Patent Application
20060084090
This invention relates to the first described pathogen-recognition molecule Nod1, which senses specifically Gram-negative bacteria through a peptidoglycan motif, muramyl tripeptide. More particularly, this invention relates to the modulation of Nod1 activity by a molecule related to the muramyl tripeptide (MTP). The invention also relates to a screening process for identifying a molecule capable of modulating Nod1 activity and the therapeutic use of such a molecule for modulating inflammation and/or apoptosis. The invention also relates to a new compound, which can be used for modulating inflammation and/or apoptosis or as an adjuvant agent.
In multicellular organisms, homeostasis is maintained by balancing the rate of cell proliferation against the rate of cell death. Cell proliferation is influenced by numerous growth factors and the expression of proto-oncogenes, which typically encourage progression through the cell cycle. In contrast, numerous events, including the expression of tumor suppressor genes, can lead to an arrest of cellular proliferation.
In differentiated cells, a particular type of cell death called apoptosis occurs when an internal suicide program is activated. This program can be initiated by a variety of external signals as well as signals that are generated within the cell in response to, for example, genetic damage. For many years, the magnitude of apoptotic cell death was not appreciated because the dying cells are quickly eliminated by phagocytes, without an inflammatory response.
The mechanisms that mediate apoptosis have been intensively studied. These mechanisms involve the activation of endogenous proteases, loss of mitochondrial function, and structural changes, such as disruption of the cytoskeleton, cell shrinkage, membrane blebbing, and nuclear condensation due to degradation of DNA. The various signals that trigger apoptosis are thought to bring about these events by converging on a common cell death pathway that is regulated by the expression of genes that are highly conserved from worms, such as C. elegans, to humans. In fact, invertebrate model systems have been invaluable tools in identifying and characterizing the genes that control apoptosis. Through the study of invertebrates and more evolved animals, numerous genes that are associated with cell death have been identified, but the way in which their products interact to execute the apoptotic program is poorly understood.
Caspases, a class of proteins central to the apoptotic program, are cysteine proteases having specificity for aspartate at the substrate cleavage site. These proteases are primarily responsible for the degradation of cellular proteins that lead to the morphological changes seen in cells undergoing apoptosis. For example, one of the caspases identified in humans was previously known as the interleukin-1 (IL-1 β) converting enzyme (ICE), a cysteine protease responsible for the processing of pro-IL-1β to the active cytokine.
Many caspases and proteins that interact with caspases possess domains of about 60 amino acids called a Caspase Recruitment Domain (CARD). Others have postulated that certain apoptotic proteins bind to each other via their CARDs and that different subtypes of CARDs may confer binding specificity, regulating the activity of various caspases, for example.
Innate immunity to bacterial pathogens relies on the specific sensing of pathogen-associated molecular patterns (PAMPs) by pattern-recognition molecules (PRMs). In mammals, Toll-like receptors (TLRs) represent the most extensively studied class of PRMs, which have been shown to sense various PAMPs, such as lipopolysaccharide (LPS), peptidoglycan (PGN), lipoproteins, double-stranded RNA and CpG DNA (Akira et al. (2001); Medzhitov (2001)). While TLRs are mainly expressed at the plasma membrane, it has been recently proposed that the Nod molecules, a family of intracellular proteins including Nod1/CARD4 and Nod2/CARD15, could represent a new group of PRMs that sense bacterial products within the cytoplasmic compartment, thus allowing to detect the presence of intracellular invasive bacteria (Inohara et al. (1999); Bertin, et al. (1999); Inohara et al. (2001); Girardin et al. (2001); Ogura et al. (2001); Ogura et al. (2001); Hugot et al. (2001)).
The partial sequences (cDNA and protein) of Nod1, also named CARD4 for Caspase Recruitment Domain, have been disclosed in patent application Ser. No. 09/019,942, filed Feb. 6, 1998, and now granted as U.S. Pat. No. 6,033,855. Furthermore, Bertin et al. (1999) disclosed the entire amino acid sequence of CARD4 and one of its functions, already mentioned in the above patent: CARD4 coordinates NF-κB and apoptotic signaling pathway. Girardin et al. (2001) disclosed that CARD4/Nod1 mediates NF-κB activation by invasive Shigella flexneri. In this article, the interaction between S. flexneri LPS and CARD4 is especially studied.
Stimulation of Nod1/CARD-4 activity is desirable in situations in which CARD-4 is abnormally downregulated and/or in which increased CARD-4 activity is likely to have a beneficial effect. Conversely, inhibition of CARD-4 activity is desirable in situations in which CARD-4 is abnormally upregulated, e.g., in myocardial infarction, and/or in which decreased CARD-4 activity is likely to have a beneficial effect. Since CARD-4 may be involved in the processing of cytokines, inhibiting the activity or expression of CARD-4 may be beneficial in patients that have aberrant inflammation.
It has recently been shown that Nod1 senses the presence of the Gram-negative pathogen, Shigella flexneri, within the cytoplasmic compartment of epithelial cells (Girardin et al. (2001)), and it was hypothesized that the detected PAMP was LPS since commercial preparations of LPS were shown to activate Nod1 (Inohara et al. (2001)). However, as these LPS often contain bacterial cell wall contaminants, there is a need in the art for more detail on whether a particular molecular motif or motifs are actually detected by Nod1 and modulate Nod1 activity.
The Gram-negative bacterium Helicobacter pylori is present in the stomachs of approximately one half of the world's population and is, arguably, the single most important cause of gastro-duodenal disease in humans. The severity of H. pylori-related disease, however, varies greatly amongst infected individuals and appears to be influenced by both host and bacterial factors. In Western populations, H. pylori strains harboring a 40 kilobase DNA region, known as the “cag” pathogenicity island (cagPAI), were found to be more frequently associated with severe gastric inflammation, ulceration and an increased risk of gastric cancer2-4. From in vitro studies, it has been shown that only H. pylori strains harboring a functional cagPAI induced cytoskeletal modifications (“cell scattering”) and NF-κB-dependent pro-inflammatory responses in gastric epithelial cells (Fischer et al (2001); Segal et al. (1999); Selbach et al. (2002)).
The cagPAI was proposed to encode a type IV secretion apparatus (Covacci et al (1998)). By analogy with equivalent systems in other bacterial pathogens (Cascales et al. (2003)), it was suggested that the apparatus was likely to mediate the translocation of protein effector molecule(s) into its target host cell (Covacci et al (1998)). Definitive proof for this suggestion was recently provided in the form of cagPAI-mediated translocation of a protein, CagA, in gastric epithelial cells (Selbach (2002); Odenbreit (2000)). While CagA translocation, and its phosphorylation, are required for H. pylori-induced cell scattering (Segal et al. (1999); Selbach et al. (2003)), these events are dispensable for H. pylori induction of NF-κB activation in host cells (Fischer et al. (2001)). Mutagenesis of the full complement of cagPAI genes failed to identify an obvious candidate protein for this activity (Fischer et al. (2001); Selbach et al. (2002)). Thus, the precise mechanism by which this extracellular pathogen is able to induce pro-inflammatory responses in gastric epithelial cells has remained obscure.
Epithelial cells express several types of transmembrane pathogen recognition molecules belonging to the family of Toll-like receptors (TLRs) (Backhed et al. (2003); Cario et al. (2002)). These molecules, which play a fundamental role in host innate immune responses, are able to recognize conserved microbial components, including various products of Gram-negative bacteria, such as lipoproteins (TLR2), lipopolysaccharide (LPS; TLR4) and flagellin (TLR5) (Backhed et al. (2003); Cario et al. (2002)). From recent work, it appears that the major pathogen recognition molecule for sensing of Gram-negative bacteria, TLR4, does not play a significant role in epithelial cell responses to H. pylori (Bäckhed et al. (2003); Maeda et al. (2001); Smith et al. (2003)). Furthermore, the data concerning the contribution of TLR2 and/or TLR5 towards epithelial cell recognition of H. pylori have been contradictory (Maeda et al. (2001); Smith et al. (2003); Lee et al. (2003)). Given that a functional type IV secretion apparatus is required for H. pylori-induced NF-κB activation in gastric epithelial cells, the inventors reasoned that an intracellular receptor may be involved in recognition of an H. pylori product that is presented within the cells.
A new family of intracytoplasmic pathogen recognition molecules with homology to plant resistance proteins, has recently been described. As mentioned above, two members of this family, Nod1/CARD4 and Nod2/CARD15, were reported to respond to different motifs within peptidoglycan (PG), a component of bacterial cell walls (Chamaillard et al. (2003); Girardin et al. (2003); Girardin et al. (2003)). The reported role of Nod1 as an important intracellular sensor of Gram-negative bacteria in epithelial cells (Girardin et al. (2001)) led the inventors to investigate the involvement of this molecule in host recognition of H. pylori. Because H. pylori is an important cause of gastroduodenal disease, there is a need for identifying the mechanism of the innate immune response in epithelia, and for understanding and manipulating how epithelial cells discriminate between pathogenic and commensal bacteria.
This invention aids in fulfilling these needs in the art. In one embodiment, this invention provides a method for identifying a compound, which modulates the interaction between Nod1 and a Gram-negative bacteria comprising:
In one embodiment, the pro-inflammatory factor is NF-κB and the cytokine or chemokine is an NF-κB-dependent cytokine or chemokine. In a particular embodiment, the NF-κB-dependent cytokine or chemokine is IL-8 or MIP-2. In another embodiment, the Nod1 expressing cell is an epithelial cell.
In one embodiment, the activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) is increased. In another embodiment, the activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) is decreased.
The invention further provides that detecting the activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and/or (b) comprises detecting NF-κB activation. In one embodiment, NF-κB activation is detected by a bioluminescent signal.
The invention also provides for abrogating the activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and/or (b) by treating said Nod1 expressing cell with siRNA against Nod1. In one embodiment, siRNA against Nod1 comprises the polynucleotide 5′-ACAACTTGCTGAAGAATGACT-3′ [SEQ ID NO: 1]. The invention also comprises for abrogating the activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and/or (b) by treating said Nod1 expressing cell with dominant-negative Nod1.
The invention also provides for a method for identifying a compound, which modulates the interaction between Nod1 and a Gram-negative bacteria comprising:
(a) contacting a Nod1 expressing cell with a cagPAI-positive H. pylori in the presence of a compound;
(b) contacting a Nod1 expressing cell with a cagPAI-positive H. pylori in the absence of said compound;
(c) contacting a Nod1 expressing cell with a cagPAI-negative H. pylori in the presence of said compound;
(d) contacting a Nod1 expressing cell with a cagPAI-negative H. pylori in the absence of said compound; and
(e) detecting the activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a), (b), (c), and (d);
wherein altered activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine (a) and/or (b) and/or (c) and/or (d) indicates that said compound modulates the interaction between Nod1 and the Gram-negative bacteria.
In one embodiment, the pro-inflammatory factor is NF-κB and said cytokine or chemokine is an NF-κB dependent cytokine or chemokine. NF-κB dependent cytokine or chemokine can be, for example, IL-8 or MIP-2.
The invention further provides for a method for detecting a dysfunction of the inflammatory and/or apoptosis pathway in which Nod1 is involved, comprising:
(a) bringing a cagPAI-positive H. pylori into contact with a cell in which the dysfunction of the inflammatory and/or apoptosis pathway in which Nod1 is involved, is suspected;
(b) bringing a cagPAI-negative H. pylori into contact with a cell in which the dysfunction of the inflammatory and/or apoptosis pathway in which Nod1 is involved, is suspected, and
(c) evaluating activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and (b),
wherein similar levels of activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and (b) indicates dysfunction of a molecule of the inflammatory and/or apoptosis pathway in which Nod1 is involved. In one embodiment, the cell is an epithelial cell.
In one embodiment, the pro-inflammatory factor is NF-κB and the cytokine or chemokine is an NF-κB dependent cytokine or chemokine. NF-κB dependent cytokine or chemokine can be, for example, IL-8 or MIP-2.
In another embodiment, the cell is an epithelial cell. In another embodiment, evaluating activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and (b) comprises detecting NF-κB activation. In a particular embodiment, NF-κB activation is detected by a bioluminescent signal.
The invention also encompasses a method for inactivating Nod1 in a Nod1 expressing cell comprising administration of siRNA against Nod1 in an amount sufficient to cause inactivation of Nod1. In one embodiment, the siRNA against Nod1 comprises the polynucleotide sequence 5′-ACAACTTGCTGAAGAATGACT-3′ [SEQ ID NO: 1]. In another, the Nod1 expressing cell is an epithelial cell. In yet another, the Nod1 expressing cell is transfected with about 50-500 ng of a construct comprising a sequence specific for CARD in human nod1. In one embodiment, this construct comprises the polynucleotide sequence 5′-ACAACTTGCTGAAGAATGACT-3′ [SEQ ID NO: 1].
The invention also encompasses a method for assaying whether a Gram-negative bacteria is cagPAI-positive comprising the steps of:
(a) contacting a Gram negative bacteria with a cell line expressing Nod1;
(b) contacting a Gram negative bacteria with a cell line not expressing Nod1; and
(c) evaluating activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and (b);
wherein altered activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and/or (b) indicates that said Gram-negative bacteria is cagPAI-positive.
In one embodiment, the pro-inflammatory factor is NF-κB and said cytokine or chemokine is an NF-κB dependent cytokine or chemokine. In a particular embodiment, the NF-κB dependent cytokine or chemokine is IL-8 or MIP-2.
The invention also encompasses evaluating activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and (b) comprising detecting NF-κB activation. In one embodiment, NF-κB activation is detected by a bioluminescent signal.
In another embodiment, altered activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and/or (b) is abrogated by treatment of the cell line expressing Nod1 with siRNA against Nod1. For example, siRNA against Nod1 can comprise the polynucleotide 5′-ACAACTTGCTGAAGAATGACT-3′ [SEQ ID NO: 1].
In another, embodiment, the altered activation of a pro-inflammatory factor and/or production of a pro-inflammatory cytokine or chemokine in (a) and/or (b) is abrogated by treatment of said cell line expressing Nod1 with dominant-negative Nod1.
The invention also encompasses a method of inducing a pro-inflammatory response and/or apoptosis in a cell containing intracellular Nod1, wherein the method comprises contacting said cell with H. pylori cell-free PG, a fragment thereof, or a related molecule thereof.
In one embodiment, the cell is a mammalian cell. In another, the cell is a mammalian gastric epithelial cell.
In another embodiment, the H. pylori PG fragment is H. pylori MTP or a molecule related to H. pylori MTP. In yet another embodiment, the method comprises activating an NF-κB signaling pathway in said cells.
The invention also encompasses a composition that comprises a biologically acceptable carrier and a biologically effective amount of H. pylori PG, H. pylori MTP, or a molecule related to H. pylori MTP.
In one embodiment, the composition is administered in a therapeutically effective amount to a human or animal in need thereof as a method for preventing or treating abnormal level or rate of apoptotic cell death or inflammation. In another embodiment, the composition is administered in an effective amount to a human or animal in need thereof, as a method for preventing or treating a Gram-negative bacteria infection.
This invention will be described in greater detail with reference to the drawings in which:
FIGS. 15(A) and (B) show that primary gastric epithelial cells from Nod1−/− mice produce lower amounts of MIP-2 in response to stimulation by H. pylori bacteria. Gastric epithelial cells were isolated from Nod1−/− and Nod1+/+ mice and analyzed by (a) immunofluorescence with anti-actin, NF-κB p65 and cytokeratin antibodies, and (b) ELISA for MIP-2 production. MIP-2 data correspond to the mean±SEM (triplicate determinations) for one experiment. MIP-2 production was reduced by 25-87% and 44-87%, respectively, in Nod1−/− cells stimulated with H. pylori B128 and 256 strains, when compared to Nod1+/+ cells (n=4-5 independent experiments).
As used herein, MTP means muramyl tripeptide from the peptidoglycan of the cell wall of a Gram-negative bacteria, that is GlcNAc-MurNAc-L-Ala-D-Glu-mesoDAP or meso-DAP containing GM-tripeptide.
As used herein, the terms “a molecule related to MTP” means a molecule or a compound having activity that is agonist or antagonist to the activity of MTP on Nod1. Molecules related to MTP comprise, but are not limited to, MTP the tripeptide L-Ala-D-Glu-mesoDAP, biologically active derivatives of MTP, such as, for example, the peptide fraction of MTP that is the three amino acids without the sugar moieties, MTP without GlcNAc, MTP with non-cyclized sugar, peptidomimetics, and molecules having activity that is antagonist to the one of MTP on Nod1.
The activity of the molecule related to MTP can be evaluated by the tests disclosed in the Examples: Evaluation of NF-κB activation or of IL-8 production for instance. A molecule having activity as agonist to MTP activity on Nod1 increases NF-κB activation or IL-8 production. A molecule having activity as antagonist to MTP activity on Nod1 decreases NF-κB activation or IL-8 production.
As used herein, the terms “biologically active derivatives” refers to function-conservative variants, homologous proteins or peptides and peptidomimetics, as well as a hormone, an antibody or a synthetic compound, (i.e., either a peptidic or non-peptidic molecule) that preferably retains the binding specificity and/or physiological activity of the parent peptide, as defined herein.
Also part of the invention are preferred peptidomimetics retaining the binding specificity and/or physiological activity of the parent peptide, as described herein and that they are positive in a test of activity as disclosed for testing one.
As used herein, “peptidomimetic” is an organic molecule that mimics some properties of peptides, preferably their binding specificity and/or physiological activity. Preferred peptidomimetics are obtained by structural modification of peptides according to the invention, preferably using unnatural amino acids, D. amino acid instead of L. amino acid, conformational restraints, isosteric replacement, cyclization, or other modifications. Other preferred modifications include without limitation, those in which one or more amide bond is replaced by a non-amide bond, and/or one or more amino acid side chain is replaced by a different chemical moiety, or one or more of the N-terminus, the C-terminus or one or more side chain is protected by a protecting group, and/or double bonds and/or cyclization and/or stereospecificity is introduced into the amino acid chain to increase rigidity and/or binding affinity.
Modifications can also be made for preparing molecules having activity that is antagonist to the one of Nod1.
While the role of Toll-like receptors in extracellular bacterial sensing has been investigated intensively, intracellular detection of bacteria through Nod molecules remains largely uncharacterized. This invention shows that Nod1 detects specifically a unique diaminopimelate-containing GlcNAc-MurNAc tripeptide motif found in Gram-negative bacterial peptidoglycan, resulting in activation of the NF-κB pathway. Moreover, this invention shows, in epithelial cells, which represent the first line of defense against invasive pathogens, that Nod1 is indispensable for intracellular Gram-negative bacterial sensing. Nod1 represents so far the first example of a pathogen-recognition molecule that specifically senses Gram-negative bacterial peptidoglycan.
Furthermore, this invention shows that Nod1 specifically senses MTP and more specially the peptide moiety of the GlcNAc-MurNAc tripeptide.
In the present invention, the inventors show that LPS was a contaminant in the previous studies and that Nod1 detects specifically a unique motif found in the peptidoglycan of Gram-negative bacteria: a muramyl tripeptide carrying at its third position a diaminopimelic amino acid.
Numerous publications are directed to MDP (muramyl dipeptide) and its adjuvant property. There are also publications about the adjuvant properties of MTP (muramyl tripeptide), which are generally directed to MTP-PE that is to muramyl tripeptide phosphatidylethanolamine. A first patent, FR 2160326, filed Nov. 19, 1971, concerns a process for preparing a soluble agent having an adjuvant activity, wherein the soluble agent is extracted from mycobacteria or Nocardia cell walls. FR 2248025, filed on Oct. 23, 1973, and is an addition to FR 2160326 and discloses the discovery that the adjuvant activity of this soluble agent comes from soluble fragments of peptidoglycans of the cell wall and concerns specific muramyl peptides. The U.S. equivalent is U.S. Pat. No. 4,186,194. The subject invention was made as follows.
The tripeptide according to the U.S. Pat. No. 4,186,194 contains always sugar moieties.
Addition of a commercial preparation of Escherichia coli LPS (10 μg) to Nod1-overexpressing HEK293 cells could potentiate by ˜5 fold the level of Nod1-dependent NF-κB activation (
The next aim was to address the potential role of PGN in stimulating the Nod1 signaling pathway. Therefore, PGNs from E. coli, S. flexneri, Neisseria meningitides, Bacillus subtilis and Staphylococcus aureus were purified according to experimental procedures specifically designed for Gram-positive or Gram-negative bacteria (de Jonge et al. (1992); Glauner et al., (1988)). The harsh purification steps used to purify these PGNs eliminate the possible contaminants (
In order to identify the minimal PGN motif detected by Nod1, muropeptides from N. meningitidis were analyzed by reverse-phase HPLC after PGN digestion with a muramidase. Indeed, the major PGN fragments naturally released by Gram-negative bacteria are muropeptides (Höltje (1988); Blackburn et al. (2001)). This analysis allowed for the separation of muropeptides according to the number of amino acids of the peptidic chain linked to the amino sugars, the degree of polymerization of the peptidic chain or natural modifications such as O-acetylation or dehydration of the amino sugars (
Individual muropeptides were collected and tested for their ability to activate the Nod1 pathway. Surprisingly, only two fractions (3 and 17) contained muropeptides able to activate Nod1 (
To gain more insight into the molecular pattern sensed by Nod1, a comparison was made of the activation of the Nod1 pathway by GM-dipeptide, GM-tripeptide and GM-tetrapeptide. Equivalent amounts (10 ng) of GM-dipeptide, GM-tripeptide (from fraction 3) and GM-tetrapeptide (fraction 6) were tested for their ability to activate the Nod1 pathway. It was observed that Nod1 specifically detects GM-tripeptide but not GM-dipeptide nor GM-tetrapeptide (
The PGN motif sensed by Nod2, GM-dipeptide, is found in all bacteria, suggesting that Nod2 is a general sensor of PGN degradation products (Girardin, et al. (2003); Inohara et al. (2003)). In contrast, the additional requirement of mesoDAP for Nod1 sensing explains why Nod1 detects only those PGNs purified from Gram-negative bacteria (see
Next, it was of interest to determine the contribution of PGN detection by Nod1 in the context of intracellular bacterial sensing by epithelial cells. Indeed, previous studies stressed the pivotal role of these cells as the first line of defense against bacterial pathogens at mucosal surfaces. First, extracts were prepared from various Gram-negative or Gram-positive bacteria and determined the relative PGN content of these extracts (
Therefore, these data show that epithelial cells sense Gram-negative but not Gram-positive bacterial products when presented to the cytoplasmic compartment. These findings are consistent with the fact that the released PGN motifs from the Gram-negative bacteria tested here all contain GM-tripeptide with a terminal mesoDAP, and that released Gram-positive bacterial PGN products lack this structure. In the case of L. monocytogenes, the PGN contains mesoDAP; however, the PGN degradation products have not yet been characterized. Of interest, the major PGN hydrolase in L. monocytogenes is a N-acetylmuramoyl-L-alanyl-amidase that cleaves the bond between the PGN sugar backbone and the peptidic chains. Therefore, L. monocytogenes is unlikely to release significant amounts of muropeptides but rather free peptidic chains and amino sugars (McLaughlan et al. (1998)).
To characterize which signaling pathways are involved in intracellular sensing of Gram-negative bacterial extracts by epithelial cells, it was first demonstrated that this pathway was independent of MyD88, a key adaptor protein of the TLR/IL-1 pathway (Kawai et al. (1999)), since a dominant-negative form of MyD88 was unable to block the activation of the NF-κB pathway induced in digitonin-permeabilized cells by extracts from Gram-negative bacteria, including S. typhimurium AF, S. flexneri and E. coli (
These findings, therefore, demonstrate that Nod1 is the crucial intracellular sensor of bacterial products in epithelial cells and that induction of the Nod1-dependent pro-inflammatory pathway depends upon the ability of a bacterial pathogen, either invasive or extracellular, to translocate Gram-negative PGN to the intracellular environment.
Moreover, additional experiments were conducted on fraction of the GM-dipeptide and surprisingly it has been found that Nod1 is able to sense the tripeptide L-Ala-D-Glu-mesoDAP without the sugar moieties. Therefore, the shortest motif sensed by Nod1, which is identified is the tripeptide.
It will be understood that this invention includes antagonists and agonists of Nod1 that can inhibit or enhance, respectively, one or more of the biological activities of Nod1. Suitable antagonists include small organic or inorganic molecules (i.e., molecules with a molecular weight below about 500), large molecules (i.e., molecules with a molecular weight above about 500), antibodies, and nucleic acid molecules. Agonists of Nod1 also include combinations of small and large molecules.
Thus, the invention features (1) methods for modulating (e.g., decreasing or increasing) an activity of Nod1 by contacting a cell expressing a functional Nod1 with a compound, which activates to Nod1 in a sufficient concentration to modulate the activity of Nod1; and (2) methods of identifying a compound that modulates the activity (e.g., decrease or increase) of Nod1 by contacting the Nod1 with a test compound (e.g., polypeptides, ribonucleic acids, small molecules, large molecules, ribozymes, antisense oligonucleotides, and deoxyribonucleic acids), and detecting and comparing the level of activity of Nod1 in the presence or absence of the test compound.
Compounds that modulate the activity of Nod1 in a cell can be identified by comparing the activity of Nod1 in the presence of a selected compound with the activity of Nod1 in the absence of that compound. A difference in the level of Nod1 activity indicates that the selected compound modulates the expression of Nod1 in the cell.
Exemplary compounds that can be screened in accordance with the invention include, but are not limited to, small organic molecules that are able to gain entry into an appropriate cell and affect the activity of Nod1 protein.
Computer modeling and searching technologies permit identification of compounds, or the improvement of already identified compounds, that can modulate Nod1 activity. Having identified such a compound or composition, the active sites or regions are identified. Such active sites might typically be a binding for a natural modulator of activity. The active site can be identified using methods known in the art including, for example, from the amino acid sequences of peptides, from the nucleotide sequences of nucleic acids, or from study of complexes of the relevant compound or composition with its natural ligand. In the latter case, chemical or X-ray crystallographic methods can be used to find the active site by finding where on the factor the modulator (or ligand) is found.
Next, the three dimensional geometric structure of the active site can be determined. This can be done by known methods, including X-ray crystallography, which can determine a complete molecular structure. On the other hand, solid or liquid phase NMR can be used to determine certain intra-molecular distances. Any other experimental method of structure determination can be used to obtain partial or complete geometric structures. The geometric structures can be measured with a complexed modulator (ligand), natural or artificial, which can increase the accuracy of the active site structure determined.
If an incomplete or insufficiently accurate structure is determined, the methods of computer-based numerical modelling can be used to complete the structure or improve its accuracy. Any recognized modelling method can be used, including parameterized models specific to particular biopolymers, such as proteins or nucleic acids, molecular dynamics models based on computing molecular motions, statistical mechanics models based on thermal ensembles, or combined models. For most types of models, standard molecular force fields, representing the forces between constituent atoms and groups, are necessary, and can be selected from force fields known in physical chemistry. The incomplete or less accurate experimental structures can serve as constraints on the complete and more accurate structures computed by these modeling methods.
Finally, having determined the structure of the active site, either experimentally, by modeling, or by a combination, candidate modulating compounds can be identified by searching databases containing compounds along with information on their molecular structure. Such a search seeks compounds having structures that match the determined active site structure and that interact with the groups defining the active site. Such a search can be manual, but is preferably computer assisted. These compounds found from this search are potential Nod1 modulating compounds.
Alternatively, these methods can be used to identify improved modulating compounds from a previously identified modulating compound or ligand. The composition of the known compound can be modified and the structural effects of modification can be determined using the experimental and computer modelling methods described above applied to the new composition. The altered structure is then compared to the active site structure of the compound to determine if an improved fit or interaction results. In this manner systematic variations in composition, such as by varying side groups, can be quickly evaluated to obtain modified modulating compounds or ligands of improved specificity or activity.
Examples of molecular modelling systems are the CHARMm and QUANTA programs (Polygen Corporation, Waltham, Mass.). CHARMm performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
A number of articles review computer modelling of drugs interactive with specific proteins, such as Rotivinen et al., Acta Pharmaceutical Fennica 97:159 [1993]; Ripka, New Scientist 54-57 [Jun. 16, 1988]; McKinaly and Rossmann, Annu Rev Pharmacol Toxicol 29:111 [1989]; Perry and Davies, OSAR: Quantitative Structure-Activity Relationships in Drug Design, pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis and Dean, Proc R Soc Lond 236:125 [1989]; and 141 [1980]; and, with respect to a model receptor for nucleic acid components, Askew et al., J Am Chem Soc 111:1082 [1989]). Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc. (Mississauga, Ontario, Canada), and Hypercube, Inc. (Cambridge, Ontario). Although these are primarily designed for application to drugs specific to particular proteins, they can be adapted to design of drugs specific to regions of DNA or RNA, once that region is identified.
Although described above with reference to design and generation of compounds that could alter binding, one could also screen libraries of known compounds, including natural products or synthetic chemicals, and biologically active materials, including proteins, for compounds that are inhibitors or activators of Nod1 activity.
Compounds identified via assays, such as those described herein, are useful, for example, in elaborating the biological function of Nod1 and for the treatment of disorders associated with aberrant Nod1 activity or expression. Assays for testing the effectiveness of compounds identified with the above-described techniques are discussed below.
In vitro systems may be designed to identify compounds capable of interacting with Nod1 (or a domain of Nod1). Compounds identified may be useful, for example, in modulating the activity of wild type and/or mutant Nod1; may be useful in elaborating the biological function Nod1; may be utilized in screens for identifying compounds that disrupt normal Nod1 interactions; or may in themselves disrupt such interactions.
The principle of the assays used to identify compounds that activate Nod1 involves preparing a reaction mixture of Nod1 (or a domain thereof) and the test compound under conditions and for a time sufficient to allow the two components to interact and activate, thus forming a complex which can be removed and/or detected in the reaction mixture. The Nod1 species used can vary depending upon the goal of the screening assay. In some situations it is preferable to employ a peptide corresponding to a domain of Nod1 fused to a heterologous protein or polypeptide that affords advantages in the assay system (e.g., labeling, isolation of the resulting complex, etc.) can be utilized.
Cell-based assays can be used to identify compounds that interact with Nod1. To this end, cell lines that express Nod1, or cell lines that have been genetically engineered to express Nod1 can be used.
In order to test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound can be initially included in the reaction mixture, or can be added at a time subsequent to the introduction of the Nod1 moiety. Control reaction mixtures are incubated without the test compound or with a non-active control compound. The formation of any complexes between the Nod1 moiety and the binding partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of Nod1 and the interactive binding partner. Additionally, complex formation within reaction mixtures containing the test compound and normal Nod1 protein can also be compared to complex formation within reaction mixtures containing the test compound and a mutant Nod1. This comparison may be important in those cases wherein it is desirable to identify compounds that disrupt interactions of mutant but not normal Nod1.
Other methods for identifying compounds capable modulating with Nod1 are disclosed in the Examples.
The invention encompasses methods of diagnosing and treating patients who are suffering from a disorder associated with an abnormal level or rate (undesirably high or undesirably low) of apoptotic cell death, abnormal activity of the Fas/APO-1 receptor complex, abnormal activity of the TNF receptor complex, abnormal activity of a caspase or inflammation of infectious or non-infectious origin by administering a compound that modulates the activity of Nod1. Examples of such compounds include small molecules and large molecules. It will be understood that this invention can be employed to treat a variety of disorders, such as the following. The invention also encompasses TNF receptor complex, abnormal activity of a caspase or inflammation of infectious or non-infectious origin.
Certain disorders are associated with an increased number of surviving cells, which are produced and continue to survive or proliferate when apoptosis is inhibited. These disorders include cancer (particularly follicular lymphomas, carcinomas associated with mutations in p53, and hormone-dependent tumors such as breast cancer, prostate cancer, and ovarian cancer), autoimmune disorders (such as systemic lupus erythematosis, immune-mediated glomerulonephritis), and viral infections (such as those caused by herpesviruses, poxviruses, and adenoviruses).
Failure to remove autoimmune cells that arise during development or that develop as a result of somatic mutation during an immune response can result in autoimmune disease. One of the molecules that plays a critical role in regulating cell death in lymphocytes is the cell surface receptor for Fas.
Populations of cells are often depleted in the event of viral infection, with perhaps the most dramatic example being the cell depletion caused by the human immunodeficiency virus (HIV). Surprisingly, most T cells that die during HIV infections do not appear to be infected with HIV. Although a number of explanations have been proposed, recent evidence suggests that stimulation of the CD4 receptor results in the enhanced susceptibility of uninfected T cells to undergo apoptosis.
A wide variety of neurological diseases are characterized by the gradual loss of specific sets of neurons. Such disorders include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS) retinitis pigmentosa, spinal muscular atrophy, and various forms of cerebellar degeneration. The cell loss in these diseases does not induce an inflammatory response, and apoptosis appears to be the mechanism of cell death.
In addition, a number of hematologic diseases are associated with a decreased production of blood cells. These disorders include anemia associated with chronic disease, aplastic anemia, chronic neutropenia, and the myelodysplastic syndromes. Disorders of blood cell production, such as myelodysplastic syndrome and some forms of aplastic anemia, are associated with increased apoptotic cell death within the bone marrow. These disorders could result from the activation of genes that promote apoptosis, acquired deficiencies in stromal cells or hematopoietic survival factors, or the direct effects of toxins and mediators of immune responses.
Two common disorders associated with cell death are myocardial infarctions and stroke. In both disorders, cells within the central area of ischemia, which is produced in the event of acute loss of blood flow, appear to die rapidly as a result of necrosis. However, outside the central ischemic zone, cells die over a more protracted time period and morphologically appear to die by apoptosis.
Certain inflammatory disorders, both of infectious and non-infectious in origin, could be treated by administering compounds that modulate Nod1 activity. Pathology of inflammatory disorders is associated with inflammation-mediated destruction of the tissue. Inflammatory diseases of non-infectious origin include, but are not limited to, allergy, asthma, psoriasis, rheumatoid arthritis, ankylosing spondylitis, autoimmune diseases (such as systemic lupus erythematosis and glomerulonephritis), and certain cancers. Infectious inflammatory diseases include such infections as those causing gastroenteritis (Shigella spp, Samonella enteritidis, Campylobacter spp., the different strains of diarrheagenic Escherchia coli), gastritis, gastric ulceration, and cancer (Helicobacter pylori), vaginitis (Chlamydia trachomatis,) and respiratory diseases (Pseudomonas aeruginosa, Mycobacteria etc).
Patients who have a disorder mediated by abnormal Nod1 activity can be treated by administration of a compound that alters activity of Nod1. Accordingly, the invention features methods for treating a patient having a disorder associated with the aberrant activity of Nod1 by administering a therapeutically effective amount of a compound (e.g., polypeptide, ribonucleic acid, small molecule, large molecule, ribozyme, antisense oligonucleotide or deoxyribonucleic acid) that decreases or increases the activity of Nod1. Accordingly, the invention features methods for modulating apoptosis by modulating the expression or activity of a gene encoding Nod1.
Agents or modulators, which have a stimulatory or inhibitory effect on Nod1 activity can be administered to individuals for prophylactic or therapeutic treatment of disorders associated with aberrant Nod1 activity. The individual's response to a foreign compound or drug permits the selection of effective agents, and can further be used to determine appropriate dosages and therapeutic regimens. Accordingly, the activity of Nod1 can be determined and used to select an appropriate agent for therapeutic or prophylactic treatment of the individual.
The invention encompasses methods for the detection of peptidoglycan (through MTP) from Gram-negative bacteria in a sample. These methods use the specific interaction between Gram-negative MTP and Nod1 to detect peptidoglycan from Gram-negative bacteria and then Gram-negative bacteria in a sample.
Detection of an interaction between Gram-negative MTP and Nod1 can be done by measuring NK-κB activation in a cell as disclosed in the Examples, for instance.
On the other hand, Nod1 auto-oligomerizes after infection (Inohara et al. (2001)). Based on this characteristic, one can detect Nod1/Gram-negative MTP interaction by the detection of Nod1 oligomerization. For example, detection of Nod1 oligomerization can be performed by means of coupling of Nod1 with a probe. More particularly, the method of the invention can be performed in an acellular system and the oligomerization of Nod1 can be monitored by a physio-chemical reaction. In a particular embodiment, oligomerization of Nod1 can be detected by means of FRET (fluorescence resonance energy transfer) well known by one skilled in the art, which generates a detectable bioluminescent signal.
Nod2 detects either Gram-negative or Gram-positive peptidoglycan (Girardin, et al. (2003); Inohara et al. (2003); Girardin, et al. (2003)). Thus, the methods of the invention can use Nod1 and Nod2 proteins to detect bacterial peptidoglycan, and then the presence of bacteria, in a sample and optionally to determine whether bacteria in said sample are of Gram-negative or Gram-positive origin. More particularly, Nod2 is a general sensor of peptidoglycan from Gram-positive or Gram-negative bacteria through muramyl dipeptide (MDP), while Nod1 is a sensor specific for peptidoglycan from negative bacteria through MTP. Interaction between bacterial peptidoglycan and Nod proteins can be detected by the above-mentioned methods. A method for detecting interaction between MDP and Nod2 is disclosed in (Girardin, et al., (2003)). In a particular embodiment, the method detects bacterial peptidoglycan interaction with Nod proteins by the detection of the oligomerization of Nod1 and Nod2 by means of the FRET technology.
Furthermore, the invention encompasses methods for screening molecules that modulate bacterial peptidoglycan interaction with Nod proteins. In a particular embodiment, said method allows distinguishing molecules that specifically modulate Gram-negative peptidoglycan interaction with Nod proteins, particularly Nod1 protein. The modulation of this interaction is detected by the above-mentioned methods.
Bacterial Strains and Products
Bacterial strains used in these studies are the following: S. typhimurium strain C52 and C52-delta flagellin (fliC::aphA-3(Km)fljB5001::Mud(Cm)); E. coli K12; S, flexneri 5a M90T; B. 16 subtilis (from Agnès Fouet, Institut Pasteur); S. aureus (from Olivier Chesneau, Institut Pasteur); L. casei (from Raphaëlle Bourdet-Sicard, Danone Vitapole); L. monocytogenes (Strain EGD, from Pascale Cossart, Institut Pasteur); N. meningitidis LNP8013. Bacterial extracts were prepared from overnight cultures of bacterial strains, diluted to an OD600 of 0.3, sonicated 3 min and filtered (0.2 micron).
Commercial LPS and lipid A were from E. coli O111:B4 (Sigma). Commercial S. aureus PGN was from Fluka Chemicals. Commercial Pam3Cys-Ser-Lys4-OH lipopeptide was from Roche Diagnostics (Mannheim) and E. coli lipoproteins preparations were provided by Emmanuelle Bouveret and Roland Lioubes (UPR 9027, Marseille).
Pure RE-LPS was from E. coli F515 and purified as previously described (Sanchez Carballo et al. (1999)). Synthetic GM-dipeptide was purchased from Sigma. PGNs of E. coli, S. flexneri and N. meningitidis were purified as described by Glauner et al (Glauner (1988)). PGNs of B. subtilis and S. aureus were purified as described by de Jonge et al (de Jonge et al. (1992)). See also Example 2.
Expression Plasmids and Transient Transfections
The expression plasmid for Flag-tagged Nod1 was from Gabriel Nuñez and has been previously described (Inohara et al., (1999)). The HA-tagged, DN-Nod1 (117-953aa) and myc-tagged “LRR (1-644aa) Nod1 were generated by PCR and cloned into pcDNA3 (Invitrogen) and pRK5 (from Alan Hall, ICRF, London), respectively. DN-MyD88 was from Marta Muzio and the expression plasmid for vsv-tagged DN-Rip2 (7-425aa) was provided by Margot Thome and Jurg Tschopp (University of Lausanne, Switzerland). Transfections were carried out in HEK293 as previously described (Girardin et al. (2001)).
NF-κB Activation Assays
For NF-κB activation assays in digitonin-permeabilized cells, 1×105 HEK293 were grown in 24 well plates and then transfected for 24 h with 75 ng of NF-κB-luciferase reporter gene (IgK luciferase) as previously described (Girardin et al. (2001)). Cells were then incubated for 30 min at 37° C. with 25 μl of sonicated bacterial extracts in 500 μl of permeabilization buffer (50 mM HEPES, pH 7, 100 mM KCl, 3 mM MgCl2, 0.1 mM DTT, 85 mM sucrose, 0.2% BSA, 1 mM ATP and 0.1 mM GTP) with or without 10 μg/ml digitonin (Sigma). Permeabilization buffer was then removed and replaced with medium (DMEM, Gibco) plus 10% fetal-calf serum (Gibco) for 4 hours before processing for luciferase measurements as described previously (Girardin et al. (2001)). For dominant-negative studies presented in
Studies examining the activation of NF-κB by LPS, lipid A, lipoproteins or the purified PGNs in cells over-expressing Nod1 were carried out as described by Inohara et al. (Inohara et al. (2001)). Briefly, HEK293 cells were transfected overnight with 10 ng of Nod1. At the same time, the LPS, lipoproteins or peptidoglycan preparations were added and the NF-κB-dependent luciferase activation was then measured following 24 h of co-incubation. It is presumed that the transfection reagent plus the added DNA aids in the uptake of bacterial products into the cells since extracellular addition of these products to cells previously transfected and washed to remove the liposome reagent does not lead to NF-κB activation (data not shown).
NF-κB-dependent luciferase assays were performed in duplicate and data represent at least 3 independent experiments. Data show mean±SEM and are expressed as fold activation compared to vector expressing cells or as fold synergy compared to the level of NF-κB activation of Nod1-expressing cells (for 10 ng of Nod1, NF-κB activation is approximately 5 fold compared to vector-expressing cells).
For immunofluorescence studies, NF-κB activation was assessed by nuclear translocation of NF-κB p65 in HeLa, Caco-2 or isolated intestinal epithelial cells following microinjection of bacterial products (diluted 1:1 with FITC-dextran) as previously described (Philpott et al., (2000)). At least 50 microinjected cells were examined per coverslip and experiments were performed at least 2 times independently with similar results.
Interleukin-8 Production
To measure Nod1-dependent IL-8 produced in epithelial cells by muropeptides, 5×105 HeLa cells were seeded into each well of a twelve well plate and transfected the following day with 10 ng Nod1 plus the individual muropeptides (as described above) or treated with IL-1 as a positive control. Eighteen hours later, supernatants were collected and assayed for IL-8 as previously described (Philpott et al. (2000)) using an ELISA kit (R and D Systems).
Western Blot and Immunoprecipitations
Western blot and immunoprecipitations were carried out as previously described (Girardin et al. (2001)). The Nod1 polyclonal antibody was obtained by immunization of rabbits with two peptides corresponding to aa 1-15 and 567-582 of Nod1. Serum was collected, affinity purified and verified to be specific for Nod1. The Nod2 polyclonal antibody was from Cayman Chemical (Ann Arbor, Mich.).
Bacterial strains used to prepare PGN are the following: E. coli K12; S, flexneri 5a M90T (wildtype); N. meningitidis; B. subtilis 168; S. aureus COL (from Olivier Chesneau, Institut Pasteur). PGNs of E. coli and S. flexneri were purified as described by Glauner et al (Glauner (1988)). PGNs of B. subtilis and S. aureus were purified as described by de Jonge et al (de Jonge, et al. (1992)). Briefly, bacteria were harvested in exponential growth phase at an optical density (600 nm) of 0.4-0.6 and quickly chilled in an ice-ethanol bath to minimize PGN hydrolysis by endogeneous autolysins. Pellets were resuspended in ice-cold water and added drop by drop to 8% boiling SDS. Samples were boiled for 30 minutes allowing immediate inactivation of autolysins. Polymeric PGN, which is insoluble, was recovered by centrifugation and washed several times until no SDS could be detected. SDS assay was done as described by Hayashi (Hayashi (1975)). SDS treatment removes contaminating proteins, non-covalently bound lipoproteins and LPS. Gram-positive bacterial samples were physically broken with acid washed glass beads (<100 nm). The PGN fraction was recovered by differential centrifugation to remove cellular debris. All PGNs were further treated with α-amylase to remove any glycogen and with trypsin (3× crystallized trypsin, Worthington) digestions to remove covalently bound proteins (LPXTG proteins in Grampositive bacteria) or lipoproteins (Gram-negative bacteria). Samples were further boiled in 1% SDS to inactivate trypsin and were washed to remove SDS. Gram-positive bacterial samples were treated with 49% hydrofluoridic acid during 48 hours at 4° C. This mild acid hydrolysis allows removal of secondary polysaccharides covalently bound to the PGN by phosphodiester bonds such as teichoic acid, capsules, poly-(β,1-6 GlcNAc), etc. Further treatment of both Grampositive and Gram-negative PGNs included washes with 8 M LiCl, 0.1 M EDTA to remove any polypeptidic contaminations and with acetone to remove lipoteichoic acids or any traces of LPS. Samples were lyophilized to measure PGN amounts. Purity of samples was assessed by HPLC amino acid and saccharide analysis after HCl hydrolysis (see also
Peptidoglycans of N. meningitidis or S. flexneri were digested by the muramidase mutanolysin (M1, Sigma) to generate the entire spectrum of muropeptides for both species. The muropeptides were reduced with sodium borohydride and separated by reverse-phase HPLC as described by Glauner (Glauner (1988)). Individual muropeptide peaks were collected and directly used for biological assays. For mass spectrometry analysis, the different muropeptide fractions from N. meningitidis peptidoglycan were further desalted by HPLC as described by Garcia-Bustos and Dougherty (Garcia-Bustos et al. (1987)). Desalted muropeptides were analyzed by MALDI-TOF as described by Xu et al. (Xu et al. (1997)).
These molecular masses were found for the following analyzed fractions: fraction 3 [M+H]+871, 6214 m/z!; [M+Na]+: 893, 3633 m/z; [M+2Na−H]+ 915, 3518 m/z which is consistent with the GlcNAc-MurNAc-L-Ala-D-Glu-mesoDAP structure (calculated mass 870); fraction 6 [M+H]+942, 4512 m/z; [M+Na]+ 964, 4689 m/z [M+2Na−H]+ 986, 4429 m/z; [M+3Na−2H]+ 1008, 4321 m/z, which is consistent with a GlcNAc-MurNAc-L-Ala-D-Glu-mesoDAP-DAI structure (calculated mass 941); fraction 17 a mixture of two muropeptide species: 1) [M+H]+ 851, 3460 m/z; [M+Na]+ 873, 3422 m/z, [M+2Na−H]+ 895, 3219 m/z; [M+3Na−2H]+ 917, 3115 m/z which is consistent with a GlcNAc-anhydro-MurNAc-L-Ala-D-GlumesoDAP structure (calculated mass 850) and 2) [M+H]+ 1865, 5588 m/z [M+Na]+ 1887, 5331 m/z, [M+2Na−H]+ 1909, 5753 m/z; [M+3Na−2H]+ 1931, 5625 m/z which is consistent with the muropeptide dimer GlcNAc-MurNAc-L-Ala-D-Glu-mesoDAP(GlcNAc-MurNAc-L-Ala-D-Glu-mesoDAP-D-Ala)-D-Ala structure (calculated mass 1864).
The Nod1 pathway is stimulated by commercial LPS and Gram-negative bacterial PGNs.
The characterization of the PGN motif detected by Nod1 is shown in
Intracellular detection of Gram-negative but not Gram-positive bacterial products in epithelial cells through Nod1/Rip2 but not MyD88 is shown in
Extracts from Gram-negative (S.t, Salmonella typhimurium; S.t ΔF, S. typhimurium-delta flagellin; E.c, Escherichia coli; S.f, Shigella flexneri) and Gram-positive (B.s, Bacillus subtilis; S.a, Staphylococcus aureus; L.c, Lactobacillus casei; L.m, Listeria monocytogenes) bacteria were added to HEK293 cells permeabilized or not by digitonin (10 μg/ml) and NF-κB activity was measured after 4 h using an NF-κB-luciferase reporter assay. The results are shown in
HeLa cells were microinjected with either Dextran-FITC only (buffer) or with bacterial extracts and stained for NF-κB p65. 100% of cell microinjected with Gram-negative bacterial supernatants show translocated in
No effect of dominant-negative MyD88 (DN-MyD88; 0, 20, 50 ng) on Gram-negative bacterial extracts-induced NF-κB activity is shown in
Inhibition of Gram-negative bacterial extracts-induced NF-κB activity in digitonin-permeabilized HEK293 cells transfected with Nod1 117-953aa (DN-Nod1; 0, 200, 400 ng) as shown in
Inhibition of Gram-negative bacterial extracts-induced NF-κB activity by dominant-negative Rip2 (DN-Rip2; 0, 50, 10 ng) as shown in
Intestinal epithelial cells from mice deficient in Nod1 do not respond to bacterial supernatants as shown in
In Drosophila, the Toll pathway detects both Gram-positive bacteria and fungi, while the lmd pathway is specific to Gram-negative bacterial sensing (Lemaitre et al. (1996) 10). Recently, two peptidoglycan-recognition proteins (PGRPs) have been shown to play a key role in the discriminatory detection of bacteria in Drosophila (Michel et al., (2001); Choe et al. (2002); Gottar, et al. (2002); Ramet et al., (2002)). PGRP-SA is involved in Gram-positive bacterial recognition in the Toll pathway while PGRP-LC acts upstream of lmd in Gram-negative bacterial sensing. However, definitive proof that this discriminatory detection actually relies on PGN is still lacking.
This invention has shown that in mammalian cells, Nod1-dependent detection of bacteria relies on the sensing of a Gram-negative PGN motif. Indeed, this invention demonstrates that GM-tripeptide and GM-dipeptide form a new class of bacterial PAMPs, which are recognized differentially by Nod1 and Nod2, respectively. These PGN motifs are naturally occurring degradation products released from the bacteria during growth. Therefore, the peptidic composition of the PGN degradation products either released by the bacteria or processed by the host cell in the lysosomal compartment is critical in defining the host response towards bacterial infection. In this respect, the characterization of the PGN motifs sensed by Nod1 and Nod2 suggest that these two molecules have complementary and non-overlapping functions that contribute to innate immunity. Moreover, the results of this invention have demonstrated that Nod1 is likely the sole sentinel molecule in the epithelial barrier allowing intracellular detection of bacteria through PGN sensing, thereby highlighting its key role in innate immune defense.
Bacterial strains were routinely subcultured on blood agar medium (Blood Agar Base No. 2 {Oxoid}), supplemented with 10% horse blood (bioMerieux) 37. Broth cultures were prepared in 10 ml Brain Heart Infusion broth (BHI; Oxoid) containing 10% heat-inactivated fetal calf serum (FCS; Invitrogen Life Technologies). Cultures were shaken at 140 rpm in tissue culture flasks (Falcon), and incubated under microaerobic conditions, at 37° C. Solid and liquid culture media were supplemented with kanamycin (20 μg/ml) or chloramphenicol (10 μg/ml), as appropriate. Viable counts of H. pylori bacteria were performed by serial dilution of culture suspensions in sterile peptone trypsin broth (Ferrero et al./(1998)).
The cagA mutant was constructed by natural transformation in H. pylori 251 as described previously (Chevalier et al. (1999)). cagM gene inactivation was performed using a construct from mini-Tn3-Km mutagenesis of a library of cloned H. pylori genomic DNA (Jenks, et al. (2001)). The transposon insertion site was mapped to nucleotide position no. 935 in the cagM gene of H. pylori 26695. H. pylori slt and lysA single mutants were generated from recombinant plasmids in which the corresponding genes had been disrupted by a non-polar kanamycin resistance marker (Skouloubris et al. (1998)). The lysAcagM double mutant was constructed by cagM gene disruption using a non-polar version of the chloramphenicol resistance catGC cassette, described by Heuermann et al (Heuermann et al. (1998)). All H. pylori mutants were verified by PCR and/or DNA sequencing, using standard molecular biology techniques.
Highly purified H. pylori LPS was prepared by hot phenol-water extraction and subsequent enzymatic treatments with DNase, RNase and proteinase K (Sigma Chemical Co.) and by ultracentrifugation, as described previously (Moran et al. (1992)). H. pylori PG was purified from H. pylori bacteria using a modified version of the technique of Glauner et al. (Girardin et al., (2003); Glauner (1988)). Briefly, bacteria were harvested in exponential growth phase (A600 0.6-0.8) and quickly cooled in an ice-ethanol bath. PG was extracted by boiling bacteria in an equal volume of 8% (w/v) SDS. After differential centrifugation, PG-containing fractions were washed several times to remove SDS. The fractions underwent enzymatic treatments to remove traces of DNA, RNA or proteins, and were further boiled in 1% SDS. SDS was removed by several wash procedures. PG samples were sequentially incubated in 8 M LiCl, centrifuged, incubated with 0.5 M EDTA, and washed. Acetone extraction of lipid-containing contaminants was performed by ultrasonic sonication. Finally, PG samples were centrifuged, washed twice and stored at −20° C. until used. Purified H. pylori PG had no activity on TLR2- or TLR4-transfected HEK293 cells (unpublished data, SEG and IB). Muropeptides from H. pylori 26695 were purified by HPLC on muramidase-digested peptidoglycan, as described elsewhere (Girardin et al. (2003). Individual muropeptide peaks were collected and directly used in NF-κB reporter assays in HEK293 cells. The muropeptides present in each fraction were identified by MALDI-TOF analysis of the fractions following desalting by HPLC (Girardin et al. (2003).
HEK293, HeLa and AGS cell lines were grown routinely in Dulbecco's Minimal Essential Media (MEM), Eagle's MEM or RPMI 1640, respectively, containing 10% FCS, and supplemented with 100 IU ml−1 penicillin, 100 mg I−1 streptomycin, and 10 mM l-glutamate (all reagents from Invitrogen), at 37° C. in 5% CO2. HEK cells were not serum-starved prior to co-culture experiments. AGS cells that had been serum-starved overnight were washed three times and the RPMI 1640 medium replaced with antibiotic-free, serum-free medium. Overnight (16-20 h) liquid cultures of Helicobacter strains were harvested by centrifugation at 4000 g for 15 min (at 4° C.) and washed twice in phosphate-buffered saline (PBS, pH 7.4) prior to resuspension in the appropriate cell culture medium. Helicobacter bacteria were added to cell cultures at an MOI of 10-100. Viable counts of the bacterial suspensions were determined by serial plating.
The expression of nod1 mRNA was detected by RT-PCR in HEK293, HeLa and AGS cells. For this, total RNA was prepared from cells using TRIzol reagent (Invitrogen). Purified RNA (2 μg) was reverse transcribed with Superscript II RNase H (Invitrogen) according to the manufacturer's instructions. PCR was then performed using forward (CCTGACAAGGTCCGCAAA) [SEQ ID NO: 3] and reverse (GTCCATGTAGATCTCCTCCA) [SEQ ID NO: 4] oligonucleotides specific for human nod1. The quantity of cDNA in samples was standardized using β-actin-specific forward (GGGTCAGAAGGATTCCTATG) [SEQ ID NO: 5] and reverse oligonucleotides (GGTCTCAAACATGATCTGGG) [SEQ ID NO: 6]. cDNA samples were subjected to one cycle of heat denaturation at 95° C., for 3 min, followed by 40 PCR cycles, each comprising successive incubations at 95° C., 60° C. and 72° C., for 20 sec each. A further extension step was performed at 72° C. for 7 min. The respective amplification products were identified by ethidium bromide staining of agarose gels.
IL-8 production by AGS cells was determined from culture supernatants (6 and 24 h post-stimulation) using a double sandwich ELISA technique (R&D Systems).
HEK293 cells were plated in 24 well plates at a density of 1×105 cells and transfected the following day with Igκ-luciferase reporter DNA, using FuGene6 reagent medium (Girardin et al. (2001)). For dominant-negative studies, cells were co-transfected with ΔCARDNod1 DNA (Bertin et al. (1999)). The transfected cells were incubated overnight and co-cultured for 4 h with live bacteria, prior to lysis of the cells (Girardin et al. (2001)). The activities of highly purified H. pylori LPS and PG on NF-κB activation was studied in HEK293 cells over-expressing Nod1, as described previously (Girardin et al. (2003)). Briefly, cells were first co-transfected with Igκ-luc reporter construct, Nod1 DNA (10 ng; Bertin et al. (1999)), and purified H. pylori LPS (10 μg) or peptidoglycan (1 μg). Luciferase activities were determined in cells following 24 h of co-incubation with the bacterial products. AGS cells were plated in 24 well plates at a density of 8×104 cells and transfected the following day using FuGene6 reagent (Roche Diagnostics) with Igκ-luciferase and β-galactosidase reporter (Invitrogen) constructs (Philpoft et al. (2000). Thirty-six hours post-transfection, cells were infected with bacteria, as described above. Six hours later, lyzed cells were assayed for luciferase and β-galactosidase activities using a Berthold 96-well luminometer.
siRNA of H. pylori-induced NF-κB reporter activity was performed using the technique described by InvivoGen. For this, HEK293 cells that had been plated at a density of 1.0×104 cells in FCS-enriched DMEM were transfected 1 day later with varying concentrations of the Nod1siRNA construct together with pCDNA3 (total DNA concentration, 500 ng) using FuGene6 reagent. The Nod1siRNA construct contained a sequence (5′-ACAACTTGCTGAAGAATGACT-3′) [SEQ ID NO: 1] which is specific for the CARD in human nod1. A sequence (5′-GCAAGCTGACCCTGAAGTTCA-3′) [SEQ ID NO: 2] with no homology to human genes (EGFPsiRNA; InvivoGen) was used as a control. For Western blot studies, the cells were co-transfected with 20 ng of Nod1 reporter construct as well as varying concentrations of the respective siRNA constructs, prior to lysis at 48 h post-transfection. The cell extracts were analyzed using standard SDS-PAGE and Western blotting techniques. Nod1 production in samples was determined using an ‘in-house’ rabbit anti-Nod1 antibody (diluted 1:2000) and chemiluminescence detection reagent (picoECL, Amersham Biosciences). β-tubulin detection was performed on “stripped” membranes using a mouse monoclonal antibody (1:10,000; Sigma). For luciferase reporter assays, the cells that had been transfected with one of the siRNA constructs were transfected 2 days later with Igκ-luciferase plasmid, incubated for 24 h, then co-cultured for 7 h with H. pylori bacteria, prior to analysis.
AGS cells were plated at a density of 0.3×104 cells in 8-well Labtek (Costar) glass slides and cultured overnight. Specific 3H-radiolabelling of H. pylori PG was performed by cultivation (6-8 h) of H. pylori 26695 lysA or lysAcagM mutant bacteria in FCS-enriched BHI medium supplemented with 20 μM 3H-labeled mDAP. The bacteria were centrifuged at 3000×g (10 min, 4° C.), and resuspended in cell culture medium. The efficiency of PG tritiation was similar for lysA or lysAcagM mutants (CC, IGB, unpublished data). AGS cells were co-cultured for 3-4 h or 16 h with radio-labeled bacteria, at an MOI of 10-100. As negative controls, AGS cells were either left untreated or were co-cultured with heat-killed (60° C., 20 min) H. pylori lysA bacteria. The AGS cells were washed 3 times with PBS, prior to fixation (20 min) in 3% (v/v) paraformaldehyde in PBS. To prepare slides for β-imager analysis, cells were washed once in PBS, dehydrated in successive washes of 90% and 100% ethanol, then air-dried. Quantitative determination of the radioactivity in AGS cells was determined using a Micro-Imager (Biospace, Paris, France) (Laniece et al. (1998)). The presence of tritiated PG was detected by the immersion of the fixed slides in nuclear emulsion (Kodak NTB-2) Rougeot et al. (1997)). The slides were processed as described previously Rougeot et al. (1997)), counter-stained with Giemsa, and analyzed by the Micro-Imager machine. Immunohistochemistry was performed on slides using anti-H. pylori whole cell rabbit (diluted 1:600), prior to their immersion in nuclear emulsion.
Nod1−/− and Nod1+/+ mice on a C57BL/6×SV129 background were generated under specific pathogen-free conditions in the animal facilities of the Institut Pasteur (Paris), from breeding pairs that had been kindly supplied by J. Bertin (Millenium Inc, MA). Six to 8 wk-old female and male mice were used throughout. These mice were shown to be Helicobacter-free by bacteriological and serological assays (data not shown). Animals were housed in polycarbonate cages in isolators and fed a commercial pellet diet with water ad libitum. Animal handling and experimentation was performed in accordance with institutional guidelines and current French legislation (Law No. 87-848).
Nod1−/− and wild-type mice were inoculated intragastrically with H. pylori or H. felis isolates (Ferrero et al. (1998)). H. pylori infection was determined by quantitative culture of gastric tissue fragments from mice sacrificed at the appropriate times (Ferrero et al. (1998)). Since H. felis does not reproducibly form isolated colonies on culture plates, H. felis colonization was assessed by histological analyses performed on multiple Giemsa-stained sections of paraffin-embedded tissues (Ferrero et al., (1995)).
Primary gastric epithelial cells. Four week-old female and male mice were used for the derivation of primary gastric epithelial cell cultures, as described previously (Ahman et al. (2002)). Briefly, the stomachs were removed and put into Hanks buffered salts solution (Invitrogen) containing 0.2% bovine serum albumin (BSA). The stomachs were opened and cut into <0.5 mm fragments, prior to centrifugation at 800 rpm for 3 min. The pelleted material was digested successive times with enzyme solution (300 U/ml collagenase in HBSS+BSA, pH7.4), by incubation at 37° C. for 1 h, with shaking. The resulting cell pellets were resuspended in DMEM supplemented with 20% FCS, l-glutamine, penicillin and streptomycin. Aliquots (500 μl) of these suspensions were added together with 1.5 ml of supplemented DMEM to 6-well tissue culture plates. The cells were grown at 37° C. in 5% CO2, for 72 h. Bacterial co-culture experiments (MOI of 10-100) were performed with serum-starved cells. The cultured cells were analyzed by immunofluorescence as described previously (Widmer et al. (1993)).
Epithelial cell signaling in response to H. pylori was investigated by measuring NF-κB activation in HEK293 cells, using an NF-κB-dependent luciferase reporter gene assay. This cell line has previously been shown to respond to intracellular stimulation with Gram-negative whole bacteria (Girardin et al. (2001)) or PG (Girardin et al. (2003)), via a Nod1-dependent pathway. Indeed, nod1 expression was detected in this cell line, as well as in AGS gastric epithelial cells (
Several H. pylori clinical and laboratory strains were identified as being able to induce NF-κB-dependent luciferase expression in HEK293 cells (
To investigate the putative role of a Nod1-dependent signaling pathway in epithelial cell sensing of cagPAI-positive H. pylori, HEK293 cells were co-transfected with the NF-κB-luciferase reporter construct and a dominant negative-Nod1 plasmid (DN-Nod1), in which the caspase-recruitment domain (CARD) necessary for NF-κB activation (Bertin et al. (1999); Inohara et al. (1999)) had been deleted. The addition of increasing concentrations of DN-Nod1 abrogated the effect of cagPAI-positive H. pylori strains on NF-κB activation by up to 90%, when compared to cells receiving vector DNA alone (
To further confirm the role of the Nod 1 pathway in H. pylori recognition, siRNA experiments were performed with a plasmid construct (Nod1siRNA) containing a cloned sequence homologous to a 21-nucleotide region within the CARD of Nod1. Differences in Nod1 synthesis and activity were determined in HEK293 cells using Western blotting and NF-κB reporter assays, respectively. Since endogenous Nod1 is below the level of detection by Western blotting (
Taken together, the preceding data demonstrated that H. pylori-induced NF-κB activation in epithelial cells was: 1) dependent on the presence in the bacteria of a functional type IV secretion system, and 2) mediated by intracytoplasmic signaling via Nod1. Thus, it is hypothesized that Nod1 might respond to an effector molecule that is delivered to the cytoplasm of host epithelial cells by the cagPAI type IV secretion system.
The PG of Gram-negative cell walls was recently identified as the microbial product that is recognized by Nod1 (Girardin et al. (2003). In agreement with this finding, intracytoplasmic presentation of H. pylori PG, together with DNA encoding exogenous Nod1, induced high levels of NF-κB activation in HEK293 cells (
It was reasoned that H. pylori bacteria that are affected in PG turnover, and that hence release smaller quantities of PG muropeptides into the external medium, should be poor inducers of pro-inflammatory responses in epithelial cells. To investigate this, an H. pylori mutant deficient in lytic transglycosylase activity (sit, HP0645 (Tomb et al. (1997)), which is involved in bacterial muropeptide release, was generated and its effect on HEK293 cells studied. slt-deficient 26695 bacteria released up to 40% less disaccharide-tripeptide than the parental strain, yet liberated normal quantities of other major muropeptide forms (CC and IGB, unpublished data). Consistent with the postulated pro-inflammatory activity of H. pylori PG muropeptides, the H. pylori slt mutant induced significantly lower levels of NF-κB activation in HEK293 cells (
To address the mechanism by which H. pylori PG enters epithelial cells, cell co-culture experiments were performed with live H. pylori bacteria in which PG had been radio-labeled using 3H-mDAP. Since mDAP can be converted into either cellular proteins, via its conversion to l-lysine, or PG, the gene encoding diaminopimelate decarboxylase (LysA) activity, which is necessary for mDAP conversion into l-lysine, was inactivated. Enzymatic assays (n=3 experiments) of 3H-mDAP conversion into l-lysine in whole cell extracts revealed an activity of 0.57±0.07 nmol/min/mg for parental bacteria, as compared to no detectable activity for lysA mutant bacteria (unpublished data; Dr D. Blanot, Universitè de Paris-Sud, Orsay, France). This confirmed PG as the sole possible end-product for 3H-mDAP incorporation in H. pylori lysA bacteria.
AGS co-culture experiments performed using 3H-labeled H. pylori bacteria revealed the highest levels of radioactivity in those cells that had been co-cultured with lysA-deficient H. pylori bacteria (
The role of Nod1 in host defense against H. pylori infection in vivo was determined. To this end, Nod1−/− mice and their wild-type (WT) counterparts were inoculated with H. pylori cagPAI-positive isolates. These were H. pylori 256, a clinical isolate (Philpott et al. (2002)), and H. pylori B128, a gerbil-adapted strain (Israel et al. (2001)). Both isolates colonize mice in moderate numbers (Philpott et al., (2002); Fox et al. (2003)) and induce NF-κB-dependent pro-inflammatory responses in AGS cells (Table 1).
1The ability of bacterial strains to induce pro-inflammatory responses (NF-κB activation and/or IL-8 production) in AGS gastric epithelium cells was determined as described previously (Philpott et al. (2002)).
2NA, not available
3Data are presented in
4H. felis cagPAI genotype was determined by low stringency Southern hybridization of H. felis chromosomal DNA using cagA- and cagF-specific genes.
5Philpott et al.(2002)
6Tomb et al. (1997)
7Fischer et al. (2001)
8Akopyants et al. (1998)
9Salama et al. (2000)
10Israel et al. (2001)
In addition, H. pylori B128 is naturally transformable. For comparative purposes, animals were also inoculated with a H. pylori B128cagM mutant and H. felis, a bacterium lacking a cagPAI homologue. H. felis colonizes mice in very high numbers and, unlike H. pylori strains, induces severe inflammatory changes in the early stages of murine infection (≦1 month) (Sakagami et al. (1996)). The colonization levels of H. pylori B128cagM and H. felis in Nod1−/− mice did not differ significantly from those in WT animals (
To address potential host immune defect(s) that may be responsible for the increased susceptibility of Nod1−/− mice to H. pylori infection, we compared the ability of cultured gastric epithelial cells from Nod1−/− and Nod1+/+ mice to mount pro-inflammatory responses against the bacterium (
CXC chemokine assays. IL-8 and MIP-2 production by AGS and cultured primary epithelial cells, respectively, were determined from culture supernatants (24 h post-stimulation) using double sandwich ELISA kits (R&D Systems).
Statistical analysis. Data were analyzed using the Student's t-test and Mann-Whitney test, as appropriate. Differences in data values were considered significant for P≦0.05.
This application is a Continuation-In-Part of U.S. application Ser. No. 10/808,735, filed Mar. 25, 2004, Attorney Docket No. 03495.0308, which is based on and claims the benefit of U.S. Provisional Application Ser. No. 60/457,572, filed Mar. 27, 2003 (Attorney Docket No. 03495.6088). The entire disclosure of these applications are relied upon and incorporated by reference herein.
| Number | Date | Country | |
|---|---|---|---|
| 60457572 | Mar 2003 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10956246 | Oct 2004 | US |
| Child | 11195696 | Aug 2005 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10808735 | Mar 2004 | US |
| Child | 10956246 | Oct 2004 | US |
