Patent Application
20240002447
This application incorporates by reference the material in the ASCII text file titled English_Translation_of_Sequence_Listing.txt, which was created on May 16, 2023 and is 170 KB.
The present application relates to the field of biotechnology. Specifically, the present application relates to a novel human papillomavirus protein, and a pentamer or a virus-like particle formed thereby, as well as use of the human papillomavirus protein, the pentamer or the human papillomavirus-like particle in the preparation of a vaccine for use in the prevention of papillomavirus infection and infection-induced diseases.
Human papillomavirus (HPV) is a class of non-enveloped small DNA viruses that infect epithelial tissue. More than 200 types of HPV have been identified, which can be classified into mucosal types and skin types according to the different sites of infection. Mucosal type HPVs mainly infect the urogenital, perianal and oropharyngeal mucous membrane and skin. HPVs can also be classified into carcinogenic types that have transforming activity and low-risk types that induce benign hyperplasia. There are more than 20 carcinogenic types, including 12 common high-risk types (HPV16, -18, -31, -33, -35, -39, -45, -51, -52, -56, -58, -59) and more than 10 relatively rare possible/suspected high-risk types (HPV26, -30, -34, -53, -66, -67, -68, -69, -70, -73, -82), the persistent infection of which can induce about 100% of cervical cancer, 88% of anal cancer, 70% of vaginal cancer, 50% of penile cancer, 43% of vulva cancer and 72% of head and neck cancer. Among these cancers, cervical cancer has the third highest incidence of women's malignant tumors in the world, and the second highest incidence of women's malignant tumors in the population of women aged 15-44, second only to breast cancer. There are about 570,000 cases and 311,000 deaths per year, of which more than 80% occur in underdeveloped countries and regions.
HPV52 is a relatively common dominant prevalent virus strain worldwide, with a detection rate of 3.5% in cervical cancer tissue, ranking sixth. It is also worth noting that in normal cervical tissues or cervical tissues with low-grade lesions in China, the detection rate of HPV52 reaches 2.8% and 16%, both ranking first. In addition, the detection rate of HPV52 in cervical cancer tissues in southern China ranks third after HPV16 and HPV18.
The major capsid protein L1 of HPV self-assembles to form virus-like particles (VLPs), which mainly induce type-specific neutralizing antibodies and protective activity. At present, the four HPV prophylactic vaccines on the market are all L1VLP combination vaccines, namely the HPV16/-18 L1VLP bivalent vaccine (Cervarix) produced by insect expression systems, the HPV161-181-6/-11 L1VLP tetravalent vaccine (Gardasil) and the HPV16/-18/-31/-33/-45/-52/-58/-6/-11 L1VLP nine-valent vaccine (Gardasil-9) produced by yeast expression systems, and the HPV16/-18 bivalent vaccine (Cecolin) produced by prokaryotic expression systems. Yet, currently, only Gardasil-9 comprises HPV52 L1VLP.
At present, the relatively commonly used VLP expression systems include prokaryotic expression systems, yeast expression systems and insect expression systems. It was found by comparing the clinical data of the marketed Cervarix and Gardasil that the content of HPV16 L1VLP in Cervarix (20 μg) was only half of that in Gardasil (40 μg), and the content of HPV18 L1VLP in Cervarix was the same as that of Gardasil (both 20 μg). But, the type-specific neutralizing antibody titers against HPV16 and HPV18, cross-neutralization activity, memory B cell number and CD4+ T cell response level induced by Cervarix were all higher than those induced by Gardasil, indicating that the immune activity of Cervarix was stronger than that of Gardasil. Furthermore, insect cell expression systems have many advantages. Compared with prokaryotic expression systems, insect cell expression systems have relatively close genetic distance to the natural host cell of the virus (both are eukaryotic multicellular organisms), do not contain endotoxins, and proteins are mostly expressed in soluble forms therein without the trouble of inclusion bodies. Compared with yeast expression systems, insect cells are easy to lyse and the purification process is relatively simple, while disruption of yeast cell wall requires high-pressure homogenization, and the presence of more host proteins causes relatively more difficulties in purification. Therefore, insect expression systems are more advantageous for developing vaccines. However, the fermentation cost of insect expression systems is relatively high, so it is especially important to increase the expression level and yield of L1VLP to reduce the cost of vaccine production.
It was found that optimizing an antigen gene according to the biased codons of the host cell could increase its expression level. For example, optimizing HPV11 L1 gene with mammalian cell biased codons increased its expression level in human embryonic kidney cells (293T) by at least 100 folds. The expression level and VLP yield of HPV16 L1 variant strains in insect and yeast expression systems were analyzed and compared. It was found that when high-frequency mutation sites were mutated into dominant amino acids, the L1 expression level and VLP yield would increase. But when high-frequency mutations sites in combination with other sites were mutated, the effect on the L1 expression level was uncertain. In insect expression systems, BPV1 L1 was modified by C-terminus truncation, and it was found that the assembly efficiency of truncated BPV L1 increased by 3 folds. At present, the effect of C-terminus truncation on protein expression amount has not been reported. In prokaryotic expression systems, L1 of HPV16, -18, -31, -33, -45, -52, -58, -6, and -11 types was modified by N-terminus truncation, and it was found that the number of amino acids truncated at N-terminus that could upregulate the L1 expression level varied from type to type and was irregular.
It has been found in the present application that optimal modification of the N-terminus, C-terminus and high-frequency mutation sites of L1 can significantly increase the expression level and yield of 52L1VLP, and the obtained HPV52 L1VLP can induce high titers of type-specific neutralizing antibodies.
Some embodiments of the present application provide a novel optimally modified HPV52 L1 protein, a pentamer or a virus-like particle composed thereof, and a vaccine containing the pentamer or virus-like particle, and study use of the vaccine in the prevention of HPV infection and infection-related diseases.
The inventor has unexpectedly found that the expression amount of HPV52 L1 protein in insect cell expression systems can be increased by appropriate amino acid substitution of high-frequency mutation sites of HPV52 L1 protein and partial deletion or amino acid substitution of its N-terminus and/or C-terminus. The optimally modified protein can be assembled into VLP and can induce a protective immune response against HPV52.
Thus, according to some embodiments of the present application, the present application relates to an optimally modified HPV52 L1 protein comprising a modification selected from the group consisting of the following or a combination thereof, compared with wild-type HPV52 L1 protein (for example, the amino acid sequence corresponding to the sequence AEI61557.1 in NCBI database):
Specifically, according to some embodiments of the present application, provided is an optimally modified HPV52 L1 protein, wherein the modified HPV52 L1 protein has any feature selected from the group consisting of the following or a combination thereof, compared with wild-type HPV52 L1 protein:
In particular embodiments, the basic amino acid is arginine (R) and/or lysine (K).
In particular embodiments, the polar uncharged amino acid is glycine (G), serine (S) and/or threonine (T).
In particular embodiments, the non-polar amino acid is alanine (A) and/or valine (V).
In particular embodiments, the acidic amino acid is aspartate (D) and/or glutamate (E).
In particular embodiments, the optimally modified HPV52 L1 protein according to the present application is modified on the basis of the sequence as shown in SEQ ID No. 1 (the amino acid sequence corresponding to the sequence AEI61557.1 in NCBI database).
In particular embodiments, the modified HPV52 L1 protein is selected from the group consisting of 52L1D447EΔC19, 52L1ΔN2, 52L1ΔN4, 52L1ΔN5, 52L1ΔN8, 52L1ΔN10, 52L1ΔN13, 52L1ΔN15, 52L1ΔN18, 52L1ΔN20, 52L1CS1, 52L1CS2, 52L1CS3, 52L1CS4, 52L1CS5, 52L1CS6, 52L1CS7, 52L1CS8, 52L1CS9, 52L1ΔN13CS1, 52L1ΔN13CS2, 52L1ΔN13CS3, 52L1NS1ΔC19, 52L1NS1ΔC25, 52L1NS2ΔC19, 52L1NS3ΔC19, 52L1NS4ΔC19 and 52L1ΔN144C25, the amino acid sequences of which are as shown in SEQ ID No. 2 to SEQ ID No. 29.
The wild-type HPV52 L1 protein can also be from, but not limited to, L1 proteins from HPV52 variant strains, such as ABU55797.1, AEI61589.1, AIF71344.1, APQ44868.1, AEI61581.1, AIF71350.1, CAD1814034.1, etc. in NCBI database, and C-terminus modified L1 proteins corresponding to the variant strains are modified in the same way as those for the above-mentioned modified HPV52 L1 protein, such as evaluated by sequence comparison.
According to some embodiments of the present application, provided is a polynucleotide encoding the optimally modified HPV52 L1 protein of the present application. Preferably, the polynucleotide is optimized using codons of commonly used expression systems, such as E. coli expression systems, yeast expression systems, insect cell expression systems, etc. Preferably, the polynucleotide is optimized using insect cell codons.
According to some embodiments of the present application, provided is a vector containing the above-mentioned polynucleotide. Preferably, the vector is selected from the group consisting of plasmid, recombinant Bacmid and recombinant baculovirus.
According to some embodiments of the present application, provided is a cell comprising the above-mentioned vector. Preferably, the cell is an E. coli cell, a yeast cell or an insect cell, and particularly preferably, the cell is an insect cell.
According to some embodiments of the present application, provided is a HPV52 L1 multimer (e.g., pentamer) or a virus-like particle, the multimer or virus-like particle contains the above-mentioned modified HPV52 L1 protein or is formed thereby.
According to some embodiments of the present application, provided is a vaccine for the prevention of HPV infection or HPV infection-related diseases comprising the above-mentioned multimer or virus-like particle, wherein the content of the multimer or virus-like particle is an effective amount that can induce a protective immune response. Preferably, the vaccine can also comprise at least one selected from other mucosa-tropic and/or skin-tropic HPV pentamer or virus-like particle, the content of which is an effective amount that can induce a protective immune response, respectively. The above-mentioned vaccine usually also comprises an excipient or carrier for vaccines.
In particular embodiments, the vaccine contains the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle, as well as at least one selected from the group consisting of HPV2, -5, -6, -7, -8, -11, -16, -18, -26, -27, -28, -29, -30, -31, -32, -33, -34, -35, -38, -39, -40, -43, -44, -45, -51, -53, -56, -57, -58, -59, -61, -66, -67, -68, -69, -70, -73, -74, -77, -81, -82, -83, -85, -91 L1 virus-like particles, the content of which is an effective amount that can induce a protective immune response, respectively.
In particular embodiments, the vaccine contains the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle, as well as HPV6, -11, -16, -18, -26, -31, -33, -35, -39, -45, -51, -56, -58, -59, -68 and -73 L1 virus-like particles, the content of which is an effective amount that can induce a protective immune response, respectively.
In particular embodiments, the vaccine contains the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle, as well as HPV6, -11, -16, -18, -31, -33, -35, -39, -45 and -58 L1 virus-like particles, the content of which is an effective amount that can induce a protective immune response, respectively.
In particular embodiments, the vaccine contains the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle, as well as HPV6, -11, -16, -18 and -58 L1 virus-like particles, the content of which is an effective amount that can induce a protective immune response, respectively.
In particular embodiments, the vaccine contains the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle, as well as HPV16, -18 and -58 L1 virus-like particles, the content of which is an effective amount that can induce a protective immune response, respectively.
In particular embodiments, the vaccine contains the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle, as well as HPV16, -18 L1 virus-like particles, the content of which is an effective amount that can induce a protective immune response, respectively.
The present application relates to a novel vaccine that can further enhance the immune response, which comprises the above-mentioned HPV52 L1 multimer (e.g., pentamer) or virus-like particle as well as an adjuvant. Preferably, the adjuvant used is a human vaccine adjuvant.
According to some embodiments of the present application, provided is use of the above-mentioned modified HPV52 L1 protein, multimer (e.g., pentamer), virus-like particle and vaccine in the prevention of HPV infection or HPV infection-related diseases.
According to the present application, the term “insect cell expression system” includes insect cell, recombinant baculovirus, recombinant Bacmid and expression vector. Among them, the insect cell is derived from a commercially available cell, the examples of which are listed here but not limited to: Sf9, Sf21, High Five.
According to the present application, examples of the term “wild-type HPV52 L1 protein” include, but are not limited to, L 1 protein corresponding to the sequence No. AEI61557.1 in NCBI database.
According to the present application, the term “excipient or carrier” refers to that selected from one or more of the following, including but not limited to, pH adjuster, surfactant and ionic strength enhancer. For example, the pH adjuster is for example but not limited to phosphate buffer. The surfactant includes cationic, anionic or nonionic surfactant, and is for example but not limited to polysorbate 80 (Tween-80). The ionic strength enhancer is for example but not limited to sodium chloride.
According to the present application, the term “adjuvant” refers to an adjuvant that can be applied clinically to the human body, including various adjuvants that have been approved and may be approved in the future.
According to the present application, the vaccine of the present application can be in a patient-acceptable form, including but not limited to oral administration or injection, preferably injection.
According to the present application, the vaccine of the present application is preferably used in a unit dosage form, wherein the dose of the optimally modified HPV52 L1 protein virus-like particle in the unit dosage form is 5 μg-80 μg, preferably 20 μg-40 μg.
The present application will be further illustrated by the non-limiting examples below. It is well known to those skilled in the art that many modifications can be made to the present application without departing from the spirit of the present application, and such modifications also fall within the scope of the present application. The following embodiments are only used to illustrate the present application and should not be regarded as limiting the scope of the present application, as the embodiments are necessarily diverse. The terms used in the present specification are intended only to describe particular embodiments but not as limitations. The scope of the present application has been defined in the appended claims.
Unless otherwise specified, all the technical and scientific terms used in the present specification have the same meaning as those generally understood by those skilled in the technical field to which the present application relates. Preferred methods and materials of the present application are described below, but any method and material similar or equivalent to the methods and materials described in the present specification can be used to implement or test the present application. Unless otherwise specified, the following experimental methods are conventional methods or methods described in product specifications. Unless otherwise specified, the experimental materials used are easily available from commercial companies. All published literatures referred to in the present specification are incorporated here by reference to reveal and illustrate the methods and/or materials in the published literatures.
The 28 mutated L1 proteins were as follows respectively:
1) 52L1D447EΔC19: The template was full-length HPV52 L1 gene (the sequence was as shown in SEQ ID NO. 1), and its corresponding amino acid sequence was the sequence No. AEI61557.1 in NCBI database (the sequence was as shown in SEQ ID NO. 30). The polynucleotide sequence encoding HPV52 L1D447EΔC19 was optimized by insect codons, constructed by deleting the nucleotides 1453-1509 of the HPV52 L1 gene backbone for insect cell codon optimization and mutating the nucleotides 1339-1341 from GAC to GAG (the amino acid sequence was as shown in SEQ ID NO. 2, and the nucleotide sequence was as shown in SEQ ID NO. 31), and synthesized by Shanghai Sangon Biotech Co., Ltd.
2) 52L1ΔN2: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-6 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 3, and the nucleotide sequence was as shown in SEQ ID NO. 32), and synthesized by Shanghai Sangon Biotech Co., Ltd.
3) 52L1ΔN4: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-12 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 4, and the nucleotide sequence was as shown in SEQ ID NO. 33), and synthesized by Shanghai Sangon Biotech Co., Ltd.
4) 52L1ΔN5: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-15 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 5, and the nucleotide sequence was as shown in SEQ ID NO. 34), and synthesized by Shanghai Sangon Biotech Co., Ltd.
5) 52L1ΔN8: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-24 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 6, and the nucleotide sequence was as shown in SEQ ID NO. 35), and synthesized by Shanghai Sangon Biotech Co., Ltd.
6) 52L1ΔN10: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-30 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 7, and the nucleotide sequence was as shown in SEQ ID NO. 36), and synthesized by Shanghai Sangon Biotech Co., Ltd.
7) 52L1ΔN13: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-39 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 8, and the nucleotide sequence was as shown in SEQ ID NO. 37), and synthesized by Shanghai Sangon Biotech Co., Ltd.
8) 52L1ΔN15: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-45 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 9, and the nucleotide sequence was as shown in SEQ ID NO. 38), and synthesized by Shanghai Sangon Biotech Co., Ltd.
9) 52L1ΔN18: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-54 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 10, and the nucleotide sequence was as shown in SEQ ID NO. 39), and synthesized by Shanghai Sangon Biotech Co., Ltd.
10) 52L1ΔN20: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by deleting the nucleotides 4-60 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 11, and the nucleotide sequence was as shown in SEQ ID NO. 40), and synthesized by Shanghai Sangon Biotech Co., Ltd.
11) 52L1CS1: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by mutating the nucleotides 1447-1449 of HPV52 L1D447EΔC19 from AAA to GGA and inserting the nucleotide sequence AAAGGTCCTGCATCGAGCGCTCCTAGAACGTCGACGGACGGCTCGGGAGTGGG ACGC after the nucleotide 1452 (the amino acid sequence was as shown in SEQ ID NO. 12, and the nucleotide sequence was as shown in SEQ ID NO. 41), and synthesized by Shanghai Sangon Biotech Co., Ltd.
12) 52L1CS2: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by mutating the nucleotides 1447-1449 of HPV52 L1D447EΔC19 from AAA to GGA and inserting the nucleotide sequence AAAGGTCCTGCATCGAGCGCTCCTAGAACGTCGACGGACGGCTCGGGAGTGGA CGGC after the nucleotide 1452 (the amino acid sequence was as shown in SEQ ID NO. 13, and the nucleotide sequence was as shown in SEQ ID NO. 42), and synthesized by Shanghai Sangon Biotech Co., Ltd.
13) 52L1CS3: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by mutating the nucleotides 1447-1449 of HPV52 L1D447EΔC19 from AAA to GGA and inserting the nucleotide sequence GGATCGCCTGCATCGAGCGCTCCTAGAACGTCGACGGACGGCTCGGGAGTGAA ACGC after the nucleotide 1452 (the amino acid sequence was as shown in SEQ ID NO. 14, and the nucleotide sequence was as shown in SEQ ID NO. 43), and synthesized by Shanghai Sangon Biotech Co., Ltd.
14) 52L1CS4: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by mutating the nucleotides 1447-1449 of HPV52 L1D447EΔC19 from AAA to GGA and inserting the nucleotide sequence GGATCGCCTGCATCGAGCGCTCCTAGAACGTCGACGGACGGCTCGGGAGTGGA CCGC after the nucleotide 1452 (the amino acid sequence was as shown in SEQ ID NO. 15, and the nucleotide sequence was as shown in SEQ ID NO. 44), and synthesized by Shanghai Sangon Biotech Co., Ltd.
52L1CS5: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by inserting the nucleotide sequence GCTGGTCCTGCCTCTTCCGCACCCGCGACTTCAACCGCTGCCGGCGGAGTTGGG TCG after the nucleotide 1452 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 16, and the nucleotide sequence was as shown in SEQ ID NO. 45), and synthesized by Shanghai Sangon Biotech Co., Ltd.
16) 52L1CS6: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by inserting the nucleotide sequence GAAGCTCCTGCCTCTTCCGCACCCGGTACTTCAACCGGCTCGAAAGCGGTTGCT GGA after the nucleotide 1452 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 17, and the nucleotide sequence was as shown in SEQ ID NO. 46), and synthesized by Shanghai Sangon Biotech Co., Ltd.
17) 52L1CS7: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by inserting the nucleotide sequence GCTGGTCCTGCTTCCTCAGCTCCAGCTACCTCAACCGACGGTTCTGGTGTGAAG CGC after the nucleotide 1452 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 18, and the nucleotide sequence was as shown in SEQ ID NO. 47), and synthesized by Shanghai Sangon Biotech Co., Ltd.
18) 52L1CS8: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by inserting the nucleotide sequence GCTGGTCCTGCTTCCTCAGCTCCACGTACCTCAACCGACGGTTCTGGTGTGAAG CGC after the nucleotide 1452 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 19, and the nucleotide sequence was as shown in SEQ ID NO. 48), and synthesized by Shanghai Sangon Biotech Co., Ltd.
19) 52L1CS9: The template was HPV52 L1D447EΔC19 gene (the sequence was as shown in SEQ ID NO. 30). It was constructed by mutating the nucleotides 1441-1443 of HPV52 L1D447EΔC19 from AGA to GGT, mutating the nucleotides 1447-1449 from AAA to GGC and inserting the nucleotide sequence TCGGGTCCTGCCTCGAGCGCCCCTAGAACGTCGACGGG TGGCTCGGCCGTGGGTAGC after the nucleotide 1452 of HPV52 L1D447EΔC19 (the amino acid sequence was as shown in SEQ ID NO. 20, and the nucleotide sequence was as shown in SEQ ID NO. 49), and synthesized by Shanghai Sangon Biotech Co., Ltd.
20) 52L1ΔN13CS1: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by mutating the nucleotides 1411-1416 of HPV52 L1ΔN13 from AAACTG to GGCTTG and inserting the nucleotide sequence TCGGGTCCTGCCTCGAGCGCCCCTAGAACGTCGACGGGTGGCTCGGCCGTGGGT AGC after the nucleotide 1416 (the amino acid sequence was as shown in SEQ ID NO. 21, and the nucleotide sequence was as shown in SEQ ID NO. 50), and synthesized by Shanghai Sangon Biotech Co., Ltd.
21) 52L1ΔN13CS2: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by mutating the nucleotides 1405-1407 of HPV52 L1ΔN13 from AGA to GGT, mutating the nucleotides 1411-1416 from AAACTG to GGCTTG and inserting the nucleotide sequence TCGGGTCCTGCCTCGAGCGCCCCTAGAACGTCGACGGGTGGCTCGGCC GTGGGTAGC after the nucleotide 1416 (the amino acid sequence was as shown in SEQ ID NO. 22, and the nucleotide sequence was as shown in SEQ ID NO. 51), and synthesized by Shanghai Sangon Biotech Co., Ltd.
22) 52L1ΔN13CS3: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by inserting the nucleotide sequence GCCGGTCCTGCCTCGAGCGCCCCTGCCACGTCGACGGCTGCGGGAGGCGTGGG TAGC after the nucleotide 1416 of HPV52 L1ΔN13 (the amino acid sequence was as shown in SEQ ID NO. 23, and the nucleotide sequence was as shown in SEQ ID NO. 52), and synthesized by Shanghai Sangon Biotech Co., Ltd.
23) 52L1NS1ΔC19: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by inserting the nucleotide sequence CCTAGCGAGGCTACC between the nucleotides 3/4 of HPV52 L1ΔN13 (the amino acid sequence was as shown in SEQ ID NO. 24, and the nucleotide sequence was as shown in SEQ ID NO. 53), and synthesized by Shanghai Sangon Biotech Co., Ltd.
24) 52L1NS1ΔC25: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by inserting the nucleotide sequence CCTAGCGAGGCTACC between the nucleotides 3/4 of HPV52 L1ΔN13 and deleting the nucleotides 1414-1431 (the amino acid sequence was as shown in SEQ ID NO. 25, and the nucleotide sequence was as shown in SEQ ID NO. 54), and synthesized by Shanghai Sangon Biotech Co., Ltd.
25) 52L1NS2ΔC19: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by inserting the nucleotide sequence TCCGAGCGT between the nucleotides 3/4 of HPV52 L1ΔN13 (the amino acid sequence was as shown in SEQ ID NO. 26, and the nucleotide sequence was as shown in SEQ ID NO. 55), and synthesized by Shanghai Sangon Biotech Co., Ltd.
26) 52L1NS3ΔC19: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by inserting the nucleotide sequence TCCGAG between the nucleotides 3/4 of HPV52 L1ΔN13 (the amino acid sequence was as shown in SEQ ID NO. 27, and the nucleotide sequence was as shown in SEQ ID NO. 56), and synthesized by Shanghai Sangon Biotech Co., Ltd.
27) 52L1NS4ΔC19: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by inserting the nucleotide sequence TCC between the nucleotides 3/4 of HPV52 L1ΔN13 (the amino acid sequence was as shown in SEQ ID NO. 28, and the nucleotide sequence was as shown in SEQ ID NO. 57), and synthesized by Shanghai Sangon Biotech Co., Ltd.
28) 52L1ΔN14ΔC25: The template was HPV52 L1ΔN13 gene (the sequence was as shown in SEQ ID NO. 37). It was constructed by deleting the nucleotides 4-6 and 1414-1431 of HPV52 L1ΔN13 (the amino acid sequence was as shown in SEQ ID NO. 29, and the nucleotide sequence was as shown in SEQ ID NO. 58), and synthesized by Shanghai Sangon Biotech Co., Ltd.
The EcoR I/BamH I restriction sites were used to digest the above-mentioned synthesized genes respectively, which were inserted into the commercial expression vector pFastBac1 (produced by Invitrogen) respectively to obtain recombinant expression vectors comprising the HPV52 L1 mutated genes, pFastBac1-52L1D447EΔC19, pFastBac1-52L1ΔN2, pFastBac1-52L1ΔN4, pFastBac1-52L1ΔN5, pFastBac1-52L1ΔN8, pFastBac1-52L1ΔN10, pFastBac1-52L1ΔN13, pFastBac1-52L1ΔN15, pFastBac1-52L1ΔN18, pFastBac1-52L1ΔN20, pFastBac1-52L1CS1, pFastBac1-52L1CS2, pFastBac1-52L1CS3, pFastBac1-52L1CS4, pFastBac1-52L1CS5, pFastBac1-52L1CS6, pFastBac1-52L1CS7, pFastBac1-52L1CS8, pFastBac1-52L1CS9, pFastBac1-52L1ΔN13CS1, pFastBac1-52L1ΔN13CS2, pFastBac1-52L1ΔN13CS3, pFastBac1-52L1NS 1 ΔC19, pFastBac1-52L1NS1ΔC25, pFastBac1-52L1NS2ΔC19, pFastBac1-52L1NS3ΔC19, pFastBac1-52L1NS4ΔC19 and pFastBac1-52L1ΔN14ΔC25.
The above-mentioned methods of enzyme digestion, ligation and construction of clones were all well known, for example, the patent CN 101293918 B.
The recombinant expression vectors comprising HPV52 L1 mutant gene, pFastBac1-52L1D447EΔC19, pFastBac1-52L1ΔN2, pFastBac1-52L1ΔN4, pFastBac1-52L1ΔN5, pFastBac1-52L1ΔN8, pFastBac1-52L1ΔN10, pFastBac1-52L1ΔN13, pFastBac1-52L1ΔN15, pFastBac1-52L1ΔN18, pFastBac1-52L1ΔN20, pFastBac1-52L1CS1, pFastBac1-52L1CS2, pFastBac1-52L1CS3, pFastBac1-52L1CS4, pFastBac1-52L1CS5, pFastBac1-52L1CS6, pFastBac1-52L1CS7, pFastBac1-52L1CS8, pFastBac1-52L1CS9, pFastBac1-52L1ΔN13CS1, pFastBac1-52L1ΔN13CS2, pFastBac1-52L1ΔN13C53, pFastBac1-52L1NS 1 ΔC19, pFastBac1-52L1NS1ΔC25, pFastBac1-52L1NS2ΔC19, pFastBac1-52L1NS3ΔC19, pFastBac1-52L1NS4ΔC19 and pFastBac1-52L1ΔN14ΔC25, were used to transform E. coli DH10Bac competent cells respectively, which were screened to obtain recombinant Bacmids. Then the recombinant Bacmids were used to transfect Sf9 insect cells to amplify recombinant baculoviruses within Sf9. Methods of screening of recombinant Bacmid and amplification of recombinant baculovirus were all well known, for example, the patent CN 101148661 B.
519 cells were inoculated with the recombinant baculoviruses of 28 HPV52 L1 mutant genes to express the HPV52 L1 mutant proteins. After incubation at 27° C. for about 80 h, the fermentation broth was collected and centrifuged at 3,000 rpm for 15 min. The supernatant was discarded, and the cells were washed with PBS for use in expression identification and purification. Methods of infection and expression were publicly available, for example, the patent CN 101148661 B.
1×106 cells expressing the different HPV52 L1 mutants and wild-type HPV52 L1 described in Example 3 respectively were collected and resuspended in 200 μl PBS solution. The cells were sonicated by ultrasonic disruption (Ningbo Scientz Ultrasonic Cell Disruptor, 2 #probe, 100 W, ultrasound 5 s, interval 7 s, total period 3 min) and centrifuged at a high speed of 13,000 rpm for 30 minutes. The lysed supernatant was collected and the total protein concentration in each lysed supernatant was detected by BCA assay. The lysed supernatant was uniformly diluted to 20 ng/μl with PBS. 2 μl of 6× loading buffer was added to 10 μl (i.e., 200 ng) of each diluted lysed supernatant. The samples were denatured at 75° C. for 8 min and subjected to SDS-PAGE electrophoresis and Western blot identification to compare the content of L1 protein (with a size of about 55 kDa) in the lysed supernatant of each mutant. The expression identification results of each mutant L1 protein were as shown in
Microtiter plates were coated with HPV52L1 monoclonal antibodies prepared by the inventor at 80 ng/well by overnight incubation at 4° C. The plate was blocked with 5% BSA-PBST at room temperature for 2 h and washed 3 times with PBST. The lysed supernatant was subjected to 2-fold serial dilution with PBS. The HPV52L1 VLP standard was also subjected to serial dilution from a concentration of 2 μg/ml to 0.0625 μg/ml. The diluted samples were added to the plate respectively at 100 μl per well and incubated at 37° C. for 1 h. The plate was washed 3 times with PBST, and 1:3000 diluted HPV52L1 rabbit polyclonal antibody was added at 100 μl per well and incubated at 37° C. for 1 h. The plate was washed 3 times with PBST, and 1:3000 diluted HRP-labeled goat anti-mouse IgG (1:3000 dilution, ZSGB-Bio Corporation) was added and incubated at 37° C. for 45 minutes. The plate was washed 5 times with PBST, and 100 μl of OPD substrate (Sigma) was added to each well for development at 37° C. for 5 minutes. The reaction was stopped with 50 μl of 2 M sulfuric acid, and the absorbance at 490 nm was determined. The concentrations of modified HPV52L1 proteins and wild-type HPV52L1 protein in the lysed supernatant were calculated according to the standard curve.
The results were as shown in Table 1. Different modifications had different effects on the expression level of HPV52L1 protein, among which the expression amount of some modified HPV52L1 proteins was increased, in particular 52L1ΔN13, 52L1CS7, 52L1CS9, 52L1ΔN13CS1, 52L1ΔN13CS2, 52 L1ΔN13CS3, 52 L1NS3ΔC19 and 52 L1NS4ΔC19, all with expression levels above 50 mg/L, much higher than the wild-type HPV52L1 protein.
An appropriate amount of cell fermentation broth of L1 mutants was collected and the cells were resuspended with PBS. PMSF was added to a final concentration of 1 mg/ml. The cells were ultrasonically disrupted (Ningbo Scientz Ultrasonic Cell Disruptor, 2 #probe, 200 W, ultrasound 5 s, interval 7 s, total period 10 min) and centrifuged at 13,000 rpm for 30 min. The supernatant was collected and diluted with PBS to 3-4 mg/mL. Saturated ammonium sulfate solution was added to the supernatant until ammonium sulfate saturation was 30%. The supernatant was let stand for precipitation at 4° C. for 1-2 hours and centrifuged at 13,000 rpm for 30 min. The precipitate was resuspended with an appropriate amount of resuspension buffer (20 mM Na3PO4, 50 mM DTT, 300 mM NaCl, pH 6.8) and stored on ice overnight. The chromatography purification step was performed at room temperature. The sample was filtered with 0.45 μm filter prior to chromatography and purified sequentially using SP-FF cation exchange chromatography and Q-HP anion exchange chromatography (100 mM NaCl, 20 mM Na3PO4, 10 mM DTT, pH 6.8 for loading). The purified product was assembled into VLPs in assembly buffer (500 mM NaCl, 2 mM CaCl2, 2 mM MgCl·6H2O, 20 mM HEPES, 0.01% Tween 80, pH 6.0) at 4° C. After 3 days of assembly, it was transferred into stabilization buffer (500 mM NaCl, 10 mM histidine, 0.01% Tween 80, pH 7.2) and stabilized at 4° C. for 2 days. The purification results showed that the purification yield of the modified 52L1 proteins was higher than that of the wild-type 52L1, in particular 52L1ΔN13, 52L1CS7, 52L1CS9, 52L1ΔN13CS1, 52L1ΔN13CS2, 52 L1ΔN13CS3, 52 L1NS3ΔC19 and 52 L1NS4ΔC19, with purification yields above 15 mg/L. The above purification methods were all publicly available, for example, the patents CN 101293918 B, CN 1976718 A, etc.
The purified protein solutions were subjected to DLS particle size analysis (Zetasizer Nano ZS 90 Dynamic Light Scatterer, Malvern), and the results were as shown in
HPV52 L1 and mutant proteins thereof were purified and assembled respectively according to the chromatographic purification method described in Example 5. The assembled VLPs were prepared on copper mesh, stained with 1% uranium acetate, fully dried and then observed using JM-1400 electron microscope (Olympus). The transmission electron microscopy images of HPV52 L1, HPV52 L1D447EΔC19, HPV52 L1CS5, HPV52 L1CS6, HPV52 L1CS7, HPV52 L1CS9, HPV52 L1ΔN13CS1, HPV52 L1ΔN13CS2 and HPV52 L1NS4ΔC19 VLPs were as shown in
4-6 weeks old female BALB/c mice were randomly divided into groups of 5 mice and immunized with 0.1 μg VLP by intramuscular injection at Weeks 0, 2 and 4. Tail vein blood was collected 2 weeks after the third immunization and serum was isolated.
HPV52 pseudovirus was used to detect the neutralizing antibody titers in immune serum, and the results were as shown in Table 3 and
In summary, the inventor has found that the mutants obtained by modification of HPV52L1 amino acid sequence have different expression levels. Their degree of assembly and immune activity can both be affected by the mutation modification in an irregular way. Therefore, it cannot be expected that HPV52L1 mutants with high expression level, effective assembly and good immune activity can be obtained by modification of the amino acid sequence. The optimally modified HPV52L1 mutants obtained by screening in the present application can be used in the formulation of multivalent HPV prophylactic vaccine and in the construction of broad-spectrum HPV prophylactic vaccine, and has good research and development prospects.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202011351390.9 | Nov 2020 | CN | national |
This application is a U.S. National Phase of International PCT Application No. PCT/CN2021/120518 filed on Sep. 26, 2021, which claims priority to Chinese Patent Application Serial No. 202011351390.9 filed on Nov. 26, 2020, the contents of each application are incorporated herein by reference in their entireties.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/120518 | 9/26/2021 | WO |
