND4		L2
12236	tRNA-S		L2
12630	ND5		L2
12693	ND5		L2
12948	ND5		L2
13803	ND5		L2
14059	ND5		L2
14544	ND6		L2
14566	ND6		L2
14599	ND6		L2
15110	CYT B		L2
15217	CYT B		L2
15229	CYT B		L2
15236	CYT B		L2
15244	CYT B		L2
15391	CYT B		L2
15629	CYT B		L2
15945	tRNA-T	T-INS	L2
16114	D-LOOP	C> A	L2
16213	D-LOOP		L2
16309	D-LOOP		L2
16390	D-LOOP		L2
200	D-LOOP		L3
2000	16S rRNA		L3
3438	ND1		L3
3450	ND1		L3
5773	tRNA-C		L3
6524	COI		L3
6587	COI		L3
6680	COI		L3
7424	COI		L3
7618	COII		L3
8616	ATPase6		L3
8618	ATPase6		L3
8650	ATPase6		L3
9554	COIII		L3
10086	ND3		L3
10373	ND3		L3
10667	ND4L		L3
10819	ND4		L3
11800	ND4		L3
13101	ND5	A> C	L3
13886	ND5		L3
13914	ND5	C> A	L3
14152	ND6		L3
14212	ND6		L3
14284	ND6		L3
15099	CYT B		L3
15311	CYT B		L3
15670	CYT B		L3
15824	CYT B		L3
15942	tRNA-T		L3
15944	tRNA-T	DEL	L3
16124	D-LOOP		L3
16327	D-LOOP		L3
930	12S rRNA		T
2141	16S rRNA		T
2850	16S rRNA		T
4688	ND2		T
4917	ND2		T
5277	ND2		T
6489	COI	C> A	T
7022	COI		T
8572	ATPase6		T
8697	ATPase6		T
9117	ATPase6		T
9899	COIII		T
10463	tRNA-R		T
11242	ND4		T
11812	ND4		T
12633	ND5	C> A	T
13368	ND5		T
13758	ND5	C> A	T
13965	ND5		T
14233	ND6		T
14687	tRNA-E		T
14905	CYT B		T
15028	CYT B		T
15274	CYT B		T
15607	CYT B		T
15928	tRNA-T		T
16163	D-LOOP		T
16182	D-LOOP	A> C	T
16186	D-LOOP		T
16294	D-LOOP		T
16296	D-LOOP		T
16324	D-LOOP		T
988	12S rRNA		U
1700	16S rRNA		U
1721	16S rRNA		U
2294	16S rRNA		U
3116	16S rRNA		U
3197	16S rRNA		U
3348	ND1		U
3720	ND1		U
3849	ND1		U
4553	ND2		U
4646	ND2		U
4703	ND2		U
4732	ND2		U
4811	ND2		U
5319	ND2		U
5390	ND2		U
5495	ND2		U
5656	NON-CODING		U
5999	COI		U
6045	COI		U
6047	COI		U
6146	COI		U
6518	COI		U
6629	COI		U
6719	COI		U
7109	COI		U
7385	COI		U
7768	COII		U
7805	COII		U
8473	ATPase8		U
9070	ATPase6	T> G	U
9266	COIII		U
9477	COIII		U
9667	COIII		U
10506	ND4L		U
10876	ND4		U
10907	ND4		U
10927	ND4		U
11197	ND4		U
11332	ND4		U
11732	ND4		U
12346	ND5		U
12557	ND5		U
12618	ND5		U
13020	ND5		U
13617	ND5		U
13637	ND5		U
14139	ND5		U
14179	ND6		U
14182	ND6		U
14620	ND6		U
14793	CYT B		U
14866	CYT B		U
15191	CYT B		U
15218	CYT B		U
15454	CYT B		U
15693	CYT B		U
15907	tRNA-T		U
16051	D-LOOP		U
16256	D-LOOP		U
16270	D-LOOP		U
16399	D-LOOP		U
4580	ND2		V
15904	tRNA-T		V
194	D-LOOP		W
1243	12S rRNA		W
1406	12S rRNA		W
3505	ND1		W
6528	COI		W
8994	ATPase6		W
10097	ND3		W
11674	ND4		W
11947	ND4		W
12414	ND5		W
13263	ND5		W
15775	CYT B		W
15884	CYT B	G> C	W
16292	D-LOOP		W
225	D-LOOP		X
226	D-LOOP		X
6371	COI		X
8393	ATPase8		X
8705	ATPase6		X
14470	ND6		X
15927	tRNA-T		X
−73	D-LOOP		not present
			in [H]
−7028	COI		not present
			in [H]
#####	ND4		not present
			in [H]
14766	CYT B		not present
			in [H]
B. Haplogroup-associated polymorphisms
16362	D-LOOP		A, C, D, E,
			H, L3
12705	ND5		A, C, D, E,
			I, L1, L2,
			L3, W, X
1888	16S rRNA		A, C, T
13708	ND5		A, J, X
8027	COII		A, L1
153	D-LOOP		A, X
207	D-LOOP		B, I, L2, W
13590	ND5		B, L2
9449	COIII		B, L3
499	D-LOOP		B, U
16325	D-LOOP		C, D
10400	ND3		C, D, E
14783	CYT B		C, D, E
10398	ND3		C, D, E, I,
			J, K, L1,
			L2, L3
15043	CYT B		C, D, E,
			I, T
489	D-LOOP		C, D, E, J
8701	ATPase6		C, D, E,
			L1, L2, L3
9540	COIII		C, D, E,
			L1, L2, L3
10873	ND4		C, D, E,
			L1, L2, L3
15301	CYT B		C, D, E,
			L2, L3
11914	ND4		C, K, L1, L2
16298	D-LOOP		C, V
3010	16S rRNA		D, H, J, U
16311	D-LOOP		H, K, L1, L3
93	D-LOOP		H, L1
16304	D-LOOP		H, T
16291	D-LOOP		H, U
16356	D-LOOP		H, U
16482	D-LOOP		H, U
15924	tRNA-T		I, K, U
10915	ND4		I, L1
204	D-LOOP		I, L2, W
8251	COII		I, W
1719	16S rRNA		I, X
14798	CYT B		J, K
15257	CYT B		J, K
5460	ND2		J, L1, W
185	D-LOOP		J, L3
11002	ND4		J, L3
4216	ND1		J, T
11251	ND4		J, T
15452	CYT B	C> A	J, T
16126	D-LOOP		J, T
9548	COIII		J, U
13934	ND5		J, U
5231	ND2		K, L1
709	12S rRNA		K, L1, T, W
1811	16S rRNA		K, U
11467	ND4		K, U
12308	tRNA-L		K, U
12372	ND5		K, U
182	D-LOOP		L1, L2
198	D-LOOP		L1, L2
769	12S rRNA		L1, L2
1018	12S rRNA		L1, L2
3594	ND1		L1, L2
4104	ND1		L1, L2
7256	COI		L1, L2
7521	tRNA-D		L1, L2
13650	ND5		L1, L2
16278	D-LOOP		L1, L2,
			L3, X
189	D-LOOP	A> C	L1, L3
2352	16S rRNA		L1, L3
13105	ND5		L1, L3
5046	ND2		L1, W
6152	COI		L2, U
15784	CYT B		L2, U, W
5147	ND2		L3, T
6221	COI		L3, X
5426	ND2		T, U
13734	ND5		T, U
13966	ND5		T, X

[0059] TV/DEL/INS column: all nucleotide substitutions are transitions unless indicated otherwise NP: nucleotide position; TV: transversion; DEL: deletion; INS: insertion

[0060] The data of Table 3 are also depicted in Table 4, wherein the frequencies of occurrence of particular “haplogroup-specific” (e.g., characteristic of only a single haplogroup) or “haplogroup-associated” (e.g., detected in two or more identified haplogroups) mitochondrial single nucleotide polymorphism among the 560 unrelated individuals analyzed are presented; full length mtDNA sequences of these 560 individuals are set forth at SEQ ID NOS:2-561 in the Sequence Listing.

TABLE 4
HAPLOGROUP-SPECIFIC AND HAPLOGROUP-ASSOCIATED POLYMORPHISMS
IN MTDNA OF 560 UNRELATED INDIVIDUALS
	HAPLOGROUP
			A	B	C	D	E	H	I	J	K	L1	L2	L3	M	T	U	V	W	X
		TV/	N	N	N	N	N	N	N	N	N	N	N	N	N	N	N	N	N	N
		DEL/	=	=	=	=	=	=	=	=	=	=	=	=	=	=	=	=	=	=
NP	GENE	INS	25	18	13	9	3	226	14	33	47	13	23	20	1	46	42	8	8	11	REF
64	D-LOOP		20	1		1		4
−73	D-LOOP		25	18	13	9	3	19	12	23	44	10	23	20	1	38	35		7	10
93	D-LOOP							15				3
114	D-LOOP										8
143	D-LOOP												4
153	D-LOOP		19				1	1												7
182	D-LOOP											9	4
185	D-LOOP						1			12		2	1	5
185	D-LOOP	G > T								1		6
186	D-LOOP											4
189	D-LOOP											4
189	D-LOOP	A > C	1				1				1	4		7					7
194	D-LOOP																		5	1
198	D-LOOP											3	3
199	D-LOOP							2	11		2				1
200	D-LOOP							1						7						1
204	D-LOOP							3	9			2	3						7
207	D-LOOP			3				1	7			1	2						6
225	D-LOOP																			7
226	D-LOOP							1												5
228	D-LOOP			1						13
235	D-LOOP		24							1
236	D-LOOP							1				3
239	D-LOOP							10
247	D-LOOP											12
249	D-LOOP	DEL			12
250	D-LOOP								10
289	D-LOOP	DEL			10
290	D-LOOP	DEL			10
295	D-LOOP							1		23
297	D-LOOP											4
357	D-LOOP											6
456	D-LOOP							16					1
462	D-LOOP									18
477	D-LOOP							13			1
489	D-LOOP				13	9	3			23					1
497	D-LOOP										25
499	D-LOOP			17												1	3
593	tRNA-F					1
663	12S		25																		3-6,
	rRNA																				14-17
709	12S			2				3			9	7		1		46	1		8		1
	rRNA
710	12S											7
	rRNA
750	12S		25	18	13	9	3	218	14	33	47	13	23	17	1	46	42	8	8	11
	rRNA
769	12S											13	23
	rRNA
825	12S											13
	rRNA
827	12S			17
	rRNA
930	12S		1										1			16					1
	rRNA
951	12S							3													1
	rRNA
961	12S							4
	rRNA
988	12S																3
	rRNA
1018	12S											13	23
	rRNA
1048	12S											2:L1a
	rRNA
1189	12S										34										1
	rRNA
1243	12S																		8		1
	rRNA
1406	12S																		5
	rRNA
1438	12S		25	18	13	9	3	208	12	33	47	6	23	20	1	46	42	8	8	11
	rRNA
1442	12S												3
	rRNA
1598	12S		2						1							1
	rRNA
1700	16S																4
	rRNA
1706	16S												3
	rRNA
1719	16S							2	14	1						1				11	1, 3,
	rRNA																				5, 6,
																					9, 12,
																					14
1721	16S																4				1
	rRNA
1736	16S		25
	rRNA
1738	16S											7
	rRNA
1811	16S							1			46						15				1
	rRNA
1888	16S		2		6					1						46					1
	rRNA
2000	16S													2							10
	rRNA
2092	16S					9															14
	rRNA
2141	16S															3
	rRNA
2158	16S									2							1				1
	rRNA
2217	16S							1			5
	rRNA
2245	16S											2:L1a
	rRNA
2294	16S																3
	rRNA
2332	16S												4	2
	rRNA
2352	16S											7		11							2, 3,
	rRNA																				6, 8,
																					10
2358	16S												3
	rRNA
2387	16S									2
	rRNA
2395	16S	DEL										4
	rRNA
2416	16S												23
	rRNA
2483	16S										2										1
	rRNA
2706	16S		25	18	13	9	3	13	14	31	47	13	23	20	1	46	42	8	8	11
	rRNA
2758	16S											13									2, 10
	rRNA
2768	16S											7
	rRNA
2789	16S												18
	rRNA
2850	16S															3
	rRNA
2885	16S											13
	rRNA
3010	16S					9		73		27			1	1			3				1
	rRNA
3027	16S						1	1
	rRNA
3116	16S																2				1
	rRNA
3197	16S					1											24				1, 4
	rRNA
3277	tRNA-L							2
3308	ND1											7	1
3316	ND1		2					1					1			1			1
3333	ND1							2
3348	ND1																2
3394	ND1						1	1		2											1
3438	ND1							1					1	3
3447	ND1								4												1
3450	ND1													6
3480	ND1										47										1
3495	ND1	C > A											3
3505	ND1																		8		1
3516	ND1	C > A										2:L1a
3547	ND1			14				2
3552	ND1				12						1
3591	ND1		1					2
3594	ND1											13	23								2, 3,
																					5, 6,
																					8, 10
3666	ND1					1		2				11
3693	ND1											7	1
3705	ND1						2						1				1			1
3720	ND1																7				1
3777	ND1											2
3796	ND1			1				3
3796	ND1	A > T						1				2
3843	ND1											2
3849	ND1																2
3915	ND1			1				9						1
3918	ND1			1									7			1	1
3990	ND1								3												1
3992	ND1							9
4024	ND1							10
4104	ND1											13	23			1
4158	ND1												3								2
4185	ND1							1					2
4216	ND1							2		33			1			46					1, 4
4248	ND1		25
4295	tRNA-I										3
4310	tRNA-I							2
4312	tRNA-I											2:L1a									4, 10
4336	tRNA-Q							10													1, 12,
																					14
4370	tRNA-Q												3
4491	ND2						2
4529	ND2	A > T							12												1, 3,
																					4, 9,
																					12, 14
4531	ND2							2
4553	ND2																4
4561	ND2							1			8						1
4580	ND2																	8			1,
																					3-5,
																					9
4586	ND2											2:L1a
4646	ND2							1									5:U4				1, 4
4688	ND2													1		2
4703	ND2																3
4715	ND2				13
4727	ND2							5
4732	ND2																2				1
4745	ND2							2													1
4767	ND2							1					3
4769	ND2		25	18	13	9	3	209	14	33	47	13	23	20	1	46	42	8	8	11
4772	ND2							2
4793	ND2							5								1
4811	ND2																2
4820	ND2			17													1
4824	ND2		25									1
4883	ND2					9
4917	ND2								1							46					1, 4
4970	ND2		2
4977	ND2			14
5004	ND2							11											1
5027	ND2												3
5036	ND2											7
5046	ND2											7		1					8		1
5147	ND2							1				1		3		16					1
5178	ND2	C > A				9															2-6,
																					11,
																					13-17
5198	ND2									3
5231	ND2										5	2:L1a
5277	ND2															5					1
5285	ND2												7
5319	ND2							1									2
5331	ND2	C > A											3
5390	ND2																7				1
5393	ND2											7
5426	ND2															7	7				1
5442	ND2							1				2:L1a			1
5460	ND2					1		1		2		2:L1a	1					1	8		1
5495	ND2																2				1
5581	tRNA-W												3				1
5603	tRNA-A											2:L1a
5633	tRNA-A									3											1
5655	tRNA-A											7
5656									1								4				1
5744													2
5773	tRNA-C													6
5814	tRNA-C												3
5913	COI		1								4										1
5951	COI											4
5999	COI															1	5:U4				1
6023	COI			3				2								1	1
6045	COI																7				1
6047	COI																5:U4				1
6071	COI											4
6146	COI																2
6150	COI											2		1
6152	COI												2			1	7				1
6185	COI											2:L1a
6216	COI			3
6221	COI												1	11		1				11	1
6253	COI							1				2
6260	COI		1			2		1			6						1
6308	COI		4
6365	COI							7
6371	COI																			11	1
6413	COI			3						1
6464	COI	C > A								2
6473	COI			14
6489	COI	C > A														5
6518	COI																2
6524	COI													2
6528	COI																		2
6548	COI											7
6554	COI									2
6587	COI													5
6629	COI																2
6671	COI						1	1		2
6680	COI						1							2
6713	COI												2
6719	COI							1									2
6734	COI								4												1
6755	COI			2				1
6776	COI							23													1
6827	COI							1			1	7
6869	COI							4
6989	COI											7
7013	COI							3
7022	COI															3
−7028	COI		25	18	13	9	3	12	14	33	47	13	23	20	1	46	42	8	8	11	3, 9
7055	COI			1								11									10
7076	COI											2
7109	COI																3
7112	COI		3
7146	COI											13
7175	COI												18
7196	COI	C > A			13
7241	COI			2
7256	COI											12	23
7274	COI												18
7337	COI											2
7385	COI																2				1
7389	COI											11
7424	COI							1						3
7476	tRNA-S									6											1
7521	tRNA-D											13	23
7598	COII						1														13
7618	COII													2
7624	COII	T > A											3
7694	COII				2
7711	COII									2
7724	COII	A > T	2
7768	COII																8				1
7771	COII												18
7805	COII																2
7867	COII											7
8027	COII		25									4
8080	COII												2
8206	COII												23
8248	COII											7
8251	COII								13							1			8		1, 3,
																					5, 9,
																					12, 14
8269	COII							8		1
8387	ATPase												3
	8
8393	ATPase																			5
	8
8414	ATPase					9															14
	8
8428	ATPase											2:L1a
	8
8448	ATPase							3
	8
8473	ATPase							4									2
	8
8541	ATPase												2
	8
8572	ATPase							1								2
	6
8584	ATPase				13
	6
8602	ATPase							3
	6
8616	ATPase	G > T							4												1
	6
8616	ATPase													2						1	1, 2,
	6																				10
8618	ATPase							2						3							1, 3,
	6																				6, 8,
																					10
8650	ATPase													4
	6
8655	ATPase											13
	6
8697	ATPase								1		1					46					1
	6
8701	ATPase				13	9	3					13	23	20	1	1
	6
8705	ATPase																			3	1
	6
8784	ATPase											2
	6
8790	ATPase												3
	6
8794	ATPase		25
	6
8803	ATPase							2
	6
8839	ATPase							2
	6
8843	ATPase							3													1
	6
8860	ATPase		25	18	13	9	3	220	14	33	47	13	23	20	1	46	42	8	8	11
	6
8877	ATPase											2
	6
8898	ATPase							2
	6
8925	ATPase												2
	6
8994	ATPase																		8		1, 3,
	6																				4, 9
9006	ATPase										2
	6
9042	ATPase											2:L1a
	6
9055	ATPase							1			47										1,
	6																				3-5,
																					9, 14
9070	ATPase	T > G															2
	6
9072	ATPase											4									2, 3,
	6																				8, 10
9117	ATPase							1								3
	6
9123	ATPase							11
	6
9150	ATPase							3
	6
9221	COIII												23
9266	COIII							1								1	3
9347	COIII											2:L1a
9380	COIII							6
9449	COIII		1	2										6
9477	COIII																23				1
9540	COIII				13	9	3					13	23	20	1
9545	COIII		1		12		1					1
9548	COIII									2							2
9554	COIII							1				1	1	2
9667	COIII										1						8				1
9698	COIII										47										1
9716	COIII										13
9755	COIII							1				2:L1a
9804	COIII							5
9818	COIII											2:L1a
9899	COIII															6
9947	COIII								3							1					1
9950	COIII			12						1
9962	COIII										3
10034	tRNA-G								12												1, 4,
																					5, 9,
																					12, 14
10044	tRNA-G							5													7
10084	ND3									4	1	1									1
10086	ND3													6							1-3,
																					6, 8,
																					10
10097	ND3																		2
10115	ND3												23								1
10172	ND3									3
10192	ND3									2
10238	ND3								14												1, 4
10289	ND3										3
10321	ND3											4									10
10373	ND3							1						6					1
10398	ND3				13	9	3		13	29	33	13	23	20	1						1, 2,
																					5, 6,
																					8, 9,
																					11-17
10400	ND3				13	9	3								1						4-6,
																					11,
																					13-17
10454	tRNA-R				2								1
10463	tRNA-R															46					1, 4
10499	ND4L									3											1
10506	ND4L																3
10550	ND4L										47
10586	ND4L							1				4
10589	ND4L							2				2:L1a				1
10598	ND4L			1		1				2
10664	ND4L											2:L1a
10667	ND4L													2
10685	ND4L			1				1		3							1
10688	ND4L											13
10792	ND4											2
10793	ND4											2
10810	ND4							2				13									1, 2,
																					5, 6,
																					8, 10
10819	ND4								1					11
10873	ND4				13	9	3					13	23	20	1						6
10876	ND4																7				1
10907	ND4							1									2:U4
10915	ND4							1	3			2:L1a									1
10927	ND4																2				1
10978	ND4										7
11002	ND4									2				3							6, 10
11065	ND4								2												1
11176	ND4											2:L1a		1			1
11177	ND4			14
11197	ND4																2				1
11242	ND4															2
11251	ND4									33						46					1
11299	ND4										47										1
11314	ND4		2
11332	ND4																5:U4				1, 4
11353	ND4							2					1
11377	ND4									3	1										1
11467	ND4										46						42				1
11470	ND4										11										1
11485	ND4										7
11560	ND4							2
11593	ND4	A > T				2
11641	ND4											2:L1a							1		3
11654	ND4											2
11674	ND4																		8		1
#####	ND4		25	18	13	9	3	6	14	33	47	13	23	20	1	46	42		8	11
11732	ND4																2				1
11800	ND4							2						3
11812	ND4											1:a				35					1
11840	ND4										7
11869	ND4	C > A									5
11899	ND4											2
11914	ND4				12			3			13	3	18	1		2
11923	ND4										3
11944	ND4												22
11947	ND4																		8		1
12007	ND4		22		1					2		2:L1a				1
12049	ND4											2
12127	ND4									2
12236	tRNA-S												3
12308	tRNA-L										47						42				1,
																					3-5,
																					9
12346	ND5						1	1		1							2
12372	ND5				1						47						42				1, 4
12414	ND5				1									1					8
12468	ND5		4
12501	ND5								14												1
12519	ND5											7
12557	ND5																2
12570	ND5									2
12579	ND5							2
12612	ND5									33											1, 4
12618	ND5																2				1
12630	ND5							2					3
12633	ND5	C > A														11					1
12642	ND5				2			2
12693	ND5												18
12705	ND5		25		13	9	3		14			13	23	19	1				8	11	1, 4
12720	ND5											2:L1a
12810	ND5											4									3, 8,
																					10
12811	ND5		2								1
12948	ND5												3
12954	ND5										7
12978	ND5				3
13020	ND5							2									7			1	1
13101	ND5	A > C												2
13105	ND5							2				13		10				1
13135	ND5										5
13149	ND5											2
13263	ND5				12														4		3, 4,
																					5, 11,
																					13-17
13276	ND5											2:L1a
13281	ND5									3
13368	ND5															46					1,
																					3-5,
																					9
13404	ND5							4
13485	ND5											4
13506	ND5											13
13590	ND5			17									23
13617	ND5																23				1
13637	ND5																4				1
13650	ND5											13	23
13680	ND5							2
13681	ND5									2
13708	ND5		3	1				4		33			3				1			5	1,
																					3-5,
																					9, 12,
																					14
13734	ND5															2	7				1
13740	ND5										7
13758	ND5	C > A														2
13759	ND5							3
13780	ND5								13												1
13789	ND5											11
13803	ND5												18								2, 10
13855	ND5		2
13879	ND5									2											1
13880	ND5	C > A										7
13886	ND5										1			3
13914	ND5	C > A												6
13933	ND5									3
13934	ND5									5							3
13965	ND5															8
13966	ND5															3				11	1
13967	ND5										3
13980	ND5						1					2
14000	ND5	T > A										4
14002	ND5										2
14037	ND5										5
14040	ND5										2
14059	ND5												3
14125	ND5							2
14139	ND5																3
14148	ND5											2
14152	ND6													3
14167	ND6										47										1
14178	ND6											11
14179	ND6																2
14182	ND6						1		1								8				1
14203	ND6											6
14212	ND6							2						11
14233	ND6								1							35					1
14284	ND6													3
14308	ND6						1				1	2:L1a
14318	ND6				12
14350	ND6							2
14364	ND6		4					1									1
14365	ND6							9
14470	ND6		1		1			1									1			11	1, 4
14470	ND6	T > A						3
14544	ND6												2								1
14560	ND6								1			11
14566	ND6												17
14569	ND6							3		2	1
14582	ND6							10
14599	ND6												2
14620	ND6																5:U4				1
14668	ND6					9
14687	tRNA-E															8
14766	CYT B		25	17	13	9	3	2	11	33	46	13	23	20	1	46	42		8	11	3
14769	CYT B				1							6					1
14783	CYT B				13	9	3								1
14793	CYT B																16				1
14798	CYT B									24	47										1
14866	CYT B																2:U4
14872	CYT B							2
14905	CYT B													3		46					1, 4
14911	CYT B											4
15028	CYT B															5					1
15043	CYT B				13	9	3		13						1	5					1, 4
15099	CYT B											1		2
15110	CYT B							1					3	1
15115	CYT B							1				7
15136	CYT B											2:L1a
15191	CYT B																2
15217	CYT B												3
15218	CYT B							2									13				1
15229	CYT B												2
15236	CYT B												2		1
15244	CYT B			1									7
15257	CYT B									6	3										1, 14
15274	CYT B															2
15301	CYT B			1	13	9	3				1	1	23	20	1		1
15311	CYT B													6
15326	CYT B		25	18	13	9	3	220	14	33	47	13	21	20	1	46	42	8	8	11
15391	CYT B												2
15452	CYT B	C > A								33						46					1
15454	CYT B																3
15466	CYT B							2
15487	CYT B	A > T			12
15535	CYT B			17
15607	CYT B															46					1, 4,
																					5, 9
15629	CYT B												7
15670	CYT B		1		2									5
15679	CYT B									2
15693	CYT B																5:U4				1
15758	CYT B								6			1				1					1
15775	CYT B																	1	2
15784	CYT B			1				1			1	1	17				3		4
15789	CYT B							2
15808	CYT B							2
15812	CYT B									3				1							1
15824	CYT B													6
15833	CYT B							9													1
15884	CYT B			1				3			4
15884	CYT B	G > C																	8		1
15904	tRNA-T																	8			1, 4
15907	tRNA-T																7				1, 4
15924	tRNA-T							3	11	1	12						2		1		1, 4
15927	tRNA-T																			5	1
15928	tRNA-T															46					1, 4,
																					9
15930	tRNA-T				6			2									1
15942	tRNA-T													4
15944	tRNA-T	DEL												6
15945	tRNA-T	T-INS											2
15946	tRNA-T										2
16051	D-LOOP				1			5						1		1	6
16069	D-LOOP									23
16092	D-LOOP		3	2						2	1
16111	D-LOOP		23	3									1
16114	D-LOOP	C > A											3				1
16124	D-LOOP													7
16126	D-LOOP							2		23		6				38
16148	D-LOOP											2:L1a
16162	D-LOOP							14								1
16163	D-LOOP															7
16172	D-LOOP							2	2	1		3		2			2
16182	D-LOOP	A > C		8				1						1		5
16186	D-LOOP															8
16187	D-LOOP											11
16188	D-LOOP	C > G						1				2:L1a
16213	D-LOOP												3
16217	D-LOOP			14
16224	D-LOOP					1					41
16230	D-LOOP											2:L1a
16234	D-LOOP		1		2		1	2		1	6			2					1
16256	D-LOOP																17	1
16261	D-LOOP			1			1	2		4
16264	D-LOOP							2				6		1
16265	D-LOOP											2
16270	D-LOOP		1								2	4					18
16278	D-LOOP		1	1				4		1		11	23	6			2			10
16290	D-LOOP		23								1
16291	D-LOOP		1					8				1		1			4
16292	D-LOOP											1	1			1			7
16293	D-LOOP							8				5
16294	D-LOOP							2				4	17	1		38	2
16296	D-LOOP							1								27
16298	D-LOOP			1	12			3								5		3
16304	D-LOOP							16	1		1					9
16309	D-LOOP							1			1		13
16311	D-LOOP				1		1	14	2	1	43	12	1	7		1	3	1	1
16319	D-LOOP		25	1	1					2	3
16320	D-LOOP							2	1		2	2:L1a		3
16324	D-LOOP							1								5
16325	D-LOOP		1	1	10	9		1
16327	D-LOOP				12									5
16356	D-LOOP							9									4
16360	D-LOOP											4
16362	D-LOOP		24		2	9	2	14		1	1		3	6	1		3		1
16390	D-LOOP		1		1	1	1		2	1			22				3	1
16391	D-LOOP		1						10
16399	D-LOOP											1	2	1		2	10
16463	D-LOOP										2
16482	D-LOOP							9
16527	D-LOOP				1							2				1
TV/DEL/INS column: all nucleotide substitutions are transitions unless indicated otherwise
NP: nucleotide position;
TV: transversion;
DEL: deletion;
INS: insertion
References
1: Finnilä et al. 2001 Am J Hum Genet 68:1475-1474
2: Chen et al. 2000 Am. J. Hum. Genet. 66:1362-1383
3: Alves-Silva et al. 2000 Am. J. Hum. Genet. 67:444-461
4: Macaulay et al. 1999 Am J Hum Genet 64:232-249
5: Wallace et al. 1999 Gene 238:211-230
6: Quintana-Murci et al. 1999Nat Genet 23:437-41
7: Lehtonen et al. 1999s in mtDNA
8: Rando et al. 1998Am J Hum Genet 62:531-550
9: Torroni et al. 1996. Genetics 144:1835-1850
10: Chen et al. 1995 Am J Hum Genet 57:133-149
11: Torroni et al. 1994 Am J Phys Anthropol 93:189-99
12: Torroni et al. 1994 Am J Hum Genet 55:760-776
13: Torroni et al. 1994 Am. J. Phys. Anthr. 93:189-199
14: Torroni et al. 1994 J Bioener Biomembr 26:261-71
15: Torroni et al. 1993 Am J Hum Genet 53:563-590
16: Torroni et al. 1992 Genetics 130:153-162
17: Wallace et al. 1992 Hum Biol 64:403-416

[0061] A mitochondrial single nucleotide polymorphism or homoplasmic mtDNA point mutation, which includes a deviation in the identity of the nucleotide base situated at a specific position in a mtDNA sequence relative to the “wildtype” human mtDNA sequence (CRS) disclosed by Anderson et al. (1981), may fall into at least one of the following categories: An “error” refers to sequencing mistakes in the human mtDNA sequence reported by Anderson et al. (1981), as corrected by Andrews et al. (1999 Nature Genetics 23:147). A “polymorphism” refers to a known polymorphism in a human mtDNA sequence that is not associated with a particular human disease, but that has been detected and described as a result of naturally occurring variability in the identity of the nucleotide base situated at a given position in a human mtDNA sequence (see, e.g., “Mitomap”, Emory University School of Medicine, available at http://www.gen.emory. edu/mitomap.html). A “rare polymorphism” refers to a mtDNA nucleotide that differs from the base situated at the corresponding position in the Cambridge Reference Sequence (CRS) of Anderson et al. (1981) but which, upon subsequent accumulation of human mtDNA sequence data from a plurality of subjects (and in contrast to the reliance of Anderson et al. upon the mtDNA sequence of a single donor to generate the CRS), suggests the presence of a low frequency allele in the CRS donor, relative to the larger sample population (see Andrews et al., 1999 Nature Genetics 23:147 and references cited therein). Particularly useful mutations that segregate with AD according to the present invention include homoplasmic mtDNA point mutations (e.g., single nucleotide polymorphisms) that are not errors, polymorphisms or rare polymorphisms as just described, and additionally, the homoplasmic mtDNA point mutations (e.g., single nucleotide polymorphisms). A number of polymorphisms are identified in Tables 3 and 4, and in FIGS. 1-6; full length mtDNA sequences of 560 unrelated human subjects are set forth at SEQ ID NOS:2-561 in the Sequence Listing.

[0062] In certain embodiments of the invention, the presence or absence of a specific genetic mutation or variation, such as, for example, a single nucleotide polymorphism or a deletion, that correlates with a specific haplogroup, disease or individual may be sufficient to determine the haplogroup, presence or risk of disease or identity of the individual from whom the biological sample being tested was obtained. In these situations, the association or correlation of a particular genetic mutation or variation with a haplogroup, disease or individual may be determined by means generally acceptable to those with skill in the relevant or a related art. For example, an association or correlation may be established by the presence of a statistically significant increase or decrease in the presence or absence of a single nucleotide polymorphism or other genetic alteration or marker in samples from subjects with a disease or haplogroup. An association or correlation with a specific indivudal may also be determined by a statistically significant presence or absence of a specific genetic mutation or alteration within mtDNA derived from the individual compared to the general population or a sample of other individuals.

[0063] In other embodiments of the invention, the determination of the presence or risk of a disease, the haplogroup or identity of an individual, or the genetic relationship between individuals may be determined by analyzing one or more genetic markers, including one or more mtDNA single nucleotide polymorphisms or deletions. In these situations, the correlation or association of one specific mtDNA mutation or alteration with a certain phenotype or individual need not be statistically significant in isolation. Rather, the overall analysis of multiple markers may be used to establish the association or correlation. The presence or absence of one or more markers together may be statistically associated or correlated with a disease, haplogroup or individual.

[0064] As presented below, the accompanying examples reveal that among individuals of the general population in the United States there are large differences in the frequencies of single nucleotide polymophisms (typically nucleotide substitutions) that are carried in the mtDNA genome (see also Table 3). While distinct sets of SNPs are associated with particular mtDNA haplogroups, individuals in the examples described below were found to carry up to 8 additional non-synonymous and 22 additional synonymous nucleotide substitutions in protein-coding genes, up to 8 nucleotide changes each in the ribosomal RNA and tRNA genes, and up to 13 changes in the D-loop region. Most of these nucleotide substitutions are likely to be of systemic nature as suggested by their detection following analyses of paired blood and skeletal muscle samples. Additionally, while the samples collected in the attached examples were non-neoplastic tissues, they exhibited some of the same nucleotide changes that were reported as acquired mutations in cancer tissue (Fliss, M. S. et al. (1999) Science 287:2017-2019). Thus, as also noted above and as shown in Table 3, the present invention provides non-haplogroup associated mitochondrial single nucleotide polymorphisms that may be used to determine the unique identity of an individual and/or to determine the presence of or risk for having a disease,(e.g., Alzheimer's disease, diabetes), in addition to providing improved profiles of mitochondrial single nucleotide polymorphisms for identifying a mitochondrial haplogroup and/or a mitochondrial haplogroup subgroup.

[0065] The present invention also contemplates compositions and methods for the detection of potentially pathogenic mtDNA mutations involved in human disease, either in the background of, or independent of, polymorphisms associated with mtDNA haplogroups. As noted above, the invention also provides materials and methods for haplogroup identification and genealogical and forensic analyses.

[0066] The following examples are offered by way of illustration, and not by way of limitation.

EXAMPLES

Example 1

DNA Isolation From Blood, Muscle and Brain Samples

[0067] Blood samples, muscle biopsies, and frozen brain samples were collected from 560 maternally unrelated individuals (as determined from family-history information) of European, African and Asian descent after institutional review board (IRB) approval and informed consent. The sampled population consisted of 38% females and 62% males ranging in age from 33-93 years and 24-103 years with mean ages of 72 and 61, respectively. Total cellular DNA was prepared from white blood cells and frozen brain tissue by homogenization and cell lysis in TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) containing proteinase K (400μ/ml) and 1% SDS at 37° C. for 12 hr, followed by phenol:chlorofom:isoamyl alcohol (50:48:2) and chloroform:isoamyl alcohol (24:1) extractions. Alternatively, mitochondria were isolated from frozen brain tissue and mtDNA was extracted. DNA was precipitated with ethanol and resuspended in TE buffer. DNA concentrations were determined by UV absorption at 260 nm.

Example 2

[0068] PCR Amplification, Sequencing and Sequence Analysis

[0069] MtDNA was amplified in 68 fragments of approximately 500 bp each in length with 50% overlap between neighboring fragments. PCR primers were 16-26 nucleotides in length and designed to be complementary to the mitochondrial light and heavy strands.

[0070] PCR amplification was performed as described below using the oligonucleotide primer set presented in Table 5 was used to generate 68 PCR product fragments spanning the complete mtDNA molecule, each fragment having approximately 50% sequence overlap with each neighboring product fragment. This strategy permitted direct mtDNA sequencing in both forward and reverse directions with four-fold redundancy in the identification of each nucleotide base, resulting in error-free sequencing. Thus, for each patient sample approximately 68,000 nucleotides were sequenced and analysis of homoplasmic mutations was verified.

TABLE 5
OLIGONUCLEOTIDE PRIMERS SPECIFIC FOR INDICATED REGIONS OF MITOCHONDRIAL GENOME
				PRIM.		SEQ	FRAG.
FRAGMENT	PRIMER	GENE	NUCLEOTIDE	LENGTH	PRIMER SEQUENCE 5′ −> 3′	ID NO.	LENGTH
201	201F	D-Loop	16225L	24	CAACTATCACACATCAACTGCA		512
					AC
	201R		168H	21	TCGCCTGTAATATTGAACGTA
202	202F	D-Loop	16477L	23	GCTAAAGTGAACTGTATCCGA		379
					CA
	202R		287H	21	GACTGTTAAAAGTGCATACCG
203	203F	D-Loop	155L	21	TATTTATCGCACCTACGTTCA		407
	203R		562H	18	AACTGTGGGGGGTGTCTT
204	204F	D-Loop/tRNA	275L	23	GACATGATAACAAAAAATTTC		510
		Phe/12S			CA
	204R		785H	18	GTGTGGCTAGGCTAAGCG
205	205F	D-Loop/tRNA	498L	16	CGCCCATCCTACCCAG		541
		Phe/12S
	205R		1039H	25	TCTTAGCTATTGTGTGTTCAGA
					TAT
206	206F	12S	773L	19	TGCAGCTCAAAACGCTTAG		525
	206R		1298H	18	CGTGGGTACTTGCGCTTA
207	207F	12S	1031L	24	GCTTTAACATATCTGAACACAC		505
					AA
	207R		1536H	24	CTTGTCTCCTCTATATAAATGC
					GT
208	208F	12S/tRNA	1285L	20	GAAGGCTACAAAGTAAGCGC		500
		Val/16S
	208R		1785H	17	TCATCTTTCCCTTGCGG
209	209F	12S/tRNA	1535L	24	TACGCATTTATATAGAGGAGA		461
		Val/16S			CAA
	209R		1996H	18	ATCACCAGGCTCGGTAGG
210	210F	16S	1780L	19	TAGTACCGCAAGGGAAAGA		417
	210R		2197H	19	GTTGAGCTTGAACGCTTTC
211	211F	16S	1986L	17	AGGCGACAAACCTACCG		411
	211R		2397H	23	GTGAGGGTAATAATGACTTGTT
					G
212	212F	16S	2165L	21	CCATAGTAGGCCTAAAAGCAG		420
	212R		2585H	22	AGTGATTATGCTACCTTTGCAC
213	213F	16S	2380L	24	CAATATCTACAARCAACCAAC		413
					AAG
	213R		2793H	20	ACCGAAATTTTTAATGCAGG
214	214F	16S	2580L	19	TAACCGTGCAAAGGTAGCA		405
	214R		2985H	18	CCTGATCCAACATCGAGG
215	215F	16S	2779L	21	CCTAAACTACCAAACCTGCAT		442
	215R		3221H	20	GCCATCTTAACAAACCTGT
216	216F	165/tRNA	2974L	19	AGGGTTTACGACCTCGATG		517
		Leu/ND1
	216R		3491H	17	GGTAGATGTGGCGGGTT
217	217F	16S/tRNA	3228L	19	TTGTTAAGATGGCAGAGCC		506
		Leu/ND1
	217R		3734H	20	AATGATGGCTAGGGTGACTT
218	218F	ND1	3482L	16	AGCCCCTAAAACCCGC		498
	218R		3980H	22	ATAATGTTTGTGTATTCGGCTA
219	219F	ND1	3718L	23	CAAACAATCTCATATGAAGTC		520
					AC
	219R		4238H	17	AGGGGGAATGCTGGAGA
220	220F	ND1/tRNAs	3967L	19	GCCCTATTCTTCATAGCCG		514
		Ile/Gln/Met/N
		D2
	220R		4481H	15	ATGACGGGTTGGGCC
221	221F	ND1/tRNAs	4224L	21	CATACCCATTACAATCTCCAG		511
		Ile/Gln/Met/N
		D2
	221R		4735H	26	TATTAATGATGAGTATTGATTG
					GTAG
222	222F	ND2	4481L	15	GGCCCAACCCGTCAT		508
	222R		4989H	20	GCTAAGATTTTGCGTAGCTG
223	223F	ND2	4691L	23	CCTCTTCAACAATATACTCTCC		548
					G
	223R		5239H	16	GGCAAAAAGCCGGTTA
224	224F	ND2	4979L	18	AAACCAGACCCAGCTACG		506
	224R		5485H	25	AAGATTATTAGTATAAAAGGG
					GAGA
225	225F	ND2/tRNAs	5234L	15	CCCGCTAACCGGCTT		480
		Trp/Ala/Asn
	225R		5714H	22	GAGAAGTAGATTGAAGCCAGT
					T
226	226F	ND2/tRNAs	5455L	17	TCATCGCCCTTACCACG		537
		Trp/Ala/Asn/Cys/Tyr+
		O-L
	226R		5992H	19	AGGAGGCTTAGAGCTGTGC
227	227F	tRNAs	5700L	20	TAAGCACCCTAATCAACTGG		542
		Ala/Asn/Cys/Tyr+
		O-L/CO1
	227R		6242H	20	CCTCCACTATAGCAGATGCG
228	228F	COI	5995L	21	CAGCTCTAAGCCTCCTTATTC		498
	228R		6493H	21	CAGCTAGGACTGGGAGAGATA
229	229F	COI	6230L	19	CCTACTCCTGCTCGCATCT		527
	229R		6757H	21	TATGGTGTGCTCACACGATAA
230	230F	COI	6476L	24	AGCAGTCCTACTTCTCCTATCT		510
					CT
	230R		6986H	25	GTCGTGTAGTACGATGTCTAGT
					GAT
231	231F	COI	6713L	23	CATAGGTATGGTCTGAGCTATG		517
					A
	231R		7230H	18	GGTGTATGCATCGGGGTA
232	232F	CO1/tRNA	6979L	24	CAAACTCATCACTAGACATCGT		501
		Ser			AC
	232R		7480H	17	ATGGGGTTGGCTTGAAA
233	233F	CO1/tRNAs	7225L	16	CGGACTACCCCGATGC		519
		Ser/Asp/COII
	233R		7744H	20	CCTGAGCGTCTGAGATGTTA
234	234F	tRNAs	7469L	18	CCCAAAGCTGGTTTCAAG		510
		Ser/Asp/COII
	234R		7979H	18	GTCAAGGAGTCGCAGGTC
235	235F	COII	7690L	20	CTTCCTAGTCCTGTATGCCC		557
	235R		8247H	18	GGGTAAATACGGGCCCTA
236	236F	COII/tRNA	7975L	16	AGGCGACCTGCGACTC		504
		Lys/ATPase 8
	236R		8479H	21	TTTATTTTTATGGGCTTTGGT
237	237F	COII/tRNA	8225L	22	ATTCCCCTAAAAATCTTTGAAA		516
		Lys/ATPase
		8/ATPase 6
	237R	8741H			25	GCAATAAAAATGATTAAGGAT
					ACTA
238	238F	ATPase	8499L	24	AAAATTATAACAAACCCTGAG		497
		8/ATPase 6			AAC
	238R		8996H	16	GCGGTTAGGCGTACGG
239	239F	ATPase	8722L	26	CGAACCTGATCTCTTATACTAG		515
		8/ATPase			TATC
		6/COIII
	239R		9237H	18	TCATGGGCTGGGTTTTAC
240	240F	ATPase	8978L	18	TTCAACCAATAGCCCTGG		506
		6/COIII
	240R		9484H	19	CAGAAAAATCCTGCGAAGA
241	241F	COIII	9229L	22	ATCATATAGTAAAACCCAGCC		505
					C
	241R		9734H	21	TCGAAGTACTCTGAGGCTTGT
242	242F	COIII/tRNA	9470L	21	CTCAGAAGTTTTTTTCTTCGC		537
		Glu
	242R		10007H	25	AGTTAATTGGAAGTTAACGGT
					ACTA
243	243F	COIII/tRNA	9732L	22	CTACAAGCCTCAGAGTACTTCG		520
		Glu/ND3
	243R		10252H	21	GGAGGGCAATTTCTAGATCAA
244	244F	COIII/tRNA	9976L	24	ATTGATGAGGGTCTTACTCTTT		523
		Glu/ND3/tRN			TA
		A Arg
	244R		10499H	23	CTAGAAGTGAGATGGTAAATG
					CT
245	245F	ND3/tRNA	10209L	26	TTCTCCATAAAATTCTTCTTAG		522
		Arg/ND4L			TAGC
	245R		10731H	26	AGTAGGTTTAGGTTATGTACGT
					AGTC
246	246F	tRNA	10450L	24	ATGATAATCATATTTACCAAAT		536
		Arg/ND4L/ND			GC
		4
	246R		10986H	18	GTTGGCTTGCCATGATTG
247	247F	ND4L/ND4	10719L	23	ACATATGGCCTAGACTACGTAC		511
					A
	247R		11230H	18	GCGATGAGTAGGGGAAGG
248	248F	ND4	10979L	17	CCCCTCACAATCATGGC		502
	248R		11481H	22	AGTGTGAGGCGTATTATACCAT
249	249F	ND4	11213L	20	TACACCCTAGTAGGCTCCCT		524
	249R		11737H	21	TTTGAGTTTGCTAGGCAGAAT
250	250F	ND4	11474L	20	GGCGGCTATGGTATAATACG		510
	250R		11984H	24	CCATTGTGTTGTGGTAAATATG
					TA
251	251F	ND4/tRNAs	11721L	24	TTACATCCTCATTACTATTCTG		511
		His/Ser			CC
	251R		12232H	18	TTAGACATGGGGGCATGA
252	252F	ND4/tRNAs	11968L	23	AGCCCTATACTCCCTCTACATA		538
		His/Ser/Leu/ND5			T
	252R		12506H	25	TTCGAGATAATAACTTCTTGGT
					CTA
253	253F	tRNAs	12213L	22	GCTCACAAGAACTGCTAACTC		516
		Ser/Leu/ND5			A
	253R		12729H	22	GAATAGGTTGTTAGCGGTAACT
254	254F	ND5	12458L	24	CATCCACCTTTATTATCAGTCT		532
					CT
	254R		12990H	17	ATTTGCCTGCTGCTGCT
255	255F	ND5	12714L	25	TACCATACTAATCTTAGTTACC		520
					GCT
	255R		13234H	21	AGTGGAGAAGGCTACGATTTT
256	256F	ND5	12979L	17	GGCCTCCTCCTAGCAGC		501
	256R		13480H	21	ACCTGTGAGGAAAGGTATTCC
257	257F	ND5	13225L	21	GACATCAAAAAAATCGTAGCC		504
	257R		13729H	25	AAATGTTGTTAGTAATGAGAA
					ATCC
258	258F	ND5	13472L	21	CATTAGCAGGAATACCTTTCC		506
	258R		13978H	19	CTAGGAGGAGTAGGGGCAG
259	259F	ND5/ND6	13720L	21	CTATTCGCAGGATTTCTCATT		517
	259R		14237H	16	GTGCGGGGGCTTTGTA
260	260F	ND5/ND6	13939L	19	CGCACAATCCCCTATCTAG		545
	260R		14484H	22	TTAATTTATTTAGGGGGAATGA
261	261F	ND6/tRNA	14209L	22	AACTACTACTAATCAACGCCCA		522
		Glu
	261R		14731H	22	GGTCATTGGTGTTCTTGTAGTT
262	262F	ND6/tRNA	14471L	20	CCAAAGACAACCATCATTCC		508
		Glu/Cyt b
	262R		14979H	18	CGTGAAGGTAGCGGATGA
263	263F	tRNA Glu/Cyt	14715L	23	ACCATCGTTGTATTTCAACTAC		514
		b			A
	263R		15229H	21	TAGCCTCCTCAGATTCATTGA
264	264F	Cyt b	14961L	22	ACGTAAATTATGGCTGAATCAT		518
	264R		15479H	20	CCTAGGAGGTCTGGTGAGAA
265	265F	Cyt b	15223L	22	CCTAGTTCAATGAATCTGAGGA		509
	265R		15732H	17	AATGAGGAGGTCTGCGG
266	266F	Cyt b/tRNA	15449L	24	TTCCTTCTCTCCTTAATGACATT		530
		Thr/Phe			A
	266R		15979H	20	TAGCTTTGGGTGCTAATGGT
267	267F	Cyt b/tRNAs	15723L	18	GACTCCTAGCCGCAGACC		509
		Thr/Phe/D-Loop
	267R		16232H	20	GGAGTTGCAGTTGATGTGTG
268	268F	tRNA Phe/D-Loop	15968L	22	TCTTTAACTCCACCATTAGCAC		517
	268R		16485H	24	GGAACCAGATGTCGGATACAG
					TTC

[0071] PCR amplifications were performed in triplicate, each containing 5-50 ng total cellular DNA or 1 ng mtDNA, 100 ng of each forward and reverse primers, and 12.5 μl of Taq PCR Master Mix (Qiagen) in a reaction volume of 25 μl. After denaturation at 95° C. for 2 min, amplification was carried out for 30 cycles at 95° C. for 10 sec, 60° C. for 10 sec, and 72° C. for 1 min, followed by 72° C. for 4 min and cooling to 4° C. Triplicate reactions were pooled and purified with the QIAquick 96 PCR Purification Kit (Qiagen). Sequencing reaction were preformed using 3 μl of PCR product, forward or reverse PCR primer, and BigDyeTerminator chemistry (Perkin-Elmer). Sequencing reactions were purified using Centri-Sep 96 plates (Princeton Separations). Electrophoresis and base calling was performed using a 3700 DNA Analyzer (Perkin-Elmer). Sequence data for the PCR fragments were built into contiguous mtDNA sequences using extensive source code modifications in the Contig Assembly Program (CAP; Thompson, J. D. et al., (1994) Nucl Acids Res 22:4673-4680) and aligned with the published sequence of mitochondrial DNA (e.g., SEQ ID NO:1) using modified publicly available FASTA (Pearson et al., 1990 Proc. Nat. Acad. Sci. USA 85:2444) and CLUSTALW (Thompson et al., 1994 Nucl. Ac. Res. 22:4673) software that was modified in order to identify nucleotide substitutions. Data analysis included categorization of sample sequences according to various parameters, including: patient haplogroup, mtDNA gene region in which an identified SNP resided and, for protein encoding mtDNA genes in which a SNP was identified, whether the SNP was a synonymous substitution (i.e., resulted in no change in the amino acid sequence of the encoded protein) or a non-synonymous substitution (i.e., resulted in a different amino acid sequence for the encoded protein). Full length mtDNA sequences from 560 unrelated human subjects are set forth as SEQ ID NOS:2-561.

Example 3

Single Nucleotide Polymorphisms in Mirochondrial DNA that Segregate with Specific Haplogroups

[0072] The distribution of mtDNA haplogroups amongst the 435 individual samples of European origin were 52%, 10.8%, 9.7%,10.6%, 7.6%, 1.8%, 3.2%, 1.8% and 2.5% for the haplogroups H (n=226), K (n=47), U (n=42), T (n=46), J (n=33), W (n=8), I (n=14), V (n=8) and X (n=11) respectively. The African mtDNA haplogroups L1, L2, and L3 were represented by 3.3%, 4.1%, and 7.4%, respectively, in our population before collection of additional African American individuals in order to expand data sets for the L haplogroups, which totaled 56 individual subjects; 69 samples were obtained from individual subjects of Asian descent. Novel polymorphisms were identified that were associated, either as “haplogroup-specific” or “haplogroup-associated” polymorphisms as described above, with one (haplogroup-specific) or more (haplogroup-associated) of mtDNA haplogroups A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W and X (Tables 3 and 4). Novel nucleotide substitutions that were specific for individual European haplogroups are C114T, C497T, T1189C, A3480G, T9698C, A10550G, A10978C, T11299C, A11470G, T12954C, C14167T and T14798C for haplogroup K; T3197C, A7768G, G9477A, T13617C, T14182, A14793G, A15218G and C16256T for haplogroup U; G228A, C295T, C462T and G15257A for haplogroup J; G930A, G1888A, T5426C, C6489A, G8697A, A11812G, T13965C, A14233G and C16296T for haplogroup T; T1243C, A3505G, G5046A, G5460A, C11674T and G15884C for haplogroup W; T250C, G12501A, and A13780G for haplogroup I; T239C, C456T, T4336C, T677C, A16162G for haplogroup H; T16298C for haplogroup V; G225A, T226C, G6371T, C8393T, A13966G, and G15927A for haplogroup X. Other novel SNPs are shared by two of the European haplogroups, i.e., A181 IG and Al 1467G, which occurred in haplogroups U and K; G207A in haplogroups I and W; T4216C, A11251G, and C15452A in haplogroups J and T; T16304C in haplogroups H and T; A15924G in haplogroups I and K; G13708A in haplogroups J and X. Many of these novel SNPs allowed for the identification of novel subgroups for haplotypes H, K, U, J, and T based on CLUSTALW/NJPLOT7 analysis (FIG. 1).

[0073] Nucleotide substitutions at positions T489C, G709A, G3010A, T6221C, G11914A, C12705T, G14905A, G15043A, C16223T, C16294T and T16362C were found in European and African haplogroups. In this regard, they are “haplogroup associated” rather than “haplogroup specific”. The finding that all individuals not belonging to haplogroup H carried the nucleotide substitutions A73G, C7028T, and G11719A, which were absent in most of the H haplotypes (93-99%), confirmed a previous report (Andrews, R. M. et al. (1999) Nature Genetics 23:147).

Example 4

Single Nucleotide Polymorphisms and Deletions in Mitochondrial DNA that Segregate with African Haplogroups

[0074] Nucleotide changes that were novel and unique to all members of the three African mtDNA haplogroups are A8701G, T9540C, and T10873C. In addition to the unique changes previously identified for the L1 and L2 haplogroups at T10810C and G16390A, respectively, the substitutions G247A, T825A, G2758A, T2885C, G3666A, T7146, C8468T, C8655T, G10688A, C13506T, T13789C, T14178C, G14560A, and C16187T were found in all (or all but one) haplogroup L1 mtDNAs, whereas the substitutions T2416C, G8206A, A9221G, T10155C, T11944C, and G13590A were present in all (or all but one) haplogroup L2 mtDNAs. Changes at nucleotide positions 2758, 2768, 3308, and 16187, previously reported and not associated with any mtDNA haplogroup, were found in haplogroup L1 mtDNA (Table 3). Nucleotide substitutions that were found both in haplogroups L1 and L2 in addition to C3594T were C182T, G769A, G1018A, A4104G, C7256T, T7521C, and C13650T. A nucleotide substitution found in haplogroups L1 and L3 was A13105G, and a substitution found in L2 and L3 was G15301A.

[0075] The African L3 haplotypes were identified based on the absence of the HpaI restriction site at nucleotide position 3592 which corresponds to the absence of a C to T transition at nucleotide position 3594, and also the absence of substitutions at positions 182, 769, 1018, 4104, 7256, 7521, and 13650. Nucleotide changes that occurred in L3 mtDNA only were A249del, A289del, A290del, C2092T, T2352C, C4883T, C5178A, C6587T, C8650T, A9545G, A14152G, C14668T, T15670C, T15942C, C3450T, T3552A, A4715G, G5733A, T6221C, C7196A, G8584A, C9449T, A10086G, G10373A, C10400T, A10819G, A13263G, C13914A, T14212C, T14318C, T14783C, A15311G, A15487T, A15824G, G15930A, T15944del, T16124C, T16325C, and C16327T. Many of these nucleotide changes were clustered in subgroups of L3 (FIG. 2). All of the L3 haplotypes were characterized by the absence of polymorphisms that were present in one or both of the other African haplogroups, except for substitutions A13105 and G15301A, which were also present in some of L1 and all of L2 mtDNAs, respectively. Of the three African haplogroups identified to date, the L3 mtDNA haplogroup that was found in the population sample described herein appeared to be of most recent origin, based according to non-limiting theory on the observation that the overall level of sequence divergence was lower than for the L1 and L2 haplogroups.

[0076] Additional clusters of polymorphisms (Tables 3 and 4) were detected and their relationships plotted using reduced meridian networks (Bandelt et al. 1995 Genetics 141:743) for European mtDNA haplogroups (FIG. 3), for European H and V mtDNA haplogroups (FIG. 4), for African mtDNA haplogroups (FIG. 5) and for Asian mtDNA mtDNA haplogroups (FIG. 6).

Example 5

Single Nucleotide Polymorphisms in Mitochondrial DNA that Correlate with Cancer and Tumors

[0077] None of the somatic changes previously reported in colorectal cancer tissue were found in tissues from the population analyzed here. More than one-third of the somatic changes previously found in lung, bladder, and head and neck tumors were also detected in the herein described population which included non-neoplastic blood, brain, and skeletal muscle samples (Table 2). The A1811G polymorphism was associated with mtDNA haplogroups K and U and was detected in 100% of the haplogroup K and in 29% of the haplogroup U mtDNAs for which the entire mtDNA was sequenced, and in an additional 24 blood samples from individuals for which only the ribosomal RNA genes were analyzed. The G2758A, A2768G, T3308C, G10688A, T10810C, and T16187C changes were associated specifically with haplogroup L1 mtDNAs and appeared together with a number of other polymorphisms (Table 1, FIG. 1). The A to C substitution (not C to A as previously reported) was found at nucleotide 16183 in 25 individual blood samples (12% of our sample population) and in four paired skeletal muscle samples from the same individuals. Furthermore, nucleotide substitutions at positions 150 (C to T), 195 (T to C) and 16519 (T to C) were common systemic polymorphisms which were found in 13%, 25% and 70%, respectively, of the herein characterized population. These substitutions were present in blood and brain, and in all skeletal muscle tissues paired with blood samples. Nucleotide substitution A4917G was found in all of haplogroup T mtDNAs where it was associated with other T-specific polymorphisms (Table 3, FIG. 1).

[0078] From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

1. A method for determining the mitochondrial haplogroup of a subject, comprising: determining, in a biological sample comprising mitochondrial DNA from a subject, the presence of at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup.

2. The method of claim 1 wherein the mitochondrial DNA is amplified.

3. The method of claim 1 wherein at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is present in a mitochondrial DNA region selected from the group consisting of a D-loop, a mitochondrial rRNA gene, a mitochondrial NADH dehydrogenase gene, a mitochondrial tRNA gene, a mitochondrial cytochrome c oxidase gene, a mitochondrial ATP synthase gene and a mitochondrial cytochrome b gene.

4. The method of claim 1 wherein at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is selected from the group consisting of a haplogroup-specific polymorphism and a haplogroup-associated polymorphism, wherein a mitochondrial single nucleotide polymorphism that is haplogroup-specific is, for a halogroup selected from the group consisting of A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W and X, located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of:

5. The method of claim 1 wherein the mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is a haplogroup-specific polymorphism that is present in members of only one haplogroup selected from the group consisting of A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W and X, located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of:

6. A method for determining a mitochondrial haplogroup subgroup of a subject, comprising: determining, in a biological sample comprising mitochondrial DNA from a subject, the presence of at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup subgroup.

7. The method of claim 6 wherein the mitochondrial haplogroup is selected from the group consisting of haplogroups K, U, J, T, W, I, H, V, X, L1, L2 and L3.

8. The method of claim 6 wherein at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup subgroup is a mitochondrial single nucleotide polymorphism located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 3010, 16162, 16189, 16304, 1811, 3197, 9477, 14793, 16256, 13617, 16270, 7768, 14182, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497, 11470, 11914, 15924, 3010, 10398, 12612, 13798, 16069, 295, 489, 228, 462, 16193, 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16189, 16294, 5426, 6489, 11812, 15043, 16298, 12633, 16163 and 16186.

9. A method for determining a mitochondrial haplogroup subgroup of a subject, comprising: determining in a biological sample comprising mitochondrial DNA from a subject of known mitochondrial haplogroup selected from the group consisting of haplogroups K, U, X, I, J, T, L1, L2 and L3, the presence or absence of a set comprising a plurality of single nucleotide polymorphisms wherein each polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1, the set selected from the group consisting of: a first haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311 and 709; a second haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189 and 10398; a third haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398 and 497; a fourth haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497 and 11914; a fifth haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497, 11914, 11470 and 15924; a sixth haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497; 11914, 11470, 15924, 12978 and 12954; a seventh haplogroup K subgroup comprising a polymorphism at positions 1147, 12308, 12372, 1811, 3480, 9055, 9698, 10550, 11299, 14167, 14798, 16224, 16311, 1189, 10398, 497; 11914, 11470, 15924, 12978, 12954 and 114; a first haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372 and 1811; a second haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270; a third haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270, 7768 and 14182; a fourth haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270, 14793 and 16256; a fifth haplogroup U subgroup comprising a polymorphism at positions 11467, 12308, 12372, 3197, 9477, 13617, 16270, 14793, 16256 and 15218; a first haplogroup X subgroup comprising a polymorphism at positions 12705, 16223, 1719, 6221, 6371, 13966, 14470, 16278 and 225; a second haplogroup X subgroup comprising a polymorphism at positions 12705, 16223, 1719, 6221, 6371, 13966, 14470, 16278, 225 and 226; a first haplogroup I subgroup comprising a polymorphism at positions 12705, 16223, 1719, 10238, 10398, 12501, 13780 and 15043; a second haplogroup I subgroup comprising a polymorphism at positions 12705, 16223, 1719, 10238, 10398, 12501, 13780, 15043, 250, 4529, 10034, 15924 and 16391; a first haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069 and 16126; a second haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295 and 489; a third haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295, 489 and 15257; a fifth haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295, 489 and 462; a sixth haplogroup J subgroup comprising a polymorphism at positions 4216, 11251, 15452, 3010, 10398, 12612, 13708, 16069, 16126, 295, 489, 462 and 228; a first haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294 and 12633; a second haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 12633, 16163 and 16186; a third haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 11812, 14233 and 16296; a fourth haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 11812, 14233, 16296, 930, 5147 and 16304; a fifth haplogroup T subgroup comprising a polymorphism at positions 709, 1888, 4917, 8697, 10463, 13368, 14905, 15607, 15928, 16126, 16294, 11812, 14233, 16296, 5426, 6489 and 15043; a first haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187 and 16311; a second haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311 and 182; a third haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311, 182, 8027 and 16294; a fourth haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311, 182, 357, 709, 710, 1738, 2352, 2768, 3308, 3693, 5036, 5393, 5655, 6548, 6827, 6989, 7867, 8248, 12519, 13880, 14203, 15115, 16126 and 16264; a fifth haplogroup L1 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 247, 825, 2758, 2885, 2666, 7055, 7146, 7389, 8468, 8655, 10688, 10810, 13105, 13506, 13789, 14178, 14560, 16187, 16311, 182, 357, 709, 710, 1738, 2352, 2768, 3308, 3693, 5036, 5393, 5655, 6548, 6827, 6989, 7867, 8248, 12519, 13880, 14203, 15115, 16126, 16264 and 14769; a first haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278 and 16390; a second haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390 and 182; a third haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390, 2789, 7175, 7274, 7771, 11914, 12693, 13803, 14566, 15784 and 16294; a fourth haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390, 2789, 7175, 7274, 7771, 11914, 12693, 13803, 14566, 15784, 16294 and 16309; a fifth haplogroup L2 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 769, 1018, 3594, 4104, 7256, 7521, 13650, 2416, 8206, 9221, 10115, 11944, 13590, 15301, 16278, 16390, 2789, 7175, 7274, 7771, 11914, 12693, 13803, 14566, 15784, 16294, 16309, 3918, 5285, 15244, 15629; a first haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301; a second haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 13105; a third haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 13105, 3450, 5773, 6221, 9449, 10089, 10373, 13914, 15311, 15824, 15944, 16124, 16278 and 16362; a fourth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783 and 15043; a fifth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 2092, 3010, 4883, 5178, 6578, 14668 and 16325; a sixth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043 and 16362; a seventh haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584 and 16298; an eighth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584, 16298, 249, 3552, 9545, 11914, 13263, 14318, 15487, 16325 and 16327; a ninth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584, 16298, 249, 3552, 9545, 11914, 13263, 14318, 15487, 16325, 16327, 289 and 290; and a tenth haplogroup L3 subgroup comprising a polymorphism at positions 8701, 9540, 10398, 10873, 12705, 16223, 15301, 489, 10400, 14783, 15043, 4715, 7196, 8584, 16298, 249, 3552, 9545, 11914, 13263, 14318, 15487, 16325, 16327, 289, 290 and 15930.

10. A method for determining a genetic relationship between two subjects, comprising: determining, in each of a first biological sample comprising mitochondrial DNA from a first subject and a second biological sample comprising mitochondrial DNA from a second subject, the presence or absence of at least one mitochondrial single nucleotide polymorphism, wherein either (i) the presence of at least one mitochondrial single nucleotide polymorphism in both of said first and second biological samples, or (ii) the absence of at least one mitochondrial single nucleotide polymorphism from both of said first and second biological samples, indicates a genetic relationship between the subjects, and therefrom determining the genetic relationship between the subjects.

11. The method of claim 10 wherein at least one mitochondrial single nucleotide polymorphism is associated with a mitochondrial haplogroup that is selected from the group consisting of haplogroups A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W and X.

12. The method of claim 10 wherein at least one mitochondrial single nucleotide polymorphism that is associated with a mitochondrial haplogroup is a haplogroup-specific polymorphism that is present in members of only one haplogroup selected from the group consisting of A, B, C, D, E, H, I, J, K, L1, L2, L3, T, U, V, W and X, located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of:

13. A method for determining a genetic relationship between (i) an unknown source or biological subject from which an unidentified sample is obtained, and (ii) a known source or biological subject from an identified sample is obtained, comprising: determining presence or absence of at least one mitochondrial single nucleotide polymorphism, in each of a first biological sample derived from an unknown subject or biological source and a second biological sample derived from a known subject or biological source, wherein said first and second biological samples each comprise mitochondrial DNA, wherein either (i) the presence of at least one mitochondrial single nucleotide polymorphism in both of said first and second biological samples, or (ii) the absence of at least one mitochondrial single nucleotide polymorphism from both of said first and second biological samples, indicates a genetic relationship between the subjects, and therefrom determining the genetic relationship between the biological samples.

14. A method of determining the presence of or the risk for having a disease associated with a mitochondrial DNA single nucleotide polymorphism, comprising: (a) identifying at least one haplogroup-associated mitochondrial DNA single nucleotide polymorphism in a biological sample comprising mitochondrial DNA from a subject suspected of having or being at risk for having a disease associated with a mitochondrial DNA single nucleotide polymorphism; and (b) identifying in said sample at least one disease associated mitochondrial DNA single nucleotide polymorphism that is not a haplogroup-associated mitochondrial DNA single nucleotide polymorphism, and therefrom determining the presence or risk of disease.

15. The method of claim 14 wherein the disease associated mitochondrial DNA single nucleotide polymorphism that is not a haplogroup-associated mitochondrial DNA single nucleotide polymorphism is a type 2 diabetes-associated polymorphism.

16. The method of claim 14 wherein the disease associated mitochondrial DNA single nucleotide polymorphism that is not a haplogroup-associated mitochondrial DNA single nucleotide polymorphism is an Alzheimer's disease-associated polymorphism.