Modified subtilisins having amino acid alterations

Information

  • Patent Grant
  • 5955340
  • Patent Number
    5,955,340
  • Date Filed
    Wednesday, June 7, 1995
    31 years ago
  • Date Issued
    Tuesday, September 21, 1999
    26 years ago
Abstract
Novel carbonyl hydrolase mutants derived from the amino acid sequence of naturally-occurring or recombinant non-human carbonyl hydrolases and DNA sequences encoding the same. The mutant carbonyl hydrolases, in general, are obtained by in vitro modification of a precursor DNA sequence encoding the naturally-occurring or recombinant carbonyl hydrolase to encode the substitution, insertion or deletion of one or more amino acids in the amino acid sequence of a precursor carbonyl hydrolase. Such mutants have one or more properties which are different than the same property of the precursor hydrolase.
Description

FIELD OF THE INVENTION
The present invention relates to novel carbonyl hydrolase mutants derived from the amino acid sequence of naturally-occurring or recombinant non-human carbonyl hydrolases and to DNA sequences encoding the same. Such mutant carbonyl hydrolases, in general, are obtained by in vitro modification of a precursor DNA sequence encoding the naturally-occurring or recombinant carbonyl hydrolase to encode the substitution, insertion or deletion of one or more amino acids in a precursor amino acid sequence.
BACKGROUND OF THE INVENTION
Serine proteases are a subgroup of carbonyl hydrolase. They comprise a diverse class of enzymes having a wide range of specificities and biological functions. Stroud, R. M. (1974) Sci Amer. 131, 74-88. Despite their functional diversity, the catalytic machinery of serine proteases has been approached by at least two genetically distinct familites of enzymes: the Bacillus subtilisins and the mammalian and homologous bacterial serine proteases (e.g., trypsin and S. gresius trypsin). These two families of serine proteases show remarkably similar mechanisms of catalysis. Kraut, J. (1977) Ann. Rev. Biochem. 46, 331-358. Furthermore, although the primary structure is unrelated, the tertiary structure of these two enzyme families bring together a conserved catalytic triad of amino acids consisting of serine, histidine and aspartate.
Subtilisin is a serine endoprotease (MW 27,500) which is secreted in large amounts from a wide variety of Bacillus species. The protein sequence of subtilisin has been determined from at least four different species of Bacillus. Markland, F. S., et al. (1971) in The Enzymes, ed. Boyer P. D., Acad Press, New York, Vol. III, pp. 561-608; Nedkov, P. et al. (1983) Hoppe-Seyler's Z. Physiol. Chem. 364, 1537-1540. The three-dimensional crystallographic structure of subtilisin BPN' (from B. amyloliqoefaciens) to 2.5 A resolution has also been reported. Wright, C. S., et al. (1969) Nature 221, 235-242; Drenth, J. et al. (1972) Eur. J. Biochem. 26, 177-181. These studies indicate that although subtilisin is genetically unrelated to the mammalian serine proteases, it has a similar active site structure. The x-ray crystal structures of subtilisin containing covalently bound peptide inhibitors (Robertus, J. D., et al. (1972) Biochemistry 11, 2439-2449), product complexes (Robertus, J. D., et al. (1972) Biochemistry 11, 4293-4303), and transition state analogs (Matthews, D. A., et al (1975) J. Biol. Chem. 250, 7120-7126; Poulos, T. L., et al. (1976) J. Biol. Chem. 251, 1097-1103), which have been reported have also provided information regarding the active site and putative substrate binding cleft of subtilisin. In addition, a large number of kinetic and chemical modification studies have been reported for subtilisin (Philipp, M., et al. (1983) Mol. Cell. Biochem. 51, 5-32; Svendsen, I. B. (1976) Carlsberg Res. Comm. 41, 237-291; Markland, F. S. Id.) as well as at least one report wherein the side chain of methione at residue 222 of subtilisin was converted by hydrogen peroxide to methionine-sulfoxide (Stauffer, D. C., et al. (1965) J. Biol. Chem. 244, 5333-5338).
Substrate specificity is a ubiquitous feature of biological macromolecules that is determined by chemical forces including hydrogen bonding, electrostatic, hydrophobic and steric interactions. Jencks, W. P., in Catalysis in Chemistry and Enzymology (McGraw-Hill, 1969) pp. 321-436; Fersht, A., in Enzyme Structure and Mechanism (Freeman, San Francisco, 1977) pp. 226-287. Substrate specificity studies of enzymes, however, have been limited to the traditional means of probing the relative importance of these binding forces. Although substrate analogs can be synthesized chemically, the production of modified enzyme analogs has been limited to chemically modified enzyme derivatives (Kaiser, E. T., et al. (1985) Ann. Rev. Biochem. 54, 565-595 or naturally occurring mutants. Kraut, J. (1977) Ann. Rev. Biochem. 46, 331-358.
The recent development of various in vitro techniques to manipulate the DNA sequences encoding naturally-occuring polypeptides as well as recent developments in the chemical synthesis of relatively short sequences of single and double stranded DNA has results in the speculation that such techniques can be used to modify enzymes to improve some functional property in a predictable way. Ulmer, K. M. (1983) Science 219, 666-671. The only working example disclosed therein, however, is the substitution of a single amino acid within the active site of tyrosyl-tRNA synthetase (Cys35-Ser) which lead to a reduction in enzymatic activity. See Winter, G., et al. (1982) Nature 299, 756-758; and Wilkinson, A. J., et al. (1983) Biochemistry 22, 3581-3586 (Cys35.fwdarw.Gly mutation also resulted in decreased activity).
When the same t-RNA synthetase was modified by substituting a different amino acid residue within the active site with two different amino acids, one of the mutants (Thr51.fwdarw.Ala) reportedly demonstrated a predicted moderate increase in kcat/Km whereas a second mutant (Thr51.fwdarw.Pro) demonstrated a massive increase in kcat/Km which could not be explained with certainty. Wilkinson, A. H., et al. (1984) Nature 307, 187-188.
Another reported example of a single substitution of an amino acid residue is the substitution of cysteine for isoleucine at the third residue of T4 lysozyme. Perry, L. J., et al. (1984) Science 226, 555-557. The resultant mutant lysozyme was mildly oxidized to form a disulfide bond between the new cysteine residue at position 3 and the native cysteine at position 97. This crosslinked mutant was initially described by the author as being enzymatically identical to, but more thermally stable than, the wild type enzyme. However, in a "Note Added in Proof", the author indicated that the enhanced stability observed was probably due to a chemical modification of cysteine at residue 54 since the mutant lysozyme with a free thiol at Cys54 has a thermal stability identical to the wild type lysozyme.
Similarly, a modified dehydrofolate reductase from E. coli has been reported to be modified by similar methods to introduce a cysteine which could be crosslinked with a naturally-occurring cysteine in the reductase. Villafranca, D. E., et al. (1983) Science 222, 782-788. The author indicates that this mutant is fully reactive in the reduced state but has significantly diminished activity in the oxidized state. In addition, two other substitutions of specific amino acid residues are reported which resulted in mutants which had diminished or no activity.
As set forth below, several laboratories have also reported the use of site directed mutagensis to produce the mutation of more than one amino acid residue within a polypeptide.
The amino-terminal region of the signal peptide of the prolipoprotein of the E. coli outer membrane was stated to be altered by the substitution or deletion of residues 2 and 3 to produce a charge change in that region of the polypeptide. Inoyye, S., et al. (1982) Proc. Nat. Acad. Sci. USA 79, 3438-3441. The same laboratory also reported the substitution and deletion of amino acid residues 9 and 14 to determine the effects of such substitution on the hydrophobic region of the same signal sequence. Inouye, S., et al. (1984) J. Biol. Chem. 259, 3729-3733. In the case of mutants at residues 2 and 3 the authors state that the results obtained were consistant with the proposed loop model for explaining the functions of the signal sequence. However, as reported the mutations at residues 9 and 14 produced results indicating that the signal peptide has unexpeded flexibility in terms of the relationship between its primary structure and function in protein secretion.
Double mutants in the active site of tyrosyl-t-RNA synthetase have also been reported. Carter, P. J., et al. (1984) Cell 38, 835-840. In this report, the improved affinity of the previously described Thr51.fwdarw.Pro mutant for ATP was probed by producing a second mutation ion the active site of the enzyme. One of the double mutants, Gly35/Pro51, reportedly demonstrated an unexpected result in that it bound ATP in the transition state better than was expected from the two single mutants. Moreover, the author warns, at least for one double mutant, that it is not readily predictable how one substitution alters the effect caused by the other substitution and that care must be taken in interpreting such substitutions.
A mutant is disclosed in U.S. Pat. No. 4,532,207, wherein a polyarginine tail was attached to the C-terminal residue of .beta.-urogastrone by modifying the DNA sequence encoding the polypeptide. As disclosed, the polyarginine tail changed the electrophoretic mobility of the urogastrone-polyaginine hybrid permiting selective purification. The polyarginine was subsequently removed, according to the patentee, by a polyarginine specific exopeptidase to produce the purified urogastrone. Properly construed, this reference discloses hybrid polypeptides which do not constitute mutant polypeptides containing the substitution, insertion or deletion of one or more amino acids of a naturally occurring polypeptide.
Single and double mutants of rat pancreatic trypsin have also been reported. Craik, C. S., et al. (1985) Science 228, 291-297. As reported, glycine residues at positions 216 and 226 were replaced with alanine residues to produce three trypsin mutants (two single mutants and one double mutant). In the case of the single mutants, the authors stated expectation was to observe a differential effect on Km. They instead reported a change in specificity (kcat/Km) which was primarily the result of a decrease in kcat. In contrast, the double mutant reportedly demonstrated a differential increase in Km for lysyl and arginyl substrates sa compared to wild type trypsin but had virtually no catalytic activity.
The references discussed above are provided solely for their disclosure prior to the filing date of the instant case, and nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or priority based on earlier filed applications.
Based on the above references, however, it is apparent that the modification of the amino acid sequence of wild type enzymes often results in the decrease or destruction of biological activity. Moreover, these references do not address the mutation of the particular carbonyl hydrolases disclosed herein.
Accordingly, it is an object herein to provide carbonyl hydrolase mutants which have at least one property which is different from the same property of the carbonyl hydrolase precursor from which the amino acid of said mutant is derived.
It is a further object to provide mutant DNA sequences encoding such carbonyl hydrolase mutants as well as expression vectors containing such mutant DNA sequences.
Still further, another object of the present invention is to provide host cells which are capable of expressing such mutants either intracellularly or extracellularly.
SUMMARY OF THE INVENTION
The invention includes carbonyl hydrolase mutants, preferably having at least one property which is substantially different from the same property of the precursor non-human carbonyl hydrolase from which the amino acid sequence of the mutant is derived. These properties include oxidative stability, substrate, specificity catalytic activity, thermal stability, alkaline stability, pH activity profile and resistance to proteolytic degradation. The precursor carbonyl hydrolase may be naturally occurring carbonyl hydrolases or recombinant carbonyl hydrolases. The amino acid sequence of the carbonyl hydrolase mutant is derived by the substitution, deletion or insertion of one or more amino acids of the precursor carbonyl hydrolase amino acid sequence.
The invention also includes mutant DNA sequences encoding such carbonyl hydrolase mutants. These mutant DNA sequences are derived from a precursor DNA sequence which encodes a naturally occurring or recombinant precursor carbonyl hydrolase. The mutant DNA sequence is derived by modifying the precursor DNA sequence to encode the substitution, deletion or insertion of one or more amino acids encoded by the precursor DNA sequence. These recombinant DNA sequences encode mutants having an amino acid sequence which does not exist in nature and at least one property which is substantially different from the same property of the precursor carbonyl hydrolase encoded by the precursor DNA sequence.
Further the invention includes expression vectors containing such mutant DNA sequences as well as host cells transformed with such vectors which are capable of expressing said carbonyl hydrolase mutants.





BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A and 1B shows the nucleotide sequence of the coding strand, correlated with the amino acid sequence of B. amyloliquefaciens subtilisin gene. Promoter (p) ribosome binding site (rbs) and termination (term) regions of the DNA sequence as well as sequences encoding the presequence (PRE) putative prosequence (PRO) and mature form (MAT) of the hydrolase are also shown.
FIG. 2 is a schematic diagram showing the substrate binding cleft of subtilisin together with substrate.
FIG. 3 is a stereo view of the S-1 binding subsite of B. amyloliquefaciens subtilisin showing a lysine P-1 substrate bound in the site in two different ways. FIG. 3A shows Lysine P-1 substrate bound to form a salt bridge with a Glu at position 15. FIG. 3B shows Lysine P-1 substrate bound to form a salt bridge with Glu at position 166.
FIG. 4 is a schematic diagram of the active site of subtilisin Asp32, His64 and Ser221.
FIGS. 5A-1, 5A-2, 5B-2 and 5C depict the amino acid sequence of subtilisin obtained from various sources. The residues directly beneath each residue of B. amyloliquefaciens subtilisin are equivalent residues which (1) can be mutated in a similar manner to that described for B. amyloliquefaciens subtilisin, or (2) can be used as a replacement amino acid residue in B. amyloliquefaciens subtilisin. FIG. 5C depicts conserved residues of B. amyloliquefaciens subtilisin when compared to other subtilisin sequences.
FIGS. 6A and 6B depict the inactivation of the mutants Met222L and Met222Q when exposed to various organic oxidants.
FIGS. 7A and 7B depicts the ultraviolet spectrum of Met222F subtilisin and the difference spectrum generated after inactivation by diperdodecanoic acid (DPDA).
FIG. 8 shows the pattern of cyanogen bromide digests of untreated and DPDA oxidized subtilisin Met222F on high resolution SDS-pyridine peptide gels.
FIG. 9 depicts a map of the cyanogen bromide fragments of FIG. 8 and their alignment with the sequence of subtilisin Met222F.
FIG. 10 depicts the construction of mutations between codons 45 and 50 of B. amyloliquefaciens subtilisin.
FIG. 11 depicts the construction of mutations between codons 122 and 127 of B. amyloliquefaciens subtilisin.
FIG. 12 depicts the effect of DPDA on the activity of subtilisin mutants at positions 50 and 124 in subtilisin Met222F.
FIG. 13 depicts the construction of mutations at codon 166 of B. amyloliquefaciens subtilisin.
FIG. 14 depicts the effect of hydrophobicity of the P-1 substrate side-chain on the kinetic parameters of wild-type B. amyloliquefaciens subtilisin.
FIG. 15A and 15B depicts the effect of position 166 side-chain substitutions on P-1 substrate specificity. FIG. 15A shows position 166 mutant subtilisins containing non-branched alkyl and aromatic side-chain substitutions arranged in order of increasing molecular volume. FIG. 15B shows a series of mutant enzymes progressing through .beta.- and .gamma.-branched aliphatic side chain substitutions of increasing molecular volume.
FIG. 16A, 16B, 16C and 16D depicts the effect of position 166 side-chain volumn on log kcat/Km for various P-1 substrates.
FIG. 17 shows the substrate specificity differences between Ile166 and wild-type (Gly166) B. amyloliquefaciens subtilisin against a series of alphatic and aromatic substrates. Each bar represents the difference in log kcat/Km for Ile166 minus wild-type (Gly166) subtilisin.
FIG. 18 depicts the construction of mutations at codon 169 of B. amyloliquefaciens subtilisin.
FIG. 19 depicts the construction of mutations at codon 104 of B. amyloliquefaciens subtilisin.
FIG. 20 depicts the construction of mutations at codon 152 B. amyloliquefaciens subtilisin.
FIG. 21 depicts the construction of single mutations at codon 156 and double mutations at codons 156 and 166 of B. amyloliquefaciens subtilisin.
FIG. 22 depicts the construction of mutations at codon 217 for B. amyloliquefaciens subtilisin.
FIG. 23A depicts the kcat/Km versus pH profile for mutations at codon 156 and 166 in B. amyloliquefaciens subtilisin.
FIG. 23B depicts the kcat/Km versus pH profile for mutations at codon 156 and 166 in B. amyloliquefaciens subtilisin.
FIG. 24 depicts the kcat/Km versus pH profile for mutations at codon 222 in B. amyloliquefaciens subtilisin.
FIG. 25 depicts the constructing mutants at codons 94, 95 and 96.
FIG. 26 and 27 depict substrate specificity of proteins for 4 substrates.
FIG. 28A, B, C and D depict the effect of charge in the P-1 binding sites due to substitutions at codon 156 and 166.
FIGS. 29A and B are a stereoview of the P-1 binding site of subtilisin BPN' showing a lysine P-1 substrate bound in the site in two ways. In 29A, Lysine P-1 substrate is built to form a salt bridge with a Glu at codon 156. In 29B, Lysine P-1 substrate is built to form a salt bridge with Glu at codon 166.
FIGS. 30A, 30B and 30C demonstrates residual enzyme activity versus temperature curves for purified wild-type (Panel A), C22/C87 (Panel B) and C24/C87 (Panel C).
FIG. 31 depicts the strategy for producing point mutations in the subtilisin coding sequence by misincorporation of .alpha.-thioldeoxynucleotide triphosphates.
FIG. 32 depicts the autolytic stability of purified wild type and mutant subtilisins 170E, 107V, 213R and 107V/213R at alkaline pH.
FIG. 33 depicts the autolytic stability of purified wild type and mutant subtilisins V50, F50 and F50/V107/R213 at alkaline pH.
FIG. 34 depicts the strategy for constructing plasmids containing random cassette mutagenesis over residues 197 and 228.
FIGS. 35A and 35B depicts the oligodeoxynucleotides used for random cassette mutagenesis over residues 197 through 228.
FIG. 36 depicts the construction of mutants at codon 204.
FIG. 37 depicts the oligodeoxynucleotides used for synthesizing mutants at codon 204.





DETAILED DESCRIPTION
The inventors have discovered that various single and multiple in vitro mutations involving the substitution, deletion or insertion of one or more amino acids within a non-human carbonyl hydrolase amino acid sequence can confer advantageous properties to such mutants when compared to the non-mutated carbonyl hydrolase.
Specifically, B. amyloliquefaciens subtilisin, an alkaline bacterial protease, has been mutated by modifying the DNA encoding the subtilisin to encode the substitution of one or more amino acids at various amino acid residues within the mature form of the subtilisin molecule. These in vitro mutant subtilisins have at least one property which is different when compared to the same property of the precursor subtilisin. These modified properties fall into several categories including: oxidative stability, substrate specificity, thermal stability, alkaline stability, catalytic activity, pH activity profile, resistance to proteolytic degradation, Km, kcat and Km/kcat ratio.
Carbonyl hydrolases are enzymes which hydrolyze compounds containing ##STR1## bonds in which X is oxygen or nitrogen. They include naturally-occurring carbonyl hydrolases and recombinant carbonyl hydrolases. Naturally occurring carbonyl hydrolases principally include hydrolases, e.g. lipases and peptide hydrolases, e.g. subtilisins or metalloproteases. Peptide hydrolases include .alpha.-aminoacylpeptide hydrolase, peptidylamino-acid hydrolase, acylamino hydrolase, serine carboxypeptidase, metallocarboxypeptidase, thiol proteinase, carboxylproteinase and metalloproteinase. Serine, metallo, thiol and acid proteases are included, as well as endo and exo-proteases.
"Recombinant carbonyl hydrolase" refers to a carbonyl hydrolase in which the DNA sequence encoding the naturally occurring carbonyl hydrolase is modified to produce a mutant DNA sequence which encodes the substitution, insertion or deletion of one or more amino acids in the carbonyl hydrolase amino acid sequence. Suitable modification methods are disclosed herein and in EPO Publication No. 0130756 published Jan. 9, 1985.
Subtilisins are bacterial carbonyl hydrolases which generally act to cleave peptide bonds of proteins or peptides. As used herein, "subtilisin" means a naturally occurring subtilisin or a recombinant subtilisin. A series of naturally occurring subtilisins is known to be produced and often secreted by various bacterial species. Amino acid sequences of the members of this series are not entirely homologous. However, the subtilisins in this series exhibit the same or similar type of proteolytic activity. This class of serine proteases shares a common amino acid sequence defining a catalytic triad which distinguishes them from the chymotrypsin related class of serine proteases. The subtilisins and chymotrypsin related serine proteases both have a catalytic triad comprising aspartate, histidine and serine. In the subtilisin related proteases the relative order of these amino acids, reading from the amino to carboxy terminus is aspartate-histidine-serine. In the chymotrypsin related proteases the relative order, however is histidine-aspartate-serine. Thus, subtilisin herein refers to a serine protease having the catalytic triad of subtilisin related proteases.
"Recombinant subtilisin" refers to a subtilisin in which the DNA sequence encoding the subtilisin is modified to produce a mutant DNA sequence which encodes the substitution, deletion or insertion of one or more amino acids in the naturally occurring subtilisin amino acid sequence. Suitable methods to produce such modification include those disclosed herein and in EPO Publication No. 0130756. For example, the subtilisin multiple mutant herein containing the substitution of methionine at amino acid residues 50, 124 and 222 with phenylalanine, isoleucine and glutamine, respectively, can be considered to be derived from the recombinant subtilisin containing the substitution of glutamine at residue 222 (Gln222) disclosed in EPO Publication No. 0130756. The multiple mutant thus is produced by the substitution of phenylalanine for methionine at residue 50 and isoleucine for methionine at residue 124 in the Gln222 recombinant subtilisin.
"Non-human carbonyl hydrolases" and their genes may be obtained from many procaryotic and eucaryotic organisms. Suitable examples of procaryotic organisms include gram negative organisms such as E. coli or pseudomonas and gram positive bacteria such as micrococcus or bacillus. Examples of eucaryotic organisms from which carbonyl hydrolase and their genes may be obtained include yeast such as S. cerevisiae, fungi such as Aspergillus sp., and non-human mammalian sources such as, for example, Bovin sp. from which the gene encoding the carbonyl hydrolase chymosin can be obtained. As with subtilisins, a series of carbonyl hydrolases can be obtained from various related species which have amino acid sequences which are not entirely homologous between the members of that series but which nevertheless exhibit the same or similar type of biological activity. Thus, non-human carbonyl hydrolase as used herein has a functional definition which refers to carbonyl hydrolases which are associated, directly or indirectly, with procaryotic and non-human eucaryotic sources.
A "carbonyl hydrolase mutant" has an amino acid sequence which is derived from the amino acid sequence of a non-human "precursor carbonyl hydrolase". The precursor carbonyl hydrolases include naturally-occurring carbonyl hydrolases and recombinant carbonyl hydrolases. The amino acid sequence of the carbonyl hydrolase mutant is "derived" from the precursor hydrolase amino acid sequence by the substitution, deletion or insertion of one or more amino acids of the precursor amino acid sequence. Such modification is of the "precursor DNA sequence" which encodes the amino acid sequence of the precursor carbonyl hydrolase rathern than manipulation of the precursor carbonyl hydrolase per se. Suitable methods for such manipulation of the precursor DNA sequence include methods disclosed herein and in EPO Publication No. 0130756.
Specific residues of B. amyloliquefaciens subtilisin are identified for substitution, insertion or deletion. These amino acid position numbers refer to those assigned to the B. amyloliquefaciens subtilisin sequence presented in FIG. 1. The invention, however, is not limited to the mutation of this particular subtilisin but extends to precursor carbonyl hydrolases containing amino acid residues which are "equivalent" to the particular identified residues in B. amyloliquefaciens subtilisin.
A residue (amino acid) of a precursor carbonyl hydrolase is equivalent to a residue of B. amyloliquefaciens subtilisin if it is either homologous (i.e., corresponding in position in either primary or tertiary structure) or analagous to a specific residue or portion of that residue in B. amyloliquefaciens subtilisin (i.e., having the same or similar functional capacity to combine, react, or interact chemically).
In order to establish homology to primary structure, the amino acid sequence of a precursor carbonyl hydrolase is directly comparted to the B. amyloliquefaciens subtilisin primary sequence and particularly to a set of residues known to be invariant in all subtilisins for which sequence is known (FIG. 5C). After aligning the conserved residues, allowing for necessary insertions and deletions in order to maintain alignment (i.e., avoiding the elimination of conserved residues through arbitrary deletion and insertion), the residues equivalent to particular amino acids in the primary sequence of B. amyloliquefaciens subtilisin are defined. Alignment of conserved residues preferably should conserve 100% of such residues. However, alignment of greater than 75% or as little sa 50% of conserved residues is also adequate to define equivalent residues. Conservation of the catalytic triad, Asp32/His64/Ser221 should be maintained.
For example, in FIGS. 5A-1 and 5A-2 the amino acid sequence of subtilisin from B. amyloliquefaciens B. subtilisin var. I168 and B. lichenformis (carlsbergensis) are aligned to provide the maximum amount of homology between amino acid sequences. A comparison of these sequences shows that there are a number of conserved residues contained in each sequence. These residues are identified in FIG. 5C.
These conserved residues thus may be used to define the corresponding equivalent amino acid residues of B. amyloliquefaciens subtilisin in other carbonyl hydrolases such as thermitase derived from Thermoactinomyces. These two particular sequences are aligned in FIG. 5B to produce the maximum homology of conserved residues. As can be seen there are a number of insertions and deletions in the thermitase sequence as compared to B. amyloliquefaciens subtilisin. Thus, the equivalent amino acid or Tyr217 in B. amyloliquefaciens subtilisin in thermitase is the particular lysine shown beneath Tyr217.
In FIG. 5A, the equivalent amino acid at position 217 in B. amyloliquefaciens subtilisin is Tyr. Likewise, in B. subtilis subtilisin position 217 is also occupied by Tyr but in B. licheniformis position 217 is occupied by Leu.
Thus, these particular residues in thermitase, and subtilisin from B. subtilisin and B. licheniformis may be substituted by a different amino acid to produce a mutant carbonyl hydrolase since they are equivalent in primary structure to Tyr217 in B. amyloliquefaciens subtilisin. Equivalent amino acids of course are not limited to those for Tyr217 but extend to any residue which is equivalent to a residue in B. amyloliquefaciens whether such residues are conserved or not.
Equivalent residues homologous at the level of tertiary structure for a precursor carbonyl hydrolase whose tertiary structure has been determined by x-ray crystallography, are defined as those for which the atomic coordinates of 2 or more of the main chain atoms of a particular amino acid residue of the precursor carbonyl hydrolase and B. amyloliquefaciens subtilisin (N on N, CA on CA, C on C, and O on O) are within 0.13 nm and preferably 0.1 nm after alignment. Alignment is achieved after the best model has been oriented and positioned to give the maximum overlap of atomic coordinates of non-hydrogen protein atoms of the carbonyl hydrolase in question to the B. amyloliquefaciens subtilisin. The best model is the crystallographic model giving the lowest R factor for experimental diffraction data at the highest resolution available. ##EQU1##
Equivalent residues which are functionally analogous to a specific residue of B. amyloliquefaciens subtilisin are defined as those amino acids of the precursor carbonyl hydrolases which may adopt a conformation such that they wither alter, modify or contribute to protein structure, substrate binding or catalysis in a manner defined and attributed to a specific residue of the B. amyloliquefaciens subtilisin as described herein. Further, they are those residues of the precursor carbonyl hydrolase (for which a tertiary structure has been obtained by x-ray crystallography), which occupy an analogous position to the extent that although the main chain atoms of the given residue may not satisfy the criteria of equivalence on the basis of occupying a homologous position, the atomic coordinates of at least two of the side chain atoms of the residue lie with 0.13 nm of the corresponding side chain atoms of B. amyloliquefaciens subtilisin. The three dimensional structures would be aligned as outlined above.
Some of the residues identified for substitution, insertion or deletion are conserved residues whereas others are not. In the case of residues which are not conserved, the replacement of one or more amino acids is limited to substitutions which produce a mutant which has an amino acid sequence that does not correspond to one found in nature. In the case of conserved residues, such replacements should not result in a naturally occurring sequence. The carbonyl hydrolase mutants of the present invention include the mature forms of carbonyl hydrolase mutants as well as the pro- and prepro-forms of such hydrolase mutants. The prepro-forms are the preferred construction since this facilitates the expression, secretion and maturation of the carbonyl hydrolase mutants.
"Prosequence" refers to a sequence of amino acids bound to the N-terminal portion of the mature form of a carbonyl hydrolase which when removed results in the appearance of the "mature" form of the carbonyl hydrolase. Many proteolytic enzymes are found in nature as translational proenzyme products and, in the absence of post-translational processing, are expressed in this fashion. The preferred prosequence for producing carbonyl hydrolase mutants, specifically subtilisin mutants, is the putative prosequence of B. amyloliquefaciens subtilisin although other subtilisin prosequences may be used.
A "signal sequence" or "presequence" refers to any sequence of amino acids bound to the N-terminal portion of a carbonyl hydrolase or to the N-terminal portion of a prohydrolase which may participate in the secretion of the mature or pro forms of the hydrolase. This definition of signal sequence is a functional one, meant to include all those amino acid sequences, encoded by the N-terminal portion of the subtilisin gene or other secretable carbonyl hydrolases, which participate in the effectuation of the secretion of subtilisin or other carbonyl hydrolases under native conditions. The present invention utilizes such sequences to effect the secretion of the carbonyl hydrolase mutants as defined herein.
A "prepro" form of a carbonyl hydrolase mutant consists of the mature form of the hydrolase having a prosequence operably linked to the amino-terminus of the hydrolase and a "pre" or "signal" sequence operably linked to the amino terminus of the prosequence.
"Expression vector" refers to a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of effecting the expression of said DNA in a suitable host. Such control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control termination of transcription and translation. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself. In the present specification, "plasmid" and "vector" are sometimes used interchangeably as the plasmid is the most commonly used form of vector at present. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which are, or become, known in the art.
The "host cells" used in the present invention generally are procaryotic or eucaryotic hosts which preferably have been manipulated by the methods disclosed in EPO Publication No. 0130756 to render them incapable of secreting enzymatically active endoprotease. A preferred host cell for expressing subtilisin is the Bacillus strain BG2036 which is deficient in enzymatically active neutral protease and alkaline protease (subtilisin). The construction of strain BG2036 is described in detail in EPO Publication No. 0130756 and further described by Yang, M. Y., et al. (1984) J. Bacteriol. 160, 15-21. Such host cells are distinguishible form those disclosed in PCT Publication No. 03949 wherein enzymatically inactive mutants of intracellular proteases in E. coli are disclosed. Other host cells for expressing subtilisin include Bacillus subtilis I168 (EPO Publication No. 0130756).
Host cells are transformed or transfected with vectors constructed using recombinant DNA techniques. Such transformed host cells are capable of either replicating vectors encoding the carbonyl hydrolase mutants or expressing the desired carbonyl hydrolase mutant. In the case of vectors which encode the pre or prepro form of the carbonyl hydrolase mutant, such mutants, when expressed, are typically secreted from the host cell into the host cell medium.
"Operably linked" when describing the relationship between two DNA regions simply means that they are functionally related to each other. For example, a presequence is operably linked to a peptide if it functions as a signal sequence, participating in the secretion of the mature form of the protein most probably involving cleavage of the signal sequence. A promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.
The genes encoding the naturally-occurring precursor carbonyl hydrolase may be obtained in accord with the general methods described in EPO Publication No. 0130756. As can ben seen from the examples disclosed therein, the methods generally comprise synthesizing labelled probes having putative sequences encoding regions of the hydrolase of interest, preparing genomic libraries from organisms expressing the hydrolase, and screening the libraries for the gene of interest by hybridization to the probes. Positively hybridizing clones are then mapped and sequenced.
The cloned carbonyl hydrolase is then used to transform a host cell in order to express the hydrolase. The hydrolase gene is then ligated into a high copy number plasmid. This plasmid replicates in hosts in the sense that it contains the well-known elements necessary for plasmid replication: a promoter operably linked to the gene in question (which may be supplied as the gene's own homologous promoter if it is recognized, i.e., transcribed, by the host), a transcription termination and polyadenylation region (necessary for stability of the mRNA transcribed by the host from the hydrolase gene in certain eucaryotic host cells) which is exogenous or is supplied by the endogenous terminator region of the hydrolase gene and, desirably, a selection gene such as an antibiotic resistance gene that enables continuous cultural maintenance of plasmid-infected host cells by growth in antibiotic-containing media. High copy number plasmids also contain an origin of replication for the host, thereby enabling large numbers of plasmids to be generated in the cytoplasm without chromosonal limitations. However, it is within the scope herein to integrate multiple copies of the hydrolase gene into host genome. This is facilitated by procaryotic and eucaryotic organisms which are particularly susceptible to homologous recombination.
Once the carbonyl hydrolase gene has been cloned, a number of modifications are undertaken to enhance the use of the gene beyond synthesis of the naturally-occurring precursor carbonyl hydrolase. Such modifications include the production of recombinant carbonyl hydrolases as disclosed in EPO Publication No. 0130756 and the production of carbonyl hydrolase mutants described herein.
The following cassette mutagenesis method may be used to facilitate the construction and identification of the carbonyl hydrolase mutants of the present invention although other methods including site-directed mutagenesis may be used. First, the gene encoding the hydrolase is obtained and sequenced in whole or in part. Then the sequence is scanned for a point at which it is desired to make a mutation (deletion, insertion or substitution) of one or more amino acids in the expressed enzyme. The sequences flanking this point are evaluated for the presence of restriction sites for replacing a short segment of the gene with an oligonucleotide pool which when expressed will encode various mutants. Such restriction sites are preferably unique sites within the hydrolase gene so as to facilitate the replacement of the gene segment. However, any convenient restriction site which is not overly redundant in the hydrolase gene may be used, provided the gene fragments generated by restriction digestion can be reassembled in proper sequence. If restriction sites are not present at locations within a convenient distance from the selected point (from 10 to 15 nucleotides), such sites are generated by substituting nucleotides in the gene in such a fashion that neither the reading frame nor the amino acids encoded are changed in the final construction. The task of locating suitable flanking regions and evaluating the needed changes to arrive at two convenient restriction site sequences is made routine by the redundancy of the genetic code, a restriction enzyme map of the gene and the large number of different restriction enzymes. Note that if a convenient flanking restriction site is available, the above method need be used only in connection with the flanking region which does not contain a site.
Mutation of the gene in order to change its sequence to conform to the desired sequence is accomplished by M13 primer extension in accord with generally known methods. Once the gene is cloned, the restriction sites flanking the sequence to be mutated are digested with the cognate restriction enzymes and a plurality of end termini-complementary oligonucleotide cassettes are ligated into the gene. The mutagenesis is enormously simplified by this method because all of the oligonucleotides can be synthesized so as to have the same restriction sites, and no synthetic linkers are necessary to create the restriction sites.
The number of commercially available restriction enzymes having sites not present in the gene of interest is generally large. A suitable DNA sequence computer search program simplifies the task of finding potential 5' and 3' convenient flanking sites. A primary constraint is that any mutation introduced in creation of the restriction site must be silent to the final construction amino acid coding sequence. For a candidate restriction site 5' to the target codon a sequence must exist in the gene which contains at least all the nucleotides but for one in the recognition sequence 5' to the cut of the candidate enzyme. For example, the blunt cutting enzyme SmaI (CCC/GGG) would be a 5' candidate if a nearby 5' sequence contained NCC, CNC, or CCN. Furthermore, if N needed to be altered to C this alteration must leave the amino acid coding sequence intact. In cases where a permanent silent mutation is necessary to introduce a restriction site one may want to avoid the introduction of a rarely used codon. A similar situation of SmaI would apply for 3' flaking sites except the sequence NGG, GNG, or GGN must exist. The criteria for locating candidate enzymes is most relaxed for blunt cutting enzymes and most stringent for 4 base overhand enzymes. In generally many candidate sites are available. For the codon-221 target described herein a BalI site (TGG/CCA) would have been engineered in one base pair 5' from the KpnI site. A 3' EcoRV site (GAT/ATC) could have been employed 11 base pairs 5' to the PstI site. A cassette having termini ranging from a blunt end up to a four base-overhang will function without difficulty. In retrospect, this hypothetical EcoRV site would have significantly shortened the oligonucleotide cassette employed (9 and 13 base pairs) thus allowing greater purity and lower pool bias problems. Flanking sites should obviously be chosen which cannot themselves ligate so that ligation of the oligonucleotide cassette can be assured in a single orientation.
The mutant carbonyl hydrolases expressed upon transformation of suitable hosts are screened for enzymes exhibiting one or more properties which are substantially different from the properties of the precursor carbonyl hydrolases, e.g., changes in substrate specificity, oxidative stability, thermal stability, alkaline stability, resistance to proteolytic degradation, pH-activity profiles and the like.
The carbonyl hydrolase mutants of the present invention may also be generated by random mutagenesis. See for example the methods disclosed by Shortle, D., et al. (1985) Genetics, 110, 539; Shortle, D., et al. (1986) Proteins: Structure, Function and Genetics, 1, 81: Shortle, D. (1986) J. Cell. Biochem, 30, 281; Alber, T., et al. (1985) Proc. Natl. Acad. of Sci., 82, 747; Matsumura, M., et al. (1985) J. Biochem., 260, 15298; Liao, H. , et al. (1986) Proc. Natl. Acad. of Sci., 83 576; and the random mutagenesis method disclosed herein.
When combined with the alkaline stability screening procedure disclosed herein, mutants obtained by random mutagenesis were identified which demonstrated either increased or decreased alkaline or thermal stability.
A change in substrate specificity is defined as a difference between the kcat/Km ratio of the precursor carbonyl hydrolase and that of the hydrolase mutant. The kcat/Km ratio is a measure of catalytic efficienty. Carbonyl hydrolase mutants with increased or diminished kcat/Km ratios are described in the examples. Generally, the objective will be to secure a mutant having a greater (numerically large) kcat/Km ratio for a given substrate, thereby enabling the use of the enzyme to more efficiently act on a target substrate. A substantial change in kcat/Km ratio is preferably at least 2-fold increase or decrease. However, smaller increases or decreases in the ratio (e.g., at least 1.5-fold) are also considered substantial. An increase in kcat/Km ratio for one substrate may be accompanied by a reduction in kcat/Km ratio for another substrate. This is a shift in substrate specificity, and mutants exhibiting such shifts have utility where the precursor hydrolase is undesirable, e.g. to prevent undesired hydrolysis of a particular substrate in an admixture of substrates. Km and kcat are measured in accord with known procedures, as describe din EPO Publication No. 0130756 or as described herein.
Oxidative stability is measured either by known procedures or by the methods described hereinafter. A substantial change in oxidative stability is evidenced by at least about 50% increase or decrease (preferably decrease) in the rate of loss of enzyme activity when exposed to various oxidizing conditions. Such oxidizing conditions are exposure to the organic oxidant diperdodecanoic acid (DPDA) under the conditions described in the examples.
Alkaline stability is measured either by known procedures or by the methods described herein. A substantial change in alkaline stability is evidenced by at least about a 5% or greater increase or decrease (preferably increase) in the half life of the enzymatic activity of a mutant when compared to the precursor carbonyl hydrolase. In the case of subtilisins, alkaline stability was measured as a function of autoproteolytic degradation of subtilisin at alkaline pH, e.g. for example, 0.1M sodium phosphate, pH 12 at 25.degree. or 30.degree. C.
Thermal stability is measured either by known procedures or by the methods described herein. A substantial change in thermal stability is evidenced by at least about a 5% or greater increase or decrease (preferably increase) in the half-life of the catalytic activity of a mutant when exposed to a relatively high temperature and neutral pH as compared to the precursor carbonyl hydrolase. In the case of subtilisins, thermal stability is measured by the autoproteolytic degradation of subtilisin at elevated temperatures and neutral pH, e.g., for example 2 mM calcium chloride, 50 mM MOPS pH 7.0 at 59.degree. C.
The inventors have produced mutant subtilisins containing the substitution of the amino acid residues of B. amyloliquefaciens subtilisin shown in Table I. The wild type amine acid sequence and DNA sequence of B. amyloliquefaciens subtilisin is shown in FIG. 1.
TABLE I______________________________________Residue Replacement Amino Acid______________________________________Tyr21 FThr22 CSer24 CAsp32 N Q SSer33 A TAsp36 A GGlyA6 VAla48 E V RSer49 C LMet50 C F VAsn77 DSer87 CLys94 CVal95 CTyr104 A C D E F G H I K L M N P Q R S T V WIle107 VGly110 C RMet124 I LAla152 G SAsn155 A D H Q TGlu156 Q SGly166 A C D E F H I K L M N P Q R S T V W YGly169 A C D E F H I K L M N P Q R S T V W YLys170 E RTyr171 FPro172 E QPhe189 A C D E G H I K L M N P Q R S T V W YAsp197 R AMet199 ISer204 C R L PLys213Tyr217 A C D E F G H I K L M N P Q R S T V WSer221 A CMet222 A C D E F G H I K L N P Q R S T V W Y______________________________________
The different amino acids substituted are represented in Table I by the following single letter designations:
______________________________________Amino acidor residue 3-letter 1-letterthereof symbol symbol______________________________________Alanine Ala AGlutamate Glu EGlutamine Gln QAspartate Asp DAsparagine Asn NLeucine Leu LGlycine Gly GLysine Lys KSerine Ser SValine Val VArginine Arg RThreonine Thr TProline Pro PIsoleucine Ile IMethionine Met MPhenylalanine Phe FTyrosine Tyr YCysteine Cys CTryptophan Trp WHistidine His H______________________________________
Except where otherwise indicated by context, wild-type amino acids are represented by the above three-letter symbols and replaced amino acids by the above single-letter symbols. Thus, if the methionine at residue 50 in B. amyloliquefaciens subtilisin is replaced by Phenylalanine, this mutation (mutant) may be designated Met50F or F50. Similar designations will be used for multiple mutants.
In addition to the amino acids used to replace the residues disclosed in Table I, other replacements of amino acids at the residues are expected to produce mutant subtilisins having useful properties. These residues and replacement amino acids are shown in Table II.
TABLE II______________________________________Residue Replacement Amino Acid(s)______________________________________Tyr-21 LThr22 KSer24 AAsp32Ser33 GGly46Ala46Ser49Met50 L K I VAsn77 DSer87 NLys94 R QVal95 L ITyr104Met124 K AAla152 C L I T MAsn155Glu156 A T M L YGly166Gly169Tyr171 K R E QPro172 D NPhe189Tyr217Ser221Met222______________________________________
Each of the mutant subtilisins in Table I contain the replacement of a single residue of the B. amyloliquefaciens amino acid sequence. These particular residues were chosen to prove the influence of such substitutions on various properties of B. amyloliquefacien subtilisin.
Thus, the inventors have identified Met124 and Met222 as important residues which if substituted with another amino acid produce a mutant subtilisin with enhanced oxidative stability. For Met124, Leu and Ile are preferred replacement amino acids. Preferred amino acids for replacement of Met222 are disclosed in EPO Publication No. 0130756.
Various other specific residues have also been identified as being important with regard to substrate specificity. These residues include Tyr104, Ala152, Glu156, Gly166, Gly169, Phe189 and Tyr217 for which mutants containing the various replacement amino acids presented in Table I have already been made, as well as other residues presented below for which mutants have yet to be made.
The identification of these residues, including those yet to be mutated, is based on the inventors' high resolution crystal structure of B. amyloliquefaciens subtilisin to 1.8 .ANG. (see Table III), their experience with in vitro mutagenesis of subtilisin and the literature on subtilisin. This work and the above reference x-ray crystal structures of subtilisin containing covalently bound peptide inhibitors, product complexes and transition state analogs has helped in identifying an extended peptide binding cleft in subtilisin. This substrate binding cleft together with substrate is schematically diagramemed in FIG. 2, according to the nomenclature of Schechter, I., et al. (1967) Biochem Bio. Res. Commun. 27, 157. The scissile bond in the substrate is identified by an arrow. The P and P' designations refer to the amino acids which are positioned repetitively toward the amino or carboxy terminus relative to the scissle bond. The S and S' designations refer to subsites in the substrate binding cleft of subtilisin which interact with the corresponding substrate amino acid residues.
______________________________________1 ALA N 19.434 53.195 -21.7561 ALA C 18.131 58.985 -21.3241 ALA CB 21.099 51.518 -21.1832 GLN CA 11.219 49.008 -21.4342 GLN D 18.765 47.165 -21.6912 GLN CG 15.028 41.305 -21.9212 GLN OEt 13.023 48.612 -22.8673 SER N 11.411 47.205 -19.8523 SER C 16.135 44.918 -19.4903 SER CB 18.589 45.638 -18.0694 VAL N 16.991 43.646 -19.7254 VAL C 16.129 41.934 -18.2904 VAL CB 16.008 41.622 -20.8224 VAL CG2 16.037 42.266 -22.1865 PRO CA 15.384 41.415 -16.0275 PRO O 14.885 39.763 -17.1465 PRO CG 13.841 43.215 -15.9216 TYR N 16.363 39.240 -15.4876 TYR C 15.359 36.975 -15.5286 TYR CB 17.824 37.323 -14.8346 TYR CD1 18.437 35.452 -16.3466 TYR CEZ 18.535 34.070 -16.6536 TYR CZ 18.222 33.154 -15.6287 GLY N 14.464 37.362 -14.6307 GLY C 12.400 36.535 -15.6708 VAL N 12.441 37.529 -16.5418 VAL C 12.363 36.433 -18.1358 VAL CB 11.765 38.900 -18.5618 VAL CG2 10.991 39.919 -17.7339 SER CA 14.419 39.342 -19.5629 SER O 14.112 33.014 -19.8019 SER DG 16.162 36.747 -20.35810 GLN CA 13.964 32.636 -16.87610 GLN O 12.785 30.642 -17.41310 GLN CG 14.295 31.617 -14.58810 GLN OE1 14.554 33.068 -12.74411 ILE N 11.625 32.575 -17.67011 ILE C 10.209 31.792 -19.60511 ILE CB 9.132 32.669 -17.47511 ILE CG2 9.162 32.655 -15.94111 IYS N 11.272 32.185 -20.27712 LYS C 10.456 33.006 -22.52212 LYS CB 11.257 30.646 -22.21612 LYS CO 12.543 28.517 -22.15912 LYS NZ 14.476 27.680 -20.93513 ALA CA 9.325 35.198 -22.63113 ALA O 9.338 35.804 -24.90114 PRO N 11.332 35.950 -23.89314 PRO C 11.786 35.557 -26.31714 PRO CB 13.461 36.580 -24.69214 PRO CD 12.281 35.936 -22.75815 ALA CA 11.379 33.450 -27.36715 ALA O 10.008 33.710 -29.27816 LEU N 9.085 34.138 -27.24016 LEU C 7.912 35.925 -28.52116 LEU CB 6.746 34.623 -26.69816 LEU CD1 5.001 33.234 -27.80917 HIS N 8.665 36.828 -27.92217 HIS C 9.510 37.981 -28.89017 HIS CB 9.708 39.100 -27.65217 HIS ND1 9.930 39.887 -25.27217 HIS CE1 9.226 39.914 -24.14418 SER N 10.443 37.033 -30.0221 ALA N 19.911 51.774 -21.9652 ALA O 18.376 51.197 -20.1152 GLN N 18.268 49.886 -22.0412 GLN C 17.875 47.706 -20.9922 GLN CB 16.125 46.760 -22.4492 GLN CD 13.912 47.762 -22.9302 GLN NEZ 14.115 46.917 -23.9263 SER CA 17.950 45.868 -19.4373 SER O 15.590 45.352 -19.2293 SER OG 17.682 46.210 -17.0494 VAL CA 15.946 42.619 -19.6394 VAL O 17.123 41.178 -18.0864 VAL CG1 14.874 40.512 -20.7415 PRO H 15.239 42.106 -17.3315 PRO C 15.501 39.905 -16.2495 PRO CB 14.150 41.880 -15.2635 PRO CD 14.044 42.986 -17.4176 TYR CA 16.628 37.803 -15.7156 TYR O 15.224 35.943 -16.2356 TYR CG 18.021 35.847 -15.0556 TYR CDZ 17.696 34.908 -14.0716 TYR CEZ 17.815 33.539 -14.3796 TYR OH 15.312 31.838 -15.9967 GLY CA 13.211 36.640 -14.3767 GLY O 11.747 35.478 -15.8838 VAL CA 11.777 37.523 -17.8368 VAL O 11.639 35.716 -19.6708 VAL CG1 11.106 38.893 -19.9439 SER N 13.661 36.318 -18.7159 SER C 14.188 33.920 -18.9659 SER CB 15.926 35.632 -19.50510 GLN N 14.115 33.887 -17.66210 GLN C 12.691 31.887 -17.27710 GLN CB 14.125 32.885 -15.41010 GLN CO 14.436 31.911 -13.14710 GLN NE2 14.552 30.960 -12.25111 ILE CA 10.373 31.503 -18.10211 ILE O 9.173 31.333 -20.18011 ILE CG1 9.066 34.117 -18.04911 ILE CD1 7.588 34.648 -17.92312 LYS CA 11.388 32.119 -21.72212 LYS O 10.173 32.703 -23.68612 LYS CC 12.283 29.830 -21.42312 LYS CE 13.023 27.467 -21.16613 ALA N 10.109 34.138 -21.99113 ALA C 10.026 35.716 -23.86313 ALA CB 8.885 36.195 -21.56514 PRO CA 11.985 36.430 -25.22014 PRO O 11.778 36.047 -21.44514 PRO CG 13.328 36.978 -23.22115 ALA N 11.560 34.236 -26.12915 ALA C 10.082 33.795 -28.03215 ALA CB 11.552 31.969 -27.06216 LEU CA 7.791 34.558 -27.82816 LEU O 7.302 36.126 -29.58816 LEU CG 5.790 33.465 -26.52216 LEU CD2 6.694 32.287 -26.28317 HIS CA 8.890 38.151 -28.53017 HIS O 9.107 38.622 -30.85617 HIS CG 9.185 39.288 -26.26217 HIS CD2 8.008 38.924 -25.69417 HIS NE2 8.079 39.328 -24.38118 SER CA 11.109 36.739 -31.32218 SER C 10.159 36.123 -32.35318 SER CI 12.311 35.799 -31.17219 GLN N 9.080 35.485 -31.94319 GLN C 7.142 36.111 -33.30319 GLN CB 7.221 33.849 -32.28019 GLN CO 6.923 31.707 -31.18119 GLN NE2 7.362 30.852 -30.25620 GLY CA 6.369 38.387 -32.85920 GLY O 4.263 39.276 -32.21521 TYR CA 4.118 37.831 -29.76321 TYR O 5.422 38.074 -27.75621 TYR CG 2.973 31.784 -30.70821 TYR CD2 3.650 34.794 -31.39721 TYR CE2 3.193 34.261 -32.58821 TYR DM 1.501 34.241 -34.25022 TYR CA 4.262 40.527 -27.12922 TYR C 3.287 41.725 -25.32522 TYR DG1 4.319 42.457 -26.59723 GLY N 1.939 40.285 -26.45323 GLY C -0.157 41.631 -26.11824 SER N -0.023 41.967 -27.37124 SER C -2.383 42.626 -27.86424 SER CP -0.734 43.120 -29.52025 ASN N -3.059 43.692 -27.51525 ASN C -5.015 42.875 -26.20525 ASN CD -5.165 43.227 -28.70025 ASN DD1 -4.965 43.767 -31.08326 VAL N -4.177 42.449 -25.29226 VAL C -4.792 42.652 -22.99726 VAL CB -3.714 40.503 -23.82126 VAL CG2 -3.598 39.576 -25.01827 LYS CA -6.133 43.524 -21.17527 LYS O -6.405 41.873 -19.41327 LYS CG -8.046 44.575 -22.49027 LYS CE -10.304 45.497 -23.13728 VAL N -4.818 43.462 -19.20028 VAL C -4.756 43.959 -16.82828 VAL CB -2.926 42.666 -17.93228 VAL CG2 -2.667 41.805 -19.17329 ALA CA -5.747 44.330 -14.63929 ALA O -4.666 42.845 -13.L0430 VAL N -4.057 45.033 -13.07230 VAL C -3.958 45.409 -10.68130 VAL CB -1.886 45.810 -12.14930 VAL CG2 -1.053 45.236 -13.30731 ILE CA -5.328 44.846 -8.67931 ILE O -3.825 43.915 -6.99731 ILE CG1 -7.295 43.707 -9.79831 ILE CD1 -8.617 42.856 -9.71732 ASP CA -2.944 46.467 -6.25532 ASP O -4.197 48.418 -5.50232 ASP CG -0.483 45.702 -6.27332 ASP OD2 -0.081 46.429 -5.33033 SER CA -1.895 49.857 -4.80133 SER O -1.706 52.136 -5.36333 SER CG 0.535 50.025 -4.77434 GLY CA -2.255 51.728 -8.16534 GLY D -0.144 50.831 -8.76135 ILE CA 0.208 52.438 -10.99535 ILE O -0.327 54.638 -11.74435 ILE CG1 -0.530 50.210 -12.09735 ILE CD1 -0.962 49.485 -13.42436 ASP CA 2.359 55.618 -11.23218 SER O 10.547 36.112 -33.53418 SER O 13.321 36.450 -30.39919 GLN CA 8.082 34.962 -32.87819 GLN O 6.297 35.972 -34.21919 GLN CG 7.975 32.602 -31.82319 GLN DE1 5.719 31.833 -31.44420 GLY N 7.205 37.223 -32.58720 GLY C 5.181 38.492 -31.88021 TYR N 5.202 37.801 -30.76121 TYR C 4.579 38.552 -28.52521 TYR CE 3.498 36.431 -29.44321 TYR CD1 1.795 36.332 -31.25821 TYR CE1 1.306 35.797 -32.44621 TYR C2 2.003 34.755 -33.06721 TYR N 3.902 39.680 -28.28822 TYR C 3.091 40.922 -26.24422 THR CE 5.133 41.759 -27.61122 THR CG2 6.476 41.323 -28.22923 GLY CA 0.809 40.600 -25.54223 GLY O -1.013 42.095 -25.33024 SER CA -0.897 42.957 -28.01224 SER O -2.813 41.508 -20.16024 SER OG 0.563 43.652 -29.72825 ASN CA -4.519 43.687 -27.39325 ASN O -6.233 42.668 -26.19025 ASN CG -4.960 44.170 -29.88525 ASN ND2 -4.747 45.461 -29.59426 VAL CA -4.674 41.679 -24.14326 VAL O -3.856 43.419 -22.68926 VAL CG1 -4.160 39.802 -22.54827 LYS N -5.910 42.613 -22.30127 LYS C -5.8i5 42.872 -19.84127 LYS CB -7.59C 43.981 -21.14927 LYS CD -9.321 45.302 -22.02027 LYS N2 -9.686 46.253 -24.26428 VAL CA -4.457 42.950 -17.89728 VAL O -4.209 45.095 -16.81728 VAL CG1 -2.466 42.105 -16.58929 ALA N -5.454 43.527 -15.81329 ALA C -4.750 44.010 -13.55329 ALA CS -7.172 44.107 -14.10130 VAL CA -3.146 44.962 -11.91030 VAL D -4.155 46.648 -10.57830 VAL CG1 -0.996 45.901 -10.90031 ILE N -4.514 44.515 -9.87731 ILE C -4.346 44.933 -7.54631 ILE CB -6.457 43.776 -1.50131 ILE CG2 -7.278 44.038 -7.22532 ASP N -4.044 46.193 -7.22732 ASP C -3.071 47.819 -5.70532 ASP CB -1.695 46.129 -7.09232 ASP 001 0.034 44.592 -6.57633 SER N -1.931 48.512 -5.39433 SER C -1.952 50.976 -5.80833 SER CB -0.621 49.922 -3.93934 GLY N -2.173 50.740 -1.08434 GLY C -1.035 51.648 -9.05735 ILE N -0.965 52.431 -10.10235 ILE C 0.568 53.919 -11.26335 ILE CE -0.042 51.694 -12.36735 ILE CG2 1.149 51.741 -13.36236 ASP N 1.816 54.253 -10.97136 ASP C 2.281 55.956 -12.70236 ASP O 3.004 55.471 -13.57936 ASP CG 4.339 51.099 -10.80436 ASP OD2 5.448 57.277 -10.26331 SER CA 1.183 51.221 -14.51231 SER O 2.545 58.303 -16.15137 SER OG -0.090 59.133 -13.87938 SER CA 4.261 59.505 -14.48138 SER D 6.543 59.251 -15.28538 SER OG 5.316 59.865 -12.23439 HIS CA 6.631 56.574 -15.29139 HIS 0 5.738 55.818 -17.41939 HIS CG 8.014 54.609 -14.45639 HIS CD2 8.769 54.345 -13.38939 HIS NE2 9.986 53.910 -13.80840 PRO CA 7.988 56.697 -18.83140 PRO D 8.032 55.097 -20.51840 PRO CG 10.053 57.405 -17.90241 ASP N 8.481 54.328 -18.48541 ASP 001 10.325 51.395 -20.42941 ASP CB 9.199 52.239 -18.22441 ASP C 7.311 52.163 -18.83942 LEU N 6.185 52.803 -18.55842 LEU C 3.924 52.901 -19.37642 LEU CB 4.421 52.158 -11.00842 LEU CD1 4.535 51.546 -14.58143 LYS N 3.018 52.135 -19.94643 LYS C 0.637 52.156 -20.01843 LYS CB 2.021 52.389 -22.16943 LYS CD 0.998 52.862 -24.33943 LYS N2 0.337 51.757 -26.41844 VAL CA -1.401 52.639 -18.76544 VAL O -2.623 53.906 -20.43444 VAL CG1 -2.724 52.941 -16.58245 ALA N -3.494 51.951 -19.81145 ALA C -S.841 52.507 -20.05345 ALA CB -4.831 50.580 -21.38946 GLY CA -7.062 52.831 -18.00146 GLY O -5.938 52.006 -16.03547 GLY CA -8.014 52.246 -14.38841 GLY O -9.968 53.481 -14.18548 ALA CA -10.255 52.870 -11.38248 ALA D -9.066 51.120 -9.12549 SER N -10.149 53.547 -9.03749 SER C -10.941 52.986 -6.78349 SER CB -9.092 54.588 -7.02950 MET N -10.835 52.007 -5.93250 MET C -11.463 51.962 -3.56150 MET CB -12.012 59.018 -4.99650 MET SD -13.460 49.889 -7.25651 VAL N -10.421 52.760 -3.42251 VAL C -10.630 54.562 -1.90751 VAL CB -8.443 53.155 -2.00051 VAL CG2 -7.764 51.815 -2.30252 PRO CA -12.372 55.933 -0.82152 PRO O -11.111 58.220 -0.92552 PRO CG -13.583 54.103 0.08553 SER N -10.442 56.906 0.29953 SER C -8.420 58.245 -0.32653 SER CB -9.004 57.701 2.06954 GLU N -8.254 57.523 -1.39354 GLU C -7.761 57.303 -3.78554 GLU CB -6.134 56.599 -2.15454 GLU CD -4.066 56.062 -0.99036 ASP CS 3.712 55.720 -10.51436 ASP 001 3.755 57.974 -11.42937 SER N 1.304 56.822 -13.11137 SER C 2.317 58.095 -14.94937 SER CB -0.093 58.049 -14.18838 SER N 3.163 58.614 -14.00138 SER C 5.466 58.705 -14.99238 SER CB 4.742 60.435 -13.39839 HIS N 5.454 57.390 -14.89239 HIS C 6.681 56.401 -16.77839 HIS CB 6.631 55.203 -14.51539 HIS ND1 8.195 54.356 -15.56139 HIS CE1 9.970 53.930 -15.13040 PRO N 7.807 56.836 -17.38740 PRO C 8.156 55.280 -19.35740 PRO CB 9.247 57.533 -19.16140 PRO CD 8.988 57.452 -16.77641 ASP 002 11.148 50.399 -18.66841 ASP CG 10.473 51.307 -19.21141 ASP CA 8.645 52.959 -18.96641 ASP O 1.396 50.947 -18.97742 LEU CA 4.892 52.141 -18.46642 LEU O 3.993 54.163 -19.49042 LEU CG 5.152 51.363 -15.94642 LEU CD2 5.273 49.871 -16.35043 LYS CA 1.893 52.655 -20.72143 LYS O 0.504 50.920 -19.82043 LYS CG 0.685 52.436 -22.91043 LYS CE -0.180 52.584 -25.26044 VAL N -0.191 53.035 -19.49044 VAL C -2.571 52.887 -19.73144 VAL CB -1.480 53.351 -11.38344 VAL CG2 -0.191 53.194 -16.55345 ALA CA -4.619 51.977 -20.81045 ALA O -6.703 53.085 -20.70346 GLY N -5.910 52.356 -18.76846 GLY C -6.981 52.443 -16.53847 GLY N -8.092 52.658 -15.79347 GLY C -9.179 52.757 -13.57248 ALA N -9.221 52.446 -12.33048 ALA C -9.190 52.675 -9.96848 ALA CB -11.558 52.100 -11.61749 SER CA -9.752 53.355 -7.65249 SER O -11.972 53.677 -6.90849 SER OG -8.879 54.255 -5.65050 MET CA -11.852 51.549 -4.97450 NET O -11.997 51.398 -2.57550 MET CG -11.912 49.463 -6.38950 MET CE -12.508 50.111 -5.90351 VAL CA -9.968 53.170 -2.06751 VAL O -10.237 55.431 -2.68251 VAL CG1 -7.892 53.579 -0.63152 PRO N -11.621 54.693 -1.05652 PRO C -11.490 57.123 -0.44052 PRO CB -13.400 55.594 0.24452 PRO CO -12.164 53.620 -0.17553 SER CA -9.538 57.982 0.68253 SER O -7.679 59.224 -0.03553 SER OG -8.256 56.521 2.12754 GLU CA -7.204 57.648 -2.42154 GLU O -7.533 56.243 -4.37954 GLU CG -5.289 56.959 -0.92154 GLU OE1 -3.545 55.694 -1.96854 GLU OE2 -3.900 55.777 0.27155 THR CA -9.433 58.121 -5.44155 THR O -9.433 57.919 -7.81055 THR OG1 -9.885 60.510 -5.41856 ASN N -7.482 58.403 -6.87756 ASN 001 -5.075 58.961 -10.33156 ASN CB -5.898 59.694 -8.20856 ASN C -6.012 57.094 -8.30551 PRO N -6.362 56.261 -9.25857 PRO CD -1.384 56.433 -10.27257 PRO CA -5.679 54.961 -9.33257 PRO O -3.509 54.128 -9.94558 PHE CA -2.141 56.577 -11.22258 PHE O -0.635 57.497 -10.68058 PHE CG -3.983 56.968 -13.35758 PHE CD2 -5.210 57.630 -13.45958 PHE CE2 -6.194 57.095 -14.27659 GLN N -2.044 57.119 -8.99059 GLN C -0.807 56.403 -7.00059 GLN CB -1.062 58.668 -7.08959 GLN CD -1.790 60.157 -5.15059 GLN NE2 -2.959 59.685 -4.74260 ASP CA 0.851 54.192 -6.30460 ASP D 2.827 55.550 -5.23160 ASP CG 2.077 52.538 -6.38060 ASP OD2 2.915 51.841 -7.03060 ASN ND2 -1.364 57.747 -2.34761 ASN CG -0.040 51.670 -2.39961 ASN CA 1.557 55.734 -2.70061 ASN O 2.933 54.862 -0.90262 ASN CA 2.877 52.348 -1.70962 ASN O 4.951 51.313 -1.77062 ASN CG 2.371 50.103 -0.69762 ASN ND2 2.622 50.208 0.60163 SER CA 5.189 51.696 -4.70963 SER O 5.593 49.790 -6.26963 SER OG 6.871 50.698 -3.41864 HIS CA 3.994 48.059 -4.93564 HIS O 3.861 46.974 -1.10864 HIS CG 3.144 46.021 -3.72664 HIS CD2 4.054 45.194 -3.13564 HIS NE2 3.556 43.920 -3.36865 GLY CA 1.552 48.264 -7.83065 GLY O 2.230 48.078 -10.13466 THR CA 4.064 50.117 -9.95466 THR O 5.333 48.789 -11.46166 THR OG1 3.637 52.425 -9.40661 HIS N 5.685 48.443 -9.27467 HIS C 6.091 46.141 -10.14367 HIS CB 7.300 47.011 -8.06467 HIS ND1 8.590 44.907 -8.27667 HIS CE1 9.857 44.491 -8.29968 VAL N 4.892 45.149 -9.73168 VAL C 3.856 44.860 -11.74068 VAL CB 2.939 44.252 -9.38668 VAL CG2 3.319 43.105 -8.00069 ALA CA 3.037 46.468 -13.42969 ALA O 4.028 45.913 -15.56570 GLY N 5.340 46.782 -13.91470 GLY C 7.046 45.370 -15.02171 THR N 6.820 44.431 -14.13871 THR C 6.224 42.506 15.54371 THR CB 7.119 42.070 -13.19155 THR N -8.571 58.251 -4.24955 THR C -3.764 58.139 -6.17955 THR CS -10.586 59.200 -5.30355 THR CG2 -11.432 59.143 -4.01156 ASN ND2 -4.930 61.179 -9.88156 ASN CG -5.273 59.925 -9.55556 ASN CA -6.762 58.425 -8.20056 ASN O -5.104 56.866 -7.47057 PRO CG -7.123 55.251 -11.11757 PRO CB -6.644 54.178 -10.23551 PRO C -4.301 55.082 -9.96658 PHE N -3.998 56.262 -10.49158 PHE C -1.712 57.129 -10.25358 PHE CB -2.943 57.502 -12.42358 PHE CD1 -3.756 55.180 -14.05958 PHE CE1 -4.122 55.255 -14.92856 PHE CZ -5.949 55.939 -15.05159 GLN CA -1.172 57.583 -7.93459 GLN O -1.639 56.G83 -6.11559 GLN CG -0.942 59.261 -6.03459 GLN OE1 -1.404 61.288 -4.83660 ASP N 0.410 55.895 -7.21160 ASP C 1.631 55.267 -5.09060 ASP CB 1.596 53.744 -7.18860 ASP 001 1.746 52.337 -5.19061 ASN N 0.959 55.265 -3.95061 ASN OD1 0.666 58.566 -2.87561 ASN CB 0.531 56.401 -1.78461 ASN C 2.291 54.632 -1.94062 ASN N 2.210 53.434 -2.46862 ASN C 4.124 51.893 -2.47962 ASN CB 1.783 51.319 -1.42162 ASN 001 2.633 49.077 -1.34363 SER N 4.152 52.104 -3.76163 SER C 5.011 50.256 -5.20963 SER CB 6.523 51.958 -4.01264 HIS N 4.202 49.475 -4.63964 HIS C 3.366 47.759 -6.26164 HIS CB 3.184 41.501 -3.74764 HIS ND1 2.107 45.247 -4.24164 HIS CE1 2.416 43.966 -4.05465 GLY N 2.287 48.428 -6.58765 GLY C 2.392 48.636 -9.03766 THR N 3.233 49.659 -8.83266 THR C 5.089 49.009 -10.29166 THR CS 4.744 51.511 -9.66766 THR CG2 5.536 52.078 -10.84967 HIS CA 6.103 47.361 -9.45867 HIS O 6.649 45.638 -11.15067 HIS CG 8.595 46.275 -8.14867 HIS CD2 9.904 46.618 -8.07667 HIS N52 10.678 45.514 -8.18668 VAL CA 4.142 44.607 -10.26668 VAL O 4.114 43.942 -12.53568 VAL CG1 1.960 43.260 -10.02069 ALA N 3.373 46.049 -12.11369 ALA C 4.193 46.390 -14.41169 ALA CB 2.332 47.851 -13.38670 GLY CA 6.595 46.805 -14.67070 GLY O 7.604 45.154 -16.11971 THR CA 7.171 43.019 -14.44671 THR O 6.602 41.828 -16.49571 THR OG1 8.191 42.592 -12.39071 THR CG2 7.274 40.583 -13.59672 VAL CA 3.916 42.491 -16.48472 VAL O 4.341 42.380 -18.86072 VAL CG1 1.512 42.480 -17.17073 ALA N 4.504 44.411 -17.88073 ALA C 5.433 46.333 -19.35573 ALA CB 3.107 45.441 -19.43374 ALA CA 1.470 41.591 -18.85974 ALA O 1.959 46.640 -21.05475 LEU N 7.650 48.784 -21.03975 LEU C 9.192 48.568 -22.96675 LEU CB 7.548 50.471 -22.80975 LEU CD1 6.079 52.436 -22.30076 ASN N 9.147 48.103 -24.16976 ASN OD1 10.950 45.840 -27.92876 ASN CB 10.010 46.651 -25.90876 ASN C 10.783 49.048 -25.64377 ASN N 11.804 49.664 -25.07177 ASH C 13.707 51.029 -25.34877 ASN CB 11.335 52.016 -25.11777 ASN 001 12.032 51.346 -22.91178 SER N 14.125 52.261 -25.16478 SER C 15.810 52.742 -23.43678 SER CB 15.905 53.941 -25.58779 ILE N 14.858 52.565 -22.52979 ILE C 14.617 51.683 -20.23079 ILE CB 14.471 54.114 -20.69779 ILE CG2 14.997 55.320 -21.61280 GLY N 14.995 51.768 -18.98180 GLY C 14.612 49.448 -18.21981 VAL N 13.513 48.766 -11.98081 VAL C 12.511 46.919 -19.21781 VAL CB 13.001 46.755 -16.67781 VAL CG2 11.638 47.261 -16.23182 LEU CA 11.312 45.020 -20.25682 LEU O 10.858 43.356 -18.60082 LEU CG 11.430 43.568 -22.36682 LEU CO2 12.359 42.675 -23.19283 GLY CA 8.133 43.321 -19.11483 GLY O 8.546 41.822 -21.02684 VAL CA 6.913 39.801 -19.88884 VAL O 6.424 39.472 -22.19484 VAL CG1 5.680 37.677 -19.55785 ALA N 5.156 40.926 -21.02185 ALA C 4.213 42.683 -22.39685 ALA CB 2.846 40.663 -21.14886 PRO CA 5.413 44.635 -23.20586 PRO O 4.291 46.605 -23.64986 PRO CG 7.030 43.468 -24.54687 SER N 3.548 44.676 -24.76987 SER C 1.103 45.132 -24.89787 SER CB 2.401 44.711 -26.92188 ALA N 1.107 44.564 -23.74288 ALA CA -0.213 44.353 -23.06488 ALA O -0.114 46.711 -22.43589 SER OG -4.146 41.102 -24.28089 SER CA -3.001 46.861 -22.22189 SER O -3.193 45.064 -20.20990 LEU CA -2.378 47.667 -18.59390 LEU O -3.582 49.604 -18.11590 LEU CG -0.233 47.851 -17.17490 LEU CD2 1.160 48.524 -11.04791 TYR CA -5.258 48.678 -16.13172 VAL N 4.930 42.881 -15.42772 VAL C 4.312 43.084 -17.83172 VAL CS 2.516 42.867 -16.08572 VAL CG2 2.142 42.327 -14.72313 ALA CA 4.581 45.091 -19.16173 ALA O 5.062 41.188 -20.21674 ALA N 6.544 46.429 -18.63574 ALA C 7.140 41.648 -20.34274 ALA CS 8.653 41.446 -17.92575 LEU CA 7.812 48.968 -22.4S675 LEU O 10.162 48.750 -22.25375 LEU CG 6.123 50.913 -22.37975 LEU CD2 5.096 50.442 -23.40576 ASN ND2 I2.385 46.432 -26.30476 ASN CG 11.195 46.274 -26.80276 ASN CA 10.359 41.738 -24.93816 ASN O 10.157 49.419 -26.61977 ASN CA 12.220 50.951 -25.68171 ASN O 14.364 49.979 -25.31377 ASN CG 11.250 52.027 -23.61677 ASN NO2 10.294 52.741 -23.02578 SER CA 15.513 52.614 -24.90678 SER D 16.982 53.071 -23.16478 SER OG 15.926 53.870 -26.99979 ILE CA 15.155 52.184 -21.12079 ILE O 13.843 50.841 -20.67979 ILE CG1 12.945 54.032 -20.81479 ILE CO1 12.135 55.176 -20.15580 GLY CA 14.476 50.940 -17.91380 GLY O 15.719 48.994 -18.54481 VAL CA 13.411 47.286 -15.06181 VAL O 12.260 47.739 -20.11781 VAL CG1 14.030 47.084 -15.57382 LEU N 12.126 45.645 -19.21682 LEU C 10.390 44.028 -19.51082 LEU CB 12.206 44.219 -21.22982 LEU CD1 10.796 44.657 -23.22383 GLY N 9.131 44.180 -19.81683 GLY C 8.027 42.011 -19.92584 VAL N 7.272 41.112 -19.28384 VAL C 6.164 40.030 -21.14084 VAL CB 6.256 38.920 -18.84184 VAL CG2 7.190 38.507 -17.70585 ALA CA 4.217 41.194 -22.15885 ALA O 3.260 43.401 -22.03066 PRO N 5.240 43.186 -23.05986 PRO C 4.321 45.311 -23.94766 PRO CB 6.822 44.184 -23.81386 PRO CD 6.317 42.440 -23.63687 SER CA 2.489 45.324 -25.52987 SER O 0.162 45.513 -25.61987 SER OG 3.591 45.143 -27.58388 ALA CB -0.163 43.510 -21.82888 ALA C -0.898 45.717 -22.69089 SER N -2.219 45.691 -22.67889 SER CB -4.343 46.903 -22.89889 SER C -3.136 46.180 -20.12190 LEU N -2.446 47.656 -20.03790 LEU C -3.483 48.430 -17.86490 LEU CB -0.951 48.273 -18.42690 LEU CD1 -0.028 46.341 -17.21991 TYR N -4.264 47.944 -16.93891 TYR C -4.873 46.750 -14.68591 TYR O -4.496 47.749 -14.0291 TYR CG -1.094 48.231 -17.74191 TYR CO2 -7.971 49.275 -18.14991 TYR CE2 -8.315 49.421 -19.49291 TYR ON -8.182 48.752 -21.76492 ALA CA -4.549 50.199 -12.70792 ALA O -6.723 50.898 -12.05093 VAL N -5.959 48.993 -11.12993 VAL C -6.708 49.014 -11.89993 VAL CB -1.957 47.555 -10.61193 VAL CG2 -8.195 47.370 -12.07294 LYS CA -6.378 50.464 -6.99994 LYS G -8.458 50.480 -5.78394 LYS CG -5.394 52.320 -5.46194 LYS CE -4.399 54.208 -4.19995 VAL N -6.909 49.0T1 -5.02695 VAL C -6.919 48.499 -2.56895 VAL CB -8.104 47.030 -4.31995 VAL CG2 -6.900 46.100 -4.33296 LEU CA -4.182 49.103 -1.48696 LEU O -3.942 51.121 -2.33696 LEU CG 3.593 46.799 -2.07296 LEU CO2 -4.489 46.082 -1.04597 GLY CA -3.890 52.307 0.28197 GLY O -1.619 51.463 0.16598 ALA CB -0.428 55.478 1.51098 ALA C 0.188 53.118 1.91799 ASP N -0.504 52.573 2.91299 ASP 001 -2.730 50.902 4.00399 ASP CB -0.648 51.603 5.17599 ASP C 0.146 50.165 3.320100 GLY N -0.424 49.683 2.168100 GLY C -1.520 47.651 2.002101 SER N -2.342 48.128 2.908101 SER C -4.159 47.894 2.532101 SER CB -3.716 41.447 4.817102 GLY N -5.821 47.092 2.577102 GLY C -8.166 46.536 2.528103 GLN N -9.377 47.058 2.498103 GLN C -10.963 45.232 2.022103 GLN CB -11.671 47.301 3.274103 GLN CD -12.360 49.104 4.915103 GLN NE2 -13.419 49.197 4.112104 TYR CA -12.068 43.126 1.508104 TYR O -12.939 43.216 -0.687104 TYR CG -11.629 40.829 2.412104 TYR CO2 -10.379 40.959 1.a60104 TYR CE2 -9.352 40.057 2.171104 TYR OH 8.481 38.191 3.324105 SER CA -14.817 45.166 -0.034105 SER O -14.759 45.935 -2.258105 SER OG -15.209 47.039 1.450106 TRP CA -12.421 47.391 -1.948106 TRP O -12.021 46.648 -4.245106 TRP CG -11.645 49.111 -0.206106 TRP CO2 -10.658 49.812 0.581106 TRP CE2 -11.359 50.573 1.561106 TRP C12 -10.671 51.318 2.500106 TRP CM2 -9.293 51.291 2.455107 ILE CA -10.765 44.250 -3.325107 ILE O -11.695 43.474 -5.398107 ILE CG1 -8.634 43.784 -1.936107 ILE CD1 -8.233 42.998 -0.62791 TYR CS -6.686 48.093 -16.31491 TYR CD1 -6.595 4T.415 -18.75591 TYR CEL -6.905 4T.572 -20.09091 TYR CZ -7.794 48.582 -20.46392 ALA N -4.895 49.958 -14.10492 ALA C -5.823 50.033 -11.90392 ALA CB -3.991 51.621 -12.48893 VAL CA -7.183 48.854 -10.32593 VAL O -6.181 47.993 -8.31293 VAL CG1 -9.213 47.488 -9.72594 LYS N -6.907 50.217 -8.32194 LYS C -7.331 49.985 -5.89494 LYS CB -6.051 51.976 -6.81894 LYS CD -4.868 53.185 -5.58294 LYS N -3.135 55.544 -4.38195 VAL CA -7.646 48.451 -3.92095 VAL 0 -7.425 48.156 -1.50195 VAL CG1 -8.868 46.852 -5.61996 LEU N -5.676 48.974 -2.60496 LEU C -4.331 50.559 -1.32196 LEU CB -3.509 48.241 -1.57396 LEU CD1 -2.267 46.184 -2.16397 GLY N -4.326 50.975 -0.06697 GLY C -2.363 52.437 0.38598 ALA N -1.954 53.648 0.75898 ALA CA -0.563 54.068 0.96598 ALA O 1.393 52.921 1.66399 ASP OD2 -2.631 51.042 6.15199 ASP CG -2.083 51.131 5.04099 ASP CA 0.101 51.610 3.85599 ASP O 0.735 49.313 4.029100 GLY CA -0.343 48.521 1.615100 GLY O -1.649 46.512 1.479101 SER CA -3.542 41.388 3.315101 SER O -4.758 48.972 1.907101 SER OG -4.411 48.634 5.2091O2 GLY CA -7.071 47.422 1.896102 GLY O -1.888 45.431 3.030103 GLN CA -10.535 46.297 3.020103 GLN N -10.779 45.482 0.817103 GLN CG -11.368 48.005 4.586103 GLN OE1 -12.159 49.816 5.902104 TYR N -11.611 44.141 2.451104 TYR C -13.031 43.690 0.413104 TYR CB -12.697 41.866 2.143104 TYR CD1 -11.819 39.199 3.317104 TYR CE1 -10.805 38.885 3.707104 TYR CZ -9.564 39.022 3.081105 SER N -13.909 44.572 0.903105 SER C -14.112 45.920 -1.159105 SER CB -15.880 46.121 0.601106 TRP N -13.079 46.625 -0.834106 TRP C -11.895 46.436 -3.012106 TRP CB -11.321 48.254 -1.355106 TRP CD1 -12.862 49.524 0.264106 TRP CE1 -12.691 50.358 1.360106 TRP CE3 -9.275 49.852 0.516106 TRP CZ3 -8.568 50.563 1.525107 ILE N -11.339 45.330 -2.491107 ILE C -11.955 43.594 -4.190107 ILE CB -9.944 43.183 -2.523107 ILE CG2 -9.632 41.930 -3.381108 ILE N -22.994 43.292 -3.571108 ILE CA -14.116 42.722 -4.320108 ILE O -14.894 43.329 -6.552108 ILE CG1 -14.726 41.077 -2.482108 ILE CD1 -15.452 40.845 -1.131109 ASN CA -15.204 46.018 -5.916109 ASN O -14.660 46.272 -8.235109 ASN CG -16.528 47.486 -4.353109 ASN NO2 -16.633 48.447 -3.442110 GLY CA -11.952 45.917 -7.865110 GLY O -11.929 44.929 -10.034111 ILE CA -12.603 42.334 -9.099111 ILE O -13.921 42.384 -11.148111 ILE CG1 -11.421 40.501 -7.655111 ILE CD1 -11.588 39.706 -6.336112 GLU CA -16.118 43.376 -10.046112 GLU O -16.467 44.130 -12.246112 GLU CG -17.847 42.917 -8.135112 GLU DE1 -19.041 40.866 -8.016113 TRP N -15.094 45.403 -10.971113 TRP C -14.076 45.663 -13.140113 TRP CB -13.882 47.553 -11.434113 TRP CD1 -14.148 49.736 -12.681113 TRP NE1 -13.597 50.443 -13.723113 TRP CE3 -11.451 47.645 -13.809113 TRP CZ3 -10.610 47.899 -14.879114 ALA N -13.089 44.801 -12.832114 ALA C -13.199 43.179 -14.752114 ALA CB -11.299 43.192 -13.140115 ILE CA -15.070 41.640 -14.897115 ILE O -16.077 42.225 -17.070115 ILE CG1 -15.218 39.836 -13.043115 ILE CD1 -16.004 39.411 -11.743116 ALA CA -17.390 44.440 -16.050116 ALA O -17.323 45.255 -18.343117 ASN N -15.423 45.390 -17.122117 ASN C -13.827 44.974 -19.034117 ASN CB -13.615 46.958 -17.426117 ASN 001 -14.565 49.082 -17.773118 ASN N -14.223 43.725 -18.967118 ASN C -12.240 42.444 -19.843118 ASN CB -14.247 42.863 -21.279118 ASN 001 -16.510 42.321 -20.759119 MET N -11.686 42.500 -18.675119 MET C -10.025 40.734 -18.928119 MET CB -9.810 42.461 -17.055119 MET SD -8.788 44.943 -17.526120 ASP N -8.904 40.437 -19.584120 ASP C -7.822 38.390 -18.856120 ASP CB -7.555 39.156 -21.236120 ASP 001 -7.801 40.706 -23.084121 VAL N -7.021 39.117 -18.115121 VAL C -6.296 39.534 -15.786121 VAL CB -4.755 38.587 -17.496121 VAL CG2 -4.707 37.916 -18.846122 ILE CA -6.248 39.799 -13.397122 ILE O -4.829 38.012 -12.469122 ILE CG1 -8.686 40.392 -13.063122 ILE CD1 -9.976 39.788 -12.383123 ASN CA -3.145 39.854 -11.232123 ASN D -3.708 41.631 -9.833123 ASN CG -0.692 40.048 -10.777123 ASN ND2 -0.346 40.747 -9.720124 MET CA -3.650 39.973 -7.438108 ILE C -14.639 43.694 -5.386108 ILE CB -15.246 42.265 -3.320108 ILE CG2 -16.568 42.024 -4.095109 ASN N -14.751 44.958 -4.981109 ASN C -14.232 46.067 -7.084109 ASN CB -15.280 47.359 -5.207109 ASN 001 -17.455 46.695 -4.646110 GLY N -12.951 45.908 -6.774110 GLY C -12.108 44.712 -8.812111 ILE N -12.379 43.539 -8.246111 ILE C -13.859 42.560 -9.942111 ILE CB -12.734 40.948 -8.364111 ILE CG2 -13.122 39.791 -9.347112 GLU N -14.893 43.075 -9.280112 GLU C -15.872 44.347 -11.171112 GLU CB -17.229 43.899 -9.141112 GLU CO -18.724 41.824 -8.685112 GLU DE2 -19.123 41.928 -9.866113 TRP CA -14.756 46.400 -12.000113 TRP O -14.319 45.932 -14.332113 TRP CG -13.486 48.556 -12.481113 TRP CD2 -12.441 48.552 -13.463113 TRP CE2 -12.545 49.761 -14.215113 TRP CZ2 -11.696 50.045 -15.274113 TRP CM2 -10.752 49.074 -15.603114 ALA CA -12.333 44.065 -13.874114 ALA O -12.963 43.074 -15.978115 ILE N -14.174 42.540 -14.119115 ILE C -15.928 42.485 -15.856115 ILE CB -16.000 40.840 -13.922115 ILE CG2 -17.151 40.168 -14.755116 ALA N -16.534 43.527 -15.267116 ALA C -16.706 45.069 -17.278116 ALA CB -18.011 45.510 -15.151117 ASN CA -14.553 45.967 -18.139117 ASN D -12.997 45.436 -19.820117 ASN CG -14.400 48.177 -16.939117 ASN ND2 -14.931 48.249 -15.736118 ASN CA -13.760 42.642 -19.832118 ASN O -11.617 42.309 -20.932118 ASN CG -15.737 43.060 -21.395118 ASN ND2 -16.136 44.096 -22.133119 MET CA -10.232 42.222 -18.478119 MET O -10.888 39.838 -18.759119 MET CG -9.880 43.883 -16.502119 MET CB -9.982 46.061 -18.263120 ASP CA -8.480 39.118 -20.030120 ASP O -8.038 37.189 -18.690120 ASP CG -8.237 39.730 -22.454120 ASP 002 -9.327 39.135 -22.739121 VAL CA -6.226 38.601 -16.974121 VAL O -6.284 40.788 -15.909121 VAL CG1 -3.758 38.176 -16.427122 ILE N -6.318 38.978 -14.590122 ILE C -5.020 39.262 -12.627122 ILE CB -7.476 39.604 -12.466122 ILE CG2 -7.221 39.883 -10.954123 ASN N -4.263 40.222 -12.110123 ASN C -3.502 40.404 -9.861123 ASN CB -1.828 40.478 -11.697123 ASN 001 -0.063 38.990 -11.018124 MET N -3.458 39.604 -8.832124 MET C -2.423 39.603 -6.614124 MET O -2.306 38.508 -6.091124 MET CG -6.158 40.082 -7.471124 MET CB -7.940 38.095 -7.542125 SER CA -0.193 40.287 -5.769125 SER O 0.235 41.617 -3.805125 SER DG 1.444 40.496 -7.575126 LEU CA -1.842 40.347 -2.386126 LEU O -2.844 38.136 -2.529126 LEU CG -3.988 41.447 -3.333126 LEU CD2 -4.179 42.760 -4.073127 GLY CA -3.035 37.871 0.193127 GLY O -2.446 39.030 2.220128 GLY CA -4.475 37.496 3.642128 GLY O -4.903 35.158 3.276129 PRO CA -4.671 34.525 5.998129 PRO O -6.338 32.887 6.305129 PRO CG -4.419 36.116 7.727130 SER N -7.051 35.015 5.912130 SER C -9.218 34.884 4.726130 SER CB -9.069 35.351 7.216131 GLY N -10.083 33.967 4.349131 GLY C -12.205 34.713 3.542132 SER N -13.040 35.058 2.594132 SER C -15.289 34.805 1.936132 SER CB -14.590 36.927 3.145133 ALA N -16.547 34.588 2.294133 ALA C -17.650 34.965 0.097133 ALA CB -18.866 33.828 1.996134 ALA CA -17.872 37.259 -0.792134 ALA O -16.781 37.585 -2.869135 LEU N -15.478 37.229 -1.046135 LEU C -14.158 36.005 -2.705135 LEU CA -13.038 37.328 -0.798135 LEU CD1 -11.460 38.415 -2.292136 LYS N -14.509 34.825 -2.173136 LYS C -15.544 33.739 -4.150136 LYS CB -14.903 32.341 -2.186136 LYS CO -15.083 29.892 -2.134136 LYS NZ -15.308 28.411 -4.160137 ALA CA -17.795 34.416 -4.883137 ALA O -17.705 35.049 -7.208138 ALA N -16.529 36.301 -5.729138 ALA C -14.903 36.696 -7.557138 ALA CB -15.522 38.567 -5.934139 VAL CA -12.946 35.291 -7.837139 VAL O -13.208 34.070 -9.877139 VAL CG1 -10.919 33.856 -7.866140 ASP N -14.593 33.536 -8.122140 ASP C -16.023 33.131 -10.084140 ASP CB -16.149 31.549 -8.138140 ASP 001 -14.178 30.403 -7.202141 LYS N -16.658 34.263 -9.820141 LYS C -16.373 35.415 -11.946141 LYS CB -18.039 36.275 -10.325141 LYS CO -19.586 38.187 -10.536141 LYS NZ -21.138 40.037 -10.275142 ALA CA -14.173 36.192 -12.614142 ALA O -13.770 35.169 -14.755143 VAL N -13.582 35.886 -12.832143 VAL C -14.346 32.233 -14.496143 VAL CB -12.551 31.673 -12.714143 VAL CG2 -11.305 32.195 -12.014144 ALA CA -16.744 31.834 -14.641124 MET CB -4.943 39.387 -6.890124 MET SD -7.585 39.472 -6.450125 SER N -1.454 40.496 -4.502125 SER C -0.422 40.712 -4.326125 SER CB 1.021 41.027 -6.328126 LEU N -1.433 40.075 -3.775126 LEU C -2.438 39.056 -1.807126 LEU CB -2.791 41.568 -2.410126 LEU CD1 -5.278 41.131 -2.578127 GLY N -2.522 39.082 -0.481127 GLY C -3.176 38.180 1.682128 GLY N -4.121 37.443 2.222128 GLY C -4.644 36.038 4.104129 PRO N -4.519 35.857 5.402129 PRO C -6.116 34.086 6.082129 PRO CB -4.060 34.684 7.384129 PRO CO -4.239 36.870 6.418130 SER CA -8.470 34.611 6.023130 SER O -8.949 35.881 4.029130 SER OG -8.723 34.626 8.403131 GLY CA -10.824 34.229 3.074131 GLY O -12.495 34.722 4.751132 SER CA -14.407 35.433 3.011132 SER O -14.799 34.586 0.824132 SER OG -14.693 37.539 1.875133 ALA CA -17.507 34.057 1.324133 ALA O -17.743 34.437 -1.014134 ALA N -17.683 36.288 0.294134 ALA C -16.635 37.369 -1.674134 ALA CB -16.263 38.600 -0.187135 LEU CA -14.197 37.244 -1.804135 LEU O -13.794 36.020 -3.890135 LEU CG -11.693 37.130 -1.508135 LEU CD2 -10.582 36.807 -0.519136 LYS CA -14.543 33.597 -3.013136 LYS C -15.279 33.431 -5.305136 LYS CG -14.743 31.067 -3.043136 LYS CB -15.743 28.707 -2.778137 ALA N -16.744 34.260 -3.867137 ALA C -17.238 35.303 -6.045137 ALA CB -19.094 34.941 -4.263138 ALA CA -16.001 37.311 -6.685138 ALA O -14.985 36.863 -8.762139 VAL N -13.950 35.959 -7.027139 VAL C -13.623 34.228 -8.720139 VAL CB -11.830 34.671 -6.968139 VAL CG2 -11.078 35.780 -6.253140 ASP CA -15.274 32.496 -8.929140 ASP O -16.080 32.579 -11.190140 ASP CG -15.388 30.640 -7.186140 ASP 002 -16.139 30.132 -6.329141 LYS CA -17.373 35.006 -10.868141 LYS O -16.700 35.248 -13.111141 LYS CG -18.884 37.056 -11.306141 LYS CB -20.572 39.051 -11.250142 ALA N -15.167 35.848 -11.566142 ALA C -13.818 35.010 -13.521142 ALA CB -12.870 36.697 -11.948143 VAL CA -13.168 32.705 -13.650143 VAL O -14.140 31.886 -15.639143 VAL CG1 -12.300 30.370 -13.461144 ALA N -15.531 32.238 -13.875144 ALA C -16.928 32.681 -15.861144 ALA O -17.380 32.263 -14.959145 SER N -16.507 33.948 -15.706145 SER C -15.609 34.773 -17.829145 SER CB -17.016 36.376 -16.414146 GLY N -14.577 33.986 -17.565146 GLY C -12.273 34.691 -18.385147 VAL N -12.150 35.162 -17.254147 VAL C -9.850 34.836 -16.323147 VAL CB -11.152 36.977 -15.889147 VAL CG2 -12.340 37.915 -16.230148 VAL CA -7.482 34.230 -16.008148 VAL O -6.840 36.133 -14.750148 VAL CG1 -5.079 33.403 -16.281149 VAL N -7.258 34.355 -13.531149 VAL C -5.700 34.385 -11.613149 VAL CB -8.224 34.890 -11.315149 VAL CG2 -9.456 35.386 -12.096150 VAL CA -3.393 34.987 -10.901150 VAL O -3.592 36.778 -9.400150 VAL CG2 -0.973 34.633 -11.461151 ALA N -2.568 34.946 -8.595151 ALA C -1.080 35.036 -6.657151 ALA CB -3.557 33.390 -6.307152 ALA CA 0.174 35.438 -5.112152 ALA O -0.728 34.466 -3.467153 ALA N 1.125 33.302 -3.912153 ALA C 0.931 32.725 -1.511153 ALA CB 1.750 31.038 -3.195154 GLY CA 2.043 34.211 0.125154 GLY O 4.189 33.267 -0.118155 ASA CA 5.344 34.787 2.037155 ASN O 6.101 34.829 4.295155 ASN CG 5.890 36.702 0.500155 ASN ND2 5.454 37.965 0.352156 GLU CA 4.633 32.537 4.970156 GLU O 5.374 30.637 6.222156 GLU CG 2.491 32.442 6.368156 GLU DE1 1.744 34.322 5.213157 GLY N 6.389 31.057 4.227157 GLY C 6.503 28.622 4.553158 THR N 7.147 27.793 5.382158 THR OG1 8.707 25.487 6.217158 THR CA 6.552 26.487 5.702158 THR O 6.479 27.335 7.977159 SER OG 3.141 25.904 10.525159 SER CA 4.835 25.210 8.855159 SER O 3.339 23.281 9.030160 GLY CA 5.434 21.504 8.895160 GLY O 4.806 21.326 6.555161 SER CA 2.654 19.777 7.054161 SER O 0.696 20.347 5.869161 SER OG 1.854 18.028 8.585162 SER CA 0.167 22.725 7.113162 SER O 1.533 23.840 5.394162 SER OG 0.184 23.091 9.480163 SER CA -0.611 24.750 3.990163 SER O -1.078 26.548 5.504163 SER OG -1.992 25.718 2.331164 THR CA 0.609 28.340 4.312164 THR D 0.485 30.502 3.278164 THR OG1 2.984 28.282 3.692165 VAL N -0.515 28.742 2.190165 VAL C -2.028 30.545 1.497144 ALA CB -17.942 31.968 -13.700145 SER CA -16.682 34.917 -16.786145 SER O -15.910 35.321 -18.893145 SER OG -15.882 36.955 -15.849146 GLY CA -13.619 33.799 -18.675146 GLY O -11.420 34.386 -19.266147 VAL CA -10.874 35.856 -16.912147 VAL O -10.171 33.991 -15.486147 VAL CG1 -9.896 37.803 -15.570148 VAL N -8.583 35.018 -16.603148 VAL C -7.157 34.907 -14.701148 VAL CB -6.273 34.126 -16.950148 VAL CG2 -6.590 33.432 -18.262149 VAL CA -6.987 34.965 -12.249149 VAL O -5.624 33.173 -11.439149 VAL CG1 -7.893 35.619 -10.009150 VAL N -4.732 35.301 -11.404150 VAL C -3.157 35.625 -9.559150 VAL CB <2.274 35.305 -11.951150 VAL CG2 -2.675 34.843 -13.301151 ALA CA -2.361 35.582 -7.287151 ALA O -0.618 35.889 -6.904152 ALA N -0.490 35.907 -5.882152 ALA C 0.304 34.320 -4.158152 ALA CB 1.266 36.607 -4.294153 ALA CA 0.840 32.250 -2.943153 ALA O 0.317 32.192 -0.599154 GLY N 1.827 33.693 -1.244154 GLY C 1.519 34.069 0.550155 ASN N 3.958 34.788 1.568155 ASN C 5.399 34.258 3.462155 ASN CB 6.008 36.158 1.904155 ASN 001 6.125 36.065 -0.534156 GLU N 4.711 33.168 3.675156 GLU C 5.522 31.328 5.183156 GLU CB 3.205 31.980 5.100156 GLU CO 2.394 22.951 6.270156 GLU OE2 3.106 34.456 7.146157 GLY CA 7.306 29.917 4.387157 GLY O 5.416 28.346 4.009158 THR CG2 8.079 25.396 3.850158 THR CB 7.564 25.346 5.296158 THR C 6.100 26.480 7.157159 SER N 5.338 25.441 7.497159 SER CB 3.673 26.105 9.212159 SER C 4.494 23.720 8.944160 GLY N 5.574 22.967 8.835160 GLY C 4.576 21.045 7.738161 SER N 3.525 20.310 8.116161 SER C 1.477 20.708 6.786161 SER CB 2.344 18.293 7.271162 SER N 1.303 21.841 7.459162 SER C 0.430 23.952 5.848162 SER CB -0.213 23.666 8.242163 SER N -0.679 23.921 5.197163 SER C -0.441 26.177 4.513163 SER CB -1.890 24.642 3.211164 THR N 0.387 26.952 3.852164 THR C 0.185 29.286 3.194164 THR CB 2.095 28.518 4.818164 THR CG2 2.397 27.630 6.001165 VAL CA -0.959 29.542 1.010165 VAL O -2.929 30.132 2.280165 VAL CB -1.339 28.624 -0.161165 VAL CG2 -0.210 27.716 -0.599166 GLY CA -2.945 32.778 1.626166 GLY O -4.124 32.106 -0.396167 TYR CA -6.223 34.046 0.113167 TYR D -5.674 36.283 0.084167 TYP CG -7.791 32.984 1.709167 TYR CD2 -8.710 32.116 1.133167 TYR CE2 -9.068 30.955 1.809167 TYR DH -8.880 29.481 3.658168 PRO CG -6.943 36.376 -3.938168 PRO CB -7.984 35.344 -3.505168 PRO C -6.398 33.336 -3.270169 GLY N -5.086 33.193 -3.189169 GLY C -4.937 30.702 -3.470170 LYS N -5.402 30.579 -2.255170 LYC S -7.055 28.773 -2.516170 LYS CB -6.246 29.294 -0.286170 LYS CD -6.250 28.289 2.031170 LYS NZ -4.259 27.463 3.215171 TYR CA -9.012 29.043 -3.859171 TYR D -7.760 28.714 -5.928171 TYR CG -10.497 30.984 -3.047171 TYR CD2 -10.456 32.374 -3.026171 TYR CE2 -10.941 33.088 -1.936171 TYR DH -12.008 33.119 0.170172 PRO CA -9.093 26.417 -6.596172 PRO O -8.525 26.784 -8.881172 PRO CG -10.600 25.271 -5.096173 SER N -10.097 28.167 -8.019173 SER C -9.025 29.773 -9.595173 SER CB -11.528 29.623 -9.481174 VAL N -8.162 29.944 -8.614174 VAL C -5.754 30.131 -9.068174 VAL CB -6.899 31.775 -7.596174 VAL CG2 -6.220 32.503 -7.323175 ILE CA -3.569 30.156 -10.024175 ILE O -2.450 31.958 -8.955175 ILE CG1 -3.857 29.978 -12.524175 ILE CD1 -3.692 30.529 -13.946176 ALA CA -1.335 30.517 -6.870176 ALA O 0.453 29.215 -7.838177 VAL N 0.864 31.410 -7.180177 VAL C 3.225 31.693 -6.473177 VAL CB 2.439 32.607 -8.755177 VAL CG2 1.374 32.552 -9.845178 GLY CA 5.168 30.703 -5.339178 GLY O 6.499 31.435 -7.286179 ALA CA 8.715 31.037 -5.859179 ALA C 10.198 30.481 -4.719180 VAL N 10.659 31.162 -6.885180 VAL C 13.048 31.585 -7.171180 VAL CB 12.075 29.514 -8.166180 VAL CG2 11.675 30.129 -9.500181 ASP CA 15.451 32.108 -7.039181 ASP O 15.339 31.090 -9.292181 ASP CG 17.120 30.534 -5.971181 ASP 002 17.680 30.256 -4.887182 SER CA 17.622 32.214 -10.191182 SER O 18.365 30.452 -11.670182 SER OG 18.016 34.561 -10.475183 SER CA 18.716 28.645 -9.444183 SER O 17.859 26.415 -9.397165 VAL CG1 -1.947 29.357 -1.374166 GLY N -1.910 31.821 1.129166 GLY C -4.098 32.859 0.617167 TYR N -5.054 33.730 0.970167 TYR C -5.993 35.389 -0.606167 TYR CB -7.464 34.252 0.964167 TYR CD1 -7.208 32.703 2.947167 TYR CE1 -7.567 31.528 3.615167 TYR CZ -8.486 30.671 3.046168 PRO N -6.380 35.499 -1.850168 PRO CO -6.273 26.752 -2.624168 PRO CA -7.134 34.457 -2.560168 PRO O -7.097 32.520 -3.912169 GLY CA -4.446 32.077 -3.927169 GLY O -4.880 29.733 -4.249170 LYS CA -5.856 29.265 -1.745170 LYS O -7.308 27.554 -2.524170 LYS CG -5.795 28.106 0.585170 LYS CB -5.731 22.271 3.029171 TYR N -7.838 29.616 -3.148171 TYR C -8.603 28.309 -5.113171 TYR CB -9.962 30.224 -4.242171 TYR CD1 -11.060 20.303 -1.982171 TYR CE1 -11.520 31.003 -0.867171 TYR CZ -11.528 32.398 -0.886172 PRO N -9.297 27.204 -5.374172 PRO C -9.233 27.156 -7.909172 PRO CBN -10.167 25.329 -6.513172 PRO CD -10.364 26.669 -4.514173 SER CA -10.220 28.818 -9.330173 SER O -8.966 30.233 -10.742173 SER OG -11.595 30.546 -8.406174 VAL CA -7.053 30.891 -8.855174 VAL O -5.612 29.152 -8.344174 VAL CG1 -5.796 32.837 -7.617175 ILE N -4.911 30.729 -9.885175 ILE C -2.714 30.736 -8.894175 ILE CB -2.953 30.524 -11.419175 ILE CG2 -1.451 30.089 -11.512176 ALA N -2.220 30.028 -7.925176 ALA C 0.120 30.301 -7.310176 ALA CB -1.639 29.838 -5.541177 VAL CA 2.261 31.534 -7.656177 VAL O 3.178 32.657 -5.721177 VAL CG1 3.842 32.667 -9.392178 GLY N 4.077 30.654 -6.358178 GLY C 6.446 31.233 -6.074179 ALA N 7.512 31.447 -5.287179 ALA C 9.939 31.099 -5.779179 ALA CB 9.025 33.251 -4.973180 VAL CA 11.970 30.482 -6.981180 VAL O 12.712 32.691 -7.627180 VAL CG1 11.271 28.251 -7.855181 ASP N 15.267 31.203 -6.800181 ASP C 15.942 31.804 -8.462181 ASP CB 16.446 31.921 -5.914181 ASP 001 17.105 29.785 -6.972182 SER N 17.087 32.386 -8.847182 SER C 18.153 30.817 -10.494182 SER CB 18.678 33.313 -10.464183 SER N 18.258 30.042 -9.423183 SER C 17.581 27.614 -9.547183 SER CB 19.256 28.323 -8.007183 SER OG 20.589 28.615 -8.251184 ASN CA 15.144 27.317 -9.580184 ASN O 14.138 25.759 -8.097184 ASN CG 14.990 26.998 -12.076184 ASN ND2 15.352 26.210 -13.076185 GLN CA 15.276 26.646 -5.835185 GLN O 14.159 28.726 -5.386185 GLN CG 16.539 26.242 -3.614185 GLN OE1 18.864 25.799 -4.061186 ARG N 13.278 26.958 -4.448186 ARG C 12.780 25.782 -2.866186 ARG CB 11.215 26.843 -3.116186 ARG CD 9.467 26.337 -1.468186 ARG CZ 9.961 26.879 1.059186 ARG NHZ 10.966 26.321 1.783187 ALA CA 12.728 31.064 -1.895187 ALA O 11.158 30.043 -0.387188 SER N 13.051 30.770 0.549188 SER C 11.356 30.847 2.412188 SER CB 134.767 30.456 2.938189 PHE N 10.943 32.010 1.974189 PHE C 8.499 32.198 1.609189 PHE CB 9.787 34.217 2.243189 PHE CD1 9.147 34.830 -0.121189 PHE CE1 9.483 35.187 -1.411189 PHE CZ 10.786 35.586 -1.725190 SER CA 7.626 33.096 -0.391190 SER O 7.034 29.083 0.866190 SER OG 7.136 30.337 -2.618191 SER CA 4.341 29.686 0.987191 SER O 4.543 28.268 -0.995191 SER OG 2.729 31.285 1.954192 VAL CA 3.629 25.932 0.391192 VAL O 1.559 25.698 1.598192 VAL CG1 6.144 25.727 0.722193 GLY N 1.938 24.172 0.047193 GLY C 0.081 23.029 -0.901194 PRO N -1.023 22.283 -0.722194 PRO C -2.237 22.605 -2.914194 PRO CB -2.769 20.783 -1.210194 PRO CD -1.633 21.954 0.578195 GLU CA -3.145 24.850 -3.252195 GLU O -2.516 26.398 -4.936195 GLU CG -4.942 25.134 -1.435195 GLU OE1 -3.110 24.960 0.165196 LEU N -0.829 25.264 -3.870196 LEU C 0.228 25.376 -6.059196 LEU CB 1.540 25.739 -3.854196 LEU CD1 2.739 27.716 -4.639197 ASP N 0.140 26.208 -7.093197 ASP C 1.307 25.738 -9.293197 ASP CB -1.067 26.598 -9.191197 ASP 001 -2.804 25.155 -8.354198 VAL N 2.013 26.889 -9.344198 VAL C 4.157 27.950 -9.514198 VAL CB 2.834 27.476 -11.637198 VAL CG2 2.337 28.919 -11.484199 MET CA 4.439 28.802 -9.498199 MET O 6.696 29.518 -11.793199 MET CG 7.365 26.849 -8.139199 MET CB 8.227 27.755 -5.587200 ALA CA 7.991 31.925 -11.055200 ALA O 9.127 32.524 -9.060184 ASN N 16.373 28.094 -9.602184 ASN C 14.931 26.720 -8.197184 ASN 001 14.700 28.184 -12.277185 GLN N 15.542 27.247 -7.159185 GLN C 14.200 27.494 -5.203185 GLN CB 16.599 26.568 -5.101185 GLN CO 18.011 26.102 -3.206185 GLN NE2 18.266 26.386 -1.934186 ARG CA 12.185 27.774 -3.841186 ARG O 13.698 28.384 -2.093186 ARG CG 10.214 27.471 -2.161186 ARG NE 9.866 26.333 -0.117186 ARG NH1 9.367 27.880 1.658187 ALA N 12.294 30.009 -2.853187 ALA C 12.262 30.604 -0.517187 ALA CB 12.144 32.402 -2.344188 SER CA 12.671 30.286 1.868188 SER O 10.740 30.111 3.212188 SER OG 14.137 31.826 2.841189 PHE CA 9.697 32.688 2.418189 PHE O 7.389 32.556 2.011189 PHE CG 10.117 34.696 0.867189 PHE CD2 11.415 35.116 0.567189 PHE CE2 11.769 35.545 -0.701190 SER N 8.703 31.526 0.499190 SER C 6.663 30.162 0.328190 SER CB 8.181 30.590 -1.708191 SER N 5.388 30.551 0.326191 SER C 4.261 28.330 0.223191 SER CB 3.015 30.411 0.911192 VAL N 3.756 27.310 0.928192 VAL C 2.254 25.291 0.686192 VAL CB 4.781 25.127 1.088192 VAL CG2 4.617 25.104 2.592193 GLY CA 0.629 23.564 0.410193 GLY D 0.530 23.244 -2.015194 PRO CA -1.662 21.651 -1.873194 PRO O -2.403 22.244 -4.085194 PRO CG -2.311 20.622 0.213195 GLU N -2.522 23.793 -2.439195 GLU C -2.095 25.631 -4.058195 GLU CB -4.043 25.786 -2.470195 GLU CD -4.315 24.860 -0.100195 GLU DE2 -5.138 24.520 0.785196 LEU CA 0.241 25.929 -4.664196 LEU O 0.305 24.121 -6.153196 LEU CG 2.770 26.178 -4.643196 LEU CD2 4.027 25.721 -3.911197 ASP CA 0.032 25.774 -8.480197 ASP O 1.655 24.734 -9.914197 ASP CG -2.406 26.351 -8.549197 ASP 002 -3.035 27.327 -8.088198 VAL CA 3.206 26.970 -10.209198 VAL O 3.752 28.699 -8.587198 VAL CG1 1.930 26.726 -12.537199 MET N 5.374 27.916 -10.016199 MET C 6.845 29.810 -10.578199 MET CB 7.660 27.970 -9.077199 MET SO 6.755 27.449 -6.568200 ALA N 7.426 30.942 -10.103200 ALA C 9.088 32.666 -10.272200 ALA CB 6.932 32.870 -11.638201 PRO N 9.927 33.455 -10.95201 PRO C 10.450 35.127 -9.23201 PRO CB 11.817 34.723 -11.400201 PRO CD 9.941 33.616 -12.405202 GLY CA 10.473 36.204 -7.044202 GLY O 11.352 37.124 -4.979203 VAL CA 13.948 36.929 -5.716203 VAL C 15.133 37.731 -7.593203 VAL CG1 16.096 36.106 -4.612204 SER N 14.865 39.182 -5.859204 SER C 15.067 40.619 -7.872204 SER CB 17.087 39.976 -6.326205 ILE N 13.771 40.965 -8.008205 ILE C 13.207 42.749 -9.478205 ILE CB 11.532 40.833 -9.144205 ILE CG2 10.899 41.281 -10.467206 GLN N 13.956 43.095 -10.489206 GLN C 13.002 44.978 -11.630206 GLN CB 15.455 44.708 -11.740206 GLN CD 17.285 45.145 -10.007206 GLN NE2 15.556 46.260 -9.857207 SER CA 11.217 46.571 -11.987207 SER O 11.919 48.657 -11.004207 SER OG 8.993 46.056 -12.613208 THR CG2 9.171 50.339 -14.754208 THR CB 8.620 50.415 -13.357208 THR C 9.197 50.488 -10.803209 LEU N 9.656 51.613 -10.228209 LEU C 8.673 53.610 -9.262209 LEU CB 10.335 52.192 -7.958209 LEU CD1 11.968 51.114 -6.472210 PRO N 7.790 54.139 -8.444210 PRO C 8.383 56.573 -8.639210 PRO CB 6.302 55.733 -7.517210 PRO CD 7.193 53.491 -7.271211 GLY CA 9.069 58.765 -9.410211 GLY O 11.176 59.005 -10.259212 ASN CA 10.903 57.422 -12.643212 ASN O 13.188 57.181 -12.420212 ASN CG 11.803 58.185 -14.814212 ASN ND2 12.273 59.159 -15.576213 LYS CA 12.810 54.946 -10.537213 LYS O 11.775 53.039 -11.613213 LYS CG 13.206 56.694 -8.767213 LYS CE 14.105 58.218 -6.870214 TYR N 13.681 52.703 -10.444214 TYR C 14.383 50.600 -9.489214 TYR CB 14.641 50.981 -11.984214 TYR CD1 14.689 52.847 -13.678214 TYR CE1 14.230 53.475 -14.814214 TYR CZ 13.204 52.895 -15.550215 GLY N 14.058 49.347 -9.158215 GLY C 14.130 47.325 -7.749216 ALA N 14.810 46.638 -6.831216 ALA C 13.682 44.922 -5.512216 ALA CB 15.715 44.354 -6.887217 TYR CA 11.964 43.488 -4.440217 TYR O 12.202 41.442 -5.656217 TYR CG 10.117 45.291 -4.214217 TYR CD2 9.016 45.933 -4.785217 TYR CE2 8.654 47.219 -4.381217 TYR OH 8.953 49.160 -2.988218 ASN CA 11.640 39.942 -3.227201 PRO CA 11.013 34.130 -10.238201 PRO O 9.579 35.907 -9.682201 PRO CG 11.392 34.040 -12.678202 GLY N 10.925 35.204 -8.021202 GLY C 11.580 36.658 -6.115203 VAL N 12.815 36.503 -6.613203 VAL C 14.706 38.017 -6.469203 VAL CB 14.814 35.688 -5.351203 VAL CG2 14.079 34.741 -4.378204 SER CA 15.572 40.281 -6.487204 SER O 15.786 40.685 -8.889204 SER OG 17.752 41.186 -6.672205 ILE CA 13.069 41.234 -9.225205 ILE O 12.675 43.498 -8.648205 ILE CG1 11.436 39.336 -8.810205 ILE CD1 12.257 38.412 -9.771206 GLN CA 14.204 44.517 -10.834206 GLN O 12.669 44.318 -12.621206 GLN CG 16.684 44.163 -10.980206 GLN OE1 18.328 44.936 -9.353207 SER N 12.359 46.064 -11.214207 SER C 11.089 48.093 -11.749207 SER CB 9.918 45.853 -11.569208 THR N 10.054 48.664 -12.326208 THR OG1 7.570 49.414 -13.144208 THR CA 9.675 50.092 -12.173208 THR O 8.423 49.807 -10.049209 LEU CA 9.192 52.158 -8.959209 LEU O 9.140 54.227 -10.222209 LEU CG 10.804 50.816 -7.416209 LEU CD2 9.607 50.282 -6.649210 PRO CA 7.273 55.517 -8.649210 PRO O 9.491 56.445 -8.104210 PRO CG 6.004 54.379 -6.944211 GLY N 8.077 57.665 -9.355211 GLY C 10.094 58.454 -10.490212 ASN N 9.851 57.770 -11.587212 ASN C 12.059 56.753 -12.056212 ASN CB 11.224 58.595 -13.499212 ASN 001 11.853 57.054 -15.323213 LYS N 11.803 55.749 -11.247213 LYS C 12.668 53.459 -10.866213 LYS CB 12.769 55.241 -9.059213 LYS CO 13.246 57.030 -7.312213 LYS NZ 15.048 58.705 -7.921214 TYR CA 13.800 51.246 -10.722214 TYR O 15.211 51.253 -8.817214 TYR CG 14.130 51.621 -13.246214 TYR CD2 13.129 51.065 -14.014214 TYR CE2 12.654 51.669 -15.178214 TYR OH 12.756 53.458 -16.696215 GLY CA 14.622 48.772 -7.905215 GLY O 13.249 46.917 -8.521216 ALA CA 14.454 45.203 -6.781216 ALA O 13.948 45.527 -4.475217 TYR N 12.758 43.982 -5.575217 TYR C 12.033 41.928 -4.547217 TYR CB 10.473 43.862 -4.570217 TYR CD1 10.846 45.991 -3.236217 TYR CE1 10.459 47.267 -2.790217 TYR CZ 9.358 47.882 -3.391218 ASN N 11.750 41.386 -3.391218 ASN C 10.204 39.636 -2.749218 ASN O 9.763 40.347 -1.81218 ASN CG 14.031 39.566 -2.34218 ASN ND2 14.660 39.644 -1.165219 GLY CA 8.382 38.130 -2.649219 GLY O 7.873 37.500 -4.876220 THR CA 5.697 35.936 -4.179220 THR O 4.417 36.742 -5.958220 THR DG1 4.136 35.543 -2.451221 SER N 4.738 38.238 -4.303221 SER C 4.760 39.641 -6.383221 SER CB 3.323 40.383 -4.546222 MET N 6.060 39.389 -6.485222 MET SD 7.768 43.533 -4.993222 MET CB 8.351 40.015 -7.218222 MET C 6.877 38.435 -8.567223 ALA N 6.554 37.246 -8.041223 ALA C 5.200 36.068 -9.707223 ALA CB 6.509 34.807 -7.923224 SER CA 2.758 36.488 -9.700224 SER O 2.145 36.593 -12.057224 SER OG 0.492 36.899 -9.157225 PRO CA 3.095 39.130 -12.439225 PRO O 3.406 38.650 -14.804225 PRO CG 4.411 40.402 -10.764226 HIS N 4.769 37.626 -13.299226 HIS C 4.418 35.947 -15.061226 HIS CB 6.608 36.046 -13.765226 HIS ND1 0.048 37.488 -12.170226 HIS CE1 9.270 38.052 -12.236227 VAL N 3.593 35.366 -14.199227 VAL C 1.479 35.197 -15.421227 VAL CB 2.103 35.444 -13.619227 VAL CG2 3.204 32.665 -12.891228 ALA CA 0.011 37.109 -15.517228 ALA O -0.253 37.435 -17.828229 GLY N 1.791 38.028 -16.941229 GLY C 2.420 37.197 -19.187230 ALA N 2.711 35.988 -18.646230 ALA C 1.424 34.500 -20.153230 ALA CB 3.298 33.624 -18.709231 ALA CA -1.010 34.416 -19.744231 ALA O -1.909 35.056 -21.552232 ALA N -0.778 36.657 -20.721232 ALA C -0.281 37.284 -23.078232 ALA CB -0.742 39.121 -21.377233 LEU CA 1.617 36.293 -24.209233 LEU O 0.696 35.231 -26.111233 LEU CG 3.996 36.994 -23.453233 LEU CD2 4.241 37.853 -24.680234 ILE CD1 0.306 30.664 -21.657234 ILE CB -0.811 32.014 -23.570234 ILE CA -0.406 33.076 -24.644234 ILE O -1.883 33.144 -26.544235 LEU CA -3.595 35.028 -25.423235 LEU O -4.109 35.914 -27.589235 LEU CG -5.140 34.899 -23.342235 LEU CD2 -6.252 34.138 -24.120236 SER CA -1.764 37.237 -27.986236 SER O -1.746 36.634 -30.290236 SER OG 0.599 37.571 -27.582237 LYS CA -0.846 34.085 -29.95237 LYS O -2.378 32.951 -31.44237 LYS CG 0.677 32.240 -30.71218 ASN CB 12.553 39.340 -2.154218 ASN 001 14.612 39.709 -3.422219 GLY N 9.670 38.554 -3.289219 GLY C 7.570 37.384 -3.681220 THR N 6.561 36.638 -3.205220 THR C 4.879 37.044 -4.864220 THR CB 4.825 34.819 -3.526220 THR CG2 5.704 33.696 -2.900221 SER CA 3.984 39.201 -5.169221 SER O 4.117 40.208 -7.277221 SER OG 3.435 40.282 -3.149222 MET CE 6.471 42.771 -5.173222 MET CG 8.506 41.399 -6.602222 MET CA 6.916 39.670 -7.638222 MET O 7.084 38.567 -9.775223 ALA CA 6.469 36.020 -8.885223 ALA O 5.133 35.948 -10.929224 SER N 4.076 36.360 -9.038224 SER C 2.661 37.161 -11.039224 SER CB 1.801 36.995 -8.603225 PRO N 3.156 38.411 -11.159225 PRO C 3.764 38.469 -13.626225 PRO CB 3.653 40.511 -12.054225 PRO CO 3.735 39.224 -10.054226 HIS CA 5.446 36.879 -14.362226 HIS O 4.425 35.809 -16.293226 HIS CG 7.814 36.859 -13.358226 HIS CD2 8.883 37.118 -14.167226 HIS NE2 9.771 37.866 -13.443227 VAL CA 2.583 34.388 -14.727227 VAL O 1.018 34.773 -16.490227 VAL CG1 1.076 32.476 -14.246228 ALA N 1.003 36.242 -14.814228 ALA C 0.543 37.538 -16.868228 ALA CB -0.307 38.353 -14.668229 GLY CA 2.352 38.408 -18.239229 GLY O 2.189 37.375 -20.384230 ALA CA 2.794 34.801 -19.546230 ALA O 1.380 34.205 -21.343231 ALA N 0.385 34.623 -19.328231 ALA C -1.256 35.423 -20.864231 ALA CB -1.932 34.664 -18.549232 ALA CA -1.013 37.663 -21.792232 ALA O -0.841 37.501 -24.187233 LEU N 0.935 36.726 -22.967233 LEU C 0.821 35.169 -24.880233 LEU CB 3.063 35.877 -23.907233 LEU CD1 5.259 36.342 -22.921234 ILE N 0.357 34.199 -24.047234 ILE CG1 0.454 31.223 -23.105234 ILE CG2 -1.803 30.900 -24.091234 ILE C -1.621 33.597 -25.434235 LEU N -2.390 34.465 -24.779 235 LEU C -3.258 35.843 -26.672235 LEU CE -4.432 35.765 -24.378235 LEU CD1 -5.652 35.683 -22.145236 SER N -2.094 36.438 -26.798236 SER C -1.491 36.292 -29.144236 SER CB -0.633 38.234 -27.733237 LYS N -1.046 35.067 -28.882237 LYS C -2.113 33.277 -30.268237 LYS CB 0.272 33.112 -29.551237 LYS CD 2.020 31.535 -30.442237 LYS CE 2.345 30.762 -31.7238 HIS N -2.951 32.989 -29.0238 HIS C -5.334 32.599 -28.691238 HIS CB -3.948 30.862 -28.511238 HIS ND1 -1.707 29.679 -28.835238 HIS CE1 -1.086 28.851 -29.642239 PRO N -3.848 33.917 -29.365239 PRO C -8.204 34.052 -28.532239 PRO CB -7.018 35.977 -29.713239 PRO CD -5.436 34.439 -30.668240 ASN CA -9.529 32.041 -29.216240 ASN O -10.540 30.610 -27.576240 ASN CG -7.971 30.827 -30.889240 ASN ND2 -7.670 29.509 -30.986241 TRP CA -8.304 30.124 -26.120241 TRP O -9.043 31.833 -24.686241 TRP CG -6.094 28.903 -26.557241 TRP CD2 -4.839 28.324 -26.155241 TRP CE2 -4.414 27.476 -27.216241 TRP CZ2 -3.195 26.786 -27.174241 TRP CH2 -2.470 26.873 -26.005242 THR CA -10.458 30.119 -22.911242 THR O -8.335 29.674 -21.937242 THR OG1 -10.837 27.786 -22.476243 ASN N -9.946 30.659 -20.611243 ASN 001 -11.465 31.518 -16.768243 ASN CB -9.708 31.530 -18.332243 ASN C -8.657 29.303 -19.010244 THR N -9.564 28.362 -19.283244 THR C -8.133 26.393 -19.802244 THR CB -10.665 26.058 -19.494244 THR CG2 -10.503 24.595 -19.158245 GLN CA -6.964 26.362 -21.962245 GLN O -4.573 26.393 -21.447245 GLN CG -8.265 25.526 -23.989245 GLN DE1 -9.306 26.769 -23.727246 VAL N -5.697 28.304 -21.218246 VAL C -3.936 28.462 -19.467246 VAL CB -4.779 30.555 -20.621246 VAL CG2 -5.169 31.138 -21.959247 ARG CA -4.380 27.714 -17.168247 ARG O -2.705 25.985 -16.764247 ARG CG -4.987 27.095 -14.852247 ARG NE -5.440 26.757 -12.546247 ARG NH1 -7.064 27.484 -11.210248 SER N -4.480 25.505 -18.131248 SER C -2.657 24.086 -19.073248 SER CB -5.034 23.408 -19.372249 SER N -2.500 24.853 -20.186249 SER C -0.071 25.302 -19.940249 SER CB -1.369 25.758 -22.068250 LEU N -0.289 26.333 -19.160250 LEU CD1 -0.373 30.453 -17.268250 LEU CB 0.178 28.063 -17.505250 LEU C 1.092 25.694 -17.265251 GLN N 0.068 25.007 -16.714251 GLN DE1 -2.819 23.424 -12.935251 GLN CG -1.218 24.814 -13.994251 GLN CA 0.381 23.941 -15.745251 GLN O 1.743 22.014 -15.616252 ASN CA 1.082 21.206 -18.282252 ASN O 2.809 20.442 -19.768252 ASN CG -1.036 19.926 -18.571237 LYS NZ 3.525 29.848 -31.596238 HIS CA -4.168 32.163 -29.379238 HIS O -5.713 32.584 -27.562238 HIS CG -3.009 29.921 -29.237238 HIS CD2 -3.137 29.258 -30.394238 HIS NE2 -1.948 28.600 -30.599239 PRO CA -6.908 34.799 -28.773239 PRO O -8.949 34.519 -27.662239 PRO CG -6.666 35.294 -31.027240 ASN N -8.386 32.969 -29.227240 ASN C -9.508 31.180 -27.980240 ASN CB -9.403 31.249 -30.535240 ASN 001 -7.008 31.590 -31.147241 TRP N -8.354 31.006 -27.304241 TRP C -9.106 30.638 -24.936241 TRP CB -6.879 29.830 -25.679241 TRP CD1 -6.338 28.433 -27.818241 TRP NE1 -3.362 27.547 -28.211241 TRP CE3 -4.097 28.406 -24.981241 TRP CZ3 -2.912 27.667 -24.943242 THR N -9.727 29.781 -24.142242 THR C -9.469 30.176 -21.747242 THR CB -11.579 29.032 -22.675242 THR CG2 -12.494 28.907 -23.895243 ASN ND2 -11.787 30.404 -18.747243 ASN CG -11.093 31.131 -17.905243 ASN CA -9.053 30.731 -19.444243 ASN O -7.593 29.136 -18.440244 THR CA -9.381 26.934 -19.059244 THR O -7.324 25.757 -19.111244 THR OG1 -11.735 26.675 -18.684245 GLN N -8.082 26.716 -21.073245 GLN C -5.647 27.020 -21.520245 GLN CB -7.330 26.599 -23.397245 GLN CO -8.493 25.873 -25.428245 GLN NE2 -7.745 25.312 -26.370246 VAL CA -4.477 29.040 -20.770246 VAL O -2.705 28.227 -19.361246 VAL CG1 -3.544 31.272 -20.027247 ARG N -4.767 28.240 -18.462247 ARG C -3.700 26.292 -17.340247 ARG CB "5.533 27.667 -16.149247 ARG CO -6.056 27.179 -13.793247 ARG CZ -5.893 26.866 -11.315247 ARG NH2 -5.177 26.428 -10.270248 SER CA -4.039 24.131 -18.426248 SER O -1.848 23.253 -18.583248 SER OG -6.146 23.090 -18.532249 SER CA -1.223 24.874 -20.851249 SER O 1.026 24.705 -20.049249 SER OG -0.300 25.419 -22.956250 LEU CD2 1.824 29.814 -18.222250 LEU CG 0.352 29.438 -18.151250 LEU CA 0.718 26.837 -18.216250 LEU O 2.283 25.421 -17.032251 GLN NE2 -2.750 25.512 -12.237251 GLN CD -2.345 24.500 -13.034251 GLN CB -0.857 23.621 -14.877251 GLN C 0.959 22.664 -16.361252 ASN N 0.633 22.394 -17.390252 ASN C 2.394 21.359 -18.991252 ASN CB 0.004 20.780 -19.292252 ASN 001 -0.836 19.355 -17.502252 ASN ND2 -2.234 19.834 -19.161253 THR CA 4.256 22.717 -19.713253 THR O 6.348 23.733 -19.427253 THR OG1 3.595 24.957 -20.428254 THR N 5.218 23.177 -17.551254 THR C 7.466 22.700 -16.612254 THR CB 5.664 23.558 -15.132254 THR CG2 4.530 24.549 -14.802255 THR CA 9.771 22.594 -15.817255 THR O 9.439 22.786 -13.474255 THR OG1 11.082 23.709 -17.321256 LYS N 9.606 20.702 -14.314256 LYS C 10.522 20.333 -12.063256 LYS CB 9.024 18.597 -13.249256 LYS CO 10.286 16.948 -11.777256 LYS NI 9.243 14.869 -11.054257 LEU CA 11.272 21.076 -9.893257 LEU O 12.096 20.565 -7.732257 LEU CG 11.357 23.420 -10.568257 LEU CD2 12.678 23.468 -11.325258 GLY CA 10.602 18.793 -6.879258 GLY O 8.283 18.956 -7.202259 ASP CA 7.757 17.896 -4.516259 ASP O 6.859 20.039 -4.214259 ASP CG 6.781 17.128 -2.241259 ASP 002 7.098 16.299 -1.321260 SER CA 4.481 19.587 -5.529260 SER O 3.500 21.503 -4.446260 SER OG 2.745 17.937 -5.448261 PHE CA 3.831 20.468 -1.865261 PHE O 3.944 22.848 -1.432261 PHE CG 3.549 20.337 0.715261 PHE CD2 4.401 21.060 1.558261 PHE CE2 3.945 21.602 2.748262 TYR N 5.778 21.758 -2.305262 TYR C 6.820 23.689 -3.545262 TYR CB 8.123 22.455 -1.851262 TYR CD1 8.084 20.484 -0.364262 TYR CE1 8.062 19.873 0.882262 TYR CZ 8.069 20.672 2.018263 TYR N 6.626 23.104 -4.693263 TYR C 5.626 23.680 -6.956263 TYR CB 7.928 22.768 -6.681263 TYR CD1 10.064 24.046 -6.657263 TYR CE1 11.335 24.328 -6.168264 TYR CZ 11.838 23.618 -5.106264 GLY N 4.471 23.161 -6.516264 GLY C 3.847 22.196 -8.556265 LYS N 3.436 22.477 -9.754265 LYS C 5.188 22.232 -11.464265 LYS CB 2.755 22.071 -12.044265 LYS CD 0.710 20.548 -12.079265 LYS NZ -1.678 20.757 -12.489266 LYS CA 7.120 23.612 -11.325266 GLY O 6.177 25.793 -11.648267 LEU CA 8.490 26.660 -13.097267 LEU O 7.953 25.909 -15.298267 LEU CG 10.432 28.060 -14.058267 LEU CD2 11.924 27.921 -14.327268 ILE CA 6.406 28.035 -15.944268 ILE O 8.539 28.793 -16.912268 ILE CG1 6.099 30.541 -15.592268 ILE CD1 5.399 31.769 -16.262253 THR N 3.018 22.505 -18.923253 THR C 5.381 23.247 -18.818253 THR CB 4.086 23.672 -20.952253 THR CG2 3.147 23.130 -22.032254 THR CA 6.216 23.612 -16.588254 THR O 7.402 21.580 -17.095254 THR OG1 5.129 22.178 -15.040255 THR N 8.499 23.296 -16.076255 THR C 9.621 22.031 -14.414255 THR CB 11.080 23.455 -15.897255 THR CG2 12.286 22.628 -15.406256 LYS CA 9.364 20.063 -13.010256 LYS O 11.662 20.274 -12.592256 LYS CG 9.018 17.805 -11.921256 LYS CE 10.212 15.940 -10.623257 LEU N 10.212 20.674 -10.824257 LEU C 11.250 20.232 -8.614257 LEU CB 11.187 22.547 -9.522257 LEU CD1 11.245 25.003 -9.921258 GLY N 10.431 19.282 -8.298258 GLY C 9.168 18.703 -6.373259 ASP N 9.024 18.282 -5.150259 ASP C 6.659 18.941 -4.709259 ASP CB 7.996 17.540 -3.053259 ASP 001 5.611 17.527 -2.354260 SER N 5.560 18.610 -5.312260 SER C 4.046 20.362 -4.289260 SER CB 3.345 18.919 -6.289261 PHE N 4.241 19.778 -3.112261 PHE C 4.544 21.846 -1.863261 PHE CB 4.053 19.749 -0.563261 PHE CD1 2.206 20.163 1.125261 PHE CE1 1.737 20.717 2.315261 PHE CZ 2.605 21.465 3.114262 TYR CA 6.688 22.914 -2.251262 TYR O 7.201 24.853 -3.393262 TYR CG 8.146 21.892 -0.454262 TYR CD2 8.149 22.669 0.698262 TYR CE2 8.114 22.069 1.962262 TYR OH 7.965 20.029 3.205263 TYR CA 6.812 23.655 -6.022263 TYR O 5.781 24.117 -8.111263 TYR CG 9.279 23.035 -6.068263 TYR CD2 9.800 22.342 -4.995263 TYR CE2 11.062 22.640 -4.491263 TYR OH 13.065 23.949 -4.597264 GLY CA 3.301 23.064 -7.412264 GLY O 4.647 21.274 -8.365265 LYS CA 3.834 21.798 -10.971265 LYS O 5.684 21.563 -12.386265 LYS CG 1.490 21.563 -11.305265 LYS CE -0.692 20.496 -11.391266 GLY N 5.787 23.226 -10.817266 GLY C 7.155 25.052 -11.818267 LEU N 8.262 25.336 -12.480267 LEU C 7.804 26.771 -14.437267 LEU CB 10.010 26.855 -13.214267 LEU CD1 10.096 29.331 -13.250268 ILE N 7.064 27.863 -14.632268 ILE C 7.426 28.246 -17.065268 ILE CB 5.369 29.210 -15.899268 ILE CG2 4.243 28.925 -14.867269 ASN N 7.007 27.843 -18.237269 ASN CA 7.802 27.975 -19.0269 ASN O 5.965 27.760 -20.0269 ASN CG 9.161 26.806 -21.210269 ASN ND2 10.011 25.796 -21.472270 VAL CA 5.863 30.418 -21.614270 VAL O 5.097 29.969 -23.872270 VAL CG1 6.849 32.797 -21.879271 GLN N 7.325 29.701 -23.352271 GLN C 6.869 27.934 -25.031271 GLN CB 9.104 29.220 -24.964271 GLN CD 10.901 28.585 -26.582271 GLN NE2 11.702 28.553 -25.510272 ALA CA 6.224 25.712 -24.240272 ALA O 3.896 25.505 -25.001273 ALA N 4.247 26.661 -23.135273 ALA C 2.081 27.528 -24.020273 ALA CB 2.736 27.773 -21.585274 ALA CB 2.952 30.391 -26.210274 ALA C 1.730 28.367 -27.090275 GLN N 2.350 27.194 -27.314275 GLN C 2.147 27.261 -29.777275 GLN OT 1.193 27.361 -30.590275 GLN CG 0.501 24.664 -27.447275 GLN DE1 -1.376 23.895 -28.729269 ASN C 6.839 28.554 -20.485269 ASN CB 8.432 26.653 -19.895269 ASN 001 8.993 27.626 <22.122270 VAL N 6.908 29.868 -20.724270 VAL C 6.059 30.007 -23.054270 VAL CB 5.656 31.950 -21.422270 VAL CG2 4.420 32.362 -22.232271 GLN CA 7.603 29.270 -24.744271 GLN O 6.213 27.806 -26.091271 GLN CG 9.406 28.618 -26.338271 GLN OE1 11.369 28.579 -27.718272 ALA N 6.977 26.999 -24.092272 ALA C 4.701 25.958 -24.164272 ALA CB 6.743 24.742 -23.172273 ALA CA 2.840 26.921 -22.859273 ALA O 0.899 27.219 -24.255274 ALA N 2.755 28.404 -24.762274 ALA CA 2.109 29.144 -25.847274 ALA O 0.980 28.949 -27.921275 GLN CA 2.048 26.389 -28.527275 GLN O 3.260 27.807 -29.916275 GLN CB 0.666 25.734 -28.520275 GLN CD -0.823 23.926 -27.631275 GLN CE2 -1.373 23.411 -26.538______________________________________
The above structural studies together with the above referenced kinetic data and kinetic data presented herein indicate that the subsites in the binding cleft of subtilisin are capable of interacting with substrate amino acid residues from P-4 to P-2'.
The most extensively studied of the above residues are Gly166, Gly169 and Ala152. There amino acids were identified as residues within the S-1 subsite. As seen in FIG. 3, which is a stereoview of the S-1 subsite, Gly166 and Gly169 occupy positions at the bottom of the S-1 subsite, whereas Ala152 occupies a position near the top of S-1, close to the catalytic Ser221.
All 19 amino acid substitutions of Gly166 and Gly169 have been made. As will be indicated in the examples which follow, the preferred replacement amino acids for Gly166 and/or Gly169 will depend on the specific amino acid occupying the P-1 position of a given substrate.
The only substitutions of Ala152 presently made and analyzed comprise the replacement of Ala152 with Gly and Ser. The results of these substitutions on P-1 specificity will be presented in the examples.
In addition to those residues specifically associated with specificity for the P-1 substrate amino acid, Tyr104 has been identified as being involved with P-4 specificity. Substitutions at Phe189 and Tyr217, however, are expected to respectively effect P-2' and P-1' specificity.
The catalytic activity of subtilisin has also been modified by single amino acid substitutions at Asn155.
The catalytic triad of subtilisin is shown in FIG. 4. As can be seen, Ser221, His64 and Asp32 are positioned to facilitate nucleophilic attach by the serine hydroxylate on the carbonyl of the scissile peptide bond. Several hydrogen bonds may also help to stabilize the transition state complex for the tetrahedral substrate intermediate. One hydrogen bond is between aspartate and the positively charged histidine, ND1. Kossiakoff, A. A., et al. (1981) Biochem. 20, 6462-6474. A second hydrogen bond forms between the scissile amide nitrogen of the substrate and the (NE2) proton on the histidine. A third set of hydrogen bonds forms between the enzyme and the oxyanion that is produced from the carbonyl oxygen of the substrate. This latter set of hydrogen bonds is formed differently by the mammalian serine proteases and substilisin. A fourth hydrogen bond appears to exist between the amide nitrogen of the peptide bond between P-1 and P-2 and the carbonyl oxygen of Ser125. Specifically, x-ray crystallographic studies of chymotrypsin (Henderson, R. (1970) J. Mol. Biol. 54, 341) indicate that two hydrogen bonds form between the substrate oxyanion and two main-chain amide protons from the enzyme (Gly193 and the catalytic Ser195). Crystallographic studies of subtilisin (Robertus, et al. (1972) Biochem. 11, 4293-4303; Matthews, et al. (1975) J. Biol. Chem. 250, 7120-7126; Poulos, et al. (1976) J. Biol. Chem. 250, 1097-1103) show that two hydrogen bonds are also formed with the oxyanion; one hydrogen bond donor is from the catalytic serine-221 main-chain amide while the other is from one of the NE2 protons of the asparagine-155 side chain. See FIG. 4.
Asn155 was substituted with Ala, Asp, His, Glu and Thr. These substitutions were made to investigate the the stabilization of the charged tetrahedral intermediate of the transition state complex by the potential hydrogen bond between the side chain of Asn155 and the oxyanion of the intermediate. These particular substitutions caused large decreases in substrate turnover, kcat (200 to 4,000 fold), marginal decreases in substrate binding Km (up to 7 fold), and a loss in transition state stabilization energy of 2.2 to 4.7 kcal/mol. The retention of Km and the drop in kcat will make these mutant enzymes useful as binding proteins for specific peptide sequences, the nature of which will be determined by the specificity of the precursor protease.
Various other amino acid residues have been identified which affect alkaline stability. In some cases, mutants having altered alkaline stability also have altered thermal stability.
In B. amyloliquefaciens subtilisin residues Asp36, Ile107, Lys170, Ser204 and Lys213 have been identified as residues which upon substitution with a different amino acid alter the alkaline stability of the mutated enzyme as compared to the precursor enzyme. The substitution of Asp36 with Ala and the substitution of Lys170 with Glu each resulted in a mutant enzyme having a lower alkaline stability as compared to the wild type subtilisin. When Ile107 was substituted with Val, Ser204 substituted with Cys, Arg or Leu or Lys213 substituted with Arg, the mutant subtilisin had a greater alkaline stability as compared to the wild type subtilisin. However, the mutant Ser204P demonstrated a decrease in alkaline stability.
In addition, other residues, previously identified as being associated with the modification of other properties of subtilisin, also affect alkaline stability. These residues include Ser24, Met50, Glu156, Gly166, Gly169 and Tyr217. Specifically the following particular substitutions result in an increased alkaline stability: Ser24C, Met50F, Gly156Q or S, Gly166A, H, K, N or Q, Gly169S or A, and Tyr 217F, K, R or L. The mutant Met50V, on the other hand, results in a decrease in the alkaline stability of the mutant subtilisin as compared to wild type subtilisin.
Other residues involved in alkaline stability based on the alkaline stability screen include the mutants of Table I for residues Asp197 and Met222.
Various other residues have been identified as being involved in thermal stability as determined by the thermal stability screen herein. These residues include the above identified residues which effect alkaline stability and Met199 and Tyr21. These latter two residues are also believed to be important for alkaline stability. Mutants at these residues include I199 and F21.
The amino acid sequence of B. amyloliquefaciens subtilisin has also been modified by substituting two or more amino acids of the wild-type sequence. Six categories of multiply substituted mutant subtilisin have been identified. The first two categories comprise thermally and oxidatively stable mutants. The next three other categories comprise mutants which combine the useful properties of any of several single mutations of B. amyloliquefaciens subtilisin. The last category comprises mutants which have modified alkaline and/or thermal stability.
The first category is double mutants in which two cysteine residues have been substituted at various amino acid residue positions within the subtilisin BPN' molecule. Formation of disulfide bridges between the two substituted cystein residues results in mutant subtilisins with altered thermal stability and catalytic activity. These mutants include A21/C22/C87 and C24/C87 which will be described in more detail in Example 11.
The second category of multiple subtilisin mutants comprises mutants which are stable in the presence of various oxidizing agents such as hydrogen peroxide or peracids. Example 1 and 2 describe these mutants which include F50/I124/Q222, F50/I124, F50/Q222, F50/L124/Q222, I124/Q222 and L124/Q222.
The third category of multiple subtilisin mutants comprises mutants with substitutions at positions 222 combined with various substitutions at positions 166 or 169. These mutants, for example, combine the property of oxidative stability of the A222 mutation with the altered substrate specificity of the various 166 or 169 substitutions. Such multiple mutants include A166/A222, A166/C222, F166/C222, K166/A222, K166/C222, V166/A222 and V166/C222. The K166/A222 mutant subtilisin, for example, has a kcat/Km ratio which is approximately two times greater than that of the single A222 mutant subtilisin when compared using a substrate with phenylalanine as the P-1 amino acid. This category of multiple mutant is described in more detail in Example 12.
The fourth category of multiple mutants combines substitutions at position 156 (Glu to Q or S) with the substitution of Lys at position 166. Either of these single mutations improve enzyme performance upon substrates with glutamate as the P-1 amino acid. When these single mutations are combined, the resulting multiple enzyme mutants perform better than either precursor. See Example 9.
The fifth category of multiple mutants contain the substitution of up to four amino acids of the B. amyloliquefaciens subtilisin sequence. These mutants have specific properties which are virtually identicle to the properties of the subtilisin from B. licheniformis. The subtilisin from B. licheniformis differs from B. amyloliquefaciens subtilisin at 87 out of 275 amino acids. The multiple mutant F50/S156/A169/L217 was found to have similar substrate specificity and kinetics to the licheniformis enzyme. (See Example 13.) However, this is probably due to only three of the mutations (S156, A169 and L217) which are present in the substrate binding region of the enzyme. It is quite surprising that, by making only three changes out of the 87 different amino acids between the sequence of the two enzymes, the B. amyloliquifaciens enzyme was converted into an enzyme with properties similar to B. licheniformis enzyme. Other enzymes in this series include F50/Q156/N166L217 and F50/S156/L217.
The sixth category of multiple mutants includes the combination of substitutions at position 107 (Ile to V) with the substitution of Lys at position 213 with Arg, and the combination of substitutions of position 204 (preferably Ser to C or L but also to all other amino acids) with the substitution of Lys at position 213 with R. Other multiple mutants which have altered alkaline stability include Q156/K166, Q156/N166, S156/K166, S156/N166 (previously identified as having altered substrate specificity), and F50/S156/A169/L217 (previously identified as a mutant of B. amyloliquifaciens subtilisin having properties similar to subtilisin from B. licheniformis). The mutant F50/V107/R213 was constructed based on the observed increase in alkaline stability for the single mutants F50, V107 and R213. It was determined that the V107/R213 mutant had an increase alkaline stability as compared to the wild type subtilisin. In this particular mutant, the increased alkaline stability was the result of the cumulative stability of each of the individual mutations. Similarly, the mutant F50/V107/R213 has an even greater alkaline stability as compared to the V107/R213 mutant indicating that the increase in the alkaline stability due to the F50 mutation was also cumulative.
Table IV summarizes the multiple mutants which have been made including those not mentioned above.
In addition, based in part on the above results, substitution at the following residues in subtilisin is expected to produce a multiple mutant having increased thermal and alkaline stability: Ser24, Met50, Ile107, Glu156, Gly166, Gly169, Ser204, Lys213, Gly215, and Tyr217.
TABLE IV______________________________________ Triple; QuadrupleDouble Mutants or Other Multiple______________________________________C22/C87 F50/I124/Q222C24/C87 F50/L124/Q222V45/V48 PSO/L124/A222C49/C94 A21/C22/C87C49/C95 P50/S156/N166/L217C50/C95 F50/Q156/N166/L217C50/C110 P50/S156/A169/L217F50/I124 P50/5156/L217F50/Q222 P50/Q156/K166/L217I124/Q222 P50/S156/X166/L217Q156/D166 P50/Q156/K166/K217Q156/K166 F50/S156/K166/K217Q156/N166 P50/V107/R213S156/D166 �S153/S156/A158/G159/S160/.DELTA.161-S156/K166 164/I165/S166/A169/R170!S156/N166 L204/R213S156/A169 R213/204A, E, Q, D, N, G, K,A166/A222 V, R, T, P, I, M, F, Y, WA166/C222 or HF166/A222 V107/R213F166/C222X166/A222K166/C222V166/A222V166/C222A169/A222A169/A222A169/C222A21/C22______________________________________
In addition to the above identified amino acid residues, other amino acid residues of subtilisin are also considered to be important with regard to substrate specificity. These are the aforementioned residues which have yet to be mutated. Mutation of each of these residues is expected to produce changes in the substrate specificity of subtilisin. Moreover, multiple mutations among these residues and among the previously identified residues are also expected to produce subtilisin mutants having novel substrate specificity.
Particularly important residues are His67, Ile107, Leu126 and Leu135. Mutation of His67 should alter the S-1' subsite, thereby altering the specificity of the mutant for the P-1' substrate residue. Changes at this position could also affect the pH activity profile of the mutant. These residue was identified based on the inventor's substrate modeling from product inhibitor complexes.
Ile107 is involved in P-4 binding. Mutation at this position thus should alter specificity for the P-4 substrate residue. Ile107 was also identified by molecular modeling from product inhibitor complexes.
The S-2 binding site includes the Leu126 residue. Modification at this position should therefore affect P-2 specificity. Moreover, this residue is believed to be important to convert subtilisin to an amino peptidase. The pH activity profile should also be modified by appropriate substitution. These residues were identified from inspection of the refined model, the three dimensional structure from modeling studies. A longer side chain is expected to preclude binding of any side chain at the S-2 subsite. Therefore, binding would be restricted to subsites S-1, S-1', S-2', S-3' and cleavage would be forced to occur after the amino terminal peptide.
Leu135 is the S-4 subsite and if mutated should alter substrate specificity for P-4 if mutated. This residue was identified by inspection of the three-dimensional structure and modeling based on the product inhibitor complex of F222.
In addition to these sites, specific amino acid residues within the segments 97-103, 126-129 and 215-215 are also believed to be important to substrate binding.
Segments 97-103 and 126-129 form an antiparallel beta sheet with the main chain of substrate residues P-4 through P-2. Mutating residues in these regions should affect the substrate orientation through main chain (enzyme)--main chain (substrate) interactions, since the main chain of these substrate residues do not interact with these particular residues within the S-4 through S-2 subsites.
Within the segment 97-103, Gly97 and Asp99 may be mutated to alter the position of residues 101-103 within the segment. Changes at these sites must be compatible, however. In B. amyloliquifaciens subtilisin Asp99 stabilizes a turn in the main chain tertiary folding that affects the direction of residues 101-103. B. licheniformis subtilisin Asp97, functions in an analogous manner.
In addition to Gly97 and Asp99, Ser101 interacts with Asp99 in B. amyliquefaciens subtilisin to stabilize the same main chain turn. Alterations at this residue should alter the 101-103 main chain direction. Mutations at Glu103 are also expected to affect the 101-103 main chain direction.
The side chain of Gly102 interact with the substrate P-3 amino acid. Side chains of substituted amino acids thus are expected to significantly affect specificity for the P-3 substrate amino acids.
All the amino acids within the 127-129 segment are considered important to substrate specificity. Gly127 is positioned such that its side chain interacts with the S-1 and S-3 subsites. Altering this residue thus should alter the specificity for P-1 and P-3 residues of the substrate.
The side chain of Gly128 comprises a part of both the S-2 and S-4 subsites. Altered specificity for P-2 and P-4 therefore would be expected upon mutation. Moreover, such mutation may convert subtilisin into an amino peptidase for the same reasons substitutions of Leu126 would be expected to produce that result.
The Pro129 residue is likely to restrict the conformational freedom of the sequence 126-133, residues which may play a major role in determining P-1 specificity. Replacing Pro may introduce more flexibility thereby broadening the range of binding capabilities of such mutants.
The side chain of Lys213 is located within the S-3 subsite. All of the amino acids within the 213-215 segment are also considered to be important to substrate specificity. Accordingly, altered P-3 substrate specificity is expected upon mutation of this residue.
The Tyr214 residue does not interact with substrate but is positioned such that it could affect the conformation of the hair pin loop 204-217.
Finally, mutation of the Gly215 residue should affect the S-3' subsite, and thereby alter P-3' specificity.
In addition to the above substitutions of amino acids, the insertion or deletion of one or more amino acids within the external loop comprising residues 152-172 may also affect specificity. This is because these residues may play a role in the "secondary contact region" described in the model of streptomyces subtilisin inhibitor complexed with subtilisin. Hirono, et al. (1984) J. Mol. Biol. 178, 389-413. Thermitase K has a deletion in this region, which eliminates several of these "secondary contact" residues. In particular, deletion of residues 161 through 164 is expected to produce a mutant subtilisin having modified substrate specificity. In addition, a rearrangement in this area induced by the deletion should alter the position of many residues involved in substrate binding, predominantly at P-1. This, in turn, should affect overall activity against proteinaceous substrates.
The effect of deletion of residues 161 through 164 has been shown by comparing the activity of the wild type (WT) enzyme with a mutant enzyme containing this deletion as well as multiple substitutions (i.e., S153/S156/A158/G159/S160/.DELTA.161-164/I165/S166/A169/R170). This produced the following results:
TABLE V______________________________________ kcat Km kcat/Km______________________________________WT 50 1.4e-4 3.6e5Deletion 8 5.0e-6 1.6e6mutant______________________________________
The WT has a kcat 6 times greater than the deletion mutant but substrate binding is 28 fold tighter by the deletion mutant. The overall efficiency of the deletion mutant is thus 4.4 times higher than the WT enzyme.
All of these above identified residues which have yet to be substituted, deleted or inserted into are presented in Table VI.
TABLE VI______________________________________Substitution/Insertion/DeletionResidues______________________________________ His67 Ala152 Leu126 Ala153 Leu135 Gly154 Gly97 Asn155 Asp99 Gly156 Ser101 Gly157 Gly102 Gly160 Glu103 Thr158 Leu126 Ser159 Gly127 Ser161 Gly128 Ser162 Pro129 Ser163 Tyr214 Thr164 Gly215 Val165 Gly166 Tyr167 Pro168 Gly169 Lys170 Tyr171 Pro172______________________________________
The mutants herein may be obtained as salts. It is clear that the ionization state of a protein will be dependent on the pH of the surrounding medium, if it is in solution, or of the solution from which it is prepared, if it is in solid form. Acidic proteins are commonly prepared as, for example, the ammonium, sodium, or potassium salts; basic proteins as the chlorides, sulfates, or phosphates. Accordingly, the present application includes both electrically neutral and salt forms of the designated carbonyl hydrolases, and the term carbonyl hydrolase referes to the organic structural backbone regardless of ionization state.
The carbonyl hydrolase mutants are particularly useful in the food processing and cleaning arts. The carbonyl hydrolases, including mutants, are produced by fermentation as described herein and recovered by suitable techniques. See for example K. Anstrup, 1974, Industrial Aspects of Biochemistry, ed. B. Spencer pp. 23-46. They are formulated with detergents or other surfactants in accord with methods known per se for use in industrial processes, especially laundry. In the latter case the enzymes are combined with detergents, builders, bleach and/or flourescent whitening agents are is known in the art for proteolytic enzymes. Suitable detergents include linear alkyl benzene sulfonates, alkyl ethoxylated sulfate, sulfated linear alcohol or ethoxylated linear alcohol. The compositions may be formulated in granular or liquid form. See for example U.S. Pat. Nos. 3,623,957; 4,404,128; 4,381,247; 4,404,115; 4,318,818; 4,261,868; 4,242,219; 4,142,999; 4,111,855; 4,011,169; 4,090,973; 3,985,686; 3,790,482; 3,749,671; 3,560,392; 3,558,498; and 3,557,002.
The following disclosure is intended to serve as a representation of embodiments herein, and should not be construed as limiting the scope of this application. These specific examples disclose the construction of certain of the above identified mutants. The construction of the other mutants, however, is apparent from the disclosure herein and that presented in EPO Publication No. 0130756.
Glossary of Experimental Manipulations
In order to simplify the Examples certain frequently occurring methods will be referenced by shorthand phrases.
Plasmids are designated by a small p proceeded and/or followed by capital letters and/or numbers. The starting plasmids herein are commercially available, are available on an unrestricted basis, or can be constructed from such available plasmids in accord with published procedures.
"Klenow treatment" refers to the process of filling a recessed 3' end of double stranded DNA with deoxyribonucleotides complementary to the nucleotides making up the protruding 5' end of the DNA strand or exonucleolytic removal of a protruding 3' end of a double stranded DNA fragment. This process is usually used to fill in a recessed end resulting from a restriction enzyme cleavage of DNA. This creates a blunt or flush end, as may be required for further ligations. Treatment with Klenow is accomplished by reacting (generally for 15 minutes at 15.degree. C.) the appropriate complementary deoxyribonucleotides with the DNA to be filled in under the catalytic activity (usually 10 units) of the Klenow fragment of E. coli DNA polymerase I ("Klenow"). Klenow and the other reagents needed are commercially available. The procedure has been published extensively. See for example T. Naniatis, et al., 1982, Molecular Cloning, pp. 107-108.
"Digestion" of DNA refers to catalytic cleavage of the DNA with an enzyme that acts only at certain locations in the DNA. Such enzymes are called restriction enzymes, and the sites for which each is specific is called a restriction site. "Partial" digestion refers to incomplete digestion by restriction enzyme, i.e., conditions are chosen that result in cleavage of some but not all of the sites for a given restriction endonuclease in a DNA substrate. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements as established by the enzyme suppliers were used. Restriction enzymes commonly are designated by abbreviations composed of a capital letter followed by other letters and then, generally, a number representing the microorganism from which each restriction enzyme originally was obtained. In general, about 1 .mu.g of plasmid or DNA gragment is used with about 1 unit of enzyme in about 20 .mu.l of buffer solution. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37.degree. C. are ordinarily used, but may vary in accordance with the supplier's instructions. After incubation, protein is removed by extraction with phenol and chloroform, and the digested nucleic acid is recovered from the aqueous fraction by precipitation with ethanol. Digestion with a restriction enzyme infrequently is followed with bacterial alkaline phosphatase hydrolysis of the terminal 5' phosphates to prevent the two restriction cleaved ends of a DNA fragment from "circularizing" or forming a closed loop that would impede insertion of another DNA fragment at the restriction site. Unless otherwise stated, digestion of plasmids is not followed by 5' terminal dephosphorylation. Procedures and reagents for dephosphorylation are conventional (T. Maniatis, et al., Id., pp. 133-134).
"Recovery" or "isolation" of a given fragment of DNA from a restriction digest means separation of the digest on 6 percent polyacrylamide gel electrophoresis, identification of the fragment of interest by molecular weight (using DNA fragments of known molecular weight as markers), removal of the gel section containing the desired fragment, and separation of the gel from DNA. This procedure is known generally. For example, see R. Lawn, et al., 1981, "Nucleic Acids Res." 9:6103-6114, and D. Goeddel, et al., 1980, "Nucleic Acids Res." 8:4057.
"Southern Analysis" is a method by which the presence of DNA sequences in a digest or DNA-containing composition is confirmed by hybridization to a known, labelled oligonucleotide or DNA fragment. For the purposes herein, Southern analysis shall mean separation of digests on 1 percent agarose and depurination as described by G. Wahl, et al., 1979, "Proc. Nat. Acad. Sci. U.S.A." 76:3683-3687, transfer to nitrocellulose by the method of E. Southern, 1975, "J. Mol. Biol." 98:503-517, and hybridization as described by T. Maniatis, et al., 1978, "cell" 15:687-701.
"Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or chromosomal integrant. Unless otherwise stated, the method used herein for transformation of E. coli is the CaCl.sub.2 method of Mandel, et al., 1970, "J. Mol Biol." 53:154, and for Bacillus, the method of Anagnostopolous, et al., 1961, "J. Bact." 81:741-746.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (T. Maniatis, et al., Id., p. 146). Unless otherwise stated, ligation was accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 .mu.g of approximately equimolar amounts of the DNA fragments to be ligated. Plasmids from the transformants were prepared, analyzed by restriction mapping and/or sequenced by the method of Messing, et al., 1981, "Nucleic Acids Res.", 9:309.
"Preparation" of DNA from transformants means isolating plasmid DNA from microbial culture. Unless otherwise states, the alkaline/SDS method of Maniatis, et al., Id., p. 90, was used.
"Oligonucleotides" are short length single or double stranded polydeoxynucleotides which were chemically synthesized by the method of Crea, et al., 1980, "Nucleic Acids Res." 8:2331-2348 (except that mesitylene nitrotriazole was used as a condensing agent) and then purified on polyacrylamide gels.
All mutant plasmids were transformed (Anagnostopoulos, C., et al., (1961) J. Bacteriol. 81, 741-746) into BG2036 (Yang, M. (1984) J. Bacteriol. 160, 15-21) to express mutant subtilisins as described (Estell, D. A., et al. (1985) J. Biol. Chem. 260, 6518-6521).
All literature citations are expressly incorporated by reference.
The following is presented by way of example and is not to be construed as a limitation to the scope of the invention.
EXAMPLE 1
Identification of Peracid Oxidizable Residues of Subtilisin Q222 and L222
The activity of naturally-occurring subtilisin is rapidly reduced up to 85% by a series of oxidants. One of the most characterized modification is the conversion of Met222 to met-sulfoxide in the presence of hydrogen peroxide. Stauffer, C. E., et al. (1969) J. Biol. Chem. 244, 5333-5338. This defect has been eliminated by substituting a variety of non-oxidizable amino acids into this position by site-directed mutagenesis of the B. amyloliquifaciens enzyme, thereby confering enhanced stability to hydrogen peroxide. See EPO Publication No. 0130756 and Estell, D. A., et al. (1985) J. Biol. Chem. 260, 6518, However, as shown in FIGS. 6A and 6B, organic peracid oxidants can still inactivate the mutant enzymes Met222L and Met222Q (L222 and Q222). This example describes the identification of peracid oxidizable sites in 222 substituted mutant subtilisins.
The first step was to determine the type of amino acid involved in peracid oxidation. Except under drastic conditions (Means, G. E., et al. (1971) Chemical Modifications of Proteins, Holden-Day S. F., Calif. pp. 160-162), organic peracids modify only methionine and tryptophan in subtilisin. In order to rule out tryptophan as a candidate, difference spectra of the enzyme over the 250 nm to 350 nm range were determined during an inactivation titration employing the reagent, diperdodecanoic acid (DPDA) as the oxidant. Despite quantitative inactivation of the enzyme, no change in absorbance over this wavelength range was noted as shown in FIGS. 7A and 7B. Oxidation of tryptophan would be expected to result in marked changes over this region. Fontana, A., et al. (1980) Methods in Peptide and Protein Sequence Analysis (C. Birr ed.) Elsevier, N.Y., P. 309. The absence of tryptophan modification implied oxidation of one or more of the remaining methionines of B. amyloliquefaciens subtilisin. See FIGS. 1A and 1B.
To confirm this result the recombinant subtilisin Met222F was cleaved with cyanogen bromide (CNBr) both before and after oxidation by DPDA. The peptides produced by CNBr cleavage were analyzed on high resolution SDS-pyridine peptide gels (SPG).
Subtilisin Met222F (F222) was oxidized in the following manner. Purified F222 was resuspended in 0.1M sodium borate pH 9.5 at 10 mg/ml and was added to a final concentration of 26 diperdodecanoic acid (DPDA) at 26 mg/ml was added to produce an effective active oxygen concentration of 30 ppm. The sample was incubated for at least 30 minutes at room temperature and then quenched with 0.1 volume of 1M Tris pH 8.6 buffer to produce a final concentration of 0.1M Tris pH 8.6). 3 mM phenylmethylsulfonyl fluoride (PMSF) was added and 2.5 ml of the sample was applied to a Pharmacia PD10 column equilibrated in 10 mM sodium phosphate pH 6.2, 1 mM PMSF. 3.5 ml of 10 mM sodium phosphate pH6.2, 1 mM PMSF was applied and the eluant collected. The sample was assumed to be at 7 mg/ml based on the observation that a 2.5 ml sample of untreated F222 at 10 mg/ml in phosphate buffer when treated with PMSF and desalted in the same manner on a Pharmacia PD10 column produced a concentration of about 7 mg/ml.
F222 DPDA oxidized F222 were precipitated with 9 volumes of acetone at -20.degree. C. For 100 ug of protein, the acetone mixture was vortexed and centrifuged in a Fischer tabletop centrifuge for 10 minutes. The pellets were washed once with 0.5 ml acetone and then dried. The sample was carefully resuspended at 10 mg/ml in 8M urea in 88% formic acid and allowed to sit for 5 minutes. An equal volume of 200 mg/ml CNBr in 88% formic acid was added (5 mg/ml protein) and the samples incubated for 2 hours at room temperature in the dark. Prior to gel electrophoresis, the samples were lyophilized for 3-4 hours in a Spin Vac (Savant Instruments) and the pellets were resuspended at 2-5 mg/ml in sample buffer (1% pyridine, 5% NaDodSo.sub.4,5% glycerol and bromophenol blue) and disassociated at 95.degree. C. for 3 minutes.
The samples were electrophoresed on discontinuous polyacrylamide gels as described by Kyte and Rodriquez (Kyte, J., et al. (1983) Anal. Bioch. 133, 515-522). The gels were stained using the Pharmacia silver staining technique (Sammons, D. W., et al. (1981) Electrophoresis 2 135-141).
The results of this experiment are shown in FIG. 8. As can be seen, F222 treated with CNBr only gives nine resolved bands on SPG. However, when F222 is also treated with DPDA prior to cleavage, bands X, 7 and 9 disappear whereas bands 5 and 6 are greatly increased in intensity.
In order to determine which of the methionines were effected, each of the CNBr peptides was isolated by reversed phase HPLC and further characterized. The buffer system in both Solvent A (aqueous) and Solvent B (organic) for all HPLC separations was 0.05% TEA-TFA. Solutions were prepared by adding equal volumes of neat triethylamine and neat trifloroacetic acid to the solvent. Programs for the gradients were generated on a Waters Systems Controller. In all cases unless noted, solvent A consisted of 0.05% TEA-TFA in H2O, solvent B was 0.05% TEA-TFA in 1-propanol, and the flow rate was 0.5 ml/minute.
For HPLC analysis, two injections of 1 mg enzyme digest were used. Three samples were acetone precipitated, washed and dried as above. The dried 1 mg samples were resuspended at 10 mg/ml in 8M urea, 88% formic acid; an equal volume of 200 mg/ml CNBr in 88% formic acid was added (5 mg/ml protein). After incubation for 2 hours in the dark at room temperature, the samples were desalted on a 0.8 cm.times.7 cm column of Tris Acryl GF05 coarse resin (IBF, Paris, France) equilibrated with 40% solvent B, 60% solvent A. 200 ul samples were applied to a flow rate of 1 ml a minute and 1.0-1.2 ml collected by monitoring the absorbance at 280 nm. Prior to injection on the HPLC, each desalted sample was diluted with 3 volumes of solvent A. The samples were injected at 1.0 ml/min (2 minutes) and the flow then adjusted to 0.5 ml/min (100% A). After 2 minutes, a linear gradient to 60% B at 1.0% B/min was initiated. From each 1 mg run, the pooled peaks were samples (50 ul) and analyzed by gel electrophoresis as described above.
Each polypeptide isolated by reversed phase HPLC was further analyzed for homogeneity by SPG. The position of each peptide on the known gene sequence (Wells, J. A., et al. (1983) Nucleic Acids Res. 11 7911-7924) was obtained through a combination of amino acid compositional analysis and, where needed, amino terminal sequencing.
Prior to such analysis the following peptides were to rechromatographed.
1. CNBr peptides from F222 not treated with DPDA:
Peptide 5 was subjected to two additional reversed phase separations. The 10 cm C4 column was equilibrated to 80% A/ 20% B and the pooled sample applied and washed for 2 minutes. Next an 0.5% ml B/min gradient was initiated. Fractions from this separation were again rerun, this time on the 25 cm C4 column, and employing 0.05% TEA-TFA in acetonitrile/1-propanol (1:1) for solvent B. The gradient was identical to the one just described.
Peptide "X" was subjected to one additional separation after the initial chromatography. The sample was applied and washed for 2 minutes at 0.5 ml/min (100% A), and a 0.5% ml B/min gradient was initiated.
Peptides 7 and 9 were rechromatographed in a similar manner to the first rerun of peptide 5.
Peptide 8 was purified to homogeneity after the initial separation.
2. CNBr Peptides from DPDA Oxidized F222:
Peptides 5 and 6 from a CNBr digest of the oxidized F222 were purified in the same manner as peptide 5 from the untreated enzyme.
Amino acid compositional analysis was obtained as follows. Samples (.about.nM each amino acid) were dried, hydrolyzed in vacuo with 100 ul 6N HCl at 106.degree. C. for 24 hours and then dried in a Speed Vac. The samples were analyzed on a Beckmann 6300 AA analyzer employing ninhydrin detection.
Amino terminal sequence data was obtained as previously described (Rodriquez, H., et al. (1984) Anal. Biochem. 134, 538-547).
The results are shown in Table VII and FIG. 9.
TABLE VII______________________________________Amino and COOH terminii of CNBr fragmentsTerminus and methodFragment amino, method COOH; method______________________________________x 1, sequence 50, composition9 51, sequence 119, composition7 125, sequence 199, composition8 200, seguence 275, composition5ox 1, sequence 119, composition6ox 120, composition 199, composition______________________________________
Peptides 5ox and 6ox refer to peptides 5 and 6 isolated from CNBr digests of the oxidized protein where their respective levels are enhanced.
From the data in Table VII and the comparison of SPG tracks for the oxidized and native protein digests in FIG. 8, it is apparent that (1) Met50 is oxidized leading to the loss of peptides X and 9 and the appearance of 5; and (2) Met124 is also oxidized leading to the loss of peptide 7 and the accumulation of peptide 6. Thus oxidation of B. amyloliquifaciens subtilisin with the peracid, diperdocecanoic acid leads to the specific oxidation of methionines 50 and 124.
EXAMPLE 2
Substitution at Met50 and Met124 in Subtilisin Met2220
The choice of amino acid for substitution at Met50 was based on the available sequence data for subtilisins from B. licheniformis (Smith, E. C., et al. (1968) J. Biol. Chem. 243, 2184-2191), B. DY (Nedkov, P., et al. (1983) Hoppe Sayler's Z. Physiol. Chem. 364 1537-1540), B. amylosacchariticus (Markland, F. S., et al. (1967) J. Biol. Chem. 242 5198-211) and B. subtilis (Stahl, M. L., et al. (1984) J. Bacteriol. 158, 411-418). In all cases, position 50 is a phenylalanine. See FIGS. 5A-1, 5A-2, 5B-1, 5B-2 and 5C. Therefore, Phe50 was chosen for construction.
At position 124, all known subtilisins possess a methionine. See FIGS. 5A-1, 5A-2, 5B-1, 5B-2, and 5C. Molecular modelling of the x-ray derived protein structure was therefore required to determine the most probable candidates for substitution. From all 19 candidates, isoleucine and leucine were chosen as the best residues to employ. In order to test whether or not modification at one site but not both was sufficient to increase oxidative stability, all possible combinations were built on the Q222 backbond (F50/Q222, I124/Q222, F50/I124/Q222).
A. Construction of Mutations Between Codons 45 and 50
All manipulations for cassette mutagenesis were carried out on pS4.5 using methods disclosed in EPO Publication No. 0130756 and Wells, J. A., et al, (1985) Gene 34, 315-323. The p.DELTA.50 in FIG. 10, line 4, mutations was produced using the mutagenesis primer shown in FIG. 10, line 6, and employed an approach designated as restriction-purification which is described below. Wells, J. A., et al. (1986) Phil. Trans. R. Soc. Lond. A (in press). Briefly, a M13 template containing the subtilisin gene, M13mp11-SIBT was used for heteroduplex synthesis (Adelman, et al (1983), DNA 2, 183-193). Following transfection of JM101 (ATCC 33876), the 1.5 kb EcoRI-BamHI fragment containing the subtilisin gene was subcloned from M13mp11 SIBT rf into a recipient vector fragment of pBS42 the construction of which is described in EPO Publication No. 0130756. To enrich for the mutant sequence (p.DELTA.50, line 4), the resulting plasmid pool was digested with KpnI, and linear molecules were purified by polyacrylamide gel electrophoresis. Linear molecules were ligated back to a circular form, and transformed into E. coli MM294 cells (ATCC 31446). Isolated plasmids were screened by restriction analysis for the KpnI site. KpnI.sup.+ plasmids were sequenced and confirmed the p.DELTA.50 sequence. Asterisks in FIG. 11 indicate the bases that are mutated from the wid type sequence (line 4). p.DELTA.50 (line 4) was cut with StuI and EcoRI and the 0.5 Kb fragment containing the 5' half of the subtilisin gene was purified (fragment 1). p.DELTA.50 (line 4) was digested with KpnI and EcoRI and the 4.0 Kb fragment containing the 3' half of the subtilisin gene and vector sequences was purified (fragment 2). Fragments 1 and 2 (line 5), and duplex DNA cassettes coding for mutations desired (shaded sequence, line 6) were mixed in a molar ratio of 1:1:10, respectively. For the particular construction of this example the DNA cassette contained the triplet TTT for codon 50 which encodes Phe. This plasmid was designated pF-50. The mutant subtilisin was designated F-50.
B. Construction of Mutation Between Codons 122 and 127
The procedure of Example 2A was followed in substantial detail except that the mutagenesis primer of FIG. 11, line 7 was used and restriction-purification for the EcoRV site in p.DELTA.124 was used. In addition, the DNA cassette (shaded sequence, FIG. 11, line 6) contained the triplet ATT for codon 124 which encodes Ile and CTT for Leu. Those plasmids which contained the substitution of Ile for Met124 were designeated pI124. The mutant subtilisin was designated I124.
C. Construction of Various F50/I124/Q222 Multiple Mutants
The triple mutant, F50/I124/Q222, was constructed from a three-way ligation in which each fragment contained one of the three mutations. The single mutant Q222 (pQ222) was prepared by cassette mutagenesis as described in EPO Publication No. 0130756. The F50 mutation was contained on a 2.2 kb AvaII to PvuII fragment from pF50; the I124 mutation was contained on a 260 bp PvuII to AvaII fragment from pI124; and the Q222 mutation was contained on 2.7 kb AvaII to AvaII fragment from pQ222. The three fragments were ligated together and transformed into E. coli MM294 cells. Restriction analysis of plasmids from isolated transformants confirmed the construction. To analyze the final construction it was convenient that the AvaII site at position 798 in the wild-type subtilisin gene was eliminated by the I124 construction.
The F50/Q222 and I124/Q222 mutants were constructed in a similar manner except that the appropriate fragment from pS4.5 was used for the final construction.
D. Oxidative Stability of Q222 Mutants
The above mutants were analyzed for stability to peracid oxidation. As shown in FIG. 12, upon incubation with diperdodecanoic acid (protein 2 mg/mL, oxidant 75 ppm�0!), both the I124/Q222 and the F50/I124/Q222 are completely stable whereas the F50/Q222 and the Q222 are inactivated. This indicates that conversion of M124 to I124 in subtilisin Q222 is sufficient to confer resistance to organic peracid oxidants.
EXAMPLE 3
Subtilisin Mutants Having Altered Substrate Specificity-Hydrophobic Substitutions at Residues 166
Subtilisin contains an extended binding cleft which is hydrophobic in character. A conserved glycine at residue 166 was replaced with twelve non-ionic amino acids which can project their side-chains into the S-1 subsite. These mutants were constructed to determine the effect of changes in size and hydrophobicity on the binding of various substrates.
A. Kinetics for Hydrolysis of Substrates Having Altered P-1 Amino Acids by Subtilisin BPN' from B. amyloliquefaciens
Wild-type subtilisin was purified from B. subtilis culture supernatants expressing the B. amyloliquefaciens subtilisin gene (Wells, J. A., et al. (1983) Nucleic Acids Res. 11, 7911-7925) as previously described (Estell, D. A., et al. (1985) J. Biol. Chem. 260, 6518-6521). Details of the synthesis of tetrapeptide substrates having the form succinyl-L-AlaL-AlaL-ProL-�X!-p-nitroanilide (where X is the P1 amino acid) are described by DelMar, E. G., et al. (1979) Anal. Biochem. 99, 316-320. Kinetic parameters, Xm(M) and kcat(s.sup.-1) were measured using a modified progress curve analysis (Estell, D. A., et al. (1985) J. Biol. Chem. 260, 6518-6521). Briefly, plots of rate versus product concentration were fit to the differential form of the rate equation using a non-linear regression algorithm. Errors in kcat and Km for all values reported are less than five percent. The various substrates in Table VIII are ranged in order of decreasing hydrophobicity. Nozaki, Y. (1971), J. Biol. Chem. 246, 2211-2217; Tanford C. (1978) Science 200, 1012).
TABLE VIII______________________________________P1 substrate kcat/KmAmino Acid kcat(S.sup.-1) 1/Km(M.sup.-1) (S.sup.-1 M-1)______________________________________Phe 50 7,100 360,000Tyr 28 40,000 1,100,000Leu 24 3,100 75,000Met 13 9,400 120,000His 7.9 1,600 13,000Ala 1.9 5,500 11,000Gly 0.003 8,300 21Gln 3.2 2,200 7,100Ser 2.8 1,500 4,200Glu 0.54 32 16______________________________________
The ratio of kcat/Km (also referred to as catalytic efficienty) is the apparent second order rate constant for the conversion of free enzyme plus substrate (E+S) to enzyme plus products (E+P) (Jencks, W. P., Catalysis in Chemistry and Enzymology (McGraw-Hill, 1969) pp. 321-436; Fersht, A., Enzyme Structure and Mechanism (Freeman, San Francisco, 1977) pp. 226-287). The log (kcat/Km) is proportional to transition state binding energy, .DELTA.G.sup..noteq..sub.T. A plot of the log kcat/Km versus the hydrophobicity of the P1 side-chain (FIG. 14) shows a strong correlation (r=0.98), with the exception of the glycine substrate which shows evidence for non-productive binding. These data show that relative differences between transition-state binding energies can be accounted for by differences in P-1 side-chain hydrophobicity. When the transition-state binding energies are calculated for these substrates and plotted versus their respective side-chain hydrophobicities, the line slops is 1.2 (not shown). A slope greater than unity, as is also the case for chymotrypsin (Fersht, A., Enzyme Structure and Mechanism (Freeman, San Francisco, 1977), pp. 226-287; Haper, J. W., et al. (1984) Biochemistry, 23, 2995-3002), suggests that the P1 binding cleft is more hydrophobic than ethanol or dioxane solvents that were used to empirically determine the hydrophobicity of amino acids (Nozaki, Y., et al. J. Biol. Chem. (1971) 246, 2211-2217; Tanford, C. (1978) Science 200, 1012).
For amide hydrolysis by subtilisin BPN', kcat can be interpreted as the acylation rate constant and Km as the dissociation constant, for the Michaelis complex (E.multidot.S), Ks. Gutfreund, H., et al (1956) Biochem. J. 63. 656. The fact that the log kcat, as well as log 1/Km, correlates with substrate hydrophobicity is consistent with proposals (Robertus, J. D., et al. (1972) Biochemistry 11, 2439-2449; Robertus, J. D., et al. (1972) Biochemistry 11, 4293-4229; Robertus, J. D., et al. (1972) Biochemistry 11, 4293-4303) that during the acylation step the P-1 side-chain moves deeper into the hydrophobic cleft as the substrate advances from the Michaelis complex (E.multidot.S) to the tetrahedral transition-state complex (E.multidot.S.sup..noteq.). However, these data can also be interpreted as the hydrophobicity of the P1 side-chain effecting the orientation, and thus the susceptibility of the scissile peptide bond to nucleophilic attack by the hydroxyl group of the catalytic Ser221.
The dependence of kcat/Km on P-1 side chain hydrophobicity suggested that the kcat/Km for hydrophobic substrates may be increased by increasing the hydrophobicity of the S-1 binding subsite. To test this hypothesis, hydrophobic amino acid substitutions of Gly166 were produced.
Since hydrophobicity of aliphatic side-chains is directly proportional to side-chain surface area (Rose, G. D., et al. (1985) Science 229, 834-838; Reynolds, J. A., et al. (1974) Proc. Natl. Acad. Sci. USA 71, 2825-2927), increasing the hydrophobicity in the S-1 subsite may also sterically hinder binding of larger substrates. Because of difficulties in predicting the relative importance of these two opposing effects, we elected to generate twelve non-charged mutations at position 166 to determine the resulting specificities against non-charged substrates of varied size and hydrophobicity.
B. Cassette Mutagenesis of the P1 Binding Cleft
The preparation of mutant subtilisims containing the substitution of the hydrophobic amino acids Ala, Val and Phe into residue 166 has been described in EPO Publication No. 0130756. The same method was used to produce the remaining hydrophobic mutants at residue 166. In applying this method, two unique and silent restriction sites were introduced in the subtilisin genes to closely flank the target codon 166. As can be seen in FIG. 13, the wild type sequence (line 1) was altered by site-directed mutagenesis in M13 using the indicated 37mer mutagenesis primer, to introduce a 13 bp delection (dashedline) and unique SacI and XmaI sites (underlined sequences) that closely flank codon 166. The subtilisin gene fragment was subcloned back into the E. coli--B. subtilis shuttle plasmid, pBS42, giving the plasmid p.DELTA.166 (FIG. 13, line 2). p.DELTA.166 was cut open with SacI and XmaI, and gapped linear molecules were purified (FIG. 13, line 2). p.DELTA.166 was cut open with SacI and XmaI, and gapped linear molecules were purified (FIG. 13, line 3). Pools of synthetic oligonucleotides containing the mutation of interest were annealed to give duplex DNA cassettes that were ligated into gapped p.DELTA.166 (underlined and overlined sequences in FIG. 13, line 4). This construction restored the coding sequence except over position 166(NNN; line 4). Mutant sequences were confirmed by dideoxy sequencing. Asterisks denote sequence changes from the wild type sequence. Plasmids containing each mutant B. amyloliquefaciens subtilisin gene were expressed at roughly equivalent levels in a protease deficient strain of B. subtilis, BG2036 as previously described. EPO Publication No. 0130756; Yang, M., et al. (1984) J. Bacteriol. 160, 15-21; Estell, D. A., et al (1985)J. Biol. Chem. 260, 6518-6521.
C. Narrowing Substrate Specificity by Steric Hindrance
To probe the change in substrate specificity caused by steric alterations in the S-1 subsite, position 166 mutants were kinetically analyzed versus P1 substrates of increasing size (i.e., Ala, Met, Phe and Tyr). Ratios of kcat/Km are presented in log form in FIGS. 15A and 15B to allow direct comparisons of transition-state binding energies between various enzyme-substrate pairs. According to transition state theory, the free enery difference between the free enzyme plus substrate (E+S) and the transition state complex E.multidot.S.sup..noteq.) can be calculated from equation (1),
.sup..DELTA. G.sub.T.sup..noteq. =-RT ln kcat/Km+RT ln kT/h(b 1)
in which kcat is the turnover number, Km is the Michaelis constant, R is the gas constant, T is the temperature, k is Boltzmann's constant, and h is Planck's constant. Specificity differences are expressed quantitatively as differences between transition state binding energies (i.e., .DELTA..DELTA.G.sub.t.sup..noteq.), and can be calculated from equation (2).
.sup..DELTA..DELTA. G.sub.T.sup..noteq. =-RT ln (kcat/Km).sub.A /(kcat/Km).sub.B (2)
A and B represent either two different substrates assayed against the same enzyme, or two mutant enzymes assayed against the same substrate.
As can be seen from FIG. 15A, as the size of the side-chain at position 166 increases the substrate preference shifts from large to small P-1 side-chains. Enlarging the side-chain at position 166 causes kcat/Km to decrease in proportion to the size of the P-1 substrate side-chain (e.g., from Gly166 (wild-type) through W166, the kcat/Km for the Tyr substrate is decreased most followed in order by the Phe, Met and Ala P-1 substrates).
Specific steric changes in the position 166 side-chain, such as he presence of a .beta.-hydroxyl group, .beta.- or .gamma.-aliphatic branching, cause large decreases in kcat/Km for larger P1 substrates. Introducing a .beta.-hydroxyl group in going from A166 (FIGS. 15A and 15B) to S166 (FIG. 15B), causes an 8 fold and 4 fold reduction in kcat/Km for Phe and Tyr substrates, respectively, while the values for Ala and Met substrates are unchanged. Producing a .beta.-branched structure in going from S166 to T166, results in a drop of 14 and 4 fold in kcat/Km for Phe and Tyr, respectively. These differences are slightly magnified for V166 which is slightly larger and isosteric with T166. Enlarging the .beta.-branched substituents from V166 to I166 causes a lowering of kcat/Km between two and six fold toward Met, Phe and Tyr substrates. Inserting a .gamma.-branched structure, by replacing M166 (FIG. 15A) with L166 (FIG. 15B), produces a 5 fold and 18 fold decrease in kcat/Km for Phe and Try substrates, respectively. Aliphatic .gamma.-branched appears to induce less steric hindrance toward the Phe P-1 substrate than .beta.-branching, as evidenced by the 100 fold decrease in kcat/Km for the Phe substrate in going from L166 to I166.
Reductions in kcat/Km resulting from increases in side chain size in the S-1 subsite, or specific structural features such as .beta.- and .gamma.-branching, are quantitatively illustrated in FIGS. 16A, 16B, 16C and 16D. The kcat/Km values for the position 166 mutants determined for the Ala, Met, Phe, and Tyr P-1 substrates (top panel through bottom panel, respectively), are plotted versus the position 166 side-chain volumes (Chothia, C. (1984) Ann. Rev. Biochem. 53, 537-672). Catalytic efficiency for the Ala substrate reaches a maximum for I166, and for the Met substrate reaches a maximum for I166, and for the Met substrate it reaches a maximum between V166 and L166. The Phe substrate shows a broad kcat/Km peak but is optimal with A166. Here, the .beta.-branched position 166 substitutions form a line that is parallel to, but roughly 50 fold lower in kcat/Km than side-chains of similar size �i.e., C166 versus T166, L166 versus I166!. The Tyr substrate is most efficiently utilized by wild type enzyme (Gly166), and there is a steady decrease as one proceeds to large position 166 side-chains. The .beta.-branched and .gamma.-branched substitutions form a parallel line below the other non-charged substitutions of similar molecular volume.
The optimal substitution at position 166 decreases in volume with increasing volume of the P1 substrate �i.e., I166/Ala substrate, L166/Met substrate, A166/Phe substrate, Gly166/Tyr substrate!. The combined volumes for these optimal pairs may approximate the volume for productive binding in the S-1 subsite. For the optimal pairs, Gly166/Tyr substrate, A166/Phe substrate, L166/Met substrate, V166/Met substrate, and I166/Ala substrate, the combined volumes are 266,295,313,339 and 261 A.sup.3, respectively. Subtracting the volume of the peptide backbond from each pair (i.e., two times the volume of glycine), an average side-chain volume of 160.+-.32A.sup.3 for productive binding can be calculated.
The effect of volume, in excess to the productive binding volume, on the drop in transition-state binding energy can be estimated from the Tyr substrate curve (bottom panel, FIGS. 16A, 16B, 16C and 16D), because these data, and modeling studies (FIG. 2), suggest that any substitution beyond glycine causes steric repulsion. A best-fit line drawn to all the data (R=0.87) gives a slope indicating a loss of roughly 3 kcal/mol in transition state binding energy per 100A.sup.3 of excess volume. (100A.sup.3 is approximately the size of a leucyl side-chain.)
D. Enhanced Catalytic Efficiency Correlates with Increasing Hydrophobicity of the Position 166 Substitution
Substantial increases in kcat/Km occur with enlargement of the position 166 side-chain, except for the Tyr P-1 substrate (FIGS. 16A, 16B, 16C and 16D). For example, kcat/Km increases in progressing from Gly166 to I166 for the Ala substrate (net of ten-fold), from Gly166 to L166 for the Met substrate (net of ten-fold) and from Gly166 to A166 for the Phe substrate (net of two-fold). The increases in kcat/Km cannot be entirely explained by the attractive terms in the van der Waals potential energy function because of their strong distance dependence (1/r.sup.6) and because of the weak nature of these attractive forces (Jencks, W. P., Catalysis in Chemistry and Enzymology (McGraw-Hill, 1969) pp. 321-436; Fersht, A., Enzyme Structure and Mechanism (Freeman, San Francisco, 1977) pp. 226-287; Levitt, M. (1976) J. Mol. Biol. 104, 59-107). For example, Levitt (Levitt, M. (1976) J. Mol. Biol. 104, 59-107) has calculated that the van der Waals attraction between two methionyl residues would produce a maximal interaction energy of roughly -0.2 kcal/mol. This energy would translate to only 1.4 fold increase in kcat/Km.
The increases of catalytic efficiency caused by side-chain substitutions at position 166 are better accounted for by increases in the hydrophobicity of the S-1 subsite. The increase kcat/Km observed for the Ala and Met substrates with increasing position 166 side-chain size would be expected, because hydrophobicity is roughly proportioal to side-chain surface area (Rose, G. D., et al. (1985) Science 229, 834-838; Reynolds, J. A., et al. (1974) Proc. Natl. Acad. Sci. USA 71, 2825-2927).
Another example that can be interpreted as a hydrophobic effect is seen when comparing kcat/Km for isosteric substitutions that differ in hydrophobicity such as S166 and C166 (FIGS. 16A, 16B, 16C and 16D). Cysteine is considerably more hydrophobic than serine (-1.0 versus +0.3 kcal/mol) (Nozaki, Y., et al. (1971) J. Biol. Chem. 246, 2211-2217; Tanford, C. (1978) Science 200, 1012). The difference in hydrophobicity correlates with the observation that C166 becomes more efficient relative to Ser166 as the hydrophobicity of the substrates increases (i.e., Ala<Met<Tye<Phe). Steric hindrance cannot explain these differences because serine is considerably smaller than cysteine (99 versus 118A.sup.3). Paul, I. C., Chemistry of the --SH Group (ed. S. Patai, Wiley Interscience, New York, 1974) pp. 111-149.
E. Production of an Elastase-Like Specificity in Subtilisin
The I166 mutation illustrates particularly well that large changes in specificity can be produced by altering the structure and hydrophobicity of the S-1 subsite by a single mutation (FIG. 17). Progressing through the small hydrophobic substrates, a maximal specificity improvement over wild type occurs for the Val substrate (16 fold in kcat/Km). As the substrate side chain size increases, these enhancements shrink to near unity (i.e., Leu and His substrates). The I166 enzyme becomes poorer against larger aromatic substrates of increasing size (e.g., I166 is over 1,000 fold worse against the Tyr substrate than is Gly166). We interpret the increase in catalytic efficiency toward the small hydrophobic substrates for I166 compared to Gly166 to the greater hydrophobicity of isoluecine (i.e., -1.8 kcal/mol versus 0). Nozaki, Y., et al. (1971) J. Biol. Chem. 246, 2211-2217; Tanford, C. (1978) Science 200, 1012. The decrease in catalytic efficiency toward the very large substrates for I166 versus Gly166 is attributed to steric repulsion.
The specificity differences between Gly166 and I166 are similar to the specificity differences between chymotrypsin and the evolutionary relative, elastase (Harper, J. W., et al (1984) Biochemistry 23, 2995-3002). In elastase, the bulky amino acids, Thr and Val, block access to the P-1 binding site for large hydrophobic substrates that are preferred by chymotrypsin. In addition, the catalytic efficiencies toward small hydrophobic substrates are greater for elastase than for chymotrypsin as we obeseve for I166 versus Gly166 in subtilisin.
EXAMPLE 4
Substitution of Ionic Amino Acids for Gly166
The construction of subtilisin mutants containing the substitution of the ionic amino acids Asp, Asn, Gln, Lys and Ang are disclosed in EPO Publication No. 0130756. In addition, a limited analysis of substrate specificity was presented therein. The present example describes the construction of the mutant subtilisin containing Glu at position 166 (E166) and presents some of the specificity data on these mutants. Further data on position 166 and 156 single and double mutants will be presented infra.
p.DELTA.166, described in Example 3, was digested with SacI and XmaI. The double strand DNA cassette (underlined and overlined) of line 4 in FIG. 13 contained the triplet GAA for the codon 166 to encode the replacement of Glu for Gly166. This mutant plasmid designated pQ166 was propagated in BG2036 as described. This mutant subtilisin, together with the other mutants containing ionic substituent amino acids at residue 166, were isolated as described and further analyzed for variations in substrate specificity.
Each of these mutants was analyzed with the tetrapeptide substrates, succinyl-L-AlaL-AlaProL-X-p-nitroanilide, where X was Phe, Ala and Glu.
The results of this analysis are shown in Table IX.
TABLE IX______________________________________ P-1 Substrate (kcat/Km .times. 10.sup.-4)Position 166 Phe Ala Glu______________________________________Gly (wild type) 36.0 1.4 0.002Asp (D) 0.5 0.4 <0.001Glu (E) 3.5 0.4 <0.001Asn (N) 18.0 1.2 0.004Gln (Q) 57.0 2.6 0.002Lys (K) 52.0 2.8 1.2Arg (R) 42.0 5.0 0.08______________________________________
These results indicate that charged amino acid substitutions at Gly166 have improved catalytic efficiencies (kcat/Km) for oppositely charged P-1 substrates (as much as 500 fold) and poorer catalytic efficiency for like charged P-1 substrates.
EXAMPLE 5
Substitution of Glycine at Position 169
The substitution of Gly169 in B. amyloliquefaciens subtilisin with Ala and Ser is described in EPO Publication No. 0130756. The same method was used to make the remaining 17 mutants containing all other substituent amino acids for position 169.
The construction protocol is summarized in FIG. 18. The overscored and underscored double stranded DNA cassettes used contained the following triplet encoding the substitution of the indicated amino acid at residue 169.
______________________________________ GCT A TGT C GAT D GAA E TTC F GGC G CAC K ATC I AAA K CTT L ATG M AAC N CCT P CAA Q AGA R AGC S ACA T GTT V TGG W TAC Y______________________________________
Each of the plasmids containing a substituted Gly169 was designated pX169, where X represents the substituent amino acid. The mutant subtilisins were similarly designated.
Two of the above mutant subtilisins, A169 and S169, were analyzed for substrate specificity against synthetic substrates containing Phe, Leu, Ala and Arg in the P-1 position. The following results are shown in Table X.
TABLE X______________________________________Effect of Serine and Alanine Mutationsat Position 169 on P-1 Substrate Specificity P-1 Substrate (kcat/Km .times. 10.sup.-4)Position 169 Phe Leu Ala Arg______________________________________Gly (wild type) 40 10 1 0.4A169 120 20 1 0.9S169 50 10 1 0.6______________________________________
These results indicate that substitutions of Ala and Ser at Gly169 have remarkably similar catalytic efficiencies against a range of P-1 substrates compared to their position 166 counterparts. This is probably because position 169 is at the bottom of the P-1 specificity subsite.
EXAMPLE 6
Substitution at Position 104
Try104 has been substituted with Ala, His, Leu, Met and Ser. The method used was a modification of the site directed mutagenesis method. According to the protocol of FIG. 19, a primer (shaded in line 4) introduced a unique HindIII site and a frame shift mutation at codon 104. Restriction-purification for the unique HindIII site facilitated the isolation of the mutant sequence (line 4). Restriction-selection against this HindIII site using pimers in Line 5 was used to obtain position 104 mutants.
The following triplets were used in the primers of FIG. 19, line 5 for the 104 codon which substituted the following amino acids.
______________________________________GCT Ala TTC PheATG Met CCT ProCTT Leu ACA ThrAGC Ser TGG TrpCAC His TAC TyrCAA Gln GTT ValGAA Glu AGA ArgGGC Gly AAC AsnATC Ile GAT AspAAA Lys TGT Cys______________________________________
The following substrates were used to analyze the substrate specificity of these mutants to give the indicated results in Table XI.
TABLE XI______________________________________kcat Km Kcat/KmSubstrate WT H104 WT H104 WT H104______________________________________sAAPFpNA 50.0 22.0 1.4 e-4 7.1 e-4 3.6 e5 3.1 e4sAAPApNA 3.2 2.0 2.3 e-4 1.9 e-3 1.4 e4 1 e3sFAPFpNA 26.0 38.0 1.8 e-4 4.1 e-4 1.5 e5 9.1 e4sFAPApNA 0.32 2.4 7.3 e-5 1.5 e-4 4.4 e3 1.6 e4______________________________________
From these data it is clear that the substitution of His for Tyr at position 104 produces an enzyme which is more efficient (higher kcat/Km) when Phe is at the P-4 substrate position than when Ala is at the P-4 substrate position.
EXAMPLE 7
Substitution of Ala152
Ala152 has been substituted by Gly and Ser to determine the effect of such substitutions on substrate specificity.
The wild type DNA sequence was mutated by the V152/P153 primer (FIG. 20, line 4) using the above restriction-purification approach for the new KpnI site. Other mutant primers (shaded sequences FIG. 20; S152, line 5 and G152, line 6) mutated the new KpnI site away and such mutants were isolated using the restriction-selection procedure as described above for loss of the KpnI site.
The results of these substitutions for the above synthetic substrates containing the P-1 amino acids Phe, Leu and Ala are shown in Table XII.
TABLE XII______________________________________ P-1 Substrate (kcat/Km .times. 10.sup.-4)Position 152 Phe Leu Ala______________________________________Gly (G) 0.2 0.4 <0.04Ala (wild type) 40.0 10.0 1.0Ser (S) 1.0 0.5 0.2______________________________________
These results indicate that, in contrast to positions 166 and 169, replacement of Ala152 with Ser or Gly causes a dramatic reduction in catalytic efficiencies across all substrates tested. This suggests Ala152, at the top of the S-1 subsite, may be the optimal amino acid because Ser and Gly are homologous Ala Substitutes.
EXAMPLE 8
Substitution at Position 156
Mutants containing the substitution of Ser and Gln for Glu156 have been constructed according to the overall method depicted in FIG. 21. This method was designed to facilitate the construction of multiple mutants at position 156 and 166 as will be described hereinafter. However, by regenerating the wild type Gly166, single mutations at Glu156 were obtained.
The plasmid p.DELTA.166 is already depicted in line 2 of FIG. 13. The synthetic oligonucleotides at the top right of FIG. 21 represent the same DNA cassettes depicted in line 4 of FIG. 13. The plasmid p166 in FIG. 21 thus represents the mutant plasmids of Examples 3 and 4. In this particular example, p166 contains the wild type Gly166.
Construction of position 156 single mutants were prepared by ligation of the three fragments (1-3) indicated at the bottom of FIG. 21. Fragment 3 , containing the carboxy-terminal portion of the subtilisin gene including the wild type position 166 codon, was isolated as a 610 bp SacI-BamHI fragment. Fragment 1 contained the vector sequences, as well as the amino-terminal sequences of the subtilisin gene through codon 151. To produce fragment 1, a unique KpnI site at codon 152 was introduced into the wild type subtilisin sequence from pS4.5. Site-directed mutagenesis in M13 employed a primer having the sequence 5'-TA-GTC-GTT-GCG-GTA-CCC-GGT-AAC-GAA-3' to produce the mutation. Enrichment for the mutant sequence was accomplished by restriction with KpnI, purification and self ligation. The mutant sequence containing the KpnI site was confirmed by direct plasmid sequencing to give pV-152 . pV-152 (.about.1 .mu.g) was digested with KpnI and treated with 2 units of DNA polymerase I large fragment (Klenow fragment from Boeringer-Mannheim) plus 50 .mu.M deoxynucleotide triphosphates at 37.degree. C. for 30 min. This created a blunt end that terminated with codon 151. The DNA was extracted with 1:1 volumes phenol and CHCl.sub.3 and DNA in the aqueous phase was precipitated by addition of 0.1 volumes 5M ammonium acetate and two volumes ethanol. After centrifugation and washing the DNA pellet with 70% ethanol, the DNA was lyophilized. DNA was digested with BamHI and the 4.6 kb piece (fragment 1) was purified by acrylamide gel electrophoresis followed by electroelution. Fragment 2 was a duplex synthetic DNA cassette which when ligated with fragments 1 and 3 properly restored the coding sequence except at codon 156. The top strand was synthesized to contain a glutamine codon, and the complementary bottom strand coded for serine at 156. Ligation of heterophosphorylated cassettes leads to a large and favorable bias for the phosphorylated over the non-phosphorylated oligonucleotide sequence in the final segrated plasmid product. Therefore, to obtain Q156 the top strand was phosphorylated, and annealed to the non-phosphorylated bottom strand prior to ligation. Similarly, to obtain S156 the bottom strand was phosphorylated and annealed to the non-phosphorylated top strand. Mutant sequences were isolated after ligation and transformation, and were confirmed by restriction analysis and DNA sequencing as before. To express variant subtilisine, plasmids were transformed into a subtilisin-neutral protease deletion mutant of B. subtilis, BG2036, as previously described. Cultures were fermented in shake flasks for 24 h at 37.degree. C. in LB media containing 12.5 mg/mL chloraphenicol and subtilisin was purified from culture supernatants as described. Purity of subtilisin was greater than 95% as judged by SDS PAGE.
These mutant plasmids designated pS156 and pQ156 and mutant subtilisins designated S156 and Q156 were analyzed with the above synthetic substrates where P-1 comprised the amino acids Glu, Gln, Met and Lys. The results of this analyses are presented in Example 9.
EXAMPLE 9
Multiple Mutants with Altered Substrate Specificity--Substitution at Positions 156 and 166
Single substitutions of position 166 are described in Examples 3 and 4. Example 8 describes single substitutions at position 156 as well as the protocol of FIG. 21 whereby various double mutants comprising the substitution of various amino acids at positions 156 and 166 can be made. This example describes the construction and substrate specificity of subtilisin containing substitutions at position 156 and 166 and summarized some of the data for single and double mutants at positions 156 and 166 with various substrates.
K166 is a common replacement amino acid in the 156/166 mutants described herein. The replacement of Lys for Gly166 was achieved by using the synthetic DNA cassette at the top right of FIG. 21 which contained the triplet AAA for NNN. This produced fragment 2 with Lys substituting for Gly166.
The 156 substituents were Gln and Ser. The Gln and Ser substitutions at Gly156 are contained within fragment 3 (bottom right FIG. 21).
The multiple mutants were produced by combining fragments 1, 2 and 3 as described in Example 8. The mutants Q156/K166 and S156/K166 were selectively generated by differential phosphorylation as described. Alternatively, the double 156/166 mutants, c.f. Q156/K166 and S156/K166, were prepared by ligation of the 4.6 kb SacI-BamHi fragment from the relevant p156 plasmid containing the 0.6 kb SacI-BamHI fragment from the relevant p166 plasmid.
These mutants, the single mutant K166, and the S156 and Q156 mutants of Example 8 were analyzed for substitute specificity against synthetic polypeptides containing Phe or Glu as the P-1 substrate residue. The results are presented in Table XIII.
TABLE XIII______________________________________ Substrate kcat/KmEnzymes P-1 (mutant)Compared.sup.(b) Residue kcat Km kcat/Km kcat/Km(wt)______________________________________Glu-156/ Phe 50.00 1.4 .times. 10.sup.-4 3.6 .times. 10.sup.5 (1)Gly-166 (WT) Glu 0.54 3.4 .times. 10.sup.-2 1.6 .times. 10.sup.1 (1)Lys-166 Phe 20.00 4.0 .times. 10.sup.-5 5.2 .times. 10.sup.5 1.4 Glu 0.70 5.6 .times. 10.sup.-5 1.2 .times. 10.sup.4 750Gln-156/ Phe 30.00 1.9 .times. 10.sup.-5 1.6 .times. 10.sup.6 4.4Lys-166 Glu 1.60 3.1 .times. 10.sup.-5 5.0 .times. 10.sup.4 3100Ser-156/ Phe 30.00 1.8 .times. 10.sup.-5 1.6 .times. 10.sup.6 4.4Lys-166 Glu 0.60 3.9 .times. 10.sup.-5 1.6 .times. 10.sup.4 1000Ser-156 Phe 34.00 4.7 .times. 10.sup.-5 7.3 .times. 10.sup.5 2.0 Glu 0.40 1.8 .times. 10.sup.-3 1.1 .times. 10.sup.2 6.9Glu-156 Phe 48.00 4.5 .times. 10.sup.-5 1.1 .times. 10.sup.6 3.1 Glu 0.90 3.3 .times. 10.sup.-3 2.7 .times. 10.sup.2 17______________________________________
As can be seen in Table XIV, either of these single mutations improve enzyme performance upon substrates with glutamate at the P-1 enzyme binding site. When these single mutations were combined, the resulting multiple enzyme mutants are better than either parent. These single or multiple mutations also alter the relative pH activity profiles of the enzymes as shown in FIGS. 23A and 23B.
To isolate the contribution of electrostatics to substrate specificity from other chemical binding forces, these various single and double mutants were analyzed for their ability to bind and cleave synthetic substrates containing Glu, Gln, Met and Lys as the P-1 substrate amino acid. This permitted comparisons between side-chains that were more sterically similar but differed in charge (e.g., Glu versus Gln, Lys versus Met). Similarly, mutant enzymes were assayed against homologous P-1 substrates that were most sterically similar but differed in charge (Table XIV).
TABLE XIV__________________________________________________________________________Kinetics of Position 156/166 SubtilisinsDetermined for Different P1 SubstratesEnzymePosition.sup.(a) Net P-1 Substrate log kcat/Km (log 1/Km).sup.(c)156 166 Charge.sup.(b) Glu Gln Met Lys__________________________________________________________________________Glu Asp -2 n.d. 3.02 (2.56) 3.93 (2.74) 4.23 (3.00)Glu Glu -2 n.d. 3.06 (2.91) 3.86 (3.28) 4.48 (3.69)Glu Asn -1 1.62 (2.22) 3.85 (3.14) 4.99 (3.85) 4.15 (2.88)Glu Gln -1 1.20 (2.12) 4.36 (3.64) 5.43 (4.36) 4.10 (3.15)Gln Asp -1 1.30 (1.79) 3.40 (3.08) 4.94 (3.87) 4.41 (3.22)Ser Asp -1 1.23 (2.13) 3.41 (3.09) 4.67 (3.68) 4.24 (3.07)Glu Met -1 1.20 (2.30) 3.89 (3.19) 5.64 (4.83) 4.70 (3.89)Glu Ala -1 n.d. 4.34 (3.55) 5.65 (4.46) 4.90 (3.24)Glu Gly(wt) -1 1.20 (1.47) 3.85 (3.35) 5.07 (3.97) 4.60 (3.13)Gln Gly 0 2.42 (2.48) 4.53 (3.81) 5.77 (4.61) 3.76 (2.82)Ser Gly 0 2.31 (2.73) 4.09 (3.68) 5.61 (4.55) 3.46 (2.74)Gln Asn 0 2.04 (2.72) 4.51 (3.76) 5.79 (4.66) 3.75 (2.74)Ser Asn 0 1.91 (2.78) 4.57 (3.82) 5.72 (4.64) 3.68 (2.80)Glu Arg 0 2.91 (3.30) 4.26 (3.50) 5.32 (4.22) 3.19 (2.80)Glu Lys 0 4.09 (4.25) 4.70 (3.88) 6.15 (4.45) 4.23 (2.93)Gln Lys +1 4.70 (4.50) 4.64 (3.68) 5.97 (4.68) 3.23 (2.75)Ser Lys +1 4.21 (4.40) 4.84 (3.94) 6.16 (4.90) 3.73 (2.84)Maximum difference:log kcat/Km 3.5 (3.0) 1.8 (1.4) 2.3 (2.2) -1.3 (-1.0)(log 1/Km).sup.(d)__________________________________________________________________________
Footnotes to Table XIV:
(a) B. subtilis, BG 2036, expressing indicated variant subtilisin were fermented and enzymes purified as previously described (Estell, et al. (1985) J. Biol. Chem. 260, 6518-6521). Wild type subtilisin is indicated (wt) containing Glu156 and Gly166.
(b) Net charge in the P-1 binding site is defined as the sum of charges from positions 156 and 166 at pH 8.6
(c) Values for kcat(s.sup.-1) and Km(M) were measured in 0.1M Tris pH 8.6 at 25.degree. C. as previously described.sup.3 against P-1 substrates having the form succinyl-L-AlaL-AlaL-ProL-�X!-p-nitroanilide, where X is the indicated P-1 amino acid. Values for log 1/Km are shown inside parentheses. All errors in determination of kcat/Km and 1/Km are below 5%.
(d) Because values for Glu156/Asp166(D166) are too small to determine accurately, the maximum difference taken for GluP-1 substrate is limited to a charge range of +1 to -1 charge change.
n.d.=not determined
The kcat/Km ratios shown are the second order rate constants for the conversion of substrate to product, and represent the catalytic efficiency of the enzyme. These ratios are presented in logarithmic form to scale the data, and because log kcat/Km is proportional to the lowering of transition-state activation energy (.DELTA.G.sub.T). Mutations at position 156 and 166 produce changes in catalytic efficiency toward Glu, Gln, Met and Lys P-1 substrates of 3100, 60, 200 and 20 fold, respectively. Making the P-1 binding-site more positively charged �e.g., compare Gln156/Lys166 (Q156/K166) versus Glu156/Met166 (Glu156/M166)! dramatically increased kcat/Km toward the Glu P-1 substrate (up to 3100 fold), and decreased the catalytic efficiency toward the Lys P-1 substrate (up to 10 fold). In addition, the results show that the catalytic efficiency of wild type enzyme can be greatly improved toward any of the four P-1 substrates by mutagenesis of the P-1 binding site.
The changes in kcat/Km are caused predominantly by changes in 1/Km. Because 1/Km is approximately equal to 1/Ks, the enzyme-substrate association constant, the mutations primarily cause a change in substrate binding. These mutations produce smaller effects on kcat that run parallel to the effects on 1/Km. The changes in kcat suggest either an alteration in binding in the P-1 binding site in going from the Michaelis-complex E.multidot.S) to the transition-state complex (E-S.apprxeq.) as previously proposed (Robertus, J. D., et al. (1972) Biochemistry 11, 2439-2449; Robertus, J. D., et al. (1972) Biochemistry 11, 4293-4303), or change in the position of the scissile peptide bond over the catalytic serine in the E.sup..multidot. s complex.
Changes in substrate preference that arise from changes in the net charge in the P-1 binding site show trands that are best accounted for by electrostatic effects (FIG. 28). As the P-1 binding cleft becomes more positively charged, the average catalytic efficiency increases much more for the Glu P-1 substrate than for its neutral and isosteric P-1 homolog, Gln (FIG. 28A). Furthermore, at the positive extreme both substrates have nearly identical catalytic efficiencies.
In contrast, as the P-1 site becomes more positively charged the catalytic efficiency toward the Lys P-1 substrate decreases, and diverges sharply from its neutral and isosteric homolog, Met (FIG. 28B). The similar and parallel upward trend seen with increasing positive charge for the Met and Glu P-1 substrates probably results from the fact that all the substrates are succinylated on their amino-terminal end, and thus carry a formal negative charge.
The trends observed in log kcat/Km are dominated by changes in the Km term (FIGS. 28C and 28D). As the pocket becomes more positively charged, the log 1/Km values converge for Glu and Gln P-1 substrates (FIG. 28C), and diverge for Lys and Met P-1 substrates (FIG. 28D). Although less pronounced effects are seen in log kcat, the effects of P-1 charge on log kcat parallel those seen in log 1/Km and become larger as the P-1 pocket becomes more positively charged. This may result from the fact that the transition-state is a tetrahedral anion, and a net positive charge in the enzyme may serve to provide some added stabilization to the transition-state.
The effect of the change in P-1 binding-site charge on substrate preference can be estimated from the differences in slopes between the charged and neutral isosteric P-1 substrates (FIG. 28B). The average change in substrate preference (.DELTA.log kcat/Km) between charged and neutral isosteric substrates increases roughly 10-fold as the complementary charge or the enzyme increases (Table XV). When comparing Glu versus Lys, this difference is 100-fold and the change in substrate preference appears predominantly in the Km term.
TABLE XV______________________________________Differential Effect on Binding SiteCharge on log kcat/Km or (log 1/Km)for P-1 Substrates that Differ in Charge.sup.(a)Change in P-1 Binding .DELTA.log kcat/Km (.DELTA.log 1/Km)Site GluGln MetLys GluLys______________________________________-2 to -1 n.d. 1.2 (1.2) n.d.-1 to 0 0.7 (0.6) 1.3 (0.8) 2.1 (1.4) 0 to +1 1.5 (1.3) 0.5 (0.3) 2.0 (1.5)Avg. change in 1.1 (1.0) 1.0 (0.8) 2.1 (1.5)log kcat/Km or(log 1/Km) perunit charge change______________________________________ .sup.(a) The difference in the slopes of curves were taken between the P1 substrates over the charge interval given for log (k(cat/Km) (FIG. 3A, B) and (log 1/Km) (FIG. 3D, D). Values represent the differential effect a charge change has in distinguishing the substrates that are compared. .sup.(b) Charge in P1 binding site is defined as the sum of charges from positions 156 and 166.
The free energy of electrostatic interactions in the structure and energetics of salt-bridge formation depends on the distance between the charges and the microscopic dielectric of the media. To dissect these structural and microenvironmental effects, the energies involved in specific salt-bridges were evaluated. In addition to the possible salt-bridges shown (FIGS. 29A and 29B), reasonable salt-bridges can be built between a Lys P-1 substrate and Asp at position 166, and between a Glu P-1 substrate and a Lys at position 166 (not shown). Although only one of these structures is confirmed by X-ray crystalography (Poulos, T. L., et al. (1976) J. Mol. Biol. 257 1097-1103), all models have favorable torsion angles (Sielecki, A. R., et al. (1979) J. Mol. Biol. 134, 781-804), and do not introduce unfavorable van der Waals contacts.
The change in charged P-1 substrate preference brought about by formation of the model salt-bridges above are shown in Table XVI.
TABLE XVI__________________________________________________________________________Effect of Salt Bridge Formation Between Enzymeand Substrate on P1 Substrate Preference.sup.(a) Substrate.sup.(d) Change Preference in Substrate Enzyme P-1 .DELTA.log PreferenceEnzymes Compared.sup.(b) Position Substrates (kcat/Km) .DELTA..DELTA.log (kcat/Km)1 2 Changed Compared 1 2 (1 - 2)__________________________________________________________________________Glu156/Asp166 Gln156/Asp166 156 LysMet +0.30 -0.53 0.83Glu156/Asn166 Gln156/Asn166 156 LysMet -0.84 -2.04 1.63Glu156/Gly166 Gln156/Gly166 156 LysMet -0.47 -2.10 1.63Glu156/Lsy-166 Gln156/Lys166 156 LysMet -1.92 -2.74 0.82 Ave .DELTA..DELTA.log 1.10 .+-. 0.3 (kcat/Km)Glu156/Asp166 Glu156/Asn166 166 LysMet +0.30 -0.84 1.14Glu156/Glu166 Glu156/Glu166 166 LysMet +0.62 -1.33 1.95Gln156/Asp166 Gln156/Asn166 166 LysMet -0.53 -2.04 1.51Ser156/Asp166 Ser156/Asn166 166 LysMet -0.43 -2.04 1.61Glu156/Lys166 Glu156/Met166 166 GluGln -0.63 -2.69 2/06 Ave .DELTA..DELTA.log 1.70 .+-. 0.3 (kcat/Km)__________________________________________________________________________ Footnotes to Table XVI: .sup.(a) Molecular modeling shows it is possible to form a salt bridge between the indicated charged P1 substrate and a complementary charge in the P1 binding site of the enzyme at the indicated position changed. .sup.(b) Enzymes compared have sterically similar amino acid substitution that differ in charge at the indicated position. .sup.(c) The P1 substrates compared are structurally similar but differ i charge. The charged P1 substrate is complementary to the charge change at the position indicated between enzymes 1 and 2. .sup.(d) Date from Table XIV was used to compute the difference in log (kcat/Km) between the charged and the noncharged P1 substrate (i.e., the substrate preference). The substrate preference is shown separately for enzyme 1 and 2. .sup.(e) The difference in substrate preference between enzyme 1 (more highly charged) and enzyme 2 (more neutral) represents the rate change accompanying the electrostatic interaction.
Footnotes to Table XVI:
(a) Molecular modeling shows it is possible to form a salt bridge between the indicated charged P-1 substrate and a complementary charge in the P-1 binding site of the enzyme at the indicated position changed.
(b) Enzymes compared have sterically similar amino acid substitutions that differ in charge at the indicated position.
(c) The P-1 substrates compared are structurally similar but differ in charge. The charged P-1 substrate is complementary to the charge change at the position indicated between enzymes 1 and 2.
(d) Data from Table XIV was used to compute the difference in log (kcat/Km) between the charged and the non-charged P-1 substrate (i.e., the substrate preference). The substrate preference is shown separately for enzyme 1 and 2.
(e) The difference in substrate preference between enzyme 1 (more highly charged) and enzyme 2 (more neutral) represents the rate change accompanying the electrostatic interaction.
The difference between catalytic efficiencies (i.e., .DELTA.log kcat/Km) for the charged and neutral P-1 substrates (e.g., Lys minus Met or Glu minus Gln) give the substrate preference for each enzyme. The change in substrate preference (.DELTA..DELTA.log kcat/Km) between the charged and more neutral enzyme homologs (e.g., Glu156/Gly166 minus Gln156(Q156)/Gly166) reflects the change in catalytic efficiency that may be attributed solely to electrostatic effects.
These results show that the average change in substrate preference is considerably greater when electrostatic substitutions are produced at position 166 (50-fold in kcat/Km) versus position 156 (12-fold in kcat/Km). From these .DELTA..DELTA.log kcat/Km values, an average change in transition-state stabilization energy can be calculated of -1.5 and -2.4 kcal/mol for substitutions at positions 156 and 166, respectively. This should represent the stabilization energy contributed from a favorable electrostatic interaction for the binding of free enzyme and substrate to form the transition-state complex.
At least three factors can contribute to the higher transition-state binding energies for electrostatic interactions at position 166. These include: (i) smaller charge separation for salt-bridges at position 166; (ii) more stable side-chain geometries for salt-bridges at position 166; and (iii) microscopic dielectric constants at positions 166.
It is unreasonable to expect all of the energy difference to be due to shorter salt bridges at position 166, because these would have to be 1.6 times shorter than at position 156 for which crystalographic data (Mathews, D. A., et al. (1975) J. Biol. Chem. 250, 7120-7126) indicate are optimally formed. Furthermore, molecular models of salt-bridges appear as structurally reasonable at 156 as at 166.
The binding energies may be more easily explained as differences in the microscopic dielectric constants at position 156 and 166. Assuming a salt-bridge distance of 3 A, .about.2.7 A), the calculated dielectric constant at position 156 would be 72 (.DELTA.Ge=Z.sub.1 Z.sub.2 /rD where Z is the charge on particle 1 and 2, r is the charge separation, and D is the dielectric constant). This corresponds closely with the dielectric constant of 78 for water at this temperature, and qualitatively fits with the fact that position 156 is located on the surface of the enzyme, and is freely exposed to solvent. A calculated dielectric constant for a salt-bridge at position 166 is 45, and fits with the fact that position 166 is more buried and less accessible to solvent. Furthermore, our estimate, based on the hydrophobicity, of the P-1 binding site, indicates that P-1 binding site has an overall dielectric constant close to that of ethanol (D=25).
A large number of mutant comparisons is necessary to show a statistically significant difference between salt-bridges at positive 156 and 166 because there is considerable variation in .DELTA..DELTA.log kcat/Km for different mutant comparisons at the same position. The change in substrate preference from putative salt-bridges at position 156 varies from six to 40-fold in kcat/Km, and those at position 166 vary 14 to 120 fold.
In addition to variation produced by factors mentioned above, it is possible that the P-1 side chains are not binding in the same ways between the enzymes compared, even though the comparisons are nearly isosteric in each case. For example, the Lys P-1 substrate side chain may contact Glu156 in Glu156/Asp166 (Glu156/D166) and Asp166 in Gln156/Asp166 (Q156/D166). Thus, one salt-bridge may be substituted for another. It is also possible that complementary charges within the P-1 binding site, e.g., Glu156/Lys166 (Glu156/K166), can form an intramolecular salt-bridge so that the charged side-chains are not free to interact independently with the substrate. Given these caveats it is remarkable that greater variation in substrate preference is not seen by electrostatic substitutions at each position.
EXAMPLE 10
Substitutions at Position 217
Tyr217 has been substituted by all other 19 amino acids. Cassette mutagenesis as described in EPO publication No. 0130756 was used according to the protocol of FIG. 22. The EcoRV restriction site was used for restriction-purification of p.sup..DELTA. 217.
Since this position is involved in substrate binding, mutations here affect kinetic parameters of the enzyme. An example is the substitution of Leu for Tyr at position 217. For the substrate sAAPFpNa, this mutant has a kcat of 277 5' and a Km of 4.7.times.10.sup.-4 with a kcat/Km ratio of 6.times.10.sup.5. This represents a 5.5-fold increase in kcat with a 3-fold increase in Km over the wild type enzyme.
In addition, replacement of Tyr217 by Lys, Arg, Phe or Leu results in mutant enzymes which are more stable at pH of about 9-11 than the WT enzyme. Conversely, replacement of Tyr217 by Asp, Glu, Gly or Pro results in enzymes which are less stable at pH of about 9-11 than the WT enzyme.
EXAMPLE 11
Multiple Mutants Having Altered Thermal Stability
B. amyloliquefacien subtilisin does not contain any cysteine residues. Thus, any attempt to produce thermal stability by Cys cross-linkage required the substitution of more than one amino acid in subtilisin with Cys. The following subtilisin residues were multiply substituted with cysteine:
Thr22/Ser87
Ser24/Ser87
Mutagenesis of Ser24 to Cys was carried out with a 5' phosphorylated oligonucleotide primer having the sequence
5'-pC-TAC-ACT-GGA-TGC-AAT-GTT-AAA-G-3'.
(Asterisks show the location of mismatches and the underlines sequence shows the position of the altered Sau3A site.) The B. amyloliquefaciens subtilisin gene on a 1.5 kb EcoRI-BAMHI fragment from pS4.5 was cloned into M13mp11 and single stranded DNA was isolated. This template (M13mp11SUBT) was double primed with the 5' phosphorylated M13 universal sequencing primer and the mutagenesis primer. Adelman, et al. (1983) DNA 2, 183-193. The heteroduplex was transfected into competent JM101 cells and plaques were probed for the mutant sequence (Zoller, M. J., et al. (1982) Nucleic Acid Res. 10, 6487-6500; Wallace, et al. (1981) Nucleic Acid Res. 9, 3647-3656) using a tetramethylammonium chloride hybridization protocol (wood, et al. (1985) Proc. Natl. Acad. Sci. USA 82, 1585-1588). The Ser87 to Cys mutation was prepared in a similar fashion using a 5' phosphorylated primer having the sequence
5'-pGGC-GTT-GCG-CCA-TGC-GCA-TCA-CT-3'.
(The asterisk indicates the position of the mismatch and the underlined sequence shows the position of a new MstI site.) The C24 and C87 mutations were obtained at a frequency of one and two percent, respectively. Mutant sequences were confirmed by dideoxy sequencing in M13.
Mutagenesis of Tyr21/Thr22 to A21/C22 was carried out with a 5' phosphorylated oligonucleotide primer having the sequence
5'-pAC-TCT-CAA-GGC-GCT-TGT-GGC-TCA-AAT-GTT-3'.
(The asterisks show mismatches to the wild type sequence and the underlined sequence shows the position of an altered Sau3A site.) Manipulations for heteroduplex synthesis were identical to those described for C24. Because direct clonging of the heteroduplex DNA fragment can yield increased frequencies of mutagenesis, the EcoRI-BamHI subtilisin fragment was purified and ligated into pBS42. E. coli MM 294 cells were transformed with the ligation mixture and plasmid DNA was purified from isolated transformants. Plasmid DNA was screened for the loss of the Sau3A site at codon 23 that was eliminated by the mutagenesis primer. Two out of 16 plasmid preparations had lost the wild type Sau3A site. The mutant sequence was confirmed by dideoxy sequencing in M13.
Double mutants, C22/C87 and C24/C87, were constructed by ligating fragments sharing a common ClaI site that separated the single parent cystine codons. Specifically, the 500 bp EcoRI-ClaI fragment containing the 5' portion of the subtilisin gene (including codons 22 and 24) was ligated with the 4.7 kb ClaI-EcoRI fragment that contained the 3' portion of the subtilisin gene (including codon 87) plus pBS42 vector sequence. E. coli MM 294 was transformed with ligation mixtures and plasmid DNA was purified from individual transformants. Double-cysteine plasmid constructions were identified by restriction site markers originating from the parent cysteine mutants (i.e., C22 and C24, Sau3A minus; Cys87, MstI plus). Plasmids from E. coli were transformed into B. subtilis BG2036. The thermal stability of these mutants as compared to wild type subtilisin are presented in FIGS. 30A, 30B and 30C and Tables XVII and XVIII.
TABLE XVII______________________________________Effect of DTT on the Half-Time ofAutolytic Inactivation of Wild-Typeand Disulfide Mutants of Subtilisin* .sup.t 1/2 -DDT +DTTEnzyme min -DTT/+DTT______________________________________Wild-type 95 85 1.1C22/C87 44 25 1.8C24/C87 92 62 1.5______________________________________ (*)Purified enzymes were either treated or not treated with 25 mM DTT and dialyzed with or without 10 mM DTT in 2 mM CaCl.sub.2, 50 mM Tris (pH 7.5 for 14 hr. at 4.degree. C. Enzyme concentrations were adjusted to 80 .mu. aliquots were quenched on ice and assayed for residual activity. Halftime for autolytic inactivation were determined from semilog plots of log.sub.10 (residual activity) versus time. These plots were linear for over 90% of the inactivation.
TABLE XVIII______________________________________Effect of Mutations in Subtilisinon the Half-Time of AutolyticInactivation at 58.degree. C.* .sup.t 1/2 Enzyme min______________________________________ Wild-type 120 C22 22 C24 120 C87 104 C22/C87 43 C24/C87 115______________________________________ (*)Half-times for autolytic inactivation were determined for wildtype and mutant subtilisins as described in the legend to Table III. Unpurified an nonreduced enzymes were used directly from B. subtilis culture supernatants.
It has been demonstrated that double-cysteine mutants of subtilisin are efficiently secreted and that disulfide bonds are formed in vivo in B. subtilis (date not shown). The introduction of disulfide bonds in subtilisin extends upon previous work in dihydrofolate reductase and T4 lysozyme (Perry, L. J., et al. (1984) Science 226, 555-557), where single cysteines were introduced near pre-existing cysteines and disulfides were oxidized in vitro. Analyses of physical properties of the subtilisin disulfides, unlike the T4 lysozyme disulfide (Perry, L. J., et al. (1986) Biochemistry, in press), were not complicated by the presence of free cysteines other than those involved in disulfide formation. Because most naturally occuring disulfides occur in secreted proteins, subtilisin is an excellent model system to identify the structural requirements for in vitro formation of stable disulfide bonds in secreted proteins.
Thermal Stability and Autolytic Stability
The data presented here do not address reverisble thermostability of subtilisin directly because of complications arising from autolysis and aggregation. For example, studies monitoring the change in the circular dichroic eliptcity at 220 nm versus temperature of phenylmethanesulfonyl fluoride-inhibited subtilisin show typical melt profiles that are coincident with the autolysis curves. However, at the end of thermal melt, SDS-PAGE shows that >90% of the subtilisin is autolyzed. Moreover, Brown and Schleich (Brown, M. F., et al. (1975) Biochemistry 14, 3069-3074) have shown that diisopropylfluorophosphate-inhibited subtilisin irreversibly aggregates in denaturants, which precludes reversible denaturation studies. Thus, until these problems are overcome, subtilisin is not an ideal system for studying the thermodynamics of protein folding.
Although there appears to be a relationship between autolyic stability and conformational stability, the disulfides introduced into subtilisin did not improve the autolytic stability of the mutant enzymes when compared to the wild-type enzyme. However, the disulfide bonds did provide a margin of autolytic stability when compared to their corresponding reduced double-cysteine enzyme. Inspection of a highly refined x-ray structure of wild-type B. amyloliquefaciens subtilisin reveals a hydrogen bond between Thr22 and Ser87. Because cysteine is a poor hydrogen donor or acceptor (Paul, I. C. (1974) in Chemistry of the --SH Group (Patai, S., ed.) pp. 111-149, Wiley Interscience, New York) weakening of 22/87 hydrogen bond may explain why the C22 and C87 single-cysteine mutant proteins are less autolytically stable than either C24 or wild-type (Table XVIII). The fact that C22 is less autolytically stable than C87 may be the result of the Try21A mutation (Table XVIII). Indeed, recent construction and analysis of Try21/C22 shows the mutant protein has an autolytic stability closer to that of C87. In summary, the C22 and C87 of single-cysteine mutations destabilize the protein toward autolysis, and disulfide bond formation increases the stability to a level less than or equal to that of wild-type enzyme.
These data suggest that the stabilizing effect of an engineered disulfide can be lowered when the parent cysteine mutations disrupt pre-existing stabilizing interactions. Similar conclusions have been drawn from reversible thermal unfolding studies of disulfide cross-linked T4 lysozyme mutants that contain destabilizing mutations. Therefore, a strategy to stabilize a protein by introduction of a disulfide bond should consider avoiding the disruption of stabilizing interactions as well as producing a disulfide with good bond geometry.
EXAMPLE 12
Multiple Mutants Containing Substitutions at Position 222 and Position 166 or 169
Double mutants 166/222 and 169/222 were prepared by ligating together (1) the 2.3 kb AcaII fragment from pS4.5 which contains the 5' portion of the subtilisin gene and vector sequences, (2) the 200bp AvaII fragment which contains the relevant 166 or 169 mutations from the respective 166 or 169 plasmids, and (3) the 2.2kb AvaII fragment which contains the relevant 222 mutation 3' and of the subtilisin genes and vector sequence from the respective p222 plasmid.
Although mutations at position 222 improve oxidation stability they also tend to increase the Km. An example is shown in Table XIX. In this case the A222 mutation was combined with the K166 mutation to give an enzyme with kcat and Km intermediate between the two parent enzymes.
TABLE XIX______________________________________ kcat Km______________________________________WT 50 1.4 .times. 10.sup.-4A222 42 9.9 .times. 10.sup.-4K166 21 3.7 .times. 10.sup.-5K166/A222 29 2.0 .times. 10.sup.-4______________________________________ substrate sAAPFpNA
EXAMPLE 13
Multiple Mutants Containing Substitutions at Positions 50, 156, 166, 217 and Combinations Thereof
The double mutant S156/A169 was prepared by ligation of two fragments, each containing one of the relevant mutations. The plasmid pS156 was cut with XmaI and treated with S1 nuclease to create a blunt end at codon 167. After removal of the nuclease by phenol/chloroform extraction and ethanol precipitation, the DNA was digested with BamHI and the approximately 4 kb fragment containing the vector plus the 5' portion of the subtilisin gene through codon 167 was purified.
The pA169 plasmid was digested with KpnI and treated with DNA polymerase Klenow fragment plus 50 .mu.M dNTPs to create a blunt end codon at codon 168. The Klenow was removed by phenol/chloroform extraction and ethanol precipitation. The DNA was digested with BamHI and the 590 bp fragment including codon 168 through the carboxy terminus of the subtilisin gene was isolated. The two fragments were then ligated to give S156/A169.
Triple and quadruple mutants were prepared by ligating together (1) the 200 bp PvuII/HaeII fragment containing the relevant 156, 166 and/or 169 mutations from the respective p156, p166 and/or p169 double of single mutant plasmid, (2) the 550 bp HaeII/BamHI fragment containing the relevant 217 mutant from the respective p217 plasmid, and (3) and 3.9 kb PvuII/BamHI fragment containing the F50 mutation and vector sequences.
The multiple mutant F50/S156/A169/L217, as well as B. amyloliquefaciens subtilisin, B. lichenformis subtilisin and the single mutant L217 were analyzed with the above synthetic polypeptides where the P-1 amino acid in the substrate was Lys, His, Ala, Gln, Tyr, Phe, Met and Leu. These results are shown in FIGS. 26 and 27.
These results show that the F50/S156/A169/L217 mutant has substrate specificity similar to that of the B. licheniformis enzyme and differs dramatically from the wild type enzyme. Although only data for the L217 mutant are shown, none of the single mutants (e.g., F50, S156 or A169) showed this effect. Although B. licheniformis differs in 88 residue positions from B. amyloliquefaciens, the combination of only these four mutations accounts for most of the differences in substrate specificity between the two enzymes.
EXAMPLE 14
Subtilisin Mutants Having Altered Alkaline Stability
A random mutagenesis technique was used to generate single and multiple mutations within the B. amyloliquefaciens subtilisin gene. Such mutants were screened for altered alkaline stability. Clones having increased (positive) alkaline stability and decreased (negative) alkaline stability were isolated and sequenced to identify the mutations within the subtilisin gene. Among the positive clones, the mutants V107 and R213 were identified. These single mutants were subsequently combined to produce the mutant V107/R213.
One of the negative clones (V50) from the random mutagenesis experiments resulted in a marked decrease in alkaline stability. Another mutant (P50) was analyzed for alkaline stability to determine the effect of a different substitution at position 50. The F50 mutant was found to have a greater alkaline stability than wild type subtilisin and when combined with the double mutant V107/R213 resulted in a mutant having an alkaline stability which reflected the aggregate of the alkaline stabilities for each of the individual mutants.
The single mutant R204 and double mutant C204/R213 were identified by alkaline screening after random cassette mutagenesis over the region from position 197 to 228. The C204/R213 mutant was thereafter modified to produce mutants containing the individual mutations C204 and R213 to determine the contribution of each of the individual mutations. Cassette mutagenesis using pooled oligonucleotides to substitute all amino acids at position 204, was utilized to determine which substitution at position 204 would maximize the increase in alkaline stability. The mutation from Lys213 to Arg was maintained constant for each of these substitutions at position 204.
A. Construction of pB0180, an E. coli-B. subtilis Shuttle Plasmid
The 2.9 kb EcoRI-BamHI fragment from pBR327 (Covarrubias, L., et al. (1981) Gene 13, 25-35) was ligated to the 3.7 kb EcoRI-BamHI fragment of pBD64 (Gryczan, T., et al. (1980) J. Bacteriol., 246-253) to give the recombinant plasmid pB0153. The unique EcoRI recognition sequence in pBD64 was eliminated by digestion with EcoRI followed by treatment with Klenow and deoxynucleotide triphosphates (Maniatis, T., et al. (eds.) (1982) in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). Blunt end ligation and transformation yielded pB0154. The unique AvaI recognition sequence in pB0154 was eliminated in a similar manner to yield pB0171. pB0171 was digested with BamHI and PvuII and treated with Klenow and deoxynucleotide triphosphates to create blunt ends. The 6.4 kb fragment was purified, ligated and transformed into LE392 cells (Enquest, L. W., et al. (1977) J. Mol. Biol., 111, 97-120), to yield pB0172 which retains the unique BamHI site. To facilitate subcloning of subtilisin mutants, a unique and silent KpnI site starting at codon 166 was introduced into the subtilisin gene from pS4.5 (Wells, J. A., et al. (1983) Nucleic Acids Res., 11, 7911-7925) by site-directed mutagenesis. The KpnI+ plasmid was digested with EcoRI and treated with Klenow and deoxynucleotide triphosphates to create a blunt end. The Klenow was inactivated by heating for 20 min at 68.degree. C., and the DNA was digested with BamHI. The 1.5 kb blunt EcoRI-BamHI fragment containing the entire subtilisin was ligated with the 5.8 kb NruI-BamHI from pB0172 to yield pB0180. The ligation of the blunt NruI end to the blunt EcoRI and recreated an EcoRI site. Proceeding clockwise around pB0180 from the EcoRI site at the 5' end of the subtilisin gene is the unique BamHI site at the 3' end of the subtilisin gene, the chloramphenicol and neomycin resistance genes and UB110 gram positive replication origin derived from pBD64, the ampicillin resistance gene and gram negative replication origin derived from pBR327.
B. Construction of Random Mutagenesis Library
The 1.5 kb EcoRI-BamHI fragment containing the B. amyloliquefaciens subtilisin gene (Wells et al., 1983) from pB0180 was cloned into M13mp11 to give M13mp11 SUBT essentially as previously described (Wells, J. A., et al. (1986) J. Biol. Chem., 261, 6564-6570). Deoxyuridine containing template DNA was prepared according to Kunkel (Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA, 82 488-492). Uridine containing template DNA (Kunkel, 1985) was purified by CsCl density gradients (maniatis, T. et al. (eds.) (1982) in Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) A primer (AvaI) having the sequence
5'GAAAAAAGACCCTAGCGTCGCTTA
ending at codon -11, was used to alter the unique AvaI recognition sequence within the subtilisin gene. (The asterisk denotes the mismatches from the wild-type sequence and underlined is the altered AvaI site.) The 5' phosphorylated AvaI primer (.about.320 pmol) and .about.40 pmol (.about.120 .mu.g) of uridine containing M13mp11 SUBT template in 1.88 ml of 53 mM NaCl, 7.4 mM MgCl2 and 7.4 mM Tris.HCl (pH 7.5) were annealed by heating to 90.degree. C. for 2 min. and cooling 15 min at 24.degree. C. (FIG. 31). Primer extension at 24.degree. C. was initiated by addition of 100 .mu.L containing 1 mM in all four deoxynucleotide triphosphates, and 20 .mu.l Klenow fragment (5 units/l). The extension reaction was stopped every 15 seconds over ten min by addition of 10 .mu.l 0.25 M EDTA (pH 8) to 50 .mu.l aliquots of the reaction mixture. Samples were pooled, phenol chlorophorm extract and DNA was precipitated twice by addition of 2.5 vol 100% ethanol, and washed twice with 70% ethanol. The pellet was dried, and redissolved in 0.4 ml 1 mM EDTA, 10 mM Tris (pH 8). Misincorporation of .alpha.-thiodeoxynucleotides onto the 3' ends of the pool of randomly terminated template was carried out by incubating four 0.2 ml solutions each containing one-fourth of the randomly terminated template mixture (.about.20 .mu.g), 0.25 mM of a given .alpha.-thiodeoxynucleotide triphosphate, 100 units AMV polymerase, 50 mM KCL, 10 mM MgCl.sub.2, 0.4 mM dithiothreitol, and 50 mM Tris (pH 8.3) (Champoux, J. J. (1984) Genetics, 2, 454-464). After incubation at 37.degree. C. for 90 minutes, misincorporation reactions were sealed by incubation for five minutes at 37.degree. C. with 50 mM all four deoxynucleotide triphosphates (pH 8), and 50 units AMV polymerase. Reactions were stopped by addition of 25 mM EDTA (final), and heated at 68.degree. C. for ten min to inactivate AMV polymerase. After ethanol precipitation and resuspension, synthesis of closed circular heteroduplexes was carried out for two days at 14.degree. C. under the same conditions used for the timed extension reactions above, except the reactions also contained 1000 units T4 DNA ligase, 0.5 mM ATP and 1 mM .beta.-mercaptoethanol. Simultaneous restriction of each heteroduplex pool with KpnI, BamHI, and EcoRI confirmed that the extension reactions were nearly quantitative. Heteroduplex DNA in each reaction mixture was methylated by incubation with 80 .mu.M S-adenosylmethionine and 150 units dam methylase for 1 hour at 37.degree. C. Methylation reactions were stopped by heating at 68.degree. C. for 15 min. One-half of each of the four methylated heteroduplex reactions were transformed into 2.5 ml competent E. coli JM101 (Messing, J. (1979) Recombinant DNA Tech. Bull., 2, 43-48). The number of independent transformants from each of the four transformations ranged from 0.4-2.0.times.10.sup.5. After growing out phage pools, RF DNA from each of the four transformations was isolated and purified by centrifugation through CsCl density gradients. Approximately 2 .mu.g of RF DNA from each of the four pools was digested with EcoRI, BamHI and AvaI. The 1.5 kb EcoRI-BamHI fragment (i.e., AvaI resistant)was purified on low gel temperature agarose and ligated into the 5.5 kb EcoRi-BamHI vector fragment of pB0180. The total number of independent transformants from each .alpha.-thiodeoxynucleotide misincorporation plasmid library ranged from 1.2-2.4.times.10.sup.4. The pool of plasmids from each of the four transformations was grown out in 200 ml LB media containing 12.5 .mu.g/ml cmp and plasmid DNA was purified by centrifugation through CsCl density gradients.
C. Expression and Screening of Subtilisin Point Mutants
Plasmid DNA from each of the four misincorporation pools was transformed (Anagnostopoulos, C., et al. (1967, J. Bacteriol., 81, 741-746) into BG2036, a strain of B. subtilis deficient in extracellular protease genes (Yang, M. Y. et al., (1984) J. Bacteriol., 160, 15-21). For each transformation, 5 .mu.g of DNA produced approximately 2.5.times.10.sup.5 indpendent BG2036 transformants, and liquid culture aliquots from the four libraries were stored in 10% glycerol at 70.degree. C. Thawed aliquots of frozen cultures were plated on LB/5 .mu.g/ml cmp/1.6% skim milk plates (Wells, J. A., et al. (1983) Nucleic Acids Res., 11, 7911-7925), and fresh colonies were arrayed onto 96-well microtiter plates containing 150 l per well LB media plus 12.5 .mu.g/ml cmp. After 1 h at room temperature, a replica was stamped (using a matched 96 prong stamp) onto a 132 mm BA 85 nitrocellulose filter (Schleicher and Scheull) which was layered on a 140 mm diameter LB/cmp/skim milk plate. Cells were grown about 16 h at 30.degree. C. until halos of proteolysis were roughly 5-7 mm in diameter and filters were transferred directly to a freshly prepared agar plate at 37.degree. C. containing only 1.6% skim milk and 50 mM sodium phosphate pH 11.5. Filters were incubated on plates for 3-6 h at 37.degree. C. to produce halos of about 5 mm for wild-type subtilisin and were discarded. The plates were stained for 10 min at 24.degree. C. with Coomassie blue solution (0.25%) Coomassie blue (R-250) 25% ethanol) and destained with 25% ethanol, 10% acetic acid for 20 min. Zones of proteolysis appeared as blue halos on a white background on the underside of the plate and were compared to the original growth plate that was similarly stained and destained as a control. Clones were considered positive that produced proportionately larger zones of proteolysis on the high pH plates relative to the original growth plate. Negative clones gave smaller halos under alkaline conditions. Positive and negative clones were restreaked to colony purify and screened again in triplicate to confirm alkaline pH results.
D. Identification and Analysis of Mutant Subtilisins
Plasmid DNA from 5 ml overnight cultures of more alkaline active B. subtilis clones was prepared according to Birnboim and Doly (1979) except that incubation with 2 mg/ml lysozyme proceeded for 5 min at 37.degree. C. to ensure cell lysis and an additional phenol/CHCl.sub.3 extraction was employed to remove contaminants. The 1.5 kb EcoRI-BamHI fragment containing the subtilisin gene was ligated into M13mp11 and template DNA was prepared for DNA sequencing (Messing, J., et al. (1982) Gene, 19 269-276). Three DNA sequencing primers ending at codon 26, +95, and +155 were synthesized to match the subtilisin coding sequence. For preliminary sequence identification a single track of DNA sequence, corresponding to the dNTPaS misincorporation library from which the mutant came, was applied over the entire mature protein coding sequence (i.e., a single dideoxyguanosine sequence track was applied to identify a mutant from the dGTPas library). A complete four track of DNA sequence was performed 200 bp over the site of mutagenesis to confirm and identify the mutant sequence (Sanger, F., et al., (1980) J. Mol. Biol., 143, 161-178). Confirmed positive and negative bacilli clones were cultured in LB media containing 12.5 .mu.g/mL cmp and purified from culture supernatants as previously described (Estell, D. A., et al., (1985) J. Biol. Chem., 260, 6518-6521). Enzymes were greater than 98% pure as analyzed by SDS-polyacrylamide gel electrophoresis (Laemmli, U. K. (1970), Nature, 227, 680-685), and protein concentrations were calculated from the absorbance at 280 nm (.epsilon..sub.280.sup.0.1% =1.17, Maturbara, H., et al. (1965), J. Biol. Chem, 1125-1130).
Enzyme activity was measured with 200 .mu.g/mL succinyl-L-AlaL-AlaL-ProL-Phep-nitroanilide (Sigma) in 0.1M Tris pH 8.6 or 0.1 M CAPS pH 10.8 at 25.degree. C. Specific activity (.mu. moles product/min-mg) was calculated from the change in absorbance at 410 nm from production of p-nitroaniline with time per mg of enzyme (E410=8,840 M-1 cm-1; Del Mar, E. G., et al. (1979), Anal. Biochem., 99, 316-320). Alkaline autolytic stability studies were performed on purified enzymes (200 .mu.g/mL) in 0.1 M potassium phosphate (pH 12.0) at 37C. At various times aliquots were assayed for residual enzyme activity (Wells, J. A., et al. (1986) J. Biol. Chem., 261, 6564-6570).
E. Results
1. Optimization and analysis of mutagenesis frequency
A set of primer-template molecules that were randomly 3'-terminated over the subtilisin gene (FIG. 31) was produced by variable extension from a fixed 5'-primer (The primer mutated a unique AvaI site at codon 11 in the subtilisin gene). This was achieved by stopping polymerase reactions with EDTA after various times of extension. The extent and distribution of duplex formation over the 1 kb subtilisin gene fragment was assessed by multiple restriction digestion (not shown). For example, production of new HinfI fragments identified when polymerase extension had proceeded past Ile110, Leu233, and Asp259 in the subtilisin gene.
Misincorporation of each dNTP.alpha.s at randomly terminated 3' ends by AMV reverse transcriptase (Zakour, R. A., et al. (1982), Nature, 295, 708-710; Zakour, R. A., et al. (1984), Nucleic Acids Res., 12, 6615-6628) used conditions previously described (Champoux, J. J., (1984), Genetics, 2, 454-464). The efficiency of each misincorporation reaction was estimated to be greater than 80% by the addition of each dNTP.alpha.s to the AvaI restriction primer, and analysis by polyacrylamide gel electrophoresis (Champoux, J. J., (1984). Misincorporations were sealed by polymerization with all four dNTP's and closed circular DNA was produced by reaction with DNA ligase.
Several manipulations were employed to maximize the yield of the mutant sequences in the heteroduplex. These included the use of a deoxyuridine containing template (Kunkel, T. A. (1985), Proc. Natl. Acad. Sci. USA, 82 488-492; Pukkila, P. J. et al., (1983), Genetics, 104, 571-582), invitro methylation of the mutagenic strand (Kramer, W. et al. (1982) Nucleic Acids Res., 10 6475-6485), and the use of AvaI restriction-selection against the wild-type template strand which contained a unique AvaI site. The separate contribution of each of these enrichment procedures to the final mutagenesis frequency was not determined, except that prior to AvaI restriction-selection roughly one-third of the segregated clones in each of the four pools still retained a wild-type AvaI site within the subtilisin gene. After AvaI restriction-selection greater than 98% of the plasmids lacked the wild-type AvaI site.
The 1.5 kb EcoRI-BamHI subtilisin gene fragment that was resistant to AvaI restriction digestion, from each of the four CsCl purified M13 RF pools was isolated on low melting agarose. The fragment was ligated in situ from the agarose with a similarly cut E. coli-B. subtilis shuttle vector, pB0180, and transformed directly into E. coli LE393. Such direct ligation and transformation of DNA isolated from agarose avoided loses and allowed large numbers of recombinants to be obtained (>100,000 per .mu.g equivalent of input M13 pool).
The frequency of mutagenesis for each of the four dNTP.alpha.s misincorporation reactions was estimated from the frequency that unique restriction sites were eliminated (Table XX). The unique restriction sites chosen for this analysis, ClaI, PvuII, and KpnI, were distributed over the subtilisin gene starting at codons 35, 104, and 166, respectively. As a control, the mutagenesis frequency was determined at the PstI site located in the .beta. lactamase gene which was outside the window of mutagenesis. Because the absolute mutagenesis frequency was close to the percentage of undigested plasmid DNA, two rounds of restriction-selection were necessary to reduce the background of surviving uncut wild-type plasmid DNA below the mutant plasmid (Table XX). The background of surviving plasmid from wild-type DNA probably represents the sum total of spontaneous mutations, uncut wild-type plasmid, plus the efficiency with which linear DNA can transform E. coli. Subtracting the frequency for unmutagenized DNA (background) from the frequency for mutant DNA, and normalizing for the window of mutagenesis sampled by a given restriction analysis (4-6 bp) provides an estimate of the mutagenesis efficiency over the entire coding sequence (.sub.-- 1000 bp).
TABLE XX______________________________________.alpha.-thiol Restric-dNTP tion Site % resistant clones.sup.(c) % resistant % mutantsmisincor- Selec- 1st 2nd clones over perporated.sup.(b) tion round round Total Background.sup.(d) 1000 bp.sup.(e)______________________________________None PstI 0.32 0.7 0.002 0 --G PstI 0.33 1.0 0.003 0.001 0.2T PstI 0.32 <0.5 <0.002 0 0C PstI 0.43 3.0 0.013 0.011 3None ClaI 0.28 5 0.014 0 --G ClaI 2.26 85 1.92 1.91 380T ClaI 0.48 31 0.15 0.14 35C ClaI 0.55 15 0.08 0.066 17None PvuII 0.08 29 0.023 0 --G PvuII 0.41 90 0.37 0.35 88T PvuII 0.10 67 0.067 0.044 9C PvuII 0.76 53 0.40 0.38 95None KpnI 0.41 3 0.012 0 --G KpnI 0.98 35 0.34 0.33 83T KpnI 0.36 15 0.054 0.042 8C KpnI 1.47 26 0.38 0.37 93______________________________________ .sup.(a) Mutagenesis frequency is estimated from the frequency for obtaining mutations that alter unique restriction sites within the mutagenized subtilisin gene (i.e., ClaI, PvuII, or KpnI) compared to mutation frequencies of the PstI site, that is outside the window of mutagenesis. .sup.(b) Plasmid DNA was from wildtype (none) or mutagenized by dNTP.alpha.s misincorporation as described. .sup.(c) Percentage of resistant clones was calculated from the fraction of clones obtained after three fold or greater overdigestion of the plasmid with the indicated restriction enzyme compared to a nondigested control. Restrictionresistant plasmid DNA from the first round was subjected to a second round of restrictionselection. The total represents the product of the fractions of resistant clones # obtained from both rounds of selection and gives percentage of restrictionsite mutant clones in the original starting pool. Frequencies were derived from counting at least 20 colonies and usually greater than 100. .sup.(d) Percent resistant clones was calculated by subtracting the percentage of restrictionresistant clones obtained for wildtype DNA (i.e. none) from that obtained for mutant DNA. .sup.(e) This extrapolates from the frequency of mutation over each restriction site to the entire subtilisin gene (.about.1 kb). This has been normalized to the number of possible bases (4-6 bp) within each restriction site that can be mutagenized by a given misincorporation event.
From this analysis, the average percentage of subtilisin genes containing mutations that result from dGTP.alpha.s, dCTP.alpha.s, or dTTP.alpha.s misincorporation was estimated to be 90, 70, and 20 percent, respectively. These high mutagenesis frequencies were generally quite variable depending upon the dNTP.alpha.s and misincorporation efficiencies at this site. Misincorporation efficiency has been reported to be both dependent on the kind of mismatch, and the context of primer (Champoux, J. J., (1984); Skinner, J. A., et al. (1986) Nucleic Acids Res., 14, 6945-6964). Biased misincorporation efficiency of dGTP.alpha.s and dCTP.alpha.s over dTTP.alpha.s has been previously observed (Shortle, D., et al. (1985), Genetics, 110, 539-555). Unlike the dGTP.alpha.s, dCTP.alpha.s, and dTTP.alpha.s libraries the efficiency of mutagenesis for the dATP.alpha.s misincorporation library could not be accurately assessed because 90% of the restriction-resistant plasmids analyzed simply lacked the subtilisin gene insert. This problem probably arose from self-ligation of the vector when the dATP.alpha.s mutagenized subtilisin gene was subcloned from M13 into pB0180. Correcting for the vector background, we estimate the mutagenesis frequency around 20 percent in the dATP.alpha.s misincorporation library. In a separate experiment (not shown), the mutagenesis efficiencies for dGTP.alpha.s and dTTP.alpha.s misincorporation were estimated to be around 50 and 30 percent, respectively, based on the frequency of reversion of an inactivating mutation at codon 169.
The location and identity of each mutation was determined by a single track of DNA sequencing corresponding to the misincorporated .alpha.thiodeoxy-nucleotide over the entire gene followed by a complete four track of DNA sequencing focused over the site of mutation. Of 14 mutants identified, the distribution was similar to that reported by Shortle and Lin (1985), except we did not observe nucleotide insertion or deletion mutations. The proportion of AG mutations was highest in the G misincorporation library, and some unexpected point mutations appeared in the dTTPas and dCTPas libraries.
2. Screening and Identification of Alkaline Stability Mutants of Subtilisin
It is possible to screen colonies producing subtilisin by halos of casein digestion (Wells, J. A. et al. (1983) Nucleic Acids Res., 11, 7911-7925). However, two problems were posed by screening colonies under high alkaline conditions (>pH 11). First, B. subtilis will not grow at high pH, and we have been unable to transform an alkylophilic strain of bacillus. This problem was overcome by adopting a replica plating strategy in which colonies were grown on filters at neutral pH to produce subtilisin and filters subsequently transferred to casein plates at pH 11.5 to assay subtilisin activity. However, at pH 11.5 the casein micells no longer formed a turbid background and thus prevented a clear observation of proteolysis halos. The problem was overcome by briefly staining the plate with Coomasssie blue to amplify proteolysis zones and acidifying the plates to develop casein micell turbidity. By comparison of the halo size produced on the reference growth plate (pH 7) to the high pH plate (pH 11.5), it was possible to identify mutant subtilisins that had increased (positives) or decreased (negatives) stability under alkaline conditions.
Roughly 1000 colonies were screened from each of the four misincorporation libraries. The percentage of colonies showing a differential loss of activity at pH 11.5 versus pH 7 represented 1.4, 1.8, 1.4, and 0.6% of the total colonies screened from the thiol dGTP.alpha.s, dATP.alpha.s, dTTP.alpha.s, and dCTP.alpha.s libraries, respectively. Several of these negative clones were sequenced and all were found to contain a single base change as expected from the misincorporation library from which they came. Negative mutants included A36, E170 and V50. Two positive mutants were identified as V107 and R213. The ratio of negatives to positives was roughly 50:1.
3. Stability and Activity of Subtilisin Mutants at Alkaline pH
Subtilisin mutants were purified and their autolytic stabilities were measured by the time course of inactivation at pH 12.0 (FIGS. 32 and 33). Positive mutants identified from the screen (i.e., V107 and R213) were more resistant to alkaline induced autolytic inactivation compared to wild-type; negative mutants (i.e., E170 and V50) were less resistant. We had advantageously produced another mutant at position 50 (F50) by site-directed mutagenesis. This mutant was more stable than wild-type enzyme to alkaline autolytic inactivation (FIG. 33) At the termination of the autolysis study, SDS-PAGE analysis confirmed that each subtilisin variant had autolyzed to an extent consistent with the remaining enzyme activity.
The stabilizing effects of V107, R213, and F50 are cumulative. See Table XXI. The double mutant, V107/R213 (made by subcloning the 920 bp EcoRI-KpnI fragment of pB0180V107 into the 6.6 kb EcoRI-KpnI fragment of pB0180R213), is more stable than either single mutant. The triple mutant, F50/V107/R213 (made by subcloning the 735 bp EcoRI-PvuII fragment of pF50 (Example 2) into the 6.8 kb EcoRI-PvuII fragment of pB0180/V107, is more stable than the double mutant V107/R213 or F50. The inactivation curves show a biphasic character that becomes more pronounced the more stable the mutant analyzed. This may result from some destabilizing chemical modification(s) (eg., deamidation) during the autolysis study and/or reduced stabilization caused by complete digestion of larger autolysis peptides. These alkaline autolysis studies have been repeated on separately purified enzyme batches with essentially the same results. Rates of autolysis should depend both on the conformational stability as well as the specific activity of the subtilisin variant (Wells, J. A., et al. (1986), J. Biol. Chem., 261, 6564-6570). It was therefore possible that the decreases in autolytic inactivation rates may result from decreases in specific activity of the more stable mutant under alkaline conditions. In general the opposite appears to be the case. The more stable mutants, if anything, have a relatively higher specific activity than wild-type under alkaline conditions and the less stable mutants have a relatively lower specific activity. These subtle effects on specific activity for V107/R213 and F50/V107R213 are cumulative at both pH 8.6 and 10.8. The changes in specific activity may reflect slight differences in substrate specificity, however, it is noteworthy that only positions 170 and 107 are within 6 .ANG. of a bound model substrate (Robertus, J. D., et al. (1972), Biochemistry 11, 2438-2449).
TABLE XXI______________________________________Relationship between relative specific activityat pH 8.6 or 10.8 and alkaline autolytic stability Alkaline autolysis Relative specific activity half-timeEnzyme pH 8.6 pH 10.8 (min).sup.(b)______________________________________Wild-type 100 .+-. 1 100 .+-. 3 86Q170 46 .+-. 1 28 .+-. 2 13V107 126 .+-. 3 99 .+-. 5 102R213 97 .+-. 1 102 .+-. 1 115V107/R213 116 .+-. 2 106 .+-. 3 130V50 66 .+-. 4 61 .+-. 1 58F50 123 .+-. 3 157 .+-. 7 131F50/V107/ 126 .+-. 2 152 .+-. 3 168R213______________________________________ .sup.(a) Relative specific activity was the average from triplicate activity determinations divided by the wildtype value at the same pH. The average specific activity of wildtype enzyme at pH 8.6 and 10.8 was 70 .mu.moles/minmg and 37 .mu.moles/minmg, respectively. .sup.(b) Time to reach 50% activity was taken from FIGS. 32 and 33.
F. Random Cassette Mutagenesis of Residues 197 through 228
Plasmid p.DELTA.222 (Wells, et al., (985) Gene 34, 315-323) was digested with PstI and BamHI and the 0.4 kb PstI/BamHI fragment (fragment 1, see FIG. 34) purified from a polyacrylamide gel by electroelution (Maniatis, et al. (1982) Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).
The 1.5 kb EcoRI/BamHI fragment from pS4.5 was cloned into M13mp9. Site directed mutagenesis was performed to create the A197 mutant and simultaneously insert a silent SstI site over codons 195-196. The mutant EcoRI/BamHI fragment was cloned back into pBS42. The A197 plasmid was digested with BamHI and SstI and the 5.3 kb BamHI/SstI fragment (fragment 2) was purified from low melting agarose.
Complimentary oligonucleotides were synthesized to span the region from SstI (codons 195-196) to PstI (codons 228-230). These oligodeoxynucleotides were designed to (1) restore codon 197 to the wild type, (2) re-create a silent KpnI site present in p.DELTA.222 at codons 219-220, (3) create a silent SmaI site over codons 210-211, and (4) eliminate the PstI site over codons 228-230 (see FIG. 35). Oligodoxynucleotides were synthesized with 2% contaminating nucleotides at each cycle of synthesis, e.g., dATP reagent was spiked with 2% dCTP, 2% dGTP, and 2% dTTP. For 97-mers, this 2% poisoning should give the following percentages of non-mutant, single mutants and double or higher mutants per strand with two or more misincorporations per complimentary strand: 14% non-mutant, 28% single mutant, and 57% with .gtoreq.2 mutations, according to the general formula ##EQU2## where .mu. is the average number of mutations and n is a number class of mutations and f is the fraction of the total having that number of mutations. Complimentary oligodeoxynucleotide pools were phosphorylated and annealed (fragment 3) and then ligated at 2-fold molar excess over fragments 1 and 2 in a three-way ligation.
E. coli MM294 was transformed with the ligation reaction, the transformation pool grown up over night and the pooled plasmid DNA was isolated. This pool represented 3.4.times.10.sup.4 independent transformants. This plasmid pool was digested with PstI and then used to retransform E. coli. A second plasmid pool was prepared and used to transform B. subtilis (BG2036). Approximately 40% of the BG2036 transformants actively expressed subtilisin as judged by halo-clearing on casein plates. Several of the non-expressing transformants were sequenced and found to have insertions or deletions in the synthetic cassettes. Expressing BG2036 mutants were arrayed in microtiter dishes with 150 .mu.l of LB/12.5 .mu.g/mL chloramphenicol (cmp) per well, incubated at 37.degree. C. for 3-4 hours and then stamped in duplicate onto nitrocellulose filters laid on LB 1.5% skim milk/5 .mu.g/mL cmp plates and incubated overnight at 33.degree. C. (until halos were approximately 4-8 mm in diameter). Filters were then lifted to stacks of filter paper saturated with 1.times.Tide commercial grade detergent, 50 mM Na.sub.2 CO.sub.3, pH 11.5 and incubated at 65.degree. C. for 90 min. Overnight growth plates were Commassie stained and destained to establish basal levels of expression. After this treatment, filters were returned to pH7/skim milk/20 .mu.g/mL tetracycline plates and incubated at 37.degree. C. for 4 hours to overnight.
Mutants identified by the high pH stability screen to be more alkaline stable were purified and analyzed for autolytic stability at high pH or high temperature. The double mutant C204/R213 was more stable than wild type at either high pH or high temperature (Table XXII).
This mutant was dissected into single mutant parents (C204 and R213) by cutting at the unique SmaI restriction site (FIG. 35) and either ligating wild type sequence 3' to the SmaI site to create the single C204 mutant or ligating wild type sequence 5.degree. to the SmaI site to create the single R213 mutant. Of the two single parents, C204 was nearly as alkaline stable as the parent double mutant (C204/R213) and slightly more thermally stable. See Table XXII. The R213 mutant was only slightly more stable than wild type under both conditions (not shown).
Another mutant identified from the screen of the 197 to 228 random cassette mutagenesis was R204. This mutant was more stable than wild type at both high pH and high temperature but less stable than C204.
TABLE XXII______________________________________Stability of subtilisin variantsPurified enzymes (200 .mu.g/mL) were incubated in 0.1Mphosphate, pH 12 at 30.degree. C. for alkaline autolysis, or in2 mM CaCl.sub.2, 50 mM MOPS, pH 7.0 at 62.degree. C. for thermalautolysis. At various times samples were assayed forresidual enzyme activity. Inactivations were roughlypseudo-first order, and t 1/2 gives the time it tookto reach 50% of the starting activity in two separateexperiments. t 1/2 t 1/2 (alkaline (thermal autolysis) autolysis) Exp. Exp. Exp. Exp.Subtilisin variant #1 #2 #1 #2______________________________________wild type 30 25 20 23F50/V107/R213 49 41 18 23R204 35 32 24 27C204- 43 46 38 40C204/R213 50 52 32 36L204/R213 32 30 20 21______________________________________
G. Random Mutagenesis at Codon 204
Based on the above results, codon 204 was targeted for random mutagenesis. Mutagenic DNA cassettes (for codon at 204) all contained a fixed R213 mutation which was found to slightly augment the stability of the C204 mutant.
Plasmid DNA encoding the subtilisin mutant C204/R213 was digested with SstI and EcoRI and a 1.0 kb EcoRi/SstI fragment was isolated by electro-elution from polyacrylamide gel (fragment 1, see FIG. 35).
C204/R213 was also digested with SmaI and EcoRI and the large 4.7 kb fragment, including vector sequences and the 3' portion of coding region, was isolated from low melting agarose (fragment 2, see FIG. 36).
Fragments 1 and 2 were combined in four separate three-way ligations with heterophosphorylated fragments 3 (see FIGS. 36 and 37). This heterophosphorylation of synthetic duplexes should preferentially drive the phosphorylated strand into the plasmid ligation product. Four plasmid pools, corresponding to the four ligations, were restricted with SmaI in order to linearize any single cut C204/R213 present from fragment 2 isolation, thus reducing the background of C204/R213. E. coli was then re-transformed with SmaI-restricted plasmid pools to yield a second set of plasmid pools which are essentially free of C204/R213 and any non-segregated heterduplex material.
These second enriched plasmid pools were then used to transform B. subtilis (BG2036) and the resulting four mutant pools were screened for clones expressing subtilisin resistant to high pH/temperature inactivation. Mutants found positive by such a screen were further characterized and identified by sequencing.
The mutant L204/R213 was found to be slightly more stable than the wild type subtilisin. See Table XXII.
Having described the preferred embodiments of the present invention, it will appear to those ordinarily skilled in the art that various modifications may be made to the disclosed embodiments, and that such modifications are intended to be within the scope of the present invention.
Claims
  • 1. A recombinant DNA encoding a subtilisin modified by a substitution of at least one amino acid at a residue position with a different naturally occurring amino acid, said residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr21, Thr22, Ser24, Asp36, Gly46, Ala48, Ser49, Met50, Asn77, Ser87, Lys94, Val95, Leu96, IIe107, Gly110, Met124, Lys170, Tyr171, Pro172, Asp197, Met199, Ser204, Lys213, His67, Leu126, Leu135, Gly97, Ser101, Gly102, Trp103, Gly127, Gly128, Pro129, Tyr214 and Gly215, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 2. A DNA according to claim 1 wherein said group of equivalent residues consists of Tyr21, Thr22, Ser24, Asp36, Gly46, Ala48, Ser49, Met50, Asn77, Ser87, Lys94, Val95, Leu96, IIe107, Gly110, Met124, Lys170, Tyr171, Pro172, Asp197, Met199, Ser204 and Lys213.
  • 3. A recombinant DNA according to claim 1 wherein said residue position is Tyr21.
  • 4. A recombinant DNA according to claim 1 wherein said residue position is Tyr21 and said different naturally occurring amino acid is selected from the group consisting of phenylalanine and leucine.
  • 5. A recombinant DNA according to claim 1 wherein said residue position is Thr22.
  • 6. A recombinant DNA according to claim 1 wherein said residue position is Thr22 and said different naturally occurring amino acid is selected from the group consisting of cysteine and lysine.
  • 7. A recombinant DNA according to claim 1 wherein said residue position is Ser24.
  • 8. A recombinant DNA according to claim 1 wherein said residue position is Ser24 said different naturally occurring amino acid is selected from the group consisting of alanine or cysteine.
  • 9. A recombinant DNA according to claim 1 wherein said residue position is Asp36.
  • 10. A recombinant DNA according to claim 1 wherein said residue position is Asp36 said different naturally occurring amino acid is selected from the group consisting of alanine and glycine.
  • 11. A recombinant DNA according to claim 1 wherein said residue position is Gly46.
  • 12. A recombinant DNA according to claim 1 wherein said residue position is Gly46 and said different naturally occurring amino acid is valine.
  • 13. A recombinant DNA according to claim 1 wherein said residue position is Ala48.
  • 14. A recombinant DNA according to claim 1 wherein said residue position is Ala-48 said different naturally occurring amino acid is selected from the group consisting of glutamine, valine and arginine.
  • 15. A recombinant DNA according to claim 1 wherein said residue position is Ser49.
  • 16. A recombinant DNA according to claim 1 wherein said residue position is Ser49 and said different naturally occurring amino acid is selected from the group consisting of cysteine and leucine.
  • 17. A recombinant DNA according to claim 1 wherein said residue position is Met50.
  • 18. A recombinant DNA according to claim 1 wherein said residue position is Met50 and said different naturally occurring amino acid is selected from the group consisting of cysteine, phenylalanine, valine leucine, lysine and isoleucine.
  • 19. A recombinant DNA according to claim 1 wherein said residue position is Asn77.
  • 20. A recombinant DNA according to claim 1 wherein said residue position is Asn77 and said different naturally occurring amino acid is aspartic acid.
  • 21. A recombinant DNA according to claim 1 wherein said residue position is Ser87.
  • 22. A recombinant DNA according to claim 1 wherein said residue position is Ser87 and said different naturally occurring amino acid is selected from the group consisting of cysteine and asparagine.
  • 23. A recombinant DNA according to claim 1 wherein said residue position is Lys94.
  • 24. A recombinant DNA according to claim 1 wherein said residue position is Lys94 and said different naturally occurring amino acid is selected from the group consisting of cysteine, arginine and glutamine.
  • 25. A recombinant DNA according to claim 1 wherein said residue position is Val95.
  • 26. A recombinant DNA according to claim 1 wherein said residue position is Val95 and said different naturally occurring amino acid is selected from the group consisting of cysteine, leucine and isoleucine.
  • 27. A recombinant DNA according to claim 1 wherein said residue position is Leu96.
  • 28. A recombinant DNA according to claim 1 wherein said residue position is Gly110.
  • 29. A recombinant DNA according to claim 1 wherein said residue position is Gly110 and said different naturally occurring amino acid is selected from the group consisting of cysteine and arginine.
  • 30. A recombinant DNA according to claim 1 wherein said residue position is Met124.
  • 31. A recombinant DNA according to claim 1 wherein said residue position is Met124 and said different naturally occurring amino acid is selected from the group consisting of lysine, alanine, isoleucine and leucine.
  • 32. A recombinant DNA according to claim 1 wherein said residue position is Lys170.
  • 33. A recombinant DNA according to claim 1 wherein said residue position is Lys170 and said different naturally occurring amino acid is selected from the group consisting of glutamic acid and arginine.
  • 34. A recombinant DNA according to claim 1 wherein said residue position is Tyr171.
  • 35. A recombinant DNA according to claim 1 wherein said residue position is Tyr171 and said different naturally occurring amino acid is selected from the group consisting of phenylalanine, lysine, arginine, glutamic acid and glutamine.
  • 36. A recombinant DNA according to claim 1 wherein said residue position is Pro172.
  • 37. A recombinant DNA according to claim 1 wherein said residue position is Pro172 and said different naturally occurring amino acid is selected from the group consisting of glutamic acid, glutamine, aspartic acid and asparagine.
  • 38. A recombinant DNA according to claim 1 wherein said residue position is Asp197.
  • 39. A recombinant DNA according to claim 1 wherein said residue position is Asp197 and said different naturally occurring amino acid is selected from the group consisting of arginine and alanine.
  • 40. A recombinant DNA according to claim 1 wherein said residue position is Met199.
  • 41. A recombinant DNA according to claim 1 wherein said residue position is Met199 and said different naturally occurring amino acid is isoleucine.
  • 42. A recombinant DNA according to claim 1 wherein said residue position is Ser204.
  • 43. A recombinant DNA according to claim 1 wherein said residue position is Ser204 and said different naturally occurring amino acid is selected from the group consisting of cysteine, arginine, leucine and proline.
  • 44. A recombinant DNA according to claim 1 wherein said residue position is Lys213.
  • 45. A recombinant DNA according to claim 1 wherein said residue position is Lys213 and said different naturally occurring amino acid is selected from the group consisting of arginine and threonine.
  • 46. A recombinant DNA according to claim 1 wherein said residue position is His67.
  • 47. A recombinant DNA according to claim 1 wherein said residue position is Leu126.
  • 48. A recombinant DNA according to claim 1 wherein said residue position is Gly97.
  • 49. A recombinant DNA according to claim 1 wherein said residue position is Gly102.
  • 50. A recombinant DNA according to claim 1 wherein said residue position is Trp103.
  • 51. A recombinant DNA according to claim 1 wherein said residue position is Gly127.
  • 52. A recombinant DNA according to claim 1 wherein said residue position is Tyr214.
  • 53. A recombinant DNA according to claim 1 wherein said residue position is Gly215.
  • 54. A recombinant DNA according to claim 1 further comprising a substitution of an amino acid at a second residue position with a different naturally occurring amino acid, said second residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp32, Ser33, His64, Tyr104, Ala152, Asn155, Glu156, Gly166, Gly169, Phe189, Tyr217 and Met222.
  • 55. A recombinant DNA encoding a subtilisin modified by a substitution of at least one amino acid at a residue position with a different naturally occurring amino acid, said residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of His67, IIe107, Leu135, Gly97, Ala98, Gly100, Ser101, Gly102, Gin103, Leu126, Gly127, Gly128, Pro129, Lys213, Tyr214, Gly215, Gly153, Asn154, Gly157, Thr158, Ser159, Gly160, Ser161, Ser162, Ser163, Thr164, Val165, Tyr167, Pro168 and Lys170, Tyr171, and Pro172, wherein said modified subtilisin has altered substrate specificity as compared to the same subtilisin having the amino acid naturally occurring at the residue position, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 56. A recombinant DNA according to claim 55 wherein said residue position is Ala98.
  • 57. A recombinant DNA according to claim 55 wherein said residue position is Gly100.
  • 58. A recombinant DNA according to claim 55 wherein said residue position is Gly153.
  • 59. A recombinant DNA according to claim 55 wherein said residue position is Asn154.
  • 60. A recombinant DNA according to claim 55 wherein said residue position is Gly157.
  • 61. A recombinant DNA according to claim 55 wherein said residue position is Thr158.
  • 62. A recombinant DNA according to claim 55 wherein said residue position is Ser159.
  • 63. A recombinant DNA according to claim 55 wherein said residue position is Gly160.
  • 64. A recombinant DNA according to claim 55 wherein said residue position is Ser161.
  • 65. A recombinant DNA according to claim 55 wherein said residue position is Ser162.
  • 66. A recombinant DNA according to claim 55 wherein said residue position is Ser163.
  • 67. A recombinant DNA according to claim 55 wherein said residue position is Tyr167.
  • 68. A recombinant DNA according to claim 55 wherein said residue position is Pro168.
  • 69. A recombinant DNA according to claim 55 further comprising a substitution of an amino acid at a second residue position with a different naturally occurring amino acid, said second residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Tyr104, Ala152, Glu156, Gly166, Gly169, Phe189 and Tyr217.
  • 70. A recombinant DNA encoding a subtilisin modified by a substitution of at least one amino acid at a residue position with a different naturally occurring amino acid, said residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp36, IIe107, Lys170, Asp197, Ser204, Lys213, Ser24, and Met50, wherein said modified subtilisin has altered alkaline stability as compared to the same subtilisin having the amino acid naturally occurring at the residue position, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 71. A recombinant DNA according to claim 70 further comprising a substitution of at least one amino acid at a second residue position with a different naturally occurring amino acid, said second residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Glu156, Gly166, Gly169, Tyr217 and Met222.
  • 72. A recombinant DNA encoding a subtilisin modified by a substitution of at least one amino acid at a residue position with a different naturally occurring amino acid, said residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Asp36, IIe107, Lys170, Ser204, Lys213, Met199 and Tyr21, wherein said modified subtilisin has altered thermal stability as compared to the same subtilisin having the amino acid naturally occurring at the residue position, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 73. A recombinant DNA encoding a subtilisin modified by a substitution of at least one amino acid at a residue position with a different naturally occurring amino acid, said residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Met50 and Met124, wherein said modified subtilisin has altered oxidative stability as compared to the same subtilisin having the amino acid naturally occurring at the residue position, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 74. A recombinant DNA according to claim 73 further comprising the substitution of a second amino acid residue at the position equivalent to Met222.
  • 75. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Thr22/Ser87, Ser24/Ser87 and Tyr21Thr22/Ser87, wherein said modified subtilisin has altered thermal stability as compared to the same subtilisin having the amino acids naturally occurring at the residue positions, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 76. A recombinant DNA according to claim 75 wherein said Thr22, Ser24 and Ser87 are substituted with cysteine.
  • 77. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Met50/Met124, Met50/Met222, Met124/Met222 and Met50/Met124/Met222, wherein said modified subtilisin has altered oxidative stability as compared to the same subtilisin having the amino acids naturally occurring at the residue positions, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 78. A recombinant DNA according to 77 wherein said Met50 is substituted with Phe, said Met124 is substituted with IIe or Leu and said Met222 is substituted with Gln.
  • 79. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Gly166/Met222 and Gly169/Met222, wherein said modified subtilisin has altered oxidative stability as compared to the same subtilisin having the amino acids naturally occurring at the residue positions, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 80. A recombinant DNA according to claim 79 wherein said Gly166 is substituted with Ala, Phe, Lys and Val, and said Met222 is substituted with Ala or Cys.
  • 81. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Glu156/Gly166, wherein said modified subtilisin has improved enzyme performance as compared to the same subtilisin having the amino acids naturally occurring at the residue positions, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 82. A recombinant DNA according to claim 81 wherein said Glu156 is substituted with Gln or Ser and said Gly166 is substituted with Lys.
  • 83. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Glu156/Bly169/Tyr217, Glu156/Gly166/Tyr217 and Glu156/Tyr217, wherein said modified subtilisin has altered substrate specificity and kinetics as compared to the same subtilisin having the amino acids naturally occurring at the residue positions, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 84. A recombinant DNA according to claim 83 further comprising the substitution of Met150 with Phe.
  • 85. A recombinant DNA according to claim 83 wherein said Glu156 is substituted with Ser or Gln, said Gly169 is substituted with Ala and said Tyr217 is substituted with Leu.
  • 86. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of IIe107/Lys213, Ser204/Lys213, Glu156/Gly166, Met50/Glu156/Gly169/Tyr217 and Met50/IIe107/Lys213, wherein said modified subtilisin has altered alkaline or thermal stability as compared to the same subtilisin having the amino acids naturally occurring at residue positions, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 87. A recombinant DNA according to claim 86 wherein said IIe107 is substituted with Val, said Lys213 is substituted with Arg, said Glu156 is substituted with Gln or Ser, said Gly166 is substituted with Lys or Asn, and said Gly169 is substituted with Ala.
  • 88. A recombinant DNA encoding a subtilisin modified by at least a combination of substitutions of amino acids at residue positions with different naturally occurring amino acids, said combination of residue positions being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Thr22/Ser87, Ser24/Ser87, Ala45/Ala48, Ser49/Lys94, Ser49/Val95, Met50/Val95, Met50/Gly110, Met50/Met124, Met50/Met222, Met124/Met222, Glu156/Gly166, Glu156/Gly169, Gly166/Met222, Gly169/Met222, Tyr21/Thr22, Met50/Met124/Met222, Tyr21/Thr22/Ser87, Met50/Glu156/Gly166/Tyr217, Met50/Glu156/Tyr217, Met50/Glu56/Gly169/Tyr217, Met50/IIe107/Lys213, Ser204/Lys213, and IIe107/Lys213, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 89. A recombinant DNA encoding a subtilisin modified by at least a deletion of an amino acid at a residue position being selected from the group of equivalent amino acid residues of subtilisin naturally produced by Bacillus amyloliquefaciens consisting of Ser161, Ser162, Ser163 and Thr164, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 90. A recombinant DNA according to claim 89 wherein said deletion comprises .DELTA.161-164.
  • 91. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Ser101 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 92. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to IIe107 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 93. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Gly128 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 94. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Pro129 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 95. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Leu135 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 96. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Thr164 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein said modified subtilisin has altered substrate specificity as compared to the same subtilisin having the amino acid naturally occurring at the residue position equivalent to Thr164, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 97. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Val165 of the Bacillus amyloliquefaciens subtilisin with a different naturally occuring amino acid, wherein said modified subtilisin has altered substrate specificity as compared to the same subtilisin having the amino acid naturally occurring at the residue position equivalent to Val165, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 98. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Asp99 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein said modified subtilisin has altered substrate specificity as compared to the same subtilisin having the amino acid naturally occurring at the residue position equivalent to Asp99, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 99. A recombinant DNA encoding a subtilisin modified by a substitution of an amino acid at the residue position equivalent to Ala45 of the Bacillus amyloliquefaciens subtilisin with a different naturally occurring amino acid, wherein the subtilisin which is modified is selected from the group consisting of subtilisins derived from procaryotes, yeast and fungi.
  • 100. A recombinant DNA according to claim 1, 55, 70 or 72 wherein said subtilisin is derived from a Bacillus subtilisin.
  • 101. A recombinant DNA according to claim 100 wherein Bacillus subtilisin is Bacillus amyloliquefaciens subtilisin.
  • 102. An expression vector containing the DNA of claim 1, 55, 70, or 72.
Parent Case Info

This application is a Divisional of U.S. Ser. No. 08/212,291, filed Mar. 14, 1994, which is a Continuation of Ser. No. 07/898,382, filed Jun. 9, 1992, now abandoned, which is a Continuation Application of Ser. No. 07/747,459, filed Aug. 12, 1991, now abandoned, which is a Continuation Application of Ser. No. 07/540,868, filed Jun. 14, 1990, now abandoned, which is a Continuation Application of Ser. No. 07/035,652, filed Apr. 5, 1987, now abandoned, which is a Continuation-in-Part Application of Ser. No. 06/858,594, filed Apr. 30, 1986, now abandoned, which is a Continuation-in-Part Application of the following: Ser. No. 06/614,612, filed May 29, 1984, which issued as U.S. Pat. No. 4,760,025, Ser. No. 06/614,615, filed May 29, 1984, now abandoned, Ser. No. 06/614,617, filed May 29, 1984, now abandoned, and, Ser. No. 06/614,491, filed May 29, 1984, and now abandoned.

US Referenced Citations (5)
Number Name Date Kind
RE34606 Estell et al. May 1994
4002572 te Nijenhuis Jan 1977
4458066 Caruthers et al. Jul 1984
4543329 Daum et al. Sep 1985
4760025 Estell et al. Jul 1988
Foreign Referenced Citations (2)
Number Date Country
130756 Jan 1985 EPX
WO8503949 Sep 1985 WOX
Non-Patent Literature Citations (72)
Entry
Rastetter, W.H., "Enzyme engineering: applications and promise." Trends Biotechnol., 1:80-84 (1983).
Winter, G., et al., "Redesigning enzyme structure by site-directed mutagenesis: tyrosyl tRNA synthetase and ATP binding." Nature, 299:756-758 (1982).
Wallace, B.R., et al., "Oligonucleotide directed mutagenesis of the human .beta.-globin gene: a general method for producing specific point mutations in cloned DNA." Nucleic Acids Res., 9:3647-3656 (1981).
Shortle, D., et al., "Gap misrepair mutagenesis: Efficient site-directed induction of transition, transversion, and frameshift mutations in vitro." Proc. Natl. Acad. Sci. USA., 79:1588-1592 (1982).
Wells, J.A., "Cloning, sequencing, and secretion of Bacillus amyloliquefaciens subtilisin in Bacillus subtilis." Nucleic Acids Res., 11:8913-8926 (1985).
Vasantha, N., et al., "Genes for Alkaline Protease and Neutral Protease from Bacillus amyloliquefaciens Contain a Large Open Reading Frame Between the Regions Coding for Signal Sequence and Mature Protein." J. Bacteriol., 159:811-819 (1984).
Jacobs, M., et al., "Cloning, sequencing and expression of subtilisin Carlsberg from Bacillus licheniformis." Nucleic Acids Res., 13: 8913-8926 (1985).
Stahl, M.L., et al., "Replacement of the Bacillus subtilis Subtilisin Structural Gene with and In Vitro-Derived Deletion Mutation." J. Bacteriol., 158:411-418 (1984).
Svendsen, I., "Chemical Modifications of the Subtilisins with Special Reference to the Binding of Large Substrates. A Review." Carlsberg Res. Commun., 41:237-291 (1976).
Smith, E.L., "The Complete Sequence; Comparison with Subtilisin BPN; Evolutionary Relationships." J. Biol. Chem., 243:2184-2191 (1968).
Kurihara, M., et al., "Isolation and Sequence of the Chymotryptic Peptides and the Complete Amino Acid Sequence." J. Biol. Chem., 247:5619-5631 (1972).
Svendsen, I., et al., "Complete Amino Acid Sequence of Alkaline Mesentericopeptidase: A subtilisin isolate from a strain of Bacillus mesentericus." FEBS, 196:228-232 (1986).
Wright, C.S., "Structure of Subtilisin BPN' at 2.5 A Resolution." Nature, 221:235-242 (1969).
Grantham, R., "Amino Acid Difference Formula to Help Explain Protein Evolution." Science, 185:962-964 (1974).
Stauffer, C.E., et al., "The Effect on Subtilisin Activity of Oxidizing a Methionine Residue." J. Biol. Chem. 244:5333-5338 (1969).
Jaye, M., et al., "Isolation of a human anti-haemophilic factor IX cDNA clone using a unique 52-base synthetic oligonucleotide probe deduced from the amino acid sequence of bovine factor IX." Nucleic Acids Res., 11:2325-2335 (1983).
Cantor, C.R., et al. "Biophysical Chemistry: Part I: The conformation of biological macromolecules." W.H. Freeman and Company, San Francisco, pp. 3-154, 253-309 (1980).
Robertus, J.D., et al., "An X-Ray Crystallographic Study of the Binding of Peptide Chloromethyl Ketone INhibitors to Subtilisin BPN'," Biochemistry, 11:2439-2449 (1972).
Ricchelli, F., et al., "Effects of pH and Urea on the Conformational Properties of Subtilisin DY." Biochemical J., 207:201-205 (1982).
Mattoccia, E., et al., "Mutation in the A Block of the Yeast tRNA.sup.Leu.sub.3 Gene that Allows Transcription but Abolishes Splicing and 5'-End Maturation," Cell, 32:67-76 (1983).
Inouye, S., et al., "Role of positive charge on the amino-terminal region of the signal peptide in protein secretion across the membrane." Proc. Natl. Acad. Sci. USA, 79:3438-3441 (1982).
Inouye, S., et al., "Effects of Mutations at Glycine Residues in the Hydrophobic Region of the Escherichia coli Prolipoprotein Signal Peptide on the Secretion across the Membrane." J. Biol. Chem., 259:3729-3733 (1984).
Carter, P., et al., "Improved Oligonucleotide Site-Directed Mutagenesis Using M13 Vectors." Nucleic Acids Res. , 13:4431-4443 (1985).
Baughman, G., et al., "Translational regulation of the L11 ribosomal protein operon of Escherichia coli: Analysis of the mRNA target site using olignucleotide-directed mutagenesis." Proc. Natl. Acad. Sci. USA, 81:5389-5393 (1984).
Carter, P.J., et al., "The Use of Double Mutants to Detect Structural Changes in the Active Site of the Tyrosyl-tRNA Synthetase (Bacillus stearothermophilus)." Cell, 33:835-840 (1984).
Stroud, R.M., Sci Amer., 131:74-88 (1974).
Kraut, J., Ann. Rev. Biochem., 46:331-358 (1977).
Markland, F.S., et al., The Enzymes, ed. Boyer, P.D., Acad Press, New York, vol. III, pp. 561-608 (1971).
Nedkov, P., et al., Hoppe-Seyler's Z. Physiol. Chem., 364:1537-1540 (1983).
Drenth, J., et al., Eur. J. Biochem., 26, 177-181 (1972).
Matthews, D.A., et al., J. Biol. Chem., 250:7120-7126 (1975).
Poulos, T.L., et al., J. Biol. Chem., 251:1097-1103 (1976).
Philipp, M., et al., Mol. Cell. Biochem., 51:5-32 (1983).
Jencks, W.P., Catalysis in Chemistry and Enzymology, McGraw-Hill, pp. 321-436 (1969).
Fersht, A., Enzyme Structure and Mechanism, Freeman, San Francisco, pp. 226-287 (1977).
Kaiser, E.T., et al., Ann. Rev. Biochem., 54:565-595 (1985).
Kraut, J., Ann. Rev. Biochem., 46:331-358 (1977).
Ulmer, K.M. Science, 219:666-671 (1983).
Wilkinson, A.J., et al., Biochemistry, 22:3581-3586 (1983).
Wilkinson, A.H., et al., Nature, 307:187-188 (1984).
Perry, L.J., et al., Science, 226:555-557 (1984).
Villafranca, D.E., et al., Science, 222:782-788 (1983).
Carter, P.J., et al., Cell, 38:835-840 (1984).
Craik, C.S., et al., Science, 228:291-297 (1985).
Polgar, L. and Sajgo, M., Biochem. Biophy. Acta., 667:351-354 (1981).
Paterson, A. and Clarke, P.H., J. Gen. Micro. 114:65-85 (1979).
Uehara, H., et al., J. Bacteriology, 139:583-590 (1979).
Kerjan, P., et al., Eur. J. Biochem., 98:353-362 (1979).
Wells, et al., Nucleic Acids Res., 11:7911-7923 (1983).
Thomas, et al., Nature, 318:37-38 (1985).
Gardell, et al., Nature, 317:551-555 (1985).
Vasantha, et al., J. Bacteriol., 165:837-842 (1986).
Zaghloul, et al., J. Bacteriol., 164:550-555 (1985).
Carter, et al., Science, 237:394-399 (1987).
Wells, et al., Cold Spring Harbor Symposia on Quantitative Biology, LII:647-652 (1987).
Toney et al., Science, 243:1485-1488 (1989).
Iverson, et al., Science, 243:1184-1188 (1989).
Wells, J.A., et al., "Designing Substrate Specificity by Protein Engineering of Electrostatic Interactions." Proc. Nat. Acad. Sci. USA, 84:1219-1223 (1987).
Estell, D.A., et al., "Probing Steric and Hydrophobic Effects on Enzyme-Substrate Interactions by Protein Engineering." Science, 233:659-663 (1986).
Wells, J.A., et al., "Protein Engineering of Subtilisin." Protein Engineering, pp. 279-287 (1987).
Abrahmsen, L., et al., "Engineering Subtilisin and Its Substrates for Efficient Ligation of Peptide Bonds in Aqueous Solution." Biochemistry, 30:4151-4159 (1991).
Markland, F.S., Carlsberg Res. Comm., 41:237-291 (1976).
Polgar, et al., Adv. Enzymol., 33:381-400 (1970).
Ottesen, et al., Meth. Enzymol., XIX:199-215 (1970).
Watson, J.D., in Molecular Biology of the Gene, 3rd Edition. Benjamin/Cummings Publ. Co., Inc. Menlo Park, CA p. 313 (1987).
Singleton, et al., Dictionary of Microbiology and Molecular Biology, Second Edition. John Wiley and Sons. Chichester. p. 741 (1987).
Wells, et al., Subtilisin: An Enzyme Designed to be Engineered, in Proteins: Form and Function (Bradshaw et al., eds.). Elsevier Trends Journals, Cambridge, UK, pp. 45-57 (1990).
Allinger, et al., in Organic Chemistry, Worth Publishers, New York, NY p. 757 (1971).
Pahler, A., et al., The EMBO Journal, vol. 3, "Three-dimensional structure of fungal proteinase K reveals similarity to bacterial subtilisin", pp. 1311-1314, 1984.
Meloun, B., et al., FEBS Letters, vol. 183, "Complete primary structure of thermitase from Thermoactinomyces vulgaris and its structural features related to the subtilisin-type proteinases", pp. 195-199, 1985.
Russell, A. J., et al., Nature, vol. 328, "Rational modification of enzyme catalysis by engineering surface charge", pp. 496-500, 1987.
Russell, A. J., et al., Journal of Molecular Biology, vol. 193, "Electrostatic effects on modification of charged groups in the active site cleft of subtilisin by protein engineering", pp. 803-813, 1987.
Related Publications (3)
Number Date Country
614615 May 1984
614617 May 1984
614491 May 1984
Divisions (1)
Number Date Country
Parent 212291 Mar 1994
Continuations (4)
Number Date Country
Parent 898382 Jun 1992
Parent 747459 Aug 1991
Parent 540868 Jun 1990
Parent 035652 Apr 1987
Continuation in Parts (2)
Number Date Country
Parent 858594 Apr 1986
Parent 614612 May 1984