MODIFIED BETA-LACTAMASE AND METHOD FOR ITS PREPARATION

FIELD OF THE INVENTION

Various antibiotics are used in the treatment of bacterial infections. However, the antibiotics do not only attack pathogens, but they also affect the normal bacterial flora, leading to adverse side effects e.g. in the patient's intestine. These side effects can be reduced by administering enzymes capable of degrading residual antibiotic in the intestine. The present invention relates to modified metallo-beta-lactamases that are useful in treating and preventing adverse effects of antibiotics having a beta-lactam ring, or in the preparation of such enzymes. The invention is also directed to a method for preparing the modified beta-lactamases as well as to nucleotide molecules, vectors and host cells useful therein.

BACKGROUND OF THE INVENTION

Beta-lactamase enzymes represent a major mechanism of resistance among bacteria to beta-lactam antibiotics, which include penicillins, cephalosporins and carbapenems. These enzymes catalyse the irreversible hydrolysis of the amide bond of the beta-lactam ring to create ineffective antimicrobial agents. On the basis of molecular structure classification and catalytic mechanisms the beta-lactamases can be divided into four classes: A, B, C, and D. Classes A, C and D are serine enzymes and comprise the majority of the beta-lactamases (Ambler, 1980). These enzymes generally inactivate penicillins or cephalosporins and often show a preference for one of these two antibiotics.

Class B beta-lactamases are metallo-enzymes that require one or two zinc ions as a cofactor for enzyme activity. The metallo-beta-lactamases constitute group 3 in the Bush-Jacoby-Madeiros functional classification (Bush, 1998). This schema is primarily based on substrate profiles, their sensitivity to EDTA and their resistance to serine beta-lactamase inhibitors. Based on structural similarities in the region that coordinates zinc binding, metallo-beta-lactamases can be divided into three subgroups, B1, B2, and B3 (Galleni et al., 2001). Subgroup B1 possesses three histidines and one cysteine as the key zinc coordinating residues. Crystallographic structures have been described for many subgroup B1 enzymes such as BcII of Bacillus cereus (Carfi et al, 1995 and 1998a), CcrA of Bacteroides fragilis and (Carfi et al., 1998b) and IMP-1 of Pseudomonas aeruginosa (Concha et al., 2000). Correspondingly, subgroup B2 lactamases have an arginine residue, instead of histidine, at the first position of the principal zinc binding motif, NXHXD. Recently, the first crystal structure of a subgroup B2 enzyme (CphA) has been solved by Garau et al. (2005). Subgroup B3 contains enzymes with multimeric structure (Walsh et al., 2005).

Metallo-beta-lactamases show a broad spectrum substrate profile including penicillins and cephalosporins, and they are resistant to the action of common conventional serine beta-lactamase inhibitors such as clavulanic acid sulbactam and tazobactam. Furthermore, unlike most of the serine beta-lactamases, metallo-beta-lactamases have the capability to hydrolyze carbapenems such as meropenem and imipenem. Various numbers of bacteria are known to produce metallo-beta-lactamases. They are commonly expressed among the Enterobacteriae genus (including Serratia marcescens, Klebsiella pneumoniae, Citrobacter freudii, Shigella flexneri), Pseudomonas aeruginosa, Stenobacterium maltophila, Acinetobacter genus, Bacteroides fragilis, Bacillus cereus, Flavobacteruim odoratum, and Bacteroides fragilis (Walsh et al., 2005).

Beta-lactamases can be utilized as pharmaceutical proteins to inactivate unabsorbed beta-lactams in the gastro intestinal tract in order to prevent the beta-lactam induced adverse effects including alterations in intestinal normal microbiota and the overgrowth of beta-lactam resistant bacteria (WO93/13795, WO2004/016248). For efficient beta-lactamase therapy in the small intestinal tract the enzyme should be resistant to the action of intestinal proteases in the presence of bile acids and preserve high enzymatic activity at a wide range of pH (5.5-7.5).

The feasibility of targeted enzyme therapy in canine and mouse models was demonstrated by employing a Bacillus licheniformis serine beta-lactamase during parenteral ampicillin medication (Harmoinen et al., 2004, Mentula et al., 2004, Stiefel et al., 2003). However, the substrate profile of this enzyme essentially limits its use as a drug substance since it has poor capacity to hydrolyze cephalosporins, carbapenems or penicillins in the presence of beta-lactamase inhibitors. Consequently, a new protease resistant beta-lactamase enzyme with broad beta-lactam spectrum is indispensable to extend the use of beta-lactamase therapy among hospitalized patients under intravenous medication with various beta-lactams.

Metallo-beta-lactamases are known to inactivate various types of beta-lactams and they are resistant to inhibitors of serine beta-lactamases. Bacillus cereus strains are known to produce metallo-beta-lactamase that belongs to group B1. A semi purified recombinantly produced metallo-beta-lactamase sample of a clinical Bacillus cereus 98ME1552 isolate was shown to eliminate the overgrowth of potential pathogenic bacteria in a mouse model (Stiefel et al., 2005). However, the present inventors found that this metallo-beta-lactamase preparation contained a mixture of beta-lactamase variants, which declines its value as a pharmaceutical protein, since variations of a drug substance reduce the robustness of the production process, increase batch to batch variations, and make clinical trials difficult, which of course has a negative impact on its registration as a medicament.

The present invention now provides means for reducing the amino terminal heterogenicity that was found to be associated with recombinant production of metallo-beta-lactamase. The invention further provides modified metallo-beta-lactamases that can be produced in substantially pure form and that can be used in the manufacture of pharmaceutical compositions.

SUMMARY OF THE INVENTION

The invention provides a modified metallo-beta-lactamase protein having the general formula:

NH₂—K-T-E-ΔBL-COOH (I)

wherein

K is lysine

T is threonine

E is glutamic acid, and

ΔBL is a metallo-beta-lactamase protein that has been truncated at the amino terminal end so as to leave four beta-strands before the first alpha-helix of the predicted secondary structure of said protein.

The invention further provides an isolated nucleotide molecule comprising a nucleotide sequence encoding said modified metallo-beta-lactamase protein, as well as an expression vector containing the nucleotide molecule, and a host cell capable of expressing the metallo-beta-lactamase protein encoded by the nucleotide molecule.

The invention also provides a modified metallo-beta-lactamase protein having the general formula

NH₂-E-ΔBL-COOH (II)

wherein

E and ΔBL are as defined above.

The invention still further provides a method of preparing a modified metallo-beta-lactamase protein, said method comprising culturing said host cell under conditions enabling the expression of a metallo-beta-lactamase having the general formula:

NH₂—K-T-E-ΔBL-COOH, (I)

wherein

K is lysine

T is threonine

E is glutamic acid, and

and conducting post translational modification resulting in a modified metallo-beta-lactamase having the general formula:

NH₂-E-ΔBL-COOH, (II)

wherein E and ΔBL are as defined above, and

optionally isolating and purifying the post translationally modified protein obtained.

As additional aspects the invention provides a pharmaceutical composition comprising the modified metallo-beta-lactamase protein of formula II, the modified metallo-beta-lactamase of formula II for use as a medicament, and the use of the modified metallo-beta-lactamase of formula II for the manufacture of a medicament for elimination of beta-lactam antibiotic induced adverse effects in the intestinal tract.

Finally the invention provides a method of treating beta-lactam anti-biotic induced adverse effects in the intestinal tract comprising administering an effective amount of the modified metallo-beta-lactamase of formula II, or the pharmaceutical composition containing it, to a person in need thereof. Specific embodiments of the invention are set forth in the dependent claims.

Other objects, details and advantages of the present invention will become apparent from the following drawings, detailed description and examples.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the complete nucleotide sequence and the deduced amino acid sequence of the B. cereus 98ME1552 beta-lactamase gene.

FIG. 2 shows the complete nucleotide sequence and the deduced amino acid sequence of the B. cereus 98ME1552 beta-lactamase gene derived from the pRSH315 expression construct. The cleavage site of the 31 amino acid residues long signal sequence of Bacillus amyloliquefaciens is predicted to occur between alanine at position −1 and glutamine at position +1. The NH₂-terminal extension of a NH₂-QAS-tripeptide that is derived from the Hind III cloning site is expressed in bold.

FIG. 3 shows the complete nucleotide sequence and the deduced amino acid sequence of the B. cereus 98ME1552 beta-lactamase gene derived from the pRSH318 expression construct. The cleavage of a 31 amino acid residues long signal sequence of Bacillus amyloliquefaciens is predicted to occur between alanine at position −1 and glutamine at position +1. The NH₂-terminal extension of the NH₂-QAS-tripeptide derived from the Hind III cloning site and the KT insertion are shown in bold.

DETAILED DESCRIPTION OF THE INVENTION

A metallo-beta-lactamase preparate was first produced in a Bacillus subtilis production system containing an expression construct of the complete metallo-beta-lactamase gene encoding the complete metallo-beta enzyme. Detailed mass spectrometry analysis revealed that the metallo enzyme preparate included various numbers of enzyme variants with heterogeneous amino terminal sequences. The variations at the amino terminus sequences were believed to be a result of post translational modification of host cell proteases. The observed alterations in the amino acid sequence of the metallo enzyme increase batch to batch variations of enzyme that has been produced in a Bacillus subtilis production system and thus in regulatory perspective reduce its use as a pharmaceutical protein. Therefore molecular biological means for reducing the observed variations in the amino terminal sequence of the metallo-beta-lactamase enzyme were studied.

The amino terminal region is expected to have no essential influence on the catalytic properties of the enzyme. In addition the amino terminal region was found to be exposed to post translational modifications of proteases in the Bacillus subtilis production system in which the recombinant protein is secreted outside the bacterial cell. In order to reduce this microheterogeneity in the amino terminal region, the nucleotide sequence encoding this predicted region was deleted by a PCR method. However, mere deletion by itself did not lead to a significant reduction of the amino terminal heterogeneity. Surprisingly, however, the deletion combined with insertion of a dipeptide, which was designed to assist post translational modification, led to a single metallo-beta-lactamase variant produced with an equally modified amino terminus.

This invention relates in general to a modified beta-lactamase useful as a pharmaceutical protein, and also to a recombinant beta-lactamase intermediate that is produced by truncation and insertion of a dipeptide at its amino terminal resulting in reduced numbers of beta-lactamase variants. These modifications facilitate the recombinant production of the enzyme in homologous form for use as a drug substance in beta-lactamase therapy for elimination of beta-lactams (cephalosporins, carbapenems, and penicillins in the presence or absence of known beta-lactamase inhibitors such as clavulanic acid, sulbactam and tazobactam) induced side effects. In particular the invention relates to targeted post translational modification of active metallo-beta-lactamase by truncation and insertion of a dipeptide at the amino terminal region to reduce amino terminal heterogeneity in a Bacillus subtilis production system.

“Metallo-beta-lactamases” as used herein refer to class B beta-lactamases i.e. beta-lactamases that require at least one bivalent metal ion (Zn²⁺) for activity; and constitute group 3 in the in the Bush-Jacoby-Madeiros functional classification (Bush, 1998). Based on the structural similarities in the region that coordinates zinc binding, metallo-beta-lactamases can be divided into three subgroups, B1, B2, and B3 (Galleni et al., 2001). Preferably the metallo-beta-lactamase of the invention belongs to subgroup B1. This subgroup possesses the key zinc coordinating residues of three histidines and one cysteine. More details about the subgroups are set forth in the background part of this specification.

The metallo-beta-lactamases are members of a large, diverse, superfamily of proteins that share a similar four layered αβ/βα structure. The polypeptide chain is divided into two domains, which comprise strands and helices in the following order: β₁β₂β₃β₄β₅α₁β₆α₂β₇α₃and β₈β₉β₁₀β₁₁α₄β₁₂α₅, respectively (Carfi et al., 1995 and 1998a, and Galleni et al., 2001). The metallo-beta-lactamases of the invention are truncated at the amino terminal end prior to the second beta strand. Preferably they are truncated between the first and second beta strands, and in particular immediately in front of the amino acid E between the first and second beta strands according to the crystallographic structure above.

Garau et al., 2004 have set forth a standard numbering scheme for class B beta-lactamases (BBL) by analogy to Ambler beta-lactamase numbering (ABL) for serine beta-lactamases (Ambler, 1980). The BBL numbering scheme is derived from a structural alignment of known metallo-beta-lactamase X-ray structures in order to discover conserved regions among various metallo beta-lactamase groups having low degree of identity in primary amino acid sequence level. The study of Garau et al. revealed that the first conserved fragment forms the second beta sheet structure in Bacillus cereus BcII metallo beta-lactamase set forth by Carfi et al. 1995, and Carfi et al., 1998a. Consequently, the β₁-sheet of B. cereus metallo beta-lactamase appears to be non-essential for enzyme function, because it is not be present in all metallo beta-lactamase groups. However, the amino terminal region of all metallo beta-lactamases possess a secondary structure of four conserved beta sheets forming fragments before the first alpha helix forming fragment. Thus the truncation site for the metallo beta-lactamase may be defined as one leaving four beta strands before the first alpha helix of the predicted secondary structure regardless of the original presence of β₁or not.

In the present context conventional one-letter amino acid codes and are used. Thus, A denotes alanine, R denotes arginine, N denotes asparagine, D denotes aspartic acid, C denotes cysteine, E denotes glutamic acid, Q denotes glutamine, G denotes glycine, H denotes histidine, I denotes isoleucine, L denotes leucine, K denotes lysine, M denotes methionine, F denotes phenylalanine, P denotes proline, S denotes serine, T denotes threonine, W denotes tryptophan, Y denotes tyrosine, and V denotes valine. The amino acid sequences are shown with the amino terminus to the left and carboxyl terminus to the right. NH₂— and —COOH may or may not be indicated.

According to one embodiment of the invention a host cell is transformed with an expression vector capable of expressing a beta-lactamase having the general formula I:

NH₂—K-T-E-ΔBL-COOH, (I)

wherein K is lysine, T is threonine, E is glutamic acid, and ΔBL is a metallo-beta-lactamase protein that has been truncated at the amino terminal end prior to the second beta-strand of said protein, whereby a protein having the general formula II:

NH₂-E-ΔBL-COOH, (II)

is formed as a result of post translational modification of the protein of formula I. The protein of the general formula I is conveniently produced by ligating a KT encoding DNA sequence to an E-ΔBL encoding DNA sequence, wherein E-ΔBL is a Bacillus and in particular a B. cereus metallo-beta-lactamase that has been truncated at the amino terminal end prior to the second beta strand immediately in front of a glutamic acid residue E. In particular the nucleotide construct comprises the sequential nucleotides 94-756 of SEQ ID NO: 2.

The length of the amino terminal region without rigid structure varies between metallo-beta-lactamase groups and within each subclass. The metallo-beta-lactamases of Bacillus spp also possess variations in the amino terminal sequence prior to the second beta strand, but most enzymes have a conserved glutamic acid (E) at position +12 (see Table 1). Consequently, the deletion coupled with the KT insertion adjacent to E can be applied to known Bacillus metallo-beta-lactamases, in which case the first eleven amino terminal amino acids are deleted from the N-terminal end of the naturally occurring mature beta-lactamase protein. According to one specific embodiment of the invention the beta-lactamase is truncated between the amino acids KT and E, and especially between VIKN and E, or VMKN and E.

TABLE 1

Comparison of the amino terminal sequences between Bacillus

sp metallo-beta-lactamases and P2A.

*The amino acid substitutions are bolded and the conserved glutamic acid (E) is shaded. The first beta strand for metallo-beta-lactamases is once underlined, and the second beta strand is twice underlined.

According to a specific embodiment of the invention E-ΔBL has at least 70, 80, 90, 95, 98 or 99% identity to the amino acid sequence of sequential amino acid residues 6-221 of SEQ ID NO: 3. Sequence identity may be determined using BLAST (Basic Local Alignment Search Tools) as described in Altschul et al., 1997. In particular E-ΔBL is a truncated form of a metallo-beta-lactamase having the sequence as set forth as SEQ ID NO: 1, or a beta-lactamase active variant or fragment thereof. It may e.g. be a truncated form of B. cereus metallo-beta-lactamase BcII. Preferably E-ΔBL has an amino terminal end that corresponds to amino acid residues 12-15, 12-19, or 12-23 of SEQ ID NO: 1, with the addition that the amino acid at position +13 may be either T (threonine) or A (alanine).

By an amino acid sequence that is a “variant” of a specific amino acid sequence is meant an amino acid sequence that is not identical to the specific amino acid sequence, but contains at least some amino acid changes i.e. deletions, substitutions, inversions, insertions etc. that do not essentially affect the biological activity of the protein as compared to that of the specific amino acid sequence. Biological activity in this context refers to beta-lactamase activity. A variant may be a polypeptide that occurs naturally e.g. as an allelic variant within the same strain, species or genus, or it may have been generated by mutagenesis.

A “fragment” is understood to be part of a specific amino acid sequence that is long enough to have the desired biological activity i.e. beta-lactamase activity. In other words the fragment may be e.g. a subsequence of the specifically disclosed beta-lactamases.

The nucleotide construct encoding NH₂—K-T-E-ΔBL-COOH may be inserted in an expression vector, and transformed into a host cell. The host cell is then cultivated under conditions enabling expression and post translational modification of the protein into NH₂-E-ΔBL-COOH, which thus may be obtained in substantially pure form, which means that at least 90%, and preferably at least 95%, in particular at least 99% of the metallo-beta-lactamase is present in a single form as NH₂-E-ΔBL-COOH. The post translational modification of the expressed protein, i.e. the cleavage of the dipeptide KT is catalyzed by proteases of the host. The host may be eukaryotic or prokaryotic, such as a bacterial, yeast or fungus cell. The bacterial host may be e.g Escherichia coli. Preferably the host belongs to Bacillus spp, and in particular it is B. licheniformis or B. subtilis. According to one preferred embodiment the NH₂—K-T-E-ΔBL-COOH is expressed as a protein comprising a signal peptide, whereby the protein is secreted into the culture medium, and the signal peptide is first cleaved, and then the dipeptide. Minor other changes such as deamidation, oxidation, disulfide bond breakage or formation, isomerization, succinimidation, non-disulfide crosslinking, Maillard reaction, deglycosylation may occur in the protein during the production process or storage, and are acceptable as long as the beta-lactamase activity is not significantly affected.

The modified beta-lactamase NH₂-E-ΔBL-COOH may originate from any bacterium capable of producing a metallo-beta-lactamase. Such bacteria are e.g. bacteria of the Enterobacteriae genus (Serratia marcescens, Klebsiella pneumoniae, Citrobacter freudii, Shigella flexneri), Pseudomonas aeruginosa, Stenobacterium maltophila, Acinetobacter genus, Bacteroides fragilis, Bacillus cereus, Flavobacteruim odoratum, and Bacteroides fragilis. Other possible sources are Aeromonas, Legionella and Stenotrophomonas species. The enzyme is truncated at the amino terminal end of the mature enzyme protein prior to the second beta strand at a position resulting in E as the N-terminal amino acid. If there is no appropriate residue E in the bacterial beta-lactamase, only the ΔBL part may be obtained from the bacterium, whereas a tripeptide KTE is coupled in front of ΔBL to from the protein NH₂—K-T-E-ΔBL-COOH.

Preferably the modified beta-lactamase is derived from Bacillus, and especially from B. cereus. In particular it is a B. cereus beta-lactamase from which the first eleven N-terminal amino acids of the non-modified mature beta-lactamase protein have been deleted.

The modified beta-lactamase of the invention may be mixed with any pharmaceutically acceptable excipients or carriers to form a pharmaceutical composition. An amount of the modified beta-lactamase effective of eliminating the adverse effect of beta-lactam antibiotics in the intestine is then administered orally to a person being treated with one or more beta-lactam antibiotics. The beta-lactamase preparation may be administered before, simultaneously with, or after the antibiotic treatment. It is insensitive to serine beta-lactamase inhibitors, and may therefore be used to eliminate the antibiotic both in the presence and absence of such inhibitors.

The invention is illustrated by the following non-limiting examples. It should be understood, however, that the embodiments given in the description above and in the examples are for illustrative purposes only, and that various changes and modifications are possible within the scope of the invention.

Example 1
Materials and Methods
Bacterial Strains and Growth Conditions

The bacterial strains and their relevant genotypes and phenotypes are presented in Table 2.

TABLE 2

Bacterial strains and their relevant genotypes and phenotypes

Strain
Relevant genotype
Relevant phenotype

Bacillus subtilis RS303
trpC2, sigG::cat
Tryptophan auxotroph,

(Δ sigG)
asporogenic

Bacillus subtilis IH 6140
sacA321
Reduced exoprotease

level

Bacillus subtilis RS314
trpC2, sigG::cat, (Δ sigG)
Tryptophan auxotroph,

pRSH314 expression construct
asporogenic, secretes

encoding the truncated
metallo-beta-lactamase

metallo-beta-lactamase

Bacillus subtilis RS315
trpC2, sigG::cat, (Δ sigG)
Tryptophan auxotroph,

pRSH315 expression construct
asporogenic, secretes

encoding the complete
metallo-beta-lactamase

metallo-beta-lactamase gene

Bacillus subtilis RS317
trpC2, sigG::cat, (Δ sigG)
Tryptophan auxotroph,

pRSH317 expression construct
asporogenic, secretes

encoding truncated
metallo-beta-lactamase

metallo-beta-lactamase

Bacillus subtilis RS318
trpC2, sigG::cat, (Δ sigG)
Tryptophan auxotroph,

pRSH318 expression construct
asporogenic, secretes

encoding truncated
metallo-beta-lactamase

metallo-beta-lactamase

Bacillus cereus 98ME1552

Multiresistant to various

beta-lactams

Bacteria were generally cultivated in complex Luria medium (5 grams of yeast extract, 10 grams of tryptone and 10 grams of sodium chloride per litre) supplemented with appropriate antibiotics as selection agents in shaking flask mode at +37° C. A synthetic culture medium supplemented with appropriate antibiotic was used in fermentations. A modified synthetic medium was used to generate competent Bacillus subtilis cells. Detailed composition of these media is described in WO03/040352.

DNA Techniques

Conventional DNA techniques including e.g. restrictions, agarose gel electrophoresis and ligations, were performed according to Sambrook and Russell (2001). The chromosomal DNA was isolated by the Marmur method (Marmur, 1961). The plasmid DNA was isolated by Qiagen plasmid Midi Kit according to manufacturer's instructions (Qiagen Plasmid Purification Handbook, 1999) but lysozyme treatment (1 mg/ml) was added to the protocol in order to degrade the peptidoglycan layer. Lysozyme was supplemented to buffer P1 and cells were incubated at 37° C. for 30 minutes.

PCR was generally performed according to protocols described in WO03/040352.

Characterization of Amino Terminal Region of Various Forms of Metallo-Beta-Lactamase

For determinations of the N-terminal amino acid sequence and mass spectrometry, purified metallo-beta-lactamase samples were subjected to reverse phase chromatography and the enzymes were fractioned in a linear gradient of 0.1% of TFA and 0.075% TFA-acetonitrile from 0% to 100% for 60 minutes.

NH₂-terminal sequences of metallo-beta-lactamase forms were determined by automated Edman degradation with an Applied Biosystems model 494A Protein Sequenator.

Mass analyses of metallo-beta-lactamase forms were performed by a hybrid quadrupole-time-of-flight (Q-TOF) instrument. Metallo-beta-lactamase variants have been assumed to provide comparable ionization potentials which have been utilized in the assessments of their relative proportions in the samples.

The nucleotide sequences of the beta-lactamase genes were determined by the dideoxy-chain termination method with an automatic DNA sequencer.

Example 2
The Complete Nucleotide Sequence of Bacillus cereus 98ME1552 Metallo-Beta-Lactamase Gene

The determination of the complete gene coding metallo-beta-lactamase was sequentially performed by using PCR and Vectorette techniques. Part of the structural gene was amplified by PCR, with isolated chromosomal DNA of a clinical isolate B. cereus 98ME1552 as a template and with primers designed to hybridize to the SQKVEKTVI coding region (forward primer) and HTLDLL coding region (reverse primer) of the Bacillus cereus 569/H metallo-beta-lactamase gene. Both primers also carry Hind III restriction sites. The amplified DNA fragment (about 700 bp) was digested with Hind III and ligated to the Hind III site of a secretion vector pKTH141. Competent Bacillus subtilis IH6140 cells were transformed with the ligation mixture. A clone harbouring a plasmid expressing metallo-beta-lactamase was verified by DNA sequencing. The plasmid was named pRSH314.

Competent B. subtilis RS303 cells prepared as described in WO03/04052 were transformed with pRSH314 resulting in strain B. subtilis RS314.

The complete DNA sequence of metallo-beta-lactamase gene was determined from PCR fragments obtained by employing Vectorette technique as follows: The chromosomal DNA of Bacillus cereus 98ME1552 was digested with Hind III restriction enzyme and ligated to Hind III treated Vectorettell. The obtained Vectorette-library was screened in a PCR reaction by employing the MEBLSQ-F (5′-AGGAAATGTTGCGGATGC) or MEBLSQ-R (5′-CCTTCGTTAATTTGTTATCCC) initiating primers designed from the DNA sequence obtained from the 700 bp of pRSH314.

PCR screening of the Vectorette library with the MEBLSQ-F primer generated a fragment of about 1000 bp (MEBL1 fragment) and with the MEBLSQ-R primer a fragment of about 1100 bp (MEBL2 fragment). Both MEBL1 and MEBL2 fragments were purified from agarose gel after electrophoresis. The nucleotide sequences of both fragments were determined by DNA sequencing resulting in the complete nucleotide of B. cereus 98ME1552 metallo-beta-lactamase gene. The complete nucleotide and deduced amino acid sequence of the B. cereus 98ME1552 metallo-beta-lactamase gene is presented in FIG. 1. The amino acid sequence is also set forth as SEQ ID NO: 1. The open reading frame encodes a 257 amino acid polypeptide, whose amino terminal sequence (30 amino acid residues) exhibits features typical of those of a bacterial signal peptide that targets protein secretion across the cytoplasmic membrane via a general secretory pathway. The predicted signal peptidase cleavage site is after alanine at position of −30 (see FIG. 1). The calculated molecular mass and the pI value of the mature protein of 227 amino acid residues is 24 877.3 Da and 6.0, respectively. The 98ME1552 metallo-beta-lactamase sequence Was used as a search template in a BLAST search in order to identify the protein. The BLAST search was performed using the SIB BLAST Network Service of Swiss Institute of Bioinformatics (http://www.expasy.org/tools/blast/). The search was done against a UniProtKB Knowledge based database using the NCBI BLASTP 2.2.13 program (Altschul et al., 1997) with BLOSUM62 algorithm and gap penalties 11 for existence and 1 for extension. The BLAST search performed with the 98ME1552 metallo-beta-lactamase gave the highest similarity scored with other class B beta-lactamases of subgroup B1. As expected, the 98ME1552 beta-lactamase exhibited a high degree of identity (over 90%) to other B. cereus beta-lactamases. According to structural alignment of various B. cereus metallo-beta-lactamase, the amino acid substitutions in B. cereus 98ME1552 lactamase are predicted to locate in regions not essential for the function of the enzyme.

Example 3
Cloning and Expression of the B. cereus 98ME1552 Metallo-Beta-Lactamase Gene in Bacillus subtilis

Based on the obtained DNA sequences from the Vectorette library, new primers,

BLC1-F

(5′-CGCGAAGCTTCCGAACAAAAGCTAGAGCAAATAGTAATC),

and

BLC1-R

(5′-

GCCGAAGCTTTTATTTTAATAAATCCAATGTATGTAAAAGTAATCCC)

were designed to generate a DNA insert encoding the complete metallo-beta-lactamase in PCR. The primers also carried Hind III-sites at their ends and purified chromosomal DNA of B. cereus 98ME1552 was used as a template. The amplified PCR fragment of about 0.7 kb was digested with Hind III and ligated to the Hind III site of a pKTH141 secretion vector. Competent Bacillus subtilis RS303 cells were transformed by the ligation mixture. One positive clone was designated RS315 and the harbouring expression construct was named pRSH315.

The pRSH315 expression construct was isolated and the insert region was sequenced. The nucleotide and deduced amino acid sequences of the cloned metallo-beta-lactamase gene were identical to those determined from the Vectorette library. The determined DNA sequence revealed in frame fusion between the nucleotide sequence encoding a 31 amino acid long signal sequence of Bacillus amyloliquefaciens alpha amylase, the Hind III cloning site and the complete B. cereus 98ME1552 metallo-beta-lactamase gene (see FIG. 2). Signal peptidase is predicted to cut the peptide bond between alanine (A) at position of −1 and glutamine (Q) at position of +1. The mature metallo-beta-lactamase possesses an NH₂-terminal extension of a NH₂-QAS-tripeptide that is derived from the Hind III cloning site in the expression construct. Hence, based on the deduced amino acid sequence the mature modified metallo-beta-lactamase is comprised of 230 amino acid residues.

Example 4
Determination of the Amino Terminal Amino Acid Sequence of Metallo-Beta-Lactamase Variants Obtained from a Bacillus subtilis Production System

For further characterization, the recombinant metallo-beta-lactamase was produced in cultivations performed in either shaking flask or fermentation by using a synthetic growth medium. The metallo-beta-lactamase was effectively secreted into the culture supernatant. The enzyme was purified from concentrated culture supernatant by ion exchange chromatography. Enzyme activity was observed in two separate fractions. Purified enzyme fractions were subjected to NH₂-terminal sequencing and mass spectrometry analysis. Analyses revealed that both fractions comprised enzyme forms with heterogeneous amino terminus. The various enzyme forms and their relative proportions are presented in Table 3. Related to the deduced amino acid sequence, all enzyme forms have deletions of various lengths in their NH₂-terminal regions. In general, the NH₂-QASEQKLE octapeptide seems to be deleted in all enzyme forms. Furthermore the smallest enzyme form in fraction 2 lacks an additional IVIKN-pentapeptide. The observed microheterogeneity in the NH₂-terminal region can be explained as post translational modifications caused by the action of various host cell proteases.

TABLE 3

Deduced and determined amino terminal sequences and determined

molecular mass of truncated metallo-beta-lactamase forms

Determined
Relative

Enzyme

NH₂-
proportion of

fraction
Deduced NH₂-terminal
terminal
enzyme forms
Determined

n:o
amino acid sequence
sequence
in fractions (%)
Mass (kDa)

1
NH₂-QASEQKLEQIVIKNETGTI
NH₂-IVIKNETGTI
100
24.122

2

NH₂-NETGTI
60
23.668

2

NH₂-ETGTI
40
23.554

Example 5
Construction of Bacillus cereus 98ME1552 Deleted Metallo-Beta-Lactamase Form and its Amino Terminal Variants in a Bacillus subtilis Production System

In order to try to reduce NH₂-terminal heterogeneity the DNA sequence encoding the variable region NH₂-EQKLEQIVIKN of the metallo-beta-lactamase gene was deleted by PCR. The complete gene of B. cereus 98ME1552 metallo-beta-lactamase was used as a template in PCR with a forward primer hybridizing to a ETGTISISQ coding sequence and a reverse primer hybridizing to a GLLLHTLDLLK coding sequence followed by a translation stop codon TAA. Both primers carried Hind III sites.

The obtained PCR fragment of about 0.7 kb was cloned into the Hind III site of the pKTH141 secretion vector and the competent B. subtilis RS303 strain was transformed by the ligation mixture. The NH₂-terminal deletion was verified by DNA sequencing of the inserted metallo-beta-lactamase gene of the expression construct isolated from a positive clone. The transformant strain was named Bacillus subtilis RS317 and the expression construct was called pRSH317.

Truncated metallo-beta-lactamase was produced in a Bacillus subtilis production host and the enzyme was purified from the culture supernatant by employing ion change chromatography from which the active enzyme was eluted as a single fraction. The enzyme fraction was subjected to NH₂-terminal amino acid sequencing and molecular mass analysis. The observed results (in Table 4) showed that the truncated metallo-beta-lactamase also appeared as a protein with a heterogeneous amino terminus. The major enzyme variant possesses an amino-terminal sequence identical to that of the deduced amino acid sequence including the Hind III site coding the initiation QAS-tripeptide. A minor variant was found to have a deletion of a QA-dipeptide. Due to amino terminal blockage, no amino acid sequence was received from one variant. Amino terminal blockage is likely to be the result of cyclization of the glutamine residue to form a pyroglutamyl residue during the production process. To conclude, the amino terminal deletion did not fundamentally reduce amino terminal microheterogeneity.

TABLE 4

Determined amino terminal sequences and molecular masses of

truncated metallo-beta-lactamase forms.

Deduced NH₂-

Relative pro-

Enzyme
terminal

portion of

fraction
amino acid
Determined NH₂-
enzyme forms
Mass analysis

n:o
sequence
terminal sequence
in fractions (%)
(kDa)

1.
NH₂-QASETGTISI
a. cyclic form of glutamine →

a. 23.823

no amino acid sequence

b. NH₂-QASETGTISI
b. 90
b. 23.840

c. NH₂-SETGTISI
c. 10
c. 23.641

Example 6
Construction of Bacillus cereus 98ME1552 Truncated Metallo-Beta-Lactamase Possessing a KT Coding Sequence Insert

In order to avoid post translational modification a molecular truncation of metallo-beta-lactamase was designed to comprise the deletion of the DNA sequence coding the NH₂-EQKLEQIVIKN region together with insertion of a KT dipeptide coding sequence located directly downstream of the 3′-Hind III cloning site.

A modified metallo-beta-lactamase gene was created as in Example 5, except for the forward primer, which contained a KT coding DNA sequence. The PCR fragment was cut with Hind III and ligated to the Hind III site of the pKTH141 secretion vector and competent B. subtilis RS303 cells were transformed by the ligation mixture. The correct nucleotide sequence of the modified metallo-beta-lactamase gene in the expression construct was confirmed by DNA sequencing. One positive clone was named Bacillus subtilis RS318 and the expression construct was called pRSH318. The nucleotide and the deduced amino acid sequence of the B. cereus 98ME1552 beta-lactamase derived from pRSH318 is presented in FIG. 3, and set forth as SEQ ID NO:2 and 3, respectively.

The truncated metallo-beta-lactamase was produced, purified, and analyzed as earlier described. The active truncated metallo enzyme was eluted from the column as a single peak. The single fraction contained metallo-beta-lactamase that possessed a homologous amino terminal glutamic acid residue (NH₂-E; see Table 5). Accordingly, the KT-dipeptide insertion conducts post translational modification resulting in a uniform amino terminal amino acid sequence. The truncated metallo-beta-lactamase was named the P2A protein.

TABLE 5

Deduced and determined amino terminal sequences and the de-

termined molecular mass of truncated metallo-beta-lactamase form

Enzyme
Deduced NH₂-
Determined NH₂-
Relative proportion
Mass

fraction
terminal amino
terminal
of enzyme forms in
analysis

n:o
acid sequence
sequence
fractions (%)
(kDa)

1.
NH₂-QASKTETGTISI
a. NH₂-ETGTISI
a. 100
a. 23554

Example 7
Kinetic Enzyme Parameters of the P2A Metallo-Beta-Lactamase

Diversity of the catalytic properties of the P2A enzyme was studied with various types of beta-lactams including the penicillin family with and without serine beta-lactamase inhibitors, second and third generation cephalosporins, and carbapenems (meropenem). The enzyme kinetic parameters k_catand K_mwere determined from initial rates by Hanes plot. The reactions were performed in 10 mM phosphate buffer, pH 7.0 at 30° C. The reaction cuvette (one mL) contained about 5 pmol of enzyme in all reactions except 1.7 pmol of enzyme in the meropenem assay. The hydrolysis of various beta-lactam substrates was spectrophometrically recorded at a wavelength specific for each substrate.

Values for different kinetic parameters (k_cat, K_mand k_cat/K_m) that represent mean values obtained from three independent measurements are reported in Table 6.

TABLE 6

Kinetic parameter values for the P2A metallo-beta-lactamase

The P2A protein

K_m
k_cat
k_cat/K_m

Antibiotic
(microM)
(1/s)
(M⁻¹× s⁻¹)

Ampicillin
942
1114
1.18 × 10⁻⁶

Ampicillin-sulbactam
1104
1251
1.15 × 10⁻⁶

(Unasyn)

Amoxycillin
716
980
1.37 × 10⁻⁶

Amoxycillin-clavulanic acid
717
990
1.38 × 10⁻⁶

(Augmentin)

Piperacillin
372
1049
2.82 × 10⁻⁶

Piperacillin-tazobactam
412
1098
2.67 × 10⁻⁶

(Tazocin)

Cefuroxime
27
221
7.99 × 10⁻⁶

Cefotaxime
66
479
7.28 × 10⁻⁶

Ceftriaxone
68
95
1.40 × 10⁻⁶

Meropenem
410
480
1.17 × 10⁻⁶

Example 8
Stability of the P2A Protein in Human Ileal Chyme

Resistance to intestinal proteases is one of the most important factors affecting the applicability of the P2A protein as a drug substance in targeted beta-lactamase therapy in the small intestine. The susceptibility of metallo-beta-lactamase to the action of small intestinal proteases was tested by adding various amounts of active enzyme in tubes consisting human ileal chyme. The hydrolysis of metallo-beta-lactamase was monitored by measuring beta-lactamase activity of ileal samples at various time points. Meropenem was employed as substrate in the activity assays.

The obtained results from four independent experiments and the mean values are expressed in Table 7. The P2A enzyme appears to be a stable protein, which was cleared in human ileal chyme with a half-life of 55 minutes (mean value). High variations of half-lives were observed between various experiments. However, the half-life of P2A in human small intestinal chyme has been evaluated to be adequate for successful application of P2A enzyme therapy for elimination of residual beta-lactam induced adverse reaction in the intestinal tracts.

TABLE 7

Half-life (in vitro) of the P2A metallo-beta-lactamase

in human ileal chyme.

Experiment n: o
Half-life (minutes)
Mean value (±SD)

1
60
55 ± 25

2
80
55 ± 25

3
20
55 ± 25

4
60
55 ± 25

REFERENCES

Altschul S. F., Madden T. L., Schäffer A. A., Zhang J., Zhang Z., Miller W., Lipman D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402

Ambler, R. P. 1980. The structure of beta-lactamases. Philos. Trans. R. Soc. London B 289:321-331.

Bush, K. 1998. Metallo-β-lactamases: a class apart. Clin. Infect. Dis. 32: 271-276.

Carfi A, Duee E, Galleni M, Frere J M, and Dideberg O. 1998a. 1.85 A resolution structure of the zinc (II) beta-lactamase from Bacillus cereus. Acta Crystallogr D Biol Crystallogr. 54:313-323.

Carfi A, Duee E, Paul-Soto R, Galleni M, Frere J M, and Dideberg O. 1998b. X-ray structure of the ZnII beta-lactamase from Bacteroides fragilis in an orthorhombic crystal form. Acta Crystallogr D Biol Crystallogr. 54:45-57.

Carfi, A., Pares, S., Duee, E., Galleni, M., Duez, C., Frere, J. M., and Dideberg O. 1995. The 3-D structure of a zinc metallo-beta-lactamase from Bacillus cereus reveals a new type of protein fold. EMBO J. 14:4914-4921.

Concha, N. O., Janson, C. A., Rowling, P., Pearson, S., Cheever, C. A, Clarke, B. P., Lewis, C., Galleni, M., Frere, J. M., Payne, D. J., Bateson, J. H., and Abdel-Meguld, S. S. 2000. Crystal structure of the IMP-1 metallo beta-lactamase from Pseudomonas aeruginosa and its complex with a mercaptocarboxylate inhibitor: binding determinants of a potent, broad-spectrum inhibitor. Biochemistry. 39:4288-4298.

Galleni, M., Lamotte-Brasseur, J., Rossolini, G. M., Spencer, J., Dideberg, O., and Frere, J. M. 2001. Metallo-beta-lactamases Standard numbering scheme for class B beta-lactamases. Antimicrob. Agents Chemother. 45:660-663

Garau, G., Garcia-Saez, I., Bebrone, C., Anne, C., Mercuri, P., Galleni, M., Frere, J. M., and Dideberg, O. 2004. Update of the standard numbering scheme for class B beta-lactamases. Antimicrob. Agents Chemother. 48:2347-2349.

Garau, G., Bebrone, C., Anne, C., Galleni, M., Frere, J. M., Dideberg, O. 2005. A metallo-beta-lactamase enzyme in action: crystal structures of the monozinc carbapenemase CphA and its complex with biapenem. J Mol Biol. 345:785-795.

Harmoinen, J., Mentula, S., Heikkilä, M., van der Rest M., Rajala-Schultz, P. J., Donskey, C. J., Frias, R., Koski, P., Wickstrand, N., Jousimies-Somer, H., Westermarck, E., Lindevall, K. 2004. Oral Targeted Recombinant Beta-Lactamase Prevents Ampicillin-Induced Selective Pressure on the Gut Microbiota: A Novel Approach to Reduce Antimicrobial Resistance Antimicrob. Agents and Chemotherapy. 48: 75-79.

Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3: 208-218.

Mentula, S., Harmoinen, J., Koski, P., Westermarck, E., Huovinen, P., and Könönen, E. 2004. Inhibition of ampicillin-induced emergence of resistance in intestinal coliforms by targeted recombinant beta-lactamase. Int. J. Antimicrob. Agents. 24:555-561.

Sambrook, J., and Russell, D. W. 2001. Molecular cloning, a Laboratory Manual. Cold Spring Harbour Laboratory Press Cold Spring Harbour, New York.

Stiefel, U., Pultz, N. J., Harmoinen, J., Koski, P., Lindevall, K., Helfand, M. S., Donskey, C. J. 2003. Oral β-lactamase administration preserves colonization resistance of piperacillin-treated mice. J Infect Dis. 10: 1605-1609.

Stiefel, U., Harmoinen, J., Koski, P., Kaariainen, S., Wickstrand, N., Lindevall, K., Pultz, N. J., Bonomo, R. A., Helfand, M. S., and Donskey, C. J. 2005. Orally administered recombinant metallo-beta-lactamase preserves colonization resistance of piperacillin-tazobactam-treated mice. Antimicrob. Agents Chemother. 49: 5190-5191.

Walsh, T. R., Toleman, M. A., Poirel, L., and Nordmann, P. 2005. Metallo-beta-lactamases: the quiet before the storm? Clin Microbiol Rev. 18:306-325

MODIFIED BETA-LACTAMASE AND METHOD FOR ITS PREPARATION

Information

Publication Number

Date Filed

Date Published

Inventors

Original Assignees

CPC

US Classifications

International Classifications

Abstract

Description

Claims

Priority Claims (1)

PCT Information